US20080311558A1 - Methods For Rapid Identification Of Pathogens In Humans And Animals - Google Patents

Methods For Rapid Identification Of Pathogens In Humans And Animals Download PDF

Info

Publication number
US20080311558A1
US20080311558A1 US11/869,449 US86944907A US2008311558A1 US 20080311558 A1 US20080311558 A1 US 20080311558A1 US 86944907 A US86944907 A US 86944907A US 2008311558 A1 US2008311558 A1 US 2008311558A1
Authority
US
United States
Prior art keywords
bioagent
ec
primers
mass
pair
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/869,449
Inventor
David J. Ecker
Richard H. Griffey
Rangarajan Sampath
Steven A. Hofstadler
John McNeil
Stanley T. Crooke
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ibis Biosciences Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US09/798,007 priority Critical patent/US20030027135A1/en
Priority to US43131902P priority
Priority to US10/325,526 priority patent/US20040121311A1/en
Priority to US10/323,233 priority patent/US20040121309A1/en
Priority to US10/325,527 priority patent/US20040121335A1/en
Priority to US10/326,051 priority patent/US20040121313A1/en
Priority to US44344303P priority
Priority to US44378803P priority
Priority to US44752903P priority
Priority to US10/660,122 priority patent/US7781162B2/en
Priority to US11/869,449 priority patent/US20080311558A1/en
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Publication of US20080311558A1 publication Critical patent/US20080311558A1/en
Assigned to IBIS BIOSCIENCES, INC. reassignment IBIS BIOSCIENCES, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CROOKE, STANLEY T., ECKER, DAVID J., GRIFFEY, RICHARD H., MCNEIL, JOHN, HOFSTADLER, STEVEN A., SAMPATH, RANGARAJAN
Assigned to IBIS BIOSCIENCES, INC. reassignment IBIS BIOSCIENCES, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ISIS PHARMACEUTICALS, INC.
Assigned to ISIS PHARMACEUTICALS, INC. reassignment ISIS PHARMACEUTICALS, INC. CORRECTIVE ASSIGNMENT TO CORRECT THE ASSIGNEE INFORMATION PREVIOUSLY RECORDED ON REEL 025433 FRAME 0816. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNMENT. Assignors: CROOKE, STANLEY T., ECKER, DAVID J., GRIFFEY, RICHARD H., MCNEIL, JOHN, HOFSTADLER, STEVEN A., SAMPATH, RANGARAJAN
Application status is Abandoned legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10TTECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00Chemistry: analytical and immunological testing
    • Y10T436/24Nuclear magnetic resonance, electron spin resonance or other spin effects or mass spectrometry

