WO1995011996A1 - Detection assay for listeria and erwinia microorganisms - Google Patents

Detection assay for listeria and erwinia microorganisms Download PDF

Info

Publication number
WO1995011996A1
WO1995011996A1 PCT/US1994/012508 US9412508W WO9511996A1 WO 1995011996 A1 WO1995011996 A1 WO 1995011996A1 US 9412508 W US9412508 W US 9412508W WO 9511996 A1 WO9511996 A1 WO 9511996A1
Authority
WO
WIPO (PCT)
Prior art keywords
lcr
dna
primers
pcr
seq id
Prior art date
Application number
PCT/US1994/012508
Other languages
French (fr)
Inventor
Carl A. Batt
Martin Weidman
Francis Barany
Original Assignee
Cornell Research Foundation, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US14506793A priority Critical
Priority to US08/145,067 priority
Application filed by Cornell Research Foundation, Inc. filed Critical Cornell Research Foundation, Inc.
Publication of WO1995011996A1 publication Critical patent/WO1995011996A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6862Ligase chain reaction [LCR]

Abstract

A polymerase chain reaction-coupled ligase chain reaction is described for the identification of microorganisms based upon single-base-pair differences in the genetic information of each organism.

Description

Detection assay for Listeria and Erwinia microorganisms.

At the present time, many microorganisms can be assayed and identified only by time-consuming culture procedures. In many instances these microorganisms require a two-step protocol: an initial isolation and identification of the microorganism based upon characteristics of the genera, and a second isolation based upon the characteristics of the species within the genera. Only then can it be determined whether the species isolated is pathogenic. Various techniques for detecting the presence of microorganisms in samples have been developed prior to the making of the present invention. The latest of these techniques have used either monoclonal antibodies or nucleic acid probes, or nucleic acid probes in conjunction with the polymerase chain reaction (PCR). The assay, according to the present invention, provides an alternative to these techniques.

In one aspect of the present invention, there is thus described an assay for determining the presence of Listeria monocytogenes in a clinical sample suspected of containing this organism. L. monocytogenes is a Gram-positive facultative anaerobe bacteria. It is ubiquitous in nature and has been linked to food-borne illness outbreaks involving a wide range of foods. The presence of Listeria monocytogenes in a prepared food products can result from contamination originating in food ingredients as well as during the processing or post-processing period in the food plant. It is known that once Listeria monocytogenes contaminates a food-processing plant, it can survive for a long time, if the temperature is low and the organism is protected by food components. The control of Listeria monocytogenes contamination involves the use of basic quality assurance systems such as the hazard analysis and critical control point (HACCP). Environmental and in-line samplings can play an important role in identifying problem areas and revealing plant conditions that may contribute to hygienic problems . An added emphasis on determining new and practical methods of pathogen control and detection in food plants is necessary in order to ensure safe food processing conditions .

Specific detection of Listeria monocytogenes is very important with regards to food hygiene and safety, since all other species within the genus Listeria appear to be non-pathogenic to humans. Conventional microbiological detection methods for Listeria monocytogenes are very time consuming and can take up to four weeks until final results are obtained. A variety of detection methods for Listeria monocytogenes based on nucleic acid probes or monoclonal antibodies have been described [see "Rapid methods for the detection of Listeria" in

Molecular Approaches To Improving Food Quality and Safety, Bhatnagar and Cleveland (ed.) pgs 189-204, Van Norstand Reinhold (New York) (1992)]. Furthermore, various detection systems using the polymerase chain reaction (PCR) for specific detection of Listeria monocytogenes have been reported [see Appl. Environ. Microbiol. 56:2930 (1990); Appl. Environ. Microbiol. 58:2625 (1992); Appl. Environ. Microbiol. 57:606 (1991 ); J. Appl. Bacteriol. 73:53 (1992); J. Appl. Bacteriol. 70:372 (1991 ); Appl. Environ. Microbiol. 57:2576 (1991); and Appl. Environ. Microbiol 58:1564 (1992)]. Most of these methods have been applied to either pure bacterial cultures or food samples, to our knowledge there has only been one report describing the. use of a PCR assay for the detection of Listeria monocytogenes from surface samples. In the following description of the assay according to the present invention, it will be shown that discrimination between the closely related L. innocua (and a large number of other Listeria species) and L. monocytogenes may be readily accomplished

The selective detection of Listeria monocytogenes is of great importance, as the ecology of Listeria spp. is not well understood and the detection of Listeria spp. other than Listeria monocytogenes may not be an accurate indicator of a foods safety [see Food Microbiol. 6:49

(1989)].

The use of 16S rRNA as a distinct signature for bacteria has become the method of choice for identifying and differentiating microorganisms when no other nucleic acid sequence constitutes a unique desired target [see Microbiol. Rev. 51 :221 (1987)]. A DNA probe based upon a 16S rRNA sequence (rDNA), which detects all Listeria spp., has been developed, although the sequences that discriminate it from other genera were not reported [see J. Assoc. Off. Anal. Chem. 7:669 (1988)] Also, a 16S rRNA-based oligonucleotide probe specific for L. monocytogenes has been designed and was used in a hybridization assay [see Appl. Environ. Microbiol. 57:3666 (1991)].

The 16S rRNA nucleotide sequence from a number of Listeria spp. has been determined either after reverse transcription or from PCR- amplified genomic rDNA, and differences in single base pairs between Listeria monocytogenes and Listeria innocua have been described for the V2 and V9 regions [see Int. J. Syst. Bacteriol. 41 :240 (1991 )].

The ligase chain reaction (LCR) has been shown to be a highly sensitive and specific method for discriminating between DNA sequences differing in only a single base pair [see Proc. Natl. Acad. Sci.

USA 88:189 (1991 ), the disclosure of which is incorporated, in toto, herein]. LCR is based on the principle of ligation of two adjacent synthetic oligonucleotide primers which hybridize uniquely to one strand of the target DNA. The junction of the two primers is positioned so that the nucleotide at the 3' end of the upstream primer coincides with a potential single-base-pair difference in the targeted sequence, which defines different alleles or species. That is, two pairs of primers, each pair adjacent to each other on one strand each of target DNA, are designed so that the 3' end of each upstream primer terminates at a nucleotide that is complementary in the targeted DNA but is mismatched in the DNA of closely related targets. If the base pair at that site matches the nucleotides at the 3" end of the upstream primer, the two adjoining primers can be covalently joined by the ligase. In the LCR, a second pair of primers complementary to the first pair are present, again with the nucleotide at the 3' end of the upstream primer denoting the sequence difference. In a cycling reaction with a thermostable Thermυs aquaticus DNA ligase, the ligated product can then serve as a template for the next and subsequent reaction cycles leading to an exponential amplification process analogous to PCR amplification. If there is a mismatch at the primer junction, it will be discriminated by the thermostable ligase, and the primers will not be ligated. The absence of the ligated product therefore indicates at least a single-base-pair change in the target sequence. This was demonstrated by using LCR to discriminate between normal bA and sickle bS-globin genotypes in humans.

