EP3418388B1 - Cellules et procédé de production de rhamnolipides - Google Patents

Cellules et procédé de production de rhamnolipides Download PDF

Info

Publication number
EP3418388B1
EP3418388B1 EP18184367.3A EP18184367A EP3418388B1 EP 3418388 B1 EP3418388 B1 EP 3418388B1 EP 18184367 A EP18184367 A EP 18184367A EP 3418388 B1 EP3418388 B1 EP 3418388B1
Authority
EP
European Patent Office
Prior art keywords
seq
sequence
enzyme
pbbr1mcs
rhamnopyranosyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
EP18184367.3A
Other languages
German (de)
English (en)
Other versions
EP3418388A1 (fr
Inventor
Steffen Schaffer
Mirja Wessel
Anja HECKER
Nadine Stein
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Evonik Operations GmbH
Original Assignee
Evonik Operations GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Evonik Operations GmbH filed Critical Evonik Operations GmbH
Publication of EP3418388A1 publication Critical patent/EP3418388A1/fr
Application granted granted Critical
Publication of EP3418388B1 publication Critical patent/EP3418388B1/fr
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
    • A01N43/02—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms
    • A01N43/04—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom
    • A01N43/14—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom six-membered rings
    • A01N43/16—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom six-membered rings with oxygen as the ring hetero atom
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/78—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Pseudomonas
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y306/00—Hydrolases acting on acid anhydrides (3.6)
    • C12Y306/04—Hydrolases acting on acid anhydrides (3.6) acting on acid anhydrides; involved in cellular and subcellular movement (3.6.4)
    • C12Y306/04013—RNA helicase (3.6.4.13)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts

Definitions

  • the invention relates to cells and processes for the production of rhamnolipids.
  • surfactants are mainly produced on the basis of petrochemical raw materials.
  • the use of surfactants based on renewable raw materials is a corresponding alternative due to the foreseeable shortage of petrochemical raw materials and increasing demand for products that are based on renewable raw materials or are biodegradable.
  • Rhamnolipids consist of one (monorhamnosyl lipids) or two rhamnose residues (dirhamnosyl lipids) and one or two 3-hydroxy fatty acid residues (see Handbook of Hydrocarbon and Lipid Microbiology, 2010, pp. 3037-51 ). They have surface-active properties that are needed as surfactants in a wide variety of applications (see Leitermann et al., 2009).
  • the properties of the rhamnolipids produced by the wild-type isolates can only be influenced to a limited extent. So far, this has only been done by optimizing the process control (pH value, oxygen supply, media composition , feeding strategies, nitrogen supply, temperature, substrate selection , etc.). However, a very targeted influence on certain product properties, such as the ratio of the various rhamnolipid species (number of rhamnose and 3-hydroxy fatty acid residues) or the chain length and degree of saturation of the 3-hydroxy fatty acid residues, would be desirable in order to be able to modulate the product properties relevant for the application.
  • rhamnolipids are to be used on a large scale as surfactants in household, cleaning, cosmetic, food processing, pharmaceutical, crop protection and other applications, they have to compete with the surfactants used today. These are large-volume chemicals that can be manufactured at very low costs, with no obvious health risks to the customer and with clearly defined and modulatable product specifications. Therefore, it must also be possible to produce rhamnolipids at the lowest possible cost, without health risks for the customer and with the most defined properties possible.
  • WO2004050882 discloses a method for phytoremediation of an environment which is contaminated with at least one heavy metal or oil hydrocarbon, the method comprising: (a) providing a transoenic plant, the plant expressing at least one heterologous nucleic acid which encodes an enzyme with rhamnosyltransferase activity, ( b) Planting or locating the transaenic plant in the environment.
  • US2007020624 relates to isolated nucleic acids and polypeptides derived from Pseudomonas aeruginosa that are used as molecular targets for diagnosis, prophylaxis and Treatment of pathological conditions, as well as materials and methods for diagnosing, preventing and alleviating pathological conditions resulting from bacterial infections, are useful.
  • WO2004083385 discloses a method of identifying a modulator of quorum sensing signaling in bacteria, the method comprising: providing a cell comprising a quorum sensing controlled gene, the cell being responsive to a quorum sensing signal to produce a detectable signal; contacting the cell with a quorum sensing signaling molecule in the presence and absence of a test compound; and detecting a change in the detectable signal, thereby identifying the test compound as a modulator of quorum sensing signaling in bacteria.
  • EMBL Database accession no. L28170 , discloses the nucleic acid and amino acid sequences of proteins from Pseudomonas aeruginosa annotated as rhamnosyltransferases.
  • This modulation can take place, for example, through a balanced provision of the individual enzyme activities, which reduces the accumulation of monorhamnosyl lipids.
  • This Modulation can also take place, for example, through the use of enzymes with certain properties, for example with regard to substrate specificity and thus approximately the chain length of the hydroxy fatty acids built into rhamnolipids.
  • the present invention was therefore based on the object of providing a possibility of producing rhamnolipids with safe production hosts from easily accessible carbon sources.
  • the present invention therefore relates to cells which are able to form rhamnolipids and, compared to their wild type, have at least one increased activity of a gene product of homologues of the gene products rhIA, rhIB and rhIC and at least one further enzyme as described in claim 1 .
  • Another object of the invention is a process for the production of rhamnolipids using the aforementioned cells as a biocatalyst and simple carbon sources.
  • An advantage of the present invention is that organisms can be used which are non-pathogenic and easy to cultivate. Another advantage is that it is not necessary to use oils as the sole or co-substrate. Another advantage is that the invention can be used to produce rhamnolipids with defined and modulatable properties. Another advantage of the present invention is that dirhamnosyl lipids can be prepared. Another advantage is that rhamnolipids can be produced with higher space-time and carbon yields than with cells without enhancing these activities.
  • wild type of a cell is used herein to denote a cell whose genome is in a state in which it has naturally arisen through evolution. The term is used both for the entire cell and for individual genes. The term “wild type” therefore does not include, in particular, cells or genes whose gene sequences have been at least partially modified by humans using recombinant methods.
  • rhamnolipid is understood to mean a compound of the general formula (I) or its salt. It is evident that the activities specifically specified above for the enzymes E 1a to E 3b represent only a specific exemplary selection of a broader spectrum of activities of the aforementioned enzymes; the activity mentioned in each case is that for which a reliable measurement method is available for a given enzyme.
  • the term “increased activity of an enzyme” is preferably to be understood as an increased intracellular activity.
  • the following statements on increasing the enzyme activity in cells apply both to increasing the activity of the enzyme E 1 to E 3 and to all the enzymes mentioned below, the activity of which can optionally be increased.
  • an increase in the enzymatic activity can be achieved by increasing the number of copies of the gene sequence or the gene sequences which code for the enzyme, using a strong promoter or an improved ribosome binding site, weakening negative regulation of gene expression, for example by means of transcription regulators, or a positive regulation of the gene expression, for example by transcription regulators, increased, the codon usage of the gene changed, the half-life of the mRNA or the enzyme increased in various ways, the regulation of the expression of the gene modified or a gene or allele used for a corresponding Enzyme encoded with an increased activity and optionally combined these measures.
  • Cells genetically modified according to the invention are generated, for example, by transformation, transduction, conjugation or a combination of these methods with a vector which contains the desired gene, an allele of this gene or parts thereof and, if appropriate, a promoter which enables expression of the gene.
  • the heterologous expression is achieved in particular by integrating the gene or the alleles into the chromosome of the cell or an extrachromosomally replicating vector.
  • the expression of the enzymes or genes mentioned above and all of the following can be detected with the aid of 1- and 2-dimensional protein gel separation and subsequent optical identification of the protein concentration with appropriate evaluation software in the gel. If the increase in an enzyme activity is based exclusively on an increase in the expression of the corresponding gene, the quantification of the increase in enzyme activity can be determined in a simple manner by comparing the 1- or 2-dimensional protein separations between wild type and genetically modified cells.
  • a common method for preparing the protein gels in coryneform bacteria and for identifying the proteins is that of Hermann et al. (Electrophoresis, 22: 1712.23 (2001 )) described procedure.
  • the protein concentration can also be determined by Western blot hybridization with an antibody specific for the protein to be detected ( Sambrook et al., Molecular Cloning: a laboratory manual, 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY USA, 1989 ) and subsequent optical evaluation with appropriate software to determine the concentration ( Lohaus and Meyer (1989) Biospektrum, 5: 32-39 ; Lottspeich (1999) Angewandte Chemie 111: 2630-2647 ) to be analyzed.
  • the activity of DNA-binding proteins can be measured using DNA band shift assays (also known as gel retardation) ( Wilson et al. (2001) Journal of Bacteriology, 183: 2151-2155 ).
  • the determination of the increase in enzyme activity and also the determination of the decrease in an enzyme activity are preferably carried out using the in Hermann et al., Electophoresis, 22: 1712-23 (2001 ), Lohaus et al., Biospektrum 5 32-39 (1998 ), Lottspeich, Angewandte Chemie 111: 2630-2647 (1999 ) and Wilson et al., Journal of Bacteriology 183: 2151-2155 (2001 ) methods described.
  • the enzyme activity is increased by mutating the endogenous gene, such mutations can either be generated in an undirected manner using conventional methods, such as UV radiation or chemicals that trigger mutations, or specifically using genetic engineering methods such as deletion (s), insertion (s) and / or nucleotide exchange (s). Altered cells are obtained through these mutations.
  • Particularly preferred mutants of enzymes are in particular those enzymes which can no longer be feedback, product or substrate inhibited, or at least less than the wild-type enzyme. If the enzyme activity is increased by increasing the synthesis of an enzyme, for example the number of copies of the corresponding genes is increased or the promoter and regulation region or the ribosome binding site located upstream of the structural gene is mutated.
  • Expression cassettes which are incorporated upstream of the structural gene act in the same way. Inducible promoters also make it possible to increase expression at any point in time.
  • so-called “enhancers” can also be assigned to the enzyme gene as regulatory sequences, which also bring about increased gene expression via an improved interaction between RNA polymerase and DNA. The expression is also improved by measures to extend the life of the mRNA. Furthermore, the enzyme activity is also increased by preventing the degradation of the enzyme protein.
  • the genes or gene constructs are either in plasmids with different numbers of copies or are integrated and amplified in the chromosome. Alternatively, overexpression of the genes concerned can also be achieved by changing the media composition and culture management. The expert can find instructions for this at Martin et al.
  • Such plasmids and vectors can e.g. B. the brochures of the companies Novagen, Promega, New England Biolabs, Clontech or Gibco BRL. Further preferred plasmids and vectors can be found in: Glover, DM (1985) DNA cloning: a practical approach, Vol. I-III, IRL Press Ltd. , Oxford ; Rodriguez, RL and Denhardt, D. T (eds) (1988) Vectors: a survey of molecular cloning vectors and their uses, 179-204, Butterworth, Stoneh at the; Goeddel, DV (1990) Systems for heterologous gene expression, Methods Enzymol.
  • the plasmid vector which contains the gene to be amplified is then transferred into the desired strain by conjugation or transformation.
  • the method of conjugation is for example at Shufer et al., Applied and Environmental Microbiology 60: 756-759 (1994 ) described.
  • Transformation methods are for example at Thierbach et al., Applied Microbiology and Biotechnology 29: 356-362 (1988 ), Dunican and Shivnan, Bio / Technology 7: 1067-1070 (1989 ) and Tauch et al., FEMS Microbiology Let-ters 123: 343-347 (1994 ) described. After homologous recombination by means of a "cross-over" event, the resulting strain contains at least two copies of the gene in question.
  • an activity of an enzyme E x increased compared to its wild type is preferably always a factor of at least 2, particularly preferably of at least 10, furthermore preferably of at least 100, more to be understood even more preferably by at least 1,000 and most preferably by at least 10,000 increased activity of the respective enzyme E x .
  • the cell according to the invention which has “an increased activity of an enzyme E x compared to its wild type”, in particular also a cell whose wild type has no or at least no detectable activity of this enzyme E x and which only after the enzyme activity has been increased, for example by overexpression , shows a detectable activity of this enzyme E x .
  • the term includes "Overexpression” or the phrase “increase in expression” used in the following statements also applies to the case that a starting cell, for example a wild-type cell, has no or at least no detectable expression and only induces detectable synthesis of the enzyme E x by recombinant methods becomes.
  • the activity of an enzyme can be determined by disrupting cells which contain this activity in a manner known to the person skilled in the art, for example with the aid of a ball mill, a French press or an ultrasonic disintegrator and then intact cells, cell fragments and disintegration aids , such as glass spheres are separated by centrifugation at 13,000 rpm and 4 ° C for 10 minutes. With the resulting cell-free raw extract, enzyme assays with subsequent LC-ESI-MS detection of the products can then be carried out.
  • the enzyme can be enriched in a manner known to the person skilled in the art by chromatographic methods (such as nickel nitrilotriacetic acid affinity chromatography, streptavidin affinity chromatography, gel filtration chromatography or ion exchange chromatography) or purified to homogeneity.
  • chromatographic methods such as nickel nitrilotriacetic acid affinity chromatography, streptavidin affinity chromatography, gel filtration chromatography or ion exchange chromatography
  • a standard assay contains 100 ⁇ M E. coli ACP, 1 mM ⁇ -mercaptoethanol, 200 ⁇ M malonyl coenzyme A, 40 ⁇ M octanoyl coenzyme A (for E 1a ) or dodecanoyl coenzyme A (for E 1b ), 100 ⁇ M NADPH, 2 ⁇ g E. coli FabD, 2 ⁇ g Mycobacterium tuberculosis FabH, 1 ⁇ g E. coli FabG, 0.1 M sodium phosphate buffer, pH 7.0, and 5 ⁇ g enzyme E 1 in a final volume of 120 ⁇ L.
  • ACP, ⁇ -mercaptoethanol and sodium phosphate buffer are preincubated for 30 min at 37 ° C. in order to reduce the ACP completely.
  • the reaction is started by adding enzyme E 1 .
  • the reactions are stopped with 2 ml of water which has been acidified to pH 2.0 with HCl and then extracted twice with 2 ml of chloroform / methanol (2: 1 (v: v)).
  • the phases are separated by centrifugation (16,100 g, 5 min, RT).
  • the lower organic phase is removed, completely evaporated in the vacuum centrifuge and the sediment taken up in 50 ⁇ l methanol. Undissolved components are sedimented by centrifugation (16,100 g, 5 min, RT) and the sample is analyzed by means of LC-ESI-MS.
  • the products are identified by analyzing the corresponding mass traces and the MS 2 spectra.
  • the activity of the enzyme E 2 is then determined with the samples obtained as described above as follows: a standard assay can be made from 185 ⁇ l 10 mM Tris-HCl (pH 7.5), 10 ⁇ l 125 mM dTDP-rhamnose and 50 ⁇ l protein crude extract (approx. 1 mg total protein) or purified protein in solution (5 ⁇ g purified protein). The reaction is started by adding 10 ⁇ l of 10 mM ethanolic solution of 3-hydroxydekanoyl-3-hydroxy decanoic acid (for E 2a ) or 3-hydroxytetradecanoyl-3-hydroxytetradecanoic acid (for E 2b ) and shaking at 30 ° C for 1 hour ( 600 rpm).
  • the activity of the enzyme E 3 is then determined with the samples obtained as described above as follows: a standard assay can be made from 185 ⁇ l of 10 mM Tris-HCl (pH 7.5), 10 ⁇ l of 125 mM dTDP-rhamnose and 50 ⁇ l of crude protein extract (approx. 1 mg total protein) or purified protein in solution (5 ⁇ g purified protein).
  • the reaction is started by adding 10 ⁇ l of 10 mM ethanolic solution of ⁇ -L-rhamnopyranosyl-3-hydroxydekanoyl-3-hydroxydecanoic acid (for E 3a ) or ⁇ -L-rhamnopyranosyl-3-hydroxytetradecanoyl-3-hydroxytetradecanoic acid (for E 3b ) started and incubated for 1 h at 30 ° C. with shaking (600 rpm). Then 1 ml of acetone is added to the reaction. Undissolved components are sedimented by centrifugation (16,100 g , 5 min, RT) and the sample is analyzed by means of LC-ESI-MS. The products are identified by analyzing the corresponding mass traces and the MS 2 spectra.
  • cells are preferred which have increased activities of the following enzyme combinations: E 1 , E 2 , E 3 , E 1 E 2 , E 1 E 3 , E 2 E 3 and E 1 E 2 E 3 , what the combination of E 2 , E 2 E 3 and E 1 E 2 E 3 , in particular E 1 E 2 E 3 is particularly preferred.
  • n 1
  • the cells according to the invention are microorganisms such as yeasts, fungi or bacteria, microorganisms being particularly preferred and bacteria and yeasts being most preferred.
  • Particularly suitable bacteria, yeasts or fungi are those bacteria, yeasts or fungi which are deposited as bacterial, yeast or fungus strains at the German Collection of Microorganisms and Cell Cultures GmbH (DSMZ), Braunschweig, Germany.
  • suitable bacteria belong to the genera under http://www.dsmz.de/species/bacteria.htm are listed
  • yeasts suitable according to the invention belong to those genera which are listed at http://www.dsmz.de/species/yeasts.htm and are fungi suitable according to the invention those that go to http://www.dsmz.de/species/fungi.htm are listed.
  • Cells preferred according to the invention are those of the genera Aspergillus, Corynebacterium, Brevibacterium, Bacillus, Acinetobacter, Alcaligenes, Lactobacillus, Paracoccus, Lactococcus, Candida, Pichia, Hansenula, Kluyveromyces, Saccharomyces, Escherichia, Zymomonas, Yarrowia, Methylobacterium, Ralstonia, Pseudomonas, Rhodospirillum, Rhodobacter, Burkholderia, Clostridium , Alstridium, Alsteri, Aspergillus, Baculus niger, Aspergillus, Aspergillus, Baculus niger subtilis, Brevibacterium flavum, Brevibacterium lactofermentum, Burkholderia andropogonis, B.
  • brasilensis B. caledonica, B. caribensis, B. caryophylli, B. fungorum, B. gladioli, B. glathei, B. glumae, B. graminis, B. hospita B. kururiensis, B. phenazinium, B. phymatum, B. phytofirmans, B. plantarii, B. sacchari, B. singaporensis, B. sordidicola, B. terricola, B. tropica, B. tuberum, B. ubonensis, B. . unamae, B. xenovorans, B. anthina, B. pyrrocinia, B.
  • thailandensis Candida blankii, Candida rugosa, Corynebacterium glutamicum, Corynebacterium efficiens, Escherichia coli, Hansenula polymorpha, Kluveromyces lactis, Methylobacterium extorquutus, Paracoccus versorquutens seudomonas argentinensis, P. borbori, P. citronellolis, P. flavescens, P. mendocina, P. nitroreducens, P. oleovorans, P. pseudoalcaligenes, P. resinovorans, P. straminea, P. aurantiaca, P.
  • aureofaciens P. chlororaphis , P. fragi, P. lundensis, P. taetrolens, P. antarctica, P. azotoformans, 'P. blatchfordae ', P. brassicacearum, P. brenneri, P. cedrina, P. corrugata, P. fluorescens, P. gessardii, P. libanensis, P. mandelii, P. marginalis, P. mediterranea, P. meridiana, P. migulae , P. mucidolens, P. orientalis, P. panacis, P. proteolytica, P.