Abstract

The present invention provides methods of: identifying pathogens in biological samples from humans and animals, resolving a plurality of etiologic agents present in samples obtained from humans and animals, determining detailed genetic information about such pathogens or etiologic agents, and rapid detection and identification of bioagents from environmental, clinical or other samples.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • The present application is a continuation of U.S. application Ser. No. 10/660,122, filed Sep. 11, 2003, which in turn: 1) is a continuation-in-part of U.S. application Ser. No. 10/323,233 filed Dec. 18, 2002; 2) is a continuation-in-part of U.S. application Ser. No. 10/326,051 filed Dec. 18, 2002; 3) is a continuation-in-part of U.S. application Ser. No. 10/325,526 filed Dec. 18, 2002; 4) is a continuation in part of U.S. application Ser. No. 10/325,527 filed Dec. 18, 2002; 5) is a continuation-in-part of U.S. application Ser. No. 09/798,007 filed Mar. 2, 2001; 6) claims the benefit of U.S. provisional application Ser. No. 60/431,319 filed Dec. 6, 2002; 7) claims the benefit of U.S. provisional application Ser. No. 60/443,443 filed Jan. 29, 2003; 8) claims the benefit of U.S. provisional application Ser. No. 60/443,788 filed Jan. 30, 2003; and 9) claims the benefit of U.S. provisional application Ser. No. 60/447,529 filed Feb. 14, 2003; each of which is incorporated herein by reference in its entirety.
  • STATEMENT OF GOVERNMENT SUPPORT
  • This invention was made with United States Government support under DARPA contract MDA972-00-C-0053. The United States Government has certain rights in the invention.
  • FIELD OF THE INVENTION
  • The present invention relates generally to clinical applications of directed to the identification of pathogens in biological samples from humans and animals. The present invention is also directed to the resolution of a plurality of etiologic agents present in samples obtained from humans and animals. The invention is further directed to the determination of detailed genetic information about such pathogens or etiologic agents.
  • The identification of the bioagent is important for determining a proper course of treatment and/or eradication of the bioagent in such cases as biological warfare and natural infections. Furthermore, the determination of the geographic origin of a selected bioagent will facilitate the identification of potential criminal identity. The present invention also relates to methods for rapid detection and identification of bioagents from environmental, clinical or other samples. The methods provide for detection and characterization of a unique base composition signature (BCS) from any bioagent, including bacteria and viruses. The unique BCS is used to rapidly identify the bioagent.
  • BACKGROUND OF THE INVENTION
  • In the United States, hospitals report well over 5 million cases of recognized infectious disease-related illnesses annually. Significantly greater numbers remain undetected, both in the inpatient and community setting, resulting in substantial morbidity and mortality. Critical intervention for infectious disease relies on rapid, sensitive and specific detection of the offending pathogen, and is central to the mission of microbiology laboratories at medical centers. Unfortunately, despite the recognition that outcomes from infectious illnesses are directly associated with time to pathogen recognition, as well as accurate identification of the class and species of microbe, and ability to identify the presence of drug resistance isolates, conventional hospital laboratories often remain encumbered by traditional slow multi-step culture based assays. Other limitations of the conventional laboratory which have become increasingly apparent include: extremely prolonged wait-times for pathogens with long generation time (up to several weeks); requirements for additional testing and wait times for speciation and identification of antimicrobial resistance; diminished test sensitivity for patients who have received antibiotics; and absolute inability to culture certain pathogens in disease states associated with microbial infection.
  • For more than a decade, molecular testing has been heralded as the diagnostic tool for the new millennium, whose ultimate potential could include forced obsolescence of traditional hospital laboratories. However, despite the fact that significant advances in clinical application of PCR techniques have occurred, the practicing physician still relies principally on standard techniques. A brief discussion of several existing applications of PCR in the hospital-based setting follows.
  • Generally speaking molecular diagnostics have been championed for identifying organisms that cannot be grown in vitro, or in instances where existing culture techniques are insensitive and/or require prolonged incubation times. PCR-based diagnostics have been successfully developed for a wide variety of microbes. Application to the clinical arena has met with variable success, with only a few assays achieving acceptance and utility.
  • One of the earliest and perhaps most widely recognized applications of PCR for clinical practice is in detection of Mycobacterium tuberculosis. Clinical characteristics favoring development of a nonculture-based test for tuberculosis include week to month long delays associated with standard testing, occurrence of drug-resistant isolates and public health imperatives associated with recognition, isolation and treatment. Although frequently used as a diagnostic adjunctive, practical and routine clinical application of PCR remains problematic due to significant inter-laboratory variation in sensitivity, and inadequate specificity for use in low prevalence populations, requiring further development at the technical level. Recent advances in the laboratory suggest that identification of drug resistant isolates by amplification of mutations associated with specific antibiotic resistance (e.g., rpoB gene in rifampin resistant strains) may be forthcoming for clinical use, although widespread application will require extensive clinical validation.
  • One diagnostic assay, which has gained widespread acceptance, is for C. trachomatis. Conventional detection systems are limiting due to inadequate sensitivity and specificity (direct immunofluorescence or enzyme immunoassay) or the requirement for specialized culture facilities, due to the fastidious characteristics of this microbe. Laboratory development, followed by widespread clinical validation testing in a variety of acute and nonacute care settings have demonstrated excellent sensitivity (90-100%) and specificity (97%) of the PCR assay leading to its commercial development. Proven efficacy of the PCR assay from both genital and urine sampling, have resulted in its application to a variety of clinical setting, most recently including routine screening of patients considered at risk.
  • While the full potential for PCR diagnostics to provide rapid and critical information to physicians faced with difficult clinical-decisions has yet to be realized, one recently developed assay provides an example of the promise of this evolving technology. Distinguishing life-threatening causes of fever from more benign causes in children is a fundamental clinical dilemma faced by clinicians, particularly when infections of the central nervous system are being considered. Bacterial causes of meningitis can be highly aggressive, but generally cannot be differentiated on a clinical basis from aseptic meningitis, which is a relatively benign condition that can be managed on an outpatient basis. Existing blood culture methods often take several days to turn positive, and are often confounded by poor sensitivity or false-negative findings in patients receiving empiric antimicrobials. Testing and application of a PCR assay for enteroviral meningitis has been found to be highly sensitive. With reporting of results within 1 day, preliminary clinical trials have shown significant reductions in hospital costs, due to decreased duration of hospital stays and reduction in antibiotic therapy. Other viral PCR assays, now routinely available include those for herpes simplex virus, cytomegalovirus, hepatitis and HIV. Each has a demonstrated cost savings role in clinical practice, including detection of otherwise difficult to diagnose infections and newly realized capacity to monitor progression of disease and response to therapy, vital in the management of chronic infectious diseases.
  • The concept of a universal detection system has been forwarded for identification of bacterial pathogens, and speaks most directly to the possible clinical implications of a broad-based screening tool for clinical use. Exploiting the existence of highly conserved regions of DNA common to all bacterial species in a PCR assay would empower physicians to rapidly identify the presence of bacteremia, which would profoundly impact patient care. Previous empiric decision making could be abandoned in favor of educated practice, allowing appropriate and expeditious decision-making regarding need for antibiotic therapy and hospitalization.
  • Experimental work using the conserved features of the 16S rRNA common to almost all bacterial species, is an area of active investigation. Hospital test sites have focused on “high yield” clinical settings where expeditious identification of the presence of systemic bacterial infection has immediate high morbidity and mortality consequences. Notable clinical infections have included evaluation of febrile infants at risk for sepsis, detection of bacteremia in febrile neutropenic cancer patients, and examination of critically ill patients in the intensive care unit. While several of these studies have reported promising results (with sensitivity and specificity well over 90%), significant technical difficulties (described below) remain, and have prevented general acceptance of this assay in clinics and hospitals (which remain dependent on standard blood culture methodologies). Even the revolutionary advances of real-time PCR technique, which offers a quantitative more reproducible and technically simpler system, remains encumbered by inherent technical limitations of the PCR assay.
  • The principle shortcomings of applying PCR assays to the clinical setting include: inability to eliminate background DNA contamination; interference with the PCR amplification by substrates present in the reaction; and limited capacity to provide rapid reliable speciation, antibiotic resistance and subtype identification. Some laboratories have recently made progress in identifying and removing inhibitors; however background contamination remains problematic, and methods directed towards eliminating exogenous sources of DNA report significant diminution in assay sensitivity. Finally, while product identification and detailed characterization has been achieved using sequencing techniques, these approaches are laborious and time-intensive thus detracting from its clinical applicability.
  • Rapid and definitive microbial identification is desirable for a variety of industrial, medical, environmental, quality, and research reasons. Traditionally, the microbiology laboratory has functioned to identify the etiologic agents of infectious diseases through direct examination and culture of specimens. Since the mid-1980s, researchers have repeatedly demonstrated the practical utility of molecular biology techniques, many of which form the basis of clinical diagnostic assays. Some of these techniques include nucleic acid hybridization analysis, restriction enzyme analysis, genetic sequence analysis, and separation and purification of nucleic acids (See, e.g., J. Sambrook, E. F. Fritsch, and T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). These procedures, in general, are time-consuming and tedious. Another option is the polymerase chain reaction (PCR) or other amplification procedure that amplifies a specific target DNA sequence based on the flanking primers used. Finally, detection and data analysis convert the hybridization event into an analytical result.
  • Other not yet fully realized applications of PCR for clinical medicine is the identification of infectious causes of disease previously described as idiopathic (e.g. Bartonella henselae in bacillary angiomatosis, and Tropheryma whippellii as the uncultured bacillus associated with Whipple's disease). Further, recent epidemiological studies which suggest a strong association between Chlamydia pneumonia and coronary artery disease, serve as example of the possible widespread, yet undiscovered links between pathogen and host which may ultimately allow for new insights into pathogenesis and novel life sustaining or saving therapeutics.
  • For the practicing clinician, PCR technology offers a yet unrealized potential for diagnostic omnipotence in the arena of infectious disease. A universal reliable infectious disease detection system would certainly become a fundamental tool in the evolving diagnostic armamentarium of the 21st century clinician. For front line emergency physicians, or physicians working in disaster settings, a quick universal detection system, would allow for molecular triage and early aggressive targeted therapy. Preliminary clinical studies using species specific probes suggest that implementing rapid testing in acute care setting is feasible. Resources could thus be appropriately applied, and patients with suspected infections could rapidly be risk stratified to the different treatment settings, depending on the pathogen and virulence. Furthermore, links with data management systems, locally regionally and nationally, would allow for effective epidemiological surveillance, with obvious benefits for antibiotic selection and control of disease outbreaks.
  • For the hospitalists, the ability to speciate and subtype would allow for more precise decision-making regarding antimicrobial agents. Patients who are colonized with highly contagious pathogens could be appropriately isolated on entry into the medical setting without delay. Targeted therapy will diminish development of antibiotic resistance. Furthermore, identification of the genetic basis of antibiotic resistant strains would permit precise pharmacologic intervention. Both physician and patient would benefit with less need for repetitive testing and elimination of wait times for test results.
  • It is certain that the individual patient will benefit directly from this approach. Patients with unrecognized or difficult to diagnose infections would be identified and treated promptly. There will be reduced need for prolonged inpatient stays, with resultant decreases in iatrogenic events.
  • Mass spectrometry provides detailed information about the molecules being analyzed, including high mass accuracy. It is also a process that can be easily automated. Low-resolution MS may be unreliable when used to detect some known agents, if their spectral lines are sufficiently weak or sufficiently close to those from other living organisms in the sample. DNA chips with specific probes can only determine the presence or absence of specifically anticipated organisms. Because there are hundreds of thousands of species of benign bacteria, some very similar in sequence to threat organisms, even arrays with 10,000 probes lack the breadth needed to detect a particular organism.
  • Antibodies face more severe diversity limitations than arrays. If antibodies are designed against highly conserved targets to increase diversity, the false alarm problem will dominate, again because threat organisms are very similar to benign ones. Antibodies are only capable of detecting known agents in relatively uncluttered environments.
  • Several groups have described detection of PCR products using high resolution electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry (ESI-FT-ICR MS). Accurate measurement of exact mass combined with knowledge of the number of at least one nucleotide allowed calculation of the total base composition for PCR duplex products of approximately 100 base pairs. (Aaserud et al., J. Am. Soc. Mass Spec., 1996, 7, 1266-1269; Muddiman et al., Anal. Chem., 1997, 69, 1543-1549; Wunschel et al., Anal. Chem., 1998, 70, 1203-1207; Muddiman et al., Rev. Anal. Chem., 1998, 17, 1-68). Electrospray ionization-Fourier transform-ion cyclotron resistance (ESI-FT-ICR) MS may be used to determine the mass of double-stranded, 500 base-pair PCR products via the average molecular mass (Hurst et al., Rapid Commun. Mass Spec. 1996, 10, 377-382). The use of matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry for characterization of PCR products has been described. (Muddiman et al., Rapid Commun. Mass Spec., 1999, 13, 1201-1204). However, the degradation of DNAs over about 75 nucleotides observed with MALDI limited the utility of this method.
  • U.S. Pat. No. 5,849,492 describes a method for retrieval of phylogenetically informative DNA sequences which comprise searching for a highly divergent segment of genomic DNA surrounded by two highly conserved segments, designing the universal primers for PCR amplification of the highly divergent region, amplifying the genomic DNA by PCR technique using universal primers, and then sequencing the gene to determine the identity of the organism.
  • U.S. Pat. No. 5,965,363 discloses methods for screening nucleic acids for polymorphisms by analyzing amplified target nucleic acids using mass spectrometric techniques and to procedures for improving mass resolution and mass accuracy of these methods.
  • WO 99/14375 describes methods, PCR primers and kits for use in analyzing preselected DNA tandem nucleotide repeat alleles by mass spectrometry.
  • WO 98/12355 discloses methods of determining the mass of a target nucleic acid by mass spectrometric analysis, by cleaving the target nucleic acid to reduce its length, making the target single-stranded and using MS to determine the mass of the single-stranded shortened target. Also disclosed are methods of preparing a double-stranded target nucleic acid for MS analysis comprising amplification of the target nucleic acid, binding one of the strands to a solid support, releasing the second strand and then releasing the first strand which is then analyzed by MS. Kits for target nucleic acid preparation are also provided.
  • PCT WO97/33000 discloses methods for detecting mutations in a target nucleic acid by nonrandomly fragmenting the target into a set of single-stranded nonrandom length fragments and determining their masses by MS.
  • U.S. Pat. No. 5,605,798 describes a fast and highly accurate mass spectrometer-based process for detecting the presence of a particular nucleic acid in a biological sample for diagnostic purposes.
  • WO 98/21066 describes processes for determining the sequence of a particular target nucleic acid by mass spectrometry. Processes for detecting a target nucleic acid present in a biological sample by PCR amplification and mass spectrometry detection are disclosed, as are methods for detecting a target nucleic acid in a sample by amplifying the target with primers that contain restriction sites and tags, extending and cleaving the amplified nucleic acid, and detecting the presence of extended product, wherein the presence of a DNA fragment of a mass different from wild-type is indicative of a mutation. Methods of sequencing a nucleic acid via mass spectrometry methods are also described.
  • WO 97/37041, WO 99/31278 and U.S. Pat. No. 5,547,835 describe methods of sequencing nucleic acids using mass spectrometry. U.S. Pat. Nos. 5,622,824, 5,872,003 and 5,691,141 describe methods, systems and kits for exonuclease-mediated mass spectrometric sequencing.
  • Thus, there is a need for a method for bioagent detection and identification which is both specific and rapid, and in which no nucleic acid sequencing is required. The present invention addresses this need.
  • SUMMARY OF THE INVENTION
  • The present invention is directed towards methods of identifying a pathogen in a biological sample by obtaining nucleic acid from a biological sample, selecting at least one pair of intelligent primers with the capability of amplification of nucleic acid of the pathogen, amplifying the nucleic acid with the primers to obtain at least one amplification product, determining the molecular mass of at least one amplification product from which the pathogen is identified. Further, this invention is directed to methods of epidemic surveillance. By identifying a pathogen from samples acquired from a plurality of geographic locations, the spread of the pathogen to a given geographic location can be determined.
  • The present invention is also directed to methods of diagnosis of a plurality of etiologic agents of disease in an individual by obtaining a biological sample from an individual, isolating nucleic acid from the biological sample, selecting a plurality of amplification primers with the capability of amplification of nucleic acid of a plurality of etiologic agents of disease, amplifying the nucleic acid with a plurality of primers to obtain a plurality of amplification products corresponding to a plurality of etiologic agents, determining the molecular masses of the plurality of unique amplification products which identify the members of the plurality of etiologic agents.
  • The present invention is also directed to methods of in silico screening of primer sets to be used in identification of a plurality of bioagents by preparing a base composition probability cloud plot from a plurality of base composition signatures of the plurality of bioagents generated in silico, inspecting the base composition probability cloud plot for overlap of clouds from different bioagents, and choosing primer sets based on minimal overlap of the clouds.
  • The present invention is also directed to methods of predicting the identity of a bioagent with a heretofore unknown base composition signature by preparing a base composition probability cloud plot from a plurality of base composition signatures of the plurality of bioagents which includes the heretofore unknown base composition, inspecting the base composition probability cloud for overlap of the heretofore unknown base composition with the cloud of a known bioagent such that overlap predicts that the identity of the bioagent with a heretofore unknown base composition signature equals the identity of the known bioagent.
  • The present invention is also directed to methods for determining a subspecies characteristic for a given pathogen in a biological sample by identifying the pathogen in a biological sample using broad range survey primers or division-wide primers, selecting at least one pair of drill-down primers to amplify nucleic acid segments which provide a subspecies characteristic about the pathogen, amplifying the nucleic acid segments to produce at least one drill-down amplification product and determining the base composition signature of the drill-down amplification product wherein the base composition signature provides a subspecies characteristic about the pathogen.
  • The present invention is also directed to methods of pharmacogenetic analysis by obtaining a sample of genomic DNA from an individual, selecting a segment of the genomic DNA which provides pharmacogenetic information, using at least one pair of intelligent primers to produce an amplification product which comprises the segment of genomic DNA and determining the base composition signature of the amplification product, wherein the base composition signature provides pharmacogenetic information about said individual.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIGS. 1A-1H and FIG. 2 are consensus diagrams that show examples of conserved regions from 16S rRNA (FIG. 1A-1, 1A-2, 1A-3, 1A-4, and 1A-5), 23S rRNA (3′-half, FIG. 1B, 1C, and 1D; 5′-half, FIG. 1E-F), 23S rRNA Domain I (FIG. 1G), 23S rRNA Domain IV (FIG. 1H) and 16S rRNA Domain III (FIG. 2) which are suitable for use in the present invention. Lines with arrows are examples of regions to which intelligent primer pairs for PCR are designed. The label for each primer pair represents the starting and ending base number of the amplified region on the consensus diagram. Bases in capital letters are greater than 95% conserved; bases in lower case letters are 90-95% conserved, filled circles are 80-90% conserved; and open circles are less than 80% conserved. The label for each primer pair represents the starting and ending base number of the amplified region on the consensus diagram. The nucleotide sequence of the 16S rRNA consensus sequence is SEQ ID NO:3 and the nucleotide sequence of the 23S rRNA consensus sequence is SEQ ID NO:4.
  • FIG. 2 shows a typical primer amplified region from the 16S rRNA Domain III shown in FIG. 1A-1.
  • FIG. 3 is a schematic diagram showing conserved regions in RNase P. Bases in capital letters are greater than 90% conserved; bases in lower case letters are 80-90% conserved; filled circles designate bases which are 70-80% conserved; and open circles designate bases that are less than 70% conserved.
  • FIG. 4 is a schematic diagram of base composition signature determination using nucleotide analog “tags” to determine base composition signatures.
  • FIG. 5 shows the deconvoluted mass spectra of a Bacillus anthracis region with and without the mass tag phosphorothioate A (A*). The two spectra differ in that the measured molecular weight of the mass tag-containing sequence is greater than the unmodified sequence.
  • FIG. 6 shows base composition signature (BCS) spectra from PCR products from Staphylococcus aureus (S. aureus 16S1337F) and Bacillus anthracis (B. anthr. 16S1337F), amplified using the same primers. The two strands differ by only two (AT-->CG) substitutions and are clearly distinguished on the basis of their BCS.
  • FIG. 7 shows that a single difference between two sequences (A14 in B. anthracis vs. A15 in B. cereus) can be easily detected using ESI-TOF mass spectrometry.
  • FIG. 8 is an ESI-TOF of Bacillus anthracis spore coat protein sspE 56 mer plus calibrant. The signals unambiguously identify B. anthracis versus other Bacillus species.
  • FIG. 9 is an ESI-TOF of a B. anthracis synthetic 16S1228 duplex (reverse and forward strands). The technique easily distinguishes between the forward and reverse strands.
  • FIG. 10 is an ESI-FTICR-MS of a synthetic B. anthracis 16S1337 46 base pair duplex.
  • FIG. 11 is an ESI-TOF-MS of a 56 mer oligonucleotide (3 scans) from the B. anthracis saspB gene with an internal mass standard. The internal mass standards are designated by asterisks.
  • FIG. 12 is an ESI-TOF-MS of an internal standard with 5 mM TBA-TFA buffer showing that charge stripping with tributylammonium trifluoroacetate reduces the most abundant charge state from [M−8H+]8− to [M−3H+]3−.
  • FIG. 13 is a portion of a secondary structure defining database according to one embodiment of the present invention, where two examples of selected sequences are displayed graphically thereunder.
  • FIG. 14 is a three dimensional graph demonstrating the grouping of sample molecular weight according to species.
  • FIG. 15 is a three dimensional graph demonstrating the grouping of sample molecular weights according to species of virus and mammal infected.
  • FIG. 16 is a three dimensional graph demonstrating the grouping of sample molecular weights according to species of virus, and animal-origin of infectious agent.
  • FIG. 17 is a figure depicting how the triangulation method of the present invention provides for the identification of an unknown bioagent without prior knowledge of the unknown agent. The use of different primer sets to distinguish and identify the unknown is also depicted as primer sets I, II and III within this figure. A three dimensional graph depicts all of bioagent space (170), including the unknown bioagent, which after use of primer set I (171) according to a method according to the present invention further differentiates and classifies bioagents according to major classifications (176) which, upon further analysis using primer set II (172) differentiates the unknown agent (177) from other, known agents (173) and finally, the use of a third primer set (175) further specifies subgroups within the family of the unknown (174).
  • FIG. 18 shows a representative base composition probability cloud for a region of the RNA polymerase B gene from a cluster of enterobacteria. The dark spheres represent the actual base composition of the organisms. The lighter spheres represent the transitions among base compositions observed in different isolates of the same species of organism.
  • FIG. 19 shows resolution of enterobacteriae members with primers targeting RNA polymerase B (rpoB). A single pair of primers targeting a hyper-variable region within rpoB was sufficient to resolve most members of this group at the genus level (Salmonella from Escherichia from Yersinia) as well as the species/strain level (E. coli K12 from O157). All organisms with the exception of Y. pestis were tested in the lab and the measured base counts (shown with arrow) matched the predictions in every case.
  • FIG. 20 shows detection of S. aureus in blood. Spectra on the right indicate signals corresponding to S. aureus detection in spiked wells A1 and A4 with no detection in control wells A2 and A3.
  • FIG. 21 shows a representative base composition distribution of human adenovirus strain types for a single primer pair region on the hexon gene. The circles represent different adenovirus sequences in our database that were used for primer design. Measurement of masses and base counts for each of the unknown samples A, B, C and D matched one or more of the known groups of adenoviruses.
  • FIG. 22 shows a representative broad range survey/drill-down process as applied to emm-typing of streptococcus pyogenes (Group A Streptococcus: GAS). Genetic material is extracted (201) and amplified using broad range survey primers (202). The amplification products are analyzed (203) to determine the presence and identity of bioagents at the species level. If Streptococcus pyogenes is detected (204), the emm-typing “drill-down” primers are used to reexamine the extract to identify the emm-type of the sample (205). Different sets of drill down primers can be employed to determine a subspecies characteristic for various strains of various bioagents (206).
  • FIG. 23 shows a representative base composition distribution of bioagents detected in throat swabs from military personnel using a broad range primer pair directed to 16S rRNA.
  • FIG. 24 shows a representative deconvoluted ESI-FTICR spectra of the PCR products produced by the gtr primer for samples 12 (top) and 10 (bottom) corresponding to emm types 3 and 6, respectively. Accurate mass measurements were obtained by using an internal mass standard and post-calibrating each spectrum; the experimental mass measurement uncertainty on each strand is +0.035 Daltons (1 ppm). Unambiguous base compositions of the amplicons were determined by calculating all putative base compositions of each stand within the measured mass (and measured mass uncertainty) and selecting complementary pairs within the mass measurement uncertainty. In all cases there was only one base composition within 25 ppm. The measured mass difference of 15.985 Da between the strands shown on the left is in excellent agreement with the theoretical mass difference of 15.994 Da expected for an A to G substitution.
  • FIG. 25 shows representative results of the base composition analysis on throat swab samples using the six primer pairs, 5′-emm gene sequencing and the MLST gene sequencing method of the present invention for an outbreak of Streptococcus pyogenes (group A streptococcus; GAS) at a military training camp.
  • FIG. 26 shows: a) a representative ESI-FTICR mass spectrum of a restriction digest of a 986 bp region of the 16S ribosomal gene from E. coli K12 digested with a mixture of BstNI, BsmFI, BfaI, and NcoI; b) a deconvoluted representation (neutral mass) of the above spectrum showing the base compositions derived from accurate mass measurements of each fragment; and c) a representative reconstructed restriction map showing complete base composition coverage for nucleotides 1-856. The NcoI did not cut.
  • FIG. 27 shows a representative base composition distribution of poxviruses for a single primer pair region on the DNA-dependent polymerase B gene (DdDpB). The spheres represent different poxvirus sequences that were used for primer design.
  • DESCRIPTION OF EMBODIMENTS A. Introduction
  • The present invention provides, inter alia, methods for detection and identification of bioagents in an unbiased manner using “bioagent identifying amplicons.” “Intelligent primers” are selected to hybridize to conserved sequence regions of nucleic acids derived from a bioagent and which bracket variable sequence regions to yield a bioagent identifying amplicon which can be amplified and which is amenable to molecular mass determination. The molecular mass then provides a means to uniquely identify the bioagent without a requirement for prior knowledge of the possible identity of the bioagent. The molecular mass or corresponding “base composition signature” (BCS) of the amplification product is then matched against a database of molecular masses or base composition signatures. Furthermore, the method can be applied to rapid parallel “multiplex” analyses, the results of which can be employed in a triangulation identification strategy. The present method provides rapid throughput and does not require nucleic acid sequencing of the amplified target sequence for bioagent detection and identification.
  • B. Bioagents
  • In the context of this invention, a “bioagent” is any organism, cell, or virus, living or dead, or a nucleic acid derived from such an organism, cell or virus. Examples of bioagents include, but are not limited, to cells, including but not limited to, cells, including but not limited to human clinical samples, bacterial cells and other pathogens) viruses, fungi, and protists, parasites, and pathogenicity markers (including but not limited to: pathogenicity islands, antibiotic resistance genes, virulence factors, toxin genes and other bioregulating compounds). Samples may be alive or dead or in a vegetative state (for example, vegetative bacteria or spores) and may be encapsulated or bioengineered. In the context of this invention, a “pathogen” is a bioagent which causes a disease or disorder.
  • Despite enormous biological diversity, all forms of life on earth share sets of essential, common features in their genomes. Bacteria, for example have highly conserved sequences in a variety of locations on their genomes. Most notable is the universally conserved region of the ribosome. But there are also conserved elements in other non-coding RNAs, including RNAse P and the signal recognition particle (SRP) among others. Bacteria have a common set of absolutely required genes. About 250 genes are present in all bacterial species (Proc. Natl. Acad. Sci. U.S.A., 1996, 93, 10268; Science, 1995, 270, 397), including tiny genomes like Mycoplasma, Ureaplasma and Rickettsia. These genes encode proteins involved in translation, replication, recombination and repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, energy generation, uptake, secretion and the like. Examples of these proteins are DNA polymerase III beta, elongation factor TU, heat shock protein groEL, RNA polymerase beta, phosphoglycerate kinase, NADH dehydrogenase, DNA ligase, DNA topoisomerase and elongation factor G. Operons can also be targeted using the present method. One example of an operon is the bfp operon from enteropathogenic E. coli. Multiple core chromosomal genes can be used to classify bacteria at a genus or genus species level to determine if an organism has threat potential. The methods can also be used to detect pathogenicity markers (plasmid or chromosomal) and antibiotic resistance genes to confirm the threat potential of an organism and to direct countermeasures.
  • C. Selection of “Bioagent Identifying Amplicons”
  • Since genetic data provide the underlying basis for identification of bioagents by the methods of the present invention, it is necessary to select segments of nucleic acids which ideally provide enough variability to distinguish each individual bioagent and whose molecular mass is amenable to molecular mass determination. In one embodiment of the present invention, at least one polynucleotide segment is amplified to facilitate detection and analysis in the process of identifying the bioagent. Thus, the nucleic acid segments which provide enough variability to distinguish each individual bioagent and whose molecular masses are amenable to molecular mass determination are herein described as “bioagent identifying amplicons.” The term “amplicon” as used herein, refers to a segment of a polynucleotide which is amplified in an amplification reaction.
  • As used herein, “intelligent primers” are primers that are designed to bind to highly conserved sequence regions that flank an intervening variable region and yield amplification products which ideally provide enough variability to distinguish each individual bioagent, and which are amenable to molecular mass analysis. By the term “highly conserved,” it is meant that the sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity. The molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region. Thus design of intelligent primers requires selection of a variable region with appropriate variability to resolve the identity of a given bioagent.
  • In one embodiment, the bioagent identifying amplicon is a portion of a ribosomal RNA (rRNA) gene sequence. With the complete sequences of many of the smallest microbial genomes now available, it is possible to identify a set of genes that defines “minimal life” and identify composition signatures that uniquely identify each gene and organism. Genes that encode core life functions such as DNA replication, transcription, ribosome structure, translation, and transport are distributed broadly in the bacterial genome and are suitable regions for selection of bioagent identifying amplicons. Ribosomal RNA (rRNA) genes comprise regions that provide useful base composition signatures. Like many genes involved in core life functions, rRNA genes contain sequences that are extraordinarily conserved across bacterial domains interspersed with regions of high variability that are more specific to each species. The variable regions can be utilized to build a database of base composition signatures. The strategy involves creating a structure-based alignment of sequences of the small (16S) and the large (23S) subunits of the rRNA genes. For example, there are currently over 13,000 sequences in the ribosomal RNA database that has been created and maintained by Robin Gutell, University of Texas at Austin, and is publicly available on the Institute for Cellular and Molecular Biology web page on the world wide web of the Internet at, for example, “rna.icmb.utexas.edu/.” There is also a publicly available rRNA database created and maintained by the University of Antwerp, Belgium on the world wide web of the Internet at, for example, “rrna.uia.ac.be.”
  • These databases have been analyzed to determine regions that are useful as bioagent identifying amplicons. The characteristics of such regions include: a) between about 80 and 100%, or greater than about 95% identity among species of the particular bioagent of interest, of upstream and downstream nucleotide sequences which serve as sequence amplification primer sites; b) an intervening variable region which exhibits no greater than about 5% identity among species; and c) a separation of between about 30 and 1000 nucleotides, or no more than about 50-250 nucleotides, or no more than about 60-100 nucleotides, between the conserved regions.
  • As a non-limiting example, for identification of Bacillus species, the conserved sequence regions of the chosen bioagent identifying amplicon must be highly conserved among all Bacillus species while the variable region of the bioagent identifying amplicon is sufficiently variable such that the molecular masses of the amplification products of all species of Bacillus are distinguishable.
  • Bioagent identifying amplicons amenable to molecular mass determination are either of a length, size or mass compatible with the particular mode of molecular mass determination or compatible with a means of providing a predictable fragmentation pattern in order to obtain predictable fragments of a length compatible with the particular mode of molecular mass determination. Such means of providing a predictable fragmentation pattern of an amplification product include, but are not limited to, cleavage with restriction enzymes or cleavage primers, for example.
  • Identification of bioagents can be accomplished at different levels using intelligent primers suited to resolution of each individual level of identification. “Broad range survey” intelligent primers are designed with the objective of identifying a bioagent as a member of a particular division of bioagents. A “bioagent division” is defined as group of bioagents above the species level and includes but is not limited to: orders, families, classes, clades, genera or other such groupings of bioagents above the species level. As a non-limiting example, members of the Bacillus/Clostridia group or gamma-proteobacteria group may be identified as such by employing broad range survey intelligent primers such as primers which target 16S or 23S ribosomal RNA.
  • In some embodiments, broad range survey intelligent primers are capable of identification of bioagents at the species level. One main advantage of the detection methods of the present invention is that the broad range survey intelligent primers need not be specific for a particular bacterial species, or even genus, such as Bacillus or Streptomyces. Instead, the primers recognize highly conserved regions across hundreds of bacterial species including, but not limited to, the species described herein. Thus, the same broad range survey intelligent primer pair can be used to identify any desired bacterium because it will bind to the conserved regions that flank a variable region specific to a single species, or common to several bacterial species, allowing unbiased nucleic acid amplification of the intervening sequence and determination of its molecular weight and base composition. For example, the 16S971-1062, 16S1228-1310 and 16S1100-1188 regions are 98-99% conserved in about 900 species of bacteria (16S=16S rRNA, numbers indicate nucleotide position). In one embodiment of the present invention, primers used in the present method bind to one or more of these regions or portions thereof.
  • Due to their overall conservation, the flanking rRNA primer sequences serve as good intelligent primer binding sites to amplify the nucleic acid region of interest for most, if not all, bacterial species. The intervening region between the sets of primers varies in length and/or composition, and thus provides a unique base composition signature. Examples of intelligent primers that amplify regions of the 16S and 23S rRNA are shown in FIGS. 1A-1H. A typical primer amplified region in 16S rRNA is shown in FIG. 2. The arrows represent primers that bind to highly conserved regions which flank a variable region in 16S rRNA domain III. The amplified region is the stem-loop structure under “1100-1188.” It is advantageous to design the broad range survey intelligent primers to minimize the number of primers required for the analysis, and to allow detection of multiple members of a bioagent division using a single pair of primers. The advantage of using broad range survey intelligent primers is that once a bioagent is broadly identified, the process of further identification at species and sub-species levels is facilitated by directing the choice of additional intelligent primers.
  • “Division-wide” intelligent primers are designed with an objective of identifying a bioagent at the species level. As a non-limiting example, a Bacillus anthracis, Bacillus cereus and Bacillus thuringiensis can be distinguished from each other using division-wide intelligent primers. Division-wide intelligent primers are not always required for identification at the species level because broad range survey intelligent primers may provide sufficient identification resolution to accomplishing this identification objective.
  • “Drill-down” intelligent primers are designed with an objective of identifying a sub-species characteristic of a bioagent. A “sub-species characteristic” is defined as a property imparted to a bioagent at the sub-species level of identification as a result of the presence or absence of a particular segment of nucleic acid. Such sub-species characteristics include, but are not limited to, strains, sub-types, pathogenicity markers such as antibiotic resistance genes, pathogenicity islands, toxin genes and virulence factors. Identification of such sub-species characteristics is often critical for determining proper clinical treatment of pathogen infections.
  • Chemical Modifications of Intelligent Primers
  • Ideally, intelligent primer hybridization sites are highly conserved in order to facilitate the hybridization of the primer. In cases where primer hybridization is less efficient due to lower levels of conservation of sequence, intelligent primers can be chemically modified to improve the efficiency of hybridization.
  • For example, because any variation (due to codon wobble in the 3rd position) in these conserved regions among species is likely to occur in the third position of a DNA triplet, oligonucleotide primers can be designed such that the nucleotide corresponding to this position is a base which can bind to more than one nucleotide, referred to herein as a “universal base.” For example, under this “wobble” pairing, inosine (I) binds to U, C or A; guanine (G) binds to U or C, and uridine (U) binds to U or C. Other examples of universal bases include nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et al., Nucleosides and Nucleotides, 1995, 14, 1001-1003), the degenerate nucleotides dP or dK (Hill et al.), an acyclic nucleoside analog containing 5-nitroindazole (Van Aerschot et al., Nucleosides and Nucleotides, 1995, 14, 1053-1056) or the purine analog 1-(2-deoxy-β-D-ribofuranosyl)-imidazole-4-carboxamide (Sala et al., Nucl. Acids Res., 1996, 24, 3302-3306).
  • In another embodiment of the invention, to compensate for the somewhat weaker binding by the “wobble” base, the oligonucleotide primers are designed such that the first and second positions of each triplet are occupied by nucleotide analogs which bind with greater affinity than the unmodified nucleotide. Examples of these analogs include, but are not limited to, 2,6-diaminopurine which binds to thymine, propyne T which binds to adenine and propyne C and phenoxazines, including G-clamp, which binds to G. Propynylated pyrimidines are described in U.S. Pat. Nos. 5,645,985, 5,830,653 and 5,484,908, each of which is commonly owned and incorporated herein by reference in its entirety. Propynylated primers are claimed in U.S. Ser. No. 10/294,203 which is also commonly owned and incorporated herein by reference in entirety. Phenoxazines are described in U.S. Pat. Nos. 5,502,177, 5,763,588, and 6,005,096, each of which is incorporated herein by reference in its entirety. G-clamps are described in U.S. Pat. Nos. 6,007,992 and 6,028,183, each of which is incorporated herein by reference in its entirety.
  • D. Characterization of Bioagent Identifying Amplicons
  • A theoretically ideal bioagent detector would identify, quantify, and report the complete nucleic acid sequence of every bioagent that reached the sensor. The complete sequence of the nucleic acid component of a pathogen would provide all relevant information about the threat, including its identity and the presence of drug-resistance or pathogenicity markers. This ideal has not yet been achieved. However, the present invention provides a straightforward strategy for obtaining information with the same practical value based on analysis of bioagent identifying amplicons by molecular mass determination.
  • In some cases, a molecular mass of a given bioagent identifying amplicon alone does not provide enough resolution to unambiguously identify a given bioagent. For example, the molecular mass of the bioagent identifying amplicon obtained using the intelligent primer pair “16S971” would be 55622 Da for both E. coli and Salmonella typhimurium. However, if additional intelligent primers are employed to analyze additional bioagent identifying amplicons, a “triangulation identification” process is enabled. For example, the “16S1100” intelligent primer pair yields molecular masses of 55009 and 55005 Da for E. coli and Salmonella typhimurium, respectively. Furthermore, the “23S855” intelligent primer pair yields molecular masses of 42656 and 42698 Da for E. coli and Salmonella typhimurium, respectively. In this basic example, the second and third intelligent primer pairs provided the additional “fingerprinting” capability or resolution to distinguish between the two bioagents.
  • In another embodiment, the triangulation identification process is pursued by measuring signals from a plurality of bioagent identifying amplicons selected within multiple core genes. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. In this process, after identification of multiple core genes, alignments are created from nucleic acid sequence databases. The alignments are then analyzed for regions of conservation and variation, and bioagent identifying amplicons are selected to distinguish bioagents based on specific genomic differences. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.
  • The triangulation identification process can be pursued by characterization of bioagent identifying amplicons in a massively parallel fashion using the polymerase chain reaction (PCR), such as multiplex PCR, and mass spectrometric (MS) methods. Sufficient quantities of nucleic acids should be present for detection of bioagents by MS. A wide variety of techniques for preparing large amounts of purified nucleic acids or fragments thereof are well known to those of skill in the art. PCR requires one or more pairs of oligonucleotide primers that bind to regions which flank the target sequence(s) to be amplified. These primers prime synthesis of a different strand of DNA, with synthesis occurring in the direction of one primer towards the other primer. The primers, DNA to be amplified, a thermostable DNA polymerase (e.g. Taq polymerase), the four deoxynucleotide triphosphates, and a buffer are combined to initiate DNA synthesis. The solution is denatured by heating, then cooled to allow annealing of newly added primer, followed by another round of DNA synthesis. This process is typically repeated for about 30 cycles, resulting in amplification of the target sequence.
  • Although the use of PCR is suitable, other nucleic acid amplification techniques may also be used, including ligase chain reaction (LCR) and strand displacement amplification (SDA). The high-resolution MS technique allows separation of bioagent spectral lines from background spectral lines in highly cluttered environments.
  • In another embodiment, the detection scheme for the PCR products generated from the bioagent(s) incorporates at least three features. First, the technique simultaneously detects and differentiates multiple (generally about 6-10) PCR products. Second, the technique provides a molecular mass that uniquely identifies the bioagent from the possible primer sites. Finally, the detection technique is rapid, allowing multiple PCR reactions to be run in parallel.
  • E. Mass Spectrometric Characterization of Bioagent Identifying Amplicons
  • Mass spectrometry (MS)-based detection of PCR products provides a means for determination of BCS which has several advantages. MS is intrinsically a parallel detection scheme without the need for radioactive or fluorescent labels, since every amplification product is identified by its molecular mass. The current state of the art in mass spectrometry is such that less than femtomole quantities of material can be readily analyzed to afford information about the molecular contents of the sample. An accurate assessment of the molecular mass of the material can be quickly obtained, irrespective of whether the molecular weight of the sample is several hundred, or in excess of one hundred thousand atomic mass units (amu) or Daltons. Intact molecular ions can be generated from amplification products using one of a variety of ionization techniques to convert the sample to gas phase. These ionization methods include, but are not limited to, electrospray ionization (ES), matrix-assisted laser desorption ionization (MALDI) and fast atom bombardment (FAB). For example, MALDI of nucleic acids, along with examples of matrices for use in MALDI of nucleic acids, are described in WO 98/54751 (Genetrace, Inc.).