In brief, the first aspect of the present invention provides for an assay utilizing PCR primers that specifically amplify the 16S rDNA of all Listeria species present in the sample for the first step of the assay procedure, whereas the use of the LCR as the second step of the assay procedure is used to specifically confirm the presence of L. monocytogenes.

In still another aspect of the present invention there is described the use of a polymerase chain reaction-coupled ligase chain reaction assay to differentiate the plant pathogenic bacterium Erwinia stewartii from other Erwiniae species. This second aspect is essentially the same protocol as used in the first, but with different genera of bacteria.

Stewart's bacterial wilt is a disease of corn (Zea mays L.) caused by the bacterium Erwinia stewartii (Smith) Dye. On three to five leaf stage corn seedlings, the disease is characterized by water soaked lesions on leaves leading to stunted plants, with severe yield reductions in susceptible and moderately susceptible corn hybrids. The Corn flea beetle, Chaetocnema pulicaria Melsh., is the overwintering host and vector of E. stewartii, and the abundance of primary inoculum is related to the population of this beetle.

Because of its sporadic nature, the disease has not been thoroughly researched, and little is known about the distribution and prevalence of E. stewartii strains, the role of symptomless carriers, and prevalence of seed transmission of the bacteria. The potential risk of seek transmission is so important in international shipment of seed, that more than 50 countries ban import of seed corn unless certified to be free of E. stewartii. Usually seed is certified by field inspection or by laboratory isolation of the pathogen on general or selective media. Since neither of these methods is very sensitive, a double sandwich enzyme linked immunosorbent assay (ELISA) was recently developed to detect low levels of E. stewartii in seed. This assay uses polyclonal antibodies for capture and monoclonal antibodies for detection, and has a detection limit of 10^ cells per sample [see Phytopathology 81 :839 (1991 )].

Accordingly, to facilitate the understanding of the epidemiology of Stewart's wilt and to improve methods for detecting the pathogen, a species-specific nucleic acid probe (which in an enzymatic amplification format was believed to be able to decrease detection limits while retaining specificity and utility engendered in ELISA) was developed in accordance with the present invention to allow for the detection of E. stewartii directly from plant and vector material.

The rationale for this aspect of the present invention is the same as given before, specifically that the 16S rDNA is generally phylogenetically conserved, although limited variable regions, within rDNA constitute a distinct signature for bacterial species, and because of this the 16S rDNA has become the preferred method for identifying microorganisms when no other unique nucleic acid sequences are known to serve as potential targets.

In this aspect of the present invention, the 16S rDNA of Erwinia stewartii and Erwinia herbicoia was amplified, coned and sequenced. Differences found between these two closely related species were used to design LCR primers that were successful in differentiating the corm pathogen from the other members of the genera.

These and other aspects of the present invention can be more fully understood by reference to the following examples and detailed discussion of the findings made with the assay according to the present invention. EXAMPLE I

This example describes the preparation of genomic DNA and PCR of Listeria 16S rDNA according to one aspect of the present invention.

Listeriae were grown in 5 ml of Listeria enrichment broth (BBL, Becton Dickinson Microbiology Systems) at 37° C on a shaker at 150 - o -

rpm. Cells from an 8-h culture (approx. 109 cells) of Listeria spp. were pelleted, resuspended in 100 μl of distilled water, and then placed in a boiling-water bath for 10 min. a 1-μl aliquot of this lysate was used for PCR amplification of the V2 region with two primers for the 16S rDNA [see J. Bacteriol. 173:697 (1991)], 16S-5 (5'-

CCGAATTCGTCGACAACAGAGTTTGATCATGG-3,) and mp19-INT (5'- CGGAAACCCCCTAACACTTA-3'), or for amplification of the V9 region with two universal primers for the 16S rDNA [see J. Bacteriol. 173:697 (1991)], 16-3 (5'-CCCGGGATCCAAGCTπAACCπGπACGACTT-3') AND MP-18 INT (5'-ATTAGATACCCTGGTAGTCC-3'). The amplified DNA was phenol-chloroform extracted, ethanol precipitated, and dissolved in TE buffer (10 mM Tris-HCL, 1 mM EDTA [pH 8.0]) by conventional procedures [see Maniatis et al, Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor (1989)]. Alternatively, the amplified DNA was used directly in the LCR. These preparations were analyzed for the presence of the expected 16S rDNA fragment of 840 bp for the V2 region or of 720 bp for the V9 region by electrophoresis on a 1.5% agarose gel in TBE buffer (89 mM Tris-borate, 2 mM EDTA, pH 8.2). The DNA concentration was estimated by visual comparison with a standard DNA preparation. Specific nucleotide primers for use in both the LCR and LDR

Primers for LCR and LDR were prepared following conventional solid state procedures. For the LCR, two sets (Lm 1 , Lm 2R, Lm 3, and Lm 4R for the V2 region, and Lm 1a, Lm 2Ra, Lm 3a, and Lm 4Ra for the V9 region) of four different primers were used. The primer sequences are shown in the following Table 1 :

TABLE 1. Sequences and melting temperatures of primers used in the LCR Primer Sequences (5 ' -> 31 ) Tm (° C)

V2 region-specific pairs : lm 1 (labeled) AGTGTGGCGC ATGCCAGCTC TTTTGA 26 73 lm 3 GGACCGGGGC TAATACCGAA TGATAA 26 73 lm 2R (labeled) TATCATTCGG TATTAGCCCC GGTTT 25 72 lm 4R GGAAΑAGCσr GGCATGCGCC ACACTT 26 76 V9 region-specific pairs : lm la (labeled) GTACAAAGGG TCGCGAAGCC G 21 6B lm 3a AAGCTACACA CGTGCTACAA TGGATA 26 73

Lm 2Ra (labeled) ATCCATTGTA GCACGTGTGT AGC 23 6B

IM 4Ra AACGGCTTCG CGACCCTTTG TACT 24 73 The nucleotide sequence of the V2 region site in L. monocytogenes and in L. innocua used for LCR and locations of primers Lm 1a, Lm 3, and Lm 4R are depicted in the following Table 2. In this sequence, oligonucleotides Lm 3 and Lm 4R contained 2-nucleotide tails to prevent ϋgation of the 3'-end. The designation "X" in this sequence listing mark differences between L. monocytogenes and L. innocua; nucleotides that are identical in L. monocytogenes and L. innocua are shown as colons.