  • P. jinjuensis P. kilonensis, P. knackmussii, P. koreensis, P. lini, P. lutea, P. moraviensis, P. otitidis, P. pachastrellae, P. palleroniana , P. papaveris, P. peli, P. perolens, P. poae, P. pohangensis, P. psychrophila, P. psychrotolerans, P. rathonis, P. reptilivora, P. resiniphila, P. rhizosphaerae, P. rubescens, P. salomonii, P. segitis, P.
  • Cells preferred according to the invention are unable to form any or no detectable amounts of rhamnolipids as wild type and, moreover, as wild type preferably have no or no detectable activity of the enzymes E 1 , E 2 and E 3 .
  • the cell according to the invention is a cell which, as wild type, is able to form polyhydroxyalkanoates with chain lengths of the monoalkanoate of C 6 to C 16 .
  • Such cells are, for example, Burkholderia sp., Burkholderia thailandensis, Pseudomonas sp., Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas oleovorans, Pseudomonas stutzeri, Pseudomonas fluorescens, Pseudomonas citronellolis, Pseudomonas resinovorans, Comamonas testosteroni, Aeromonas hydrophila, Cupriavidus necator, Alcaligenes latus and Ralstonia eutropha .
  • preferred cells according to the invention are genetically modified in such a way that they are able to form fewer polyhydroxyalkanoates compared to their wild type.
  • Such cells are described in, for example De Eugenio et al., Environ Microbiol. 2010. 12 (1): 207-21 and Rehm et al., Appl Environ Microbiol. 2001. 67 (7): 3102-9 .
  • Such a cell which is less able to form polyhydroxyalkanoates compared to its wild type is particularly characterized in that it has a reduced activity of at least one enzyme Eg or E 10 compared to its wild type, where Eg is a polyhydroxyalkanoate synthase, EC: 2.3.1.-, in particular with a polypeptide sequence Seq ID No. 30 or Seq ID No. 32 or with a polypeptide sequence in which up to 25%, preferably up to 20%, particularly preferably up to 15% in particular up to 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% of the amino acid residues compared to the respective reference sequence Seq ID No. 30 or Seq ID No.
  • E 10 is a 3-hydroxyalkanoyl-ACP: coenzyme A transferase, in particular with polypeptide sequence Seq ID No. 34 or Seq ID No. 36 or with a polypeptide sequence in which up to 25%, preferably up to 20%, particularly preferably up to 15%, in particular up to 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% of the amino acid residues compared to the respective reference sequence Seq ID No. 34 or Seq ID No. 36 are changed by deletion, insertion, substitution or a combination thereof and which still contain at least 10%, preferably 50%, particularly preferably 80%, in particular more than 90% of the enzymatic activity of the enzyme with the respective reference sequence Seq ID No. 34 or Seq ID No.
  • enzymatic activity for an enzyme E 10 is understood to mean the ability to convert 3-hydroxyalkanoyl-ACP to 3-hydroxyalkananoyl-coenzyme A, in particular 3-hydroxyalkananoyl-ACP to 3-hydroxytetradecanoyl-coenzyme A, to implement.
  • the activity of the enzyme Eg is then determined using the samples obtained as described above for the enzymes E 1 to E 3 by first adding 560 ⁇ l of 100 mM Tris / HCl, pH 7.5, 20 ⁇ l of 35 mM DTNB in DMSO and 20 ⁇ l of 41 mM 3-Hydroxydekanoyl-Coenzyme A are mixed.
  • the activity of the enzyme E 10 is then determined using the samples obtained as described above for the enzymes E 1 to E 3 .
  • the standard assay contains 3 mM MgCl 2 , 40 ⁇ M hydroxydekanoyl-coenzyme A and 20 ⁇ M E. coli ACP in 50 mM Tris-HCl, pH 7.5, in a total volume of 200 ⁇ l.
  • the reaction is started by adding 5 ⁇ g of purified enzyme E 10 in 50 ⁇ l of Tris / HCl, pH 7.5 and incubating at 30 ° C. for 1 h.
  • the reaction is stopped by adding 50% (w / v) trichloroacetic acid and 10 mg / ml BSA (30 ⁇ l).
  • Released coenzyme A is determined spectrophotometrically by recording the increase in the extinction at 412 nm, caused by the addition of 5,5'-dithiobis (2-nitrobenzoate) (DTNB) to free SH groups, over time.
  • DTNB 5,5'-dithiobis (2-nitrobenzoate)
  • the phrase "reduced activity of an enzyme E x" used accordingly preferably means a factor of at least 0.5, particularly preferably at least 0.1, furthermore preferably at least 0.01, furthermore even more preferably at least 0.001 and most preferably at least 0.0001 understood decreased activity.
  • the phrase “decreased activity” also includes no detectable activity ("activity of zero").
  • the activity of a specific enzyme can be reduced, for example, by targeted mutation or by other measures known to the person skilled in the art for reducing the activity of a specific enzyme. Processes for reducing enzymatic activities in microorganisms are known to the person skilled in the art. Molecular biological techniques are particularly useful here.
  • Cells preferred according to the invention are characterized in that the reduction in enzymatic activity is achieved by modifying a gene comprising one of the nucleic acid sequences mentioned, the modification being selected from the group comprising, preferably consisting of, insertion of foreign DNA into the gene, deletion at least of parts of the gene, point mutations in the gene sequence, RNA interference (siRNA), antisense RNA or modification (insertion, deletion or point mutations) of regulatory sequences such as promoters and terminators or of ribosome binding sites that flank the gene.
  • RNA interference siRNA
  • antisense RNA or modification insertion, deletion or point mutations
  • regulatory sequences such as promoters and terminators or of ribosome binding sites that flank the gene.
  • foreign DNA is to be understood as any DNA sequence that is "foreign” to the gene (and not to the organism), ie endogenous DNA sequences can also function as "foreign DNA” in this context.
  • the gene is interrupted by inserting a selection marker gene, so that the foreign DNA
  • the cell is Pseudomonas putida cells which have a reduced polyhydroxyalkanoate synthesis compared to their wild type.
  • Such cells are for example in Ren et al., Journal Applied Microbiology and Biotechnology 1998 Jun, 49 (6): 743-50 as GPp121, GPp122, GPp123 and GPp124, in Huisman et al., J Biol Chem. 1991 Feb 5; 266 (4): 2191-8 as GPp104 as well as in De Eugenio et al., Environ Microbiol. 2010. 12 (1): 207-21 as KT42C1 and in Ouyang et al. Macromol Biosci. 2007. 7 (2): 227-33 described as KTOY01 and KTOY02
  • the radical determined via R 1 and R 2 is derived from 3-hydroxyoctanoyl-3-hydroxyoctanoic acid, 3-hydroxyoctanoyl-3-hydroxydecanoic acid, 3-hydroxydekanoyl-3-hydroxyoctanoic acid, 3-hydroxyoctanoyl-3-hydroxydecenoic acid, 3-hydroxydecenoyl-3-hydroxy-3-hydroxyoctanoic acid, 3-hydroxy-3-hydroxyoctanoic acid, 3-Hydroxydodecanoyl-3-Hydroxyoctanoic acid, 3-Hydroxyoctanoyl-3-Hydroxydodecenoic acid, 3-Hydroxydodecenoyl-3-Hydroxyoctanoic acid, 3-Hydroxydekanoyl-3-Hydroxydekanoyl-3-Hyd
  • a cell according to the invention is also able to form mixtures of different rhamnolipids of the general formula (I).
  • -% of the rhamnolipids formed derives from 3-hydroxydekanoyl-3-hydroxyoctanoic acid or 3-hydroxyoctanoyl-3-hydroxy decanoic acid, the specified% by weight being based on the sum of all rhamnolipids of the general formula (I) formed.
  • the cell according to the invention has also been genetically modified with regard to E 1 to E 3 in such a way that it has an increased activity compared to its wild type, as specified below in each case of at least one of the enzymes selected from the group consisting of
  • At least one enzyme E 4 a dTTP: ⁇ -D-glucose-1-phosphate thymidylyl transferase, EC 2.7.7.24, in particular one with a polypeptide sequence Seq ID No. 10 or with a polypeptide sequence in which up to 25%, preferably up to 20%, particularly preferably up to 15%, in particular up to 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% of the amino acid residues compared to the reference sequence Seq ID No. 10 are changed by deletion, insertion, substitution or a combination thereof and which are still at least 10%, preferably 50%, particularly preferably 80%, especially more possesses as 90% of the enzymatic activity of the enzyme with the reference sequence Seq ID No.
  • enzymatic activity for an enzyme E 4 is understood to mean the ability to convert ⁇ -D-glucose-1-phosphate and dTTP to dTDP-glucose, at least one enzyme E 5 , a dTTP-glucose-4,6-hydrolyase, EC 4.2.1.46, in particular one with polypeptide sequence Seq ID No. 12 or with a polypeptide sequence in which up to 25%, preferably up to 20%, particularly preferred up to 15%, in particular up to 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% of the amino acid residues compared to the reference sequence Seq ID No.
  • an enzyme E 6 being understood to mean the ability to convert dTDP-4-dehydro-6-deoxy-D-glucose to dTDP-4-dehydro-6-deoxy-L-mannose and at least one enzyme E 7 , a dTDP-4-dehydrorhamnose reductase, EC 1.1.1.133, in particular one with a polypeptide sequence Seq ID No. 16 or with a polypeptide sequence in which up to 25%, preferably up to 20%, particularly preferably up to 15% in particular up to 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% of the amino acid residues compared to the reference sequence Seq ID No.
  • 16 have been changed by deletion, insertion, substitution or a combination thereof, and that still possesses at least 10%, preferably 50%, particularly preferably 80%, in particular more than 90% of the enzymatic activity of the enzyme with the reference sequence Seq ID No. 16, with enzymatic activity for an enzyme E 7 being understood to mean the ability to dTDP-4 -To convert dehydro-6-deoxy-L-mannose to dTDP-6-deoxy-L-mannose, having.
  • the activity of the enzyme E 4 is determined using the samples obtained as described above for the enzymes E 1 to E 3 by adding ⁇ -D-glucose-1-phosphate (1.3 mM) with dTTP (5 mM) and 5 ⁇ g of purified Enzyme E 4 is incubated in 50 ⁇ l sodium phosphate buffer, pH 8.5, and after 5, 10 and 20 min incubation at 30 ° C., the reaction is stopped by adding 20 ⁇ l chloroform. The mixture is then vortexed and centrifuged for 5 min at 16,000 g and room temperature. The aqueous phase is transferred to a new reaction vessel and the organic phase is extracted again with 80 ⁇ l of water. Both aqueous phases are combined and analyzed by means of HPLC.
  • a Phenosphere ODS2 column 250 x 4.6 mm; Phenomenex, Torrance, USA
  • a Spheresorb ODS2 column 250 x 4.6 mm; Waters, Milford, USA.
  • the analytes are eluted at a flow rate of 1 ml min -1 with 0.5 M KH 2 PO 4 (eluent A) for 15 min, followed by a linear gradient up to 80% eluent A and 20% methanol over a period of 14 min at a flow rate of 0.7 ml min -1 .
  • the activity of the enzyme E 5 is then determined with the samples obtained as described above for the enzymes E 1 to E 3 by mixing dTDP- ⁇ -D-glucose (1.3 mM) with 5 ⁇ g of purified enzyme E 5 in 50 ⁇ l of sodium phosphate -Buffer, pH 8.5, incubated and after 5, 10 and 20 min incubation at 30 ° C, the reaction is stopped by adding 20 ⁇ l of chloroform. The mixture is then vortexed and centrifuged for 5 min at 16,000 g and room temperature. The aqueous phase is transferred to a new reaction vessel and the organic phase is extracted again with 80 ⁇ l of water. Both aqueous phases are combined and analyzed by means of HPLC.
  • a Phenosphere ODS2 column 250 x 4.6 mm; Phenomenex, Torrance, USA
  • a Spheresorb ODS2 column 250 x 4.6 mm; Waters, Milford, USA
  • the analytes are eluted at a flow rate of 1 ml min -1 with 0.5 M KH 2 PO 4 (eluent A) for 15 min, followed by a linear gradient up to 80% eluent A and 20% methanol over a period of 14 min at a flow rate of 0.7 ml min -1 .
  • the activity of the enzyme E 6 is then determined with the samples obtained as described above for the enzymes E 1 to E 3 by first adding dTDP- ⁇ -D-glucose (1.3 mM) with 5 ⁇ g of purified enzyme E 5 in 50 ⁇ l Sodium phosphate buffer, pH 8.5, incubated for 10 min at 30 ° C will. Then 0.5 ⁇ g of purified enzyme E 6 are added, and after 5, 10 and 20 minutes of incubation at 30 ° C., the reaction is stopped by adding 20 ⁇ l of chloroform. The mixture is then vortexed and centrifuged for 5 min at 16,000 g and room temperature. The aqueous phase is transferred to a new reaction vessel and the organic phase is extracted again with 80 ⁇ l of water.
  • Both aqueous phases are combined and analyzed by means of HPLC.
  • a Phenosphere ODS2 column 250 x 4.6 mm; Phenomenex, Torrance, USA
  • a Spheresorb ODS2 column 250 x 4.6 mm; Waters, Milford, USA
  • the analytes are eluted at a flow rate of 1 ml min -1 with 0.5 M KH 2 PO 4 (eluent A) for 15 min, followed by a linear gradient up to 80% eluent A and 20% methanol over a period of 14 min at a flow rate of 0.7 ml min -1 .
  • the activity of the enzyme E 7 is then determined using the samples obtained as described above for the enzymes E 1 to E 3 by first adding dTDP- ⁇ -D-glucose (1.3 mM) with 5 ⁇ g of purified enzyme E 5 in 50 ⁇ l Sodium phosphate buffer, pH 8.5, can be incubated for 10 min at 30 ° C. Then 5 ⁇ g of purified enzyme E 6 and 0.5 ⁇ g of purified enzyme E 7 and NADPH (10 mM) are added, and after 5, 10 and 20 min incubation at 30 ° C., the reaction is stopped by adding 20 ⁇ l of chloroform. The mixture is then vortexed and centrifuged for 5 min at 16,000 g and room temperature.
  • the aqueous phase is transferred to a new reaction vessel and the organic phase is extracted again with 80 ⁇ l of water. Both aqueous phases are combined and analyzed by means of HPLC.
  • a Phenosphere ODS2 column 250 x 4.6 mm; Phenomenex, Torrance, USA
  • a Spheresorb ODS2 column 250 x 4.6 mm; Waters, Milford, USA
  • the analytes are eluted at a flow rate of 1 ml min -1 with 0.5 M KH 2 PO 4 (eluent A) for 15 min, followed by a linear gradient up to 80% eluent A and 20% methanol over a period of 14 min at a flow rate of 0.7 ml min -1 .
  • cells are preferred which have increased activities of the following enzyme combinations: E 4 E 5 , E 4 E 6 , E 4 E 7 , E 5 E 6 , E 5 E 7 , E 6 E 7 , E 4 E 5 E 6 , E 4 E 5 E 7 , E 5 E 6 E 7 , E 4 E 6 E 7 , E 4 E 5 E 6 E 7 , of which the combination E 4 E 5 E 6 E 7 is particularly preferred.
  • the cell according to the invention has been genetically modified in the fatty acid biosynthesis in such a way that the enzymatic reactions that are required to convert acyl-ACP and malonyl-coenzyme A to 3-ketoacyl-ACP and / or to convert 3 -Ketoacyl-ACP lead to ( R ) -3-hydroxyalkanoyl-ACP.
  • the cell according to the invention has been genetically modified in the fatty acid biosynthesis in such a way that the enzymatic reactions that are necessary for the conversion of ( R ) -3-hydroxyalkanoyl-ACP to trans -2-enoyl-ACP and / or lead to the conversion of trans -2-enoyl-ACP to acyl-ACP, are weakened.
  • the cell according to the invention has been genetically modified in the ⁇ -oxidation of fatty acids in such a way that the enzymatic reactions that are necessary to convert acyl-coenzyme A to trans -2-enoyl-coenzyme A and / or to convert trans -2-enoyl-coenzyme A lead to ( S ) -3-hydroxyalkanoyl-coenzyme A, be strengthened.
  • the cell according to the invention has been genetically modified in the ⁇ -oxidation of fatty acids in such a way that the enzymatic reactions that convert ( S ) -3-hydroxyalkanoyl-coenzyme A into 3-ketoacyl-coenzyme A and / or lead to the conversion of 3-ketoacyl-coenzyme A to acyl-coenzyme A and acetyl-coenzyme A are weakened. Compare for an overview Figure 1 .
  • the cells according to the invention can advantageously be used for the production of rhamnolipids and since these lipids are then optionally purified, it is advantageous if the cells according to the invention have an increased activity compared to their wild type of at least one enzyme E 8 , which exports a rhamnolipid of the general formula (I) catalyzed from the cell into the surrounding medium.
  • proteins E 8 are preferably selected from the group consisting of an enzyme E 8 with polypeptide sequence Seq ID No. 8, Seq ID No. 24, Seq ID No. 26 or Seq ID No. 28 or with a polypeptide sequence in which up to 25%, preferably up to 20%, particularly preferably up to 15% in particular up to 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% of the amino acid residues compared to the respective reference sequence Seq ID No. 8, Seq ID No. 24, Seq ID No. 26 or Seq ID No. 28 have been changed by deletion, insertion, substitution or a combination thereof and which still contain at least 50%, preferably 65%, particularly preferably 80%, in particular more than 90% of the enzymatic activity of the enzyme with the respective reference sequence Seq ID No.
  • Another, preferred embodiment of cells according to the invention is characterized in that it has at least one of the nucleic acids or vectors according to the invention mentioned below.
  • Cells according to the invention can advantageously be used for the production of rhamnolipids.
  • the use of cells according to the invention for the production of compounds of the general formula (I) is thus disclosed.
  • the genetically modified cells according to the invention can be used continuously or discontinuously in the batch process (batch cultivation) or in the fed-batch process (feed process) or repeated fed-batch process (repetitive feed process) for the purpose of producing the abovementioned products with the nutrient medium brought into contact and thus cultivated.
  • a semi-continuous process is also conceivable, as it is in the GB-A-1009370 is described.
  • a summary of known cultivation methods is in the textbook of Chmiel ("Bioprocess Engineering 1. Introduction to Bioprocess Engineering” (Gustav Fischer Verlag, Stuttgart, 1991 )) or in the textbook by Storhas ("Bioreactors and peripheral equipment", Vieweg Verlag, Braunschweig / Wiesbaden, 1994 ) described.
  • the culture medium to be used must suitably meet the requirements of the respective strains. Descriptions of culture media of different yeast strains are for example in " Nonconventional yeast in biotechnology "(Ed. Klaus Wolf, Springer-Verlag Berlin, 1996 ) contain.
  • carbohydrates such as. B. glucose, sucrose, arabinose, xylose, lactose, fructose, maltose, molasses, starch, cellulose and hemicellulose, vegetable and animal oils and fats such as. B.
  • soybean oil soybean oil, safflower oil, peanut oil, hemp oil, jatropha oil, coconut fat, pumpkin seed oil, linseed oil, corn oil, poppy seed oil, evening primrose oil, olive oil, palm kernel oil, palm oil, rapeseed oil, sesame oil, sunflower oil, grapeseed oil, walnut oil, wheat germ oil, and coconut oil B.
  • caprylic acid capric acid, lauric acid, myristic acid, palmitic acid, palmitolenic acid, stearic acid, arachidonic acid, behenic acid, oleic acid, linoleic acid, linolenic acid, gamma-linolenic acid and their methyl or ethyl esters and fatty acid mixtures, mono-, di- and triglycerides with the fatty acids just mentioned , Alcohols such as B. glycerine, ethanol and methanol, hydrocarbons such as methane, carbon-containing gases and gas mixtures such as CO, CO 2 , synthesis or flue gas, amino acids such as L-glutamate or L-valine or organic acids such as.
  • acetic acid can be used. These substances can be used individually or as a mixture.
  • carbohydrates in particular monosaccharides, oligosaccharides or polysaccharides, as a carbon source is particularly preferred, as in FIG U.S. 6.01,494 and U.S. 6,136,576 is described and of hydrocarbons, in particular of alkanes, alkenes and alkynes and the monocarboxylic acids derived therefrom and the mono-, di- and triglycerides derived from these monocarboxylic acids, and of glycerol and acetate.