  • In some embodiments, large DNAs and RNAs, or large amplification products therefrom, can be digested with restriction endonucleases prior to ionization. Thus, for example, an amplification product that was 10 kDa could be digested with a series of restriction endonucleases to produce a panel of, for example, 100 Da fragments. Restriction endonucleases and their sites of action are well known to the skilled artisan. In this manner, mass spectrometry can be performed for the purposes of restriction mapping.
  • Upon ionization, several peaks are observed from one sample due to the formation of ions with different charges. Averaging the multiple readings of molecular mass obtained from a single mass spectrum affords an estimate of molecular mass of the bioagent. Electrospray ionization mass spectrometry (ESI-MS) is particularly useful for very high molecular weight polymers such as proteins and nucleic acids having molecular weights greater than 10 kDa, since it yields a distribution of multiply-charged molecules of the sample without causing a significant amount of fragmentation.
  • The mass detectors used in the methods of the present invention include, but are not limited to, Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), ion trap, quadrupole, magnetic sector, time of flight (TOF), Q-TOF, and triple quadrupole.
  • In general, the mass spectrometric techniques which can be used in the present invention include, but are not limited to, tandem mass spectrometry, infrared multiphoton dissociation and pyrolytic gas chromatography mass spectrometry (PGC-MS). In one embodiment of the invention, the bioagent detection system operates continually in bioagent detection mode using pyrolytic GC-MS without PCR for rapid detection of increases in biomass (for example, increases in fecal contamination of drinking water or of germ warfare agents). To achieve minimal latency, a continuous sample stream flows directly into the PGC-MS combustion chamber. When an increase in biomass is detected, a PCR process is automatically initiated. Bioagent presence produces elevated levels of large molecular fragments from, for example, about 100-7,000 Da which are observed in the PGC-MS spectrum. The observed mass spectrum is compared to a threshold level and when levels of biomass are determined to exceed a predetermined threshold, the bioagent classification process described hereinabove (combining PCR and MS, such as FT-ICR MS) is initiated. Optionally, alarms or other processes (halting ventilation flow, physical isolation) are also initiated by this detected biomass level.
  • The accurate measurement of molecular mass for large DNAs is limited by the adduction of cations from the PCR reaction to each strand, resolution of the isotopic peaks from natural abundance 13C and 15N isotopes, and assignment of the charge state for any ion. The cations are removed by in-line dialysis using a flow-through chip that brings the solution containing the PCR products into contact with a solution containing ammonium acetate in the presence of an electric field gradient orthogonal to the flow. The latter two problems are addressed by operating with a resolving power of >100,000 and by incorporating isotopically depleted nucleotide triphosphates into the DNA. The resolving power of the instrument is also a consideration. At a resolving power of 10,000, the modeled signal from the [M−14H+]14− charge state of an 84 mer PCR product is poorly characterized and assignment of the charge state or exact mass is impossible. At a resolving power of 33,000, the peaks from the individual isotopic components are visible. At a resolving power of 100,000, the isotopic peaks are resolved to the baseline and assignment of the charge state for the ion is straightforward. The [13C,15N]-depleted triphosphates are obtained, for example, by growing microorganisms on depleted media and harvesting the nucleotides (Batey et al., Nucl. Acids Res., 1992, 20, 4515-4523).
  • While mass measurements of intact nucleic acid regions are believed to be adequate to determine most bioagents, tandem mass spectrometry (MSn) techniques may provide more definitive information pertaining to molecular identity or sequence. Tandem MS involves the coupled use of two or more stages of mass analysis where both the separation and detection steps are based on mass spectrometry. The first stage is used to select an ion or component of a sample from which further structural information is to be obtained. The selected ion is then fragmented using, e.g., blackbody irradiation, infrared multiphoton dissociation, or collisional activation. For example, ions generated by electrospray ionization (ESI) can be fragmented using IR multiphoton dissociation. This activation leads to dissociation of glycosidic bonds and the phosphate backbone, producing two series of fragment ions, called the w-series (having an intact 3′ terminus and a 5′ phosphate following internal cleavage) and the α-Base series (having an intact 5′ terminus and a 3′ furan).
  • The second stage of mass analysis is then used to detect and measure the mass of these resulting fragments of product ions. Such ion selection followed by fragmentation routines can be performed multiple times so as to essentially completely dissect the molecular sequence of a sample.
  • If there are two or more targets of similar molecular mass, or if a single amplification reaction results in a product which has the same mass as two or more bioagent reference standards, they can be distinguished by using mass-modifying “tags.” In this embodiment of the invention, a nucleotide analog or “tag” is incorporated during amplification (e.g., a 5-(trifluoromethyl) deoxythymidine triphosphate) which has a different molecular weight than the unmodified base so as to improve distinction of masses. Such tags are described in, for example, PCT WO97/33000, which is incorporated herein by reference in its entirety. This further limits the number of possible base compositions consistent with any mass. For example, 5-(trifluoromethyl)deoxythymidine triphosphate can be used in place of dTTP in a separate nucleic acid amplification reaction. Measurement of the mass shift between a conventional amplification product and the tagged product is used to quantitate the number of thymidine nucleotides in each of the single strands. Because the strands are complementary, the number of adenosine nucleotides in each strand is also determined.
  • In another amplification reaction, the number of G and C residues in each strand is determined using, for example, the cytidine analog 5-methylcytosine (5-meC) or propyne C. The combination of the A/T reaction and G/C reaction, followed by molecular weight determination, provides a unique base composition. This method is summarized in FIG. 4 and Table 1.
  • TABLE 1
    Total Total
    Total Base Base base base
    Double Single mass info info comp. comp.
    strand strand this this other Top Bottom
    Mass tag sequence Sequence strand strand strand strand strand
    T*mass T*ACGT*ACGT* T*ACGT*ACGT* 3x 3T 3A 3T 3A
    (T*-T) = x AT*GCAT*GCA 2A 2T
    2C 2G
    2G 2C
    AT*GCAT*GCA 2x 2T 2A
    C*mass TAC*GTAC*GT TAC*GTAC*GT 2x 2C 2G
    (C*-C) = y ATGC*ATGC*A
    ATGC*ATGC*A 2x 2C 2G
  • The mass tag phosphorothioate A (A*) was used to distinguish a Bacillus anthracis cluster. The B. anthracis (A14G9C14T9) had an average MW of 14072.26, and the B. anthracis (A1A*13G9C14T9) had an average molecular weight of 14281.11 and the phosphorothioate A had an average molecular weight of +16.06 as determined by ESI-TOF MS. The deconvoluted spectra are shown in FIG. 5.
  • In another example, assume the measured molecular masses of each strand are 30,000.115Da and 31,000.115 Da respectively, and the measured number of dT and dA residues are (30,28) and (28,30). If the molecular mass is accurate to 100 ppm, there are 7 possible combinations of dG+dC possible for each strand. However, if the measured molecular mass is accurate to 10 ppm, there are only 2 combinations of dG+dC, and at 1 ppm accuracy there is only one possible base composition for each strand.
  • Signals from the mass spectrometer may be input to a maximum-likelihood detection and classification algorithm such as is widely used in radar signal processing. The detection processing uses matched filtering of BCS observed in mass-basecount space and allows for detection and subtraction of signatures from known, harmless organisms, and for detection of unknown bioagent threats. Comparison of newly observed bioagents to known bioagents is also possible, for estimation of threat level, by comparing their BCS to those of known organisms and to known forms of pathogenicity enhancement, such as insertion of antibiotic resistance genes or toxin genes.
  • Processing may end with a Bayesian classifier using log likelihood ratios developed from the observed signals and average background levels. The program emphasizes performance predictions culminating in probability-of-detection versus probability-of-false-alarm plots for conditions involving complex backgrounds of naturally occurring organisms and environmental contaminants. Matched filters consist of a priori expectations of signal values given the set of primers used for each of the bioagents. A genomic sequence database (e.g. GenBank) is used to define the mass basecount matched filters. The database contains known threat agents and benign background organisms. The latter is used to estimate and subtract the signature produced by the background organisms. A maximum likelihood detection of known background organisms is implemented using matched filters and a running-sum estimate of the noise covariance. Background signal strengths are estimated and used along with the matched filters to form signatures which are then subtracted. The maximum likelihood process is applied to this “cleaned up” data in a similar manner employing matched filters for the organisms and a running-sum estimate of the noise-covariance for the cleaned up data.
  • F. Base Composition Signatures as Indices of Bioagent Identifying Amplicons
  • Although the molecular mass of amplification products obtained using intelligent primers provides a means for identification of bioagents, conversion of molecular mass data to a base composition signature is useful for certain analyses. As used herein, a “base composition signature” (BCS) is the exact base composition determined from the molecular mass of a bioagent identifying amplicon. In one embodiment, a BCS provides an index of a specific gene in a specific organism.
  • Base compositions, like sequences, vary slightly from isolate to isolate within species. It is possible to manage this diversity by building “base composition probability clouds” around the composition constraints for each species. This permits identification of organisms in a fashion similar to sequence analysis. A “pseudo four-dimensional plot” can be used to visualize the concept of base composition probability clouds (FIG. 18). Optimal primer design requires optimal choice of bioagent identifying amplicons and maximizes the separation between the base composition signatures of individual bioagents. Areas where clouds overlap indicate regions that may result in a misclassification, a problem which is overcome by selecting primers that provide information from different bioagent identifying amplicons, ideally maximizing the separation of base compositions. Thus, one aspect of the utility of an analysis of base composition probability clouds is that it provides a means for screening primer sets in order to avoid potential misclassifications of BCS and bioagent identity. Another aspect of the utility of base composition probability clouds is that they provide a means for predicting the identity of a bioagent whose exact measured BCS was not previously observed and/or indexed in a BCS database due to evolutionary transitions in its nucleic acid sequence.
  • It is important to note that, in contrast to probe-based techniques, mass spectrometry determination of base composition does not require prior knowledge of the composition in order to make the measurement, only to interpret the results. In this regard, the present invention provides bioagent classifying information similar to DNA sequencing and phylogenetic analysis at a level sufficient to detect and identify a given bioagent. Furthermore, the process of determination of a previously unknown BCS for a given bioagent (for example, in a case where sequence information is unavailable) has downstream utility by providing additional bioagent indexing information with which to populate BCS databases. The process of future bioagent identification is thus greatly improved as more BCS indexes become available in the BCS databases.
  • Another embodiment of the present invention is a method of surveying bioagent samples that enables detection and identification of all bacteria for which sequence information is available using a set of twelve broad-range intelligent PCR primers. Six of the twelve primers are “broad range survey primers” herein defined as primers targeted to broad divisions of bacteria (for example, the Bacillus/Clostridia group or gamma-proteobacteria). The other six primers of the group of twelve primers are “division-wide” primers herein defined as primers which provide more focused coverage and higher resolution. This method enables identification of nearly 100% of known bacteria at the species level. A further example of this embodiment of the present invention is a method herein designated “survey/drill-down” wherein a subspecies characteristic for detected bioagents is obtained using additional primers. Examples of such a subspecies characteristic include but are not limited to: antibiotic resistance, pathogenicity island, virulence factor, strain type, sub-species type, and clade group. Using the survey/drill-down method, bioagent detection, confirmation and a subspecies characteristic can be provided within hours. Moreover, the survey/drill-down method can be focused to identify bioengineering events such as the insertion of a toxin gene into a bacterial species that does not normally make the toxin.
  • G. Fields of Application of the Present Invention
  • The present methods allow extremely rapid and accurate detection and identification of bioagents compared to existing methods. Furthermore, this rapid detection and identification is possible even when sample material is impure. The methods leverage ongoing biomedical research in virulence, pathogenicity, drug resistance and genome sequencing into a method which provides greatly improved sensitivity, specificity and reliability compared to existing methods, with lower rates of false positives. Thus, the methods are useful in a wide variety of fields, including, but not limited to, those fields discussed below.
  • 1. Identification of Pathogens in Humans and Animals
  • In other embodiments of the invention, the methods disclosed herein can identify infectious agents in biological samples. At least a first biological sample containing at least a first unidentified infectious agent is obtained. An identification analysis is carried out on the sample, whereby the first infectious agent in the first biological sample is identified. More particularly, a method of identifying an infectious agent in a biological entity is provided. An identification analysis is carried out on a first biological sample obtained from the biological entity, whereby at least one infectious agent in the biological sample from the biological entity is identified. The obtaining and the performing steps are, optionally, repeated on at least one additional biological sample from the biological entity.
  • The present invention also provides methods of identifying an infectious agent that is potentially the cause of a health condition in a biological entity. An identification analysis is carried out on a first test sample from a first infectious agent differentiating area of the biological entity, whereby at least one infectious agent is identified. The obtaining and the performing steps are, optionally, repeated on an additional infectious agent differentiating area of the biological entity.
  • Biological samples include, but are not limited to, hair, mucosa, skin, nail, blood, saliva, rectal, lung, stool, urine, breath, nasal, ocular sample, or the like. In some embodiments, one or more biological samples are analyzed by the methods described herein. The biological sample(s) contain at least a first unidentified infectious agent and may contain more than one infectious agent. The biological sample(s) are obtained from a biological entity. The biological sample can be obtained by a variety of manners such as by biopsy, swabbing, and the like. The biological samples may be obtained by a physician in a hospital or other health care environment. The physician may then perform the identification analysis or send the biological sample to a laboratory to carry out the analysis.
  • Biological entities include, but are not limited to, a mammal, a bird, or a reptile. The biological entity may be a cow, horse, dog, cat, or a primate. The biological entity can also be a human. The biological entity may be living or dead.
  • An infectious agent differentiating area is any area or location within a biological entity that can distinguish between a harmful versus normal health condition. An infectious agent differentiating area can be a region or area of the biological entity whereby an infectious agent is more likely to predominate from another region or area of the biological entity. For example, infectious agent differentiating areas may include the blood vessels of the heart (heart disease, coronary artery disease, etc.), particular portions of the digestive system (ulcers, Crohn's disease, etc.), liver (hepatitis infections), and the like. In some embodiments, one or more biological samples from a plurality of infectious agent differentiating areas is analyzed the methods described herein.
  • Infectious agents of the invention may potentially cause a health condition in a biological entity. Health conditions include any condition, syndrome, illness, disease, or the like, identified currently or in the future by medical personnel. Infectious agents include, but are not limited to, bacteria, viruses, parasites, fungi, and the like.
  • In other embodiments of the invention, the methods disclosed herein can be used to screen blood and other bodily fluids and tissues for pathogenic and non-pathogenic bacteria, viruses, parasites, fungi and the like. Animal samples, including but not limited to, blood and other bodily fluid and tissue samples, can be obtained from living animals, who are either known or not known to or suspected of having a disease, infection, or condition. Alternately, animal samples such as blood and other bodily fluid and tissue samples can be obtained from deceased animals. Blood samples can be further separated into plasma or cellular fractions and further screened as desired. Bodily fluids and tissues can be obtained from any part of the animal or human body. Animal samples can be obtained from, for example, mammals and humans.
  • Clinical samples are analyzed for disease causing bioagents and biowarfare pathogens simultaneously with detection of bioagents at levels as low as 100-1000 genomic copies in complex backgrounds with throughput of approximately 100-300 samples with simultaneous detection of bacteria and viruses. Such analyses provide additional value in probing bioagent genomes for unanticipated modifications. These analyses are carried out in reference labs, hospitals and the LRN laboratories of the public health system in a coordinated fashion, with the ability to report the results via a computer network to a common data-monitoring center in real time. Clonal propagation of specific infectious agents, as occurs in the epidemic outbreak of infectious disease, can be tracked with base composition signatures, analogous to the pulse field gel electrophoresis fingerprinting patterns used in tracking the spread of specific food pathogens in the Pulse Net system of the CDC (Swaminathan, B., et al., Emerging Infectious Diseases, 2001, 7, 382-389). The present invention provides a digital barcode in the form of a series of base composition signatures, the combination of which is unique for each known organism. This capability enables real-time infectious disease monitoring across broad geographic locations, which may be essential in a simultaneous outbreak or attack in different cities.
  • In other embodiments of the invention, the methods disclosed herein can be used for detecting the presence of pathogenic and non-pathogenic bacteria, viruses, parasites, fungi and the like in organ donors and/or in organs from donors. Such examination can result in the prevention of the transfer of, for example, viruses such as West Nile virus, hepatitis viruses, human immunodeficiency virus, and the like from a donor to a recipient via a transplanted organ. The methods disclosed herein can also be used for detection of host versus graft or graft versus host rejection issues related to organ donors by detecting the presence of particular antigens in either the graft or host known or suspected of causing such rejection. In particular, the bioagents in this regard are the antigens of the major histocompatibility complex, such as the HLA antigens. The present methods can also be used to detect and track emerging infectious diseases, such as West Nile virus infection, HIV-related diseases.
  • In other embodiments of the invention, the methods disclosed herein can be used for pharmacogenetic analysis and medical diagnosis including, but not limited to, cancer diagnosis based on mutations and polymorphisms, drug resistance and susceptibility testing, screening for and/or diagnosis of genetic diseases and conditions, and diagnosis of infectious diseases and conditions. In context of the present invention, pharmacogenetics is defined as the study of variability in drug response due to genetic factors. Pharmacogenetic investigations are often based on correlating patient outcome with variations in genes involved in the mode of action of a given drug. For example, receptor genes, or genes involved in metabolic pathways. The methods of the present invention provide a means to analyze the DNA of a patient to provide the basis for pharmacogenetic analysis.
  • The present method can also be used to detect single nucleotide polymorphisms (SNPs), or multiple nucleotide polymorphisms, rapidly and accurately. A SNP is defined as a single base pair site in the genome that is different from one individual to another. The difference can be expressed either as a deletion, an insertion or a substitution, and is frequently linked to a disease state. Because they occur every 100-1000 base pairs, SNPs are the most frequently bound type of genetic marker in the human genome.
  • For example, sickle cell anemia results from an A-T transition, which encodes a valine rather than a glutamic acid residue. Oligonucleotide primers may be designed such that they bind to sequences that flank a SNP site, followed by nucleotide amplification and mass determination of the amplified product. Because the molecular masses of the resulting product from an individual who does not have sickle cell anemia is different from that of the product from an individual who has the disease, the method can be used to distinguish the two individuals. Thus, the method can be used to detect any known SNP in an individual and thus diagnose or determine increased susceptibility to a disease or condition.
  • In one embodiment, blood is drawn from an individual and peripheral blood mononuclear cells (PBMC) are isolated and simultaneously tested, such as in a high-throughput screening method, for one or more SNPs using appropriate primers based on the known sequences which flank the SNP region. The National Center for Biotechnology Information maintains a publicly available database of SNPs on the world wide web of the Internet at, for example, “ncbi.nlm.nih.gov/SNP/.”
  • The method of the present invention can also be used for blood typing. The gene encoding A, B or O blood type can differ by four single nucleotide polymorphisms. If the gene contains the sequence CGTGGTGACCCTT (SEQ ID NO:5), antigen A results. If the gene contains the sequence CGTCGTCACCGCTA (SEQ ID NO:6) antigen B results. If the gene contains the sequence CGTGGT-ACCCCTT (SEQ ID NO:7), blood group 0 results (“-” indicates a deletion). These sequences can be distinguished by designing a single primer pair which flanks these regions, followed by amplification and mass determination.
  • The method of the present invention can also be used for detection and identification of blood-borne pathogens such as Staphylococcus aureus for example.
  • The method of the present invention can also be used for strain typing of respiratory pathogens in epidemic surveillance. Group A streptococci (GAS), or Streptococcus pyogenes, is one of the most consequential causes of respiratory infections because of prevalence and ability to cause disease with complications such as acute rheumatic fever and acute glomerulonephritis. GAS also causes infections of the skin (impetigo) and, in rare cases, invasive disease such as necrotizing fasciitis and toxic shock syndrome. Despite many decades of study, the underlying microbial ecology and natural selection that favors enhanced virulence and explosive GAS outbreaks is still poorly understood. The ability to detect GAS and multiple other pathogenic and non-pathogenic bacteria and viruses in patient samples would greatly facilitate our understanding of GAS epidemics. It is also essential to be able to follow the spread of virulent strains of GAS in populations and to distinguish virulent strains from less virulent or avirulent streptococci that colonize the nose and throat of asymptomatic individuals at a frequency ranging from 5-20% of the population (Bisno, A. L. (1995) in Principles and Practice of Infectious Diseases, eds. Mandell, G. L., Bennett, J. E. & Dolin, R. (Churchill Livingston, New York), Vol. 2, pp. 1786-1799). Molecular methods have been developed to type GAS based upon the sequence of the emm gene that encodes the M-protein virulence factor (Beall, B., Facklam, R. & Thompson, T. (1996) J. Clin. Micro. 34, 953-958; Beall, B., et al. (1997) J. Clin. Micro. 35, 1231-1235; Facklam, R., et al. (1999) Emerging Infectious Diseases 5, 247-253). Using this molecular classification, over 150 different emm-types are defined and correlated with phenotypic properties of thousands of GAS isolates (www.cdc.gov/ncidod/biotech/strep/strepindex.html) (Facklam, R., et al. (2002) Clinical Infectious Diseases 34, 28-38). Recently, a strategy known as Multi Locus Sequence Typing (MLST) was developed to follow the molecular Epidemiology of GAS (13). In MLST, internal fragments of seven housekeeping genes are amplified, sequenced, and compared to a database of previously studied isolates (www.test.mlst.net/).
  • The present invention enables an emm-typing process to be carried out directly from throat swabs for a large number of samples within 12 hours, allowing strain tracking of an ongoing epidemic, even if geographically dispersed, on a larger scale than ever before achievable.
  • In another embodiment, the present invention can be employed in the serotyping of viruses including, but not limited to, adenoviruses. Adenoviruses are DNA viruses that cause over 50% of febrile respiratory illnesses in military recruits. Human adenoviruses are divided into six major serogroups (A through F), each containing multiple strain types. Despite the prevalence of adenoviruses, there are no rapid methods for detecting and serotyping adenoviruses.
  • In another embodiment, the present invention can be employed in distinguishing between members of the Orthopoxvirus genus. Smallpox is caused by the Variola virus. Other members of the genus include Vaccinia, Monkeypox, Camelpox, and Cowpox. All are capable of infecting humans, thus, a method capable of identifying and distinguishing among members of the Orthopox genus is a worthwhile objective.
  • In another embodiment, the present invention can be employed in distinguishing between viral agents of viral hemorrhagic fevers (VHF). VHF agents include, but are not limited to, Filoviridae (Marburg virus and Ebola virus), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito viruses), Bunyaviridae (Crimean-Congo hemorrhagic fever virus (CCHFV), Rift Valley fever virus, and Hanta viruses), and Flaviviridae (yellow fever virus and dengue virus). Infections by VHF viruses are associated with a wide spectrum of clinical manifestations such as diarrhea, myalgia, cough, headache, pneumonia, encephalopathy, and hepatitis. Filoviruses, arenaviruses, and CCHFV are of particular relevance because they can be transmitted from human to human, thus causing epidemics with high mortality rates (Khan, A. S., et al., Am. J. Trop. Med. Hyg, 1997, 57, 519-525). In the absence of bleeding or organ manifestation, VHF is clinically difficult to diagnose, and the various etiologic agents can hardly be distinguished by clinical tests. Current approaches to PCR detection of these agents are time-consuming, as they include a separate cDNA synthesis step prior to PCR, agarose gel analysis of PCR products, and in some instances a second round of nested amplification or Southern hybridization. PCRs for different pathogens have to be run assay by assay due to differences in cycling conditions, which complicate broad-range testing in a short period. Moreover, post-PCR processing or nested PCR steps included in currently used assays increase the risk of false positive results due to carryover contamination (Kwok, S, and R. Higuchi, Nature 1989, 339, 237-238).
  • In another embodiment, the present invention, can be employed in the diagnosis of a plurality of etiologic agents of a disease. An “etiologic agent” is herein defined as a pathogen acting as the causative agent of a disease. Diseases may be caused by a plurality of etiologic agents. For example, recent studies have implicated both human herpesvirus 6 (HHV-6) and the obligate intracellular bacterium Chlamydia pneumoniae in the etiology of multiple sclerosis (Swanborg, R. H. Microbes and Infection 2002, 4, 1327-1333). The present invention can be applied to the identification of multiple etiologic agents of a disease by, for example, the use of broad range bacterial intelligent primers and division-wide primers (if necessary) for the identification of bacteria such as Chlamydia pneumoniae followed by primers directed to viral housekeeping genes for the identification of viruses such as HHV-6, for example.
  • In other embodiments of the invention, the methods disclosed herein can be used for detection and identification of pathogens in livestock. Livestock includes, but is not limited to, cows, pigs, sheep, chickens, turkeys, goats, horses and other farm animals. For example, conditions classified by the California Department of Food and Agriculture as emergency conditions in livestock (www.cdfa.ca.gov/ahfss/ah/pdfs/CA_reportable_disease_list05292002.pdf) include, but are not limited to: Anthrax (Bacillus anthracis), Screwworm myiasis (Cochliomyia hominivorax or Chrysomya bezziana), African trypanosomiasis (Tsetse fly diseases), Bovine babesiosis (piroplasmosis), Bovine spongiform encephalopathy (Mad Cow), Contagious bovine pleuropneumonia (Mycoplasma mycoides mycoides small colony), Foot-and-mouth disease (Hoof-and-mouth), Heartwater (Cowdria ruminantium), Hemorrhagic septicemia (Pasteurella multocida serotypes B:2 or E:2), Lumpy skin disease, Malignant catarrhal fever (African type), Rift Valley fever, Rinderpest (Cattle plague), Theileriosis (Corridor disease, East Coast fever), Vesicular stomatitis, Contagious agalactia (Mycoplasma species), Contagious caprine pleuropneumonia (Mycoplasma capricolumn capripneumoniae), Nairobi sheep disease, Peste des petits ruminants (Goat plague), Pulmonary adenomatosis (Viral neoplastic pneumonia), Salmonella abortus ovis, Sheep and goat pox, African swine fever, Classical swine fever (Hog cholera), Japanese encephalitis, Nipah virus, Swine vesicular disease, Teschen disease (Enterovirus encephalomyelitis), Vesicular exanthema, Exotic Newcastle disease (Viscerotropic velogenic Newcastle disease), Highly pathogenic avian influenza (Fowl plague), African horse sickness, Dourine (Trypanosoma equiperdum), Epizootic lymphangitis (equine blastomycosis, equine histoplasmosis), Equine piroplasmosis (Babesia equi, B. caballi), Glanders (Farcy) (Pseudomonas mallei), Hendra virus (Equine morbillivirus), Horse pox, Surra (Trypanosoma evansi), Venezuelan equine encephalomyelitis, West Nile Virus, Chronic wasting disease in cervids, and Viral hemorrhagic disease of rabbits (calicivirus)
  • Conditions classified by the California Department of Food and Agriculture as regulated conditions in livestock include, but are not limited to: rabies, Bovine brucellosis (Brucella abortus), Bovine tuberculosis (Mycobacterium bovis), Cattle scabies (multiple types), Trichomonosis (Tritrichomonas fetus), Caprine and ovine brucellosis (excluding Brucella ovis), Scrapie, Sheep scabies (Body mange) (Psoroptes ovis), Porcine brucellosis (Brucella suis), Pseudorabies (Aujeszky's disease), Ornithosis (Psittacosis or avian chlamydiosis) (Chlamydia psittaci), Pullorum disease (Fowl typhoid) (Salmonella gallinarum and pullorum), Contagious equine metritis (Taylorella equigenitalis), Equine encephalomyelitis (Eastern and Western equine encephalitis), Equine infectious anemia (Swamp fever), Duck viral enteritis (Duck plague), and Tuberculosis in cervids.
  • Additional conditions monitored by the California Department of Food and Agriculture include, but are not limited to: Avian tuberculosis (Mycobacterium avium), Echinococcosis/Hydatidosis (Echinococcus species), Leptospirosis, Anaplasmosis (Anaplasma marginale or A. centrale), Bluetongue, Bovine cysticercosis (Taenia saginata in humans), Bovine genital campylobacteriosis (Campylobacter fetus venerealis), Dermatophilosis (Streptothricosis, mycotic dermatitis) (Dermatophilus congolensis), Enzootic bovine leukosis (Bovine leukemia virus), Infectious bovine rhinotracheitis (Bovine herpesvirus-1), Johne's disease (Paratuberculosis) (Mycobacterium avium paratuberculosis), Malignant catarrhal fever (North American), Q Fever (Coxiella burnetii), Caprine (contagious) arthritis/encephalitis, Enzootic abortion of ewes (Ovine chlamydiosis) (Chlamydia psittaci), Maedi-Visna (Ovine progressive pneumonia), Atrophic rhinitis (Bordetella bronchiseptica, Pasteurella multocida), Porcine cysticercosis (Taenia solium in humans), Porcine reproductive and respiratory syndrome, Transmissible gastroenteritis (coronavirus), Trichinellosis (Trichinella spiralis), Avian infectious bronchitis, Avian infectious laryngotracheitis, Duck viral hepatitis, Fowl cholera (Pasteurella multocida), Fowl pox, Infectious bursal disease (Gumboro disease), Low pathogenic avian influenza, Marek's disease, Mycoplasmosis (Mycoplasma gallisepticum), Equine influenza Equine rhinopneumonitis (Equine herpesvirus-1), Equine viral arteritis, and Horse mange (multiple types).
  • 2. Identification of Bioagents of Biological Warfare
  • A key problem in determining that an infectious outbreak is the result of a bioterrorist attack is the sheer variety of organisms that might be used by terrorists. According to a recent review (Taylor, L. H. et al. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 2001, 356, 983-989), there are over 1400 organisms infectious to humans; most of these have the potential to be used in a deliberate, malicious attack. These numbers do not include numerous strain variants of each organism, bioengineered versions, or pathogens that infect plants or animals. Paradoxically, most of the new technology being developed for detection of biological weapons incorporates a version of quantitative PCR, which is based upon the use of highly specific primers and probes designed to selectively identify specific pathogenic organisms. This approach requires assumptions about the type and strain of bacteria or virus which is expected to be detected. Although this approach will work for the most obvious organisms, like smallpox and anthrax, experience has shown that it is very difficult to anticipate what a terrorist will do.
  • The present invention can be used to detect and identify any biological agent, including bacteria, viruses, fungi and toxins without prior knowledge of the organism being detected and identified. As one example, where the agent is a biological threat, the information obtained such as the presence of toxin genes, pathogenicity islands and antibiotic resistance genes for example, is used to determine practical information needed for countermeasures. In addition, the methods can be used to identify natural or deliberate engineering events including chromosome fragment swapping, molecular breeding (gene shuffling) and emerging infectious diseases. The present invention provides broad-function technology that may be the only practical means for rapid diagnosis of disease caused by a biowarfare or bioterrorist attack, especially an attack that might otherwise be missed or mistaken for a more common infection.
  • Bacterial biological warfare agents capable of being detected by the present methods include, but are not limited to, Bacillus anthracis (anthrax), Yersinia pestis (pneumonic plague), Franciscella tularensis (tularemia), Brucella suis, Brucella abortus, Brucella melitensis (undulant fever), Burkholderia mallei (glanders), Burkholderia pseudomalleii (melioidosis), Salmonella typhi (typhoid fever), Rickettsia typhii (epidemic typhus), Rickettsia prowasekii (endemic typhus) and Coxiella burnetii (Q fever), Rhodobacter capsulatus, Chlamydia pneumoniae, Escherichia coli, Shigella dysenteriae, Shigella flexneri, Bacillus cereus, Clostridium botulinum, Coxiella burnetti, Pseudomonas aeruginosa, Legionella pneumophila, and Vibrio cholerae.
  • Besides 16S and 23S rRNA, other target regions suitable for use in the present invention for detection of bacteria include, but are not limited to, 5S rRNA and RNase P (FIG. 3).
  • Fungal biowarfare agents include, but are not limited to, Coccidioides immitis (Coccidioidomycosis), and Magnaporthe grisea.
  • Biological warfare toxin genes capable of being detected by the methods of the present invention include, but are not limited to, botulinum toxin, T-2 mycotoxins, ricin, staph enterotoxin B, shigatoxin, abrin, aflatoxin, Clostridium perfringens epsilon toxin, conotoxins, diacetoxyscirpenol, tetrodotoxin and saxitoxin.
  • Parasites that could be used in biological warfare include, but are not limited to: Ascaris suum, Giardia lamblia, Cryptosporidium, and Schistosoma.
  • Biological warfare viral threat agents are mostly RNA viruses (positive-strand and negative-strand), with the exception of smallpox. Every RNA virus is a family of related viruses (quasispecies). These viruses mutate rapidly and the potential for engineered strains (natural or deliberate) is very high. RNA viruses cluster into families that have conserved RNA structural domains on the viral genome (e.g., virion components, accessory proteins) and conserved housekeeping genes that encode core viral proteins including, for single strand positive strand RNA viruses, RNA-dependent RNA polymerase, double stranded RNA helicase, chymotrypsin-like and papain-like proteases and methyltransferases. “Housekeeping genes” refers to genes that are generally always expressed and thought to be involved in routine cellular metabolism.
  • Examples of (−)-strand RNA viruses include, but are not limited to, arenaviruses (e.g., sabia virus, lassa fever, Machupo, Argentine hemorrhagic fever, flexal virus), bunyaviruses (e.g., hantavirus, nairovirus, phlebovirus, hantaan virus, Congo-crimean hemorrhagic fever, rift valley fever), and mononegavirales (e.g., filovirus, paramyxovirus, ebola virus, Marburg, equine morbillivirus).
  • Examples of (+)-strand RNA viruses include, but are not limited to, picornaviruses (e.g., coxsackievirus, echovirus, human coxsackievirus A, human echovirus, human enterovirus, human poliovirus, hepatitis A virus, human parechovirus, human rhinovirus), astroviruses (e.g., human astrovirus), calciviruses (e.g., chiba virus, chitta virus, human calcivirus, norwalk virus), nidovirales (e.g., human coronavirus, human torovirus), flaviviruses (e.g., dengue virus 1-4, Japanese encephalitis virus, Kyanasur forest disease virus, Murray Valley encephalitis virus, Rocio virus, St. Louis encephalitis virus, West Nile virus, yellow fever virus, hepatitis c virus) and togaviruses (e.g., Chikugunya virus, Eastern equine encephalitis virus, Mayaro virus, O'nyong-nyong virus, Ross River virus, Venezuelan equine encephalitis virus, Rubella virus, hepatitis E virus). The hepatitis C virus has a 5′-untranslated region of 340 nucleotides, an open reading frame encoding 9 proteins having 3010 amino acids and a 3′-untranslated region of 240 nucleotides. The 5′-UTR and 3′-UTR are 99% conserved in hepatitis C viruses.
  • In one embodiment, the target gene is an RNA-dependent RNA polymerase or a helicase encoded by (+)-strand RNA viruses, or RNA polymerase from a (−)-strand RNA virus. (+)-strand RNA viruses are double stranded RNA and replicate by RNA-directed RNA synthesis using RNA-dependent RNA polymerase and the positive strand as a template. Helicase unwinds the RNA duplex to allow replication of the single stranded RNA. These viruses include viruses from the family picornaviridae (e.g., poliovirus, coxsackievirus, echovirus), togaviridae (e.g., alphavirus, flavivirus, rubivirus), arenaviridae (e.g., lymphocytic choriomeningitis virus, lassa fever virus), cononaviridae (e.g., human respiratory virus) and Hepatitis A virus. The genes encoding these proteins comprise variable and highly conserved regions which flank the variable regions.
  • In one embodiment, the method can be used to detect the presence of antibiotic resistance and/or toxin genes in a bacterial species. For example, Bacillus anthracis comprising a tetracycline resistance plasmid and plasmids encoding one or both anthracis toxins (px01 and/or px02) can be detected by using antibiotic resistance primer sets and toxin gene primer sets. If the B. anthracis is positive for tetracycline resistance, then a different antibiotic, for example quinalone, is used.
  • While the present invention has been described with specificity in accordance with certain of its embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.
  • EXAMPLES Example 1 Nucleic Acid Isolation and PCR
  • In one embodiment, nucleic acid is isolated from the organisms and amplified by PCR using standard methods prior to BCS determination by mass spectrometry. Nucleic acid is isolated, for example, by detergent lysis of bacterial cells, centrifugation and ethanol precipitation. Nucleic acid isolation methods are described in, for example, Current Protocols in Molecular Biology (Ausubel et al.) and Molecular Cloning; A Laboratory Manual (Sambrook et al.). The nucleic acid is then amplified using standard methodology, such as PCR, with primers which bind to conserved regions of the nucleic acid which contain an intervening variable sequence as described below.
  • General Genomic DNA Sample Prep Protocol: Raw samples are filtered using Supor-200 0.2 μm membrane syringe filters (VWR International). Samples are transferred to 1.5 ml eppendorf tubes pre-filled with 0.45 g of 0.7 mm Zirconia beads followed by the addition of 350 μl of ATL buffer (Qiagen, Valencia, Calif.). The samples are subjected to bead beating for 10 minutes at a frequency of 19 l/s in a Retsch Vibration Mill (Retsch). After centrifugation, samples are transferred to an S-block plate (Qiagen) and DNA isolation is completed with a BioRobot 8000 nucleic acid isolation robot (Qiagen).
  • Swab Sample Protocol: Allegiance S/P brand culture swabs and collection/transport system are used to collect samples. After drying, swabs are placed in 17×100 mm culture tubes (VWR
  • International) and the genomic nucleic acid isolation is carried out automatically with a Qiagen Mdx robot and the Qiagen QIAamp DNA Blood BioRobot Mdx genomic preparation kit (Qiagen, Valencia, Calif.).
  • Example 2 Mass Spectrometry
  • FTICR Instrumentation: The FTICR instrument is based on a 7 tesla actively shielded superconducting magnet and modified Bruker Daltonics Apex II 70e ion optics and vacuum chamber. The spectrometer is interfaced to a LEAP PAL autosampler and a custom fluidics control system for high throughput screening applications. Samples are analyzed directly from 96-well or 384-well microtiter plates at a rate of about 1 sample/minute. The Bruker data-acquisition platform is supplemented with a lab-built ancillary NT datastation which controls the autosampler and contains an arbitrary waveform generator capable of generating complex rf-excite waveforms (frequency sweeps, filtered noise, stored waveform inverse Fourier transform (SWIFT), etc.) for sophisticated tandem MS experiments. For oligonucleotides in the 20-30-mer regime typical performance characteristics include mass resolving power in excess of 100,000 (FWHM), low ppm mass measurement errors, and an operable m/z range between 50 and 5000 m/z.
  • Modified ESI Source: In sample-limited analyses, analyte solutions are delivered at 150 mL/minute to a 30 mm i.d. fused-silica ESI emitter mounted on a 3-D micromanipulator. The ESI ion optics consists of a heated metal capillary, an rf-only hexapole, a skimmer cone, and an auxiliary gate electrode. The 6.2 cm rf-only hexapole is comprised of 1 mm diameter rods and is operated at a voltage of 380 Vpp at a frequency of 5 MHz. A lab-built electro-mechanical shutter can be employed to prevent the electrospray plume from entering the inlet capillary unless triggered to the “open” position via a TTL pulse from the data station. When in the “closed” position, a stable electrospray plume is maintained between the ESI emitter and the face of the shutter. The back face of the shutter arm contains an elastomeric seal that can be positioned to form a vacuum seal with the inlet capillary. When the seal is removed, a 1 mm gap between the shutter blade and the capillary inlet allows constant pressure in the external ion reservoir regardless of whether the shutter is in the open or closed position. When the shutter is triggered, a “time slice” of ions is allowed to enter the inlet capillary and is subsequently accumulated in the external ion reservoir. The rapid response time of the ion shutter (<25 ms) provides reproducible, user defined intervals during which ions can be injected into and accumulated in the external ion reservoir.
  • Apparatus for Infrared Multiphoton Dissociation: A 25 watt CW CO2 laser operating at 10.6 μm has been interfaced to the spectrometer to enable infrared multiphoton dissociation (IRMPD) for oligonucleotide sequencing and other tandem MS applications. An aluminum optical bench is positioned approximately 1.5 m from the actively shielded superconducting magnet such that the laser beam is aligned with the central axis of the magnet. Using standard IR-compatible mirrors and kinematic mirror mounts, the unfocused 3 mm laser beam is aligned to traverse directly through the 3.5 mm holes in the trapping electrodes of the FTICR trapped ion cell and longitudinally traverse the hexapole region of the external ion guide finally impinging on the skimmer cone. This scheme allows IRMPD to be conducted in an m/z selective manner in the trapped ion cell (e.g. following a SWIFT isolation of the species of interest), or in a broadband mode in the high pressure region of the external ion reservoir where collisions with neutral molecules stabilize IRMPD-generated metastable fragment ions resulting in increased fragment ion yield and sequence coverage.
  • Example 3 Identification of Bioagents
  • Table 2 shows a small cross section of a database of calculated molecular masses for over 9 primer sets and approximately 30 organisms. The primer sets were derived from rRNA alignment. Examples of regions from rRNA consensus alignments are shown in FIGS. 1A-1C. Lines with arrows are examples of regions to which intelligent primer pairs for PCR are designed. The primer pairs are >95% conserved in the bacterial sequence database (currently over 10,000 organisms). The intervening regions are variable in length and/or composition, thus providing the base composition “signature” (BCS) for each organism. Primer pairs were chosen so the total length of the amplified region is less than about 80-90 nucleotides. The label for each primer pair represents the starting and ending base number of the amplified region on the consensus diagram.
  • Included in the short bacterial database cross-section in Table 2 are many well known pathogens/biowarfare agents (shown in bold/red typeface) such as Bacillus anthracis or Yersinia pestis as well as some of the bacterial organisms found commonly in the natural environment such as Streptomyces. Even closely related organisms can be distinguished from each other by the appropriate choice of primers. For instance, two low G+C organisms, Bacillus anthracis and Staph aureus, can be distinguished from each other by using the primer pair defined by 16S1337 or 23S855 (ΔM of 4 Da).
  • TABLE 2
    Cross Section Of A Database Of Calculated Molecular Masses1
    Primer Regions
    Bug Name 16S_971 16S_1100 16S_1337 16S_1294 16S_1228 23S_1021 23S_855 23S_193 23S_115
    Acinetobacter calcoaceticus 55619.1 55004 28446.7 35854.9 51295.4 30299 42654 39557.5 54999
    Figure US20080311558A1-20081218-P00001
    55005 54388 28448 35238 51296 30295 42651 39560 56850
    Bacillus cereus 55622.1 54387.9 28447.6 35854.9 51296.4 30295 42651 39560.5 56850.3
    Bordetella bronchiseptica 56857.3 51300.4 28446.7 35857.9 51307.4 30299 42653 39559.5 51920.5
    Borrelia burgdorferi 56231.2 55621.1 28440.7 35852.9 51295.4 30297 42029.9 38941.4 52524.6
    Figure US20080311558A1-20081218-P00002
    58098 55011 28448 35854 50683
    Campylobacter jejuni 58088.5 54386.9 29061.8 35856.9 50674.3 30294 42032.9 39558.5 45732.5
    Figure US20080311558A1-20081218-P00003
    55000 55007 29063 35855 50676 30295 42036 38941 56230
    Figure US20080311558A1-20081218-P00004
    55006 53767 28445 35855 51291 30300 42656 39562 54999
    Clostridium difficile 56855.3 54386.9 28444.7 35853.9 51296.4 30294 41417.8 39556.5 55612.2
    Enterococcus faecalis 55620.1 54387.9 28447.6 35858.9 51296.4 30297 42652 39559.5 56849.3
    Figure US20080311558A1-20081218-P00005
    55622 55009 28445 35857 51301 30301 42656 39562 54999
    Figure US20080311558A1-20081218-P00006
    53769 54385 28445 35856 51298
    Haemophilus influenzae 55620.1 55006 28444.7 35855.9 51298.4 30298 42656 39560.5 55613.1
    Klebsiella pneumoniae 55622.1 55008 28442.7 35856.9 51297.4 30300 42655 39562.5 55000
    Figure US20080311558A1-20081218-P00007
    55618 55626 28446 35857 51303
    Mycobacterium avium 54390.9 55631.1 29064.8 35858.9 51915.5 30298 42656 38942.4 56241.2
    Mycobacterium leprae 54389.9 55629.1 29064.8 35860.9 51917.5 30298 42656 39559.5 56240.2
    Mycobacterium tuberculosis 54390.9 55629.1 29064.8 35860.9 51301.4 30299 42656 39560.5 56243.2
    Mycoplasma genitalium 53143.7 45115.4 29061.8 35854.9 50671.3 30294 43264.1 39558.5 56842.4
    Mycoplasma pneumoniae 53143.7 45118.4 29061.8 35854.9 50673.3 30294 43264.1 39559.5 56843.4
    Neisseria gonorrhoeae 55627.1 54389.9 28445.7 35855.9 51302.4 30300 42649 39561.5 55000
    Figure US20080311558A1-20081218-P00008
    55623 55010 28443 35858 51301 30298 43272 39558 55619
    Figure US20080311558A1-20081218-P00009
    58093 55621 28448 35853 50677 30293 42650 39559 53139
    Figure US20080311558A1-20081218-P00010
    58094 55623 28448 35853 50679 30293 42648 39559 53755
    Figure US20080311558A1-20081218-P00011
    55622 55005 28445 35857 51301 30301 42658
    Figure US20080311558A1-20081218-P00012
    55623 55009 28444 35857 51301
    Staphylococcus aureus 56854.3 54386.9 28443.7 35852.9 51294.4 30298 42655 39559.5 57466.4
    Streptomyces 54389.9 59341.6 29063.8 35858.9 51300.4 39563.5 56864.3
    Treponema pallidum 56245.2 55631.1 28445.7 35851.9 51297.4 30299 42034.9 38939.4 57473.4
    Figure US20080311558A1-20081218-P00013
    55625 55626 28443 35857 52536 29063 30303 35241 50675
    Vibrio parahaemolyticus 54384.9 55626.1 28444.7 34620.7 50064.2
    Figure US20080311558A1-20081218-P00014
    55620 55626 28443 35857 51299
    1Molecular mass distribution of PCR amplified regions for a selection of organisms (rows) across various primer pairs (columns). Pathogens are shown in bold. Empty cells indicate presently incomplete or missing data.