TABLE 2

L. monocytogenes: lm 3

GG A lm 1 A

5' GGAAACCGGGGCTAATACCGAATGATAAAGTGTGGCGCATGCCACGCTTTTGAA 3' CCTTTGGCCCCGATTATGGCTTACTATTTCΆCΆCCGCGTACGG GCGAAAACTT T lm 2R T GG lm 4R

L. innocua:

:::::::::::::::::::::::::: :X: :::::::::::::::::: :X: ::: :

5' GGAAACCGGGGCTAATACCGAATGATAGAGTGTGGCGCΆTGCCACGC CTTGAA V2 The nucleotide sequence of the V9 region site in L. monocytogenes and in L. innocua used for LCR and locations of primers Lm 1a, Lm 2Ra, Lm 3a, and Lm 4Ra are depicted in the following table 3. Oligonucleotides Lm 3a and Lm 4Ra contained 2-nucleotide tails to prevent ligation of the 3' end. TABLE 3

L. monocytogenes:

Lm 3a

AA A lm la

G 5' C-TGGGCTACACACGTGCTACAATG^

3 ' GACCCGATGTGTGCACGATGTTACC-TATCATGTTTCCCAGCGCTTCGGCG A lm 2Ra T AA lm 4-Ra L. innocua:

:::::::::::::::::::::::::: :X: :::::::::::::::::::: :

5f CTGGGCTACACΑCGTGCTAC-- TGGATGGTACAAAGGGTCGCGAAGCCGC

For the ligase detection reaction (LDR) of the V9 region, either the primer pair Lm 1a plus Lm 3a or the pair Lm 2Ra plus Lm 4Ra was used. Primers Lm 1 , 1a, 2R, and 2Ra were 5'-end labeled with [g- 32P]ATP (Amersham) as described previously [see Proc. Natl. Acad. Sci. USA 88:189 (1991)].

The LCR and LDR were performed under conditions as described previously [see Proc. Natl. Acad. Sci. USA 88:189 (1991) and Clin. Chem. 37:1522 (1991)] with minor modifications.

The Listeria strains used in the LCR assay according to the present invention are described in the following Table 4 in which information about the serotypes was provided from the laboratories that provided strains and in which ND indicates that serotype was not determined and NT indicates serotype was not typeable. In the table, USDA represents the United States Department of Agriculture, FDA represents the United States Food and Drug Administration, ERRC represents the Eastern Regional Research Center,

TABLE 4

Species and Strain Serctype Source/Reference LCR Product

L. monocytogenes:

A/F2380 ND USDA-ERRC +

C/ATCC 15313 NT USDA-ERRC +

D/LCDC91 -329 1 /2a USDA-ERRC +

E ND USDA-ERRC +

SLCC 53 1 /2a Univ. Vermont +

SLCC2371 1 /2a Univ. Vermont +

SLC 5779 1 /2a Univ. Vermont +

ATCC 19112 1 /2 c Univ. Vermont +

Scott A 4b Univ. Minnesota +

L. innocua:

SA 3 VT ND USDA -

SH3V ND Univ. Minnesota -

P5V5 ND Univ. Minnesota -

L. ivanovii:

KC 1714 ND USDA -

L 29/R1 -7 ND Univ. Vermont/FDA -

L 30/R1-8 ND Univ. Vermont/FDA -

L. seeiigeri:

ND Univ. Minnesota -

L. welshimeri:

H2N.G. ND USDA -

CCK9LG ND Univ. Minnesota -

L grayi:

ATCC 19120/KC 1773

ND USDA -

A positive LCR product reaction indicates an LCR product on a denaturing polyacrylamide gel after 25 LCR cycles, as detected by autoradiograph exposure of 12 hours.

EXAMPLE II One set of primers (50 fmol of each primer) were incubated in the presence of target 16S rDNA (5 fmol) in 50 μl of reaction buffer (50 mM Tris-HCL, 100 mM KCL, 10 mM MgC-2, 1 mM EDTA, 10 mM dithiothreitol, 1 mM NAD+, 0.01% Triton X-100, 20 μg of salmon sperm DNA) with 75 nick-closing units of T. aquaticus DNA ligase (purified as described in Gene 109:1 (1991 )), and overlaid with 50 μl of mineral oil. The reaction cycle was 1 min at 94°C followed by 4 min at 65°C, and this cycle was repeated 25 times. Annealing temperatures of 70 and 74°C were also tested in the LCR performed with the primers for the V2 region. The reaction was stopped by adding 40 μl of formamide containing 10 mM EDTA, 0.2% bromophenol blue, and 0.2% xylene cyanole. Alternatively, bacterial lysates (prepared as described above) were also used directly in the LCR.

As described above, only a single pair of primers was used in conducting the LDR, whereas two pair of primers were used in conducting *he LCR.

To evaluate the overall sensitivity of the PCR-coupled LCR, serial dilutions of an 8-h L. monocytogenes culture were used to prepare boiled lysates and tested with the primers for the V9 region. These samples were analyzed for the PCR product after PCR amplification, and then 5 μl of the PCR product was used for the second LCR step.

EXAMPLE III Electrophoresis was conducted as follows: LCR samples were heated to 90° C for 5 min, and 10 μl was loaded onto a 16% polyacrylamide minigel (8 by 7.3 cm in Mini-PROTEAN

II Electrophoresis Cell; Bio-Rad) containing 7 M urea. Electrophoresis was carried out in TBE buffer (89 mM Tris-borate, 2 mM EDTA, pH 8.2) at 175 V constant voltage for 1 hour. Gels were autoradiographed on Kodak X-Omat AR film at -20°C for 12 hours. Results for one aspect of the present invention, that showing the ability of an LCR assay according to the present invention to discriminate different species of Listeria utilizing L. monocytogenes and L. innocua having previously reported single-base-pair differences at nucleotide 193 (V2 region) and at nucleotide 1259 (V9 region) in the 16S rDNA [see Appl. Environ. Microbiol 57:3666 (19910 and Int. J. Syst.

Bacteriol. 41 :240 (1991)] are reported below. All other Listeria spp. are far more divergent in that region. These two sites, specifically those depicted in Tables 2 and 3, were used to design primers for an LCR assay according to the present invention. As depicted above, the LCR assay based on those single-base-pair differences according to the present invention was developed which is successful in distinguishing L. monocytogenes from other Listeria spp. This method was tested on 19 different L. monocytogenes strains and other Listeria spp. (Table 4), and even species closely related to L. monocytogenes, such as L. innocua, could be reliably distinguished.