  • Mono-, di- and triglycerides containing the esterification products of glycerol with caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, palmitolenic acid, stearic acid, arachidonic acid, behenic acid, oleic acid, linoleic acid, linolenic acid and / or gamma-linolenic acid are very particularly preferred.
  • a great advantage of the present invention is that the cells according to the invention are able to form rhamnolipids from the simplest carbon sources such as glucose, sucrose or glycerol, so that it is not necessary to provide longer-chain carbon sources in the medium during the method according to the invention.
  • the medium in step I) of the method according to the invention contains no or no detectable amounts of carboxylic acids with a chain length of greater than six carbon atoms or esters or glycerides which can be derived from these.
  • Organic nitrogenous compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, ammonia, ammonium hydroxide or ammonia water can be used as the nitrogen source.
  • the nitrogen sources can be used singly or as a mixture.
  • Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the phosphorus source.
  • the culture medium must also contain salts of metals such as. B. Magnesium sulfate or iron sulfate, which are necessary for growth.
  • essential growth substances such as amino acids and vitamins can be used in addition to the substances mentioned above.
  • suitable precursors can be added to the culture medium will. The stated starting materials can be added to the culture in the form of a single batch or fed in in a suitable manner during the cultivation.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid are used in a suitable manner to control the pH of the culture.
  • antifoam agents such as. B. fatty acid polyglycol esters are used.
  • suitable selectively acting substances such as. B. Antibiotics are added.
  • oxygen or oxygen-containing gas mixtures such as. B. Air entered into the culture.
  • the temperature of the culture is normally more than 20 ° C, preferably more than 25 ° C, it can also be more than 40 ° C, advantageously a cultivation temperature of 95 ° C, particularly preferably 90 ° C and most preferably 80 ° C is not exceeded.
  • the rhamnolipids formed by the cells can optionally be isolated from the cells and / or the nutrient medium, all methods known to the person skilled in the art for isolating low molecular weight substances from complex compositions, such as filtration, extraction, being suitable for isolation , Adsorption (chromatography) or crystallization.
  • the product phase contains residues of biomass and various impurities such as oils, fatty acids and other nutrient media components.
  • the impurities are preferably separated off in a solvent-free process.
  • the product phase can be diluted with water to make it easier to adjust the pH value.
  • the product and aqueous phases can then be homogenized by converting the rhamnolipids into a water-soluble form by lowering or raising the pH value using acids or alkalis.
  • the solubilization of the rhamnolipids in the aqueous phase can potentially be supported by incubation at higher temperatures, for example at 60 to 90 ° C., and constant mixing.
  • the rhamnolipids can then be converted back into a water-insoluble form by subsequently raising or lowering the pH value by means of alkalis or acids, so that they can easily be separated from the aqueous phase.
  • the product phase can then be washed one or more times with water in order to remove water-soluble impurities.
  • Oil residues can be separated off, for example, by extraction using suitable solvents, advantageously using organic solvents.
  • the preferred solvent is an alkane such as n-hexane.
  • the product can be separated off from the aqueous phase using a suitable solvent, for example an ester such as ethyl acetate or butyl acetate.
  • Solvents are preferably used here, in particular organic solvents.
  • the preferred solvent is n-pentanol. For example, distillation is used to remove the solvent.
  • the lyophilized product can then be purified further, for example by means of chromatographic methods.
  • chromatographic methods include precipitation using suitable solvents, extraction using suitable solvents, complexing, for example using cyclodextrins or cyclodextrin derivatives, crystallization, purification or isolation using chromatographic methods, or the conversion of the rhamnolipids into easily separable derivatives.
  • the rhamnolipids which can be produced using the process according to the invention are disclosed, in particular also the rhamnolipid mixtures which are described above and which can be produced using the process according to the invention.
  • the rhamnolipids and mixtures which can be prepared using the process according to the invention can advantageously be used in cleaning agents, in cosmetic or pharmaceutical formulations and in crop protection formulations.
  • the use of the rhamnolipids obtained with the method according to the invention for the production of cosmetic, dermatological or pharmaceutical formulations, of crop protection formulations and of care and cleaning agents and surfactant concentrates is thus disclosed.
  • care product is understood here to mean a formulation that fulfills the purpose of keeping an object in its original form, the effects of external influences (e.g. time, light, temperature, pressure, pollution, chemical reaction with others, with the object reactive compounds coming into contact) such as aging, soiling, material fatigue, fading, to reduce or avoid or even to improve the desired positive properties of the object. For last point for example, improved hair gloss or greater elasticity of the object under consideration.
  • Plant protection formulations are to be understood as meaning those formulations which, from the nature of their preparation, are obviously used for plant protection; this is particularly the case when the formulation contains at least one compound from the classes of herbicides, fungicides, insecticides, acaricides, nematicides, bird repellants, plant nutrients and soil structure improvers.
  • the rhamnolipids produced by the process according to the invention can be used in care and cleaning agents for households, industry, in particular for hard surfaces, leather or textiles.
  • nucleotide identity or “amino acid identity” is determined here with the aid of known methods. In general, special computer programs with algorithms are used that take special requirements into account. Preferred methods for determining the identity initially produce the greatest correspondence between the sequences to be compared. Computer programs used to determine identity include, but are not limited to, the GCG program package, including GAP ( Deveroy, J. et al., Nucleic Acid Research 12 (1984), p. 387 , Genetics Computer Group University of Wisconsin, Medicine (Wi), and BLASTP, BLASTN and FASTA ( Altschul, S. et al., Journal of Molecular Biology 215 (1990), pp. 403-410 .
  • GAP Deveroy, J. et al., Nucleic Acid Research 12 (1984), p. 387 , Genetics Computer Group University of Wisconsin, Medicine (Wi), and BLASTP, BLASTN and FASTA ( Altschul, S. et al., Journal of Molecular Biology 215 (1990), pp. 40
  • the BLAST program can be obtained from the National Center For Biotechnology Information (NCBI) and from other sources ( BLAST Handbuch, Altschul S. et al., NCBI NLM NIH Bethesda ND 22894 ; Altschul S. et al., Supra).
  • NCBI National Center For Biotechnology Information
  • the well-known Smith-Waterman algorithm can also be used to determine the nucleotide identity.
  • Preferred parameters for determining the "nucleotide identity" are when using the BLASTN program ( Altschul, S. et al., Journal of Molecular Biology 215 (1990), pp. 403-410 : Expect Threshold: 10 Word size: 28 Match Score: 1 Mismatch Score: -2 Gap costs: Linear
  • the above parameters are the default parameters in the nucleotide sequence comparison.
  • the GAP program is also suitable for use with the above parameters.
  • the above parameters are the default parameters in the amino acid sequence comparison.
  • the GAP program is also suitable for use with the above parameters.
  • An identity of 60% according to the above algorithm means 60% identity in connection with the present invention. The same goes for higher identities.
  • sequence which hybridizes with the opposite strand of a sequence or would hybridize taking into account the degeneration of the genetic code indicates a sequence which, under preferably stringent conditions, hybridizes with the opposite strand of a reference sequence or would hybridize taking into account the degeneration of the genetic code .
  • the hybridizations can be carried out at 68 ° C. in 2 ⁇ SSC or according to the protocol of the digoxigenin labeling kit from Boehringer (Mannheim).
  • Preferred hybridization conditions are e.g. B. Incubation at 65 ° C overnight in 7% SDS, 1% BSA, 1 mM EDTA, 250 mM sodium phosphate buffer (pH 7.2) and subsequent washing at 65 ° C.
  • the derivatives of the isolated DNA according to the invention which according to alternative F1), F2) or F3) by substitution, addition, inversion and / or deletion of one or more bases of a sequence according to one of groups A1) to E1), A2) to E2) and A3) to E3) include, in particular, those sequences which in the protein which they encode for conservative amino acid exchanges, such as e.g. B. lead to the replacement of glycine for alanine or of aspartic acid for glutamic acid.
  • Such functionally neutral mutations are referred to as sense mutations and do not lead to any fundamental change in the activity of the polypeptide.
  • the nucleic acid contained according to the invention is preferably a vector, in particular an expression vector or a gene expression cassette.
  • All vectors known to the person skilled in the art which are usually used to introduce DNA into a host cell, can be considered as vectors. These vectors can replicate autonomously, since they have origins of replication, such as those of the 2 ⁇ plasmid or ARS (autonomously replicating sequences), or integrate into the chromosomes (non-replicative plasmids). Vectors are also understood to mean linear DNA fragments which do not have any origins of replication, such as gene insertion or gene expression cassettes.
  • Gene overexpression cassettes usually consist of a marker, the genes to be overexpressed and regulatory regions relevant for the expression of the genes, such as promoters and terminators.
  • Preferred vectors are selected from the group comprising plasmids and cassettes, such as E. coli yeast shuttle plasmids, particularly preferred are expression vectors, gene insertion or gene expression cassettes, in particular the vectors described below Seq ID No. 38, Seq ID No. 40, Seq ID No. 42, Seq ID No. 45 and Seq ID No. 47.
  • the sequences of groups [A1 to G1], [A2 to G2] and [A3 to G3] are under the control of at least one constitutive or regulatable promoter which encodes the DNA sequences encoded by these Polypeptide in the cell of a microorganism, preferably a bacterial, yeast or fungal cell, whereby Aspergillus nidulans, Aspergillus niger, Alcaligenes latus, Bacillus megaterium, Bacillus subtilis, Brevibacterium flavum, Brevibacterium lactofermentum, Burkholderia andropogonica, B. braedonensis, B. B. caribensis, B.
  • a microorganism preferably a bacterial, yeast or fungal cell, whereby Aspergillus nidulans, Aspergillus niger, Alcaligenes latus, Bacillus megaterium, Bacillus subtilis, Brevibacterium flavum, Brevibacterium lac
  • thailandensis Candida blankii, Candida rugosa, Corynebacterium glutamicum, Corynebacterium efficiens, Escherichia coli, Hansenula polymorpha, Kluveromyces lactis, Methylobacterium extorquens, Paracoccus versutus, Pseudomonas argentinensis, P. borbori, P. citronellolis, P. flavesrorcens, P. mendocina, P. n.n. pseudoalcaligenes, P. resinovorans, P. straminea, P. aurantiaca, P. aureofaciens, P. chlororaphis, P.
  • viridiflava P. abietaniphila, P. acidophila, P. agarici, P. alcaliphila, P. alkanolytica, P. amyloderamosa, P. asplenii , P. azotifigens, P. cannabina, P. coenobios, P. congelans, P. costantinii, P. cruciviae, P. delhiensis, P. excibis, P. extremorientalis, P. frederiksbergensis, P. fuscovaginae, P. gelidicola, P. grimontii, P. indica, P. jessenii, P. jinjuensis, P.
  • thermotolerans P. aeruginosa, P. tremae, P. trivialis, P. turbinellae, P. tuticorinensis, P. umsongensis, P. vancouverensis , P. vranovensis, P. xanthomarina, Ralstonia eutropha, Rhodospirillum rubrum, Rhodobacter sphaeroides, Saccharomyces cerevisiae, Yarrowia lipolytica, Zymomonas mobilis, in particular Pseudomonas putida, Escherichia coli and Burkholderia thailandensis are particularly preferred, is suitable.
  • constitutive promoters are lac, lacUV5, tac, trc (in each case in the absence of the LacI repressor in the cells according to the invention), Ltet-O1 (in the absence of the TetR repressor in the cells according to the invention), T5 and gap.
  • inducible promoters are lac, lacUV5, tac, trc (in each case in the presence of the LacI repressor in the cells according to the invention), Ltet-O1 (in the presence of the TetR repressor in the cells according to the invention), T5 (in combination with a lac - Operator and the presence of the Lacl repressor in the cells according to the invention), SP6 and T7 (in the presence of the gene coding for the cognate RNA polymerase, the expression of which is in turn regulated).
  • the vector contained according to the invention should preferably comprise a ribosome binding site and a terminator.
  • nucleic acid contained according to the invention is incorporated into an expression cassette of the vector comprising the promoter, the ribosome binding site and the terminator.
  • the vector can furthermore comprise selection genes known to the person skilled in the art.
  • the plasmid pBBR1MCS-2 was constructed for the heterologous expression of the Pseudomonas aeruginosa DSM1707 genes rhlA and rhIB .
  • the synthetic operon rhlAB (Seq ID No. 37) was synthesized by GeneArt AG (Regensburg) and inter-cloned in the commercial vector pMA (GeneArt AG). The basis for the synthesis was the already known genomic sequence of Pseudomonas aeruginosa DSM1707.
  • pMA the synthetic operon using Bg / II and Xba I from the vector was cut and then pBBR1MCS-2 (SEQ ID NO. 49) (described in the cut with Bam HI and Xba I expression vector with Kovach et al., 1995: Four new derivatives of the broad-host-range cloning vector pBBR1MCS carrying different antibiotic-resistance cassettes. Gene, 166: 175-176 ) ligated.
  • the resulting plasmid pBBR1MCS-2 :: AB (Seq ID No. 38) is 7422 base pairs in size. The ligation and transformation of chemically competent E.
  • coli DH5a cells (Gibco-BRL, Düsseldorf) took place in a manner known to the person skilled in the art. The authenticity of the insert was checked by DNA sequence analysis.
  • the plasmid DNA from 10 clones was isolated and analyzed. The resulting strains carrying the plasmids were named P.
  • putida KT2440 pBBR1MCS-2 P. putida GPp104 pBBR1MCS-2, P. putida KT2440 pBBR1MCS-2 :: AB and P. putida GPp104 pBBR1MCS-2 :: AB, respectively.
  • the plasmid pBBR1MCS-2 was constructed for the heterologous expression of the Pseudomonas aeruginosa DSM1707 genes rhIA, rhIB and rhIC .
  • the synthetic operon rhIABC was synthesized by the company GeneArt AG (Regensburg) and intermediate cloned in the commercial vector pMA (GeneArt AG). The basis for the synthesis was the already known genomic sequence of Pseudomonas aeruginosa DSM1707.
  • the synthetic operon was cut from the vector using Bgl II and Xba I and then into the expression vector pBBR1MCS-2 (Seq ID No. 49) cut with Bam HI and Xba I ( Kovach et al., 1995: Four new derivatives of the broad-host-range cloning vector pBBR1MCS carrying different antibiotic-resistance cassettes. Gene, 166: 175-176 ) ligated.
  • the resulting plasmid pBBR1MCS-2 :: ABC (Seq ID No. 40) is 8409 base pairs in size. The ligation and transformation of chemically competent E.
  • the plasmid pBBR1MCS-2 ABM (Seq ID No. 42) was constructed.
  • the synthetic operon rhIAB-pa1131 was synthesized by the company GeneArt AG (Regensburg) and inter-cloned in the commercial vector pMA (GeneArt AG). The basis for the synthesis was the already known genomic sequence of Pseudomonas aeruginosa DSM1707.
  • Expression vector pBBR1MCS-2 (Seq ID No. 49) ( Kovach et al., 1995: Four new derivatives of the broad-host-range cloning vector pBBR1MCS carrying different antibiotic-resistance cassettes. Gene, 166: 175-176 ) ligated.
  • the resulting plasmid pBBR1MCS-2 (Seq ID No. 42) is 8702 base pairs in size. The ligation and transformation of chemically competent E.
  • CMP medium The medium referred to below as CMP medium was used to produce the rhamnolipids. This consists of 2% (w / v) glucose, 0.007% (w / v) KH 2 PO 4 , 0.11% Na 2 HPO 4 x 2 H 2 O, 0.2% (w / v) NaNO 3 , 0.04% (w / v) MgSO 4 x H 2 O, 0.01% (w / v) CaCl 2 x 2 H 2 O and 0.2% (v / v) of a trace element solution.
  • This consists of 0.2% (w / v) FeSO 4 x 7 H 2 O, 0.15% (w / v) MnSO 4 x H 2 O and 0.06% (w / v) (NH 4 ) MO 7 O 24 ⁇ 4 H 2 O.
  • the pH of the medium was adjusted to 6.7 with NaOH and the medium was then sterilized using an autoclave (121 ° C., 20 min). It was not necessary to adjust the pH during cultivation.
  • a preculture was first set up. For this purpose, an inoculation loop of a strain freshly streaked on LB agar plate was used and 10 ml of LB medium were inoculated in a 100 ml Erlenmeyer flask. All recombinant P. putida strains were in LB medium to which 50 ⁇ g / ml kanamycin was added. The strains were cultivated at 30 ° C. and 200 rpm overnight.
  • the precultures were used to inoculate 50 ml of CMP medium in the 250 ml Erlenmeyer flask (starting OD 600 0.1). The cultures were cultivated at 200 rpm and 30 ° C. for a maximum of 120 h. A sample of 1 ml of broth was taken from the culture flask every 24 hours. The sample preparation for the following chromatographic analyzes was carried out as follows: Using a displacement pipette (Combitip), 1 ml of acetone was placed in a 2 ml reaction vessel and the reaction vessel was immediately closed to minimize evaporation. This was followed by the addition of 1 ml of broth. After vortexing the broth / acetone mixture, it was centrifuged off for 3 min at 13,000 rpm, and 800 ⁇ l of the supernatant was transferred to an HPLC vessel.
  • Combitip displacement pipette
  • An Evaporative Light Scattering Detector (Sedex LT-ELSD Model 85LT) was used to detect and quantify rhamnolipids. The actual measurement was carried out using the Agilent Technologies 1200 Series (Santa Clara, California) and the Zorbax SB-C8 Rapid Resolution column (4.6 ⁇ 150 mm, 3.5 ⁇ m, Agilent). The injection volume was 5 ⁇ l and the running time of the method was 20 minutes. Aqueous 0.1% TFA (trifluoroacetic acid, solution A) and methanol (solution B) were used as the mobile phase. The column temperature was 40 ° C.
  • the ELSD detector temperature 60 ° C
  • the DAD diode array, 210 nm
  • the gradient used in the method was: t [min] Solution B vol .-% Flow [ml / min] 0.00 70% 1.00 15.00 100% 1.00 15.01 70% 1.00 20.00 70% 1.00