  • FIG. 6 shows the use of ESI-FT-ICR MS for measurement of exact mass. The spectra from 46 mer PCR products originating at position 1337 of the 16S rRNA from S. aureus (upper) and B. anthracis (lower) are shown. These data are from the region of the spectrum containing signals from the [M−8H+]8− charge states of the respective 5′-3′ strands. The two strands differ by two (AT→CG) substitutions, and have measured masses of 14206.396 and 14208.373+0.010 Da, respectively. The possible base compositions derived from the masses of the forward and reverse strands for the B. anthracis products are listed in Table 3.
  • TABLE 3
    Possible base composition for B. anthracis products
    Calc. Mass Error Base Comp.
    14208.2935 0.079520 A1 G17 C10 T18
    14208.3160 0.056980 A1 G20 C15 T10
    14208.3386 0.034440 A1 G23 C20 T2
    14208.3074 0.065560 A6 G11 C3 T26
    14208.3300 0.043020 A6 G14 C8 T18
    14208.3525 0.020480 A6 G17 C13 T10
    14208.3751 0.002060 A6 G20 C18 T2
    14208.3439 0.029060 A11 G8 C1 T26
    14208.3665 0.006520 A11 G11 C6 T18
    14208.3890 0.016020 A11 G14 C11 T10
    14208.4116 0.038560 A11 G17 C16 T2
    14208.4030 0.029980 A16 G8 C4 T18
    14208.4255 0.052520 A16 G11 C9 T10
    14208.4481 0.075060 A16 G14 C14 T2
    14208.4395 0.066480 A21 G5 C2 T18
    14208.4620 0.089020 A21 G8 C7 T10
    14079.2624 0.080600 A0 G14 C13 T19
    14079.2849 0.058060 A0 G17 C18 T11
    14079.3075 0.035520 A0 G20 C23 T3
    14079.2538 0.089180 A5 G5 C1 T35
    14079.2764 0.066640 A5 G8 C6 T27
    14079.2989 0.044100 A5 G11 C11 T19
    14079.3214 0.021560 A5 G14 C16 T11
    14079.3440 0.000980 A5 G17 C21 T3
    14079.3129 0.030140 A10 G5 C4 T27
    14079.3354 0.007600 A10 G8 C9 T19
    14079.3579 0.014940 A10 G11 C14 T11
    14079.3805 0.037480 A10 G14 C19 T3
    14079.3494 0.006360 A15 G2 C2 T27
    14079.3719 0.028900 A15 G5 C7 T19
    14079.3944 0.051440 A15 G8 C12 T11
    14079.4170 0.073980 A15 G11 C17 T3
    14079.4084 0.065400 A20 G2 C5 T19
    14079.4309 0.087940 A20 G5 C10 T13
  • Among the 16 compositions for the forward strand and the 18 compositions for the reverse strand that were calculated, only one pair (shown in bold) are complementary, corresponding to the actual base compositions of the B. anthracis PCR products.
  • Example 4 BCS of Region from Bacillus anthracis and Bacillus cereus
  • A conserved Bacillus region from B. anthracis (A14G9C14T9) and B. cereus (A15G9C13T9) having a C to A base change was synthesized and subjected to ESI-TOF MS. The results are shown in FIG. 7 in which the two regions are clearly distinguished using the method of the present invention (MW=14072.26 vs. 14096.29).
  • Example 5 Identification of Additional Bioagents
  • In other examples of the present invention, the pathogen Vibrio cholera can be distinguished from Vibrio parahemolyticus with ΔM>600 Da using one of three 16S primer sets shown in Table 2 (16S971, 16S1228 or 16S1294) as shown in Table 4. The two mycoplasma species in the list (M. genitalium and M. pneumoniae) can also be distinguished from each other, as can the three mycobacteriae. While the direct mass measurements of amplified products can identify and distinguish a large number of organisms, measurement of the base composition signature provides dramatically enhanced resolving power for closely related organisms. In cases such as Bacillus anthracis and Bacillus cereus that are virtually indistinguishable from each other based solely on mass differences, compositional analysis or fragmentation patterns are used to resolve the differences. The single base difference between the two organisms yields different fragmentation patterns, and despite the presence of the ambiguous/unidentified base N at position 20 in B. anthracis, the two organisms can be identified.
  • Tables 4a-b show examples of primer pairs from Table 1 which distinguish pathogens from background.
  • TABLE 4a
    Organism name 23S_855 16S_1337 23S_1021
    Bacillus anthracis 42650.98 28447.65 30294.98
    Staphylococcus aureus 42654.97 28443.67 30297.96
  • TABLE 4b
    Organism name 16S_971 16S_1294 16S_1228
    Vibrio cholerae 55625.09 35856.87 52535.59
    Vibrio parahaemolyticus 54384.91 34620.67 50064.19
  • Table 5 shows the expected molecular weight and base composition of region 16S1100-1188 in Mycobacterium avium and Streptomyces sp.
  • TABLE 5
    Organism Molecular
    Region name Length weight Base comp.
    16S_1100-1188 Mycobac- 82 25624.1728 A16G32C18T16
    terium avium
    16S_1100-1188 Strepto- 96 29904.871 A17G38C27T14
    myces sp.
  • Table 6 shows base composition (single strand) results for 16S1100-1188 primer amplification reactions different species of bacteria. Species which are repeated in the table (e.g., Clostridium botulinum) are different strains which have different base compositions in the 16S1100-1188 region.
  • TABLE 6
    Organism name Base comp.
    Mycobacterium avium A16G32C18T16
    Streptomyces sp. A17G38C27T14
    Ureaplasma urealyticum A18G30C17T17
    Streptomyces sp. A19G36C24T18
    Mycobacterium leprae A20G32C22T16
    Figure US20080311558A1-20081218-P00015
    A 20 G 33 C 21 T 16
    Figure US20080311558A1-20081218-P00016
    A 20 G 33 C 21 T 16
    Fusobacterium necroforum A21G26C22T18
    Listeria monocytogenes A21G27C19T19
    Clostridium botulinum A21G27C19T21
    Neisseria gonorrhoeae A21G28C21T18
    Bartonella quintana A21G30C22T16
    Enterococcus faecalis A22G27C20T19
    Bacillus megaterium A22G28C20T18
    Bacillus subtilis A22G28C21T17
    Pseudomonas aeruginosa A22G29C23T15
    Legionella pneumophila A22G32C20T16
    Mycoplasma pneumoniae A23G20C14T16
    Clostridium botulinum A23G26C20T19
    Enterococcus faecium A23G26C21T18
    Acinetobacter calcoaceti A23G26C21T19
    Figure US20080311558A1-20081218-P00017
    A 23 G 26 C 24 T 15
    Figure US20080311558A1-20081218-P00018
    A 23 G 26 C 24 T 15
    Clostridium perfringens A23G27C19T19
    Figure US20080311558A1-20081218-P00019
    A 23 G 27 C 20 T 18
    Figure US20080311558A1-20081218-P00020
    A 23 G 27 C 20 T 18
    Figure US20080311558A1-20081218-P00021
    A 23 G 27 C 20 T 18
    Aeromonas hydrophila A23G29C21T16
    Escherichia coli A23G29C21T16
    Pseudomonas putida A23G29C21T17
    Figure US20080311558A1-20081218-P00022
    A 23 G 29 C 22 T 15
    Figure US20080311558A1-20081218-P00023
    A 23 G 29 C 22 T 15
    Vibrio cholerae A23G30C21T16
    Figure US20080311558A1-20081218-P00024
    A 23 G 31 C 21 T 15
    Figure US20080311558A1-20081218-P00025
    A 23 G 31 C 21 T 15
    Mycoplasma genitalium A24G19C12T18
    Clostridium botulinum A24G25C18T20
    Bordetella bronchiseptica A24G26C19T14
    Francisella tularensis A24G26C19T19
    Figure US20080311558A1-20081218-P00019
    A 24 G 26 C 20 T 18
    Figure US20080311558A1-20081218-P00026
    A 24 G 26 C 20 T 18
    Figure US20080311558A1-20081218-P00027
    A 24 G 26 C 20 T 18
    Helicobacter pylori A24G26C20T19
    Helicobacter pylori A24G26C21T18
    Moraxella catarrhalis A24G26C23T16
    Haemophilus influenzae Rd A24G28C20T17
    Figure US20080311558A1-20081218-P00028
    A 24 G 28 C 21 T 16
    Figure US20080311558A1-20081218-P00029
    A 24 G 28 C 21 T 16
    Figure US20080311558A1-20081218-P00030
    A 24 G 28 C 21 T 16
    Pseudomonas putida A24G29C21T16
    Figure US20080311558A1-20081218-P00031
    A 24 G 30 C 21 T 15
    Figure US20080311558A1-20081218-P00032
    A 24 G 30 C 21 T 15
    Figure US20080311558A1-20081218-P00033
    A 24 G 30 C 21 T 15
    Clostridium botulinum A25G24C18T21
    Clostridium tetani A25G25C18T20
    Francisella tularensis A25G25C19T19
    Acinetobacter calcoacetic A25G26C20T19
    Bacteriodes fragilis A25G27C16T22
    Chlamydophila psittaci A25G27C21T16
    Borrelia burgdorferi A25G29C17T19
    Streptobacillus monilifor A26G26C20T16
    Rickettsia prowazekii A26G28C18T18
    Rickettsia rickettsii A26G28C20T16
    Mycoplasma mycoides A28G23C18T20
  • The same organism having different base compositions are different strains. Groups of organisms which are highlighted or in italics have the same base compositions in the amplified region. Some of these organisms can be distinguished using multiple primers. For example, Bacillus anthracis can be distinguished from Bacillus cereus and Bacillus thuringiensis using the primer 16S971-1062 (Table 7). Other primer pairs which produce unique base composition signatures are shown in Table 6 (bold). Clusters containing very similar threat and ubiquitous non-threat organisms (e.g. anthracis cluster) are distinguished at high resolution with focused sets of primer pairs. The known biowarfare agents in Table 6 are Bacillus anthracis, Yersinia pestis, Francisella tularensis and Rickettsia prowazekii.
  • TABLE 7
    Organism 16S_971-1062 16S_1228-1310 16S_1100-1188
    Aeromonas hydrophila A21G29C22T20 A22G27C21T13 A23G31C21T15
    Aeromonas salmonicida A21G29C22T20 A22G27C21T13 A23G31C21T15
    Bacillus anthracis A 21 G 27 C 22 T 22 A24G22C19T18 A23G27C20T18
    Bacillus cereus A22G27C22T22 A24G22C19T18 A23G27C20T18
    Bacillus thuringiensis A22G27C21T22 A24G22C19T18 A23G27C20T18
    Chlamydia trachomatis A 22 G 26 C 20 T 23 A 24 G 23 C 19 T 16 A24G28C21T16
    Chlamydia pneumoniae AR39 A26G23C20T22 A26G22C16T18 A24G28C21T16
    Leptospira borgpetersenii A22G26C20T21 A22G25C21T15 A23G26C24T15
    Leptospira interrogans A22G26C20T21 A22G25C21T15 A23G26C24T15
    Mycoplasma genitalium A28G23C15T22 A 30 G 18 C 15 T 19 A 24 G 19 C 12 T 18
    Mycoplasma pneumoniae A28G23C15T22 A 27 G 19 C 16 T 20 A 23 G 20 C 14 T 16
    Escherichia coli A 22 G 28 C 20 T 22 A24G25C21T13 A23G29C22T15
    Shigella dysenteriae A 22 G 28 C 21 T 21 A24G25C21T13 A23G29C22T15
    Proteus vulgaris A 23 G 26 C 22 T 21 A 26 G 24 C 19 T 14 A24G30C21T15
    Yersinia pestis A24G25C21T22 A25G24C20T14 A24G30C21T15
    Yersinia pseudotuberculosis A24G25C21T22 A25G24C20T14 A24G30C21T15
    Francisella tularensis A 20 G 25 C 21 T 23 A 23 G 26 C 17 T 17 A 24 G 26 C 19 T 19
    Rickettsia prowazekii A 21 G 26 C 24 T 25 A 24 G 23 C 16 T 19 A 26 G 28 C 18 T 18
    Rickettsia rickettsii A 21 G 26 C 25 T 24 A 24 G 24 C 17 T 17 A 26 G 28 C 20 T 16
  • The sequence of B. anthracis and B. cereus in region 16S971 is shown below. Shown in bold is the single base difference between the two species which can be detected using the methods of the present invention. B. anthracis has an ambiguous base at position 20.
  • B.anthracis_16S_971
    (SEQ ID NO: 1)
    GCGAAGAACCUUACCAGGUNUUGACAUCCUCUGACAACCCUAGAGAUAGG
    GCUUCUCCUUCGGGAGCAGAGUGACAGGUGGUGCAUGGUU
    B.cereus_16S_971
    (SEQ ID NO: 2)
    GCGAAGAACCUUACCAGGUCUUGACAUCCUCUGAAAACCCUAGAGAUAGG
    GCUUCUCCUUCGGGAGCAGAGUGACAGGUGGUGCAUGGUU
  • Example 6 ESI-TOF MS of sspE 56-mer Plus Calibrant
  • The mass measurement accuracy that can be obtained using an internal mass standard in the ESI-MS study of PCR products is shown in FIG. 8. The mass standard was a 20-mer phosphorothioate oligonucleotide added to a solution containing a 56-mer PCR product from the B. anthracis spore coat protein sspE. The mass of the expected PCR product distinguishes B. anthracis from other species of Bacillus such as B. thuringiensis and B. cereus.
  • Example 7 B. anthracis ESI-TOF Synthetic 16S1228 Duplex
  • An ESI-TOF MS spectrum was obtained from an aqueous solution containing 5 μM each of synthetic analogs of the expected forward and reverse PCR products from the nucleotide 1228 region of the B. anthracis 16S rRNA gene. The results (FIG. 9) show that the molecular weights of the forward and reverse strands can be accurately determined and easily distinguish the two strands. The [M−21H+]21− and [M−20H+]20+ charge states are shown.
  • Example 8 ESI-FTICR-MS of Synthetic B. anthracis 16S1337 46 Base Pair Duplex
  • An ESI-FTICR-MS spectrum was obtained from an aqueous solution containing 5 μM each of synthetic analogs of the expected forward and reverse PCR products from the nucleotide 1337 region of the B. anthracis 16S rRNA gene. The results (FIG. 10) show that the molecular weights of the strands can be distinguished by this method. The [M−16H+]16− through [M−10H+]10− charge states are shown. The insert highlights the resolution that can be realized on the FTICR-MS instrument, which allows the charge state of the ion to be determined from the mass difference between peaks differing by a single 13C substitution.
  • Example 9 ESI-TOF MS of 56-mer Oligonucleotide from saspB Gene of B. anthracis with Internal Mass Standard
  • ESI-TOF MS spectra were obtained on a synthetic 56-mer oligonucleotide (5 μM) from the saspB gene of B. anthracis containing an internal mass standard at an ESI of 1.7 μL/min as a function of sample consumption. The results (FIG. 11) show that the signal to noise is improved as more scans are summed, and that the standard and the product are visible after only 100 scans.
  • Example 10 ESI-TOF MS of an Internal Standard with Tributylammonium (TBA)-trifluoroacetate (TFA) Buffer
  • An ESI-TOF-MS spectrum of a 20-mer phosphorothioate mass standard was obtained following addition of 5 mM TBA-TFA buffer to the solution. This buffer strips charge from the oligonucleotide and shifts the most abundant charge state from [M−8H+]8− to [M−3H+]3− (FIG. 12).
  • Example 11 Master Database Comparison
  • The molecular masses obtained through Examples 1-10 are compared to molecular masses of known bioagents stored in a master database to obtain a high probability matching molecular mass.
  • Example 12 Master Data Base Interrogation over the Internet
  • The same procedure as in Example 11 is followed except that the local computer did not store the Master database. The Master database is interrogated over an internet connection, searching for a molecular mass match.
  • Example 13 Master Database Updating
  • The same procedure as in example 11 is followed except the local computer is connected to the internet and has the ability to store a master database locally. The local computer system periodically, or at the user's discretion, interrogates the Master database, synchronizing the local master database with the global Master database. This provides the current molecular mass information to both the local database as well as to the global Master database. This further provides more of a globalized knowledge base.
  • Example 14 Global Database Updating
  • The same procedure as in example 13 is followed except there are numerous such local stations throughout the world. The synchronization of each database adds to the diversity of information and diversity of the molecular masses of known bioagents.
  • Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in the present application is incorporated herein by reference in its entirety.
  • Example 15 Demonstration of Detection and Identification of Five Species of Bacteria in a Mixture
  • Broad range intelligent primers were chosen following analysis of a large collection of curated bacterial 16S rRNA sequences representing greater than 4000 species of bacteria. Examples of primers capable of priming from greater than 90% of the organisms in the collection include, but are not limited to, those exhibited in Table 8 wherein Tp=5′propynylated uridine and Cp=5′propynylated cytidine.
  • TABLE 8
    Intelligent Primer Pairs for Identification of Bacteria
    Forward Reverse
    Primer Forward Primer SEQ ID Reverse Primer SEQ ID
    Pair Name Sequence NO: Sequence NO:
    16S_EC_107 GTGAGATGTTGGGTTAAGTCCC 8 GACGTCATCCCCACCTTCCTC 9
    7_1195 GTAACGAG
    16S_EC_108 ATGTTGGGTTAAGTCCCGCAAC 10 TTGACGTCATCCCCACCTTCCT 11
    2_1197 GAG C
    16S_EC_109 TTAAGTCCCGCAACGATCGCAA 12 TGACGTCATCCCCACCTTCCTC 13
    0_1196
    16S_EC_122 GCTACACACGTGCTACAATG 14 CGAGTTGCAGACTGCGATCCG 15
    2_1323
    16S_EC_133 AAGTCGGAATCGCTAGTAATCG 16 GACGGGCGGTGTGTACAAG 17
    2_1407
    16S_EC_30 TGAACGCTGGTGGCATGCTTAA 18 TACGCATTACTCACCCGTCCGC 19
    126 CAC
    16S_EC_38 GTGGCATGCCTAATACATGCAA 20 TTACTCACCCGTCCGCCGCT 21
    120 GTCG
    16S_EC_49 TAACACATGCAAGTCGAACG 22 TTACTCACCCGTCCGCC 23
    120
    16S_EC_683 GTGTAGCGGTGAAATGCG 24 GTATCTAATCCTGTTTGCTCCC 25
    795
    16S_EC_713 AGAACACCGATGGCGAAGGC 26 CGTGGACTACCAGGGTATCTA 27
    809
    16S_EC_785 GGATTAGAGACCCTGGTAGTCC 28 GGCCGTACTCCCCAGGCG 29
    897
    16S_EC_785 GGATTAGATACCCTGGTAGTCC 30 GGCCGTACTCCCCAGGCG 31
    _897_2 ACGC
    16S_EC_789 TAGATACCCTGGTAGTCCACGC 32 CGTACTCCCCAGGCG 33
    894
    16S_EC_960 TTCGATGCAACGCGAAGAACCT 34 ACGAGCTGACGACAGCCATG 35
    1073
    16S_EC_969 ACGCGAAGAACCTTACC 36 ACGACACGAGCTGACGAC 37
    1078
    23S_EC_182 CTGACACCTGCCCGGTGC 38 GACCGTTATAGTTACGGCC 39
    6_1924
    23S_EC_264 TCTGTCCCTAGTACGAGAGGAC 40 TGCTTAGATGCTTTCAGC 41
    5_2761 CGG
    23S_EC_264 CTGTCCCTAGTACGAGACGACC 42 GTTTCATGCTTAGATGCTTTCA 43
    5_2767 GG GC
    23S_EC_493 GGGGAGTGAAAGAGATCCTGAA 44 ACAAAACGTACGCCGTCACCC 45
    _571 ACCG
    23S_EC_493 GGGGAGTGAAAGAGATCCTGAA 46 ACAAAAGGCACGCCATCACCC 47
    _571_2 ACCG
    23S_EC_971 CGAGAGGGAAACAACCCAGACC 48 TGGCTGCTTCTAAGCCAAC 49
    1077
    INFB_EC_13 TGCTCGTGGTGCACAAGTAACG 50 TGCTCCTTTCGCATGGTTAATT 51
    65_1467 GATATTA GCTTCAA
    RPOC_EC_10 CAAAACTTATTAGGTAAGCGTG 52 TCAAGCGCCATTTCTTTTGGTA 53
    18_1124 TTGACT AACCACAT
    RPOC_EC_10 CAAAACTTATTAGGTAAGCGTG 54 TCAAGCGCCATCTCTTTCGGTA 55
    18_1124_2 TTGACT ATCCACAT
    RPOC_EC_11 TAAGAAGCCGGAAACCATCAAC 56 GGCGCTTGTACTTACCGCAC 57
    4_232 TACCG
    RPOC_EC_21 TGATTCTCGTGCCCGTGGT 58 TTGGCCATCAGGCCACGCATAC 59
    78_2246
    RPOC_EC_21 TGATTCCGGTGCCCGTGGT 60 TTGGCCATCAGACCACGCATAC 61
    78_2246_2
    RPOC_EC_22 CTGGCAGGTATGCGTGGTCTGA 62 CGCACCGTGGGTTGAGATGAAG 63
    18_2337 TG TAC
    RPOC_EC_22 CTTGCTGGTATGCGTGGTCTGA 64 CGCACCATGCGTAGAGATGAAG 65
    18_2337_2 TG TAC
    RPOC_EC_80 CGTCGGCTGATTAACCGTAACA 66 GTTTTTCGTTGCGTACGATGAT 67
    8_889 ACCG GTC
    RPOC_EC_80 CGTCGTGTAATTAACCGTAACA 68 ACGTTTTTCGTTTTGAACGATA 69
    8_891 ACCG ATGCT
    RPOC_EC_99 CAAAGGTAAGCAAGGTCGTTTC 70 CGAACGGCCTGAGTAGTCAACA 71
    3_1059 CGTCA CG
    RPOC_EC_99 CAAAGGTAAGCAAGGACGTTTC 72 CGAACGGCCAGAGTAGTCAACA 73
    3_1059_2 CGTCA CG
    TUFB_EC_23 TAGACTGCCCAGGACACGCTG 74 GCCGTCCATCTGAGCAGCACC 75
    9_303
    TUFB_EC_23 TTGACTGCCCAGGTCACGCTG 76 GCCGTCCATTTGAGCAGCACC 77
    9_303_2
    TUFB_EC_97 AACTACCGTCCGCAGTTCTACT 78 GTTGTCGCCACGCATAACCATT 79
    6_1068 TCC TC
    TUFB_EC_97 AACTACCGTCCTCACTTCTACT 80 GTTGTCACCAGGCATTACCATT 81
    6_1068_2 TCC TC
    TUFB_EC_98 CCACAGTTCTACTTCCGTACTA 82 TCCAGGCATTACCATTTCTACT 83
    5_1062 CTGACG CCTTCTCG
    RPLB_EC_65 GACCTACAGTAAGAGGTTCTGT 84 TCCAAGTGCTGGTTTACCCCAT 85
    0_762 AATGAACC GG
    RPLB_EC_68 CATCCACACGGTGGTGGTGAAG 86 GTGCTGCTTTACCCCATGGAGT 87
    8_757 G
    RPOC_EC_10 CGTGTTGACTATTCGGGGCGTT 88 ATTCAAGAGCCATTTCTTTTGG 89
    36_1126 CAG TAAACCAC
    RPOB_EC_37 TCAACAACCTCTTGGAGGTAAA 90 TTTCTTGAAGAGTATGAGCTGC 91
    62_3865 GCTCAGT TCCGTAAG
    RBLB_EC_68 CATCCACACGGTGGTGGTGAAG 92 TGTTTTGTATCCAAGTGCTGGT 93
    8_771 G TTACCCC
    VALS_EC_11 CGTGGCGGCGTGGTTATCGA 94 CGGTACGAACTGGATGTCGCCG 95
    05_1218 TT
    RPOB_EC_18 TATCGCTCAGGCGAACTCCAAC 96 GCTGGATTCGCCTTTGCTACG 97
    45_1929
    RPLB_EC_66 TGTAATGAACCCTAATGACCAT 98 CCAAGTGCTGGTTTACCCCATG 99
    9_761 CCACACGG GAGTA
    RPLB_EC_67 TAATGAACCCTAATGACCATCC 100 TCCAAGTGCTGGTTTACCCCAT 101
    1_762 ACACGGTG GGAG
    RPOB_EC_37 CTTGGAGGTAAGTCTCATTTTG 102 CGTATAAGCTGCACCATAAGCT 103
    75_3858 GTGGGCA TGTAATGC
    VALS_EC_18 CGACGCGCTGCGCTTCAC 104 GCGTTCCACAGCTTGTTGCAGA 105
    33_1943 AG
    RPOB_EC_13 GACCACCTCGGCAACCGT 106 TTCGCTCTCGGCCTGGCC 107
    36_1455
    TUFB_EC_22 GCACTATGCACACGTAGATTGT 108 TATAGCACCATCCATCTGAGCG 109
    5_309 CCTGG GCAC
    DNAK_EC_42 CGGCGTACTTCAACGACAGCCA 110 CGCGGTCGGCTCGTTGATGA 111
    8_522
    VALS_EC_19 CTTCTGCAACAAGCTGTGGAAC 112 TCGCAGTTCATCAGCACGAAGC 113
    20_1970 GC G
    TUFB_EC_75 AAGACGACCTGCACGGGC 114 GCGCTCCACGTCTTCACGC 115
    7_867
    23S_EC_264 CTGTTCTTAGTACGAGAGGACC 116 TTCGTGCTTAGATGCTTTCAG 117
    6_2765
    16S_EC_969 ACGCGAAGAACCTTACpC 118 ACGACACGAGCpTpGACGAC 119
    _1078_3P
    16S_EC_972 CGAAGAACpCpTTACC 120 ACACGAGCpTpGAC 121
    _1075_4P
    16S_EC_972 CGAAGAACCTTACC 122 ACACGAGCTGAC 123
    _1075
    23S_EC_- CCTGATAAGGGTGAGGTCG 124 ACGTCCTTCATCGCCTCTGA 125
    347_59
    23S_EC_- GTTGTGAGGTTAAGCGACTAAG 126 CTATCGGTCAGTCAGGAGTAT 127
    7_450
    23S_EC_- GTTGTGAGGTTAAGCGACTAAG 128 TTGCATCGGGTTGGTAAGTC 129
    7_910
    23S_EC_430 ATACTCCTGACTGACCGATAG 130 AACATAGCCTTCTCCGTCC 131
    _1442
    23S_EC_891 GACTTACCAACCCGATGCAA 132 TACCTTAGGACCGTTATAGTTA 133
    _1931 CG
    23S_EC_142 GGACGGAGAAGGCTATGTT 134 CCAAACACCGCCGTCGATAT 135
    4_2494
    23S_EC_190 CGTAACTATAACGGTCCTAAGG 136 GCTTACACACCCGGCCTATC 137
    8_2852 TA
    23S_EC_247 ATATCGACGGCGGTGTTTGG 138 GCGTGACAGGCAGGTATTC 139
    5_3209
    16S_EC_- AGTCTCAAGAGTGAACACGTAA 140 GCTGCTGGCACGGAGTTA 141
    60_525
    16S_EC_326 GACACGGTCCAGACTCCTAC 142 CCATGCAGCACCTGTCTC 143
    _1058
    16S_EC_705 GATCTGGAGGAATACCGGTG 144 ACGGTTACCTTGTTACGACT 145
    _1512
    16S_EC_126 GAGAGCAAGCGGACCTCATA 146 CCTCCTGCGTGCAAAGC 147
    8_1775
    GROL_EC_94 TGGAAGATCTGGGTCAGGC 148 CAATCTGCTGACGGATCTGAGC 149
    1_1060
    INFB_EC_11 GTCGTGAAAACGAGCTGGAAGA 150 CATGATGGTCACAACCGG 151
    03_1191
    HFLB_EC_10 TGGCGAACCTGGTGAACGAAGC 152 CTTTCGCTTTCTCGAACTCAAC 153
    82_1168 CAT
    INFB_EC_19 CGTCAGGGTAAATTCCGTGAAG 154 AACTTCGCCTTCGGTCATGTT 155
    69_2058 TTAA
    GROL_EC_21 GGTGAAAGAAGTTGCCTCTAAA 156 TTCAGGTCCATCGGGTTCATGC 157
    9_350 GC C
    VALS_EC_11 CGTGGCGGCGTGGTTATCGA 158 ACGAACTGGATGTCGCCGTT 159
    05_1214
    16S_EC_556 CGGAATTACTGGGCGTAAAG 160 CGCATTTCACCGCTACAC 161
    _700
    RPOC_EC_12 ACCCAGTGCTGCTGAACCGTGC 162 GTTCAAATGCCTGGATACCCA 163
    56_1315
    16S_EC_774 GGGAGCAAACAGGATTAGATAC 164 CGTACTCCCCAGGCG 165
    _894
    RPOC_EC_15 TGGCCCGAAAGAAGCTGAGCG 166 ACGCGGGCATGCAGAGATGCC 167
    84_1643
    16S_EC_108 ATGTTGGGTTAAGTCCCGC 168 TGACGTCATCCCCACCTTCC 169
    2_1196
    16S_EC_138 CTTGTACACACCGCCCGTC 170 AAGGAGGTGATCCAGCC 171
    9_1541
    16S_EC_130 CGGATTGGAGTCTGCAACTCG 172 GACGGGCGGTGTGTACAAG 173
    3_1407
    23S_EC_23 GGTGGATGCCTTGGC 174 GGGTTTCCCCATTCGG 175
    130
    23S_EC_187 GGGAACTGAAACATCTAAGTA 176 TTCGCTCGCCGCTAC 177
    _256
    23S_EC_160 TACCCCAAACCGACACAGG 178 CCTTCTCCCGAAGTTACG 179
    2_1703
    23S_EC_168 CCGTAACTTCGGGAGAAGG 180 CACCGGGCAGGCGTC 181
    5_1842
    23S_EC_182 GACGCCTGCCCGGTGC 182 CCGACAAGGAATTTCGCTACC 183
    7_1949
    23S_EC_243 AAGGTACTCCGGGGATAACAGG 184 AGCCGACATCGAGGTGCCAAAC 185
    4_2511 C
    23S_EC_259 GACAGTTCGGTCCCTATC 186 CCGGTCCTCTCGTACTA 187
    9_2669
    23S_EC_265 TAGTACGAGAGGACCGG 188 TTAGATGCTTTCAGCACTTATC 189
    3_2758
    23S_BS_- AAACTAGATAACAGTAGACATC 190 GTGCGCCCTTTCTAACTT 191
    68_21 AC
    16S_EC_8_3 AGAGTTTGATCATGGCTCAG 192 ACTGCTGCCTCCCGTAG 193
    58
    16S_EC_314 CACTGGAACTGAGACACGG 194 CTTTACGCCCAGTAATTCCG 195
    _575
    16S_EC_518 CCAGCAGCCGCGGTAATAC 196 GTATCTAATCCTGTTTGCTCCC 197
    _795
    16S_EC_683 GTGTAGCGGTGAAATGCG 198 GGTAAGGTTCTTCGCGTTG 199
    _985
    16S_EC_937 AAGCGGTGGAGCATGTGG 200 ATTGTAGCACGTGTGTAGCCC 201
    _1240
    16S_EC_119 CAAGTCATCATGGCCCTTA 202 AAGGAGGTGATCCAGCC 203
    5_1541
    16S_EC_8_1 ACAGTTTGATCATGGCTCAG 204 AAGGAGGTGATCCAGCC 205
    541
    23S_EC_183 ACCTGCCCAGTGCTGGAAG 206 TCGCTACCTTAGGACCGT 207
    1_1936
    16S_EC_138 GCCTTGTACACACCTCCCGTC 208 CACGGCTACCTTGTTACGAC 209
    7_1513
    16S_EC_139 TTGTACACACCGCCCGTCATAC 210 CCTTGTTACGACTTCACCCC 211
    0_1505
    16S_EC_136 TACGGTGAATACGTTCCCGGG 212 ACCTTGTTACGACTTCACCCCA 213
    7_1506
    16S_EC_804 ACCACGCCGTAAACGATGA 214 CCCCCGTCAATTCCTTTGAGT 215
    _929
    16S_EC_791 GATACCCTGGTAGTCCACACCG 216 GCCTTGCGACCGTACTCCC 217
    _904
    16S_EC_789 TAGATACCCTGGTAGTCCACGC 218 GCGACCGTACTCCCCAGG 219
    _899
    16S_EC_109 TAGTCCCGCAACGAGCGC 220 GACGTCATCCCCACCTTCCTCC 221
    2_1195
    23S_EC_258 TAGAACGTCGCGAGACAGTTCG 222 AGTCCATCCCGGTCCTCTCG 223
    6_2677
    HEXAMER_EC GAGGAAAGTCCGGGCTC 224 ATAAGCCGGGTTCTGTCG 225
    61_362
    RNASEP_BS GAGGAAAGTCCATGCTCGC 226 GTAAGCCATGTTTTGTTCCATC 227
    43_384
    RNASEP_EC GAGGAAAGTCCGGGCTC 228 ATAAGCCGGGTTCTGTCG 229
    61_362
    YAED_TRNA GCGGGATCCTCTAGAGGTGTTA 230 GCGGGATCCTCTAGAAGACCTC 231
    ALA- AATAGCCTGGCAG CTGCGTGCAAAGC
    RRNH_EC_51
    3_49
    RNASEP_SA GAGGAAAGTCCATGCTCAC 232 ATAAGCCATGTTCTGTTCCATC 233
    31_379
    16S_EC_108 ATGTTGGGTTAAGTCCCGC 234 AAGGAGGTGATCCAGCC 235
    2_1541
    16S_EC_556 CGGAATTACTGGGCGTAAAG 236 GTATCTAATCCTGTTTGCTCCC 237
    _795
    16S_EC_108 ATGTTGGGTTAAGTCCCGC 238 TGACGTCATGCCCACCTTCC 239
    2_1196_10G
    16S_EC_108 ATGTTGGGTTAAGTCCCGC 240 TGACGTCATGGCCACCTTCC 241
    2_1196_10G
    _11G
    TRNA_ILERR GCGGGATCCTCTAGACCTGATA 242 GCGGGATCCTCTAGAGCGTGAC 243
    NH_ASPRRNH AGGGTGAGGTCG AGGCAGGTATTC
    _EC_32_41
    16S_EC_969 ACGCGAAGAACCTTACC 244 GACGGGCGGTGTGTACAAG 245
    _1407
    16S_EC_683 GTGTAGCGGTGAAATGCG 246 CGAGTTGCAGACTGCGATCCG 247
    _1323
    16S_EC_49 TAACACATGCAAGTCGAACG 248 CGTACTCCCCAGGCG 249
    894
    16S_EC_49 TAACACATGCAAGTCGAACG 250 ACGACACGAGCTGACGAC 251
    1078
    CYA_BA_134 ACAACGAAGTACAATACAAGAC 252 CTTCTACATTTTTAGCCATCAC 253
    9_1447
    16S_EC_109 TTAAGTCCCGCAACGAGCGCAA 254 TGACGTCATCCCCACCTTCCTC 255
    0_1196_2
    16S_EC_405 TGAGTGATGAAGGCCTTACGGT 256 CGGCTGCTGGCACGAAGTTAG 257
    _527 TGTAAA
    GROL_EC_49 ATGGACAAGGTTGGCAAGGAAG 258 TAGCCGCGGTCGAATTGCAT 259
    6_596 G
    GROL_EC_51 AAGGAAGGCGTGATCACCGTTG 260 CCGCGGTCGAATTGCATGCCTT 261
    1_593 AAGA C
    VALS_EC_18 ACGCGCTGCGCTTCAC 262 TTGCAGAAGTTGCGGTAGCC 263
    35_1928
    RPOB_EC_13 TCGACCACCTGGGCAACC 264 ATCAGGTCGTGCGGCATCA 265
    34_1478
    DNAK_EC_42 CACGGTGCCGGCGTACT 266 GCGGTCGGCTCGTTGATGAT 267
    0_521
    RPOB_EC_37 TTGGAGGTAAGTCTCATTTTGG 268 AAGCTGCACCATAAGCTTGTAA 269
    76_3853 TGG TGC
    RPOB_EC_38 CAGCGTTTCGGCGAAATGGA 270 CGACTTGACGGTTAACATTTCC 271
    02_3885 TG
    RPOB_EC_37 GGGCAGCGTTTCGGCGAAATGG 272 GTCCGACTTGACGGTCAACATT 273
    99_3888 A TCCTG
    RPOC_EC_21 CAGGAGTCGTTCAACTCGATCT 274 ACGCCATCAGGCCACGCAT 275
    46_2245 ACATGAT
    ASPS_EC_40 GCACAACCTGCGGCTGCG 276 ACGGCACGAGGTAGTCGC 277
    5_538
    RPOC_EC_13 CGCCGACTTCGACGGTGACC 278 GAGCATCAGCGTGCGTGCT 279
    74_1455
    TUFB_EC_95 CCACACGCCGTTCTTCAACAAC 280 GGCATCACCATTTCCTTGTCCT 281
    7_1058 T TCG
    16S_EC_7_1 GAGAGTTTGATCCTGGCTCAGA 282 TGTTACTCACCCGTCTGCCACT 283
    22 ACGAA
    VALS_EC_61 ACCGAGCAAGGAGACCAGC 284 TATAACGCACATCGTCAGGGTG 285
    0_727 A
  • For evaluation in the laboratory, five species of bacteria were selected including three γ-proteobacteria (E. coli, K pneumoniae and P. auergiosa) and two low G+C gram positive bacteria (B. subtilitis and S. aureus). The identities of the organisms were not revealed to the laboratory technicians.
  • Bacteria were grown in culture, DNA was isolated and processed, and PCR performed using standard protocols. Following PCR, all samples were desalted, concentrated, and analyzed by Fourier Transform Ion Cyclotron Resonance (FTICR) mass spectrometry. Due to the extremely high precision of the FTICR, masses could be measured to within 1 Da and unambiguously deconvoluted to a single base composition. The measured base compositions were compared with the known base composition signatures in our database. As expected when using broad range survey 16S primers, several phylogenetic near-neighbor organisms were difficult to distinguish from our test organisms. Additional non-ribosomal primers were used to triangulate and further resolve these clusters.
  • An example of the use of primers directed to regions of RNA polymerase B (rpoB) is shown in FIG. 19. This gene has the potential to provide broad priming and resolving capabilities. A pair of primers directed against a conserved region of rpoB provided distinct base composition signatures that helped resolve the tight enterobacteriae cluster. Joint probability estimates of the signatures from each of the primers resulted in the identification of a single organism that matched the identity of the test sample. Therefore a combination of a small number of primers that amplify selected regions of the 16S ribosomal RNA gene and a few additional primers that amplify selected regions of protein encoding genes provide sufficient information to detect and identify all bacterial pathogens.
  • Example 16 Detection of Staphylococcus aureus in Blood Samples
  • Blood samples in an analysis plate were spiked with genomic DNA equivalent of 103 organisms/ml of Staphylococcus aureus. A single set of 16S rRNA primers was used for amplification. Following PCR, all samples were desalted, concentrated, and analyzed by Fourier Transform Ion Cyclotron Resonance (FTICR) mass spectrometry. In each of the spiked wells, strong signals were detected which are consistent with the expected BCS of the S. aureus amplicon (FIG. 20). Furthermore, there was no robotic carryover or contamination in any of the blood only or water blank wells. Methods similar to this one will be applied for other clinically relevant samples including, but not limited to: urine and throat or nasal swabs.
  • Example 17 Detection and Serotyping of Viruses
  • The virus detection capability of the present invention was demonstrated in collaboration with Naval health officers using adenoviruses as an example.
  • All available genomic sequences for human adenoviruses available in public databases were surveyed. The hexon gene was identified as a candidate likely to have broad specificity across all serotypes. Four primer pairs were selected from a group of primers designed to yield broad coverage across the majority of the adenoviral strain types (Table 9) wherein Tp=5′propynylated uridine and Cp=5′propynylated cytidine.
  • TABLE 9
    Intelligent Primer Pairs for Serotyping of Adenoviruses
    Forward Reverse
    Primer Pair Forward Primer SEQ ID Reverse Primer SEQ ID
    Name Sequence NO: Sequence NO:
    HEX_HAD7 + 4 + 2 AGACCCAATTACATTGGCTT 286 CCACTGCTGTTGTAGTACAT 287
    1_934_995
    HEX_HAD7 + 4 + 2 ATGTACTACAACAGTACTGG 288 CAAGTCAACCACAGCATTCA 289
    1_976_1050
    HEX_HAD7 + 4 + 2 GGGCTTATGTACTACAACAG 290 TCTGTCTTGCAAGTCAACCAC 291
    1_970_1059
    HEX_HAD7 + 3_7 GGAATTTTTTGATGGTAGAGA 292 TAAAGCACAATTTCAGGCG 293
    71_827
    HEX_HAD4 + 16 TAGATCTGGCTTTCTTTGAC 294 ATATGAGTATCTGGAGTCTGC 295
    746_848
    HEX_HAD7_509 GGAAAGACATTACTGCAGACA 296 CCAACTTGAGGCTCTGGCTG 297
    _578
    HEX_HAD4_121 ACAGACACTTACCAGGGTG 298 ACTGTGGTGTCATCTTTGTC 299
    6_1289
    HEX_HAD21_51 TCACTAAAGACAAAGGTCTTCC 300 GGCTTCGCCGTCTGTAATTTC 301
    5_567
    HEX_HAD_1342 CGGATCCAAGCTAATCTTTGG 302 GGTATGTACTCATAGGTGTTG 303
    _1469 GTG
    HEX_HAD7 + 4 + 2 AGACpCpCAATTpACpATpTGG 304 CpCpAGTGCTGTpTpGTAGTA 305
    1_934_995P CTT CAT
    HEX_HAD7 + 4 + 2 ATpGTpACTpACAACAGTACpT 306 CAAGTpCpAACCACAGCATpT 307
    1_976_1050P pGG pCA
    HEX_HAD7 + 4 + 2 GGGCpTpTATpGTpACTACAAC 308 TCTGTpCpTTGCAAGTpCpAA 309
    1_970_1059P pAG CCAC
    HEX_HAD7 + 3_7 GGAATTpTpTpTpTGATGGTAG 310 TAAAGCACAATpTpTpCpAGG 311
    71_827P AGA CG
    HEX_HAD4 + 16 TAGATCTGGCTpTpTpCpTTTG 312 ATATGAGTATpCpTpGGAGTp 313
    746_848P AC CpTGC
    HEX_HAD_1342 CGGATpCCAAGCpTAATCpTpT 314 GGTATGTACTCATAGGTCTpT 315
    _1469P TGG pGGTG
    HEX_HAD7 + 21 + AACAGACCCAATTACATTGGCT 316 GAGGCACTTGTATGTGGAAAG 317
    3_931_1645 T G
    HEX_HAD4 + 2_9 ATGCCTAACAGACCCAATTACA 318 TTCATGTAGTCGTAGGTGTTG 319
    25_1469 T G
    HEX_HAD7 + 21 + CGCGCCTAATACATCTCAGTGG 320 AAGCCAATGTAATTGCGTCTG 321
    3_384_953 AT TT
    HEX_HAD4 + 2_3 CTACTCTGGCACTGCCTACAAC 322 ATGTAATTGGGTCTGTTAGGC 323
    45_947 AT
    HEX_HAD2_772 CAATCCGTTCTGGTTCCGGATG 324 CTTGCCGGTCGTTCAAAGAGG 325
    _865 AA TAG
    HEX_HAD7 + 4 + 2 AGTCCGGGTCTGGTGCAG 326 CGGTCGGTGGTCACATC 327
    1_73_179
    HEX_HAD7 + 4 + 2 ATGGCCACCCCATCGATG 328 CTGTCCGGCGATGTGCATG 329
    1_1_54
    HEX_HAD7 + 4 + 2 GGTCGTTATGTGCCTTTCCACA 330 TCCTTTCTGAAGTTCCACTCA 331
    1_1612_1718 T TAGG
    HEX_HAD7 + 4 + 2 ACAACATTGGCTACCAGGGCTT 332 CCTGCCTGCTCATAGGCTGGA 333
    1_2276_2368 AGTT
  • These primers also served to clearly distinguish those strains responsible for most disease (types 3, 4, 7 and 21) from all others. DNA isolated from field samples known to contain adenoviruses were tested using the hexon gene PCR primers, which provided unambiguous strain identification for all samples. A single sample was found to contain a mixture of two viral DNAs belonging to strains 7 and 21.
  • Test results (FIG. 21) showed perfect concordance between predicted and observed base composition signatures for each of these samples. Classical serotyping results confirmed each of these observations. Processing of viral samples directly from collection material such as throat swabs rather than from isolated DNA, will result in a significant increase in throughput, eliminating the need for virus culture.
  • Example 18 Broad Rapid Detection and Strain Typing of Respiratory Pathogens for Epidemic Surveillance
  • Genome preparation: Genomic materials from culture samples or swabs were prepared using a modified robotic protocol using DNeasy™ 96 Tissue Kit, Qiagen). Cultures of Streptococcus pyogenes were pelleted and transferred to a 1.5 mL tube containing 0.45 g of 0.7 mm Zirconia beads (Biospec Products, Inc.). Cells were lysed by shaking for 10 minutes at a speed of 19 l/s using a MM300 Vibration Mill (Retsch, Germany). The samples were centrifuged for 5 min and the supernatants transferred to deep well blocks and processed using the manufacture's protocol and a Qiagen 8000 BioRobot.
  • PCR: PCR reactions were assembled using a Packard MPII liquid handling platform and were performed in 50 μL volume using 1.8 units each of Platinum Taq (Invitrogen) and Hotstart PFU Turbo (Stratagene) polymerases. Cycling was performed on a DNA Engine Dyad (MJ Research) with cycling conditions consisting of an initial 2 min at 95° C. followed by 45 cycles of 20 at 95° C., 15 s at 58° C., and 15 s at 72° C.
  • Broad-range primers: PCR primer design for base composition analysis from precise mass measurements is constrained by an upper limit where ionization and accurate deconvolution can be achieved. Currently, this limit is approximately 140 base pairs. Primers designed to broadly conserved regions of bacterial ribosomal RNAs (16 and 23 S) and the gene encoding ribosomal protein L3 (rpoC) are shown in Table 10.
  • TABLE 10
    Broad Range Primer Pairs
    SEQ Length
    Target Direc- ID of
    Gene tion Primer NO Amplicon
    16S_1 F GGATTAGAGACCCTGGTAGTCC 334 116
    16S_1 R GGCCGTACTCCCCAGGCG 335 116
    16S_2 F TTCGATGCAACGCGAAGAACCT 336 115
    16S_2 R ACGAGCTGACGACAGCCATG 337 115
    23S F TCTGTCCCTAGTACGAGAGGACCGG 338 118
    23S R TGCTTAGATGCTTTCAGC 339 118
    rpoC F CTGGCAGGTATGCGTGGTCTGATG 340 121
    rpoC R CGCACCGTGGGTTGAGATGAAGTAC 341 121
  • Emm-typing primers: The allelic profile of a GAS strain by Multilocus Sequencing Technique (MLST) can be obtained by sequencing the internal fragments of seven housekeeping genes. The nucleotide sequences for each of these housekeeping genes, for 212 isolates of GAS (78 distinct emm types), are available (www.mlst.net). This corresponds to one hundred different allelic profiles or unique sequence types, referred to by Enright et al. as ST1-ST100 (Enright, M. C., et al., Infection and Immunity 2001, 69, 2416-2427). For each sequence type, we created a virtual transcript by concatenating sequences appropriate to their allelic profile from each of the seven genes. MLST primers were designed using these sequences and were constrained to be within each gene loci. Twenty-four primer pairs were initially designed and tested against the sequenced GAS strain 700294. A final subset of six primer pairs Table 11 was chosen based on a theoretical calculation of minimal number of primer pairs that maximized resolution of between emm types.
  • TABLE 11
    Drill-Down Primer Pairs Used in Determining
    emm-type
    Length
    SEQ of
    Target Direc- ID Ampli-
    Gene tion Primer NO con
    gki F GGGGATTCAGCCATCAAAGCAGCTATTGA 342 116
    C
    gki R CCAACCTTTTCCACAACAGAATCAGC 343 116
    gtr F CCTTACTTCGAACTATGAATCTTTTGGAA 344 115
    G
    gtr R CCCATTTTTTCACGCATGCTGAAAATATC 345 115
    murI F CGCAAAAAAATCCAGCTATTAGC 346 118
    murI R AAACTATTTTTTTAGCTATACTCGAACAC 347 118
    mutS F ATGATTACAATTCAAGAAGGTCGTCACGC 348 121
    mutS R TTGGACCTGTAATCAGCTGAATACTGG 349 121
    xpt F GATGACTTTTTAGCTAATGGTCAGGCAGC 350 122
    xpt R AATCGACGACCATCTTGGAAAGATTTCTC 351 122
    yqiL F GCTTCAGGAATCAATGATGGAGCAG 352 119
    yqiL R GGGTCTACACCTGCACTTGCATAAC 353 119
  • Microbiology: GAS isolates were identified from swabs on the basis of colony morphology and beta-hemolysis on blood agar plates, gram stain characteristics, susceptibility to bacitracin, and positive latex agglutination reactivity with group A-specific antiserum.
  • Sequencing: Bacterial genomic DNA samples of all isolates were extracted from freshly grown GAS strains by using QIAamp DNA Blood Mini Kit (Qiagen, Valencia, Calif.) according to the procedures described by the manufacture. Group A streptococcal cells were subjected to PCR and sequence analysis using emm-gene specific PCR as previously described (Beall, B., et al. J. Clin. Micro., 1996, 34, 953-958; Facklam, R., et al. Emerg. Infect. Dis. 1999, 5, 247-253). Homology searches on DNA sequences were conducted against known emm sequences present in (www.cdc.gov/ncidod/biotech/infotech_hp.html). For MLST analysis, internal fragments of seven housekeeping genes, were amplified by PCR and analyzed as previously described (Enright, M. C., et al., Infection and Immunity 2001, 69, 2416-2427). The emm-type was determined from comparison to the MLST database.
  • Broad Range Survey/Drill-Down Process (100): For Streptococcus pyogenes, the objective was the identification of a signature of the virulent epidemic strain and determination of its emm-type. Emm-type information is useful both for treatment considerations and epidemic surveillance. A total of 51 throat swabs were taken both from healthy recruits and from hospitalized patients in December 2002, during the peak of a GAS outbreak at a military training camp. Twenty-seven additional isolates from previous infections ascribed to GAS were also examined. Initially, isolated colonies were examined both from throat culture samples and throat swabs directly without the culture step. The latter path can be completed within 6-12 hours providing information on a significant number of samples rapidly enough to be useful in managing an ongoing epidemic.
  • The process of broad range survey/drill-down (200) is shown in FIG. 22. A clinical sample such as a throat swab is first obtained from an individual (201). Broad range survey primers are used to obtain amplification products from the clinical sample (202) which are analyzed to determine a BCS (203) from which a species is identified (204). Drill-down primers are then employed to obtain PCR products (205) from which specific information is obtained about the species (such as Emm-type) (206).
  • Broad Range Survey Priming: Genomic regions targeted by the broad range survey primers were selected for their ability to allow amplification of virtually all known species of bacteria and for their capability to distinguish bacterial species from each other by base composition analysis. Initially, four broad-range PCR target sites were selected and the primers were synthesized and tested. The targets included universally conserved regions of 16S and 23S rRNA, and the gene encoding ribosomal protein L3 (rpoC).
  • While there was no special consideration of Streptococcus pyogenes in the selection of the broad range survey primers (which were optimized for distinguishing all important pathogens from each other), analysis of genomic sequences showed that the base compositions of these regions distinguished Streptococcus pyogenes from other respiratory pathogens and normal flora, including closely related species of streptococci, staphylococci, and bacilli (FIG. 23).
  • Drill Down Priming (Emm-Typing): In order to obtain strain-specific information about the epidemic, a strategy was designed to measure the base compositions of a set of fast clock target genes to generate strain-specific signatures and simultaneously correlate with emm-types. In classic MLST analysis, internal fragments of seven housekeeping genes (gki, gtr, muri, mutS, recP, xpt, yqiL) are amplified, sequenced and compared to a database of previously studied isolates whose emm-types have been determined (Horner, M. J., et al. Fundamental and Applied Toxicology, 1997, 36, 147). Since the analysis enabled by the present embodiment of the present invention provides base composition data rather than sequence data, the challenge was to identify the target regions that provide the highest resolution of species and least ambiguous emm-classification. The data set from Table 2 of Enright et al. (Enright, M. C., et al. Infection and Immunity, 2001, 69, 2416-2427) to bioinformatically construct an alignment of concatenated alleles of the seven housekeeping genes from each of 212 previously emm-typed strains, of which 101 were unique sequences that represented 75 distinct emm-types. This alignment was then analyzed to determine the number and location of the optimal primer pairs that would maximize strain discrimination strictly on base composition data.
  • An example of assignment of BCSs of PCR products is shown in FIG. 24 where PCR products obtained using the gtr primer (a drill-down emm-typing primer) from two different swab samples were analyzed (sample 12—top and sample 10—bottom). The deconvoluted ESI-FCTIR spectra provide accurate mass measurements of both strands of the PCR products, from which a series of candidate BCSs were calculated from the measured mass (and within the measured mass uncertainty). The identification of complementary candidate BCSs from each strand provides a means for unambiguous assignment of the BCS of the PCR product. BCSs and molecular masses for each strand of the PCR product from the two different samples are also shown in FIG. 24. In this case, the determination of BCSs for the two samples resulted in the identification of the emm-type of Streptococcus pyogenes-sample 12 was identified as emm-type 3 and sample 10 was identified as emm-type 6.
  • The results of the composition analysis using the six primer pairs, 5′-emm gene sequencing and MLST gene sequencing method for the GAS epidemic at a military training facility are compared in FIG. 25. The base composition results for the six primer pairs showed a perfect concordance with 5′-emm gene sequencing and MLST sequencing methods. Of the 51 samples taken during the peak of the epidemic, all but three had identical compositions and corresponded to emm-type 3. The three outliers, all from healthy individuals, probably represent non-epidemic strains harbored by asymptomatic carriers. Samples 52-80, which were archived from previous infections from Marines at other naval training facilities, showed a much greater heterogeneity of composition signatures and emm-types.
  • Example 19 Base Composition Probability Clouds
  • FIG. 18 illustrates the concept of base composition probability clouds via a pseudo-four dimensional plot of base compositions of enterobacteria including Y. pestis, Y. psuedotuberculosis, S. typhimurium, S. typhi, Y. enterocolitica, E. coli K12, and E. coli O157:H7. In the plot of FIG. 18, A, C and G compositions correspond to the x, y and z axes respectively whereas T compositions are represented by the size of the sphere at the junction of the x, y and z coordinates. There is no absolute requirement for having a particular nucleobase composition associated with a particular axis. For example, a plot could be designed wherein G, T and C compositions correspond to the x, y and z axes respectively whereas the A composition corresponds to the size of the sphere at the junction of the x, y and z coordinates. Furthermore, a different representation can be made of the “pseudo fourth” dimension i.e.: other than the size of the sphere at junction of the x, y and z coordinates. For example, a symbol having vector information such as an arrow or a cone can be rotated at an angle which varies proportionally with the composition of the nucleobase corresponding to the pseudo fourth dimension. The choice of axes and pseudo fourth dimensional representation is typically made with the aim of optimal visualization of the data being presented.
  • A similar base composition probability cloud analysis has been presented for a series of viruses in U.S. provisional patent application Ser. No. 60/431,319, which is commonly owned and incorporated herein by reference in its entirety. In this base composition probability cloud analysis, the closely related Dengue virus types 1-4 are clearly distinguishable from each other. This example is indicative of a challenging scenario for species identification based on BCS analysis because RNA viruses have a high mutation rate, it would be expected to be difficult to resolve closely related species. However, as this example illustrates, BCS analysis, aided by base composition probability cloud analysis is capable of resolution of closely related viral species.
  • A base composition probability cloud can also be represented as a three dimensional plot instead of a pseudo-four dimensional plot. An example of such a three dimensional plot is a plot of G, A and C compositions correspond to the x, y and z axes respectively, while the composition of T is left out of the plot. Another such example is a plot where the compositions of all four nucleobases is included: G, A and C+T compositions correspond to the x, y and z axes respectively. As for the pseudo-four dimensional plots, the choice of axes for a three dimensional plot is typically made with the aim of optimal visualization of the data being presented.
  • Example 20 Biochemical Processing of Large Amplification Products for Analysis by Mass Spectrometry
  • In the example illustrated in FIG. 26, a primer pair which amplifies a 986 bp region of the 16S ribosomal gene in E. coli (K12) was digested with a mixture of 4 restriction enzymes: BstNI, BsmFI, Bfal, and NcoI. FIG. 26( a) illustrates the complexity of the resulting ESI-FTICR mass spectrum which contains multiple charge states of multiple restriction fragments. Upon mass deconvolution to neutral mass, the spectrum is significantly simplified and discrete oligonucleotide pairs are evident (FIG. 26 b). When base compositions are derived from the masses of the restriction fragments, perfect agreement is observed for the known sequence of nucleotides 1-856 (FIG. 26 c); the batch of NcoI enzyme used in this experiment was inactive and resulted in a missed cleavage site and a 197-mer fragment went undetected as it is outside the mass range of the mass spectrometer under the conditions employed. Interestingly however, both a forward and reverse strand were detected for each fragment measured (solid and dotted lines in, respectively) within 2 ppm of the predicted molecular weights resulting in unambiguous determination of the base composition of 788 nucleotides of the 985 nucleotides in the amplicon. The coverage map offers redundant coverage as both 5′ to 3′ and 3′ to 5′ fragments are detected for fragments covering the first 856 nucleotides of the amplicon.
  • This approach is in many ways analogous to those widely used in MS-based proteomics studies in which large intact proteins are digested with trypsin, or other proteolytic enzyme(s), and the identity of the protein is derived by comparing the measured masses of the tryptic peptides with theoretical digests. A unique feature of this approach is that the precise mass measurements of the complementary strands of each digest product allow one to derive a de novo base composition for each fragment, which can in turn be “stitched together” to derive a complete base composition for the larger amplicon. An important distinction between this approach and a gel-based restriction mapping strategy is that, in addition to determination of the length of each fragment, an unambiguous base composition of each restriction fragment is derived. Thus, a single base substitution within a fragment (which would not be resolved on a gel) is readily observed using this approach. Because this study was performed on a 7 Tesla ESI-FTICR mass spectrometer, better than 2 ppm mass measurement accuracy was obtained for all fragments. Interestingly, calculation of the mass measurement accuracy required to derive unambiguous base compositions from the complementary fragments indicates that the highest mass measurement accuracy actually required is only 15 ppm for the 139 bp fragment (nucleotides 525-663). Most of the fragments were in the 50-70 bp size-range which would require mass accuracy of only ˜50 ppm for unambiguous base composition determination. This level of performance is achievable on other more compact, less expensive MS platforms such as the ESI-TOF suggesting that the methods developed here could be widely deployed in a variety of diagnostic and human forensic arenas.
  • This example illustrates an alternative approach to derive base compositions from larger PCR products. Because the amplicons of interest cover many strain variants, for some of which complete sequences are not known, each amplicon can be digested under several different enzymatic conditions to ensure that a diagnostically informative region of the amplicon is not obscured by a “blind spot” which arises from a mutation in a restriction site. The extent of redundancy required to confidently map the base composition of amplicons from different markers, and determine which set of restriction enzymes should be employed and how they are most effectively used as mixtures can be determined. These parameters will be dictated by the extent to which the area of interest is conserved across the amplified region, the compatibility of the various restriction enzymes with respect to digestion protocol (buffer, temperature, time) and the degree of coverage required to discriminate one amplicon from another.
  • Example 21 Identification of members of the Viral Genus Orthopoxvirus
  • Primer sites were identified on three essential viral genes—the DNA-dependent polymerase (DdDp), and two sub-units of DNA-dependent RNA polymerases A and B (DdRpA and DdRpB). These intelligent primers designed to identify members of the viral genus Orthopoxvirus are shown in Table 12 wherein Tp=5′propynylated uridine and Cp=5′propynylated cytidine.
  • TABLE 12
    Intelligent Primer Pairs for Identification of members of the Viral
    Genus Orthopoxvirus
    Forward Reverse
    Primer Pair Forward Primer SEQ ID Reverse Primer SEQ ID
    Name Sequence NO: Sequence NO:
    A25L_NC00161 GTACTGAATCCGCCTAAG 354 GTGAATAAAGTATCGCCCTAA 355
    1_28_127 TA
    A18R_NC00161 GAAGTTGAACCGGGATCA 356 ATTATCGGTCGTTGTTAATGT 357
    1_100_207
    A18R_NC00161 CTGTCTGTAGATAAACTAGGAT 358 CGTTCTTCTCTGGAGGAT 359
    1_1348_1445 T
    E9L_NC001611 CGATACTACGGACGC 360 CTTTATGAATTACTTTACATA 361
    _1119_1222 T
    K8R_NC001611 CTCCTCCATCACTAGGAA 362 CTATAACATTGAAAGCTTATT 363
    _221_311 G
    A24R_NC00161 CGCGATAATAGATAGTGCTAAA 364 GCTTCCACCAGGTCATTAA 365
    1_795_878 C
    A25L_NC00161 GTACpTpGAATpCpCpGCpCpT 366 GTGAATAAAGTATpCpGCpCp 367
    1_28_127P AAG CpTpAATA
    A18R_NC00161 GAAGTpTpGAACpCpGGGATCA 368 ATTATCGGTpCpGTpTpGTpT 369
    1_100_207P pAATGT
    A18R_NC00161 CTGTpCpTpGTAGATAAACpTp 370 CGTTCpTpTpCpTpCpTpGGA 371
    1_1348_1445P AGGATT GGAT
    E9L_NC001611 CGATACpTpACpGGACGC 372 CTTTATGAATpTpACpTpTpT 373
    _1119_1222P pACATAT
    K8R_NC001611 CTpCpCpTCpCpATCACpTpAG 374 CTATAACATpTpCpAAAGCpT 375
    _221_311P GAA pTpATTG
    A24R_NC00161 CGCGATpAATpAGATAGTpGCp 376 GCTTCpCpACpCAGGTpCATp 377
    1_795_8782 TpAAAC TAA
  • As illustrated in FIG. 27, members of the Orthopoxvirus genus group can be identified, distinguished from one another, and distinguished from other members of the Poxvirus family using a single pair of primers designed against the DdRpB gene.
  • Since the primers were designed across regions of high conservation within this genus, the likelihood of missed detection due to sequence variations at these sites is minimized. Further, none of the primers is expected to amplify other viruses or any other DNA, based on the data available in GenBank. This method can be used for all families of viral threat agents and is not limited to members of the Orthopoxvirus genus.
  • Example 22 Identification of Viruses that Cause Viral Hemorrhagic Fevers
  • In accordance with the present invention an approach of broad PCR priming across several different viral species is employed using conserved regions in the various viral genomes, amplifying a small, yet highly informative region in these organisms, and then analyzing the resultant amplicons with mass spectrometry and data analysis. These regions will be tested with live agents, or with genomic constructs thereof.
  • Detection of RNA viruses will necessitate a reverse transcription (RT) step prior to the PCR amplification of the TIGER reporter amplicon. To maximize throughput and yield while minimizing the handling of the samples, commercial one-step reverse transcription polymerase chain reaction (RT-PCR) kits will be evaluated for use. If necessary, a one-step RT-PCR mix using our selected DNA polymerase for the PCR portion of the reaction will be developed. To assure there is no variation in our reagent performance all new lots of enzymes, nucleotides and buffers will be individually tested prior to use.
  • Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in the present application is incorporated herein by reference in its entirety