When crude bacterial lysates were used without prior PCR in the LCR assay with the V9 primers, a ligation product was detectable with a 24 hour autoradiogram exposure. PCR amplification of either the V2 or the V9 region of the 16S rDNA was successful in generating DNA fragments which were suitable for use in the LCR. There was no significant difference in sensitivity or specificity whether phenol- chloroform-extracted or unpurified DNA from the PCR step was used for the LCR. The two complementary pairs of primers designed for the V9 region had a low variation in melting temperature (68 to 70° C). When this set of primers was used in the LCR assay (as well as in LDR), clear differentiation between L. monocytogenes and other Listeria spp. was possible. For example, examination of representative autoradiographic results of the LCR for 13 Listeria spp. with the primers for the V9 region (L. monocytogenes strains Scott A; SICC 53; SLCC 5779; ATCC 19112; E; A; D; SLCC 2371 ; and C; L. ivanovii L 30; L innocua SA 3 VT; L. welshmerii and L. seeligeri) clearly indicated two labeled primers, and upper and lower band, visible on the gel; the lower band being primer Lm 1a (21 nucleotides), and the higher one being primer Lm 2Ra (23 nucleotides). When autoradiographs of the ligated products (primer pairs Lm 1a plus 3a and Lm 2Ra plus 4Ra) only a single band appeared on the autoradiogram.

The addition of 0.01 % Triton X-100 to the reaction mixture gave higher yields of ligation product with both LDR and LCR. This was quantified by excising the bands from gels after a 25-cycle LCR and measuring the specific activities of the ligation product and the unligated primers by liquid scintillation counting. Using 5 fmol of target DNA, a slightly higher amount of false-positive ligation was detected when 0.01% Triton X-100 was used than in LCR reactions without Triton X-100.

When 0.01% Triton X-100 was used, approximately 80% of the starting primers were ligated after 25 LCR cycles at a concentration of 5 fmol of target DNA. Since only one pair of primers was used in the LDR, only one band for the unligated labeled primer was seen (primer Lm 2Ra, 23 nucleotides), while the autoradiogram of the LCR, two bands of unligated primers were seen.

When L. innocua served as a target in the LCR with the V9 primer set, a very small amount of ligation product was detected only after the gel had been autoradiographed for more than 20 hours. In εnecies distantly related to L. monocytogenes (e.g. L. seeligeri and L. grayi), no ligation product was observed even when the gel was autoradiographed for more than 36 hours. When different dilutions of target cells were used for the PCR- coupled LCR, small numbers of target cells (150 to 15,000 CFU) gave no detectable PCR product in ethidium bromide-staged gels, but the second LCR step revealed the presence of L. monocytogenes.

The LCR primers for the V2 region exhibited a high degree of ligation in the absence of target DNA. Since the melting temperature of those primers ranged from 70 to 78° C, cycles with higher annealing temperatures (70 or 74° C) then originally described were tested. At an annealing temperature of 74° C, the amount of ligated product decreased drastically, not only in the absence but also in the presence of target; however, target-independent ligation products were still observed.

When LCR was first described for the detection of the βA-globin gene [see Proc. Natl. Acad. Sci. USA 88:189 (1991)], sensitivity was reported to be limited to about 200 target molecules. PCR has been shown to have a much greater sensitivity, although it cannot always discriminate between two targets differing in only a single base pair. For example Bej and co-workers [see Appl. Environ. Microbiol. 56:307 (1990)] were able to detect fewer than 5 coliform bacteria in 100 ml of water by using PCR amplification. The PCR primers for the V2 region allowed the amplification of an 840-bp fragment, whereas the universal PCR primers for the V9 region amplified a 720-bp fragment. In the PCR amplification, no difference was observed in the results obtained with crude bacterial cell lysates and purified DNA. When using the PCR to amplify the target region for the LCR, it is possible to combine the high sensitivity of the PCR with the high specificity of the LCR. Furthermore, the results of the assay according to the present invention clearly showed that a second LCR step can increase the sensitivity of the PCR step for the detection of L. monocytogenes when ethidium bromide staining of the the agarose gels is used to detect the PCR products. One primer of an LCR primer pair can easily be radioactively labeled following conventional protocols, and the ligation product can be detected by gel electrophoresis and subsequent autoradiography of the gel. This approach was shown to be highly sensitive {see Proc. Natl. Acad. Sci. USA 88:189 (1991 )], so that even minimal amounts of ligation products could be detected; primers containing a mismatch with the target DNA yielded from <0.2 to 1.3% of the ligation product obtained with perfect complementarity, depending on the target nucleotides involved. As indicated above in Table 3, L. monocytogenes has an A-T base pair while L. innocua has a G-C base pair at nucleotide 1259 in the V9 target region. Based upon initial findings with G-T and C-A mismatches, a 1.3% background signal with L. innocua would be expected.

The inclusion of 0.01% Triton X-100 in the LCR reaction mixture increased LCR efficiency, but also intensified false-positive ligation when 5 fmol of target DNA was used and the gel was exposed for longer than 12 hours, a problem that should be eliminated by using either shorter exposure times or smaller amounts of target DNA.

The use of a PCR-coupled LCR for the specific detection of L. monocytogenes may be simplified by using a nonradioactive reporter.

For example, the use of biotin, as discussed below for assaying for different species of Erwinia, for labeling one primer and of a suitable nonisotopic reporter group for the second primer following conventional protocols would allow product capture and detection in a manner amenable to automation [see for example Science 241 :1077 (1988) and Proc. Natl. Acad. Sci. USA 87:8923 (1990)]. The following two examples and discussion describes such nonisotopic procedures for the detection of L. monocytogenes. EXAMPLE IV

The ligase chain reaction was performed with the LCR primers described in Table 1. To facilitate the nonradioactive detection of the LCR products, primers Lm 3a and Lm 4Ra were synthesized with a biotin group at the 5' end by the Biotin-On (Clontech) phosphoramidite method with an Applied Biosystems 392 DNA synthesizer. Primers Lm 1a and Lm 2Ra were phosphorylated at the 5' end with 300 pmol of primer, 20 nmol of ATP, and 6 U of polynucleotide kinase (New England Biolabs) in 30 μl of 1 X polynucleotide kinase buffer at 37° C for 45 min, followed by 68° C for 10 min to inactivate the enzyme. The phosphorylated primers were then 3' labeled with a single 11-ddUPT digoxigen molecule (Boehringer Mannheim). The labeling reaction was performed as recommended by the manufacturer with 85 U of terminal deoxynucleotidyl transferase (US Biochemical).

LCR reactions were performed as described above with minor modifications. Primers Lm 1a, 2Ra, 3a, and 4Ra (100 fmol of each) were incubated with 1μl of PCR-amplified 16S genes coding for rRNA in 25 μl of LCR buffer containing 37.5 nick closing units of Thermυs aquaticus DNA ligase [see Gene 109:1 (1991)].