  • P. putida KT2440 pBBR1MCS-2 and GPp104 pBBR1MCS-2 did not produce rhamnolipids, in the recombinant strains P. putida KT2440 pBBR1MCS-2 :: AB, P. putida KT2440 pBBR1MCS-2 :: ABC, P. putida KT2440 pBBR1MCS- 2 :: ABM, P. putida GPp104 pBBR1MCS-2 :: AB, P. putida GPp104 pBBR1MCS-2 :: ABC and P. putida GPp104 pBBR1MCS-2 :: ABM the formation of different rhamnolipid species can be determined ( Fig. 2 and 3 ).
  • pBBR1MCS-2 :: AB or pBBR1MCS-2 :: ABM monorhamnosyl lipids could be generated ( Fig. 3 ).
  • monorhamnosyl lipids could be generated ( Fig. 3 ).
  • the products were identified by analysis of the corresponding mass traces and the MS 2 spectra in LC-MS. If rhIC (pBBR1MCS-2 :: ABC) was also introduced into the strains, mono- and dirhamnosyl lipids were produced ( Fig. 2 ).
  • putida KT2440 pBBR1MCS-2 :: AB
  • 23 peak areas rhamnolipids / OD 600 nm P. putida GPp104 pBBR1MCS-2 :: AB
  • a vector pBBR1MCS-2 ABMC for the heterologous expression of the Pseudomonas aeruginosa DSM1707 genes rhIA, rhIB, pa1131 and rhIC in Pseudomonas putida
  • the plasmid pBBR1MCS-2 :: ABMC (Seq ID No. 51) was constructed for heterologous expression of the Pseudomonas aeruginosa DSM1707 genes rhIA, rhIB, pa1131 and rhIC .
  • the synthetic operon rhIAB-pa1131-rhIC (Seq ID No.
  • pBBR1MCS-2 ABMC (Seq ID No. 51) is 9663 base pairs in size.
  • the ligation and transformation of chemically competent E. coli DH5 ⁇ cells took place in a manner known to the person skilled in the art. The authenticity of the insert was checked by DNA sequence analysis.
  • the transformation of Pseudomonas putida KT2440 and GPp104 with the vector pBBR1MCS-2 :: ABMC took place as described above ( Iwasaki et al. Biosci. Biotech. Biochem. 1994. 58 (5): 851-854 ).
  • the resulting strains carrying the plasmids were named P. putida KT2440 pBBR1MCS-2 :: ABMC and P. putida GPp104 pBBR1MCS-2 :: ABMC, respectively.
  • the recombinant strains P. putida GPp104 pBBR1MCS-2 and P. putida GPp104 pBBR1MCS-2 :: ABMC and P. aeruginosa DSM 19880 were on LB agar kanamycin (50 ⁇ g / ml; P. putida ) and LB agar Plates ( P. aeruginosa ) cultivated.
  • CMP medium The medium referred to below as CMP medium was used to produce the rhamnolipids. This consists of 2% (w / v) glucose, 0.007% (w / v) KH 2 PO 4 , 0.11% Na 2 HPO 4 x 2 H 2 O, 0.2% (w / v) NaNO 3 , 0.04% (w / v) MgSO 4 x H 2 O, 0.01% (w / v) CaCl 2 x 2 H 2 O and 0.2% (v / v) of a trace element solution.
  • This consists of 0.2% (w / v) FeSO 4 x 7 H 2 O, 0.15% (w / v) MnSO 4 x H 2 O and 0.06% (w / v) (NH 4 ) MO 7 O 24 x 4 H 2 O.
  • the pH of the medium was adjusted to 6.7 with NaOH and the medium was then sterilized by means of an autoclave (121 ° C., 20 min). It was not necessary to adjust the pH during cultivation.
  • a preculture was first set up. For this purpose, an inoculation loop of a strain freshly streaked on LB agar plate was used and 10 ml of LB medium were inoculated in a 100 ml Erlenmeyer flask.
  • the recombinant P. putida strains were cultivated in LB medium to which 50 ⁇ g / ml kanamycin had been added.
  • P. aeruginosa was cultivated in LB medium. The strains were cultivated at 30 ° C. and 200 rpm overnight.
  • the precultures were used to inoculate 50 ml of CMP medium in the 250 ml Erlenmeyer flask (starting OD 600 0.1). The cultures were cultivated at 200 rpm and 30 ° C. for a maximum of 120 h. A sample of 1 ml of broth was taken from the culture flask every 24 hours. The sample preparation for the following chromatographic analyzes was carried out as follows: Using a displacement pipette (Combitip), 1 ml of acetone was placed in a 2 ml reaction vessel and the reaction vessel was immediately closed to minimize evaporation. This was followed by the addition of 1 ml of broth. After vortexing the broth / acetone mixture, it was centrifuged off for 3 min at 13,000 rpm, and 800 ⁇ l of the supernatant was transferred to an HPLC vessel.
  • Combitip displacement pipette
  • the detection was carried out by means of a DAD detector in the wavelength range of 200 - 600 nm and mass-selective with a high-resolution FT-ICR mass spectrometer LTQ-FT (Thermo Scientific, Dreieich) in the scanning range m / z 100 - 1000.
  • the ionization was carried out by means of ESI (electrospray ionization) .
  • the P. putida GPp104 pBBR1MCS-2 strain did not produce any rhamnolipids.
  • putida GPp104 pBBR1MCS-2 in contrast to P. aeruginosa DSM 19880, formed no or only very few rhamnolipids with a residue determined via R 1 and R 2 derived from 3-hydroxyoctanoyl-3-hydroxydecanoic acid or 3- Hydroxydecanoyl-3-hydroxyoctanoic acid.
  • the PCR product obtained was inter-cloned in Trenzyme's Alligator Cloning System and transformed into E. coli DH5a (New England Biolabs; Frankfurt). Vectors from different candidates were analyzed and sequenced. After successful and error-free DNA sequencing, the vector was cut using EcoRI and the target fragment rfbBDAC was isolated. For a further intermediate cloning, the vector pBBR1MCS-2 ( Kovach et al., 1995: Four new derivatives of the broad-host-range cloning vector pBBR1MCS carrying different antibiotic-resistance cassettes. Gene, 166: 175-176 ) cut in the same way.
  • the cut target fragment ( rfbBDAC ) and the cut vector (pBBR1MCS-2) were joined by conventional ligation.
  • the resulting vector pBBR1MCS-2 was also transformed into E. coli DH5a (New England Biolabs; Frankfurt). Some candidate transformants were examined for successful uptake of the plasmid.
  • the vector pBBR1MCS-2 :: rfbBDAC served as a template for a PCR.
  • the following oligonucleotides were used: RL_Xbal-fw: 5'- TATATATATCTAGAATTAATGCAGCTGGCACGAC -3 '(Seq ID No. 44) RL_Xba_rev: 5'- GGCCGCTCTAGAACTAGTGGA -3 '(Seq ID No. 46)
  • the PCR was carried out with the Phusion TM High-Fidelity Master Mix from New England Biolabs (Frankfurt) Polymerase. It took place in a manner known to the person skilled in the art.
  • the target sequence ( lac promoter and rfbBDAC ) was inter-cloned into the Trenzyme Alligator Cloning System. E. coli DH5a (New England Biolabs; Frankfurt) transformants were selected and the plasmid DNA of various candidates was isolated and sequenced. After the sequence had been checked and examined for correctness, the vector was cut with Xba I.
  • the target fragment was ligated into pBBR1MCS-2 :: ABC (see above), which had also been cut with Xba I, using conventional ligation methods.
  • the resulting target vector pBBR1MCS-2 has a size of 12249 base pairs.
  • the insert of the vector was sequenced. Carrying out the PCR, checking the successful amplification of the PCR using agarose gel electrophoresis, ethidium bromide staining of the DNA, determining the PCR fragment size, purifying the PCR products and DNA concentration determination was carried out in a manner known to the person skilled in the art.
  • the transformation of Pseudomonas putida KT2440 and GPp104 with the vector pBBR1MCS-2 :: ABC_rfbBDAC took place as described above ( Iwasaki et al. Biosci.
  • CMP medium The medium referred to below as CMP medium is used to produce the rhamnolipids. This consists of 2% (w / v) glucose, 0.007% (w / v) KH 2 PO 4 , 0.11% Na 2 HPO 4 x 2 H 2 O, 0.2% (w / v) NaNO 3 , 0.04% (w / v) MgSO 4 x H 2 O, 0.01% (w / v) CaCl 2 x 2 H 2 O and 0.2% (v / v) of a trace element solution.
  • This consists of 0.2% (w / v) FeSO 4 x 7 H 2 O, 0.15% (w / v) MnSO 4 x H 2 O and 0.06% (w / v) (NH 4 ) MO 7 O 24 ⁇ 4 H 2 O.
  • the pH of the medium is adjusted to 6.7 with NaOH and the medium is then sterilized using an autoclave (121 ° C., 20 min). It is not necessary to adjust the pH value during cultivation.
  • a preculture is first set up.
  • an inoculation loop of a strain freshly spread on LB agar plate is used and 10 ml of LB medium are inoculated in a 100 ml Erlenmeyer flask.
  • All recombinant P. putida strains are cultivated in LB medium to which 50 ⁇ g / ml kanamycin is added. Cultivation of the P. putida strains were carried out at 30 ° C. and 200 rpm overnight.
  • the precultures are used to inoculate 50 ml of CMP medium in the 250 ml Erlenmeyer flask (starting OD 600 0.1).
  • the cultures are cultivated at 200 rpm and 30 ° C. for a maximum of 120 h.
  • a sample of 1 ml of broth is taken from the culture flask every 24 hours.
  • the sample preparation for the following chromatographic analyzes is carried out as follows: Using a displacement pipette (Combitip), 1 ml of acetone is placed in a 2 ml reaction vessel and the reaction vessel is immediately closed to minimize evaporation. This is followed by the addition of 1 ml of broth. After vortexing the broth / acetone mixture, it is centrifuged off for 3 min at 13,000 rpm, and 800 ⁇ l of the supernatant is transferred to an HPLC vessel.
  • Combitip displacement pipette
  • An Evaporative Light Scattering Detector (Sedex LT-ELSD Model 85LT) is used to detect and quantify rhamnolipids.
  • the actual measurement is carried out using the Agilent Technologies 1200 Series (Santa Clara, California) and the Zorbax SB-C8 Rapid Resolution column (4.6 x 150 mm, 3.5 ⁇ m, Agilent).
  • the injection volume is 5 ⁇ l and the running time of the method is 20 min.
  • Aqueous 0.1% TFA (trifluoroacetic acid, solution A) and methanol (solution B) are used as the mobile phase.
  • the column temperature is 40 ° C.
  • the ELSD detector temperature 60 ° C
  • the DAD diode array, 210 nm
  • the gradient used in the method is: t [min] Solution B vol .-% Flow [ml / min] 0.00 70% 1.00 15.00 100% 1.00 15.01 70% 1.00 20.00 70% 1.00
  • P. putida KT2440 pBBR1MCS-2 shows an increased compared to P. putida KT2440 pBBR1MCS-2 :: ABC and P. putida GPp104 pBBR1MCS-2 :: ABC_rfbBDAC compared to P. putida GPp104 pBBR1MCS-2 :: ABC Formation of di- and monorhamnosyl lipids. This clearly shows the positive influence of the enhancement of the expression of rfbBDAC on the formation of mono- and dirhamnosyl lipids.
  • E. coli W3110 The transformation of E. coli W3110 was carried out as described above ( Miller JH. A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Plainview, NY: Cold Spring Harbor Lab. Press; 1992 ) by means of electroporation.
  • the plasmid DNA of 10 clones each was isolated and analyzed.
  • the resulting strains carrying the plasmids were E. coli W3110 pBBR1MCS-2 :: ABC_rfbBDAC and E. coli W3110 called pBBR1MCS-2 :: ABC_rfbBDAC.
  • E. coli W3110 pBBR1MCS-2; E. coli W3110 pBBR1MCS-2 :: ABC and E. coli W3110 pBBR1MCS-2 :: ABC_rfbBDAC are cultivated on LB agar kanamycin (50 ⁇ g / ml) plates.
  • the medium referred to below as CMP medium is used to produce the rhamnolipids.
  • This consists of 2% (w / v) glucose, 0.007% (w / v) KH 2 PO 4 , 0.11% Na 2 HPO 4 x 2 H 2 O, 0.2% (w / v) NaNO 3 , 0.04% (w / v) MgSO 4 x H 2 O, 0.01% (w / v) CaCl 2 x 2 H 2 O and 0.2% (v / v) of a trace element solution.
  • This consists of 0.2% (w / v) FeSO 4 x 7 H 2 O, 0.15% (w / v) MnSO 4 x H 2 O and 0.06% (w / v) (NH 4 ) MO 7 O 24 ⁇ 4 H 2 O.
  • the pH of the medium is adjusted to 6.7 with NaOH and the medium is then sterilized using an autoclave (121 ° C., 20 min). It is not necessary to adjust the pH value during cultivation.
  • a preculture is first set up.
  • an inoculation loop of a strain freshly spread on LB agar plate is used and 10 ml of LB medium are inoculated in a 100 ml Erlenmeyer flask.
  • All recombinant E. coli strains are cultivated in LB medium to which 50 ⁇ g / ml kanamycin is added.
  • the E. coli strains are cultivated at 37 ° C. and 200 rpm overnight.
  • the precultures are used to inoculate 50 ml of CMP medium in the 250 ml Erlenmeyer flask (starting OD 600 0.1).
  • the cultures are cultivated at 200 rpm and 30 ° C. for a maximum of 120 h.
  • a sample of 1 ml of broth is taken from the culture flask every 24 hours.
  • the sample preparation for the following chromatographic analyzes is carried out as follows: Using a displacement pipette (Combitip), 1 ml of acetone is placed in a 2 ml reaction vessel and the reaction vessel is immediately closed to minimize evaporation. This is followed by the addition of 1 ml of broth. After vortexing the broth / acetone mixture, it is centrifuged off for 3 min at 13,000 rpm, and 800 ⁇ l of the supernatant is transferred to an HPLC vessel.
  • Combitip displacement pipette
  • An Evaporative Light Scattering Detector (Sedex LT-ELSD Model 85LT) is used to detect and quantify rhamnolipids.
  • the actual measurement is carried out using the Agilent Technologies 1200 Series (Santa Clara, California) and the Zorbax SB-C8 Rapid Resolution column (4.6 x 150 mm, 3.5 ⁇ m, Agilent).
  • the injection volume is 5 ⁇ l and the running time of the method is 20 min.
  • Aqueous 0.1% TFA (trifluoroacetic acid, solution A) and methanol (solution B) are used as the mobile phase.
  • the column temperature is 40 ° C.
  • the ELSD detector temperature 60 ° C
  • the DAD diode array, 210 nm
  • the gradient used in the method is: t [min] Solution B vol .-% Flow [ml / min] 0.00 70% 1.00 15.00 100% 1.00 15.01 70% 1.00 20.00 70% 1.00
  • E. coli W3110 pBBR1MCS-2 does not produce rhamnolipids
  • the recombinant strains E. coli W3110 pBBR1MCS-2 :: ABC and E. coli W3110 pBBR1MCS-2 :: ABC_rfbBDAC the formation of mono- and dirhamnosyl lipids can be determined, whereby E. coli W3110 pBBR1MCS-2 :: ABC_rfbBDAC forms significantly more mono- and dirhamnosyl lipids than E. coli W3110 pBBR1MCS-2 :: ABC.
  • the plasmid pBBR1MCS-2 ABC-BTH_II1077-II1080-II1081 (Seq ID No. 69) is constructed.
  • the synthetic operon BTH_II1077, BT_II1080 and BT_II1081 (Seq ID No.
  • the target vector obtained pBBR1MCS-2 has a size of 13768 base pairs.
  • the insert of the vector is sequenced.
  • the implementation of the PCR, the checking of the successful amplification of the PCR by means of agarose gel electrophoresis, ethidium bromide staining of the DNA, determination of the PCR fragment size, purification of the PCR products and determination of the DNA concentration takes place in a manner known to the person skilled in the art.
  • putida KT2440 pBBR1MCS-2 : ABC-BTH_II1077-II1080-II1081
  • the medium referred to below as M9 medium is used to produce the rhamnolipids.
  • This medium consists of 2% (w / v) glucose, 0.3% (w / v) KH 2 PO 4 , 0.679% Na 2 HPO 4 , 0.05% (w / v) NaCl, 0.2% ( w / v) NH 4 Cl, 0.049% (w / v) MgSO 4 x 7 H 2 O and 0.1% (v / v) of a trace element solution.
  • the pH value of the medium is adjusted to 7.4 with NH 4 OH and the medium is then adjusted using an autoclave (121 ° C, 20 min) sterilized. It is not necessary to adjust the pH value during cultivation.
  • a preculture is first set up. For this purpose, an inoculation loop of a strain freshly spread on LB agar plate is used and 10 ml of LB medium are inoculated in a 100 ml Erlenmeyer flask. All recombinant P. putida strains are cultivated in LB medium to which 50 ⁇ g / ml kanamycin has been added. The P. putida strains are cultivated at 37 ° C.
  • the precultures are used to inoculate 50 ml of M9 medium (+ 50 ⁇ g / ml Kanamycin) in 250 ml Erlenmeyer flasks (starting OD 600 0.1).
  • the cultures are cultivated at 200 rpm and 30 ° C.
  • a sample of 1 ml of broth is taken from the culture flask every 24 hours.
  • the sample preparation for the subsequent chromatographic analyzes and the chromatographic analyzes themselves are carried out as described in Example 4. It is shown that the recombinant strains P. putida KT2440 pBBR1MCS-2 :: AB-BTH_II1077-II1080-II1081 and P.
  • putida GPp104 pBBR1MCS-2 :: AB-BTH_II1077-II1080-II1081 produce significantly more monorhamnosyl lipids than the strains P. putida KT2440 pBBR1MCS-2 :: AB and P. putida GPp104 pBBR1MCS-2 :: AB.
  • thailandensis E264 increases the formation of mono- and dirhamnosyl lipids in P. putida strains with the Pseudomonas aeruginosa DSM1707 genes rhIABC .
  • the weakening of polyhydroxybutyrate formation in the strain background P. putida GPp104 compared to the strain P. putida KT2440 leads to an increased rhamnolipid formation, since the strains P. putida KT2440 pBBR1MCS-2 :: AB, P. putida KT2440 pBBR1MCS-2 :: ABC, P.
  • putida KT2440 pBBR1MCS-2 AB-BTH_II1077-II1080-II1081 and P. putida KT2440 pBBR1MCS-2 :: ABC-BTH_II1077-II1080-II1081 significantly less mono- () or Mono- and dirhamnosyl lipids () are able to form as the corresponding control strains P. putida GPp104 pBBR1MCS-2 :: AB, P. putida GPp104 pBBR1MCS-2 :: ABC, P.
  • putida GPp104 pBBR1MCS-2 :: AB-BTH_II1077-II1080- II1081 and P. putida GPp104 pBBR1MCS-2 :: ABC-BTH_II1077-II1080-II1081.
  • results show that the overexpression of the P. aeruginosa gene pa1131 in both strain backgrounds (KT2440: wild type or GPp104 with inactivated polyhydroxybutyrate formation) leads to an increased formation of di- and monorhamnosyl lipids.
  • results also show that the weakening of the polyhydroxybutyrate formation in GPp104 generally leads to an increased formation of rhamnosyl lipids.
  • the plasmid pEC-XT99A :: AB (Seq ID No. 52) is constructed.
  • the synthetic operon rhIAB (Seq ID No. 37) was synthesized by GeneArt AG (Regensburg) and cloned in between in the commercial vector pMA (GeneArt AG). The basis for the synthesis was the already known genomic sequence of Pseudomonas aeruginosa DSM1707.
  • the synthetic operon is cut from the vector using Bgl II and Xba I and then into the expression vector pEC-XT99A (cut with Bam HI and Xba I) U.S. Patent 7118904 ) ligated.
  • the resulting plasmid pEC-XT99A :: AB (Seq ID No. 52) is 9793 base pairs in size.
  • the ligation and transformation of chemically competent E. coli DH5 ⁇ cells takes place in a manner known to the person skilled in the art. The authenticity of the insert is checked by DNA sequence analysis. The transformation of C.
  • glutamicum ATCC13032 with the vector pEC-XT99A :: AB takes place as described above ( Liebl et al., FEMS Microbiol. Lett. 53: 299-303 (1989 )).
  • the transformants are selected on LBHIS agar plates (18.5 g / L brain-heart infusion Boullion, 0.5 M Sorbitol, 5 g / L Bacto-Tryptone, 2.5 g / L Bacto-yeast extract, 5 g / L NaCl and 18 g / L Bacto-Agar, supplemented with 5 mg / L tetracycline).
  • the plates were incubated for two days at 33 ° C.
  • the resulting strain carrying the plasmid is called C. glutamicum pEC-XT99A :: AB.
  • the plasmid pEC-XT99A (Seq ID No. 53) is constructed.
  • the synthetic operon rhIABC (Seq ID No. 39) was synthesized by the company GeneArt AG (Regensburg) and intermediate cloned in the commercial vector pMA (GeneArt AG). The basis for the synthesis was the already known genomic sequence of Pseudomonas aeruginosa DSM1707.
  • the synthetic operon is cut from the vector using Bgl II and Xba I and then into the expression vector pEC-XT99A (cut with Bam HI and Xba I) U.S. Patent 7118904 ) ligated.
  • the resulting plasmid pEC-XT99A :: ABC (Seq ID No. 53) is 10780 base pairs in size.
  • the ligation and transformation of chemically competent E. coli DH5 ⁇ cells takes place in a manner known to the person skilled in the art. The authenticity of the insert is checked by DNA sequence analysis. The transformation of C.
  • glutamicum ATCC13032 with the vector pEC-XT99A :: ABC takes place as described above ( Liebl et al., FEMS Microbiol. Lett. 53: 299-303 (1989 )).
  • the transformants are selected on LBHIS agar plates (18.5 g / L brain-heart infusion Boullion, 0.5 M sorbitol, 5 g / L Bacto-tryptone, 2.5 g / L Bacto-yeast extract, 5 g / L NaCl and 18 g / L Bacto-Agar, supplemented with 5 mg / L tetracycline).
  • the plates were incubated for two days at 33 ° C.
  • the resulting strain carrying the plasmid is called C. glutamicum pEC-XT99A :: ABC.
  • the plasmid pEC-XT99A :: ABM (Seq ID No. 54) is constructed.
  • the synthetic operon rhIABM (Seq ID No. 41) was used by the company GeneArt AG (Regensburg) synthesized and intermediate cloned in the commercial vector pMA (GeneArt AG). The basis for the synthesis was the already known genomic sequence of Pseudomonas aeruginosa DSM1707.
  • the synthetic operon is cut from the vector using Bgl II and Xba I and then into the expression vector pEC-XT99A (cut with Bam HI and Xba I) U.S. Patent 7118904 ) ligated.
  • the resulting plasmid pEC-XT99A is 11073 base pairs in size.
  • the ligation and transformation of chemically competent E. coli DH5 ⁇ cells takes place in a manner known to the person skilled in the art. The authenticity of the insert is checked by DNA sequence analysis. The transformation of C.
  • glutamicum ATCC13032 with the vector pEC-XT99A :: ABM takes place as described above ( Liebl et al., FEMS Microbiol. Lett. 53: 299-303 (1989 )).
  • the transformants are selected on LBHIS agar plates (18.5 g / L brain-heart infusion Boullion, 0.5 M sorbitol, 5 g / L Bacto-tryptone, 2.5 g / L Bacto-yeast extract, 5 g / L NaCl and 18 g / L Bacto-Agar, supplemented with 5 mg / L tetracycline).
  • the plates were incubated for two days at 33 ° C.
  • the resulting strain carrying the plasmid is called C. glutamicum pEC-XT99A :: ABM.
  • the vector pVWEX1 For heterologous expression of the genes rfbBDAC from P. putida under the control of the lac promoter in C. glutamicum , the vector pVWEX1 :: rfbBDAC (Seq ID No. 57) is constructed.
  • the vector pBBR1MCS-2 For this purpose, the vector pBBR1MCS-2 :: rfbBDAC (Seq ID No. 45) is digested with Xba I and the fragment (3840 bp) containing the genes rfbBDAC from P. putida KT2440 and the lac promoter into the vector pVWEX1 digested with Xba I (Seq ID No. 56).
  • the resulting plasmid pVWEX1 :: rfbBDAC (Seq ID No. 57) is 12311 base pairs in size.
  • the ligation and transformation of chemically competent E. coli DH5 ⁇ cells takes place in a manner known to the person skilled in the art. The authenticity of the insert is checked by DNA sequence analysis.
  • ATCC13032 pEC-XT99A, ATCC13032 pEC-XT99A :: AB, ATCC13032 pEC-XT99A :: ABM, ATCC13032 pEC-XT99A :: ABC and ATCC13032 pEC-XT99A :: ABCM are transformed with the vector pVWEX1 ::. RfbBDAC as described above ( Liebl et al., FEMS Microbiol. Lett. 53: 299-303 (1989 )).
  • the transformants are selected on LBHIS agar plates (18.5 g / L brain-heart infusion Boullion, 0.5 M sorbitol, 5 g / L Bacto-tryptone, 2.5 g / L Bacto-yeast extract, 5 g / L NaCl and 18 g / L Bacto-Agar, supplemented with 5 mg / L tetracycline and 25 mg / L kanamycin).
  • the plates were incubated for two days at 33 ° C.
  • the Strains carrying plasmids are C. glutamicum pEC-XT99A pVWEX1 :: rfbBDAC, C.
  • glutamicum pEC-XT99A :: AB pVWEX1 :: rfbBDAC
  • C. glutamicum pEC-XT99A :: ABM pVWEX1 :: rfbBDAC
  • C. glutamicum pEC-XT99A :: ABCM called pVWEX1 :: rfbBDAC.
  • the recombinant strains C. glutamicum generated in Examples 15 to 19, C. glutamicum pEC-XT99A, C. glutamicum pEC-XT99A :: AB, C. glutamicum pEC-XT99A :: ABC, C. glutamicum pEC-XT99A :: ABM, C. glutamicum pEC-XT99A :: ABCM, C. glutamicum pEC-XT99A pVWEX1 :: rfbBDAC, C. glutamicum pEC-XT99A :: AB pVWEX1 :: rfbBDAC, C.
  • glutamicum pEC-XT99A ABM pVWEX1 ::. RfbBDAC
  • C. glutamicum pEC-XT99A ABC pVWEX1 :: rfbBDAC
  • C. glutamicum pEC-XT99A ABCM pVWEX1 :: rfbBDAC
  • an inoculation loop of a strain freshly spread on an LBHIS agar plate is used and 10 ml of LBHIS medium (18.5 g / L brain-heart infusion Boullion, 0.5 M sorbitol, 5 g / L Bacto-Tryptone, 2.5 g / L Bacto yeast extract and 5 g / L NaCl, supplemented with 5 mg / L tetracycline or 5 mg / L tetracycline and 25 mg / L kanamycin) in a 100 ml Erlenmeyer flask.
  • the strains are cultivated at 33 ° C. and 200 rpm overnight.
  • the cultures are cultivated at 200 rpm and 33 ° C. up to an optical density (600 nm) of 0.4-0.6. At this optical density, the cultures are induced by adding IPTG (isopropyl- ⁇ -D-thiogalactopyranoside; 1 mM final concentration). The subsequent expression also takes place at 33 ° C. and 200 rpm for 72 h. A sample of 1 ml of broth is taken from the culture flask every 24 hours. The sample preparation for the subsequent chromatographic analyzes and the chromatographic analyzes themselves are carried out as described in Example 4.
  • C. glutamicum pEC-XT99A does not produce any rhamnolipids
  • the recombinant strains are C. glutamicum pEC-XT99A :: AB, C. glutamicum pEC-XT99A :: ABC, C. glutamicum pEC-XT99A :: ABM and C. glutamicum pEC -XT99A :: ABCM the formation of rhamnolipids detectable.
  • C. glutamicum pEC-XT99A :: AB and C. glutamicum pEC-XT99A :: ABM only form monorhamnosyl lipids, while C.
  • glutamicum pEC-XT99A ABC
  • C. glutamicum pEC-XT99A ABM
  • C. glutamicum pEC-XT99A ABCM are able to form dirhamnosyl lipids and monorhamnosyl lipids. It is also shown that C. glutamicum pEC-XT99A :: ABM and C. glutamicum pEC-XT99A :: ABCM are able to form more monorhamnosyl lipids or dirhamnosyl lipids and monorhamnosyl lipids than the respective reference strains
  • C. glutamicum pEC-XT99A :: AB
  • C. glutamicum pEC-XT99A ABC without amplification of the pa1131 gene from Pseudomonas aeruginosa.
  • glutamicum pEC-XT99A ABM pVWEX1 :: rfbBDAC
  • mono- and dirhamnosyl lipids C. glutamicum pEC-XT99A :: ABC pVWEX1 :: rfbBDAC
  • C. glutamicum pEC-XT99A ABCM pVWEX1 :: rfbBDAC
  • C. glutamicum pEC -XT99A :: ABC
  • C. glutamicum pEC-XT99A ABCM without amplification of the rfbBDA genes from P. putida.
  • the plasmids pBBR1MCS-2, pBBR1MCS-2 :: AB, pBBR1MCS-2 :: ABC, pBBR1MCS-2 :: ABM and pBBR1MCS-2 :: ABCM are in Pseudomonas fluorescens DSM 50090, Pseudomonas fluorescens DSM 9958, Pseudomonas putida DSM 6899, Pseudomonas putida DSM 50204, Pseudomonas putida 50194, P. brassicacearum DSM 13227, P.
  • Pseudomonas stutzeri DSM 10701 Pseudomonas stutzeri DSM 4166 and Pseudomonas fulva DSM 17717 introduced by electroporation.
  • the transformation of Pseudomonas strains takes place as described above ( Iwasaki et al. Biosci. Biotech. Biochem. 1994. 58 (5): 851-854 ).
  • the transformants are selected on nutrient agar plates (5 g / L peptone; 3 g / L meat extract; 15 g / L agar; pH 7; supplemented with 50 mg / L kanamycin).
  • the plates are incubated for two days at 30 ° C and 28 ° C, respectively.
  • the resulting strains carrying the plasmids will be Pseudomonas fluorescens DSM 50090 pBBR1MCS-2, Pseudomonas fluorescens DSM 9958 pBBR1 MCS-2, Pseudomonas putida DSM 6899 pBBR1 MCS-2, Pseudomonas putida DSM 50204 2 pBBR1MCS-2, Pseudomonas putida 50M194BBRida P. brassicacearum DSM 13227 pBBR1MCS-2, P.
  • brassicacearum DSM 13227 pBBR1MCS- 2 :: AB
  • P. stutzeri DSM 10701 pBBR1 MCS-2 : AB
  • Pseudomonas stutzeri DSM 4166 pBBR1MCS-2 :: AB
  • Pseudomonas fulva DSM 17717 pBBR1 MCS-2 :: AB
  • Pseudomonas fluorescens DSM 50090 pBBR1MCS-2 :: ABC
  • DSM 9958 pBBR1MCS-2 :: ABC
  • Pseudomonas putida DSM 6899 pBBR1MCS-2 :: ABC
  • Pseudomonas putida DSM 50204 pBBR1MCS-2 :: ABC
  • Pseudomonas putida 50194 pBBR1MCS-2 ::
  • brassicacearum DSM 13227 pBBR1MCS-2 : ABC, P. stutzeri DSM 10701 pBBR1MCS-2 :: ABC, Pseudomonas stutzeri DSM 4166 pBBR1MCS-2 :: ABC, Pseudomonas fulva DSM 17717 pBBR1MCS-2 :: ABC, Pseudomonas fluorescens DSM 50090 pBBR1MCS-2 :: ABCM, Pseudomonas fluorescens DSMCS-2 :: ABCM, Pseudomonas fluorescens DSMCS-2 9958 pBBR1MCS-2 :: ABCM, Pseudomonas putida DSM 6899 pBBR1MCS-2 :: ABCM, Pseudomonas putida DSM 50204 pBBR1MCS-2 :: ABCM, Pseu
  • brassicacearum DSM 13227-2 :: pBBR1MCS ABCM
  • P. stutzeri DSM 10701 pBBR1MCS-2 : ABCM
  • Pseudomonas stutzeri DSM 4166 pBBR1MCS-2 : ABCM
  • Pseudomonas fulva DSM 17717 pBBR1MCS-2 : ABCM
  • DSM 50090 pBBR1MCS-2 ABM
  • Pseudomonas DSM 9958 pBBR1MCS-2 :: ABM
  • Pseudomonas putida DSM 6899 pBBR1MCS-2 :: ABM
  • Pseudomonas putida DSM 50204 pBBR1MCS-2 :: ABM
  • Pseudomonas putida 50194 pBBR1MCS-2 :: ABM
  • Example 21 Generated in Example 21 recombinant strains Pseudomonas strains Pseudomonas fluorescens DSM 50090, Pseudomonas fluorescens DSM 9958 pBBR1MCS-2, Pseudomonas putida DSM 6899 pBBR1MCS-2, Pseudomonas putida DSM 50204 pBBR1MCS-2, Pseudomonas putida 50194 pBBR1MCS-2, P. brassicacearum DSM 13227 pBBR1MCS-2, P.
  • brassicacearum DSM 13227 pBBR1MCS-2 : ABC, P. stutzeri DSM 10701 pBBR1MCS-2 :: ABC, Pseudomonas stutzeri DSM 4166 pBBR1MCS-2 :: ABC, Pseudomonas fulva DSM 17717 pBBR1MCS-2 :: ABC, Pseudomonas fluorescens DSM 50090 2 :: ABCM, Pseudomonas fluorescens DSM 9958 pBBR1MCS-2 :: ABCM, Pseudomonas putida DSM 6899 pBBR1MCS-2 :: ABCM, Pseudomonas putida DSM 50204 pBBR1MCS-2 :: ABCM, Pseudomonas putida 50194 pBBR1MCS-2 :: ABCM, P.
  • brassicacearum DSM 13227 pBBR1MCS-2 :: ABM, P. stutzeri DSM 10701 pBBR1MCS-2 :: ABM, Pseudomonas stutzeri DSM 4166 pBBR1MCS-2 :: ABM and Pseudomonas fulva DSM 17717 pBBR1MCS-2 :: ABM are cultivated on LB agar kanamycin (50 ⁇ g / ml) plates.
  • the subsequent cultivation for the production of the rhamnolipids takes place as described in Example 12.
  • the sample preparation for the subsequent chromatographic analyzes and the chromatographic analyzes themselves are carried out as described in Example 4.
  • brassicacearum DSM 13227 pBBR1MCS-2 ABM
  • P. stutzeri DSM 10701 pBBR1MCS-2 ABCSM
  • Pseudomonas stutzeriBR DSM 41CSM Pseudomonas stutzeriBR DSM 41CSM -2 :: ABM
  • Pseudomonas fulva DSM 17717 pBBR1MCS-2 :: ABM the formation of monorhamnosyl lipids and in the strains Pseudomonas fluorescens DSM 50090 pBBR1MCS-2 :: ABC, Pseudomonas fluorescens DSM 9958 pBBR1MCS-2 :: ABC, Pseudomonas putida DSM 6899-2BBR1 :: ABCM 6899-2BBR1 , Pseudomonas putida DSM 50204 pBBR
  • brassicacearum DSM 13227 pBBR1MCS-2 : ABC, P. stutzeri DSM 10701 pBBR1MCS-2 :: ABC, Pseudomonas stutzeri DSM 4166 pBBR1MCS-2 :: ABC, Pseudomonas fulva DSM 17717 pBBR1MCS-2 :: ABC, Pseudomonas fluorescens DSM 50090 pBBR1MCS-2 :: ABCM, Pseudomonas fluorescens DSM 9958 pBBR1MCS-2 :: ABCM, Pseudomonas putida DSM 6899 :: pBBR1MCS-2 , Pseudomonas putida DSM 50204 pBBR1MCS-2 :: ABCM, Pseudomonas putida 50194 pBBR1MCS-2 :: ABCM,
  • brassicacearum DSM 13227 2 : ABC
  • P. stutzeri DSM 10701 pBBR1MCS-2 : ABC
  • Pseudomonas stutzeri DSM 4166 pBBR1MCS-2 :: ABC
  • Pseudomonas fulva DSM 17717 pBBR1MCS-2 : ABC without amplification of the pa1131 gene from Pseudomonas aeruginosa.
  • the plasmids pBBR1MCS-2 :: ABPA01 (Seq ID No. 62) and pBBR1MCS-2 :: ABPA7 (Seq ID No. 63) constructed.
  • the synthetic operons rhIABPAO1 (Seq ID No. 64) and rhIABPA7 (Seq ID No.
  • the plasmids pBBR1MCS-2 :: ABPAO1-C1 (Seq ID No. 66) and pBBR1MCS-2 :: ABPA7-CE264 (Seq ID No. 67) are generated.
  • the rhIC genes from Pseudomonas aeruginosa 1 (Seq ID No. 68) and Burkholderia thailandensis E264 (Seq ID No. 76) are synthesized by DNA 2.0 (Menlo Park, CA, USA) and stored in the commercial vector pJ294 (DNA 2.0 ) cloned in between.
  • the basis for the synthesis is already known genomic sequence of the strains Pseudomonas aeruginosa 1 and Burkholderia thailandensis E264.
  • the rhIC genes are cut from the vectors using Xba and SacI and then into the vectors pBBR1MCS-2 :: ABPAO1 (Seq ID No. 62), which are also cut with Xba and SacI or pBBR1MCS-2 :: ABPA7 (Seq ID No. 63).
  • pBBR1MCS-2 ABPAO1-C1 (Seq ID No. 66) and pBBR1MCS-2 :: ABPA7-CE264 (Seq ID No. 67) are 8325 and 8335 base pairs, respectively.
  • the ligation and transformation of chemically competent E. coli DH5 ⁇ cells takes place in a manner known to the person skilled in the art. The authenticity of the insert is checked by DNA sequence analysis.
  • putida KT2440 pBBR1MCS-2 :: ABPA7-CE264
  • P. putida GPp104 pBBR1MCS-2 P. putida GPp104 pBBR1MCS-2 :: ABPAO1-C1
  • P. putida GPp104 called pBBR1MCS-2 ABPA7-CE264.
  • the recombinant P. putida strains generated in Example 23 are cultivated on LB agar kanamycin (50 ⁇ g / ml) plates.
  • the subsequent cultivation for the production of the rhamnolipids takes place as described in Example 12.
  • the sample preparation for the subsequent chromatographic analyzes and the chromatographic analyzes themselves are carried out as described in Example 4.
  • P. putida KT2440 pBBR1MCS-2 and P. putida GPp104 pBBR1MCS-2 strains are not able to produce mono- and dirhamnosyl lipids
  • the P. putida KT2440 pBBR1MCS-2 :: ABPAO1-C1
  • P. putida KT2440 strains produce pBBR1MCS-2 :: ABPA7-CE264
  • P. putida GPp104 pBBR1MCS-2 both mono- and dirhamnosyl lipids.
  • pBBR1MCS-2 For the construction of the vectors pBBR1MCS-2 :: AB_rfbBDAC, pBBR1MCS-2 :: ABM_rfbBDAC and pBBR1MCS-2 :: ABMC_rfbBDAC for overexpression of the P. putida rfbBDAC operon in P. putida and E. coli , the P. putida rfbBDAC- Operon amplified by PCR.
  • the vector pBBR1MCS-2 :: rfbBDAC (Seq ID No. 45) served as a template for a PCR.
  • RL_Agel-fw 5'- TATATATAACCGGTATTAATGCAGCTGGCACGAC -3 '(Seq ID No. 71)
  • RL_Agel_rev 5'- GGCCGACCGGTACTAGTGGA -3 '(Seq ID No. 72)
  • the PCR was carried out with the Phusion TM High-Fidelity Master Mix from New England Biolabs (Frankfurt) Polymerase. It took place in a manner known to the person skilled in the art.
  • the target sequence ( lac promoter and rfbBDAC) was inter-cloned into the Trenzyme Alligator Cloning System. E. coli DH5a (New England Biolabs; Frankfurt) transformants were selected and the plasmid DNA of various candidates was isolated and sequenced. After the sequence was checked and examined for accuracy, the vector was cut with Age I. The target fragment was divided into the vectors pBBR1MCS-2 :: AB (Seq ID No.
  • pBBR1MCS-2 ABM (Seq ID No. 42) and pBBR1MCS-2 :: ABMC (Seq ID No. 42), which were also cut with Age I. 51) using conventional ligation techniques.
  • the resulting vectors pBBR1MCS-2 :: AB_rfbBDAC (Seq ID No. 73), pBBR1MCS-2 :: ABM_rfbBDAC (Seq ID No. 74) and pBBR1 MCS-2 :: ABMC_rfbBDAC (Seq ID No. 75) have sizes of 11960, 13289 and 14250 base pairs, respectively.
  • the inserts of the vectors were sequenced.
  • the resulting strains carrying the plasmids are P. putida KT2440 pBBR1MCS-2 :: AB_rfbBDAC, P. putida KT2440 pBBR1MCS-2 :: ABM_rfbBDAC and P. putida KT2440 called pBBR1MCS-2 :: ABMC_rfbBDAC.
  • the recombinant P. putida strains generated in examples 2, 7 and 25 are cultivated on LB agar kanamycin (50 ⁇ g / ml) plates.
  • the subsequent cultivation for the production of the rhamnolipids takes place as described in Example 12.
  • the sample preparation for the subsequent chromatographic analyzes and the chromatographic analyzes themselves are carried out as described in Example 4.
  • P. putida KT2440 pBBR1MCS-2 :: AB_rfbBDAC
  • P. putida KT2440 pBBR1MCS-2 ABM_rfbBDAC
  • P. putida KT2440 pBBR1MCS-2 :: AB
  • P. putida KT2440 pBBR1MCS-2 :: ABM in the Monorhamnosyl lipids are able to form while P. putida KT2440 pBBR1MCS-2 :: ABMC_rfbBDAC, P. putida KT2440 pBBR1MCS-2 :: ABC_rfbBDAC, P.
  • putida KT2440 pBBR1MCS-2 ABC and P. putida KT2440 pBBR1MC are able to form mono- and dirhamnosyl lipids. It is also shown that P. putida KT2440 pBBR1MCS-2 :: ABM_rfbBDAC, P. putida KT2440 pBBR1MCS-2 :: ABM, KT2440 pBBR1MCS-2 :: ABMC_rfbBDAC and KT2440 pBBR1MCS-2 :: ABMC are able to produce more mono- and dirhamnipids as the corresponding control strains P.
  • putida KT2440 pBBR1MCS-2 :: AB_rfbBDAC
  • KT2440 pBBR1MCS-2 :: ABC_rfbBDAC
  • KT2440 pBBR1MCS-2 :: ABC without enhancement of the Pseudomonas aer1131.
  • putida KT2440 pBBR1MCS-2 ABM_rfbBDAC
  • mono- and Dirhamnosyllipide P. putida KT2440 pBBR1MCS-2 :: ABC_rfbBDAC and P. putida KT2440 pBBR1MCS-2: : ABMC_rfbBDAC
  • P. putida KT2440 pBBR1MCS-2 :: AB
  • P. putida KT2440 pBBR1MCS-2 ABM
  • P. putida KT2440 pBBR1MCS-2 ABC
  • P. putida KT2440 pBBR1MCS-2 ABMC without reinforcement of the P. putida genes rfbBDAC.
  • E. coli W3110 pBBR1MCS-2 :: AB, E. coli W3110 pBBR1MCS-2 :: ABM, E. coli W3110 pBBR1MCS-2 :: ABC, E. coli W3110 pBBR1MCS-2 :: ABCM, E. coli W3110 pBBR1MCS-2 :: AB_rfbBDAC, E. coli W3110 p88R1MCS-2 :: ABM_rfbBDAC, E. coli W3110 pBBR1MCS-2 :: ABC_rfbBDAC and E. coli W3110 p88R1MCS-2 :: ABCM_rfbBDAC
  • E. coli W3110 The transformation of E. coli W3110 was carried out as described above ( Miller JH. A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Plainview, NY: Cold Spring Harbor Lab. Press; 1992 ) by means of electroporation.
  • the plasmid DNA of 10 clones each was isolated and analyzed.
  • the resulting strains carrying the plasmids were E. coli W3110 pBBR1MCS-2 :: AB, E. coli W3110 pBBR1MCS-2 :: ABM, E. coli W3110 pBBR1MCS-2 :: ABC, E. coli W3110 pBBR1MCS-2 :: ABCM, E.
  • coli W3110 pBBR1MCS-2 :: AB_rfbBDAC
  • E. coli W3110 pBBR1MCS-2 :: ABM_rfbBDAC
  • E. coli W3110 pBBR1MCS-2 :: ABC_rfbBDAC
  • e. coli W3110 called pBBR1MCS-2 :: ABCM_rfbBDAC.
  • E. coli W3110 pBBR1MCS-2 Quantification of rhamnolipid production by recombinant E. coli W3110 pBBR1MCS-2 :: AB, E. coli W3110 pBBR1MCS-2 :: ABM, E. coli W3110 pBBR1MCS-2 :: ABC, E. coli W3110 pBBR1MCS-2 :: ABCM , E. coli W3110 pBBR1MCS-2 :: AB_rfbBDAC, E. coli W3110 pBBR1MCS-2 :: ABM_rfbBDAC , E. coli W3110 pBBR1MCS-2 :: ABC_rfbBDAC and E. coli W3110 pBBR1MCS-2 :: ABCM_rfbBDAC
  • the recombinant E. coli strains generated in example 27 are cultivated on LB agar kanamycin (50 ⁇ g / ml) plates.
  • the subsequent cultivation for the production of the rhamnolipids takes place as described in Example 10.
  • the sample preparation for the subsequent chromatographic analyzes and the chromatographic analyzes themselves are carried out as described in Example 4.
  • E. coli W3110 pBBR1MCS-2 :: AB
  • E. coli W3110 pBBR1MCS-2 ABM
  • E. coli W3110 pBBR1MCS-2 :: AB_rfbBDAC
  • E. coli W3110 pBBR1MCS-2 :: ABM_rfbBDAC
  • E. coli W3110 pBBR1MCS-2 :: ABM_rfbBDAC
  • E. coli W3110 pBBR1MCS-2 ABCM_rfbBDAC are able to form mono- and dirhamnosyl lipids. It is also shown that E. coli W3110 pBBR1MCS-2 :: ABM and E. coli W3110 pBBR1MCS-2 :: ABM_rfbBDAC produce more monorhamnosyl lipids than E. coli W3110 pBBR1MCS-2 :: AB and E. coli W3110 pBBR1MCS-2 :: AB_rfbBDAC without amplification of the Pseudomonas aeruginosa gene pa1131. It is also shown that E.
  • E. coli W3110 pBBR1MCS-2 ABCM and E. coli W3110 pBBR1MCS-2 :: ABCM_rfbBDAC produce more mono- and dirhamnosyl lipids than E. coli W3110 pBBR1MCS-2 :: ABC and E. coli W3110 pBBR1MCS- 2 :: ABC_rfbBDAC without amplification of the Pseudomonas aeruginosa gene pa1131 . It is also shown that E. coli W3110 pBBR1MCS-2 :: ABM and E.
  • E. coli W3110 pBBR1MCS-2 ABM_rfbBDAC produce more monorhamnosyl lipids than E. coli W3110 pBBR1MCS-2 :: AB and E. coli W3110 pBBR1MCS-2 :: AB_rfbBDAC without amplification of the Pseudomonas aeruginosa gene pa1131. Finally, it is shown that E. coli W3110 pBBR1MCS-2 :: AB_rfbBDAC, E. coli W3110 pBBR1MCS-2 :: ABM_rfbBDAC, E.
  • coli W3110 pBBR1MCS-2 ABC_rfbBDAC and E. coli W3110 pBBR1MCS-2 :: ABCM_rfbBDAC more mono- ( E. coli W3110 pBBR1MCS-2 :: AB_rfbBDAC, E. coli W3110 pBBR1MCS-2 :: ABM_rfbBDAC) or mono- and dirhamnosyl lipids ( E. coli W3110 p. ABC_rfbBDAC and E. coli W3110 pBBR1MCS-2 :: ABCM_rfbBDAC) are able to form E. than the respective control strains.
  • E. coli W3110 pBBR1MCS-2 AB
  • E. coli W3110 pBBR1MCS-2 ABM
  • E. coli W3110 pBBR1MCS-2 ABC
  • E. coli W3110 pBBR1MCS-2 ABCM without amplification of the P. putida genes rfbBDAC.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Environmental Sciences (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Dermatology (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Cosmetics (AREA)
  • Medicinal Preparation (AREA)
  • Saccharide Compounds (AREA)

Claims (11)

  1. Cellule, choisie parmi des micro-organismes, qui peut former au moins un rhamnolipide de formule générale (I),
    Figure imgb0304
     dans laquelle
    m = 2, 1 ou 0, en particulier 1 ou 0,
    n = 1 ou 0, en particulier 1,
    R1 et R2 = indépendamment l'un de l'autre, des radicaux organiques identiques ou différents comprenant 2 à 24 atomes de carbone, en particulier des radicaux alkyle le cas échéant ramifiés, le cas échéant substitués, en particulier substitués par hydroxy, le cas échéant insaturés, en particulier le cas échéant mono-insaturés, di-insaturés ou tri-insaturés,
    caractérisée en ce qu'elle a été modifiée par technique génique de manière telle qu'elle présente, par rapport à son type sauvage, une activité augmentée d'au moins une des enzymes E1, E2 et E3, l'enzyme E1 pouvant catalyser la transformation de la 3-hydroxyalcanoyl-ACP via l'acide 3-hydroxyalcanoyl-3-hydroxyalcanoïque-ACP en acide hydroxyalcanoyl-3-hydroxyalcanoïque, l'enzyme E2 étant une rhamnosyltransférase I et pouvant catalyser la transformation de dTDP-rhamnose et de 3-hydroxyalcanoyl-3-hydroxyalcanoate en α-L-rhamnopyranosyl-3-hydroxyalcanoyl-3-hydroxyalcanoate et l'enzyme E3 étant une rhamnosyltransférase II et pouvant catalyser la transformation de dTDP-rhamnose et d'α-L-rhamnopyranosyl-3-hydroxyalcanoyl-3-hydroxyalcanoate en α-L-rhamnopyranosyl-(1-2)-α-L-rhamnopyranosyl-3-hydroxyalcanoyl-3-hydroxyalcanoate et
    caractérisée en ce qu'elle présente, par rapport à son type sauvage, une activité augmentée d'au moins une enzyme E8, qui catalyse l'expert d'un rhamnolipide de formule générale (I) de la cellule dans le milieu environnant, présentant de préférence une séquence polypeptidique SEQ ID NO 8, SEQ ID NO 24, SEQ ID NO 26 ou SEQ ID NO 28 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 8, SEQ ID NO 24, SEQ ID NO 26 ou SEQ ID NO 28 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence respective SEQ ID NO 8, SEQ ID NO 24, SEQ ID NO 26 ou SEQ ID NO 28.
  2. Cellule selon la revendication 1, caractérisée en ce que les enzymes E1, E2 et E3 sont choisies dans le groupe constitué par
    au moins une enzyme E1 choisie parmi
    - une enzyme E1a présentant une séquence polypeptidique SEQ ID NO 2 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 2 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 2,
    - une enzyme E1b présentant la séquence polypeptidique SEQ ID NO 18 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence SEQ ID NO 18 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 18,
    - une enzyme E1c présentant la séquence polypeptidique SEQ ID NO 78 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 78 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 78,
    - une enzyme E1d présentant la séquence polypeptidique SEQ ID NO 80 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 80 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 80, et
    - une enzyme E1e présentant la séquence polypeptidique SEQ ID NO 82 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 82 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 82,
    au moins une Enzyme E2 choisie parmi
    - une enzyme E2a présentant la séquence polypeptidique SEQ ID NO 4 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 4 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 4,
    - une enzyme E2b présentant la séquence polypeptidique SEQ ID NO 20 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 20 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 20,
    - une enzyme E2c présentant la séquence polypeptidique SEQ ID NO 84 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 84 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 84,
    - une enzyme E2d présentant la séquence polypeptidique SEQ ID NO 86 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 86 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 86, et
    - une enzyme E2e présentant la séquence polypeptidique SEQ ID NO 88 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 88 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 88, et
    au moins une enzyme E3 choisie parmi
    - une enzyme E3a présentant la séquence polypeptidique SEQ ID NO 6 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 6 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 6,
    - une enzyme E3b présentant la séquence polypeptidique SEQ ID NO 22 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 22 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 22,
    - une enzyme E3c présentant la séquence polypeptidique SEQ ID NO 90 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 90 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 90 et
    - une enzyme E3d présentant la séquence polypeptidique SEQ ID NO 92 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 92 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 92.
  3. Cellule selon la revendication 1 ou 2, caractérisée en ce qu'elle présente des activités augmentées d'une combinaison enzymatique choisie parmi E2, E2E3 et E1E2E3
  4. Cellule selon au moins l'une quelconque des revendications précédentes, caractérisée en ce qu'elle présente une activité augmentée de la combinaison enzymatique E1E2E3 et n = 1.
  5. Cellule selon au moins l'une quelconque des revendications précédentes, caractérisée en ce qu'elle est choisie parmi un genre du groupe constitué par Aspergillus, Corynebacterium, Brevibacterium, Bacillus, Acinetobacter, Alcaligenes, Lactobacillus, Paracoccus, Lactococcus, Candida, Pichia, Hansenula, Kluyveromyces, Saccharomyces, Escherichia, Zymomonas, Yarrowia, Methylobacterium, Ralstonia, Pseudomonas, Rhodospirillum, Rhodobacter, Burkholderia, Clostridium et Cupriavidus.
  6. Cellule selon au moins l'une quelconque des revendications précédentes, caractérisée en ce qu'elle peut former, en tant que type sauvage, des polyhydroxyalcanoates présentant des longueurs de chaîne de C6 à C16, en particulier une cellule qui a été modifiée par technique génique de manière telle qu'elle peut former moins de polyhydroxyalcanoates par rapport à son type sauvage.
  7. Cellule selon la revendication 6, caractérisée en ce que la cellule présente, par rapport à son type sauvage, une activité diminuée d'au moins une enzyme Eg ou E10,
    E9 étant une polyhydroxyalcanoate-synthase, EC:2.3.1.-, présentant l'aptitude à transformer la 3-hydroxyalcanoyl-coenzyme A en poly(acide 3-hydroxyalcanoïque), présentant en particulier la séquence polypeptidique SEQ ID NO 30 ou SEQ ID NO 32 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 30 ou SEQ ID NO 32 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 30 ou SEQ ID NO 32, et
    E10 étant une 3-hydroxyalcanoyl-ACP-coenzyme A-transférase présentant l'aptitude à transformer la 3-hydroxyalcanoyl-ACP en 3-hydroxyalcanoyl-coenzyme A, présentant en particulier la séquence polypeptidique SEQ ID NO 34 ou SEQ ID NO 36 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 34 ou SEQ ID NO 36 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 34 ou SEQ ID NO 36.
  8. Cellule selon au moins l'une quelconque des revendications précédentes, caractérisée en ce qu'elle présente, par rapport à son type sauvage, une activité augmentée d'au moins une des enzymes choisies dans le groupe constitué par
    - au moins une enzyme E4, une dTTP:α-D-glucose-1-phosphate thymidylyl-transférase, EC 2.7.7.24, présentant en particulier la séquence polypeptidique SEQ ID NO 10 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 10 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 10,
    - au moins une enzyme E5, une dTTP-glucose-4,6-hydrolase, EC 4.2.1.46, présentant en particulier la séquence polypeptidique SEQ ID NO 12 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 12 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 12,
    - au moins une enzyme E6, une dTDP-4-déshydrorhamnose-3,5-épimérase, EC 5.1.3.13, présentant en particulier la séquence polypeptidique SEQ ID NO 14 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 14 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 14, et
    - au moins une enzyme E7, une dTDP-4-déshydrorhamnose-réductase, EC 1.1.1.133, présentant en particulier la séquence polypeptidique SEQ ID NO 16 ou présentant une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 16 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence SEQ ID NO 16.
  9. Cellule selon au moins l'une quelconque des revendications précédentes, caractérisée en ce que l'enzyme E8 présente une séquence polypeptidique SEQ ID NO 8, SEQ ID NO 24, SEQ ID NO 26 ou SEQ ID NO 28 ou une séquence polypeptidique dans laquelle jusqu'à 25% des restes d'acide aminé ont été modifiés par délétion, insertion, substitution ou par une combinaison de celles-ci par rapport à la séquence de référence respective SEQ ID NO 8, SEQ ID NO 24, SEQ ID NO 26 ou SEQ ID NO 28 et qui possède encore au moins 10% de l'activité enzymatique de l'enzyme présentant la séquence de référence respective SEQ ID NO 8, SEQ ID NO 24, SEQ ID NO 26 ou SEQ ID NO 28.
  10. Cellule selon au moins l'une quelconque des revendications précédentes, caractérisée en ce qu'elle présente au moins un acide nucléique isolé, qui présente au moins à chaque fois une séquence choisie parmi les trois groupes [A1 à G1], [A2 à G2] et [A3 à G3] où
    le groupe [A1 à G1] est constitué par les séquences suivantes :
    A1a) une séquence selon SEQ ID NO 1, cette séquence codant pour une protéine qui est en mesure de transformer la 3-hydroxydécanoyl-ACP via la 3-hydroxydécanoyl-3-hydroxydécanoyl-ACP en acide 3-hydroxydécanoyl-3-hydroxydécanoïque,
    B1a) une séquence exempte d'intron, qui est dérivée d'une séquence selon A1a) et qui code pour la même protéine ou le même peptide que la séquence selon SEQ ID NO 1,
    C1a) une séquence qui code pour une protéine ou un peptide qui comprend la séquence d'acides aminés selon SEQ ID NO 2,
    D1a) une séquence qui est identique à raison d'au moins 70% à une séquence selon l'un des groupes A1a) à C1a) ,
    E1a) une séquence qui s'hybride ou, tenant compte de la dégénérescence du code génétique, s'hybriderait avec un contre-brin d'une séquence selon l'un des groupes A1a) à D1a), cette séquence codant pour une protéine ou un peptide qui est en mesure de transformer la 3-hydroxydécanoyl-ACP via la 3-hydroxydécanoyl-3-hydroxydécanoyl-ACP en acide 3-hydroxydécanoyl-3-hydroxydécanoïque et les conditions d'hybridation étant une incubation à 65°C pendant une nuit dans 7% de SDS, 1% de BSA, 1 mM en EDTA, 250 mM en tampon phosphate sodique (pH 7,2) et lavage consécutif à 65°C avec 2 x SSC ; 0,1% de SDS,
    F1a) un dérivé, obtenu par substitution, addition, inversion et/ou délétion d'au moins une base, mais pas de plus de 100 bases, d'une séquence selon l'un des groupes A1a) à E1a),
    G1a) une séquence complémentaire à une séquence selon l'un des groupes A1a) à F1a),
    A1b) une séquence selon SEQ ID NO 17, cette séquence codant pour une protéine qui est en mesure de transformer la 3-hydroxytétradécanoyl-ACP via la 3-hydroxytétradécanoyl-3-hydroxytétradécanoyl-ACP en acide 3-hydroxytétradécanoyl-3-hydroxytétradécanoïque,
    B1b) une séquence exempte d'intron, qui est dérivée d'une séquence selon A1b) et qui code pour la même protéine ou le même peptide que la séquence selon SEQ ID NO 17,
    C1b) une séquence qui code pour une protéine ou un peptide qui comprend la séquence d'acides aminés selon SEQ ID NO 18,
    D1b) une séquence qui est identique à raison d'au moins 70% à une séquence selon l'un des groupes A1b) à C1b),
    E1b) une séquence qui s'hybride ou, tenant compte de la dégénérescence du code génétique, s'hybriderait avec un contre-brin d'une séquence selon l'un des groupes A1b) à D1b), cette séquence codant pour une protéine ou un peptide qui est en mesure de transformer la 3-hydroxytétradécanoyl-ACP via la 3-hydroxytétradécanoyl-3-hydroxytétradécanoyl-ACP en acide 3-hydroxytétradécanoyl-3-hydroxytétradécanoïque et les conditions d'hybridation étant une incubation à 65°C pendant une nuit dans 7% de SDS, 1% de BSA, 1 mM en EDTA, 250 mM en tampon phosphate sodique (pH 7,2) et lavage consécutif à 65°C avec 2 x SSC ; 0,1% de SDS,
    F1b) un dérivé, obtenu par substitution, addition, inversion et/ou délétion d'au moins une base, mais pas de plus de 100 bases, d'une séquence selon l'un des groupes A1b) à E1b),
    G1b) une séquence complémentaire à une séquence selon l'un des groupes A1b) à F1b), et
    le groupe [A2 à G2] est constitué par les séquences suivantes :
    A2a) une séquence selon SEQ ID NO 3, cette séquence codant pour une protéine qui est en mesure de transformer le dTDP-rhamnose et l'acide 3-hydroxydécanoyl-3-hydroxydécanoïque en acide α-L-rhamnopyranosyl-3-hydroxydécanoyl-3-hydroxydécanoïque,
    B2a) une séquence exempte d'intron, qui est dérivée d'une séquence selon A2a) et qui code pour la même protéine ou le même peptide que la séquence selon SEQ ID NO 3,
    C2a) une séquence qui code pour une protéine ou un peptide qui comprend la séquence d'acides aminés selon SEQ ID NO 4,
    D2a) une séquence qui est identique à raison d'au moins 80% à une séquence selon l'un des groupes A2a) à C2a),
    E2a) une séquence qui s'hybride ou, tenant compte de la dégénérescence du code génétique, s'hybriderait avec un contre-brin d'une séquence selon l'un des groupes A2a) à D2a), cette séquence codant pour une protéine ou un peptide qui est en mesure de transformer le dTDP-rhamnose et l'acide 3-hydroxydécanoyl-3-hydroxydécanoïque en acide α-L-rhamnopyranosyl-3-hydroxydécanoyl-3-hydroxydécanoïque et les conditions d'hybridation étant une incubation à 65°C pendant une nuit dans 7% de SDS, 1% de BSA, 1 mM en EDTA, 250 mM en tampon phosphate sodique (pH 7,2) et lavage consécutif à 65°C avec 2 x SSC ; 0,1% de SDS,
    F2a) un dérivé, obtenu par substitution, addition, inversion et/ou délétion d'au moins une base, mais pas de plus de 100 bases, d'une séquence selon l'un des groupes A2a) à E2a),
    G2a) une séquence complémentaire à une séquence selon l'un des groupes A2a) à F2a),
    A2b) une séquence selon SEQ ID NO 19, cette séquence codant pour une protéine qui est en mesure de transformer le dTDP-rhamnose et l'acide 3-hydroxytétradécanoyl-3-hydroxytétradécanoïque en acide α-L-rhamnopyranosyl-3-hydroxytétradécanoyl-3-hydroxytétradécanoïque,
    B2b) une séquence exempte d'intron, qui est dérivée d'une séquence selon A2b) et qui code pour la même protéine ou le même peptide que la séquence selon SEQ ID NO 19,
    C2b) une séquence qui code pour une protéine ou un peptide qui comprend la séquence d'acides aminés selon SEQ ID NO 20,
    D2b) une séquence qui est identique à raison d'au moins 70% à une séquence selon l'un des groupes A2b) à C2b),
    E2b) une séquence qui s'hybride ou, tenant compte de la dégénérescence du code génétique, s'hybriderait avec un contre-brin d'une séquence selon l'un des groupes A2b) à D2b), cette séquence codant pour une protéine ou un peptide qui est en mesure de transformer le dTDP-rhamnose et l'acide 3-hydroxytétradécanoyl-3-hydroxytétradécanoïque en acide α-L-rhamnopyranosyl-3-hydroxytétradécanoyl-3-hydroxytétradécanoïque et les conditions d'hybridation étant une incubation à 65°C pendant une nuit dans 7% de SDS, 1% de BSA, 1 mM en EDTA, 250 mM en tampon phosphate sodique (pH 7,2) et lavage consécutif à 65°C avec 2 x SSC ; 0,1% de SDS,
    F2b) un dérivé, obtenu par substitution, addition, inversion et/ou délétion d'au moins une base, mais pas de plus de 100 bases, d'une séquence selon l'un des groupes A2b) à E2b) et
    G2b) une séquence complémentaire à une séquence selon l'un des groupes A2b) à F2b) et
    le groupe [A3 à G3] est constitué par les séquences suivantes :
    A3a) une séquence selon SEQ ID NO 5, cette séquence codant pour une protéine qui est en mesure de transformer le dTDP-rhamnose et l'acide α-L-rhamnopyranosyl-3-hydroxydécanoyl-3-hydroxydécanoïque en acide α-L-rhamnopyranosyl-(1-2)-α-L-rhamnopyranosyl-3-hydroxydécanoyl-3-hydroxydécanoïque,
    B3a) une séquence exempte d'intron, qui est dérivée d'une séquence selon A3a) et qui code pour la même protéine ou le même peptide que la séquence selon SEQ ID NO 5,
    C3a) une séquence qui code pour une protéine ou un peptide qui comprend la séquence d'acides aminés selon SEQ ID NO 6,
    D3a) une séquence qui est identique à raison d'au moins 80% à une séquence selon l'un des groupes A3a) à C3a),
    E3a) une séquence qui s'hybride ou, tenant compte de la dégénérescence du code génétique, s'hybriderait avec un contre-brin d'une séquence selon l'un des groupes A3a) à D3a), cette séquence codant pour une protéine ou un peptide qui est en mesure de transformer le dTDP-rhamnose et l'acide α-L-rhamnopyranosyl-3-hydroxydécanoyl-3-hydroxydécanoïque en acide α-L-rhamnopyranosyl-(1-2)-α-L-rhamnopyranosyl-3-hydroxydécanoyl-3-hydroxydécanoïque et les conditions d'hybridation étant une incubation à 65°C pendant une nuit dans 7% de SDS, 1% de BSA, 1 mM en EDTA, 250 mM en tampon phosphate sodique (pH 7,2) et lavage consécutif à 65°C avec 2 x SSC ; 0,1% de SDS,
    F3a) un dérivé, obtenu par substitution, addition, inversion et/ou délétion d'au moins une base, mais pas de plus de 100 bases, d'une séquence selon l'un des groupes A3a) à E3a),
    G3a) une séquence complémentaire à une séquence selon l'un des groupes A3a) à F3a),
    A3b) une séquence selon SEQ ID NO 21, cette séquence codant pour une protéine qui est en mesure de transformer le dTDP-rhamnose et l'acide α-L-rhamnopyranosyl-3-hydroxytétradécanoyl-3-hydroxytétradécanoïque en acide α-L-rhamnopyranosyl-(1-2)-α-L-rhamnopyranosyl-3-hydroxytétradécanoyl-3-hydroxytétradécanoïque,
    B3b) une séquence exempte d'intron, qui est dérivée d'une séquence selon A3b) et qui code pour la même protéine ou le même peptide que la séquence selon SEQ ID NO 21,
    C3b) une séquence qui code pour une protéine ou un peptide qui comprend la séquence d'acides aminés selon SEQ ID NO 22,
    D3b) une séquence qui est identique à raison d'au moins 60% à une séquence selon l'un des groupes A3b) à C3b),
    E3b) une séquence qui s'hybride ou, tenant compte de la dégénérescence du code génétique, s'hybriderait avec un contre-brin d'une séquence selon l'un des groupes A3b) à D3b), cette séquence codant pour une protéine ou un peptide qui est en mesure de transformer le dTDP-rhamnose et l'acide α-L-rhamnopyranosyl-3-hydroxytétradécanoyl-3-hydroxytétradécanoïque en acide α-L-rhamnopyranosyl-(1-2)-α-L-rhamnopyranosyl-3-hydroxytétradécanoyl-3-hydroxytétradécanoïque et les conditions d'hybridation étant une incubation à 65°C pendant une nuit dans 7% de SDS, 1% de BSA, 1 mM en EDTA, 250 mM en tampon phosphate sodique (pH 7,2) et lavage consécutif à 65°C avec 2 x SSC ; 0,1% de SDS,
    F3b) un dérivé, obtenu par substitution, addition, inversion et/ou délétion d'au moins une base, mais pas de plus de 100 bases, d'une séquence selon l'un des groupes A3b) à E3b) et
    G3b) une séquence complémentaire à une séquence selon l'un des groupes A3a) à F3a),
    ou au moins un vecteur, en particulier un vecteur d'expression ou une cassette de surexpression génique, comprenant au moins une séquence d'acide nucléique choisie parmi les séquences SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42, SEQ ID NO 45, SEQ ID NO 47 et des acides nucléiques choisis parmi les trois groupes susmentionnés [A1 à G1], [A2 à G2] et [A3 à G3].
  11. Procédé pour la préparation de rhamnolipides de formule générale (I), comprenant les étapes de procédé
    I) mise en contact d'une cellule selon au moins l'une quelconque des revendications 1 à 10 avec un milieu contenant une source de carbone,
    II) culture de la cellule dans des conditions qui permettent à la cellule de former un rhamnolipide à partir de la source de carbone et
    III) le cas échéant isolement des rhamnolipides formés.
EP18184367.3A 2010-07-28 2011-07-20 Cellules et procédé de production de rhamnolipides Active EP3418388B1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE102010032484A DE102010032484A1 (de) 2010-07-28 2010-07-28 Zellen und Verfahren zur Herstellung von Rhamnolipiden
EP11734101.6A EP2598646B1 (fr) 2010-07-28 2011-07-20 Cellules et procédé de production de rhamnolipides
PCT/EP2011/062441 WO2012013554A1 (fr) 2010-07-28 2011-07-20 Cellules et procédé de production de rhamnolipides

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
EP11734101.6A Division EP2598646B1 (fr) 2010-07-28 2011-07-20 Cellules et procédé de production de rhamnolipides
EP11734101.6A Division-Into EP2598646B1 (fr) 2010-07-28 2011-07-20 Cellules et procédé de production de rhamnolipides

Publications (2)

Publication Number Publication Date
EP3418388A1 EP3418388A1 (fr) 2018-12-26
EP3418388B1 true EP3418388B1 (fr) 2020-10-28

Family

ID=44478868

Family Applications (2)

Application Number Title Priority Date Filing Date
EP18184367.3A Active EP3418388B1 (fr) 2010-07-28 2011-07-20 Cellules et procédé de production de rhamnolipides
EP11734101.6A Active EP2598646B1 (fr) 2010-07-28 2011-07-20 Cellules et procédé de production de rhamnolipides

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP11734101.6A Active EP2598646B1 (fr) 2010-07-28 2011-07-20 Cellules et procédé de production de rhamnolipides

Country Status (11)

Country Link
US (2) US9005928B2 (fr)
EP (2) EP3418388B1 (fr)
JP (2) JP6066908B2 (fr)
CN (2) CN108587995B (fr)
BR (2) BR122020023808B1 (fr)
CA (1) CA2806430C (fr)
DE (1) DE102010032484A1 (fr)
ES (2) ES2837485T3 (fr)
HU (2) HUE053232T2 (fr)
RU (1) RU2619877C2 (fr)
WO (1) WO2012013554A1 (fr)

Families Citing this family (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102006025821A1 (de) * 2006-06-02 2007-12-06 Degussa Gmbh Ein Enzym zur Herstellung von Mehylmalonatsemialdehyd oder Malonatsemialdehyd
DE102007052463A1 (de) * 2007-11-02 2009-05-07 Evonik Degussa Gmbh Fermentative Gewinnung von Aceton aus erneuerbaren Rohstoffen mittels neuen Stoffwechselweges
DE102007060705A1 (de) * 2007-12-17 2009-06-18 Evonik Degussa Gmbh ω-Aminocarbonsäuren oder ihre Lactame, herstellende, rekombinante Zellen
DE102008002715A1 (de) * 2008-06-27 2009-12-31 Evonik Röhm Gmbh 2-Hydroxyisobuttersäure produzierende rekombinante Zelle
DE102009009580A1 (de) 2009-02-19 2010-08-26 Evonik Degussa Gmbh Verfahren zur Herstellung freier Säuren aus ihren Salzen
DE102009046623A1 (de) 2009-11-11 2011-05-12 Evonik Röhm Gmbh Verwendung eines zu einem MeaB-Protein homologen Proteins zur Erhöhung der enzymatischen Aktivität einer 3-Hydroxycarbonsäure-CoA-Mutase
DE102009046626A1 (de) 2009-11-11 2011-05-12 Evonik Degussa Gmbh Candida tropicalis Zellen und deren Verwendung
DE102010014680A1 (de) 2009-11-18 2011-08-18 Evonik Degussa GmbH, 45128 Zellen, Nukleinsäuren, Enzyme und deren Verwendung sowie Verfahren zur Herstellung von Sophorolipiden
DE102010015807A1 (de) 2010-04-20 2011-10-20 Evonik Degussa Gmbh Biokatalytisches Oxidationsverfahren mit alkL-Genprodukt
DE102011004465A1 (de) 2010-09-10 2012-03-15 Evonik Degussa Gmbh Verfahren zur direkten Aminierung sekundärer Alkohole mit Ammoniak zu primären Aminen
DE102010043470A1 (de) 2010-11-05 2012-05-10 Evonik Degussa Gmbh Zusammensetzung aus Polyamiden mit niedriger Konzentration an Carbonsäureamidgruppen und elektrisch leitfähigem Kohlenstoff
DE102011075162A1 (de) 2010-12-08 2012-06-14 Evonik Degussa Gmbh Verfahren zur homogen-katalysierte, hochselektiven direkten Aminierung von primären Alkoholen mit Ammoniak zu primären Aminen bei hohem Volumenverhältnis von Flüssig- zu Gasphase und/oder hohen Drücken
BR112013021208A2 (pt) 2011-02-21 2019-09-24 Evonik Degussa Gmbh processo para aminação direta de álcoois com amônia para formar aminas primárias por meio de sistema catalisador xantphos
EP2734631B1 (fr) 2011-07-20 2016-08-31 Evonik Degussa GmbH Oxydation et amination d'alcools secondaires
EP2573172A1 (fr) 2011-09-21 2013-03-27 Heinrich-Heine-Universität Düsseldorf Moyens et procédés pour la production de rhamnolipides
DE102011084518A1 (de) 2011-10-14 2013-04-18 Evonik Industries Ag Verwendung einer Mehrschichtfolie mit Polyamid- und Polyesterschichten fürdie Herstellung photovoltaischer Module
EP2602328A1 (fr) 2011-12-05 2013-06-12 Evonik Industries AG Procédé d'oxydation d'alcanes en utilisant d'une alcane 1-mono-oxygénase AlkB
EP2607479A1 (fr) 2011-12-22 2013-06-26 Evonik Industries AG Production bio-technologique d'alcools et dérivés associés
EP2631298A1 (fr) 2012-02-22 2013-08-28 Evonik Industries AG Procédé biotechnologique et procédé de production de butanol et d'acide butyrique
EP2639308A1 (fr) 2012-03-12 2013-09-18 Evonik Industries AG Omega-oxydation et -amination enzymatique d'acides gras
EP2647696A1 (fr) 2012-04-02 2013-10-09 Evonik Degussa GmbH Procédé de fabrication aérobie d'alanine ou d'une liaison établie sous consommation d'alanine
WO2014039940A1 (fr) * 2012-09-10 2014-03-13 Logos Technologies Llc Cellules et méthodes de production de rhamnolipides
DE102012221519A1 (de) 2012-11-26 2014-05-28 Evonik Industries Ag Verfahren zur Isolierung von Rhamnolipiden
EP2746400A1 (fr) 2012-12-21 2014-06-25 Evonik Industries AG Fabrication d'amines et de diamines à partir d'acide carbonique ou d'acide de dicarbone ou un mono-ester composé de ceux-ci
DE102013205756A1 (de) * 2013-04-02 2014-10-02 Evonik Industries Ag Mischungszusammensetzung enthaltend Rhamnolipide
DE102013205755A1 (de) 2013-04-02 2014-10-02 Evonik Industries Ag Waschmittelformulierung für Textilien enthaltend Rhamnolipide mit einem überwiegenden Gehalt an di-Rhamnolipiden
US10190144B2 (en) 2013-06-06 2019-01-29 The United States Of America, As Represented By The Secretary Of Agriculture Production of dirhamnose-lipid in recombinant nonpathogenic bacterium Pseudomonas chlororaphis
EP2949214A1 (fr) 2014-05-26 2015-12-02 Evonik Degussa GmbH Procédés de production de rhamnolipides
EP3023431B1 (fr) 2014-11-19 2017-01-04 Evonik Degussa GmbH Compositions de rhamnolipides concentrées et peu visqueuses
BR112017014710B1 (pt) * 2015-01-12 2022-06-14 Stepan Company Processo livre de solvente orgânico para a obtenção de uma composição compreendendo um ou mais ramnolipídeos (rls) e composições
JP2018505690A (ja) * 2015-02-19 2018-03-01 エボニック デグサ ゲーエムベーハーＥｖｏｎｉｋ Ｄｅｇｕｓｓａ ＧｍｂＨ ラムノ脂質合成
CA2937594A1 (fr) 2015-02-26 2016-08-26 Evonik Degussa Gmbh Production d'alkene
EP3061442A1 (fr) 2015-02-27 2016-08-31 Evonik Degussa GmbH Composition contenant du rhamnolipide et du siloxane
CA2984762C (fr) * 2015-05-05 2023-09-19 Logos Technologies Llc Procede semi-continu de production de rhamnolipides a rendement et titre eleves
US10907180B2 (en) 2015-07-08 2021-02-02 Rheinisch-Westfaelische Technische Hochshule Aachen (RWTH) Extracellular production of designer hydroxyalkanoyloxy alkanoic acids with recombinant bacteria
CN108699097B (zh) 2016-02-22 2021-11-23 赢创运营有限公司 鼠李糖脂酯作为非离子表面活性剂用于化妆品用途
WO2017144318A1 (fr) 2016-02-22 2017-08-31 Evonik Degussa Gmbh Amides de rhamno-lipides aux fins de rétention d'une substance odorante capillaire
CA3017990C (fr) 2016-03-18 2023-08-01 Evonik Degussa Gmbh Granules comprenant un support solide inorganique sur lequel est contenu au moins un tensioactif biologique
US11685905B2 (en) 2016-10-24 2023-06-27 Evonik Operations Gmbh Rhamnolipid-producing cell having reduced glucose dehydrogenase activity
JP2019532088A (ja) * 2016-10-24 2019-11-07 エボニック デグサ ゲーエムベーハーＥｖｏｎｉｋ Ｄｅｇｕｓｓａ ＧｍｂＨ 代替グルコーストランスポーターを使用してラムノリピドを製造するための細胞および方法
CN110248952B (zh) 2017-02-06 2023-11-14 斯泰潘公司 浓缩鼠李糖脂组合物的脱色
US11142782B2 (en) * 2017-07-31 2021-10-12 Stepan Company Enhanced production of rhamnolipids using at least two carbon sources
WO2019038125A1 (fr) 2017-08-24 2019-02-28 Evonik Degussa Gmbh Dérivés de rhamnolipides utilisés comme agents émulsifiants et dispersants
CN108060111B (zh) * 2017-10-27 2021-06-04 中国科学院微生物研究所 一种提高鼠李糖脂产量的铜绿假单胞菌及其构建方法
US11236372B2 (en) * 2018-02-09 2022-02-01 Evonik Operations Gmbh Lipid production
US11541105B2 (en) 2018-06-01 2023-01-03 The Research Foundation For The State University Of New York Compositions and methods for disrupting biofilm formation and maintenance
CN112481335A (zh) * 2019-09-11 2021-03-12 万华化学集团股份有限公司 一种鼠李糖脂发酵方法
BR112022018009A2 (pt) 2020-03-11 2022-11-08 Evonik Operations Gmbh Composição, método para preparar uma formulação e uso de trietil citrato
CN115175660A (zh) 2020-03-24 2022-10-11 赢创运营有限公司 包含鼠李糖脂、烷基多糖苷和酰基乳酸盐的组合物
US20230348514A1 (en) 2020-07-22 2023-11-02 Evonik Operations Gmbh New rhamnolipid oligo-esters
CN114438000B (zh) * 2020-11-05 2024-02-27 万华化学(四川)有限公司 一株铜绿假单胞菌及其构建方法与应用
WO2023198511A1 (fr) * 2022-04-13 2023-10-19 Evonik Operations Gmbh Procédé de production par fermentation d'un biotensioactif
CN115290765B (zh) * 2022-04-28 2024-02-13 华东理工大学 一种羧酸标记hplc-uv定量检测鼠李糖脂的方法
EP4155371A1 (fr) 2022-08-29 2023-03-29 Evonik Operations GmbH Composition riche en mono-rhamnolipides
CH720165A2 (de) 2022-10-26 2024-04-30 Chemtek Ug Zusammensetzungen mit N-Acylglycaminen

Family Cites Families (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US601494A (en) 1898-03-29 Spar for vessels
NL301993A (fr) 1962-12-18
US4601893A (en) 1984-02-08 1986-07-22 Pfizer Inc. Laminate device for controlled and prolonged release of substances to an ambient environment and method of use
EP0473869A1 (fr) 1990-08-28 1992-03-11 Landis & Gyr Business Support AG Procédé de réémission automatique d'un message reçu avec erreurs
DE4027453A1 (de) 1990-08-30 1992-03-05 Degussa Neue plasmide aus corynebacterium glutamicum und davon abgeleitete plasmidvektoren
DE4440118C1 (de) 1994-11-11 1995-11-09 Forschungszentrum Juelich Gmbh Die Genexpression in coryneformen Bakterien regulierende DNA
ATE452979T1 (de) 1996-11-13 2010-01-15 Du Pont Herstellungsverfahren von 1,3-propandiol durch rekombinante organismen
JPH10229891A (ja) 1997-02-20 1998-09-02 Mitsubishi Rayon Co Ltd マロン酸誘導体の製造法
US6551795B1 (en) * 1998-02-18 2003-04-22 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to pseudomonas aeruginosa for diagnostics and therapeutics
US20040033549A1 (en) 1999-09-03 2004-02-19 Greenberg E. Peter Quorum sensing signaling in bacteria
DE10031999A1 (de) 1999-09-09 2001-04-19 Degussa Verfahren zur fermentativen Herstellung von D-Pantothensäure unter Verwendung coryneformer Bakterien
EP1083225A1 (fr) 1999-09-09 2001-03-14 Degussa-Hüls Aktiengesellschaft Procédé pour la préparation d'acide pantothénique en utilisant les bactéries corynéformes
US6713289B2 (en) 1999-10-05 2004-03-30 Degussa Ag Nucleotide sequences which code for the eno gene
DE19953206A1 (de) * 1999-11-05 2001-05-10 Degussa Plasmide aus Corynebacterium glutamicum und deren Verwendung
GB0228444D0 (en) * 2002-12-05 2003-01-08 Plant Bioscience Ltd Bioremediation with transgenic plants
CN100584841C (zh) * 2007-08-08 2010-01-27 暨南大学 穿心莲内酯衍生物及其在制药中的应用
WO2014039940A1 (fr) * 2012-09-10 2014-03-13 Logos Technologies Llc Cellules et méthodes de production de rhamnolipides
EP2949214A1 (fr) * 2014-05-26 2015-12-02 Evonik Degussa GmbH Procédés de production de rhamnolipides
CN104830889B (zh) * 2015-03-06 2019-01-25 西安海格生物技术研究所有限公司 一种铜绿假单胞菌高产鼠李糖脂的基因重组方法
CN106755031B (zh) * 2016-11-14 2020-04-17 自然资源部天津海水淡化与综合利用研究所 鼠李糖脂生产质粒及其构建方法与大肠杆菌工程菌和应用

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None *

Also Published As

Publication number Publication date
BR112013002124A2 (pt) 2016-09-20
CA2806430C (fr) 2019-06-25
US20150247151A1 (en) 2015-09-03
US20130130319A1 (en) 2013-05-23
US9580720B2 (en) 2017-02-28
ES2837485T3 (es) 2021-06-30
JP2017060523A (ja) 2017-03-30
HUE042573T2 (hu) 2019-07-29
BR112013002124B1 (pt) 2021-08-31
WO2012013554A1 (fr) 2012-02-02
CN108587995A (zh) 2018-09-28
HUE053232T2 (hu) 2021-06-28
ES2713479T3 (es) 2019-05-22
US9005928B2 (en) 2015-04-14
BR122020023808B1 (pt) 2022-01-11
RU2013108700A (ru) 2014-09-10
EP3418388A1 (fr) 2018-12-26
JP6461078B2 (ja) 2019-01-30
EP2598646B1 (fr) 2018-11-07
DE102010032484A1 (de) 2012-02-02
JP6066908B2 (ja) 2017-01-25
RU2619877C2 (ru) 2017-05-18
CN103038357A (zh) 2013-04-10
CA2806430A1 (fr) 2012-02-02
EP2598646A1 (fr) 2013-06-05
CN108587995B (zh) 2022-04-01
CN103038357B (zh) 2018-05-25
JP2013537411A (ja) 2013-10-03

Similar Documents

Publication Publication Date Title
EP3418388B1 (fr) Cellules et procédé de production de rhamnolipides
US9157108B2 (en) Cells, nucleic acids, enzymes and use thereof, and methods for the production of sophorolipids
DE102012201360A1 (de) Zellen und Verfahren zur Herstellung von Rhamnolipiden
DE102007015583A1 (de) Ein Enzym zur Herstellung von Methylmalonyl-Coenzym A oder Ethylmalonyl-Coenzym A sowie dessen Verwendung
DE102010029973A1 (de) Mikrobiologische Herstellung von C4-Körpern aus Saccharose und Kohlendioxid
CA2948696A1 (fr) Procedes de production de rhamnolipides
EP3824078A1 (fr) Fabrication biotechnologique de cannabinoïdes
EP1240336A2 (fr) Enzymes et genes pour produire de la vanilline
WO2013152913A1 (fr) Acétyltransférase de wickerhamomyces ciferrii
WO2015110518A1 (fr) Procédé de fermentation comprenant une culture de cellules à faible concentration en oxygène dissous
DE10258127A1 (de) Verfahen zur fermentativen Herstellung von R-α-Liponsäure
DE10261579A1 (de) Verfahren zur Herstellung von Trehalose-freien Aminosäuren
DE10104722A1 (de) Verfahren zur fermentativen Herstellung von Cystein, Cystin und Glutathion
DE102007051452A1 (de) Fermentative Gewinnung von α-Ketoglutarsäure aus erneuerbaren Rohstoffen unter erhöhter Stickstoffzufuhr
WO2009053489A1 (fr) Production par fermentation d'acide alpha-cétoglutarique

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20180719

AC Divisional application: reference to earlier application

Ref document number: 2598646

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: EVONIK DEGUSSA GMBH

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20191028

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: EVONIK OPERATIONS GMBH

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20200626

GRAJ Information related to disapproval of communication of intention to grant by the applicant or resumption of examination proceedings by the epo deleted

Free format text: ORIGINAL CODE: EPIDOSDIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

GRAR Information related to intention to grant a patent recorded

Free format text: ORIGINAL CODE: EPIDOSNIGR71

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

INTC Intention to grant announced (deleted)
AC Divisional application: reference to earlier application

Ref document number: 2598646

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

INTG Intention to grant announced

Effective date: 20200922

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

Free format text: NOT ENGLISH

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: AT

Ref legal event code: REF

Ref document number: 1328268

Country of ref document: AT

Kind code of ref document: T

Effective date: 20201115

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 502011016962

Country of ref document: DE

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

Free format text: LANGUAGE OF EP DOCUMENT: GERMAN

REG Reference to a national code

Ref country code: SK

Ref legal event code: T3

Ref document number: E 35926

Country of ref document: SK

Ref country code: NL

Ref legal event code: FP

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210301

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210129

Ref country code: NO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210128

REG Reference to a national code

Ref country code: LT

Ref legal event code: MG4D

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210228

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

REG Reference to a national code

Ref country code: HU

Ref legal event code: AG4A

Ref document number: E053232

Country of ref document: HU

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2837485

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20210630

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 502011016962

Country of ref document: DE

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

Ref country code: LT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20210729

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20210731

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20210731

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210228

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20210720

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20210720

REG Reference to a national code

Ref country code: AT

Ref legal event code: MM01

Ref document number: 1328268

Country of ref document: AT

Kind code of ref document: T

Effective date: 20210720

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20210720

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230524

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IT

Payment date: 20230724

Year of fee payment: 13

Ref country code: GB

Payment date: 20230721

Year of fee payment: 13

Ref country code: ES

Payment date: 20230926

Year of fee payment: 13

Ref country code: BG

Payment date: 20230719

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SK

Payment date: 20230710

Year of fee payment: 13

Ref country code: HU

Payment date: 20230721

Year of fee payment: 13

Ref country code: FR

Payment date: 20230726

Year of fee payment: 13

Ref country code: DE

Payment date: 20230719

Year of fee payment: 13

Ref country code: BE

Payment date: 20230719

Year of fee payment: 13

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201028

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20240719

Year of fee payment: 14