Claims (8)

1-22. (canceled)
23. A method of identifying a bioagent comprising the steps of: selecting at least one pair of oligonucleotide primers, wherein one member of said pair of primers hybridizes to a first conserved region of nucleic acid from said bioagent and the other member of said pair of primers hybridizes to a second conserved region of nucleic acid from said bioagent, wherein said first and second conserved regions flank a variable nucleic acid region that when amplified creates a unique base composition signature among at least five bioagents; amplifying nucleic acid from at least one said bioagent with said pair of oligonucleotide primers to produce an amplification product; determining the molecular mass of said amplification product by mass spectrometry; calculating the base composition of said amplification product from said molecular mass; comparing said base composition of at least one said bioagent to five or more calculated or measured base compositions of amplification products of known bioagents produced by using said at least one pair of oligonucleotide primers, thereby identifying said bioagent.
24. The method of claim 23, wherein said comparing comprises comparing said base composition of at least one said bioagent to nineteen or more calculated or measured base compositions of amplification products of known bioagents produced by using said at least one pair of oligonucleotide primers.
25. The method of claim 23, wherein said bioagent is a bacterium, virus, mold, fungus or parasite.
26. A method of identifying a bioagent comprising the steps of: selecting at least one pair of oligonucleotide primers, wherein one member of said pair of primers hybridizes to a first conserved region of a nucleic acid encoding a protein that participates in translation, replication, recombination, repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, uptake, secretion, antibiotic resistance, virulence, or pathogenicity, and the other member of said pair of primers hybridizes to a second conserved region of said nucleic acid encoding a protein that participates in translation, replication, recombination, repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, uptake, secretion, antibiotic resistance, virulence, or pathogenicity, wherein said first and second conserved regions flank a variable nucleic acid region that when amplified creates unique base composition signatures among at least five bioagents; amplifying nucleic acid from at least one said bioagent with said pair of oligonucleotide primers to produce an amplification product; determining the molecular mass of said amplification product by mass spectrometry; calculating the base composition of said amplification product from said molecular mass; comparing said base composition of at least one said bioagent to five or more calculated or measured base compositions of amplification products of known bioagents produced by using said at least one pair of oligonucleotide primers, thereby identifying said bioagent.
27. The method of claim 26, wherein said molecular masses of said amplification products are determined by ES1-TOF mass spectrometry.
28. The method of claim 26, wherein said bioagent is a bacterium, virus, mold, fungus or parasite.
29. The method of claim 26, wherein said comparing comprises comparing said base composition of at least one said bioagent to nineteen or more calculated or measured base compositions of amplification products of known bioagents produced by using said at least one pair of oligonucleotide primers.
US11/869,449 2001-03-02 2007-10-09 Methods For Rapid Identification Of Pathogens In Humans And Animals Abandoned US20080311558A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
US09/798,007 US20030027135A1 (en) 2001-03-02 2001-03-02 Method for rapid detection and identification of bioagents
US43131902P true 2002-12-06 2002-12-06
US10/323,233 US20040121309A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues
US10/325,527 US20040121335A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US10/326,051 US20040121313A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in organs for transplantation
US10/325,526 US20040121311A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in livestock
US44344303P true 2003-01-29 2003-01-29
US44378803P true 2003-01-30 2003-01-30
US44752903P true 2003-02-14 2003-02-14
US10/660,122 US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals
US11/869,449 US20080311558A1 (en) 2001-03-02 2007-10-09 Methods For Rapid Identification Of Pathogens In Humans And Animals