EXAMPLE V For the detection of the LCR products in the microtiter plate format, a modified procedure of Nickerson et al [see Proc. Natl. Acad. Sci. USA 87:8923 (1990)] was used wit e following modifications. Five μl of the LCR reaction mixture dilut i 40 μl of buffer 1 (100 mM Tris-HCI, pH 7.5, 150 mM NaCI) together with 10 μl of plate binding buffer (1 M NaCI, 0.75 M NaOH) was used per well. Substrates tested in the microtiter plate detection included Lumi-Phos 530 (Boehringer Mannheim) and p-nitrophenyl phosphate (p-NPP, Sigma). All detection reactions were run in duplicate. For the detection with p-NPP, a 12 hour incubation at ambient temperature was used. The optical density at 450 nm was calculated as the average of the two wells representing the same LCR reaction. In the detection mode with Lumi-Phos 530, a positive LCR result translates into a chemiluminescent reaction that can be seen as a bright dot on Polaroid type 612 film after a 5 min exposure.

Results are considered positive for L. monocytogenes when the signal intensity for a wall is clearly higher than the one obtained from the LCR with L. innocua PCR-amplified 16S genes coding for rRNA. In the detection with p-NPP, and LCR is considered positive for L. monocytogenes when the optical density at 450 nm calculated for the average of two replicates is 2 standard deviations higher than the optical density at 450 nm of L. innocua PCR-amplified 16S genes coding for rRNA.

Detection of the LCR products with the luminogenic substrate Lumi-Phos 530 and the chromogenic substrate p-NPP gave equivalent results when an incubation time of 12 hours was chosen for the latter substrate. When compared, however, the detection method with Lumi- Phos 530 is better with respect to the rapidity with which the results of the LCR are obtained; this assay can be finished in 3 hours, whereas both the radioactive assay described in Example III and the nonradioactive detection with p-NPP take more than 12 hours. On the other hand, the detection mode with p-NPP allows a noninstrumental semiquantitative readout of the yellow color.

The PCR-coupled LCR assay according to the present invention as described in Example V was tested on different Listeria strains as well as on other bacterial and showed highly specific results. The PCR- coupled LCR consistently allowed the detection of 10 CFU of L. monocytogenes.

The PCR-coupled LCR assay according to the present invention as described in the preceding examples can detect the presence of Listeria spp in the first PCR step while specifically recognizing L. monocytogenes in the second LCR step. This assay will therefor provide information equivalent to that provided by classical microbiological methods. The luminogenic nonisotopic detection method allows one to perform the assay in approximately 10 hours compared with the previously used isotopic detection method which needed almost 24 hours for completion. Sin- the detection of the LCR products in a microtiter plate with luminogenic or chromogenic substrates is amenable to automation, the present invention will prove useful for screening large amounts of samples, and will facilitate the use of this assay in a routine setting.

EXAMPLE VI The growth conditions by which Erwinia species used in confirmation of the assay according to the present invention are given below.

Bacteria were stored frozen at -70° C, and cultured at 28° C on tryptone yeast extract phosphate medium consisting of 5 g yeast extract, 10 g Bacto-tryptone, 2.2 g K2HPO4-3H20, 0.75 g KH2PO4, and 18 g bacto-agar per liter of distilled water. Luria-Bertani medium (LB) was used to grow Erwinia for DNA preparations [see Current protocols in molecular biology, Ausubel et al eds., Greene Publishing Associates and Wiley Intersciences (1987)]. Identities of Erwinia stewartii strains were confirmed by colonial morphology on tryptone yeast extract phosphate media, oxidative/fermentative reaction, lack of motility, and pathogenicity tests on the susceptible sweet corn cultivar, Jubilee. Other Erwinia species used in this study were obtained from stocks kept in the Department of Plant Pathology, Cornell University. All Erwinia species and strains used in the making of this invention, their sources, along with the results of the assay according to the present invention are shown in the following table in which ATCC designate -s American Type Culture Collection, NCPPB designates National Collection of Plant Pathogenic Bacteria. TABLE 5

Strain Origin LCR product

Erwinia stewartii:

E-s-2 Corn, Cayuga Co., New York + E-s-4 Corn, Genesee Co., New York +

E-s-1 3 Corn, Genesee Co., New York +

E-s-20 Corn, Onondaga Co., New York +

E-s-36b Corn, Ontario Co., New York +

E-s-37a Corn, Yates Co., New York + E-s-50b Corn, Suffolk Co., New York +

E-s-62 Corn, Wye, Maryland +

E-s-6 Corn, Illinois +

Erwinia herbicola:

E-h- 107 Rhododendron, Netherlands E-h-1 12y Apple, United Kingdom

E-h-252 Apple, New York

E-h-262 Tomato, New York

E-h-306 unknown

E-h-312 New York E-h-331 Canada, ATCC 33243

E-h-332 Pineapple, Brazil, ATCC 33244

E-h-342 Chevron

E-h-345 Chevron

E-h-351 Apple, New York Erwinia amylovora:

E-a-302 Apple, New Zealand, ATCC 15357 E-a-304 ATCC 19381 E-a-321 Hawthorne, France

Erwinia cartovora pv. betavasculorum: E-Cb NCPPB 2793

A positive LCR product reaction indicates an LCR product on a denaturing polyacrylamide gel after 25 LCR cycles, as detected by autoradiograph exposure of 12 hours.

A nucleotide sequence and alignment of a 120 nucleotide segment of 16S rDNA from E. stewartii 20 and E. herbicola 252 is depicted in the following Table 6. In Table 6, differences between the two bacterial sequences are depicted by "X", matches by ":", and a base that is missing relative to the E. coli sequences is indicated by ".". The numbers at the right hand end of the sequence are from alignment with E. coli 16S rDNA [see Proc. Natl. Acad. Sci. USA 75:4801 (1978)].

TABLE 6

E. Stewartii CCCGCACT^GCGGTGGAG(^TGTGGTTTAATTC^TGC-AA968 ::::::::::::::::::::::::::::::::::::::::

E. herbicola CCCGCAC-AAGCGGTGGAGCATGTGGTTTAAITCGATGCAA

E. stewartii CGCGAAGAACCTTACC.ATCCTTGACATCCAGCGAACTTG 1008 :::::::::::::::: ::::::::::::: :X: :::: :X

E. herbicola CGCGAAGAACCTTACC.ATCCTTGACATCCAGAGAACTTA E. Stewartii GCAGAGATGCCTTGGTGCCTTCGGGAACCGTGAGACAGGTG 1049

::::::::::X:: ::::::::::: :::::::::::::::::

GCAGAGATGCTTTGGTGCCTTCGGGAACCGTGAGACAGGTG

EXAMPLE VII The amplification, cloning, and sequencing of the 16S rDNA of Erwinia was conducted as follows:

Genomic DNA was isolated from Erwinia stewartii 20 and Erwinia herbicola 252 by the method of Ausubel supra, except that the lysates were extracted two times with chloroform to remove residual phenol. PCR amplification and sequencing of the 16S rDNA were carried out utilizing known protocols [see Appl. Environ. Microbiol. 59:304 (1993)], and primers 16S-P5 and 16S-P3, as shown in Table 6, were used to amplify the complete 16S rDNA [see Appl. Environ. Microbiol. 59:304 (1993) and J. Bacteriol. 173:697 (1991)]. Amplification reactions were performed on a Hybaid TRI thermocycler with 2.5 U Taq polymerase (Promega) and 100 ng of genomic DNA for one cycle of 10 minutes at