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US11/869,449 US20080311558A1 (en) 2001-03-02 2007-10-09 Methods For Rapid Identification Of Pathogens In Humans And Animals
US11/929,910 US8214154B2 (en) 2001-03-02 2007-10-30 Systems for rapid identification of pathogens in humans and animals

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/660,122 Continuation US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/929,910 Continuation US8214154B2 (en) 2001-03-02 2007-10-30 Systems for rapid identification of pathogens in humans and animals

Publications (1)

Publication Number Publication Date
US20080311558A1 true US20080311558A1 (en) 2008-12-18

Family

ID=32512832

Family Applications (7)

Application Number Title Priority Date Filing Date
US10/325,526 Abandoned US20040121311A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in livestock
US10/325,527 Abandoned US20040121335A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US10/323,233 Abandoned US20040121309A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues
US10/326,051 Abandoned US20040121313A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in organs for transplantation
US10/660,122 Active 2022-11-10 US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals
US11/869,449 Abandoned US20080311558A1 (en) 2001-03-02 2007-10-09 Methods For Rapid Identification Of Pathogens In Humans And Animals
US11/929,910 Active US8214154B2 (en) 2001-03-02 2007-10-30 Systems for rapid identification of pathogens in humans and animals

Family Applications Before (5)

Application Number Title Priority Date Filing Date
US10/325,526 Abandoned US20040121311A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in livestock
US10/325,527 Abandoned US20040121335A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US10/323,233 Abandoned US20040121309A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues
US10/326,051 Abandoned US20040121313A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in organs for transplantation
US10/660,122 Active 2022-11-10 US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/929,910 Active US8214154B2 (en) 2001-03-02 2007-10-30 Systems for rapid identification of pathogens in humans and animals

Country Status (5)

Country Link
US (7) US20040121311A1 (en)
EP (1) EP1581657A4 (en)
JP (1) JP2006508696A (en)
CA (1) CA2508584A1 (en)
WO (1) WO2004052175A2 (en)

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070243544A1 (en) * 2003-09-11 2007-10-18 Rangarajan Sampath Compositions for use in identification of bacteria
US20090047665A1 (en) * 2003-09-11 2009-02-19 Ibis Biosciences, Inc. Compositions for use in identification of adenoviruses
US20090263809A1 (en) * 2008-03-20 2009-10-22 Zygem Corporation Limited Methods for Identification of Bioagents
US20100323362A1 (en) * 2009-06-23 2010-12-23 Gen-Probe Incorporated Compositions and methods for detecting nucleic acid from mollicutes
WO2011047307A1 (en) 2009-10-15 2011-04-21 Ibis Biosciences, Inc. Multiple displacement amplification
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US8046171B2 (en) 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8071309B2 (en) 2002-12-06 2011-12-06 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9068017B2 (en) 2010-04-08 2015-06-30 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US9393564B2 (en) 2009-03-30 2016-07-19 Ibis Biosciences, Inc. Bioagent detection systems, devices, and methods
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US9777335B2 (en) 2001-06-04 2017-10-03 Geneohm Sciences Canada Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US9970061B2 (en) 2011-12-27 2018-05-15 Ibis Biosciences, Inc. Bioagent detection oligonucleotides

Families Citing this family (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
WO2006071241A2 (en) * 2004-02-18 2006-07-06 Isis Pharmaceuticals, Inc. Compositions for use in identification of bacteria
CA2775655C (en) * 2005-01-20 2014-03-25 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention Multiplexed analysis for determining a serodiagnosis of viral infection
US20070026426A1 (en) 2005-04-26 2007-02-01 Applera Corporation System for genetic surveillance and analysis
WO2006138679A2 (en) * 2005-06-15 2006-12-28 Gen-Probe Incorporated Methods for quantitative analysis of a nucleic acid amplification reaction
US20070111234A1 (en) * 2005-09-12 2007-05-17 Christian Birkner Detection of biological DNA
US20080227087A1 (en) * 2005-10-11 2008-09-18 Ann Huletsky Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx
US7531309B2 (en) 2005-12-06 2009-05-12 Michigan State University PCR based capsular typing method
US7819615B2 (en) * 2005-12-06 2010-10-26 Hewlett-Packard Development Method and apparatus for finishing sheets for a bound document
WO2007095590A2 (en) * 2006-02-14 2007-08-23 Intelliscience Corporation Methods and systems for data analysis and feature recognition including detection of avian influenza virus
US8625885B2 (en) 2006-03-23 2014-01-07 Intelliscience Corporation Methods and systems for data analysis and feature recognition
US20070244844A1 (en) * 2006-03-23 2007-10-18 Intelliscience Corporation Methods and systems for data analysis and feature recognition
EP2029777B1 (en) * 2006-05-31 2017-03-08 Sequenom, Inc. Methods and compositions for the extraction of nucleic acid from a sample
CN101501251A (en) * 2006-06-16 2009-08-05 塞昆纳姆股份有限公司 Methods and compositions for the amplification, detection and quantification of nucleic acid from a sample
US7902345B2 (en) 2006-12-05 2011-03-08 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
US8076104B2 (en) * 2007-01-25 2011-12-13 Rogan Peter K Rapid and comprehensive identification of prokaryotic organisms
EP2140031A4 (en) 2007-03-26 2011-04-20 Sequenom Inc Restriction endonuclease enhanced polymorphic sequence detection
US7811766B2 (en) * 2007-03-28 2010-10-12 Thinkvillage, Llc Genetic identification and validation of Echinacea species
EP1985712A1 (en) * 2007-04-17 2008-10-29 Vereniging voor christelijk hoger onderwijs, wetenschappelijk onderzoek en patiëntenzorg Microbial population analysis
US8527207B2 (en) * 2007-05-15 2013-09-03 Peter K. Rogan Accurate identification of organisms based on individual information content
US20090226895A1 (en) * 2007-06-15 2009-09-10 The Hong Kong Polytechnic University Method of detecting vibrio parahaemolyticus via real-time PCR-hybridization
EP2195452B1 (en) 2007-08-29 2012-03-14 Sequenom, Inc. Methods and compositions for universal size-specific polymerase chain reaction
EP2231851A4 (en) * 2007-12-20 2011-02-02 Biotrove Inc System for the detection of a biological pathogen and use thereof
US9637776B2 (en) * 2008-02-19 2017-05-02 Opgen, Inc. Methods of identifying an organism
US8175992B2 (en) 2008-03-17 2012-05-08 Intelliscience Corporation Methods and systems for compound feature creation, processing, and identification in conjunction with a data analysis and feature recognition system wherein hit weights are summed
AU2009228312B2 (en) 2008-03-26 2015-05-21 Sequenom, Inc. Restriction endonuclease enhanced polymorphic sequence detection
WO2010071821A1 (en) * 2008-12-19 2010-06-24 Abbott Laboratories Diagnostic test for mutations in codons 12-13 of human k-ras
WO2010080616A1 (en) 2008-12-19 2010-07-15 Abbott Laboratories Molecular assay for diagnosis of malaria
CA2757493C (en) 2009-04-03 2018-11-13 Sequenom, Inc. Nucleic acid preparation compositions and methods
WO2011014811A1 (en) 2009-07-31 2011-02-03 Ibis Biosciences, Inc. Capture primers and capture sequence linked solid supports for molecular diagnostic tests
EP2494079A4 (en) * 2009-10-29 2013-06-26 Bio Rad Laboratories Rapid detection of mycoplasma contamination in cell culture samples
US20110224106A1 (en) 2010-03-10 2011-09-15 Ibis Biosciences, Inc. Production Of Single-Stranded Circular Nucleic Acid
ES2644839T3 (en) * 2011-06-15 2017-11-30 Grifols Therapeutics Inc. Process, compositions and kits for determining the HIV (HIV)
WO2013036603A1 (en) 2011-09-06 2013-03-14 Ibis Biosciences, Inc. Sample preparation methods
WO2014186874A1 (en) 2013-05-23 2014-11-27 Yyz Pharmatech, Inc. Methods and compositions for enzyme linked immuno and hybridization mass spectrometric assay
US20190032104A1 (en) * 2016-01-21 2019-01-31 T2 Biosystems, Inc. Rapid antimicrobial susceptibility testing using high-sensitivity direct detection methods

Citations (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4075475A (en) * 1976-05-03 1978-02-21 Chemetron Corporation Programmed thermal degradation-mass spectrometry analysis method facilitating identification of a biological specimen
US5015845A (en) * 1990-06-01 1991-05-14 Vestec Corporation Electrospray method for mass spectrometry
US5213961A (en) * 1989-08-31 1993-05-25 Brigham And Women's Hospital Accurate quantitation of RNA and DNA by competetitive polymerase chain reaction
US5288611A (en) * 1983-01-10 1994-02-22 Gen-Probe Incorporated Method for detecting, identifying, and quantitating organisms and viruses
US5484808A (en) * 1995-02-09 1996-01-16 Eli Lilly And Company Methods of inhibiting cell-cell adhesion
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5503980A (en) * 1992-11-06 1996-04-02 Trustees Of Boston University Positional sequencing by hybridization
US5504329A (en) * 1994-03-10 1996-04-02 Bruker-Franzen Analytik Gmbh Method of ionizing atoms or molecules by electrospraying
US5504327A (en) * 1993-11-04 1996-04-02 Hv Ops, Inc. (H-Nu) Electrospray ionization source and method for mass spectrometric analysis
US5605798A (en) * 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US5608217A (en) * 1994-03-10 1997-03-04 Bruker-Franzen Analytik Gmbh Electrospraying method for mass spectrometric analysis
US5612179A (en) * 1989-08-25 1997-03-18 Genetype A.G. Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5622824A (en) * 1993-03-19 1997-04-22 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5625184A (en) * 1995-05-19 1997-04-29 Perseptive Biosystems, Inc. Time-of-flight mass spectrometry analysis of biomolecules
US5856174A (en) * 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US5864137A (en) * 1996-10-01 1999-01-26 Genetrace Systems, Inc. Mass spectrometer
US5866429A (en) * 1991-04-03 1999-02-02 Bloch; Will Precision and accuracy of anion-exchange separation of nucleic acids
US5869242A (en) * 1995-09-18 1999-02-09 Myriad Genetics, Inc. Mass spectrometry to assess DNA sequence polymorphisms
US5871697A (en) * 1995-10-24 1999-02-16 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US5876938A (en) * 1996-08-05 1999-03-02 Prolinx, Incorporated Use of boron-containing polynucleotides as diagnostic agents
US5876936A (en) * 1997-01-15 1999-03-02 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
US5885775A (en) * 1996-10-04 1999-03-23 Perseptive Biosystems, Inc. Methods for determining sequences information in polynucleotides using mass spectrometry
US5900481A (en) * 1996-11-06 1999-05-04 Sequenom, Inc. Bead linkers for immobilizing nucleic acids to solid supports
US6015666A (en) * 1994-06-23 2000-01-18 Bayer Aktiengesellschaft Rapid DNA test for detecting quinolone-resistant Staphylococcus aureus pathogens in clinical material
US6018713A (en) * 1997-04-09 2000-01-25 Coli; Robert D. Integrated system and method for ordering and cumulative results reporting of medical tests
US6024925A (en) * 1997-01-23 2000-02-15 Sequenom, Inc. Systems and methods for preparing low volume analyte array elements
US6028183A (en) * 1997-11-07 2000-02-22 Gilead Sciences, Inc. Pyrimidine derivatives and oligonucleotides containing same
US6046005A (en) * 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
US6051378A (en) * 1996-03-04 2000-04-18 Genetrace Systems Inc. Methods of screening nucleic acids using mass spectrometry
US6055487A (en) * 1991-07-30 2000-04-25 Margery; Keith S. Interactive remote sample analysis system
US6054278A (en) * 1997-05-05 2000-04-25 The Perkin-Elmer Corporation Ribosomal RNA gene polymorphism based microorganism identification
US6060246A (en) * 1996-11-15 2000-05-09 Avi Biopharma, Inc. Reagent and method for isolation and detection of selected nucleic acid sequences
US6180339B1 (en) * 1995-01-13 2001-01-30 Bayer Corporation Nucleic acid probes for the detection and identification of fungi
US6180372B1 (en) * 1997-04-23 2001-01-30 Bruker Daltonik Gmbh Method and devices for extremely fast DNA replication by polymerase chain reactions (PCR)
US6187842B1 (en) * 1996-11-28 2001-02-13 New Japan Chemical Co., Ltd. Sugar compounds, gelling agents, gelling agent compositions processes for the preparation of them, and gel compositions
US6194144B1 (en) * 1993-01-07 2001-02-27 Sequenom, Inc. DNA sequencing by mass spectrometry
US6214555B1 (en) * 1996-05-01 2001-04-10 Visible Genetics Inc. Method compositions and kit for detection
US6218118B1 (en) * 1998-07-09 2001-04-17 Agilent Technologies, Inc. Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry
US6221598B1 (en) * 1994-09-30 2001-04-24 Promega Corporation Multiplex amplification of short tandem repeat loci
US6221587B1 (en) * 1998-05-12 2001-04-24 Isis Pharmceuticals, Inc. Identification of molecular interaction sites in RNA for novel drug discovery
US20020006611A1 (en) * 1997-02-20 2002-01-17 Franklin H. Portugal Compositions and methods for differentiating among shigella species and shigella from e. coli species
US20020028923A1 (en) * 1998-04-13 2002-03-07 Lex M. Cowsert Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6361940B1 (en) * 1996-09-24 2002-03-26 Qiagen Genomics, Inc. Compositions and methods for enhancing hybridization and priming specificity
US20020042506A1 (en) * 2000-07-05 2002-04-11 Kristyanne Eva Szucs Ion exchange method for DNA purification
US20020042112A1 (en) * 1996-11-06 2002-04-11 Hubert Koster Dna diagnostics based on mass spectrometry
US6372424B1 (en) * 1995-08-30 2002-04-16 Third Wave Technologies, Inc Rapid detection and identification of pathogens
US20020045178A1 (en) * 2000-06-13 2002-04-18 The Trustees Of Boston University Use of nucleotide analogs in the analysis of oligonucleotide mixtures and in highly multiplexed nucleic acid sequencing
US20030017487A1 (en) * 2001-06-06 2003-01-23 Pharmacogenetics, Ltd. Method for detecting single nucleotide polymorphisms (SNP'S) and point mutations
US20030027135A1 (en) * 2001-03-02 2003-02-06 Ecker David J. Method for rapid detection and identification of bioagents
US20030039976A1 (en) * 2001-08-14 2003-02-27 Haff Lawrence A. Methods for base counting
US20030050470A1 (en) * 1996-07-31 2003-03-13 Urocor, Inc. Biomarkers and targets for diagnosis, prognosis and management of prostate disease, bladder and breast cancer
US20030064483A1 (en) * 1993-09-03 2003-04-03 Duke University. Method of nucleic acid sequencing
US20030073112A1 (en) * 2000-01-13 2003-04-17 Jing Zhang Universal nucleic acid amplification system for nucleic acids in a sample
US6553317B1 (en) * 1997-03-05 2003-04-22 Incyte Pharmaceuticals, Inc. Relational database and system for storing information relating to biomolecular sequences and reagents
US20040005555A1 (en) * 2000-08-31 2004-01-08 Rothman Richard E. Molecular diagnosis of bactermia
US20040006611A1 (en) * 2002-06-20 2004-01-08 Samsung Electronics Co., Ltd. Remote management system and method
US6680476B1 (en) * 2002-11-22 2004-01-20 Agilent Technologies, Inc. Summed time-of-flight mass spectrometry utilizing thresholding to reduce noise
US20040013703A1 (en) * 2002-07-22 2004-01-22 James Ralph Bioabsorbable plugs containing drugs
US20040014957A1 (en) * 2002-05-24 2004-01-22 Anne Eldrup Oligonucleotides having modified nucleoside units
US6682889B1 (en) * 2000-11-08 2004-01-27 Becton, Dickinson And Company Amplification and detection of organisms of the Chlamydiaceae family
US20040023209A1 (en) * 2001-11-28 2004-02-05 Jon Jonasson Method for identifying microorganisms based on sequencing gene fragments
US20040023207A1 (en) * 2002-07-31 2004-02-05 Hanan Polansky Assays for drug discovery based on microcompetition with a foreign polynucleotide
US20040029129A1 (en) * 2001-10-25 2004-02-12 Liangsu Wang Identification of essential genes in microorganisms
US20040038208A1 (en) * 1993-06-11 2004-02-26 Fisher Douglas A. Novel human phosphodiesterase IV isozymes
US20040038385A1 (en) * 2002-08-26 2004-02-26 Langlois Richard G. System for autonomous monitoring of bioagents
US20040038234A1 (en) * 2000-06-30 2004-02-26 Gut Ivo Glynne Sample generation for genotyping by mass spectrometry
US20040038206A1 (en) * 2001-03-14 2004-02-26 Jia Zhang Method for high throughput assay of genetic analysis
US6706530B2 (en) * 1998-05-07 2004-03-16 Sequenom, Inc. IR-MALDI mass spectrometry of nucleic acids using liquid matrices
US6705530B2 (en) * 1999-10-01 2004-03-16 Perfect Plastic Printing Corporation Transparent/translucent financial transaction card
US20040081993A1 (en) * 2002-09-06 2004-04-29 The Trustees Of Boston University Quantification of gene expression
US20050026641A1 (en) * 2003-07-30 2005-02-03 Tomoaki Hokao Mobile communicatiion system, mobile communication terminal, power control method used therefor, and program therefor
US20050026147A1 (en) * 2003-07-29 2005-02-03 Walker Christopher L. Methods and compositions for amplification of dna
US20050027459A1 (en) * 2001-06-26 2005-02-03 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US6852487B1 (en) * 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6856914B1 (en) * 1999-11-19 2005-02-15 The University Of British Columbia Method, apparatus, media and signals for identifying associated cell signaling proteins
US20050065813A1 (en) * 2003-03-11 2005-03-24 Mishelevich David J. Online medical evaluation system
US6875593B2 (en) * 1991-11-26 2005-04-05 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US20060020391A1 (en) * 2000-09-06 2006-01-26 Kreiswirth Barry N Method for tracking and controlling infections
US6994962B1 (en) * 1998-12-09 2006-02-07 Massachusetts Institute Of Technology Methods of identifying point mutations in a genome
US20060057605A1 (en) * 2004-03-22 2006-03-16 Isis Pharmaceuticals, Inc. Compositions for use in identification of viral hemorrhagic fever viruses
US7024370B2 (en) * 2002-03-26 2006-04-04 P) Cis, Inc. Methods and apparatus for early detection of health-related events in a population
US7022835B1 (en) * 1999-09-10 2006-04-04 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften. E.V. Method for binding nucleic acids to a solid phase
US20070048735A1 (en) * 2001-03-02 2007-03-01 Ecker David J Methods for rapid detection and identification of biogents in epidemiological and forensic investigations
US7349808B1 (en) * 2000-09-06 2008-03-25 Egenomics, Inc. System and method for tracking and controlling infections
US20090004643A1 (en) * 2004-02-18 2009-01-01 Isis Pharmaceuticals, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US7666588B2 (en) * 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US20100070194A1 (en) * 2005-07-21 2010-03-18 Ecker David J Methods for rapid identification and quantitation of nucleic acid variants