90° C, 25 cycles of 30 sec. at 94° C, 30 sec at 42° C, and 1 min at 72° C, followed by 1 cycle for 5 min at 72° C,. The fastest transitions between temperatures were used. The resulting PCR product was purified from residual primers and Taq DNA polymerase by phenol/chloroform extraction followed by ethanol precipitation using conventional protocols according to Maniatis, supra, and dissolved in distilled water. The resulting 1.5 kb purified PCR product was restricted with Sail and Bam HI, and the restricted products were ligated into plasmid M13mp18/19 [see Gene 19:259 (1982)]. Sequences were determined using single-stranded M13mp18/19 template and conventional -40 primer [see Proc. Nat. Acad. Sci. USA 74:5463 (1977)]. A Sequenase kit with 7-deazaGTP (US Biochemicals) was employed for all sequencing reactions in order to resolve compressions that made the sequence difficult to read.

In conducting the amplification procedure, the 1.5 kb amplification product was first restricted with Sail and BamHI for ligation into M13 as described above. However, two fragments of approximately 0.9 and 0.6 kb were observed, and thus the amplification products were digested with each enzyme separately to reveal an unexpected Sail site, rarely found internally within the 16S sequence [see J. Bacteriol. 173:697 (1991 )]. When sequenced and aligned to Escherichia coli 16S rDNA [see Proc. Natl. Acad. Sci. USA 75:4801 (1978)], the Sail restriction site was found to be 873 base pairs into the 16S rDNA gene of both E. stewartii and E. herbicola (see Table 6).

The 624 bp Sall/BamHII 3' terminal fragment was therefore used in the ligation to M13mp18/19 described above.

Several single-stranded M13 templates were next sequenced for both E. stewartii and E. herbicola, and sequences were compared between species for differences and within the same species for discrepancies. When approximately 240 base pairs of the 16S rDNA was sequenced, comparisons revealed three base-pair differences in the V3 [see Nucleic Acids Res. 12:5837 (1984)] region, one at nucleotide 1001 (C->A), one at nucleotide 1008 (G->A), and one at nucleotide 1019 (C- >T).

TABLE 7

Sequences and Melting Temperatures of LCR and PCR Primers

Primer Sequence π° C.

PCR 16S-P5 CCGAATTCGTCGACAACAGAGTTTGATCATGG 42

16S-P3 CCCGGGATCCAAGCTTTACCTTGTTACGACTT 46

LCR

Es-1 GGCAGCGAACTTGGCAGAGATGCC 70

Es-2 TTGGTGCCTTCGGGAACCGTGA 70 Es-3 GCATCTCTGCCAAGTTCGCTGG 70

Es-4 GGCACGGTTCCCGAAGGCACCAAG 72

In the above table, the dissociation temperature (T) was calculated by the method of Suggs et al. [see Developmental Biology Using Purified Genes, Brown and Fox eds., pg 683, Academic Press (1981 )].

In the above table it should become readily apparent that LCR primers Es-1 and Es-3 contain the base pair differences at positions 1001 and 1008 noted above, while primers Es-1 and Es-4 contain the single base pair difference at nucleotide 1019, so that, when primers annealed to the target DNA, only primers exactly complementary to the targeted E. stewartii DNA would be efficiently bound, ligated and amplified to yield a ligation product.

Two pair of LCR primers (Es-1 and Es-2, and Es-3 and Es-4) were designed to flank a single base pair difference determined by 16S rDNA sequence comparisons of Erwinia stewartii and Erwinia herbicola according to the following Table 8. More specifically, the LCR primers utilized according to the present invention are depicted with corresponding E. stewartii target sequences. The "*" indicates a 32 p ATP label (Amersham) produced using polynucleotide kinase [see Proc. Natl. Acad. Sci. USA 88:189 (1991)], and for each primer, only the two end bases are depicted. The dashed line represents the corresponding sequence on the E. stewartii target DNA; and primers Es1 and Es4 have a GG tail on their 5' ends. TABLE 8

Es2

Esl *TT GA GCA _cc 5 * CΆTCCΆGCGAACTTGGCAGAGATGCCTTGGTGCCTTCGGGAACCGTGAGA 3 * 3 ' GTAGGTCGCTTG CCGTCTCTACGGAACCACGGAAGCCC -KX^CACTCT 5 '

GG -----CG*

Es3 GA ACGG

Es4 in the primers depicted in Table 8, on the 5' end of Es1 and Es4, two nucleotide tails (GG) have been added to prevent ligation of the 3' ends [see PCR Methods Applications 1 :5 (1991)]. Primer size was selected so that the primers would have a melting temperature of 70±2° C. EXAMPLE VIII

Minipreparations of Genomic DNA from Erwinia isolates were prepared according to the methods of Ausubel supra. DNA concentration was determined by measuring the absorbance at 260 nm and 100 ng of DNA was used in the PCR. Alternatively, crude lysis of the bacterial cells could be (and was) performed to recover DNA. Erwiniae were grown overnight in 5 ml of LB medium at 28°C on a shaker at 150 rpm. Cells from the overnight cultures were pelleted, resuspended in 95 μl of IX PCR buffer (Promega), and lysed by incubation with 4 μl of lysozyme (50 mg/ml) for 15 min at ambient temperature. One μl proteinase K (20 mg/ml) was then added and the lysate was incubated for 1 hour at 60° C. The lysate was divided into two 50 ml aliquots and boiled for 20 minutes. A total of 5 μl of the boiled lysate was used for PCR

EXAMPLE IX The PCR/LCR condition and PCR amplifications conditions for the

PCR-coupled LCR were: 1 cycle of 4 min at 92° C, followed by 25 cycles of 1 min at 94° C, 1.5 min at 50° C, 1.5 min at 72° C, and a final extension of 6 min at 72° C. Any residual Taq DNA polymerase activity was eliminated by one cycle of 25 min at 97° C. PCR product reactions were observed on 1.5% agarose gels after electrophoresis ant ethidium bromide staining as described above. LCR was performed as described in the literature [see Appl. Environ. Microbiol. 58:3443 (1992)]. Optimal reaction conditions were 25 cycles of 1 min at 94° C, followed by 4 min at 65° C. Electrophoresis of the resulting LCR products was carried out as described in Example III.

The two stage assay (an initial PCR amplification followed by LCR) according to the present invention was successful in distinguishing E. stewartii from other Erwinia species using bacterial genomic DNA. Whether the genomic DNA was from a minipreparation (either purified or unpurified following PCR) or from a crude lysate made no significant difference in the LCR assay. In a typical autoradiograph after LCR and gel electrophoresis, two bands were seen in each lane: an upper band corresponding to the 46 base pair ligation product, and a lower band corresponding to unligated radiolabelled primers, allowing for a clear distinction between E. stewartii and E. herbicola to be seen. Other Erwinia spp. when tested produced similar results to E. herbicola, ie, no, or only a trace background, LCR product was observed.

Thus, PCR-coupled LCR has been shown to be a highly sensitive and specific method to detect and identify bacteria, and once detected to distinguish one species or strain from another. PCR enhances sensitivity by amplifying the target DNA region, and LCR provides the specificity since a positive reaction is only observed upon ligation of primer pairs with the correct 3' and 5' ends. The sequences of the LCR primers for detection of bacteria are preferably derived from the 16S rDNA region (which as a general rule is phylogenetically conserved among bacteria) of the bacteria genome. While variable segments in the 16S rDNA are highly but not completely homologous among closely related bacteria, they diverge sufficiently among distantly related bacteria so that discrimination of closely related bacterial virtually ensures discrimination of less closely related bacteria. Thus, the present invention is applicable for all bacterial assays, not just for assays regarding the specific Listeria and Erwinia species described herein. As described herein, an advantages of the use of PCR-coupled LCR according to the present invention is that even if the target sequence for the LCR can only be amplified to the attomolar range (because of competition from other bacteria in the original sample, whose 16 rDNA is also amplified by the universal PCR primers), this amount of DNA is still sufficient to be detected by LCR. Thus, the assay system described herein provides a highly sensitive and specific means to identify and distinguish bacteria species and strains, one from the other. A complete listing of the nucleotide sequences described herein is provided as follows:

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Carl A. Batt, Martin Wiedmann and Francis Barany

(ii) TITLE OF INVENTION: Assay For microorganisms By

Polymerase Chain Reaction-Coupled Ligase Chain Reaction

(iii) NUMBER OF SEQUENCES: 28 (2) INFORMATION FOR SEQ ID NO:1 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1 :

CCGAATTCGT CGACAACAGA GTTTGATCAT GG 32

(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: CGGAAACCCC CTAACACTTA 20

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CCCGGGATCC AAGCTTTAAC CTTGTTACGA CTT 33

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

ATTAGATACC CTGGTAGTCC 20 (2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NOS

AGTGTGGCGC ATGCCAGCTC TTTTGA 26

(2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GGACCGGGGC TAATACCGAA TGATAA 26 (2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

TATCATTCGG TATTAGCCCC GGTTT 25 (2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

GGAAAAGCGT GGCATGCGCC ACACTT 26

(2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9 GTACAAAGGG TCGCGAAGCC G 21

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

AAGCTACACA CGTGCTACAA TGGATA 26

(2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11 :

ATCCATTGTA GCACGTGTGTAGC 23

(2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: AACGGCTTCG CGACCCTTTG TACT 24

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 54 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

GGAAACCGGG GCTAATACCG AATGATAAAG TGTGGCGCAT .40 GCCACGCTTTTGAA 54

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 54 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

TTCAAAAGCG TGGCATGCGC CACACTTTAT CATTCGGTAT 40 TAGCCCCGGTTTCC 54 (2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 54 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

GGAAACCGGG GCTAATACCG AATGATAGAG TGTGGCGCAT 40 GCCACGCTCTTGAA 54

(2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 50 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

CTGGGCTACA CACGTGCTAC AATGGATAGT ACAAAGGGTC 40 GCGAAGCCGC 50

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 50 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

GCGGCTTCGC GACCCTTTGT ACTATCCATT GTAGCACGTG 40 TGTAGCCCAG 50

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 50 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

CTGGGCTACA CACGTGCTAC AATGGATGGT ACAAAGGGTC 40

GCGAAGCCGC 50

(2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 120 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: CCCGCACAAG CGGTGGAGCA TGTGGTTTAA TTCGATGCAA 40 CGCGAAGAAC CTTACCATCC TTGACATCCA GCGAACTTGG 80 CAGAGATGCC TTGGTGCCTT CGGGAACCGT GAGACAGGTG 120 (2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 120 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20

CCCGCACAAG CGGTGGAGCA TGTGGTTTAA TTCGATGCAA 40

CGCGAAGAAC CTTACCATCC TTGACATCCA GAGAACTTAG 80 CAGAG ATGCT TTGGTGCCTT CGGGAACCGT GAGACAGGTG 120

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21 :

CCGAATTCGT CGACAACAGA GTTTGATCATGG 32 (2) INFORMATION FOR SEQ ID NO:22:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: CCCGGGATCC AAGCTTTACC TTGTTACGAC TT 32

(2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

GGCAGCGAAC TTGGCAGAGA TGCC 24

(2) INFORMATION FOR SEQ ID NO:24:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: TTGGTGCCTT CGGGAACCGT GA 22

(2) INFORMATION FOR SEQ ID NO:25:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2111 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

GCATCTCTGC CAAGTTCGCT GG 22 (2) INFORMATION FOR SEQ ID NO:26:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

GGCACGGTTC CCGAAGGCAC CAAG 24

(2) INFORMATION FOR SEQ ID NO:27:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 50 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: CATCCAGCGA ACTTGGCAGA GATGCCTTGG TGCCTTCGGG 40

AACCGTGAGA 50

(2) INFORMATION FOR SEQ ID NO:28:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 50 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: TCTCACGGTT CCCGAAGGCA CCAAGGCATC TCTGCCAAGT 40

TCGCTGGATG 50

While we have illustrated and described preferred embodiments of our invention, it is to be understood that this invention is capable of variation and modification, and we therefore do not wish to be limited to the precise terms set forth, but desire to avail ourselves of such changes and alterations which may be made for adapting the invention to various usages and conditions. For example, it is well within the skill of others to identify other primers which may be used in the present invention; and in optimizing the individual PCR and LCR reactions, the LCR and PCR cycles and temperatures may be adjusted according to optimal protocols for each test system. Accordingly, such changes and alterations are properly intended to be within the full range of equivalents, and therefore within the purview of the following claims.