Family Cites Families (321)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5567587A (en) 1983-01-10 1996-10-22 Gen-Probe Incorporated Method for detecting, the presence and amount of prokaryotic organisms using specific rRNA subsequences as probes
US4683202B1 (en) * 1985-03-28 1990-11-27 Cetus Corp
US4683195B1 (en) * 1986-01-30 1990-11-27 Cetus Corp
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
EP0272009B2 (en) 1986-11-24 2007-10-03 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
PT86881A (en) 1987-03-02 1989-03-30 Lyle J Arnold Jr Method for purification, separation and hybridization of nucleic acids using polycationic supports
US5270030A (en) 1988-12-29 1993-12-14 Bio-Technology General Corp. Fibrin binding domain polypeptide and method of producing
US5198543A (en) 1989-03-24 1993-03-30 Consejo Superior Investigaciones Cientificas PHI29 DNA polymerase
WO1990015157A1 (en) 1989-05-31 1990-12-13 Gene-Trak Systems Universal eubacteria nucleic acid probes and methods
US5219727A (en) * 1989-08-21 1993-06-15 Hoffmann-Laroche Inc. Quantitation of nucleic acids using the polymerase chain reaction
US5188963A (en) 1989-11-17 1993-02-23 Gene Tec Corporation Device for processing biological specimens for analysis of nucleic acids
DE69132616D1 (en) 1990-01-12 2001-06-28 Hsc Res Dev Corp Introns and exons of the cystic fibrosis gene for cystic and mutations represent several of the gens
US5143905A (en) 1990-05-03 1992-09-01 The Regents Of The University Of California Method and means for extending the host range of insecticidal proteins
US5712125A (en) * 1990-07-24 1998-01-27 Cemv Bioteknik Ab Competitive PCR for quantitation of DNA
DE4030262A1 (en) 1990-09-25 1992-03-26 Suedzucker Ag rhamnolipids process for the preparation of rhamnose from
NL9002259A (en) 1990-10-17 1992-05-18 Eurodiagnostics B V A method of determining a genotype by comparing the nucleotide sequence of members of a gene family, as well as kit for the detection of genetic variations.
WO1992009703A1 (en) 1990-11-26 1992-06-11 Cbr Laboratories, Inc. Testing for spirochetal nucleic acid sequences in samples
US5072115A (en) 1990-12-14 1991-12-10 Finnigan Corporation Interpretation of mass spectra of multiply charged ions of mixtures
WO1992013629A1 (en) 1991-01-31 1992-08-20 Wayne State University A method for analyzing an organic sample
IL97531A (en) * 1991-03-12 1995-12-31 Kelman Elliot Hair cutting apparatus
US5472843A (en) 1991-04-25 1995-12-05 Gen-Probe Incorporated Nucleic acid probes to Haemophilus influenzae
US5213796A (en) 1991-05-06 1993-05-25 Dana Farber Cancer Institute Assay for polyomavirus in humans and uses thereof
CA2116543C (en) 1991-07-31 2007-10-02 Kay S. Greisen Methods and reagents for detection of bacteria in cerebrospinal fluid
AT257860T (en) 1991-08-02 2004-01-15 Biomerieux Bv Quantification of nucleic
DK0787807T3 (en) 1991-08-27 2003-08-11 Hoffmann La Roche Primers and probes for the detection of hepatitis C
WO1993005182A1 (en) 1991-09-05 1993-03-18 Isis Pharmaceuticals, Inc. Determination of oligonucleotides for therapeutics, diagnostics and research reagents
ES2152933T3 (en) * 1991-10-23 2001-02-16 Baylor College Medicine Determination of traces on bacterial strains using amplifying repetitive DNA sequences.
FR2683827B1 (en) * 1991-11-15 1994-03-04 Institut Nal Sante Recherc Medic Method for determination of the quantity of a DNA fragment of interest by an enzymatic amplification method.
DE637965T1 (en) * 1991-11-26 1995-12-14 Gilead Sciences Inc Increased formation of triple and double helices of oligomers having modified pyrimidines.
TW393513B (en) * 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
IL103935D0 (en) 1991-12-04 1993-05-13 Du Pont Method for the identification of microorganisms by the utilization of directed and arbitrary dna amplification
AU3794893A (en) 1992-03-13 1993-10-05 Park Scientific Instruments Corp. Scanning probe microscope
US5981176A (en) 1992-06-17 1999-11-09 City Of Hope Method of detecting and discriminating between nucleic acid sequences
US6303297B1 (en) 1992-07-17 2001-10-16 Incyte Pharmaceuticals, Inc. Database for storage and analysis of full-length sequences
FR2694754B1 (en) 1992-08-12 1994-09-16 Bio Merieux DNA fragments of mycobacteria, amplification primers, hybridization probes, reagents and detection of mycobacteria detection method.
AU5128593A (en) * 1992-09-16 1994-04-12 University Of Tennessee Research Corporation, The Antigen of hybrid m protein and carrier for group a streptococcal vaccine
WO1994009156A1 (en) * 1992-10-08 1994-04-28 The Regents Of The University Of California Pcr assays to determine the presence and concentration of a target
JPH11503611A (en) 1995-04-11 1999-03-30 トラスティーズ・オブ・ボストン・ユニバーシティ Solid phase sequencing of biopolymer
US6436635B1 (en) 1992-11-06 2002-08-20 Boston University Solid phase sequencing of double-stranded nucleic acids
EP1262564A3 (en) 1993-01-07 2004-03-31 Sequenom, Inc. Dna sequencing by mass spectrometry
US6428955B1 (en) 1995-03-17 2002-08-06 Sequenom, Inc. DNA diagnostics based on mass spectrometry
WO1997037041A2 (en) 1996-03-18 1997-10-09 Sequenom, Inc. Dna sequencing by mass spectrometry
FR2701961B1 (en) 1993-02-24 1995-04-21 Bio Merieux A process for destabilization of secondary structure intrachain of a polynucleotide single-stranded, and said capture nucleotide.
US6074823A (en) 1993-03-19 2000-06-13 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US6140053A (en) 1996-11-06 2000-10-31 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5639606A (en) * 1993-04-06 1997-06-17 The University Of Rochester Method for quantitative measurement of gene expression using multiplex competitive reverse transcriptase-polymerase chain reaction
JPH0775585A (en) 1993-06-14 1995-03-20 Immuno Japan:Kk Hepatitis c virus-related oligonucleotide and method for judging virus gene type
US5830853A (en) 1994-06-23 1998-11-03 Astra Aktiebolag Systemic administration of a therapeutic preparation
US6001584A (en) 1993-07-19 1999-12-14 The Regents Of The University Of California Oncoprotein protein kinase
WO1995004161A1 (en) 1993-07-29 1995-02-09 Sergio Danilo Junho Pena Method for recognition of the nucleotide sequence of a purified dna segment
GB9315847D0 (en) 1993-07-30 1993-09-15 Isis Innovation Tag reagent and assay method
US5527675A (en) 1993-08-20 1996-06-18 Millipore Corporation Method for degradation and sequencing of polymers which sequentially eliminate terminal residues
US5683869A (en) 1993-09-03 1997-11-04 Duke University Method of nucleic acid sequencing
WO1995011996A1 (en) 1993-10-27 1995-05-04 Cornell Research Foundation, Inc. Detection assay for listeria and erwinia microorganisms
DE4338119A1 (en) 1993-11-08 1995-05-11 Bayer Ag Specific probes and methods for the quantitative detection of methicillin-resistant staphylococci
NL9301957A (en) 1993-11-11 1995-06-01 U Gene Research Bv A method for identifying micro-organisms, and appropriate equipment therefor.
JP3396942B2 (en) 1994-02-21 2003-04-14 三菱化学株式会社 The method of producing an aromatic polycarbonate
US5849492A (en) * 1994-02-28 1998-12-15 Phylogenetix Laboratories, Inc. Method for rapid identification of prokaryotic and eukaryotic organisms
US5976798A (en) 1994-03-30 1999-11-02 Mitokor Methods for detecting mitochondrial mutations diagnostic for Alzheimer's disease and methods for determining heteroplasmy of mitochondrial nucleic acid
WO1995031997A1 (en) 1994-05-20 1995-11-30 UNITED STATES OF AMERICA, represented by THE SECRETARY OF THE ARMY Model for testing immunogenicity of peptides
US5814442A (en) 1994-06-10 1998-09-29 Georgetown University Internally controlled virion nucleic acid amplification reaction for quantitation of virion and virion nucleic acid
GB9417211D0 (en) 1994-08-25 1994-10-12 Solicitor For The Affairs Of H Nucleotide sequencing method
US20020055101A1 (en) 1995-09-11 2002-05-09 Michel G. Bergeron Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US6001564A (en) 1994-09-12 1999-12-14 Infectio Diagnostic, Inc. Species specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US5994066A (en) 1995-09-11 1999-11-30 Infectio Diagnostic, Inc. Species-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US5753489A (en) * 1994-11-10 1998-05-19 Immuno Ag Method for producing viruses and vaccines in serum-free culture
US5654141A (en) 1994-11-18 1997-08-05 Thomas Jefferson University Amplification based detection of bacterial infection
KR100399813B1 (en) 1994-12-14 2004-06-09 가부시키가이샤 니콘 Exposure apparatus
US5763169A (en) * 1995-01-13 1998-06-09 Chiron Diagnostics Corporation Nucleic acid probes for the detection and identification of fungi
US5707802A (en) * 1995-01-13 1998-01-13 Ciba Corning Diagnostics Corp. Nucleic acid probes for the detection and identification of fungi
US5702895A (en) 1995-01-19 1997-12-30 Wakunaga Seiyaku Kabushiki Kaisha Method and kit for detecting methicillin-resistant Staphylococcus aureus
GB9504598D0 (en) 1995-03-03 1995-04-26 Imp Cancer Res Tech Method of nucleic acid analysis
TW399094B (en) * 1995-04-11 2000-07-21 Ciba Sc Holding Ag Compounds with (benzo)triazole radicals
US5928905A (en) * 1995-04-18 1999-07-27 Glaxo Group Limited End-complementary polymerase reaction
US5932220A (en) 1995-05-08 1999-08-03 Board Of Regents University Of Texas System Diagnostic tests for a new spirochete, Borrelia lonestari sp. nov.
US5700642A (en) 1995-05-22 1997-12-23 Sri International Oligonucleotide sizing using immobilized cleavable primers
US5830655A (en) 1995-05-22 1998-11-03 Sri International Oligonucleotide sizing using cleavable primers
CA2222793A1 (en) 1995-06-07 1996-12-19 Commonwealth Scientific And Industrial Research Organisation Optimized minizymes and miniribozymes and uses thereof
US6146854A (en) * 1995-08-31 2000-11-14 Sequenom, Inc. Filtration processes, kits and devices for isolating plasmids
US5727202A (en) 1995-10-18 1998-03-10 Palm Computing, Inc. Method and apparatus for synchronizing information on two different computer systems
US6110710A (en) 1996-10-15 2000-08-29 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Sequence modification of oligonucleotide primers to manipulate non-templated nucleotide addition
US5972693A (en) 1995-10-24 1999-10-26 Curagen Corporation Apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US5716825A (en) * 1995-11-01 1998-02-10 Hewlett Packard Company Integrated nucleic acid analysis system for MALDI-TOF MS
AT240408T (en) 1997-07-22 2003-05-15 Qiagen Genomics Inc Methods and compounds for the analysis of nucleic acids by mass spectrometry
US6312893B1 (en) 1996-01-23 2001-11-06 Qiagen Genomics, Inc. Methods and compositions for determining the sequence of nucleic acid molecules
GB9602028D0 (en) * 1996-02-01 1996-04-03 Amersham Int Plc Nucleoside analogues
CA2222192A1 (en) 1996-03-20 1997-09-25 Bio Merieux Nucleic acid isolation
JP3365198B2 (en) 1996-03-21 2003-01-08 ミノルタ株式会社 Image forming apparatus
US5745751A (en) * 1996-04-12 1998-04-28 Nelson; Robert W. Civil site information system
US5928906A (en) 1996-05-09 1999-07-27 Sequenom, Inc. Process for direct sequencing during template amplification
WO1997047766A1 (en) 1996-06-10 1997-12-18 University Of Utah Research Foundation Rapid, accurate identification of dna sequence variants by electrospray mass spectrometry
AU4042597A (en) 1996-07-19 1998-02-10 Hybridon, Inc. Method for sequencing nucleic acids using matrix-assisted laser desorption ionization time-of-flight mass spectrometry
US6563025B1 (en) * 1996-07-26 2003-05-13 Board Of Trustees Of The University Of Illinois Nucleotide sequences encoding anthranilate synthase
US5770029A (en) 1996-07-30 1998-06-23 Soane Biosciences Integrated electrophoretic microdevices
DE19633436A1 (en) 1996-08-20 1998-02-26 Boehringer Mannheim Gmbh A method for detecting nucleic acids by determining the mass
US5777324A (en) 1996-09-19 1998-07-07 Sequenom, Inc. Method and apparatus for maldi analysis
WO1998012355A1 (en) 1996-09-19 1998-03-26 Genetrace Systems Methods of preparing nucleic acids for mass spectrometric analysis
US5965363A (en) 1996-09-19 1999-10-12 Genetrace Systems Inc. Methods of preparing nucleic acids for mass spectrometric analysis
EP0979305B1 (en) 1997-01-15 2006-09-27 Xzillion GmbH &amp; CO.KG Mass label linked hybridisation probes
GB9620769D0 (en) 1996-10-04 1996-11-20 Brax Genomics Ltd Nucleic acid sequencing
US6133436A (en) 1996-11-06 2000-10-17 Sequenom, Inc. Beads bound to a solid support and to nucleic acids
ES2215241T3 (en) 1996-11-06 2004-10-01 Sequenom, Inc. Mass spectrometry procedure.
US5822824A (en) 1996-12-03 1998-10-20 Dion; William D. Mountable washing device
DE69735445D1 (en) 1996-12-10 2006-05-04 Sequenom Inc Cleavable, nonvolatile molecules for mass marker
US5981190A (en) 1997-01-08 1999-11-09 Ontogeny, Inc. Analysis of gene expression, methods and reagents therefor
US7285422B1 (en) 1997-01-23 2007-10-23 Sequenom, Inc. Systems and methods for preparing and analyzing low volume analyte array elements
WO1998035057A1 (en) 1997-02-06 1998-08-13 The National University Of Singapore Diagnosis of plasmodium infection by analysis of extrachromosomal genetic material
US5828062A (en) 1997-03-03 1998-10-27 Waters Investments Limited Ionization electrospray apparatus for mass spectrometry
DE19710166C1 (en) 1997-03-12 1998-12-10 Bruker Franzen Analytik Gmbh Two-step method of DNA amplification for MALDI-TOF measurements
WO1998040520A1 (en) 1997-03-14 1998-09-17 Hybridon, Inc. Method for sequencing of modified nucleic acids using electrospray ionization-fourier transform mass spectrometry
US5849497A (en) 1997-04-03 1998-12-15 The Research Foundation Of State University Of New York Specific inhibition of the polymerase chain reaction using a non-extendable oligonucleotide blocker
US20010039263A1 (en) 1997-05-02 2001-11-08 Max-Delbruck-Centrum Fur Molekulare Medizin Chimeric oligonucleotides and the use thereof
CA2292039A1 (en) 1997-05-28 1998-12-03 The Walter And Eliza Hall Institute Of Medical Research Nucleic acid diagnostics based on mass spectrometry or mass separation and base specific cleavage
US6159681A (en) 1997-05-28 2000-12-12 Syntrix Biochip, Inc. Light-mediated method and apparatus for the regional analysis of biologic material
WO1998054751A1 (en) 1997-05-30 1998-12-03 Genetrace Systems, Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
US6061686A (en) * 1997-06-26 2000-05-09 Digital Equipment Corporation Updating a copy of a remote document stored in a local computer system
DE19732086C2 (en) 1997-07-25 2002-11-21 Univ Leipzig A method for quantitative determination of eubacteria
US6207370B1 (en) 1997-09-02 2001-03-27 Sequenom, Inc. Diagnostics based on mass spectrometric detection of translated target polypeptides
GB9719044D0 (en) 1997-09-08 1997-11-12 Inst Of Ophthalmology Assay
US6090558A (en) 1997-09-19 2000-07-18 Genetrace Systems, Inc. DNA typing by mass spectrometry with polymorphic DNA repeat markers
US6063031A (en) * 1997-10-14 2000-05-16 Assurance Medical, Inc. Diagnosis and treatment of tissue with instruments
US6111096A (en) 1997-10-31 2000-08-29 Bbi Bioseq, Inc. Nucleic acid isolation and purification
JP3423597B2 (en) 1997-11-05 2003-07-07 三井農林株式会社 Methods for the identification of bacteria
US6007992A (en) * 1997-11-10 1999-12-28 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
AT217028T (en) 1997-12-05 2002-05-15 Max Planck Gesellschaft A method for identification of nucleic acids by matrix-assisted laser desorption / ionization mass spectrometry
US6914137B2 (en) 1997-12-06 2005-07-05 Dna Research Innovations Limited Isolation of nucleic acids
US6268131B1 (en) 1997-12-15 2001-07-31 Sequenom, Inc. Mass spectrometric methods for sequencing nucleic acids
US20030096232A1 (en) 1997-12-19 2003-05-22 Kris Richard M. High throughput assay system
US6458533B1 (en) 1997-12-19 2002-10-01 High Throughput Genomics, Inc. High throughput assay system for monitoring ESTs
DE19802905C2 (en) 1998-01-27 2001-11-08 Bruker Daltonik Gmbh A process for the preferred production of only one strand of genetic material selected for mass spectrometric measurements
US6428956B1 (en) 1998-03-02 2002-08-06 Isis Pharmaceuticals, Inc. Mass spectrometric methods for biomolecular screening
KR20010034600A (en) 1998-03-10 2001-04-25 엔. 레이 앤더슨 Detection and Characterization of Microorganisms
US6277578B1 (en) 1998-03-13 2001-08-21 Promega Corporation Deploymerization method for nucleic acid detection of an amplified nucleic acid target
US6268146B1 (en) 1998-03-13 2001-07-31 Promega Corporation Analytical methods and materials for nucleic acid detection
US6312902B1 (en) 1998-03-13 2001-11-06 Promega Corporation Nucleic acid detection
US6270974B1 (en) 1998-03-13 2001-08-07 Promega Corporation Exogenous nucleic acid detection
US6270973B1 (en) 1998-03-13 2001-08-07 Promega Corporation Multiplex method for nucleic acid detection
US6235480B1 (en) 1998-03-13 2001-05-22 Promega Corporation Detection of nucleic acid hybrids
US6391551B1 (en) 1998-03-13 2002-05-21 Promega Corporation Detection of nucleic acid hybrids
US6261769B1 (en) * 1998-03-31 2001-07-17 The United States Of America As Represented By The Secretary Of Agriculture Intergenic spacer target sequence for detecting and distinguishing Chlamydial species or strains
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6223186B1 (en) * 1998-05-04 2001-04-24 Incyte Pharmaceuticals, Inc. System and method for a precompiled database for biomolecular sequence information
DE19822108A1 (en) 1998-05-12 2000-02-03 Schering Ag A method for detecting microorganisms in products, particularly in pharmaceuticals and cosmetics
DE19922161A1 (en) 1998-05-18 1999-12-09 Fraunhofer Ges Forschung Anti-adhesion coating for e.g. soldering/welding tools and electric contacts
US6468743B1 (en) 1998-05-18 2002-10-22 Conagra Grocery Products Company PCR techniques for detecting microbial contaminants in foodstuffs
US6104028A (en) 1998-05-29 2000-08-15 Genetrace Systems Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
DE19824280B4 (en) 1998-05-29 2004-08-19 Bruker Daltonik Gmbh Mutation analysis by mass spectrometry
GB2339905A (en) 1998-06-24 2000-02-09 Bruker Daltonik Gmbh Use of mass-specrometry for detection of mutations
AT440963T (en) * 1998-07-02 2009-09-15 Gen Probe Inc molecular torches
US6074831A (en) * 1998-07-09 2000-06-13 Agilent Technologies, Inc. Partitioning of polymorphic DNAs
US6432651B1 (en) 1998-07-10 2002-08-13 Cetek Corporation Method to detect and analyze tight-binding ligands in complex biological samples using capillary electrophoresis and mass spectrometry
GB9815166D0 (en) 1998-07-13 1998-09-09 Brax Genomics Ltd Compounds for mass spectrometry
US6605433B1 (en) 1998-08-20 2003-08-12 The Johns Hopkins University Mitochondrial dosimeter
US6146144A (en) 1998-09-29 2000-11-14 Fowler; Ernest R. Rug hooking kit and method for handicapped
US6610492B1 (en) 1998-10-01 2003-08-26 Variagenics, Inc. Base-modified nucleotides and cleavage of polynucleotides incorporating them
WO2000020643A1 (en) 1998-10-05 2000-04-13 Mosaic Technologies Reverse displacement assay for detection of nucleic acid sequences
DE19852167C2 (en) 1998-11-12 2000-12-14 Bruker Saxonia Analytik Gmbh Simple SNP analysis by mass spectrometry
CA2351671A1 (en) 1998-11-24 2000-06-08 Regents Of The University Of Minnesota Transgenic circulating endothelial cells
DE19859723A1 (en) 1998-12-23 2000-06-29 Henkel Kgaa Formulations for coloring keratin-containing fibers
US6503718B2 (en) 1999-01-10 2003-01-07 Exact Sciences Corporation Methods for detecting mutations using primer extension for detecting disease
US6638714B1 (en) 1999-02-03 2003-10-28 Ortho-Clinical Diagnostics, Inc. Oligonucleotide primers for efficient detection of hepatitis C virus (HCV) and methods of use thereof
US6153389A (en) 1999-02-22 2000-11-28 Haarer; Brian K. DNA additives as a mechanism for unambiguously marking biological samples
EP1035219A1 (en) 1999-02-25 2000-09-13 Universiteit Gent Gastric helicobacter 16 S rDNA sequences from cattle and pigs and their use for detection and typing of Helicobacter strains
DE19910592A1 (en) * 1999-03-10 2000-09-14 Volkswagen Ag Restraint
US6436640B1 (en) 1999-03-18 2002-08-20 Exiqon A/S Use of LNA in mass spectrometry
US6613509B1 (en) 1999-03-22 2003-09-02 Regents Of The University Of California Determination of base (nucleotide) composition in DNA oligomers by mass spectrometry
EP1171584A1 (en) 1999-04-21 2002-01-16 Annovis, Inc. Magnetic dna extraction kit for plants
US6649351B2 (en) 1999-04-30 2003-11-18 Aclara Biosciences, Inc. Methods for detecting a plurality of analytes by mass spectrometry
DE60042623D1 (en) 1999-05-03 2009-09-03 Gen Probe Inc Polynukleotidmatrix-based method for identification of microorganisms
US20020086289A1 (en) 1999-06-15 2002-07-04 Don Straus Genomic profiling: a rapid method for testing a complex biological sample for the presence of many types of organisms
AU1471001A (en) 1999-11-04 2001-05-14 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
EP1196565A2 (en) 1999-06-30 2002-04-17 Corixa Corporation Compositions and methods for the therapy and diagnosis of lung cancer
AU5371099A (en) 1999-07-22 2001-02-13 Artus Gesellschaft Fur Molekularbiologische Diagnostik Und Entwicklung Mbh Method for the species-specific detection of organisms
US6723505B1 (en) 1999-08-13 2004-04-20 Nye Colifast As Method for identification of the indicators of contamination in liquid samples
US6266144B1 (en) 1999-08-26 2001-07-24 Taiwan Semiconductor Manufacturing Company Stepper and scanner new exposure sequence with intra-field correction
WO2001023608A2 (en) 1999-09-27 2001-04-05 Merck Sharp & Dohme De Espana, S.A.E. Hybridization probes which specifically detect strains of the genera microbispora, microtetraspora, nonomuria and planobispora
JP2003511015A (en) 1999-09-28 2003-03-25 インフェクティオ ダイアグノスティク(アイ.ディー.アイ.)インコーポレイティド Highly conserved genes, and species-specific, genus-specific, family specific, by generating a group-specific and universal nucleic acid probes and amplification primers, algae from clinical specimens diagnosis, archaea, bacteria, fungi and rapidly detect and their use for identifying microbial parasites
US6787302B2 (en) 1999-10-25 2004-09-07 Genprime, Inc. Method and apparatus for prokaryotic and eukaryotic cell quantitation
EP1268764A2 (en) 1999-11-29 2003-01-02 Aventis Pharma S.A. Method for obtaining nucleic acids from an environment sample
US6608190B1 (en) * 1999-12-16 2003-08-19 E. I. Du Pont De Nemours And Company Nucleic acid fragments for the identification of bacteria in industrial wastewater bioreactors
US6936414B2 (en) 1999-12-22 2005-08-30 Abbott Laboratories Nucleic acid isolation method and kit
DE60025850T2 (en) 1999-12-29 2006-08-03 Keygene N.V. Method for generation of oligonucleotides, particularly for detection of amplified restriction fragments obtained by AFLP
SE0000061D0 (en) 2000-01-10 2000-01-10 Bjoern Herrmann A method for detection of pathogenic organisms
CA2298181C (en) 2000-02-02 2006-09-19 Dayan Burke Goodnough Non-targeted complex sample analysis
US20020009727A1 (en) 2000-02-02 2002-01-24 Schultz Gary A. Detection of single nucleotide polymorphisms
US6453244B1 (en) 2000-02-10 2002-09-17 Stanford University Detection of polymorphisms by denaturing high-performance liquid chromatography
US6468210B2 (en) 2000-02-14 2002-10-22 First Opinion Corporation Automated diagnostic system and method including synergies
US6393367B1 (en) * 2000-02-19 2002-05-21 Proteometrics, Llc Method for evaluating the quality of comparisons between experimental and theoretical mass data
DE10015797B4 (en) 2000-03-26 2006-02-02 Bruker Daltonik Gmbh Multiplex analysis of DNA mixtures by means of photolytically readable DNA chips
DE10015262A1 (en) 2000-03-28 2001-10-04 Basf Ag Paper coating composition useful for off set printing, contains a binding agent prepared by radical polymerization of ethylenically unsaturated compounds
AU6052001A (en) 2000-03-29 2001-10-08 Ct For The Applic Of Molecular Methods for genotyping by hybridization analysis
US6613520B2 (en) 2000-04-10 2003-09-02 Matthew Ashby Methods for the survey and genetic analysis of populations
US6475736B1 (en) 2000-05-23 2002-11-05 Variagenics, Inc. Methods for genetic analysis of DNA using biased amplification of polymorphic sites
US6716634B1 (en) 2000-05-31 2004-04-06 Agilent Technologies, Inc. Increasing ionization efficiency in mass spectrometry
US6507837B1 (en) * 2000-06-08 2003-01-14 Hyperphrase Technologies, Llc Tiered and content based database searching
EP1287028A2 (en) 2000-06-09 2003-03-05 Corixa Corporation Compositions and methods for the therapy and diagnosis of colon cancer
FR2811321A1 (en) 2000-07-04 2002-01-11 Bio Merieux New oligonucleotide primers, useful for identifying bacteria, particularly in cases of septicemia, provide amplification of bacterial 16S ribosomal nucleic acid
BR0112163A (en) 2000-07-06 2004-02-10 Bio Merieux the microbiological quality control processes from an environmental aqueous medium, microbiological detection kit of a microorganism present in a sample and production process and / or disinfecting liquid
US6783939B2 (en) 2000-07-07 2004-08-31 Alphavax, Inc. Alphavirus vectors and virosomes with modified HIV genes for use in vaccines
AU8305601A (en) 2000-07-27 2002-02-13 California Inst Of Techn A rapid, quantitative method for the mass spectrometric analysis of nucleic acids for gene expression and genotyping
AUPQ909000A0 (en) 2000-07-28 2000-08-24 University Of Sydney, The A method of detecting microorganisms
US6813615B1 (en) 2000-09-06 2004-11-02 Cellomics, Inc. Method and system for interpreting and validating experimental data with automated reasoning
AU8876201A (en) 2000-09-08 2002-03-22 Large Scale Proteomics Corp Detection and characterization of microorganisms
SE0003286D0 (en) 2000-09-15 2000-09-15 Ulf Gyllensten Method and kit for human identification
US20040101809A1 (en) * 2001-09-21 2004-05-27 Weiss Ervin I Device, method and materials for mobilizing substances into dentinal tubules in root canal treatment
AT434035T (en) 2000-09-25 2009-07-15 Polymun Scient Immunbio Forsch Live influenza vaccine and process for its manufacture
AU9665001A (en) 2000-10-05 2002-04-15 Millennium Pharm Inc 65499 and 58875, novel seven-transmembrane receptors and uses therefor
US6996472B2 (en) 2000-10-10 2006-02-07 The United States Of America As Represented By The Department Of Health And Human Services Drift compensation method for fingerprint spectra
EP1325459A4 (en) * 2000-10-13 2010-09-01 Irm Llc High throughput processing system and method of using
AU2002246612B2 (en) 2000-10-24 2007-11-01 The Board Of Trustees Of The Leland Stanford Junior University Direct multiplex characterization of genomic DNA
US6906316B2 (en) * 2000-10-27 2005-06-14 Fuji Electric Co., Ltd. Semiconductor device module
WO2002050307A1 (en) 2000-12-12 2002-06-27 Chugai Seiyaku Kabushiki Kaisha Method of detecting polymorphism in dna by using mass spectroscopy
US6800289B2 (en) 2000-12-21 2004-10-05 Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of National Defence Strain of the western equine encephalitis virus
US6586584B2 (en) 2001-01-29 2003-07-01 Becton, Dickinson And Company Sequences and methods for detection of Hepatitis C virus
DE10108453B4 (en) 2001-02-22 2005-10-20 Bruker Daltonik Gmbh Mass spectrometric mutation analysis with photocleavable primers
BR0207657A (en) 2001-02-28 2004-10-26 Chondrogene Inc One or more isolated polynucleotide sequences, vector, host cell, composition, arrangement, methods for diagnosing mild, moderate, marked and severe osteoarthritis in a patient for identifying an agent that increases or decreases expression of a polynucleotide sequence, to prepare a collection of cDNA chondrocyte, and to make a provision, and set
US6699670B2 (en) 2001-03-01 2004-03-02 The Johns Hopkins University Quantitative assay for the simultaneous detection and speciation of bacterial infections
US8288523B2 (en) 2003-09-11 2012-10-16 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US20040121314A1 (en) 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in containers
US20040121311A1 (en) * 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in livestock
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US20060240412A1 (en) 2003-09-11 2006-10-26 Hall Thomas A Compositions for use in identification of adenoviruses
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US20030104410A1 (en) * 2001-03-16 2003-06-05 Affymetrix, Inc. Human microarray
EP2332896A3 (en) 2001-03-19 2012-09-26 President and Fellows of Harvard College Evolving new molecular function
EP1373558B1 (en) 2001-03-28 2013-12-25 Council of Scientific and Industrial Research Universal primers for wildlife identification
US7630836B2 (en) * 2001-05-30 2009-12-08 The Kitasato Institute Polynucleotides
CA2348042A1 (en) 2001-06-04 2002-12-04 Ann Huletsky Sequences for detection and identification of methicillin-resistant staphylococcus aureus
ES2311613T3 (en) 2001-06-06 2009-02-16 Dsm Ip Assets B.V. Improved isoprenoid production.
GB0113908D0 (en) 2001-06-07 2001-08-01 Univ London Designing degenerate PCR primers
US20020187490A1 (en) 2001-06-07 2002-12-12 Michigan State University Microbial identification chip based on DNA-DNA hybridization
GB0113907D0 (en) 2001-06-07 2001-08-01 Univ London Virus detection using degenerate PCR primers
US6906319B2 (en) * 2002-05-17 2005-06-14 Micromass Uk Limited Mass spectrometer
DE10132147B4 (en) 2001-07-03 2004-04-15 Universität Leipzig A method for the rapid quantitative determination of bacteria Eu
GB0117054D0 (en) 2001-07-12 2001-09-05 Plant Bioscience Ltd Methods and means for modification of plant characteristics
JP4358618B2 (en) 2001-07-19 2009-11-04 ジェネオーム サイエンシズ カナダ インコーポレイティド Universal methods and compositions for allowing rapid lysis of cells for detecting release and their nucleic acid
US20040191769A1 (en) 2001-07-24 2004-09-30 Transgenomic, Inc. Methods, compositions, and kits for mutation detection in mitochondrial DNA
WO2003012074A2 (en) 2001-07-30 2003-02-13 Den Kgl. Veterinær- Og Landbohøjskole Bacterial strains belonging to lactobacillus species and their use in food and feed industry
US7115385B2 (en) 2001-08-02 2006-10-03 North Carolina State University Media and methods for cultivation of microorganisms
AT411174B (en) 2001-08-09 2003-10-27 Lambda Labor Fuer Molekularbio Method and chip for analyzing nucleic acids
US20040175715A1 (en) 2001-08-21 2004-09-09 Burgoyne Leigh A. Method and device for simultaneously molecularly cloning and polylocus profiling of genomes or genomes mixtures
US7105296B2 (en) 2001-08-29 2006-09-12 E. I. Du Pont De Nemours And Company Genes encoding Baeyer-Villiger monooxygenases
US7049286B2 (en) 2001-08-30 2006-05-23 Diatos, S.A. Insulin conjugates and methods of use thereof
EP1446412B1 (en) 2001-09-04 2012-03-07 Exiqon A/S Novel lna compositions and uses thereof
DE10150121B4 (en) 2001-10-11 2005-12-01 Bernhard-Nocht-Institut für Tropenmedizin Real-time detection of DNA amplification
US6977148B2 (en) 2001-10-15 2005-12-20 Qiagen Gmbh Multiple displacement amplification
US7297485B2 (en) 2001-10-15 2007-11-20 Qiagen Gmbh Method for nucleic acid amplification that results in low amplification bias
DE10152821B4 (en) 2001-10-25 2006-11-16 Bruker Daltonik Gmbh Mass spectra without electronic noise
EP1308506A1 (en) 2001-11-06 2003-05-07 Eidgenössische Technische Hochschule Zürich Mixtures of Propionibacterium jensenii and Lactobacillus sp. with antimicrobial activities for use as a natural preservation system
PL220644B1 (en) 2001-11-13 2015-11-30 The Trustees Of The University Of Pennsylvania Method for the identification of the serotype sequence of the adenovirus associated virus (AAV), a diagnostic kit, method for the isolation of new viruses, new virus serotype, isolated viruses, proteins comprising a fragment of AAV capsid protein, synthetic proteins, recombinant virus, molecules, a method for producing recombinant viruses, host cells, compositions, method for the transgene delivery, isolated AAV, recombinant cell, a method for producing recombinant virus, the use of the virus
EP1453484B1 (en) 2001-11-15 2009-12-23 Whatman, Inc. Methods and materials for detecting genetic material
JP3692067B2 (en) 2001-11-30 2005-09-07 株式会社東芝 The method of manufacturing a semiconductor device using the polishing slurry and for it cmp copper
US20030148284A1 (en) 2001-12-17 2003-08-07 Vision Todd J. Solid phase detection of nucleic acid molecules
TW509116U (en) 2001-12-18 2002-11-01 Ind Tech Res Inst Device for clipping and tightening spindle of honing and milling machine
US20030175709A1 (en) 2001-12-20 2003-09-18 Murphy George L. Method and system for depleting rRNA populations
US7468185B2 (en) 2001-12-21 2008-12-23 Pfizer Inc. Vaccine for periodontal disease
KR100444230B1 (en) 2001-12-27 2004-08-16 삼성전기주식회사 Nonreducible dielectric ceramic composition
WO2003060163A2 (en) 2001-12-28 2003-07-24 Keygene N.V. Discrimination and detection of target nucleotide sequences using mass spectrometry
AT358185T (en) 2002-02-01 2007-04-15 Bruker Daltonik Gmbh Mutation analysis by PCR and mass spectrometry
US20030190635A1 (en) 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
CN1202204C (en) 2002-02-27 2005-05-18 财团法人工业技术研究院 Red light organic electroluminescent light-emitting compound and module and device produced with it
KR100600988B1 (en) 2002-03-13 2006-07-13 주식회사 엘지생명과학 Method for enhancing immune responses by codelivering influenza NP DNA in DNA immunization
US6897027B2 (en) 2002-03-27 2005-05-24 Decode Genetics Ehf. Method for desalting nucleic acids
US20030228571A1 (en) 2002-04-01 2003-12-11 Ecker David J. Method for rapid detection and identification of viral bioagents
WO2003087993A2 (en) * 2002-04-09 2003-10-23 Beattie Kenneth L Oligonucleotide probes for genosensor chips
JP2004000200A (en) 2002-04-19 2004-01-08 Menicon Co Ltd Method for detecting microorganism
FR2838740A1 (en) 2002-04-22 2003-10-24 Centre Nat Rech Scient Detecting primate T cell lymphoma/leukemia viruses, useful e.g. for diagnosis and drug screening, using degenerate oligonucleotides based on conserved regions of envelope protein
GB0209812D0 (en) 2002-04-30 2002-06-05 Renovo Ltd Genetic testing
DE10222632B4 (en) 2002-05-17 2006-03-09 Con Cipio Gmbh Microsatellite markers for genetic analysis and discrimination of roses
EP1365031A1 (en) 2002-05-21 2003-11-26 MTM Laboratories AG Method for detection of somatic mutations using mass spectometry
US20030220844A1 (en) * 2002-05-24 2003-11-27 Marnellos Georgios E. Method and system for purchasing genetic data
WO2003100068A1 (en) 2002-05-29 2003-12-04 Aresa Biodetection Aps Reporter system for plants
GB0212666D0 (en) 2002-05-31 2002-07-10 Secr Defence Immunogenic sequences
WO2003104410A2 (en) 2002-06-07 2003-12-18 Incyte Corporation Enzymes
WO2004005458A2 (en) 2002-06-13 2004-01-15 Regulome Corporation Functional sites
AU2003247777B2 (en) 2002-07-01 2008-09-18 Wayne State University Methods and compositions for the identification of antibiotics that are not susceptible to antibiotic resistance
AU2003254093A1 (en) 2002-07-19 2004-02-09 Isis Pharmaceuticals, Inc. Methods for mass spectrometry analysis utilizing an integrated microfluidics sample platform
GB0217434D0 (en) 2002-07-27 2002-09-04 Royal Vetinary College Biological material
US7172868B2 (en) 2002-08-01 2007-02-06 The Regents Of The University Of California Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis
US20040110138A1 (en) 2002-11-01 2004-06-10 University Of Ottawa Method for the detection of multiple genetic targets
US20060257871A1 (en) 2002-11-12 2006-11-16 Franck Chaubron One step real-time rt pcr kits for the universal detection of organisms in industrial products
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
DE60331587D1 (en) 2002-11-15 2010-04-15 Gen Probe Inc Test and compositions for evidence of Bacillus anthracis nucleic acid
WO2004060278A2 (en) 2002-12-06 2004-07-22 Isis Pharmaceuticals, Inc. Methods for rapid identification of pathogens in humans and animals
US20040117354A1 (en) 2002-12-16 2004-06-17 Azzaro Steven Hector Process for tagging and measuring quality
US20040122598A1 (en) * 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in food products and cosmetics thereby
US20040121329A1 (en) * 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in blood, bodily fluids, and bodily tissues thereby
US20040121310A1 (en) * 2002-12-18 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in forensic studies
US20040121340A1 (en) * 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent associated with host versus graft and graft versus host rejections thereby
US20040122857A1 (en) * 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in forensic studies thereby
US20040121312A1 (en) * 2002-12-18 2004-06-24 Ecker David J. Methods for rapid detection and identification of the absence of bioagents
US20040121315A1 (en) * 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in containers thereby
US9487823B2 (en) 2002-12-20 2016-11-08 Qiagen Gmbh Nucleic acid amplification
US20040170981A1 (en) 2003-02-10 2004-09-02 Mckenney Keith Real-time polymerase chain reaction using large target amplicons
US20040170954A1 (en) 2003-02-10 2004-09-02 Mckenney Keith Pathogen inactivation assay
US20040185438A1 (en) 2003-03-10 2004-09-23 Ecker David J. Methods of detection and notification of bioagent contamination
US8046171B2 (en) * 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
CA2523490A1 (en) 2003-04-25 2004-11-11 Sequenom, Inc. Fragmentation-based methods and systems for de novo sequencing
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
WO2005009202A2 (en) 2003-05-12 2005-02-03 Isis Pharmaceuticals, Inc. Automatic identification of bioagents
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
AT373729T (en) 2003-07-03 2007-10-15 Danmarks Og Groenlands Geol Un Process for the selective detection of a target nucleic acid
KR100632429B1 (en) 2003-08-01 2006-10-09 프로테온 주식회사 Screening system of reassortant influenza viruses using primer dependent multiplex RT-PCR
US20050142584A1 (en) 2003-10-01 2005-06-30 Willson Richard C. Microbial identification based on the overall composition of characteristic oligonucleotides
WO2005036369A2 (en) 2003-10-09 2005-04-21 Isis Pharmaceuticals, Inc. Database for microbial investigations
FR2861743B1 (en) 2003-11-04 2007-10-19 Univ Aix Marseille Ii Molecular identification of bacteria of the genus Corynebacterium
WO2005062770A2 (en) 2003-12-19 2005-07-14 Novakoff James L Method for conducting pharmacogenomics-based studies
CA2791798C (en) 2004-02-10 2016-08-16 F. Hoffmann-La Roche Ag New primers and probes for the detection of parvovirus b19
WO2006071241A2 (en) 2004-02-18 2006-07-06 Isis Pharmaceuticals, Inc. Compositions for use in identification of bacteria
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US20050266411A1 (en) 2004-05-25 2005-12-01 Hofstadler Steven A Methods for rapid forensic analysis of mitochondrial DNA
US7627437B2 (en) 2005-01-14 2009-12-01 Idaho Research Foundation Categorization of microbial communities
DE102005008583B4 (en) 2005-02-24 2007-10-25 Johannes-Gutenberg-Universität Mainz A method for typing an individual by means of short tandem repeat (STR) loci of the genomic DNA
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
JP5162447B2 (en) 2005-04-13 2013-03-13 アイビス バイオサイエンシズ インコーポレイティッド Composition used for the identification of adenovirus
US20070026435A1 (en) 2005-07-28 2007-02-01 Polysciences, Inc. Hydroxysilane functionalized magnetic particles and nucleic acid separation method
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US20100204266A1 (en) 2007-03-23 2010-08-12 Ibis Biosciences, INC Compositions for use in identification of mixed populations of bioagents
JP5276999B2 (en) 2009-01-19 2013-08-28 矢崎総業株式会社 The case of the fixed structure

Patent Citations (99)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4075475A (en) * 1976-05-03 1978-02-21 Chemetron Corporation Programmed thermal degradation-mass spectrometry analysis method facilitating identification of a biological specimen
US5288611A (en) * 1983-01-10 1994-02-22 Gen-Probe Incorporated Method for detecting, identifying, and quantitating organisms and viruses
US5612179A (en) * 1989-08-25 1997-03-18 Genetype A.G. Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5213961A (en) * 1989-08-31 1993-05-25 Brigham And Women's Hospital Accurate quantitation of RNA and DNA by competetitive polymerase chain reaction
US5015845A (en) * 1990-06-01 1991-05-14 Vestec Corporation Electrospray method for mass spectrometry
US5866429A (en) * 1991-04-03 1999-02-02 Bloch; Will Precision and accuracy of anion-exchange separation of nucleic acids
US6055487A (en) * 1991-07-30 2000-04-25 Margery; Keith S. Interactive remote sample analysis system
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US6875593B2 (en) * 1991-11-26 2005-04-05 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5503980A (en) * 1992-11-06 1996-04-02 Trustees Of Boston University Positional sequencing by hybridization
US5605798A (en) * 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US6194144B1 (en) * 1993-01-07 2001-02-27 Sequenom, Inc. DNA sequencing by mass spectrometry
US5872003A (en) * 1993-03-19 1999-02-16 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5622824A (en) * 1993-03-19 1997-04-22 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US20040038208A1 (en) * 1993-06-11 2004-02-26 Fisher Douglas A. Novel human phosphodiesterase IV isozymes
US20030064483A1 (en) * 1993-09-03 2003-04-03 Duke University. Method of nucleic acid sequencing
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5504327A (en) * 1993-11-04 1996-04-02 Hv Ops, Inc. (H-Nu) Electrospray ionization source and method for mass spectrometric analysis
US5504329A (en) * 1994-03-10 1996-04-02 Bruker-Franzen Analytik Gmbh Method of ionizing atoms or molecules by electrospraying
US5608217A (en) * 1994-03-10 1997-03-04 Bruker-Franzen Analytik Gmbh Electrospraying method for mass spectrometric analysis
US6015666A (en) * 1994-06-23 2000-01-18 Bayer Aktiengesellschaft Rapid DNA test for detecting quinolone-resistant Staphylococcus aureus pathogens in clinical material
US6221598B1 (en) * 1994-09-30 2001-04-24 Promega Corporation Multiplex amplification of short tandem repeat loci
US6180339B1 (en) * 1995-01-13 2001-01-30 Bayer Corporation Nucleic acid probes for the detection and identification of fungi
US5484808A (en) * 1995-02-09 1996-01-16 Eli Lilly And Company Methods of inhibiting cell-cell adhesion
US6043031A (en) * 1995-03-17 2000-03-28 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6221601B1 (en) * 1995-03-17 2001-04-24 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6221605B1 (en) * 1995-03-17 2001-04-24 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6197498B1 (en) * 1995-03-17 2001-03-06 Sequenom, Inc DNA diagnostics based on mass spectrometry
US20090042203A1 (en) * 1995-03-17 2009-02-12 Sequenom, Inc. Mass Spectrometric Methods for Detecting Mutations in a Target Nucleic Acid
US20090092977A1 (en) * 1995-03-17 2009-04-09 Sequenom, Inc. Mass spectrometric methods for detecting mutations in a target nucleic acid
US5625184A (en) * 1995-05-19 1997-04-29 Perseptive Biosystems, Inc. Time-of-flight mass spectrometry analysis of biomolecules
US5856174A (en) * 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US6372424B1 (en) * 1995-08-30 2002-04-16 Third Wave Technologies, Inc Rapid detection and identification of pathogens
US5869242A (en) * 1995-09-18 1999-02-09 Myriad Genetics, Inc. Mass spectrometry to assess DNA sequence polymorphisms
US5871697A (en) * 1995-10-24 1999-02-16 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US6852487B1 (en) * 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6051378A (en) * 1996-03-04 2000-04-18 Genetrace Systems Inc. Methods of screening nucleic acids using mass spectrometry
US6214555B1 (en) * 1996-05-01 2001-04-10 Visible Genetics Inc. Method compositions and kit for detection
US20030050470A1 (en) * 1996-07-31 2003-03-13 Urocor, Inc. Biomarkers and targets for diagnosis, prognosis and management of prostate disease, bladder and breast cancer
US5876938A (en) * 1996-08-05 1999-03-02 Prolinx, Incorporated Use of boron-containing polynucleotides as diagnostic agents
US6361940B1 (en) * 1996-09-24 2002-03-26 Qiagen Genomics, Inc. Compositions and methods for enhancing hybridization and priming specificity
US5864137A (en) * 1996-10-01 1999-01-26 Genetrace Systems, Inc. Mass spectrometer
US5885775A (en) * 1996-10-04 1999-03-23 Perseptive Biosystems, Inc. Methods for determining sequences information in polynucleotides using mass spectrometry
US20090023150A1 (en) * 1996-11-06 2009-01-22 Sequenom, Inc. DNA Diagnostics Based on Mass Spectrometry
US20020042112A1 (en) * 1996-11-06 2002-04-11 Hubert Koster Dna diagnostics based on mass spectrometry
US7198893B1 (en) * 1996-11-06 2007-04-03 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US7501251B2 (en) * 1996-11-06 2009-03-10 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US5900481A (en) * 1996-11-06 1999-05-04 Sequenom, Inc. Bead linkers for immobilizing nucleic acids to solid supports
US6060246A (en) * 1996-11-15 2000-05-09 Avi Biopharma, Inc. Reagent and method for isolation and detection of selected nucleic acid sequences
US6187842B1 (en) * 1996-11-28 2001-02-13 New Japan Chemical Co., Ltd. Sugar compounds, gelling agents, gelling agent compositions processes for the preparation of them, and gel compositions
US6046005A (en) * 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
US5876936A (en) * 1997-01-15 1999-03-02 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
US6024925A (en) * 1997-01-23 2000-02-15 Sequenom, Inc. Systems and methods for preparing low volume analyte array elements
US20020006611A1 (en) * 1997-02-20 2002-01-17 Franklin H. Portugal Compositions and methods for differentiating among shigella species and shigella from e. coli species
US6553317B1 (en) * 1997-03-05 2003-04-22 Incyte Pharmaceuticals, Inc. Relational database and system for storing information relating to biomolecular sequences and reagents
US6018713A (en) * 1997-04-09 2000-01-25 Coli; Robert D. Integrated system and method for ordering and cumulative results reporting of medical tests
US6180372B1 (en) * 1997-04-23 2001-01-30 Bruker Daltonik Gmbh Method and devices for extremely fast DNA replication by polymerase chain reactions (PCR)
US6054278A (en) * 1997-05-05 2000-04-25 The Perkin-Elmer Corporation Ribosomal RNA gene polymorphism based microorganism identification
US6028183A (en) * 1997-11-07 2000-02-22 Gilead Sciences, Inc. Pyrimidine derivatives and oligonucleotides containing same
US20020028923A1 (en) * 1998-04-13 2002-03-07 Lex M. Cowsert Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US7321828B2 (en) * 1998-04-13 2008-01-22 Isis Pharmaceuticals, Inc. System of components for preparing oligonucleotides
US6706530B2 (en) * 1998-05-07 2004-03-16 Sequenom, Inc. IR-MALDI mass spectrometry of nucleic acids using liquid matrices
US6221587B1 (en) * 1998-05-12 2001-04-24 Isis Pharmceuticals, Inc. Identification of molecular interaction sites in RNA for novel drug discovery
US6218118B1 (en) * 1998-07-09 2001-04-17 Agilent Technologies, Inc. Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry
US6994962B1 (en) * 1998-12-09 2006-02-07 Massachusetts Institute Of Technology Methods of identifying point mutations in a genome
US7022835B1 (en) * 1999-09-10 2006-04-04 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften. E.V. Method for binding nucleic acids to a solid phase
US6705530B2 (en) * 1999-10-01 2004-03-16 Perfect Plastic Printing Corporation Transparent/translucent financial transaction card
US6856914B1 (en) * 1999-11-19 2005-02-15 The University Of British Columbia Method, apparatus, media and signals for identifying associated cell signaling proteins
US20030073112A1 (en) * 2000-01-13 2003-04-17 Jing Zhang Universal nucleic acid amplification system for nucleic acids in a sample
US20020045178A1 (en) * 2000-06-13 2002-04-18 The Trustees Of Boston University Use of nucleotide analogs in the analysis of oligonucleotide mixtures and in highly multiplexed nucleic acid sequencing
US20040038234A1 (en) * 2000-06-30 2004-02-26 Gut Ivo Glynne Sample generation for genotyping by mass spectrometry
US20020042506A1 (en) * 2000-07-05 2002-04-11 Kristyanne Eva Szucs Ion exchange method for DNA purification
US20040005555A1 (en) * 2000-08-31 2004-01-08 Rothman Richard E. Molecular diagnosis of bactermia
US7349808B1 (en) * 2000-09-06 2008-03-25 Egenomics, Inc. System and method for tracking and controlling infections
US20060020391A1 (en) * 2000-09-06 2006-01-26 Kreiswirth Barry N Method for tracking and controlling infections
US6682889B1 (en) * 2000-11-08 2004-01-27 Becton, Dickinson And Company Amplification and detection of organisms of the Chlamydiaceae family
US7666588B2 (en) * 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US20030027135A1 (en) * 2001-03-02 2003-02-06 Ecker David J. Method for rapid detection and identification of bioagents
US20070048735A1 (en) * 2001-03-02 2007-03-01 Ecker David J Methods for rapid detection and identification of biogents in epidemiological and forensic investigations
US20040038206A1 (en) * 2001-03-14 2004-02-26 Jia Zhang Method for high throughput assay of genetic analysis
US20030017487A1 (en) * 2001-06-06 2003-01-23 Pharmacogenetics, Ltd. Method for detecting single nucleotide polymorphisms (SNP'S) and point mutations
US20050027459A1 (en) * 2001-06-26 2005-02-03 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US20030039976A1 (en) * 2001-08-14 2003-02-27 Haff Lawrence A. Methods for base counting
US20040029129A1 (en) * 2001-10-25 2004-02-12 Liangsu Wang Identification of essential genes in microorganisms
US20040023209A1 (en) * 2001-11-28 2004-02-05 Jon Jonasson Method for identifying microorganisms based on sequencing gene fragments
US7024370B2 (en) * 2002-03-26 2006-04-04 P) Cis, Inc. Methods and apparatus for early detection of health-related events in a population
US20040014957A1 (en) * 2002-05-24 2004-01-22 Anne Eldrup Oligonucleotides having modified nucleoside units
US20040006611A1 (en) * 2002-06-20 2004-01-08 Samsung Electronics Co., Ltd. Remote management system and method
US20040013703A1 (en) * 2002-07-22 2004-01-22 James Ralph Bioabsorbable plugs containing drugs
US20040023207A1 (en) * 2002-07-31 2004-02-05 Hanan Polansky Assays for drug discovery based on microcompetition with a foreign polynucleotide
US20040038385A1 (en) * 2002-08-26 2004-02-26 Langlois Richard G. System for autonomous monitoring of bioagents
US20040081993A1 (en) * 2002-09-06 2004-04-29 The Trustees Of Boston University Quantification of gene expression
US6680476B1 (en) * 2002-11-22 2004-01-20 Agilent Technologies, Inc. Summed time-of-flight mass spectrometry utilizing thresholding to reduce noise
US20050065813A1 (en) * 2003-03-11 2005-03-24 Mishelevich David J. Online medical evaluation system
US20050026147A1 (en) * 2003-07-29 2005-02-03 Walker Christopher L. Methods and compositions for amplification of dna
US20050026641A1 (en) * 2003-07-30 2005-02-03 Tomoaki Hokao Mobile communicatiion system, mobile communication terminal, power control method used therefor, and program therefor
US20090004643A1 (en) * 2004-02-18 2009-01-01 Isis Pharmaceuticals, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US20060057605A1 (en) * 2004-03-22 2006-03-16 Isis Pharmaceuticals, Inc. Compositions for use in identification of viral hemorrhagic fever viruses
US20100070194A1 (en) * 2005-07-21 2010-03-18 Ecker David J Methods for rapid identification and quantitation of nucleic acid variants

Cited By (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8017743B2 (en) 2001-03-02 2011-09-13 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US9752184B2 (en) 2001-03-02 2017-09-05 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8802372B2 (en) 2001-03-02 2014-08-12 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8815513B2 (en) 2001-03-02 2014-08-26 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US9416424B2 (en) 2001-03-02 2016-08-16 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8017322B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8265878B2 (en) 2001-03-02 2012-09-11 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US9777335B2 (en) 2001-06-04 2017-10-03 Geneohm Sciences Canada Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US8921047B2 (en) 2001-06-26 2014-12-30 Ibis Biosciences, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8380442B2 (en) 2001-06-26 2013-02-19 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8071309B2 (en) 2002-12-06 2011-12-06 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US9725771B2 (en) 2002-12-06 2017-08-08 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8046171B2 (en) 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8476415B2 (en) 2003-05-13 2013-07-02 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US20090047665A1 (en) * 2003-09-11 2009-02-19 Ibis Biosciences, Inc. Compositions for use in identification of adenoviruses
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8013142B2 (en) 2003-09-11 2011-09-06 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US20070243544A1 (en) * 2003-09-11 2007-10-18 Rangarajan Sampath Compositions for use in identification of bacteria
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US9447462B2 (en) 2004-02-18 2016-09-20 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US9449802B2 (en) 2004-05-24 2016-09-20 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8987660B2 (en) 2004-05-24 2015-03-24 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8551738B2 (en) 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US20090263809A1 (en) * 2008-03-20 2009-10-22 Zygem Corporation Limited Methods for Identification of Bioagents
US8252599B2 (en) 2008-09-16 2012-08-28 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US9023655B2 (en) 2008-09-16 2015-05-05 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US9027730B2 (en) 2008-09-16 2015-05-12 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8609430B2 (en) 2008-09-16 2013-12-17 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US9165740B2 (en) 2009-02-12 2015-10-20 Ibis Biosciences, Inc. Ionization probe assemblies
US8796617B2 (en) 2009-02-12 2014-08-05 Ibis Biosciences, Inc. Ionization probe assemblies
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US9393564B2 (en) 2009-03-30 2016-07-19 Ibis Biosciences, Inc. Bioagent detection systems, devices, and methods
US20100323362A1 (en) * 2009-06-23 2010-12-23 Gen-Probe Incorporated Compositions and methods for detecting nucleic acid from mollicutes
US9212397B2 (en) 2009-06-23 2015-12-15 Gen-Probe Incorporated Compositions and methods for detecting nucleic acid from mollicutes
US9920382B2 (en) 2009-06-23 2018-03-20 Gen-Probe Incorporated Compositions and methods for detecting nucleic acid from mollicutes
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
WO2011047307A1 (en) 2009-10-15 2011-04-21 Ibis Biosciences, Inc. Multiple displacement amplification
EP3225695A1 (en) 2009-10-15 2017-10-04 Ibis Biosciences, Inc. Multiple displacement amplification
EP2957641A1 (en) 2009-10-15 2015-12-23 Ibis Biosciences, Inc. Multiple displacement amplification
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification
US9752173B2 (en) 2010-04-08 2017-09-05 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
US9068017B2 (en) 2010-04-08 2015-06-30 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
US9970061B2 (en) 2011-12-27 2018-05-15 Ibis Biosciences, Inc. Bioagent detection oligonucleotides

Also Published As

Publication number Publication date
JP2006508696A (en) 2006-03-16
EP1581657A2 (en) 2005-10-05
US20040219517A1 (en) 2004-11-04
US20040121311A1 (en) 2004-06-24
CA2508584A1 (en) 2004-06-24
US8214154B2 (en) 2012-07-03
US20040121313A1 (en) 2004-06-24
US20040121309A1 (en) 2004-06-24
US20120142085A1 (en) 2012-06-07
WO2004052175A2 (en) 2004-06-24
WO2004052175A3 (en) 2004-11-11
EP1581657A4 (en) 2007-09-12
US20040121335A1 (en) 2004-06-24
US7781162B2 (en) 2010-08-24

Similar Documents

Publication Publication Date Title
Boivin et al. Human metapneumovirus infections in hospitalized children
Fraher et al. Techniques used to characterize the gut microbiota: a guide for the clinician
Merien et al. A rapid and quantitative method for the detection of Leptospira species in human leptospirosis
CA2616281C (en) Methods for rapid identification and quantitation of mitochondrial dna variants
EP1891244B1 (en) Compositions for use in identification of adenoviruses
Lin et al. Using a resequencing microarray as a multiple respiratory pathogen detection assay
EP2295603A1 (en) Method and devices for multiplexing amplification reactions
US20060240412A1 (en) Compositions for use in identification of adenoviruses
Verweij et al. Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections
Dragsted et al. Comparison of culture and PCR for detection of Bordetella pertussis and Bordetella parapertussis under routine laboratory conditions
Buchan et al. Emerging technologies for the clinical microbiology laboratory
Skuce et al. Discrimination of Mycobacterium tuberculosis complex bacteria using novel VNTR-PCR targets
ES2448770T3 (en) Method for rapid detection and identification of bio-agents
Von Wintzingerode et al. Base-specific fragmentation of amplified 16S rRNA genes analyzed by mass spectrometry: a tool for rapid bacterial identification
Navarro et al. Diagnosis of human brucellosis using PCR
Beige et al. Clinical evaluation of a Mycobacterium tuberculosis PCR assay.
CA2572617C (en) Resequencing pathogen microarray
Chiu et al. Microarray detection of human parainfluenzavirus 4 infection associated with respiratory failure in an immunocompetent adult
Boman et al. Molecular diagnosis of Chlamydia pneumoniae infection
Fredricks et al. Application of polymerase chain reaction to the diagnosis of infectious diseases
US9447462B2 (en) Methods for concurrent identification and quantification of an unknown bioagent
AU2007353877B2 (en) Targeted whole genome amplification method for identification of pathogens
US20100204266A1 (en) Compositions for use in identification of mixed populations of bioagents
Yang et al. PCR-based diagnostics for infectious diseases: uses, limitations, and future applications in acute-care settings
US20050266411A1 (en) Methods for rapid forensic analysis of mitochondrial DNA

Legal Events

Date Code Title Description
AS Assignment

Owner name: IBIS BIOSCIENCES, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ECKER, DAVID J.;GRIFFEY, RICHARD H.;SAMPATH, RANGARAJAN;AND OTHERS;SIGNING DATES FROM 20040121 TO 20040204;REEL/FRAME:025433/0816

Owner name: IBIS BIOSCIENCES, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ISIS PHARMACEUTICALS, INC.;REEL/FRAME:025435/0575

Effective date: 20070814

AS Assignment

Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE ASSIGNEE INFORMATION PREVIOUSLY RECORDED ON REEL 025433 FRAME0816. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNMENT;ASSIGNORS:ECKER, DAVID J.;GRIFFEY, RICHARD H.;SAMPATH, RANGARAJAN;AND OTHERS;SIGNING DATES FROM 20040121 TO 20040204;REEL/FRAME:026149/0804