Having thus described our invention and the manner and a process of making and using it in such full, clear, concise and exact terms so as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same;

Claims

WE CLAIM:
1. A method to discriminate one bacterial species or strain from another bacterial species or strain which comprises identifying a single base pair mismatch between the 16S rDNA nucleotide sequences of each bacterial species, designing and utilizing a compatible nucleotide PCR primer in a polymerase chain reaction to amplify the 16S rDNA of each bacterial species containing the single base pair mismatch, designing and utilizing a compatible LCR nucleotide primer in a ligase chain reaction to determine whether the LCR primer will ligate the PCR-amplified 16S rDNA; and determining whether ligation has occurred in the ligase chain reaction.
PCT/US1994/012508 1993-10-27 1994-10-26 Detection assay for listeria and erwinia microorganisms WO1995011996A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US14506793A true 1993-10-27 1993-10-27
US08/145,067 1993-10-27

Publications (1)

Publication Number Publication Date
WO1995011996A1 true WO1995011996A1 (en) 1995-05-04

Family

ID=22511460

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/012508 WO1995011996A1 (en) 1993-10-27 1994-10-26 Detection assay for listeria and erwinia microorganisms

Country Status (1)

Country Link
WO (1) WO1995011996A1 (en)

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5888731A (en) * 1995-08-30 1999-03-30 Visible Genetics Inc. Method for identification of mutations using ligation of multiple oligonucleotide probes
US5914229A (en) * 1996-06-14 1999-06-22 Sarnoff Corporation Method for amplifying a polynucleotide
WO2002095066A2 (en) * 2001-05-18 2002-11-28 Biotecon Diagnostics Gmbh Detecting microorganisms of the yersinia pestis/yersinia pseudotuberculosis species
EP1331276A1 (en) * 2002-01-28 2003-07-30 Universita' degli studi di Bologna Method and kit for detecting Gram-positive bacteria
US7943314B2 (en) 2005-07-01 2011-05-17 Iseao Technologies Limited Methods of detecting viability-associated molecules
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY, Volume 24, Number 2, issued April 1991, COLLINS et al., "Phylogenetic Analysis of the Genus Listeria Based on Reverse Transcriptase Sequencing of 16S rRNA", pages 240-246. *

Cited By (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5888731A (en) * 1995-08-30 1999-03-30 Visible Genetics Inc. Method for identification of mutations using ligation of multiple oligonucleotide probes
US6025139A (en) * 1995-08-30 2000-02-15 Visible Genetics Inc. Method for identification of mutations using ligation of multiple oligonucleotide probes
US5914229A (en) * 1996-06-14 1999-06-22 Sarnoff Corporation Method for amplifying a polynucleotide
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8815513B2 (en) 2001-03-02 2014-08-26 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8265878B2 (en) 2001-03-02 2012-09-11 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US9752184B2 (en) 2001-03-02 2017-09-05 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US9416424B2 (en) 2001-03-02 2016-08-16 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8802372B2 (en) 2001-03-02 2014-08-12 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
WO2002095066A2 (en) * 2001-05-18 2002-11-28 Biotecon Diagnostics Gmbh Detecting microorganisms of the yersinia pestis/yersinia pseudotuberculosis species
WO2002095066A3 (en) * 2001-05-18 2003-12-04 Biotecon Diagnostics Gmbh Detecting microorganisms of the yersinia pestis/yersinia pseudotuberculosis species
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8380442B2 (en) 2001-06-26 2013-02-19 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8921047B2 (en) 2001-06-26 2014-12-30 Ibis Biosciences, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
EP1331276A1 (en) * 2002-01-28 2003-07-30 Universita' degli studi di Bologna Method and kit for detecting Gram-positive bacteria
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US9725771B2 (en) 2002-12-06 2017-08-08 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8476415B2 (en) 2003-05-13 2013-07-02 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8013142B2 (en) 2003-09-11 2011-09-06 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US9447462B2 (en) 2004-02-18 2016-09-20 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US9449802B2 (en) 2004-05-24 2016-09-20 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8987660B2 (en) 2004-05-24 2015-03-24 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US7943314B2 (en) 2005-07-01 2011-05-17 Iseao Technologies Limited Methods of detecting viability-associated molecules
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US8551738B2 (en) 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US9023655B2 (en) 2008-09-16 2015-05-05 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US9027730B2 (en) 2008-09-16 2015-05-12 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8252599B2 (en) 2008-09-16 2012-08-28 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8609430B2 (en) 2008-09-16 2013-12-17 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US9165740B2 (en) 2009-02-12 2015-10-20 Ibis Biosciences, Inc. Ionization probe assemblies
US8796617B2 (en) 2009-02-12 2014-08-05 Ibis Biosciences, Inc. Ionization probe assemblies
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification

Similar Documents

Publication Publication Date Title
Nübel et al. Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.
v. Wintzingerode et al. Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis
Widjojoatmodjo et al. Rapid identification of bacteria by PCR-single-strand conformation polymorphism.
Eyers et al. Discrimination among thermophilic Campylobacter species by polymerase chain reaction amplification of 23S rRNA gene fragments.
Hill et al. The polymerase chain reaction: applications for the detection of foodborne pathogens
Rainey et al. Clostridium paradoxum DSM 7308T contains multiple 16S rRNA genes with heterogeneous intervening sequences
Yamamoto et al. PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains.
Rosado et al. Genetic Diversity of nifH Gene Sequences inPaenibacillus azotofixans Strains and Soil Samples Analyzed by Denaturing Gradient Gel Electrophoresis of PCR-Amplified Gene Fragments
US5702895A (en) Method and kit for detecting methicillin-resistant Staphylococcus aureus
Viaud et al. Diversity of soil fungi studied by PCR–RFLP of ITS
Michotey et al. Comparison of methods for quantification of cytochrome cd 1-denitrifying bacteria in environmental marine samples
EP2781604B1 (en) Sequences for detection and identification of methicillin-resistant Staphylococcus aureus
Felske et al. Spatial homogeneity of abundant bacterial 16S rRNA molecules in grassland soils
EP0620862B1 (en) Method for the identification of microorganisms by the utilization of directed and arbitrary dna amplification
Witham et al. A PCR-based assay for the detection of Escherichia coli Shiga-like toxin genes in ground beef.
Massol-Deya et al. Bacterial community fingerprinting of amplified 16S and 16–23S ribosomal DNA gene sequences and restriction endonuclease analysis (ARDRA)
Springer et al. Two-laboratory collaborative study on identification of mycobacteria: molecular versus phenotypic methods.
EP0314294B1 (en) Detection of listeria
Vandamme et al. Campylobacter hyoilei Alderton et al. 1995 and Campylobacter coli Veron and Chatelain 1973 are subjective synonyms
Jacobsen Microscale detection of specific bacterial DNA in soil with a magnetic capture-hybridization and PCR amplification assay.
Lee et al. Nonradioactive method to study genetic profiles of natural bacterial communities by PCR-single-strand-conformation polymorphism.
Pearson et al. The molecular genetics of cyanobacterial toxicity as a basis for monitoring water quality and public health risk
Smalla et al. Prevalence of npt II and Tn5 in kanamycin-resistant bacteria from different environments
Klijn et al. Identification of mesophilic lactic acid bacteria by using polymerase chain reaction-amplified variable regions of 16S rRNA and specific DNA probes.
US7390623B2 (en) Detection and identification of staphylococcus aureus and epidermidis using the 16S-23S rRNA spacer

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase