EP3193915A1 - Kombinationen aus niedrigen, immunfördernden dosen von mtor-inhibitoren und cars - Google Patents

Kombinationen aus niedrigen, immunfördernden dosen von mtor-inhibitoren und cars

Info

Publication number
EP3193915A1
EP3193915A1 EP15753232.6A EP15753232A EP3193915A1 EP 3193915 A1 EP3193915 A1 EP 3193915A1 EP 15753232 A EP15753232 A EP 15753232A EP 3193915 A1 EP3193915 A1 EP 3193915A1
Authority
EP
European Patent Office
Prior art keywords
cells
cell
mtor inhibitor
immune effector
optionally
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP15753232.6A
Other languages
English (en)
French (fr)
Inventor
Jennifer BROGDON
David Glass
Joan Mannick
Michael C. MILONE
Leon Murphy
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
University of Pennsylvania Penn
Original Assignee
Novartis AG
University of Pennsylvania Penn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis AG, University of Pennsylvania Penn filed Critical Novartis AG
Publication of EP3193915A1 publication Critical patent/EP3193915A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4738—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4745—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4637—Other peptides or polypeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464411—Immunoglobulin superfamily
    • A61K39/464412—CD19 or B4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/48—Blood cells, e.g. leukemia or lymphoma

Definitions

  • the invention relates generally to the administration of a low, immune enhancing dose of an mTOR inhibitor in combination with immune effector cells (e.g., T cells or NK cells) engineered to express a Chimeric Antigen Receptor (CAR) to treat a disease, e.g., a disease associated with expression of a tumor marker.
  • immune effector cells e.g., T cells or NK cells
  • CAR Chimeric Antigen Receptor
  • T-cell responses play an important role in effective immune responses, for example, against infectious diseases and cancer.
  • effector T cells can be suppressed by various immunosuppressive mechanisms, including (PD-Ll)/programmed death- 1 (PD-1) interaction, leading to T-cell exhaustion (Pen et al. Gene Therapy 21, 262-271, 2014).
  • PD-Ll programmed death ligand-1
  • PD-1 programmed death ligand-1
  • Treg regulatory T
  • PD-Ll/PD-1 binding is important in the maintenance of peripheral T-cell tolerance, preventing autoimmune responses.
  • high levels of PD-1 expression generally correlate with loss of T cell function, leading to increased viral load in cases of viral infection (Pen et al. Gene Therapy 21, 262-271, 2014).
  • Methods and compositions disclosed herein are directed to the administration of a low, immune enhancing dose of an mTOR inhibitor and immune effector cells (e.g., T cells or NK cells) engineered to express a Chimeric Antigen Receptor (CAR), to treat a disease, e.g., a disease associated with expression of a cancer associated antigen (or tumor marker).
  • an mTOR inhibitor and immune effector cells e.g., T cells or NK cells
  • CAR Chimeric Antigen Receptor
  • partial mTOR inhibition e.g., with low, immune enhancing, doses of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, such as RAD001
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, such as RAD001
  • treatment with a low, immune enhancing, dose e.g., a dose that is insufficient to completely suppress the immune system but sufficient to improve immune function
  • treatment with a low, immune enhancing, dose e.g., a dose that is insufficient to completely suppress the immune system but sufficient to improve immune function
  • PD-1 positive T cells can be exhausted by engagement with cells which express a PD-1 ligand, e.g., PD-L1 or PD-L2.
  • a PD-1 ligand e.g., PD-L1 or PD-L2.
  • treatment with a low, immune enhancing, dose of an mTOR inhibitor can increase naive T cell numbers, e.g., at least transiently, e.g., as compared to a non-treated subject.
  • treatment with a low, immune enhancing, dose of an mTOR inhibitor results in an increase in the expression of one or more of the following markers: CD62L high , CD127 high , CD27 + , and BCL2, e.g., on memory T cells, e.g., memory T cell precursors;
  • KLRGl a decrease in the expression of KLRGl, e.g., on memory T cells, e.g., memory T cell precursors; and an increase in the number of memory T cell precursors, e.g., cells with any one or combination of the following characteristics: increased CD62L hlgh , increased CD127 hlgh , increased CD27 + , decreased KLRGl, and increased BCL2; wherein any of the changes described above occurs, e.g., at least transiently, e.g., as compared to a non-treated subject.
  • embodiments of the invention are based, at least in part, on the recognition that partial mTOR inhibition, e.g., with low, immune enhancing, dose of an mTOR inhibitor, is associated with a reduction in the percentage of programmed death (PD)-l positive CD4 and CD8 T lymphocytes.
  • PD programmed death
  • this approach can be used to optimize the performance of immune effector cells, e.g., T cells, in the subject. While not wishing to be bound by theory, it is believed that, in an embodiment, the performance of endogenous, non-modified immune effector cells, e.g., T cells, is improved. While not wishing to be bound by theory, it is believed that, in an embodiment, the performance of immune effector cells, e.g., T cells, that are harvested to be engineered to express a CAR, is improved.
  • immune effector cells e.g., T cells
  • T cells which have, or will be engineered to express a CAR
  • an mTOR inhibitor that increases the number of PD1 negative immune effector cells, e.g., T cells or increases the ratio of PD1 negative immune effector cells, e.g., T cells/ PD1 positive immune effector cells, e.g., T cells.
  • the present invention relates to a method of treating, e.g., promoting an immune response in, a subject, e.g., a human subject, comprising,
  • an immune effector cell e.g., a T cell, engineered to express a CAR
  • the CAR comprises an antigen binding domain (e.g., antibody or antibody fragment, TCR or TCR fragment) a transmembrane domain, and an intracellular signaling domain (e.g., an intracellular signaling domain comprising a costimulatory domain and/or a primary signaling domain).
  • the antigen binding domain binds a cancer associated antigen (or tumor marker).
  • the cancer associated antigen (or tumor marker) is a solid cancer associated antigen (or a solid tumor marker).
  • the cancer associated antigen (or tumor marker) is a hematological cancer marker.
  • administration of the low, immune enhancing, dose of an mTOR inhibitor is initiated prior to administration of the immune effector cell, e.g., T cell or NK cell, engineered to express a CAR.
  • administration of the low, immune enhancing, dose of an mTOR inhibitor is completed prior to administration of the immune effector cell, e.g., T cell or NK cell, engineered to express a CAR.
  • administration of the low, immune enhancing, dose of an mTOR inhibitor overlaps with the administration of the immune effector cell, e.g., T cell or NK cell, engineered to express a CAR.
  • the immune effector cell e.g., T cell or NK cell
  • administering continues after the administration of the immune effector cell, e.g., T cellor NK cell, engineered to express a CAR.
  • the immune effector cell e.g., T cellor NK cell
  • the immune effector cell e.g., T cell, engineered to express a CAR
  • the immune effector cell is administered after a sufficient time, or after sufficient dosing of the low, immune enhancing, dose of an mTOR inhibitor, such that the level of PD1 negative immune effector cells, e.g., T cells, or the ratio of PD1 negative immune effector cells, e.g., T cells/ PD1 positive immune effector cells, e.g., T cells, has been, at least transiently, increased.
  • the immune effector cell e.g., T cell
  • the immune effector cell is harvested after a sufficient time, or after sufficient dosing of the low, immune enhancing, dose of an mTOR inhibitor, such that the level of PD1 negative immune effector cells, e.g., T cells, or the ratio of PD1 negative immune effector cells, e.g., T cells/ PD1 positive immune effector cells, e.g., T cells, in the subject or harvested from the subject has been, at least transiently, increased.
  • the low, immune enhancing, dose of an mTOR inhibitor is administered for an amount of time sufficient to decrease the proportion of PD-1 positive T cells, increase the proportion of PD-1 negative T cells, or increase the ratio of PD-1 negative T cells/ PD-1 positive T cells, in the peripheral blood of the subject, or in a preparation of T cells isolated from the subject.
  • the method of treating, e.g., promoting an immune response in, a subject, e.g., a human subject comprises inhibiting a negative immune response mediated by the engagement of PD-1 with PD-L1 or PD-L2.
  • the method of treating, e.g., promoting an immune response in, a subject, e.g., a human subject comprises increasing the number of T cells capable of
  • the method of treating, e.g., promoting an immune response in, a subject comprises increasing the number of T cells capable of cytotoxic function, secreting cytokines, or activation.
  • the administering of the low, immune enhancing, dose of an mTOR inhibitor results in the partial, but not total, inhibition of mTOR for at least 1, 5, 10, 20, 30, or 60 days.
  • the low, immune enhancing, dose of an mTOR inhibitor is administered prior to administration of immune effector cells, e.g., T cells to be engineered to express an CAR, (e.g., prior to or after harvest of the immune effector cells) for an amount of time sufficient for one or more of the following to occur: i) a decrease in the number of PD-1 positive immune effector cells; ii) an increase in the number of PD-1 negative immune effector cells; iii) an increase in the ratio of PD-1 negative immune effector cells / PD-1 positive immune effector cells; iv) an increase in the number of naive T cells; v) an increase in the expression of one or more of the following markers: CD62L hlgh , CD127 high , CD27 + , and BCL2, e.g., on memory T cells, e.g., memory T cell precursors; vi) a decrease in the expression of KLRG1, e.g., on memory
  • the immune effector cell e.g., T cell
  • the immune effector cell is harvested at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 days after initiation, or completion, of dosing with the low, immune enhancing, dose of an mTOR inhibitor.
  • the low, immune enhancing, dose of an mTOR inhibitor is administered prior to harvest of immune effector cells, e.g., T cells to be engineered to express an CAR, for an amount of time sufficient for one or more of the following to occur e.g., to occur in the harvested cells or in the engineered cells (or in non-harvested cells, or in both): i) a decrease in the number of PD-1 positive immune effector cells; ii) an increase in the number of PD-1 negative immune effector cells; iii) an increase in the ratio of PD-1 negative immune effector cells / PD-1 positive immune effector cells; iv) an increase in the number of naive T cells; v) an increase in the expression of one or more of the following markers: CD62L hlgh , CD127 high , CD27 + , and BCL2, e.g., on memory T cells, e.g., memory T cell precursors; vi) a decrease in the following markers: CD62L
  • the immune effector cell e.g., T cell
  • the immune effector cell is harvested at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 days after initiation, or completion, of dosing with the low, immune enhancing, dose of an mTOR inhibitor.
  • the low, immune enhancing, dose of an mTOR inhibitor is administered after harvest of immune effector cells, e.g., T cells to be engineered to express an CAR, for an amount of time sufficient for one or more of the following to occur: i) a decrease in the number of PD-1 positive immune effector cells; ii) an increase in the number of PD-1 negative immune effector cells; iii) an increase in the ratio of PD-1 negative immune effector cells / PD-1 positive immune effector cells; iv) an increase in the number of naive T cells; v) an increase in the expression of one or more of the following markers: CD62L hlgh , CD127 high , CD27 + , and BCL2, e.g., on memory T cells, e.g., memory T cell precursors; vi) a decrease in the expression of KLRG1, e.g., on memory T cells, e.g., memory T cell precursors; or vii)
  • the low, immune enhancing, dose of an mTOR inhibitor is administered after administration of immune effector cells, e.g., T cells to be engineered to express an CAR, for an amount of time sufficient for one or more of the following to occur: i) a decrease in the number of PD-1 positive immune effector cells; ii) an increase in the number of PD-1 negative immune effector cells; iii) an increase in the ratio of PD-1 negative immune effector cells / PD-1 positive immune effector cells; iv) an increase in the number of naive T cells; v) an increase in the expression of one or more of the following markers: CD62L hlgh , CD127 high , CD27 + , and BCL2, e.g., on memory T cells, e.g., memory T cell precursors; vi) a decrease in the expression of KLRG1, e.g., on memory T cells, e.g., memory T cell precursors; or vii)
  • the low, immune enhancing, dose of an mTOR inhibitor is administered to immune effector cells, e.g., T cells, which have, or will be engineered to express a RCAR, ex vivo for an amount of time sufficient for one or more of the following to occur: i) a decrease in the number of PD-1 positive immune effector cells; ii) an increase in the number of PD-1 negative immune effector cells; iii) an increase in the ratio of PD-1 negative immune effector cells / PD-1 positive immune effector cells; iv) an increase in the number of naive T cells; v) an increase in the expression of one or more of the following markers: CD62L hlgh ,
  • CD127 high , CD27 + , and BCL2 e.g., on memory T cells, e.g., memory T cell precursors; vi) a decrease in the expression of KLRG1, e.g., on memory T cells, e.g., memory T cell precursors; or vii) an increase in the number of memory T cell precursors, e.g., cells with any one or combination of the following characteristics: increased CD62L hlgh , increased CD127 high , increased CD27 + , decreased KLRG1, and increased BCL2; and wherein i), ii), ii), iv), v), vi), or vii) occurs e.g., at least transiently, e.g., as compared to a non-treated cell.
  • the mTOR inhibitor is an allosteric mTOR inhibitor. In an embodiment, the mTOR inhibitor is a RAD001. In an embodiment, the mTOR inhibitor is rapamycin. [0027] In an embodiment, the mTOR inhibitor is a catalytic inhibitor, e.g., a kinase inhibitor. In an embodiment, the kinase inhibitor is selective for mTOR. In an embodiment, the kinase inhibitor is selected from BEZ235 and CCG168.
  • the low, immune enhancing, dose comprises a plurality of mTOR inhibitors.
  • the dose comprises an allosteric and a catalytic mTOR inhibitor.
  • the low, immune enhancing, dose of an mTOR inhibitor is associated with mTOR inhibition of at least 5 but no more than 90%, e.g., as measured by p70 S6K inhibition.
  • the mTOR inhibitor comprises RADOOl.
  • the low, immune enhancing, dose of an mTOR inhibitor is associated with mTOR inhibition of at least 10% but no more than 80%, e.g., as measured by p70 S6K inhibition.
  • the mTOR inhibitor comprises RADOOl.
  • the low, immune enhancing, dose of an mTOR inhibitor is associated with mTOR inhibition of at least 10% but no more than 40%, e.g., as measured by p70 S6K inhibition.
  • the mTOR inhibitor comprises RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in an immediate release dosage form, 0.1 to 20, 0.5 to 10, 2.5 to 7.5, 3 to 6, or about 5, mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, once per week, in an immediate release dosage form, about 5 mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in an immediate release dosage form, an amount of an mTOR inhibitor other than RADOOl, that is bioequivalent to a one per week, immediate release dosage form of 0.1 to 20, 0.5 to 10, 2.5 to 7.5, 3 to 6, or about 5 mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, once per week, in an immediate release dosage form, an amount of an mTOR inhibitor other than RADOOl, that is bioequivalent to a once per week, immediate release dosage form of about 5 mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in a sustained release dosage form, 0.3 to 60, 1.5 to 30, 7.5 to 22.5, 9 to 18, or about 15 mgs of RAD001.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, once per week, in a sustained release dosage form, about 15 mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in a sustained release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per week, sustained release dosage form of 0.3 to 60, 1.5 to 30, 7.5 to 22.5, 9 to 18, or about 15 mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, once per week, in a sustained release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per week sustained release dosage form of about 15 mgs of RAD001.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per day, e.g., in an immediate release dosage form, 0.005 to 1.5, 0.01 to 1.5, 0.1 to 1.5, 0.2 to 1.5, 0.3 to 1.5, 0.4 to 1.5, 0.5 to 1.5, 0.6 to 1.5, 0.7 to 1.5, 0.8 to 1.5, 1.0 to 1.5, 0.3 to 0.6, or about 0.5 mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering once per day, in an immediate release dosage form, about 0.5 mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per day, e.g., in an immediate release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per day, immediate release dosage form of 0.005 to 1.5, 0.01 to 1.5, 0.1 to 1.5, 0.2 to 1.5, 0.3 to 1.5, 0.4 to 1.5, 0.5 to 1.5, 0.6 to 1.5, 0.7 to 1.5, 0.8 to 1.5, 1.0 to 1.5, 0.3 to 0.6, or about 0.5 mgs of RADOOl.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, once per day, in an immediate release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per day, immediate release dosage form of about 0.5 mgs of RAD001.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per day, e.g., in a sustained release dosage form, 0.015 to 4.5, 0.03 to 4.5, 0.3 to 4.5, 0.6 to 4.5, 0.9 to 4.5, 1.2 to 4.5, 1.5 to 4.5, 1.8 to 4.5,
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per day, e.g., in a sustained release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per day, sustained release dosage form of 0.015 to 4.5, 0.03 to 4.5, 0.3 to 4.5, 0.6 to 4.5, 0.9 to 4.5,
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in a sustained release dosage form, 0.1 to 30, 0.2 to 30, 2 to 30, 4 to 30, 6 to 30, 8 to 30, 10 to 30, 1.2 to 30, 14 to 30, 16 to 30, 20 to 30, 6 to 12, or about 10 mgs of RAD001.
  • administering to the subject a low, immune enhancing, dose of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in a sustained release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per week, sustained release dosage form of 0.1 to 30, 0.2 to 30, 2 to 30, 4 to 30, 6 to 30, 8 to 30, 10 to 30, 1.2 to 30, 14 to 30, 16 to 30, 20 to 30, 6 to 12, or about 10 mgs of RAD001.
  • the mTOR inhibitor is RAD001 and the dose provides for a trough level of RAD001 in a range of between about 0.1 and 3 ng/ml, between 0.3 or less and 3 ng/ml, or between 0.3 or less and 1 ng/ml.
  • the mTOR inhibitor is other than RAD001 and the dose is bioequivalent to a dose of RAD001 that provides for a trough level of RAD001 in a range of between about 0.1 and 3 ng/ml, between 0.3 or less and 3 ng/ml, or between 0.3 or less and 1 ng/ml.
  • the subject has cancer and the method comprises promoting the subject's immune response to the cancer.
  • the subject was selected on the basis of having cancer.
  • a cell of the cancer expresses PD-Ll or PD-L2.
  • a cell in the cancer microenvironment expresses PD-Ll or PD-L2.
  • the cancer comprises a solid tumor.
  • the cancer is a hematological cancer.
  • the cancer is a leukemia.
  • the cancer is a chronic lymphocytic leukemia (CLL).
  • the cancer is CLL and wherein the antigen binding domain of the CAR targets CD 19.
  • the cancer is melanoma.
  • the method further comprises administering an additional treatment, e.g., a chemotherapeutic, radiation, a cellular thereapy, bone marrow transplant to the subject.
  • the method further comprises administering an additional treatment that kills T cells, e.g., radiation or cytotoxic chemotherapy.
  • the method further comprises administering to the subject an mTOR pathway inhibitor, such as vitamin E, vitamin A, an antibacterial antibiotic, an antioxidant, L- carnitine, lipoic acid, metformin, resveratrol, leptine, a non-steroid anti- inflammatory drug, or a COX inhibitor.
  • an additional treatment e.g., a chemotherapeutic, radiation, a cellular thereapy, bone marrow transplant
  • the method further comprises administering an additional treatment that kills T cells, e.g., radiation or cytotoxic chemotherapy.
  • the method further comprises administering to the subject an mTOR pathway inhibitor, such as vitamin E, vitamin A, an antibacterial antibiotic, an antioxidant, L
  • the method further comprises administering metformin to the subject.
  • the low, immune enhancing, dose of mTOR inhibitor is administered prior to or after the initiation of the additional treatment.
  • the method further comprises administering an additional treatment for the cancer.
  • the subject is immunocompromised.
  • the subject is HIV+ or has AIDs.
  • the subject has an infectious disease.
  • the subject has an impaired immune response.
  • the subject is immunoscenescent.
  • the subject has an age related condition.
  • the method of treating, e.g., promoting an immune response in, a subject further comprises, enhancing an immune response to an antigen in the subject.
  • the method further comprises administering the antigen or a vaccine to the subject.
  • the method prior to the step of administering a low, immune enhancing, dose of an mTOR inhibitor, the method comprises a step of identifying a subject having an impaired immune response to an antigen.
  • the immune effector cell e.g., T cell or NK cell, engineered to express a CAR
  • a CAR is a cell described herein, e.g., a human T cell or a human NK cell, e.g., a human T cell described herein or a human NK cell described herein.
  • the human T cell is a CD8+ T cell.
  • the immune effector cell e.g., T cell or NK cell, engineered to express a CAR
  • the immune effector cell can further express another agent, e.g., an agent which enhances the activity of a CAR-expressing cell.
  • the agent can be an agent which inhibits an inhibitory molecule.
  • inhibitory molecules include PD-1, PD-Ll, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3 and/or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFR beta, e.g., as described herein.
  • CEACAM e.g., CEACAM-1, CEACAM-3 and/or CEACAM-5
  • LAG3, VISTA e.g., VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF
  • the agent which inhibits an inhibitory molecule comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein.
  • the agent comprises a first polypeptide, e.g., of an inhibitory molecule such as PD-1, PD-Ll, PD-L2, CEACAM (e.g., CEACAM-1, CEACAM-3 and/or CEACAM-5), LAG3, CTLA4, VISTA, CD160, BTLA, LAIR1, TIM3, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TIGIT, or a fragment of any of these, and a second polypeptide which is an intracellular signaling domain described herein (e.g., comprising a costimulatory domain (e.g., 4- IBB, CD27, ICOS, or CD28, e.g., as described herein) and/or a primary signaling domain (e.g.
  • the agent comprises a first polypeptide of PD-1 or a fragment thereof, and a second polypeptide of an intracellular signaling domain described herein (e.g., a CD28, CD27, OX40, ICOS, or 4-IBB signaling domain described herein and/or a CD3 zeta signaling domain described herein).
  • the intracellular signaling domain of the isolated CAR molecule comprises a costimulatory domain.
  • the intracellular signaling domain of the isolated CAR molecule comprises a primary signaling domain.
  • the intracellular signaling domain of the isolated CAR molecule comprises a costimulatory domain and a primary signaling domain.
  • the costimulatory domain comprises a functional signaling domain of a protein selected from the group consisting of MHC class I molecule, TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SLAM proteins), activating NK cell receptors, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CDl la/CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R
  • a protein selected from
  • the costimulatory domain comprises 4-1BB, CD27, CD28, or ICOS. In one embodiment, the costimulatory domain comprises a sequence of SEQ ID NO: 14.
  • the costimulatory domain comprises an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 20, 10 or 5 modifications (e.g., substitutions) of an amino acid sequence of SEQ ID NO: 14, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 14.
  • the primary signaling domain comprises a functional signaling domain of CD3 zeta.
  • the functional signaling domain of CD3 zeta comprises SEQ ID NO: 18 or SEQ ID NO: 20.
  • the immune effector cell e.g., T cell or NK cell, engineered to express a CAR
  • a CAR can further express one or more CARs (e.g., a T cell contains two or more CARs).
  • an immune effector cell (e.g., T cell, NK cell) of the present invention comprises a first CAR comprising an antigen binding domain that binds to a tumor marker as described herein, and a second CAR comprising a PD1 extracellular domain or a fragment thereof.
  • the method further comprises administering the immune effector cell, e.g., T cell, engineered to express a CAR, in combination with another agent (in addition to the low, immune enhancing, dose of an mTOR inhibititor).
  • the agent can be a kinase inhibitor, e.g., a CDK4/6 inibitor, a BTK inhibitor, an mTOR inhibitor (administered, e.g., at a dose that is higher than the low, immune enhancing dose discussed elsewhere herein, e.g., a dose that provides an anti-cancer effect), a MNK inhibitor, or a dual mTOR/P13K kinase inhibitor, and combinations thereof).
  • a kinase inhibitor e.g., a CDK4/6 inibitor, a BTK inhibitor
  • an mTOR inhibitor administered, e.g., at a dose that is higher than the low, immune enhancing dose discussed elsewhere herein, e.g., a dose
  • the method comprises providing an anti-tumor immunity in a mammal.
  • the cell is an autologous T cell or an autologous NK cell.
  • the cell is an allogeneic T cell or an allogeneic NK cell.
  • the mammal is a human.
  • the method comprises treating a mammal having a disease associated with expression of a cancer associated antigen or tumor marker.
  • the method comprises administering an agent that increases the efficacy of the immune effector cell, e.g., T cell or NK cell, engineered to express a CAR, e.g., an agent described herein.
  • an agent that increases the efficacy of the immune effector cell e.g., T cell or NK cell
  • a CAR e.g., an agent described herein.
  • the method comprises administering agent that ameliorates one or more side effect associated with administration of a cell expressing a CAR molecule the immune effector cell, e.g., T cell or NK cell, engineered to express a CAR, e.g., an agent described herein.
  • a CAR e.g., an agent described herein.
  • the method comprises administering an agent that treats the disease associated with a cancer associated antigen as described herein, e.g., an agent described herein.
  • the immune effector cell e.g., T cell or NK cell, engineered to express a CAR, expresses two or more CAR molecules and, e.g., is administered to a subject in need thereof to treat cancer.
  • the immune effector cell e.g., T cell or NK cell, engineered to express a CAR, is administered at a dose and/or dosing schedule described herein.
  • the CAR molecule is introduced into immune effector cells (e.g., T cells, NK cells), e.g., using in vitro transcription, and the subject (e.g., human) receives an initial administration of cells comprising a CAR molecule, and one or more subsequent administrations of cells comprising a CAR molecule, wherein the one or more subsequent administrations are administered less than 15 days, e.g., 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 days after the previous administration.
  • immune effector cells e.g., T cells, NK cells
  • the subject e.g., human
  • more than one administration of cells comprising a CAR molecule are administered to the subject (e.g., human) per week, e.g., 2, 3, or 4 administrations of cells comprising a CAR molecule are administered per week.
  • the subject e.g., human subject
  • receives more than one administration of cells comprising a CAR molecule per week e.g., 2, 3 or 4 administrations per week
  • one or more additional administration of cells comprising a CAR molecule e.g., more than one administration of the cells comprising a CAR molecule per week
  • the subject receives more than one cycle of cells comprising a CAR molecule, and the time between each cycle is less than 10, 9, 8, 7, 6, 5, 4, or 3 days.
  • the cells comprising a CAR molecule are administered every other day for 3 administrations per week.
  • the cells comprising a CAR molecule are administered for at least two, three, four, five, six, seven, eight or more weeks.
  • the immune effector cell e.g., T cell or NK cell, engineered to express a CAR, e.g., a CAR molecule described herein
  • a first line treatment for the disease e.g., the cancer, e.g., the cancer described herein.
  • the immune effector cell, e.g., T cell, engineered to express a CAR, e.g., a CAR molecule described herein are administered as a second, third, fourth line treatment for the disease, e.g., the cancer, e.g., the cancer described herein.
  • a population of cells described herein is administered.
  • the low, immune enhancing, dose of an mTOR inhibitor (e.g., RAD001 or rapamycin) and the immune effector cell, e.g., a T cell, engineered to express a CAR are present in a single composition, e.g., are administered as a single composition.
  • the low, immune enhancing, dose of an mTOR inhibitor (e.g., RAD001 or rapamycin) and the immune effector cell, e.g., a T cell, engineered to express a CAR are present in separate compositions, e.g., are administered as separate compositions.
  • the invention pertains to the isolated nucleic acid molecule encoding a CAR of the invention, the isolated polypeptide molecule of a CAR of the invention, the vector comprising a CAR of the invention, a formulation of a low, immune enhancing dose, of an mTOR inhibitor, and the cell comprising a CAR of the invention for use as a medicament.
  • the invention pertains to the isolated nucleic acid molecule encoding a CAR of the invention, the isolated polypeptide molecule of a CAR of the invention, the vector comprising a CAR of the invention, a formulation of a low, immune enhancing, dose of an mTOR inhibitor, and the cell comprising a CAR of the invention for use in the treatment of a disease expressing a cancer associated antigen as described herein.
  • the disclosure provides an mTOR inhibitor for use in the treatment of a subject, wherein said mTOR inhibitor enhances an immune response of said subject, and wherein said subject has received, is receiving or is about to receive an immune effector cell engineered to express a CAR.
  • the mTOR inhibitor is at a low, immune- enhancing dose. In some embodiments, the mTOR inhibitor is administered at a low, immune- enhancing dose.
  • the disclosure provides an immune effector cell engineered to express a CAR for use in the treatment of a subject, wherein said subject has received, is receiving, or is about to receive, an mTOR inhibitor that enhances an immune response of said subject.
  • the mTOR inhibitor is at a low, immune -enhancing dose. In some embodiments, the mTOR inhibitor is administered at a low, immune-enhancing dose.
  • the isolated nucleic acid molecule further comprises a sequence encoding a costimulatory domain, e.g., a costimulatory domain described herein.
  • a costimulatory domain e.g., a costimulatory domain described herein.
  • the intracellular signaling domain comprises a costimulatory domain. In embodiments, the intracellular signaling domain comprises a primary signaling domain. In embodiments, the intracellular signaling domain comprises a costimulatory domain and a primary signaling domain.
  • the encoded costimulatory domain is a functional signaling domain obtained from a protein, e.g., described herein, e.g., selected from the group consisting of MHC class I molecule, TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SLAM proteins), activating NK cell receptors, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CDl la/CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD 19, CD4, CD8alpha, CD8beta,
  • a protein e
  • the encoded costimulatory domain comprises 4-1BB, CD27, CD28, or ICOS.
  • the encoded costimulatory domain of 4- IBB comprises the sequence of SEQ ID NO: 14.
  • the encoded costimulatory domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 14, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 14.
  • the nucleic acid sequence encoding the costimulatory domain comprises the nucleotide sequence of SEQ ID NO: 15, or a sequence with 95-99% identity thereof.
  • the encoded costimulatory domain of CD28 comprises the amino acid sequence of SEQ ID NO:91.
  • the encoded costimulatory domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO:91, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO:91.
  • the nucleic acid sequence encoding the costimulatory domain of CD28 comprises the nucleotide sequence of SEQ ID NO:92, or a sequence with 95- 99% identity thereof.
  • the encoded co stimulatory domain of CD27 comprises the amino acid sequence of SEQ ID NO: 16.
  • the encoded costimulatory domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 16, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 16.
  • the nucleic acid sequence encoding the costimulatory domain of CD27 comprises the nucleotide sequence of SEQ ID NO: 17, or a sequence with 95-99% identity thereof.
  • the encoded costimulatory domain of ICOS comprises the amino acid sequence of SEQ ID NO:93.
  • the encoded costimulatory domain of ICOS comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO:93, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO:93.
  • the nucleic acid sequence encoding the costimulatory domain of ICOS comprises the nucleotide sequence of SEQ ID NO:94, or a sequence with 95-99% identity thereof.
  • the encoded primary signaling domain comprises a functional signaling domain of CD3 zeta.
  • the functional signaling domain of CD3 zeta comprises the sequence of SEQ ID NO: 18 (mutant CD3 zeta) or SEQ ID NO: 20 (wild type human CD3 zeta), or a sequence with 95-99% identity thereof.
  • the intracellular signaling domain comprises a functional signaling domain of CD27 and/or a functional signaling domain of CD3 zeta.
  • the intracellular signaling domain comprises a functional signaling domain of CD28 and/or a functional signaling domain of CD3 zeta. In one embodiment, the intracellular signaling domain comprises a functional signaling domain of ICOS and/or a functional signaling domain of CD3 zeta. In one embodiment, the intracellular signaling domain comprises a functional signaling domain of 4- IBB and/or a functional signaling domain of CD3 zeta.
  • the invention includes a population of autologous cells that are transfected or transduced with a vector comprising a nucleic acid molecule encoding a CAR molecule, e.g., as described herein.
  • the vector is a retroviral vector.
  • the vector is a self-inactivating lentiviral vector as described elsewhere herein.
  • the vector is delivered (e.g., by transfecting or electroporating) to a cell, e.g., a T cell or a NK cell, wherein the vector comprises a nucleic acid molecule encoding a CAR of the present invention as described herein, which is transcribed as an mRNA molecule, and the CARs of the present invention is translated from the RNA molecule and expressed on the surface of the cell.
  • a cell e.g., a T cell or a NK cell
  • the vector comprises a nucleic acid molecule encoding a CAR of the present invention as described herein, which is transcribed as an mRNA molecule, and the CARs of the present invention is translated from the RNA molecule and expressed on the surface of the cell.
  • the present invention provides a population of CAR-expressing cells, e.g., CAR-expressing T cells (CART cells) or CAR-expressing NK cells.
  • the population of CAR-expressing cells comprises a mixture of cells expressing different CARs.
  • the population of CAR-expressing cells can include a first cell expressing a CAR having an antigen binding domain that binds to a first tumor marker as described herein, and a second cell expressing a CAR having a different antigen binding domain that binds to a second tumor marker as described herein.
  • the population of CAR-expressing cells can include a first cell expressing a CAR that includes an antigen binding domain that binds to a tumor marker as described herein, and a second cell expressing a CAR that includes an antigen binding domain to a target other than a tumor marker as described herein.
  • the population of CAR-expressing cells includes, e.g., a first cell expressing a CAR that includes a primary intracellular signaling domain, and a second cell expressing a CAR that includes a secondary signaling domain.
  • the present invention provides a population of cells wherein at least one cell in the population expresses a CAR having an antigen binding domain that binds to a tumor marker as described herein, and a second cell expressing another agent, e.g., an agent which enhances the activity of a CAR-expressing cell.
  • the agent can be an agent which inhibits an inhibitory molecule.
  • inhibitory molecules include PD-1, PD-L1, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3 and/or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFR beta.
  • CEACAM e.g., CEACAM-1, CEACAM-3 and/or CEACAM-5
  • LAG3, VISTA e.g., VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR
  • the agent which inhibits an inhibitory molecule is a molecule described herein, e.g., an agent that comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein.
  • the agent comprises a first polypeptide, e.g., of an inhibitory molecule such as PD- 1, PD-L1, PD-L2, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3 and/or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFR beta, or a fragment of any of these, and a second polypeptide which is an intracellular signaling domain described herein (e.g., comprising a costimulatory domain (e.g., 4- IBB, ICOS, CD27, or CD28, e.g., as described herein) and/or a primary signaling domain (
  • the agent comprises a first polypeptide of PD-1 or a fragment thereof, and a second polypeptide of an intracellular signaling domain described herein (e.g., a CD28, CD27, ICOS, OX40 or 4- IBB signaling domain described herein and/or a CD3 zeta signaling domain described herein).
  • a second polypeptide of an intracellular signaling domain described herein e.g., a CD28, CD27, ICOS, OX40 or 4- IBB signaling domain described herein and/or a CD3 zeta signaling domain described herein.
  • the nucleic acid molecule encoding a CAR of the present invention is expressed as an mRNA molecule.
  • the genetically modified CAR of the present invention-expressing cells e.g., immune effector cells (e.g., T cells, NK cells)
  • a CAR of the present invention molecule is translated from the RNA molecule once it is incorporated and expressed on the surface of the recombinant cell.
  • the present invention also provides a method of making an immune effector cell, e.g., a T cell, having disposed therein a nucleic acid encoding a CAR, comprising: a) providing an immune effector cell, e.g., a T cell, made by: i) administering to a subject a low, immune enhancing dose, of an mTOR inhibitor, e.g., RAD001, or rapamycin, for an amount of time sufficient
  • an mTOR inhibitor e.g., RAD001, or rapamycin
  • PD-1 negative immune effector cells e.g., T cells/ PD-1 positive immune effector cells, e.g., T cells;
  • Id an increase in the number of naive T cells; le) an increase in the expression of one or more of the following markers:
  • KLRG1 a decrease in the expression of KLRG1, e.g., on memory T cells, e.g., memory T cell precursors;
  • lg an increase in the number of memory T cell precursors, e.g., cells with any one or combination of the following characteristics: increased CD62L hlgh , increased CD127 high , increased CD27 + , decreased KLRG1, and increased BCL2;
  • lg occurs e.g., at least transiently, e.g., as compared to a non-treated subject, in the subject or in a preparation of immune effector cells, e.g., T cells, collected from the subject; and
  • providing an immune effector cell comprises one or both of: administering to a subject a low, immune enhancing dose, of an mTOR inhibitor, e.g., RAD001, or rapamycin, for an amount of time sufficient
  • an mTOR inhibitor e.g., RAD001, or rapamycin
  • PD-1 negative immune effector cells e.g., T cells/ PD-1 positive immune effector cells, e.g., T cells;
  • an increase in the number of memory T cell precursors e.g., cells with any one or combination of the following characteristics: increased CD62L hlgh , increased
  • CD127 high increased CD27 + , decreased KLRG1, and increased BCL2;
  • a), b), c), d), e), f) or g) occurs e.g., at least transiently, e.g., as compared to a non- treated subject, in the subject or in a preparation of immune effector cells, e.g., T cells, collected from the subject; and collecting an immune effector cell, e.g., a T cell, from the subject.
  • immune effector cells e.g., T cells
  • the present invention also provides a method of making an immune effector cell, which is optionally at T cell, having disposed therein a nucleic acid encoding a CAR, comprising: a) contacting an immune effector cell, which is optionally a T cell, with an mTOR
  • an immune effector cell which is optionally a T cell, having disposed therein a nucleic acid encoding a CAR,
  • step a) occurs prior to, concurrently with, or after said inserting of step b);
  • mTOR inhibitor causes one or more of the following to occur:
  • Id an increase in the number of naive T cells
  • the CAR comprises an antigen binding domain (e.g., antibody or antibody fragment, TCR or TCR fragment) a transmembrane domain, and an intracellular signaling domain (e.g., an intracellular signaling domain comprising a costimulatory domain and/or a primary signaling domain).
  • an antigen binding domain e.g., antibody or antibody fragment, TCR or TCR fragment
  • an intracellular signaling domain e.g., an intracellular signaling domain comprising a costimulatory domain and/or a primary signaling domain.
  • the antigen binding domain binds a tumor marker.
  • the tumor marker is a solid tumor marker.
  • the method of making an immune effector cell further comprises introducing the immune effector cell, e.g., a T cell or a NK cell, having disposed therein a nucleic acid encoding a CAR, into a subject, e.g., the subject from which the immune effector cells were derived from a different subject.
  • the subject is the subject from which the immune effector cells were derived.
  • the subject is a different subject.
  • the immune effector cells are T cells.
  • the immune effector cells are NK cells.
  • the method further comprises evaluating the level of PD1 negative or PD1 positive immune effector cells, e.g., T cells, in the subject or in T cells taken from the subject.
  • PD1 negative or PD1 positive immune effector cells e.g., T cells
  • the method of making disclosed herein further comprises contacting the population of immune effector cells with a nucleic acid encoding a telomerase subunit, e.g., hTERT.
  • the nucleic acid encoding the telomerase subunit can be DNA.
  • the method of making disclosed herein further comprises culturing the population of immune effector cells in serum comprising 2% hAB serum.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor is initiated at least 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 days prior to collection of T cells.
  • the administering to a subject a low, immune enhancing dose, of an mTOR inhibitor results in the partial, but not total, inhibition of mTOR for at least at least 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 days prior to collection of immune effector cells, e.g., T cells, from the subject.
  • the mTOR inhibitor is an allosteric mTOR inhibitor.
  • the mTOR inhibitor is a RAD001.
  • the mTOR inhibitor is rapamycin.
  • the mTOR inhibitor is a catalytic inhibitor, e.g., a kinase inhibitor.
  • the kinase inhibitor is selective for mTOR.
  • the kinase inhibitor is selected from BEZ235 and CCG168.
  • the method of making an immune effector cell comprises increasing the number of T cells capable of proliferation.
  • the method of making an immune effector cell comprises increasing the number of T cells capable of cytotoxic function, secreting cytokines, or activation.
  • the administering of a low, immune enhancing, dose of an mTOR inhibitor results in the partial, but not total, inhibition of mTOR for at least 1, 5, 10, 20, 30, or 60 days.
  • the dose of an mTOR inhibitor is associated with mTOR inhibition of at least 5% but no more than 90%, e.g., as measured by p70 S6K inhibition.
  • the mTOR inhibitor comprises RAD001.
  • the dose of an mTOR inhibitor is associated with mTOR inhibition of at least 10% but no more than 80%, e.g., as measured by p70 S6K inhibition.
  • the mTOR inhibitor comprises RAD001.
  • the dose of an mTOR inhibitor is associated with mTOR inhibition of at least 10 but no more than 40%, e.g., as measured by p70 S6K inhibition.
  • the mTOR inhibitor comprises RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in an immediate release dosage form, 0.1 to 20, 0.5 to 10, 2.5 to 7.5, 3 to 6, or about 5 mgs of RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, once per week, in an immediate release dosage form, about 5 mgs of RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in an immediate release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per week, immediate release dosage form of 0.1 to 20, 0.5 to 10, 2.5 to 7.5, 3 to 6, or about 5 mgs of RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, once per week, in an immediate release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per week, immediate release dosage form of about 5 mgs of RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in a sustained release dosage form, 0.3 to 60, 1.5 to 30, 7.5 to 22.5, 9 to 18, or about 15 mgs of RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, once per week, in a sustained release dosage form, about 15 mgs of RADOOl.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in a sustained release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per week, sustained release dosage form of 0.3 to 60, 1.5 to 30, 7.5 to 22.5, 9 to 18, or about 15 mgs of RADOOl.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, once per week, in a sustained release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per week, sustained release dosage form of about 15 mgs of RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per day, e.g., in an immediate release dosage form, 0.005 to 1.5, 0.01 to 1.5, 0.1 to 1.5, 0.2 to 1.5, 0.3 to 1.5, 0.4 to 1.5, 0.5 to 1.5, 0.6 to 1.5, 0.7 to 1.5, 0.8 to 1.5, 1.0 to 1.5, 0.3 to 0.6, or about 0.5 mgs of RADOOl.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering once per day, in an immediate release dosage form, about 0.5 mgs of RADOOl.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per day, e.g., in an immediate release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per day, immediate release dosage form of 0.005 to 1.5, 0.01 to 1.5, 0.1 to 1.5, 0.2 to 1.5, 0.3 to 1.5, 0.4 to 1.5, 0.5 to 1.5, 0.6 to 1.5, 0.7 to 1.5, 0.8 to 1.5, 1.0 to 1.5, 0.3 to 0.6, or about 0.5 mgs of RADOOl.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, once per day, in an immediate release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per day, immediate release dosage form of about 0.5 mgs of RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per day, e.g., in a sustained release dosage form, 0.015 to 4.5, 0.03 to 4.5, 0.3 to 4.5, 0.6 to 4.5, 0.9 to 4.5, 1.2 to 4.5, 1.5 to 4.5, 1.8 to 4.5,
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per day, e.g., in a sustained release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per day, sustained release dosage form of 0.015 to 4.5, 0.03 to 4.5, 0.3 to 4.5, 0.6 to 4.5, 0.9 to 4.5,
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in a sustained release dosage form, 0.1 to 30, 0.2 to 30, 2 to 30, 4 to 30, 6 to 30, 8 to 30, 10 to 30, 1.2 to 30, 14 to 30, 16 to 30, 20 to 30, 6 to 12, or about 10 mgs of RAD001.
  • administering to a subject a low, immune enhancing dose, of an mTOR inhibitor comprises administering, e.g., once per week, e.g., in a sustained release dosage form, an amount of an mTOR inhibitor other than RAD001, that is bioequivalent to a once per week sustained release form of 0.1 to 30, 0.2 to 30, 2 to 30, 4 to 30, 6 to 30, 8 to 30, 10 to 30, 1.2 to 30, 14 to 30, 16 to 30, 20 to 30, 6 to 12, or about 10 mgs of RAD001.
  • the mTOR inhibitor is RAD001 and the dose provides for a trough level of RAD001 in a range of between about 0.1 and 3 ng/ml, between 0.3 or less and 3 ng/ml, or between 0.3 or less and 1 ng/ml.
  • the mTOR inhibitor is other than RAD001 and the dose is bioequivalent to a dose of RAD001 that provides for a trough level of RAD001 in a range of between about 0.1 and 3 ng/ml, between 0.3 or less and 3 ng/ml, or between 0.3 or less and 1 ng/ml.
  • the subject has cancer.
  • a cell of the cancer expresses PD-Ll or PD-L2.
  • a cell in the cancer microenvironment expresses PD-Ll or PD-L2.
  • the cancer comprises a solid tumor.
  • the cancer is a hematological cancer.
  • the cancer is chronic lymphocytic leukemia (CLL).
  • the cancer is CLL and the antigen binding domain of the CAR targets CD19.
  • the cancer is selected from a cancer described herein.
  • the cancer is melanoma.
  • the subject is immunocompromised.
  • the subject is HIV+ or has AIDs.
  • the subject has an infectious disease.
  • the subject has an impaired immune response.
  • the subject is immunosenescent.
  • the subjest has an age related condition.
  • a preparation of human immune effector cells e.g., T cells, is also described herein, wherein the preparation of human effector cells has disposed therein a nucleic acid encoding a CAR made by any of the methods described herein.
  • the subject has cancer or is immunocompromised.
  • Headings, sub-headings or numbered or lettered elements e.g., (a), (b), (i) etc, are presented merely for ease of reading.
  • the use of headings or numbered or lettered elements in this document does not require the steps or elements be performed in alphabetical order or that the steps or elements are necessarily discrete from one another.
  • FIG. 1A and IB are graphs showing an increase in titers to influenza vaccine strains as compared to placebo.
  • the increase above baseline in influenza geometric mean titers to each of the 3 influenza vaccine strains H1N1 A/California/ 07/2009, H3N2
  • FIG. 2 shows a scatter plot of RAD001 concentration versus fold increase in geometric mean titer to each influenza vaccine strain 4 weeks after vaccination.
  • RAD001 concentrations (1 hour post dose) were measured after subjects had been dosed for 4 weeks. All subjects who had pharmacokinetic measurements were included in the analysis set.
  • the fold increase in geometric mean titers at 4 weeks post vaccination relative to baseline is shown on the y axis.
  • FIG. 3 is a graphic representation showing increase in titers to heterologous influenza strains as compared to placebo. The increase above baseline in influenza geometric mean titers to 2 heterologous influenza strains (A/H1N1 strain A/New Jersey/8/76 and A/H3N2 strain
  • A/Victoria/361/11) not contained in the influenza vaccine relative to the increase in the placebo cohort 4 weeks after vaccination is shown for each of the RADOOl dosing cohorts in the intention to treat population.
  • FIG. 4A and 4B are graphic representations of IgG and IgM levels before and after influenza vaccination. Levels of anti-A/HlNl/California/07/2009 influenza IgG and IgM were measured in serum obtained from subjects before and 4 weeks post influenza vaccination. No significant difference in the change from baseline to 4 weeks post vaccination in anti-HlNl influenza IgG and IgM levels were detected between the RADOOl and placebo cohorts (all p values > 0.05 by Kruskal-Wallis rank sum test).
  • FIG. 5A, 5B, and 5C are graphic representations of the decrease in percent of PD-1- positive CD4 and CD8 and increase in PD-1 -negative CD4 T cells after RADOOl treatment.
  • the percent of PD-1 -positive CD4, CD8 and PD-1 -negative CD4 T cells was determined by FACS analysis of PBMC samples at baseline, after 6 weeks of study drug treatment (Week 6) and 6 weeks after study drug discontinuation and 4 weeks after influenza vaccination (Week 12).
  • FIG. 5A, 5B, and 5C are graphic representations of the decrease in percent of PD-1- positive CD4 and CD8 and increase in PD-1 -negative CD4 T cells after RADOOl treatment.
  • the percent of PD-1 -positive CD4, CD8 and PD-1 -negative CD4 T cells was determined by FACS analysis of PBMC samples at baseline, after 6 weeks of study drug treatment (Week 6) and 6 weeks after study drug discontinuation and 4 weeks after influenza vaccination (Week 12).
  • FIG. 6A and 6B are graphic representations of the decrease in percent of PD-1- positive CD4 and CD8 and increase in PD-1 -negative CD4 T cells after RAD001 treatment adjusted for differences in baseline PD-1 expression.
  • the percent of PD-1 -positive CD4, CD8 and PD-1 -negative CD4 T cells was determined by FACS analysis of PBMC samples at baseline, after 6 weeks of study drug treatment (Week 6) and 6 weeks after study drug discontinuation and 4 weeks after influenza vaccination (Week 12).
  • FIG. 6A and 6B represent the data in FIG. 5A, 5B, and 5C but with the different RAD001 dosage groups of FIG. 5A, 5B, and 5C pooled into the single
  • FIG. 7 depicts increases in exercise and energy in elderly subjects in response to RAD001.
  • FIG. 8A and 8B depict the predicted effect of RAD001 on P70 S6K activity in cells.
  • FIG. 8A depicts P70 S6 kinase inhibition with higher doses of weekly and daily RAD001;
  • FIG. 8B depicts P70 S6 kinase inhibition with lower doses of weekly RAD001.
  • FIG. 9 indicates that PD1 interaction with PDL-1 is sufficient in causing clustering of PD1 on the Jurkat cell surface and triggers the strong activation of the NFAT pathway.
  • FIG 10 shows that the proliferation of CAR-expressing, transduced T cells is enhanced by low doses of RAD001 in a cell culture system.
  • CARTs were co-cultured with NALM6 (Nalm-6) cells in the presence of different concentrations of RAD001 (nM).
  • the number of CAR-positive CD3-positive T cells black and total T cells (white) was assessed after 4 days of co-culture.
  • Figure 11 depicts tumor growth measurements of NALM6-luc cells with daily RADOOl dosing at 0.3, 1, 3, and 10 mg/kg (mpk) or vehicle dosing.
  • Circles denote the vehicle; squares denote the 10 mg/kg dose of RADOOl; triangles denote the 3 mg/kg dose of RADOOl, inverted triangles denote the 1 mg/kg dose of RADOOl; and diamonds denote the 0.3 mg/kg dose of RADOOl.
  • FIG. 12A and 12B show pharmacokinetic curves showing the amount of RADOOl in the blood of NSG mice with NALM6 tumors.
  • FIG. 12A shows day 0 PK following the first dose of RADOOl.
  • FIG. 12B shows Day 14 PK following the final RADOOl dose.
  • Diamonds denote the 10 mg/kg dose of RADOOl; squares denote the 1 mg/kg dose of RADOOl; triangles denote the 3 mg/kg dose of RADOOl; and x's denote the 10 mg/kg dose of RADOOl.
  • Figures 13A and 13B show in vivo proliferation of humanized CD19 CART cells with and without RADOOl dosing. Low doses of RADOOl (0.003 mg/kg) daily lead to an enhancement in CAR T cell proliferation, above the normal level of huCAR19 proliferation.
  • Figures 13A shows CD4 + CAR T cells;
  • FIG. 13B shows CD8 + CAR T cells.
  • Circles denote PBS; squares denote huCTL019; triangles denote huCTL019 with 3 mg/kg RADOOl; inverted triangles denote huCTL019 with 0.3 mg/kg RADOOl; diamonds denote huCTL019 with 0.03 mg/kg RADOOl; and circles denote huCTL019 with 0.003 mg/kg RADOOl.
  • an element means one element or more than one element.
  • a disorder e.g., a cancer
  • adjuvant refers to a compound that, when used in combination with a specific immunogen, e.g., a vaccine immunogen, in a formulation, augments or otherwise alters, modifies or enhances the resultant immune responses.
  • allogeneic refers to any material derived from a different animal of the same species as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci are not identical. In some aspects, allogeneic material from individuals of the same species may be sufficiently unlike genetically to interact antigenically.
  • anti-cancer effect refers to a biological effect which can be manifested by various means, including but not limited to, e.g., a decrease in tumor volume, a decrease in the number of cancer cells, a decrease in the number of metastases, an increase in life expectancy, decrease in cancer cell proliferation, decrease in cancer cell survival, or amelioration of various physiological symptoms associated with the cancerous condition.
  • An "anti-cancer effect” can also be manifested by the ability of the compounds (e.g., mTOR inhibitors), peptides, polynucleotides, cells and antibodies of the invention in prevention of the occurrence of cancer in the first place.
  • anti-tumor effect refers to a biological effect which can be manifested by various means, including but not limited to, e.g., a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in tumor cell proliferation, or a decrease in tumor cell survival.
  • antibody refers to a protein, or polypeptide sequence derived from an immunoglobulin molecule which specifically binds with an antigen.
  • Antibodies can be polyclonal or monoclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources.
  • Antibodies can be tetramers of immunoglobulin molecules.
  • antibody fragment refers to at least one portion of an intact antibody, or recombinant variants thereof, and refers to the antigen binding domain, e.g., an antigenic determining variable region of an intact antibody, that is sufficient to confer recognition and specific binding of the antibody fragment to a target, such as an antigen.
  • antibody fragments include, but are not limited to, Fab, Fab', F(ab') 2 , Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), a Fd fragment consisting of the VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (either VL or VH), camelid VHH domains, multi- specific molecules formed from antibody fragments such as a bivalent fragment comprising two or more, e.g., two, Fab fragments linked by a disulfide brudge at the hinge region, or two or more, e.g., two isolated CDR or other epitope binding fragments of an antibody linked.
  • An antibody fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005).
  • Antibody fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3)(see U.S. Patent No.: 6,703,199, which describes fibronectin polypeptide minibodies).
  • Fn3 fibronectin type III
  • scFv refers to a fusion protein comprising at least one antibody fragment comprising a variable region of a light chain and at least one antibody fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived.
  • an scFv may have the VL and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH or may comprise VH-linker-VL.
  • CDR complementarity determining region
  • HCDRl heavy chain variable region
  • HCDR2 HCDR3
  • LCDR1, LCDR2, and LCDR3 three CDRs in each light chain variable region
  • the precise amino acid sequence boundaries of a given CDR can be determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme), Al-Lazikani et al., (1997) JMB 273,927-948 (“Chothia” numbering scheme), or a combination thereof.
  • the CDR amino acid residues in the heavy chain variable domain (VH) are numbered 31-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3); and the CDR amino acid residues in the light chain variable domain (VL) are numbered 24-34 (LCDRl), 50-56 (LCDR2), and 89-97 (LCDR3).
  • the CDR amino acids in the VH are numbered 26-32 (HCDR1), 52-56 (HCDR2), and 95-102 (HCDR3); and the CDR amino acid residues in the VL are numbered 26-32 (LCDRl), 50-52 (LCDR2), and 91-96 (LCDR3).
  • the CDRs correspond to the amino acid residues that are part of a Kabat CDR, a Chothia CDR, or both.
  • the CDRs correspond to amino acid residues 26-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3) in a VH, e.g., a mammalian VH, e.g., a human VH; and amino acid residues 24-34 (LCDRl), 50-56 (LCDR2), and 89-97 (LCDR3) in a VL, e.g., a mammalian VL, e.g., a human VL.
  • the portion of the CAR of the invention comprising an antibody or antibody fragment thereof may exist in a variety of forms, for example, where the antigen binding domain is expressed as part of a polypeptide chain including, for example, a single domain antibody fragment (sdAb), a single chain antibody (scFv), or e.g., a humanized antibody, or bispecific antibody (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci.
  • sdAb single domain antibody fragment
  • scFv single chain antibody
  • bispecific antibody Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston e
  • the antigen binding domain of a CAR composition of the invention comprises an antibody fragment.
  • the CAR comprises an antibody fragment that comprises a scFv.
  • the precise amino acid sequence boundaries of a given CDR can be determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD ("Kabat” numbering scheme), Al-Lazikani et al., (1997) JMB 273,927-948 ("Chothia” numbering scheme), or a combination thereof.
  • binding domain refers to a protein, e.g., an immunoglobulin chain or fragment thereof, comprising at least one immunoglobulin variable domain sequence.
  • binding domain or “antibody molecule” encompasses antibodies and antibody fragments.
  • an antibody molecule is a multispecific antibody molecule, e.g., it comprises a plurality of immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope.
  • a multispecific antibody molecule is a bispecific antibody molecule.
  • a bispecific antibody has specificity for no more than two antigens.
  • a bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence which has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.
  • antibody heavy chain refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.
  • antibody light chain refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa ( ⁇ ) and lambda ( ⁇ ) light chains refer to the two major antibody light chain isotypes.
  • antigen refers to a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
  • antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequence or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an "antigen" as that term is used herein.
  • an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a "gene" at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample, or might be macromolecule besides a polypeptide.
  • Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a fluid with other biological components.
  • the term "antigen presenting cell” or “APC” refers to an immune system cell such as an accessory cell (e.g., a B-cell, a dendritic cell, and the like) that displays a foreign antigen complexed with major histocompatibility complexes (MHC's) on its surface.
  • MHC's major histocompatibility complexes
  • T-cells may recognize these complexes using their T-cell receptors (TCRs).
  • APCs process antigens and present them to T-cells.
  • autologous refers to any material derived from the same individual to whom it is later to be re-introduced into the individual.
  • bioequivalent refers to an amount of an agent other than the reference compound (e.g., RAD001), required to produce an effect equivalent to the effect produced by the reference dose or reference amount of the reference compound (e.g., RAD001).
  • the effect is the level of mTOR inhibition, e.g., as measured by P70 S6 kinase inhibition, e.g., as evaluated in an in vivo or in vitro assay, e.g., as measured by an assay described herein, e.g., the Boulay assay, or measurement of phosphorylated S6 levels by western blot.
  • the effect is the alteration of the ratio of PD-1 positive/PD-1 negative T cells, as measured by cell sorting.
  • a bioequivalent amount or dose of an mTOR inhibitor is the amount or dose that achieves the same level of P70 S6 kinase inhibition as does the reference dose or reference amount of a reference compound.
  • a bioequivalent amount or dose of an mTOR inhibitor is the amount or dose that achieves the same level of alteration in the ratio of PD-1 positive/PD-1 negative T cells as does the reference dose or reference amount of a reference compound.
  • CAR Chimeric Antigen Receptor
  • a recombinant polypeptide construct comprising at least an extracellular antigen binding domain, a transmembrane domain and a cytoplasmic signaling domain (also referred to herein as "an intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule as defined below.
  • the domains in the CAR polypeptide construct are in the same polypeptide chain, e.g., comprise a chimeric fusion protein.
  • the domains in the CAR polypeptide construct are not contiguous with each other, e.g., are in different polypeptide chains, e.g., as provided in an RCAR as described herein.
  • the stimulatory molecule of the CAR is the zeta chain associated with the T cell receptor complex.
  • the cytoplasmic signaling domain comprises a primary signaling domain (e.g., a primary signaling domain of CD3-zeta).
  • the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule as defined below.
  • the costimulatory molecule is chosen from 4-1BB (i.e., CD137), CD27 and/or CD28.
  • the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulatory molecule and a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein comprising an
  • the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more co-stimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule.
  • the CAR comprises an optional leader sequence at the amino-terminus (N-ter) of the CAR fusion protein.
  • the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen binding domain, wherein the leader sequence is optionally cleaved from the antigen binding domain (e.g., a scFv) during cellular processing and localization of the CAR to the cellular membrane.
  • a CAR comprises an antigen binding domain.
  • a CAR comprises an extracellular ligand domain specific for a counter ligand.
  • a CAR that comprises an antigen binding domain e.g., a scFv, a single domain antibody, or TCR (e.g., a TCR alpha binding domain or TCR beta binding domain)
  • XCAR a CAR that comprises an antigen binding domain that targets CD 19
  • CD19CAR a CAR that comprises an antigen binding domain that targets CD 19
  • the CAR can be expressed in any cell, e.g., an immune effector cell as described herein (e.g., a T cell or an NK cell).
  • the term "cancer” refers to a disease characterized by the uncontrolled growth of aberrant cells.
  • Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described herein and include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer and the like.
  • a cancer is characterized by expression of a PD-1 ligand, e.g., PD-L1 or PD-L2, on a cancer cell or in a tumor microenvironment.
  • cancer refers to all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness.
  • tumor and cancer are used interchangeably herein, e.g., both terms encompass solid and liquid, e.g., diffuse or circulating, tumors.
  • cancer or “tumor” includes premalignant, as well as malignant cancers and tumors.
  • cancer associated antigen or “tumor marker” interchangeably refers to a molecule (typically protein, carbohydrate or lipid) that is preferentially expressed on the surface of a cancer cell, either entirely or as a fragment (e.g., MHC/peptide), in comparison to a normal cell, and which is useful for the preferential targeting of a pharmacological agent to the cancer cell.
  • a cancer-associated antigen is a cell surface molecule that is overexpressed in a cancer cell in comparison to a normal cell, for instance, 1-fold over expression, 2-fold overexpression, 3-fold overexpression or more in comparison to a normal cell.
  • a cancer-associated antigen is a cell surface molecule that is
  • a cancer- associated antigen will be expressed exclusively on the cell surface of a cancer cell, entirely or as a fragment (e.g., MHC/peptide), and not synthesized or expressed on the surface of a normal cell.
  • CD19 refers to the Cluster of Differentiation 19 protein, which is an antigenic determinant detectable on leukemia precursor cells.
  • the human and murine amino acid and nucleic acid sequences can be found in a public database, such as GenBank, UniProt and Swiss-Prot.
  • the amino acid sequence of human CD 19 can be found as UniProt/Swiss-Prot Accession No. P15391 and the nucleotide sequence encoding of the human CD19 can be found at Accession No. NM_001178098.
  • CD19 includes proteins comprising mutations, e.g., point mutations, fragments, insertions, deletions and splice variants of full length wild-type CD19. CD19 is expressed on most B lineage cancers, including, e.g., acute lymphoblastic leukaemia, chronic lymphocyte leukaemia and non-Hodgkin
  • CD 19 lymphoma.
  • Other cells with express CD 19 are provided below in the definition of "disease associated with expression of CD19.” It is also an early marker of B cell progenitors. See, e.g., Nicholson et al. Mol. Immun. 34 (16-17): 1157-1165 (1997).
  • the antigen-binding portion of the CART recognizes and binds an antigen within the extracellular domain of the CD19 protein.
  • the CD19 protein is expressed on a cancer cell.
  • CD20 refers to an antigenic determinant known to be detectable on B cells.
  • Human CD20 is also called membrane-spanning 4-domains, subfamily A, member 1 (MS4A1).
  • the human and murine amino acid and nucleic acid sequences can be found in a public database, such as GenBank, UniProt and Swiss-Prot.
  • the amino acid sequence of human CD20 can be found at Accession Nos. NP_690605.1 and NP_068769.2
  • the nucleotide sequence encoding transcript variants 1 and 3 of the human CD20 can be found at Accession No. NM_152866.2 and NM_021950.3, respectively.
  • the antigen-binding portion of the CAR recognizes and binds an antigen within the extracellular domain of the CD20 protein.
  • the CD20 protein is expressed on a cancer cell.
  • CD22 refers to an antigenic determinant known to be detectable on leukemia precursor cells.
  • the human and murine amino acid and nucleic acid sequences can be found in a public database, such as GenBank, UniProt and Swiss-Prot.
  • the amino acid sequences of isoforms 1-5 human CD22 can be found at Accession Nos. NP 001762.2, NP 001172028.1, NP 001172029.1, NP 001172030.1, and NP 001265346.1, respectively, and the nucleotide sequence encoding variants 1-5 of the human CD22 can be found at Accession No.
  • the antigen-binding portion of the CAR recognizes and binds an antigen within the extracellular domain of the CD22 protein.
  • the CD22 protein is expressed on a cancer cell.
  • ROR1 refers to an antigenic determinant known to be detectable on leukemia precursor cells.
  • the human and murine amino acid and nucleic acid sequences can be found in a public database, such as GenBank, UniProt and Swiss-Prot.
  • the amino acid sequences of isoforms 1 and 2 precursors of human RORl can be found at Accession Nos. NP_005003.2 and NP_001077061.1, respectively, and the mRNA sequences encoding them can be found at Accession Nos. NM_005012.3 and NM_001083592.1, respectively.
  • the antigen-binding portion of the CAR recognizes and binds an antigen within the extracellular domain of the RORl protein.
  • the RORl protein is expressed on a cancer cell.
  • conservative sequence modifications refers to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody or antibody fragment containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into an antibody or antibody fragment of the invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
  • amino acids with basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid, glutamic acid
  • uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine
  • beta-branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine.
  • one or more amino acid residues within a CAR of the invention can be replaced with other amino acid residues from the same side chain family and the altered CAR can be tested using the functional assays described herein.
  • constitutive promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
  • “Derived from” indicates a relationship between a first and a second molecule. It generally refers to structural similarity between the first molecule and a second molecule and does not connotate or include a process or source limitation on a first molecule that is derived from a second molecule. For example, in the case of an intracellular signaling domain that is derived from a CD3zeta molecule, the intracellular signaling domain retains sufficient CD3zeta structure such that it has the required function, namely, the ability to generate a signal under the appropriate conditions.
  • disease associated with expression of a tumor marker as described herein includes, but is not limited to, a disease associated with a cell that expresses a tumor marker as described herein or condition associated with a cell which expresses, or at any time expressed, a tumor marker as described herein including, e.g., proliferative diseases such as a cancer or malignancy or a precancerous condition such as a myelodysplasia, a myelodysplasia syndrome or a preleukemia; or a noncancer related indication associated with a cell which expresses a tumor marker as described herein.
  • proliferative diseases such as a cancer or malignancy or a precancerous condition such as a myelodysplasia, a myelodysplasia syndrome or a preleukemia
  • a noncancer related indication associated with a cell which expresses a tumor marker as described herein.
  • a cancer associated with expression of a tumor marker as described herein is a hematological cancer.
  • a cancer associated with expression of a tumor marker as described herein is a solid cancer.
  • Further diseases associated with expression of a tumor marker as described herein include, but not limited to, e.g., atypical and/or non-classical cancers, malignancies, precancerous conditions or proliferative diseases associated with expression of a tumor marker as described herein.
  • Non- cancer related indications associated with expression of a tumor marker as described herein include, but are not limited to, e.g., autoimmune disease, (e.g., lupus), inflammatory disorders (allergy and asthma) and transplantation.
  • the phrase "disease associated with expression of CD19" includes, but is not limited to, a disease associated with a cell that expresses CD 19 or condition associated with a cell which expresses, or at any time expressed, CD 19 including, e.g., proliferative diseases such as a cancer or malignancy or a precancerous condition such as a myelodysplasia, a myelodysplasia syndrome or a preleukemia; or a noncancer related indication associated with a cell which expresses CD19.
  • proliferative diseases such as a cancer or malignancy or a precancerous condition such as a myelodysplasia, a myelodysplasia syndrome or a preleukemia
  • a noncancer related indication associated with a cell which expresses CD19.
  • a disease associated with expression of CD19 may include a condition associated with a cell which does not presently express CD 19, e.g., because CD19 expression has been downregulated, e.g., due to treatment with a molecule targeting CD19, e.g., a CD19 CAR, but which at one time expressed CD19.
  • a cancer associated with expression of CD 19 is a hematological cancer.
  • the hematolical cancer is a leukemia or a lymphoma.
  • a cancer associated with expression of CD 19 includes cancers and malignancies including, but not limited to, e.g., one or more acute leukemias including but not limited to, e.g., B-cell acute Lymphoid Leukemia (BALL), T-cell acute Lymphoid Leukemia (TALL), acute lymphoid leukemia (ALL); one or more chronic leukemias including but not limited to, e.g., chronic myelogenous leukemia (CML), Chronic Lymphoid Leukemia (CLL).
  • BALL B-cell acute Lymphoid Leukemia
  • TALL T-cell acute Lymphoid Leukemia
  • ALL acute lymphoid leukemia
  • chronic leukemias including but not limited to, e.g., chronic myelogenous leukemia (CML), Chronic Lymphoid Leukemia (CLL).
  • Additional cancers or hematologic conditions associated with expression of CD19 comprise, but are not limited to, e.g., B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B cell lymphoma, Follicular lymphoma, Hairy cell leukemia, small cell- or a large cell-follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma (MCL), Marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplasia syndrome, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma,
  • B cell prolymphocytic leukemia blastic plasmacytoid dendritic cell neoplasm
  • Burkitt's lymphoma diffuse large B cell lymphoma
  • CD19 expression includes, but not limited to, e.g., atypical and/or non-classical cancers, malignancies, precancerous conditions or proliferative diseases associated with expression of CD19.
  • Non-cancer related indications associated with expression of CD19 include, but are not limited to, e.g., autoimmune disease, (e.g., lupus), inflammatory disorders (allergy and asthma) and transplantation.
  • the tumor antigen-expressing cell expresses, or at any time expressed, mRNA encoding the tumor antigen.
  • the tumor antigen - expressing cell produces the tumor antigen protein (e.g., wild-type or mutant), and the tumor antigen protein may be present at normal levels or reduced levels.
  • the tumor antigen -expressing cell produced detectable levels of a tumor antigen protein at one point, and subsequently produced substantially no detectable tumor antigen protein.
  • an effective amount or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result.
  • the term "encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
  • a gene, cDNA, or RNA encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
  • Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
  • endogenous refers to any material from or produced inside an organism, cell, tissue or system.
  • exogenous refers to any material introduced from or produced outside an organism, cell, tissue or system.
  • expression refers to the transcription and/or translation of a particular nucleotide sequence driven by a promoter.
  • expression vector refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
  • Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
  • flexible polypeptide linker or "linker” as used in the context of a scFv refers to a peptide linker that consists of amino acids such as glycine and/or serine residues used alone or in combination, to link variable heavy and variable light chain regions together.
  • the flexible polypeptide linkers include, but are not limited to, (Gly 4 Ser)4 (SEQ ID NO:29) or (Gly 4 Ser) 3 (SEQ ID NO:30).
  • the linkers include multiple repeats of (Gly 2 Ser), (GlySer) or (Gly 3 Ser) (SEQ ID NO:31). Also included within the scope of the invention are linkers described in WO2012/138475 (incorporated herein by reference). [00187] "Fully human” refers to an immunoglobulin, such as an antibody or antibody fragment, where the whole molecule is of human origin or consists of an amino acid sequence identical to a human form of the antibody or immunoglobulin.
  • homologous refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules.
  • two nucleic acid molecules such as, two DNA molecules or two RNA molecules
  • polypeptide molecules between two polypeptide molecules.
  • a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous or identical at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric
  • immunoglobulins immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies and antibody fragments thereof are human immunoglobulins (recipient antibody or antibody fragment) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity.
  • CDR complementary-determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity, and capacity.
  • Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • a humanized antibody/antibody fragment can comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications can further refine and optimize antibody or antibody fragment performance.
  • the humanized antibody or antibody fragment thereof will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or a significant portion of the FR regions are those of a human immunoglobulin sequence.
  • the humanized antibody or antibody fragment can also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • Immuno effector cell refers to a cell that is involved in an immune response, e.g., in the promotion of an immune effector response.
  • immune effector cells include T cells, e.g., alpha/beta T cells and gamma/delta T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloic-derived phagocytes.
  • Immuno effector function or immune effector response refers to function or response, e.g., of an immune effector cell, that enhances or promotes an immune attack of a target cell.
  • an immune effector function or response refers a property of a T or NK cell that promotes killing or the inhibition of growth or proliferation, of a target cell.
  • primary stimulation and co- stimulation are examples of immune effector function or response.
  • effector function refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines.
  • immunosenescence refers to a decrease in immune function resulting in impaired immune response, e.g., to cancer, vaccination, infectious pathogens, among others. It involves both the host's capacity to respond to infections and the development of long-term immune memory, especially by vaccination. This immune deficiency is ubiquitous and found in both long- and short-lived species as a function of their age relative to life expectancy rather than chronological time. It is considered a major contributory factor to the increased frequency of morbidity and mortality among the elderly. Immunosenescence is not a random deteriorative phenomenon, rather it appears to inversely repeat an evolutionary pattern and most of the parameters affected by immunosenescence appear to be under genetic control.
  • Immunosenescence can also be sometimes envisaged as the result of the continuous challenge of the unavoidable exposure to a variety of antigens such as viruses and bacteria.
  • Immunosenescence is a multifactorial condition leading to many pathologically significant health problems, e.g., in the aged population.
  • Age-dependent biological changes such as depletion of hematopoietic stem cells, decline in the total number of phagocytes and NK cells and a decline in humoral immunity contribute to the onset of immunosenescence.
  • immunosenescence can be measured in an individual by measuring telomere length in immune cells (See, e.g., US5741677). Immunosenescence can also be determined by documenting in an individual a lower than normal number of naive CD4 and/or CD8 T cells, T cell repertoire, or response to vaccination in a subject greater than or equal to 65 years of age.
  • the term "impaired immune response" refers to a state in which a subject does not have an appropriate immune response, e.g., to cancer, vaccination, pathogen infection, among others.
  • a subject having an impaired immune response is predicted not to get protective antibody titer levels following prophylactic vaccination, or in which a subject does not have a decrease in disease burden after therapeutic vaccination.
  • a subject can also have an impaired immune response if the subject is a member of a population known to have decreased immune function or that has a history of decreased immune function such as the elderly, subjects undergoing chemotherapy treatment, asplenic subjects, immunocompromised subjects, or subjects having HIV/AIDS.
  • Methods described herein allow for the treatment of an impaired immune response by administration of a low, immune enhancing, dose of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, such as RAD001.
  • inducible promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
  • intracellular signaling domain refers to an intracellular portion of a molecule.
  • the intracellular signal domain transduces the effector function signal and directs the cell to perform a specialized function. While the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal.
  • intracellular signaling domain is thus meant to include any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.
  • the intracellular signaling domain can comprise a primary intracellular signaling domain.
  • Exemplary primary intracellular signaling domains include those derived from the molecules responsible for primary stimulation, or antigen dependent simulation.
  • the intracellular signaling domain can comprise a costimulatory intracellular domain.
  • Exemplary costimulatory intracellular signaling domains include those derived from molecules responsible for costimulatory signals, or antigen independent stimulation.
  • a primary intracellular signaling domain can comprise a cytoplasmic sequence of a T cell receptor
  • a costimulatory intracellular signaling domain can comprise cytoplasmic sequence from co-receptor or costimulatory molecule.
  • a primary intracellular signaling domain can comprise a signaling motif which is known as an immunoreceptor tyrosine-based activation motif or IT AM.
  • ⁇ containing primary cytoplasmic signaling sequences include, but are not limited to, those derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), FcsRI, and CD66d.
  • Further examples of molecules containing a primary intracellular signaling domain that are of particular use in the invention include those of DAP10, DAP 12, and CD32.
  • zeta or alternatively “zeta chain”, “CD3-zeta” or “TCR-zeta” is defined as the protein provided as GenBan Acc. No. BAG36664.1, or the equivalent residues from a non- human species, e.g., mouse, rodent, monkey, ape and the like, and a "zeta stimulatory domain” or alternatively a "CD3-zeta stimulatory domain” or a “TCR-zeta stimulatory domain” is defined as the amino acid residues from the cytoplasmic domain of the zeta chain that are sufficient to functionally transmit an initial signal necessary for T cell activation.
  • the cytoplasmic domain of zeta comprises residues 52 through 164 of GenBank Acc. No.
  • the "zeta stimulatory domain” or a "CD3-zeta stimulatory domain” is the sequence provided as SEQ ID NO:18. In one aspect, the "zeta stimulatory domain” or a “CD3-zeta stimulatory domain” is the sequence provided as SEQ ID NO:20.
  • costimulatory molecule refers to the cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation.
  • Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response.
  • Costimulatory molecules include, but are not limited to an MHC class I molecule, TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SLAM proteins), activating NK cell receptors, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1
  • CDl la/CD18 4-lBB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CDl ld, ITGAE, CD103, ITGAL, CDl la, LFA-1, ITGAM, CDl lb, ITGAX, CDl lc, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE/RANKL, DNAM1 (CD226),
  • a costimulatory intracellular signaling domain refers to the intracellular portion of a costimulatory molecule.
  • the intracellular signaling domain can comprise the entire intracellular portion, or the entire native intracellular signaling domain, of the molecule from which it is derived, or a functional fragment thereof.
  • the term "4- IBB” refers to a member of the TNFR superfamily with an amino acid sequence provided as GenBank Acc. No. AAA62478.2, or the equivalent residues from a non- human species, e.g., mouse, rodent, monkey, ape and the like; and a "4-lBB costimulatory domain” is defined as amino acid residues 214-255 of GenBank accno. AAA62478.2, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like.
  • the "4-lBB costimulatory domain” is the sequence provided as SEQ ID NO: 14 or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like.
  • in vitro transcribed RNA refers to RNA, preferably mRNA, that has been synthesized in vitro. Generally, the in vitro transcribed RNA is generated from an in vitro transcription vector. The in vitro transcription vector comprises a template that is used to generate the in vitro transcribed RNA. [00205] The term “isolated” means altered or removed from the natural state.
  • nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
  • An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • A refers to adenosine
  • C refers to cytosine
  • G refers to guanosine
  • T refers to thymidine
  • U refers to uridine.
  • lentivirus refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses.
  • lentiviral vector refers to a vector derived from at least a portion of a lentivirus genome, including especially a self-inactivating lentiviral vector as provided in Milone et al., Mol. Ther. 17(8): 1453-1464 (2009).
  • Other examples of lentivirus vectors that may be used in the clinic include but are not limited to, e.g., the LENTIVECTOR® gene delivery technology from Oxford BioMedica, the LENTIMAXTM vector system from Lentigen and the like. Nonclinical types of lentiviral vectors are also available and would be known to one skilled in the art.
  • the term 'low, immune enhancing, dose when used in conjuction with an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., RAD001 or rapamycin, or a catalytic mTOR inhibitor, refers to a dose of mTOR inhibitor that partially, but not fully, inhibits mTOR activity, e.g., as measured by the inhibition of P70 S6 kinase activity. Methods for evaluating mTOR activity, e.g., by inhibition of P70 S6 kinase, are discussed herein. The dose is insufficient to result in complete immune suppression but is sufficient to enhance the immune response.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., RAD001 or rapamycin, or a catalytic mTOR inhibitor.
  • the low, immune enhancing, dose of mTOR inhibitor results in a decrease in the number of PD-1 positive T cells and/or an increase in the number of PD-1 negative T cells, or an increase in the ratio of PD-1 negative T cells/PD-1 positive T cells.
  • the low, immune enhancing, dose of mTOR inhibitor results in an increase in the number of naive T cells.
  • the low, immune enhancing, dose of mTOR inhibitor results in one or more of the following: an increase in the expression of one or more of the following markers: CD62L hlgh , CD127 high , CD27 + , and BCL2, e.g., on memory T cells, e.g., memory T cell precursors;
  • KLRG1 a decrease in the expression of KLRG1, e.g., on memory T cells, e.g., memory T cell precursors;
  • an increase in the number of memory T cell precursors e.g., cells with any one or combination of the following characteristics: increased CD62L hlgh , increased CD127 hlgh , increased CD27 + , decreased KLRG1, and increased BCL2;
  • any of the changes described above occurs, e.g., at least transiently, e.g., as compared to a non-treated subject.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 5 but no more than 90%, at least 10 but no more than 90%, at least 15, but no more than 90%, at least 20 but no more than 90%, at least 30 but no more than 90%, at least 40 but no more than 90%, at least 50 but no more than 90%, at least 60 but no more than 90%, or at least 70 but no more than 90%.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 5 but no more than 80%, at least 10 but no more than 80%, at least 15, but no more than 80%, at least 20 but no more than 80%, at least 30 but no more than 80%, at least 40 but no more than 80%, at least 50 but no more than 80%, or at least 60 but no more than 80%.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 5 but no more than 70%, at least 10 but no more than 70%, at least 15, but no more than 70%, at least 20 but no more than 70%, at least 30 but no more than 70%, at least 40 but no more than 70%, or at least 50 but no more than 70%.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 5 but no more than 60%, at least 10 but no more than 60%, at least 15, but no more than 60%, at least 20 but no more than 60%, at least 30 but no more than 60%, or at least 40 but no more than 60%.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 5 but no more than 50%, at least 10 but no more than 50%, at least 15, but no more than 50%, at least 20 but no more than 50%, at least 30 but no more than 50%, or at least 40 but no more than 50%.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 5 but no more than 40%, at least 10 but no more than 40%, at least 15, but no more than 40%, at least 20 but no more than 40%, at least 30 but no more than 40%, or at least 35 but no more than 40%.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 5 but no more than 30%, at least 10 but no more than 30%, at least 15, but no more than 30%, at least 20 but no more than 30%, or at least 25 but no more than 30%.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 1, 2, 3, 4 or 5 but no more than 20%, at least 1, 2, 3, 4 or 5 but no more than 30%, at least 1, 2, 3, 4 or 5, but no more than 35, at least 1, 2, 3, 4 or 5 but no more than 40%, or at least 1, 2, 3, 4 or 5 but no more than 45%.
  • a dose of an mTOR inhibitor is associated with, or provides, mTOR inhibition of at least 1, 2, 3, 4 or 5 but no more than 90%.
  • the extent of mTOR inhibition can be expressed as the extent of P70 S6K inhibition, e.g., the extent of mTOR inhibition can be determined by the level of decrease in P70 S6K activity, e.g., by the decrease in phosphorylation of a P70 S6K substrate.
  • the level of mTOR inhibition can be evaluated by a method described herein, e.g. by the Boulay assay.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.
  • the phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
  • nucleic acid refers to adenosine
  • C refers to cytosine
  • G refers to guanosine
  • T refers to thymidine
  • U refers to uridine.
  • nucleic acid or “polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double- stranded form.
  • nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
  • a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).
  • operably linked refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter.
  • a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
  • Operably linked DNA sequences can be contiguous with each other and, e.g., where necessary to join two protein coding regions, are in the same reading frame.
  • parenteral administration of an immunogenic composition includes, e.g., subcutaneous (s.c), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, intratumoral, or infusion techniques.
  • peptide refers to a compound comprised of amino acid residues covalently linked by peptide bonds.
  • a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence.
  • Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
  • the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
  • Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
  • a polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof.
  • poly(A) is a series of adenosines attached by polyadenylation to the mRNA.
  • the polyA is between 50 and 5000 (SEQ ID NO: 34), preferably greater than 64, more preferably greater than 100, most preferably greater than 300 or 400.
  • poly(A) sequences can be modified chemically or enzymatically to modulate mRNA functionality such as localization, stability or efficiency of translation.
  • polyadenylation refers to the covalent linkage of a polyadenylyl moiety, or its modified variant, to a messenger RNA molecule.
  • mRNA messenger RNA
  • the 3' poly(A) tail is a long sequence of adenine nucleotides (often several hundred) added to the pre-mRNA through the action of an enzyme, polyadenylate polymerase.
  • the poly(A) tail is added onto transcripts that contain a specific sequence, the polyadenylation signal.
  • the poly(A) tail and the protein bound to it aid in protecting mRNA from degradation by exonucleases.
  • Polyadenylation is also important for transcription termination, export of the mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after transcription of DNA into RNA, but additionally can also occur later in the cytoplasm. After transcription has been terminated, the mRNA chain is cleaved through the action of an endonuclease complex associated with RNA polymerase. The cleavage site is usually characterized by the presence of the base sequence AAUAAA (SEQ ID NO:40) near the cleavage site. After the mRNA has been cleaved, adenosine residues are added to the free 3' end at the cleavage site.
  • Prodrug refers to a compound that is processed, in the body of a subject, into a drug.
  • the processing comprises the breaking or formation of a bond, e.g., a covalent bond.
  • breakage of a covalent bond releases the drug.
  • the term "promote” or “enhance” in the context of an immune response refers to an increase in immune response, such as an increase in the ability of immune cells to target and/or kill cancer cells, to target and/or kill pathogens and pathogen infected cells, and protective immunity following vaccination, among others.
  • protective immunity refers to the presence of sufficient immune response (such as antibody titers) to protect against subsequent infection by a pathogen expressing the same antigen.
  • promoter refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
  • promoter/regulatory sequence refers to a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
  • the promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
  • prophylaxis means the prevention of or protective treatment for a disease or disease state. Prevention may be complete, e.g., the total absence of a disease or disease state. The prevention may also be partial, such that the likelihood of the occurrence of the disease or disease state in a subject is less likely to occur than had the subject not received the prophylactic treatment.
  • rapalog refers to a small molecule analog of rapamycin.
  • recombinant antibody refers to an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage or yeast expression system.
  • the term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequence technology which is available and known in the art.
  • a 5' cap (also termed an RNA cap, an RNA 7-methylguanosine cap or an RNA m G cap) is a modified guanine nucleotide that has been added to the "front" or 5' end of a eukaryotic messenger RNA shortly after the start of transcription.
  • the 5' cap consists of a terminal group which is linked to the first transcribed nucleotide. Its presence is critical for recognition by the ribosome and protection from RNases. Cap addition is coupled to transcription, and occurs co-transcriptionally, such that each influences the other.
  • RNA polymerase Shortly after the start of transcription, the 5' end of the mRNA being synthesized is bound by a cap- synthesizing complex associated with RNA polymerase. This enzymatic complex catalyzes the chemical reactions that are required for mRNA capping. Synthesis proceeds as a multi-step biochemical reaction.
  • the capping moiety can be modified to modulate functionality of mRNA such as its stability or efficiency of translation.
  • signal transduction pathway refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of a cell.
  • cell surface receptor includes molecules and complexes of molecules capable of receiving a signal and transmitting signal across the membrane of a cell.
  • signaling domain refers to the functional portion of a protein which acts by transmitting information within the cell to regulate cellular activity via defined signaling pathways by generating second messengers or functioning as effectors by responding to such messengers.
  • substantially purified cell refers to a cell that is essentially free of other cell types.
  • a substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state.
  • a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state.
  • the cells are cultured in vitro. In other aspects, the cells are not cultured in vitro.
  • the term "specifically binds,” refers to an antibody, or a ligand, which recognizes and binds with a cognate binding partner (e.g., a stimulatory and/or costimulatory molecule present on a T cell) protein present in a sample, but which antibody or ligand does not substantially recognize or bind other molecules in the sample.
  • a cognate binding partner e.g., a stimulatory and/or costimulatory molecule present on a T cell
  • stimulation refers to a primary response induced by binding of a stimulatory molecule (e.g., a TCR/CD3 complex or CAR) with its cognate ligand (or tumor antigen in the case of a CAR) thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR/CD3 complex or signal transduction via the appropriate NK receptor or signaling domains of the CAR.
  • a stimulatory molecule e.g., a TCR/CD3 complex or CAR
  • its cognate ligand or tumor antigen in the case of a CAR
  • Stimulation can mediate altered expression of certain molecules.
  • the term "stimulatory molecule,” refers to a molecule expressed by a T cell that provides the primary cytoplasmic signaling sequence(s) that regulate primary activation of the TCR complex in a stimulatory way for at least some aspect of the T cell signaling pathway.
  • the primary signal is initiated by, for instance, binding of a TCR/CD3 complex with an MHC molecule loaded with peptide, and which leads to mediation of a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like.
  • a primary cytoplasmic signaling sequence (also referred to as a "primary signaling domain") that acts in a stimulatory manner may contain a signaling motif which is known as immunoreceptor tyrosine- based activation motif or IT AM.
  • IT AM immunoreceptor tyrosine- based activation motif
  • Examples of an IT AM containing primary cytoplasmic signaling sequence that is of particular use in the invention includes, but is not limited to, those derived from CD3 zeta, common FcR gamma (FCER1G), FcR beta (Fc Epsilon Rib), CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, DAP10, DAP 12, CD278 (also known as "ICOS”), FcsRI, CD66d, DAP10, and DAP12.
  • FCER1G common FcR gamma
  • FcR beta Fc Epsilon Rib
  • the intracellular signaling domain in any one or more CARs of the invention comprises an intracellular signaling sequence, e.g., a primary signaling sequence of CD3-zeta.
  • the primary signaling sequence of CD3-zeta is the sequence provided as SEQ ID NO: 18, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like.
  • the primary signaling sequence of CD3-zeta is the sequence as provided in SEQ ID NO:20, or the equivalent residues from a non- human species, e.g., mouse, rodent, monkey, ape and the like.
  • the term "subject”, refers to any living organisms in which an immune response can be elicited (e.g., mammals, human).
  • the subject is a human.
  • a subject may be of any age.
  • the subject is an elderly human subject, e.g., 65 years of age or older.
  • a subject is a human subject who is not an elderly, e.g., less than 65 years of age.
  • a subject is a human pediatric subject, e.g., 18 years of age or less.
  • a subject is an adult subject, e.g., older than 18 years of age.
  • the term "therapeutic” as used herein means a treatment. A therapeutic effect is obtained by reduction, suppression, remission, or eradication of a disease state.
  • the term "transfer vector” refers to a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “transfer vector” includes an autonomously replicating plasmid or a virus.
  • the term should also be construed to further include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, a polylysine compound, liposome, and the like.
  • viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
  • tissue-specific promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
  • transfected or transformed or transformed refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • transfected or transformed or transformed refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • transformed or transduced cell is one which has been transfected, transformed or transduced with exogenous nucleic acid.
  • the cell includes the primary subject cell and its progeny.
  • transient refers to expression of a non-integrated transgene for a period of hours, days or weeks, wherein the period of time of expression is less than the period of time for expression of the gene if integrated into the genome or contained within a stable plasmid replicon in the host cell.
  • tumor antigen or “hyperproliferative disorder antigen” or “antigen associated with a hyperproliferative disorder” refers to antigens that are common to specific hyperproliferative disorders.
  • the hyperproliferative disorder antigens of the present invention are derived from, cancers including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non- Hodgkin lymphoma, Hodgkins lymphoma, leukemias, uterine cancer, cervical cancer, bladder cancer, kidney cancer and adenocarcinomas such as breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, and the like.
  • cancers including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non- Hodgkin lymphoma, Hodgkins lymphoma, leukemias, uterine cancer, cervical cancer, bladder cancer, kidney cancer and adenocarcinomas such as breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, and the like.
  • the term "vaccine” refers to a composition, such as a suspension or solution of antigen or antigenic moieties, usually containing an antigen (e.g., an inactivated infectious agent, or some part of the infectious agent, a tumor antigen, among others) that is injected or otherwise introduced into the body to produce active immunity.
  • an antigen e.g., an inactivated infectious agent, or some part of the infectious agent, a tumor antigen, among others
  • the antigen or antigenic moiety making up the vaccine can be a live or killed microorganism, or a natural product purified from a microorganism or other cell including, but not limited to tumor cells, a synthetic product, a genetically engineered protein, peptide, polysaccharide or similar product or an allergen.
  • the antigen or antigenic moiety can also be a subunit of a protein, peptide, polysaccharide or similar product.
  • RCAR Regulatable chimeric antigen receptor
  • An RCARX cell relies at least in part, on an antigen binding domain to provide specificity to a target cell that comprises the antigen bound by the antigen binding domain.
  • an RCAR includes a dimerization switch that, upon the presence of a dimerization molecule, can couple an intracellular signaling domain to the antigen binding domain.
  • Membrane anchor or “membrane tethering domain”, as that term is used herein, refers to a polypeptide or moiety, e.g., a myristoyl group, sufficient to anchor an extracellular or intracellular domain to the plasma membrane.
  • Switch domain refers to an entity, typically a polypeptide-based entity, that, in the presence of a dimerization molecule, associates with another switch domain. The association results in a functional coupling of a first entity linked to, e.g., fused to, a first switch domain, and a second entity linked to, e.g., fused to, a second switch domain.
  • a first and second switch domain are collectively referred to as a dimerization switch.
  • the first and second switch domains are the same as one another, e.g., they are polypeptides having the same primary amino acid sequence, and are referred to collectively as a homodimerization switch. In embodiments, the first and second switch domains are different from one another, e.g., they are polypeptides having different primary amino acid sequences, and are referred to collectively as a heterodimerization switch. In embodiments, the switch is intracellular. In embodiments, the switch is extracellular. In embodiments, the switch domain is a polypeptide-based entity, e.g., FKBP or FRB-based, and the dimerization molecule is small molecule, e.g., a rapalogue.
  • the switch domain is a polypeptide-based entity, e.g., an scFv that binds a myc peptide
  • the dimerization molecule is a polypeptide, a fragment thereof, or a multimer of a polypeptide, e.g., a myc ligand or multimers of a myc ligand that bind to one or more myc scFvs.
  • the switch domain is a polypeptide-based entity, e.g., myc receptor
  • the dimerization molecule is an antibody or fragments thereof, e.g., myc antibody.
  • dimerization molecule refers to a molecule that promotes the association of a first switch domain with a second switch domain.
  • the dimerization molecule does not naturally occur in the subject, or does not occur in concentrations that would result in significant dimerization.
  • the dimerization molecule is a small molecule, e.g., rapamycin or a rapalogue, e.g, RAD001.
  • Refractory refers to a disease, e.g., cancer, that does not respond to a treatment.
  • a refractory cancer can be resistant to a treatment before or at the beginning of the treatment.
  • the refractory cancer can become resistant during a treatment.
  • a refractory cancer is also called a resistant cancer.
  • Relapsed or a "relapse” as used herein refers to the reappearance of a disease (e.g., cancer) or the signs and symptoms of a disease such as cancer after a period of improvement or responsiveness, e.g., after prior treatment of a therapy, e.g., cancer therapy.
  • the period of responsiveness may involve the level of cancer cells falling below a certain threshold, e.g., below 20%, 1%, 10%, 5%, 4%, 3%, 2%, or 1%.
  • the reappearance may involve the level of cancer cells rising above a certain threshold, e.g., above 20%, 1%, 10%, 5%, 4%, 3%, 2%, or 1%.
  • Ranges throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and
  • a range such as 95-99% identity includes something with 95%, 96%,
  • preparation of T cells refers to a preparation that comprises at least one T cell. In an embodiment it is enriched for T cell as compared to peripheral blood.
  • xenogeneic refers to a graft derived from an animal of a different species.
  • apheresis refers to the art-recognized extracorporeal process by which the blood of a donor or patient is removed from the donor or patient and passed through an apparatus that separates out selected particular constituent(s) and returns the remainder to the circulation of the donor or patient, e.g., by retransfusion.
  • an apheresis sample refers to a sample obtained using apheresis.
  • mTOR inhibitor refers to a compound or ligand, or a pharmaceutically acceptable salt thereof, which inhibits the mTOR kinase in a cell.
  • an mTOR inhibitor is an allosteric inhibitor.
  • an mTOR inhibitor is a catalytic inhibitor.
  • Allosteric mTOR inhibitors include the neutral tricyclic compound rapamycin (sirolimus), rapamycin-related compounds, that is compounds having structural and functional similarity to rapamycin including, e.g., rapamycin derivatives, rapamycin analogs (also referred to as rapalogs) and other macrolide compounds that inhibit mTOR activity.
  • rapamycin neutral tricyclic compound
  • rapamycin-related compounds that is compounds having structural and functional similarity to rapamycin including, e.g., rapamycin derivatives, rapamycin analogs (also referred to as rapalogs) and other macrolide compounds that inhibit mTOR activity.
  • Rapamycin is a known macrolide antibiotic produced by Streptomyces hygroscopicus having the structure shown in Formula A.
  • Rapamycin analogs useful in the invention are, for example, O-substituted analogs in which the hydroxy group on the cyclohexyl ring of rapamycin is replaced by ORi in which Ri is hydroxyalkyl, hydroxyalkoxyalkyl, acylaminoalkyl, or aminoalkyl; e.g. RADOOl, also known as, everolimus as described in US 5,665,772 and WO94/09010 the contents of which are
  • rapamycin analogs include those substituted at the 26- or 28-position.
  • the rapamycin analog may be an epimer of an analog mentioned above, particularly an epimer of an analog substituted in position 40, 28 or 26, and may optionally be further hydrogenated, e.g. as described in US 6,015,815, WO95/14023 and WO99/15530 the contents of which are incorporated by reference, e.g. ABT578 also known as zotarolimus or a rapamycin analog described in US 7,091,213, WO98/02441 and WO01/14387 the contents of which are incorporated by reference, e.g. AP23573 also known as ridaforolimus.
  • 5,665,772 include, but are not limited to, 40-O-benzyl-rapamycin, 40-O-(4'- hydroxymethyl)benzyl-rapamycin, 40-O-[4'-(l,2-dihydroxyethyl)]benzyl-rapamycin, 40-O-allyl- rapamycin, 40-O-[3'-(2,2-dimethyl-l,3-dioxolan-4(S)-yl)-prop-2'-en- -yl]-rapamycin,
  • rapamycin analogs useful in the present invention are analogs where the hydroxy group on the cyclohexyl ring of rapamycin and/or the hydroxy group at the 28 position is replaced with an hydroxyester group are known, for example, rapamycin analogs found in US RE44,768, e.g. temsirolimus.
  • rapamycin analogs useful in the preset invention include those wherein the methoxy group at the 16 position is replaced with another substituent, preferably (optionally hydroxy- substituted) alkynyloxy, benzyl, orthomethoxybenzyl or chlorobenzyl and/or wherein the mexthoxy group at the 39 position is deleted together with the 39 carbon so that the cyclohexyl ring of rapamycin becomes a cyclopentyl ring lacking the 39 position methyoxy group; e.g. as described in W095/16691 and WO96/41807 the contents of which are
  • analogs can be further modified such that the hydroxy at the 40- position of rapamycin is alkylated and/or the 32-carbonyl is reduced.
  • W095/16691 include, but are not limited to, 16-demethoxy-16-(pent-2-ynyl)oxy-rapamycin, 16- demethoxy- 16-(but-2-ynyl)oxy-rapamycin, 16-demethoxy- 16-(propargyl)oxy-rapamycin, 16- demethoxy- 16- (4-hydroxy-but-2-ynyl)oxy-rapamycin, 16-demethoxy- 16-benzyloxy-40-O- (2- hydroxyethyl)-rapamycin, 16-demethoxy- 16-benzyloxy-rapamycin, 16-demethoxy- 16-ortho- methoxybenzyl-rapamycin, 16-demethoxy-40-O-(2-methoxyethyl)-16-pent-2-ynyl)oxy- rapamycin, 39-demethoxy-40-desoxy-39-formyl-42-nor-rapamycin, 39-demethoxy-40
  • WO96/41807 include, but are not limited to, 32-deoxo-rapamycin, 16-0-pent-2-ynyl-32-deoxo- rapamycin, 16-O-pent-2-ynyl-32-deoxo-40-O-(2-hydroxy-ethyl)-rapamycin, 16-0-pent-2-ynyl- 32-(S)-dihydro-40-O-(2-hydroxyethyl)-rapamycin, 32(S)-dihydro-40-O-(2-methoxy)ethyl- rapamycin and 32(S)-dihydro-40-O-(2-hydroxyethyl)-rapamycin.
  • rapamycin analog is umirolimus as described in US2005/0101624 the contents of which are incorporated by reference.
  • the target of rapamycin (mTOR) kinase exists as a multiprotein complex described as the mTORCl complex or mTORC2 complex, which senses the availability of nutrients and energy and integrates inputs from growth factors and stress signaling.
  • the mTORCl complex is sensitive to allosteric mTOR inhibitors such as rapamycin, is composed of mTOR, GPL, and regulatory associated proteins of mTOR (raptor), and binds to the peptidyl- prolyl isomerase FKBP12 protein (a FK506-binding protein 1A, 12 kDa).
  • the mTORC2 complex is composed of mTOR, GPL, and rapamycin-insensitive companion proteins of mTOR (rictor), and does not bind to the FKBP12 protein in vitro.
  • the mTORCl complex has been shown to be involved in protein translational control, operating as a growth factor and nutrient sensitive apparatus for growth and proliferation regulation.
  • mTORCl regulates protein translation via two key downstream substrates: P70 S6 kinase, which in turn phosphorylates ribosomal protein P70 S6, and eukaryotic translation initiation factor 4E binding protein 1 (4EBP1), which plays a key role in modulating eIF4E regulated cap-dependent translation.
  • the mTORCl complex regulates cell growth in response to the energy and nutrient homeostasis of the cell, and the deregulation of mTORCl is common in a wide variety of human cancers.
  • the function of mTORC2 involves the regulation of cell survival via phosphorylation of Akt and the modulation of actin cytoskeleton dynamics.
  • the mTORCl complex is sensitive to allosteric mTOR inhibitors such as rapamycin and derivatives in large part due to rapamycin" s mode of action, which involves the formation of an intracellular complex with the FKBP12 and binding to the FKBP12-rapamycin binding (FRB) domain of mTOR.
  • rapamycin rapamycin binding
  • FRB FKBP12-rapamycin binding
  • Rapamycin and rapalogues such as RAD001 have gained clinical relevance by inhibiting hyperactivation of mTOR associated with both benign and malignant proliferation disorders.
  • RAD001 otherwise known as everolimus (Afinitor®)
  • has the chemical name (lR,9S,12S,15R,16E,18R,19R,21R,23S,24E,26E,28E,30S,32S,35R)-l,18-dihydroxy-12- ⁇ (lR)- 2-[(lS,3R,4R)-4-(2-hydroxyethoxy)-3-methoxycyclohexyl]-l-methylethyl ⁇ -19,30-dimethoxy- 15, 17,21, 23,29,35-hexamethyl-l l,36-dioxa-4-aza-tricyclo[30.3.1.04,9]hexatriaconta- 16,24,26,28-tetraene-2,3,10,14,20-pentaone and the following chemical structure
  • Everolimus is an FDA approved drug for the treatment of advanced kidney cancer and is being investigated in several other phase III clinical trials in oncology. Preclinical studies have shown that Everolimus is able to inhibit the proliferation of a wide variety of tumor cell lines both in vitro and in vivo, presumably through the suppression of rapamycin sensitive mTORCl function. Everolimus, as a derivative of rapamycin, is an allosteric mTOR inhibitor that is highly potent at inhibiting part of the mTORCl function, namely P70 S6 kinase (P70 S6K) and the downstream P70 S6K substrate P70 S6.
  • P70 S6K P70 S6 kinase
  • Allosteric mTOR inhibitors like everolimus (and other rapamycin analogs) have little or no effect at inhibiting the mTORC2 pathway, or its resulting activation of Akt signaling.
  • Further examples of allosteric mTOR inhibitors include sirolimus (rapamycin, AY-22989), 40-[3-hydroxy-2-(hydroxymethyl)-2- methylpropanoate] -rapamycin (also called temsirolimus or CCT779) and ridaforolimus (AP- 23573/MK-8669).
  • Other examples of allosteric mTor inhibtors include zotarolimus (ABT578) and umirolimus.
  • catalytic, ATP-competitive mTOR inhibitors have been found to target the mTOR kinase domain directly and target both mTORCl and mTORC2. These are also more effective inhibitors of mTORCl than such allosteric mTOR inhibitors as rapamycin, because they modulate rapamycin-resistant mTORCl outputs such as 4EBP1-T37/46 phosphorylation and cap-dependent translation.
  • BEZ235 is a catalytic mTOR inhibitor, having the chemical name 2-methyl-2-[4-(3- methyl-2-oxo-8-quinolin-3-yl-2,3-dihydro-imidazo[4,5-c]quinolin-l-yl)-phenyl]-propionitrile and the following chemical structure
  • BEZ235 may also be used in its monotosylate salt form.
  • the synthesis of BEZ235 is described in WO2006/122806.
  • BEZ235 As a catalytic mTOR inhibitor BEZ235 is capable of shutting down the complete function of mTORCl complex, including both the rapamycin sensitive (phosphorylation of P70 S6K, and subsequently phosphorylation of P70 S6) and rapamycin insensitive (phosphorylation of 4EBP1) functions. BEZ235 has a differential effect according to the drug concentration used, whereby mTOR inhibition predominates at a low concentration (less than 100 nmol/L) but dual PI3K/ mTOR inhibition at relatively higher concentrations (approximately 500 nmol/L), Serra et al., 2008.
  • CCG168 Another catalytic mTOR inhibitor described in the literature is CCG168 (otherwise known as AZD-8055, Chresta, CM., et al., Cancer Res, 2010, 70(1), 288-298) which has the chemical name ⁇ 5-[2,4-bis-((S)-3-methyl-morpholin-4-yl)-pyrido[2,3d]pyrimidin-7-yl]-2- methoxy-phenyl ⁇ -methanol and the following chemical structure
  • Another catalytic mTOR inhibitor described in the literature is 3-(2- aminobenzo [d] oxazol-5-yl)- 1 -isopropyl- 1 H-pyrazolo [3 ,4-d]pyrimidin-4-amine (WO 10051043 and WO2013023184) having following chemical structure:
  • Another catalytic mTOR inhibitor described in the literature is N-(3-(N-(3-((3,5- dimethoxyphenyl)amino)quinoxaline-2-yl)sulfamoyl)phenyl)-3-methoxy-4-methylbenzamide (WO07044729 and WO12006552) having the following chemical structure:
  • PKI-587 (Venkatesan, A.M., J. Med.Chem., 2010, 53, 2636-2645) which has the chemical name l-[4-[4- (dimethylamino)piperidine-l-carbonyl]phenyl]-3-[4-(4,6-dimorpholino-l,3,5-triazin-2- yl)phenyl]urea and having the following chemical structure
  • GSK-2126458 ACS Med. Chem. Lett., 2010, 1, 39-43 which has the chemical name 2,4-difluoro-N- ⁇ 2-methoxy-5- [4-(4-pyridazinyl)-6-quinolinyl]-3-pyridinyl ⁇ benzenesulfonamide and having the following chemical structure:
  • catalytic mTOR inhibitors include 8-(6-methoxy-pyridin-3-yl)-3- methyl-l-(4-piperazin-l-yl-3-trifluoromethyl-phenyl)-l,3-dihydro-imidazo[4,5-c]quinolin-2-one (WO2006/122806) and Ku-0063794 (Garcia-Martinez JM, et al.,Biochem J., 2009, 421(1), 29- 42.. Ku-0063794 is a specific inhibitor of the mammalian target of rapamycin (mTOR).) WYE- 354 is another example of a catalytic mTor inhibitor (Yu K, et al. (2009). Biochemical, Cellular, and In vivo Activity of Novel ATP-Competitive and Selective Inhibitors of the Mammalian Target of Rapamycin. Cancer Res. 69(15): 6232-6240).
  • mTOR inhibitors useful according to the present invention also include prodrugs, derivatives, pharmaceutically acceptable salts, or analogs thereof of any of the foregoing.
  • mTOR inhibitors such as RAD001
  • RAD001 may be formulated for delivery based on well- established methods in the art based on the particular dosages described herein.
  • US Patent 6,004,973 (incorporated herein by reference) provides examples of formulations useable with the mTOR inhibitors described herein.
  • Exemplary mTOR inhibitors include, e.g., temsirolimus; ridaforolimus (formally known as deferolimus, (lR,2R,45)-4-[(2R)-2 [(1R,95,125,15R,16E,18R,19R,21R,
  • WO 03/064383 everolimus (Afinitor® or RAD001); rapamycin (AY22989, Sirolimus®); simapimod (CAS 164301-51-3); emsirolimus, (5- ⁇ 2,4-Bis[(35 , )-3-methylmorpholin-4-yl]pyrido[2,3-(i]pyrimidin-7-yl ⁇ -2- methoxyphenyl)methanol (AZD8055); 2-Amino-8-[iraw5 , -4-(2-hydroxyethoxy)cyclohexyl]-6-(6- methoxy-3-pyridinyl)-4-methyl-pyrido[2,3-JJpyrimidin-7(8H)-one (PF04691502, CAS 1013101- 36-4); and N -[l,4-dioxo-4-[[4-(4 -oxo-8-phenyl-4H-l-benzopyran-2-yl)morpholinium-4-
  • administering results in increased or prolonged proliferation or persistence of CAR-expressing cells, e.g., in culture or in a subject, e.g., as compared to non-treated CAR-expressing cells or a non-treated subject.
  • increased proliferation or persistence is associated with in an increase in the number of CAR-expressing cells. Methods for measuring increased or prolonged proliferation are described in Examples 6 and 7. In another embodiment,
  • a low, immune enhancing, dose of an mTOR inhibitor results in increased killing of cancer cells by CAR-expressing cells, e.g., in culture or in a subject, e.g., as compared to non-treated CAR-expressing cells or a non-treated subject.
  • increased killing of cancer cells is associated with in a decrease in tumor volume.
  • a low, immune enhancing, dose of an mTOR inhibitors e.g., to increase the level of PD1 negative immune effector cells, e.g., T cells, to decrease the level of PD1 positive immune effector cells, e.g., T cells, to increase the ratio of PD1 negative immune effector cells, e.g., T cells/PDl positive immune effector cells, e.g., T cells, to increase the level of naive T cells, or to increase the number of memory T cell precursors or the expression level of memory T cell precursor markers.
  • an mTOR inhibitors e.g., to increase the level of PD1 negative immune effector cells, e.g., T cells, to decrease the level of PD1 positive immune effector cells, e.g., T cells, to increase the ratio of PD1 negative immune effector cells, e.g., T cells/PDl positive immune effector cells, e.g., T cells, to increase the level of naive T cells,
  • any of these methods can also be practiced with, in place of the low, immune enhancing, dose of an mTOR inhibitors, the administration of an inhibitor of a downstream element in the pathway, e.g., P70 S6K or TORC1.
  • an inhibitor of a downstream element in the pathway e.g., P70 S6K or TORC1.
  • P70 S6K include PF-4708671 (Pfizer) or LY2584702 tosylate (Eli Lilly).
  • Examples of inhibitors of mTORCl include allosteric mTOR inhibitors that specifically inhibit mTORCl, but do not inhibit mTORC2.
  • a downstream inhibitor is adminered at a dose effective to increase the level of PD1 negative immune effector cells, e.g., T cells, to decrease the level of PD1 positive immune effector cells, e.g., T cells, to increase the ratio of PD1 negative immune effector cells, e.g., T cells/PDl positive immune effector cells, e.g., T cells, to increase the level of naive T cells, or to increase the number of memory T cell precursors or the expression level of memory T cell precursor markers.
  • PD1 negative immune effector cells e.g., T cells
  • PD1 positive immune effector cells e.g., T cells
  • PDl positive immune effector cells e.g., T cells
  • mTOR phosphorylates the kinase P70 S6, thereby activating P70 S6K and allowing it to phosphorylate its substrate.
  • the extent of mTOR inhibition can be expressed as the extent of P70 S6K inhibition, e.g., the extent of mTOR inhibition can be determined by the level of decrease in P70 S6K activity, e.g., by the decrease in phosphorylation of a P70 S6K substrate.
  • the level of inhibition of P70 S6K gives the level of mTOR inhibition.
  • mTOR activity as measured by P70 S6K activity, is inhibited by 40%.
  • the extent or level of inhibition referred to herein is the average level of inhibition over the dosage interval. By way of example, if the inhibitor is given once per week, the level of inhibition is given by the average level of inhibition over that interval, namely a week.
  • Boulay et al., Cancer Res, 2004, 64:252-61 teaches an assay that can be used to assess the level of mTOR inhibition (referred to herein as the Boulay assay).
  • the assay relies on the measurement of P70 S6 kinase activity from biological samples before and after administration of an mTOR inhibitor, e.g., RAD001. Samples can be taken at preselected times after treatment with an mTOR ihibitor, e.g., 24, 48, and 72 hours after treatment.
  • Biological samples e.g., from skin or peripheral blood
  • PBMCs mononuclear cells
  • Total protein extracts are prepared from the samples.
  • P70 S6 kinase is isolated from the protein extracts by immunoprecipitation using an antibody that specifically recognizes the P70 S6 kinase.
  • Activity of the isolated P70 S6 kinase can be measured in an in vitro kinase assay.
  • the isolated kinase can be incubated with 40S ribosomal subunit substrates (which is an endogenous substrate of P70 S6K) and gamma- 32 P under conditions that allow phosphorylation of the substrate. Then the reaction mixture can be resolved on an SDS-PAGE gel, and 32 P signal analyzed using a Phosphorlmager.
  • a 32 P signal corresponding to the size of the 40S ribosomal subunit indicates phosphorylated substrate and the activity of P70 S6K.
  • Increases and decreases in kinase activity can be calculated by quantifying the area and intensity of the 32 P signal of the phosphorylated substrate (e.g., using ImageQuant, Molecular Dynamics), assigning arbitrary unit values to the quantified signal, and comparing the values from after administration with values from before administration or with a reference value.
  • percent inhibition of kinase activity can be calculated with the following formula: 1- (value obtained after administration/value obtained before administration) x 100.
  • the extent or level of inhibition referred to herein is the average level of inhibition over the dosage interval.
  • the level of mTOR inhibition can also be evaluated by a change in the ratio of PDl negative to PDl positive T cells.
  • T cells from peripheral blood can be identified as PDl negative or positive by art-known methods.
  • Methods described herein use low, immune enhancing, dose mTOR inhibitors, doses of mTOR inhibitors, e.g., allosteric mTOR inhibitors, including rapalogs such as RAD001. In contrast, levels of inhibitor that fully or near fully inhibit the mTOR pathway are low, immune enhancing, dose mTOR inhibitors, doses of mTOR inhibitors, e.g., allosteric mTOR inhibitors, including rapalogs such as RAD001. In contrast, levels of inhibitor that fully or near fully inhibit the mTOR pathway are
  • rapalogs that fully inhibit mTOR also inhibit tumor cell growth and are used to treat a variety of cancers
  • rapalogs that fully inhibit mTOR also inhibit tumor cell growth and are used to treat a variety of cancers.
  • Antineoplastic effects of mammalian target of rapamycine inhibitors Salvadori M. World J Transplant. 2012 Oct 24;2(5):74-83; Current and Future Treatment Strategies for Patients with Advanced Hepatocellular Carcinoma: Role of mTOR Inhibition.
  • the present invention is based, at least in part, on the surprising finding that doses of mTOR inhibitors well below those used in current clinical settings had a superior effect in increasing an immune response in a subject and increasing the ratio of PD-1 negative T cells/PD- 1 positive T cells. It was surprising that low doses of mTOR inhibitors, producing only partial inhibition of mTOR activity, were able to effectively improve immune responses in human subjects and increase the ratio of PD-1 negative T cells/PD-1 positive T cells.
  • low, a low, immune enhancing, dose of an mTOR inhibitor can increase naive T cell numbers, e.g., at least transiently, e.g., as compared to a non-treated subject.
  • treatment with an mTOR inhibitor after a sufficient amount of time or sufficient dosing results in one or more of the following:
  • CD62L hlgh CD127 high , CD27 + , and BCL2, e.g., on memory T cells, e.g., memory T cell precursors;
  • KLRG1 a decrease in the expression of KLRG1, e.g., on memory T cells, e.g., memory T cell precursors;
  • an increase in the number of memory T cell precursors e.g., cells with any one or combination of the following characteristics: increased CD62L hlgh , increased CD127 hlgh , increased CD27 + , decreased KLRG1, and increased BCL2;
  • Memory T cell precursors are memory T cells that are early in the differentiation program.
  • memory T cells have one or more of the following characteristics: increased CD62L hlgh , increased CD127 hlgh , increased CD27 + , decreased KLRG1, and/or increased BCL2.
  • the present invention provides compositions, e.g., provides as a unit dosage form, comprising an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., RADOOl, at a concentration of about 0.005-1.5 mg, about 0.005-1.5 mg, about 0.01-1 mg, about 0.01-0.7 mg, about 0.01-0.5 mg, or about 0.1-0.5 mg.
  • an mTOR inhibitor e.g., RADOOl
  • compositions comprising an mTOR inhibitor, e.g., RADOOl, at a concentration of 0.005-1.5 mg, 0.005-1.5 mg, 0.01-1 mg, 0.01-0.7 mg, 0.01-0.5 mg, or 0.1-0.5 mg.
  • the invention provides compositions comprising an mTOR inhibitor, e.g., RADOOl, at a dose of about 0.005 mg, 0.006 mg, 0.007 mg, 0.008 mg, 0.009 mg, 0.01 mg, 0.02 mg, 0.03 mg, 0.04 mg, 0.05 mg, 0.06 mg, 0.07 mg, 0.08 mg, 0.09 mg, 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, or 1.0 mg.
  • the mTOR inhibitor e.g., RADOOl
  • the mTOR inhibitor is at a dose of 0.5 mg or less.
  • the mTOR inhibitor e.g., RADOOl
  • the invention provides compositions comprising an mTOR inhibitor, e.g., RADOOl, at a dose of 0.005 mg, 0.006 mg, 0.007 mg, 0.008 mg, 0.009 mg, 0.01 mg, 0.02 mg, 0.03 mg, 0.04 mg, 0.05 mg, 0.06 mg, 0.07 mg, 0.08 mg, 0.09 mg, 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, or 1.0 mg.
  • the mTOR inhibitor e.g., RADOOl
  • the mTOR inhibitor is at a dose of 0.5 mg or less.
  • the mTOR inhibitor e.g., RADOOl
  • the mTOR inhibitor is at a dose of 0.5 mg.
  • compositions comprising an mTOR inhibitor that is not RADOOl, in an amount that is bioequivalent to the specific amounts or doses specified for RADOOl.
  • the invention relates to compositions comprising an mTOR inhibitor in an amount sufficient to inhibit P70 S6 kinase by no greater than 80%.
  • the compositions described herein comprise an mTOR inhibitor in an amount sufficient to inhibit P70 S6 kinase by no greater than 38%.
  • the invention relates to a composition, or dosage form, of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., a rapalog, rapamycin, or RADOOl, or a catalytic mTOR inhibitor, which, when administered on a selected dosing regimen, e.g., once daily or once weekly, is associated with: a level of mTOR inhibition that is not associated with complete, or significant immune suppression, but is associated with enhancement of the immune response.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., a rapalog, rapamycin, or RADOOl
  • a catalytic mTOR inhibitor e.g., a catalytic mTOR inhibitor
  • the invention provides methods for enhancing immune response, e.g., treating immunosenescence, comprising a step of administering to a subject an mTOR inhibitor.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., RADOOl
  • an mTOR inhibitor can be administered at a dose of about 0.005-1.5 mg daily, about 0.01-1 mg daily, about 0.01-0.7 mg daily, about 0.01-0.5 mg daily, or about 0.1-0.5 mg daily.
  • an mTOR inhibitor, e.g., RADOOl can be administered at a dose of about 0.1-20 mg weekly, about 0.5-15 mg weekly, about 1-10 mg weekly, or about 3-7 mg weekly.
  • an mTOR inhibitor e.g., RADOOl
  • an mTOR inhibitor can be administered at a dose of 0.005-1.5 mg daily, 0.01-1 mg daily, 0.01-0.7 mg daily, 0.01-0.5 mg daily, or 0.1-0.5 mg daily.
  • an mTOR inhibitor e.g., RADOOl
  • the invention relates to methods for enhancing immune response, e.g., treating immunosenescence, comprising the step of administering an mTOR inhibitor that is not RADOOl, in an amount that is bioequivalent to the specific amounts or doses described herein for RADOOl.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, eg., e.g., RADOOl
  • RADOOl can be administered at a dose of no greater than about 0.7 mg in a 24 hour period.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., RADOOl
  • RADOOl can be administered at a dose of no greater than about 0.5 mg in a 24 hour period.
  • RADOOl can be administered at a dose of 0.5 mg or less daily.
  • RADOOl can be administered at a dose of 0.5 mg daily.
  • the invention can utilize an mTOR inhibitor other than RADOOl in an amount that is bioequivalent to the specific amounts or doses specified for RADOOl.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., RADOOl
  • an mTOR inhibitor can be administered at a dose of 0.1 mg weekly, 0.2 mg weekly, 0.3 mg weekly, 0.4 mg weekly, 0.5 mg weekly, 0.6 mg weekly, 0.7 mg weekly, 0.8 mg weekly, 0.9 mg weekly, 1 mg weekly, 2 mg weekly, 3 mg weekly, 4 mg weekly, 5 mg weekly, 6 mg weekly, 7 mg weekly, 8 mg weekly, 9 mg weekly, 10 mg weekly, 11 mg weekly, 12 mg weekly, 13 mg weekly, 14 mg weekly, 15 mg weekly, 16 mg weekly, 17 mg weekly, 18 mg weekly, 19 mg weekly, or 20 mg weekly.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., RAD001
  • an mTOR inhibitor is administered at a dose of 5 mg or less weekly.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., RAD001
  • the invention can utilize an mTOR inhibitor other than RAD001 in an amount that is bioequivalent to the specific amounts or doses specified for RAD001.
  • An mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., a rapalog, rapamycin, or RAD001, or a catalytic mTOR inhibitor, can be provided in a sustained relase formulation. Any of the compositions or unit dosage forms described herein can be provided in a sustained release formulation. In some embodiments, a sustained release formulation will have lower
  • a sustained release formulation will have from about 2 to about 5, about 2.5 to about 3.5, or about 3 times the amount of inhibitor provided in the immediate release formulation.
  • immediate release forms e.g., of RAD001, typically used for one administration per week, having 0.1 to 20, 0.5 to 10, 2.5 to 7.5, 3 to 6, or about 5, mgs per unit dosage form.
  • these immediate release formulations correspond to sustained release forms, having, respectively, 0.3 to 60, 1.5 to 30, 7.5 to 22.5, 9 to 18, or about 15 mgs of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RAD001.
  • both forms are administered on a once/week basis.
  • immediate release forms e.g., of RAD001, typically used for one administration per day, having having 0.005 to 1.5, 0.01 to 1.5, 0.1 to 1.5, 0.2 to 1.5, 0.3 to 1.5, 0.4 to 1.5, 0.5 to 1.5, 0.6 to 1.5, 0.7 to 1.5, 0.8 to 1.5, 1.0 to 1.5, 0.3 to 0.6, or about 0.5 mgs per unit dosage form, are provided.
  • these immediate release forms correspond to sustained release forms, having, respectively, 0.015 to 4.5, 0.03 to 4.5, 0.3 to 4.5, 0.6 to 4.5, 0.9 to 4.5, 1.2 to 4.5, 1.5 to 4.5, 1.8 to 4.5, 2.1 to 4.5, 2.4 to 4.5, 3.0 to 4.5, 0.9 to 1.8, or about 1.5 mgs of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RAD001.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RAD001.
  • these immediate release forms correspond to sustained release forms, having, respectively, 0.1 to 30, 0.2 to 30, 2 to 30, 4 to 30, 6 to 30, 8 to 30, 10 to 30, 1.2 to 30, 14 to 30, 16 to 30, 20 to 30, 6 to 12, or about 10 mgs of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RAD001.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RAD001.
  • immediate release forms e.g., of RAD001, typically used for one administration per day, having having 0.01 to 1.0 mgs per unit dosage form.
  • these immediate release forms correspond to sustained release forms, having, respectively, 0.03 to 3 mgs of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RADOOl.
  • these immediate release forms correspond to sustained release forms, having, respectively, 0.2 to 20 mgs of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RAD001.
  • immediate release forms e.g., of RAD001, typically used for one administration per week, having having 0.5 to 5.0 mgs per unit dosage form, are provided.
  • these immediate release forms correspond to sustained release forms, having, respectively, 1.5 to 15 mgs of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RAD001.
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., rapamycin or RAD001.
  • one target of the mTOR pathway is the P70 S6 kinase.
  • doses of mTOR inhibitors which are useful in the methods and compositions described herein are those which are sufficient to achieve no greater than 80% inhibition of P70 S6 kinase activity relative to the activity of the P70 S6 kinase in the absence of an mTOR inhibitor, e.g., as measured by an assay described herein, e.g., the Boulay assay.
  • the invention provides an amount of an mTOR inhibitor sufficient to achieve no greater than 38% inhibition of P70 S6 kinase activity relative to P70 S6 kinase activity in the absence of an mTOR inhibitor, e.g., as measured by an assay described herein, e.g., the Boulay assay
  • the dose of mTOR inhibitor useful in the methods and compositions of the invention is sufficient to achieve, e.g., when administered to a human subject, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60%, 59%, 58%, 57%, 56%, 55%, 54%, 54%, 53%, 52%, 51%, 50%, 49%, 48%, 47%
  • the dose of mTOR inhibitor useful in the methods and compositions of the invention is sufficient to achieve, e.g., when administered to a human subject, 90 +/-5 % (i.e., 85-95%), 89+/-5 %, 88+/-5 %, 87+/-5 %, 86+/-5 %, 85+/-5 %, 84+/-5 %, 83+/-5 %, 82+/-5 %, 81+/-5 %, 80+/-5 %, 79+/-5 %, 78+/-5 %, 77+/-5 %, 76+/-5 %, 75+/-5 %, 74+/-5 %, 73+/-5 %, 72 +/-5%, 71 +/-5%, 70 +/-5%, 69 +/-5%, 68 +1-5%, 67 +/-5%, 66 +/-5%, 65 +1-5%, 64 +/-5%, 63
  • P70 S6 kinase activity in a subject may be measured using methods known in the art, such as, for example, according to the methods described in U.S. Pat. 7,727,950, by immunoblot analysis of phosphoP70 S6K levels and/or phosphoP70 S6 levels or by in vitro kinase activity assays.
  • the invention relates to compositions comprising an mTOR inhibitor such as an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., RADOOl .
  • an mTOR inhibitor such as an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., RADOOl
  • Doses of an mTOR inhibitor, e.g., an allosteric mTOR inhibitor, e.g., RADOOl, in such compositions can be in the range of about 30 pM to 4 nM.
  • the dose of an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., RADOOl
  • an mTOR inhibitor e.g., an allosteric mTOR inhibitor, e.g., RADOOl
  • the dose of RADOOl is in the range of 50 pM to 2nM, 100 pM to 1.5 nM, 200 pM to 1 nM, or 300 pM to 500 pM.
  • the dose of RADOOl is about 30 pM, 40 pM, 50 pM, 60 pM, 70 pM, 80 pM, 90 pM, 100 pM, 150 pM, 200 pM, 250 pM, 300 pM, 350 pM, 400 pM, 450 pM, 500 pM, 550 pM, 600 pM, 650 pM, 700 pM, 750 pM, 800 pM, 850 pM, 900 pM, 950 pM, 1 nM, 1.5 nM, 2 nM, 2.5 nM, 3 nM, 3.5 nM, or 4 nM.
  • the invention can utilize an mTOR inhibitor other than RADOOl in an amount that is bioequivalent to the specific amounts or doses specified for RADOOl .
  • the invention further relates to methods comprising the administration of an mTOR inhibitor to a subject. Such methods may employ doses of the mTOR inhibitor RADOOl in the range of about 30 pM to 4 nM. In a further aspect, the dose of RADOOl can be in the range of about 50 pM to 2nM, about 100 pM to 1.5 nM, about 200 pM to 1 nM, or about 300 pM to 500 pM.
  • the dose of RADOOl is in the range of 50 pM to 2nM, 100 pM to 1.5 nM, 200 pM to 1 nM, or 300 pM to 500 pM. In a further aspect the dose of RADOOl is about 30 pM, 40 pM, 50 pM, 60 pM, 70 pM, 80 pM, 90 pM, 100 pM, 150 pM, 200 pM, 250 pM, 300 pM, 350 pM, 400 pM, 450 pM, 500 pM, 550 pM, 600 pM, 650 pM, 700 pM, 750 pM, 800 pM, 850 pM, 900 pM, 950 pM, 1 nM, 1.5 nM, 2 nM, 2.5 nM, 3 nM, 3.5 nM, or 4 nM.
  • the methods of the invention can utilize an mTOR inhibitor other than RADOOl in an amount that is bioequivalent to the specific amounts or doses specified for RADOOl.
  • the term "about” in reference to a dose of mTOR inhibitor refers to up to a +/- 10% variability in the amount of mTOR inhibitor, but can include no variability around the stated dose.
  • the invention provides methods comprising administering to a subject an mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RADOOl, at a dosage within a target trough level.
  • an mTOR inhibitor e.g., an allosteric inhibitor, e.g., RADOOl
  • the trough level is significantly lower than trough levels associated with dosing regimens used in organ transplant and cancer patients.
  • mTOR inhibitor e.g., RADOOl, or rapamycin
  • mTOR inhibitor e.g., RADOOl, or rapamycin
  • a trough level that is less than 1 ⁇ 2, 1/4, 1/10, or 1/20 of the trough level provided on the FDA approved packaging insert for use in immunosuppression or an anticancer indications.
  • a method disclosed herein comprises administering to a subject an mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RADOOl, at a dosage that provides a target trough level of 0.1 to 10 ng/ml, 0.1 to 5 ng/ml, 0.1 to 3ng/ml, 0.1 to 2 ng/ml, or 0.1 to 1 ng/ml.
  • an mTOR inhibitor e.g., an allosteric inhibitor, e.g., RADOOl
  • a method disclosed herein comprises administering to a subject an mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RADOOl, at a dosage that provides a target trough level of 0.2 to 10 ng/ml, 0.2 to 5 ng/ml, 0.2 to 3ng/ml, 0.2 to 2 ng/ml, or 0.2 to 1 ng/ml.
  • an mTOR inhibitor e.g., an allosteric inhibitor, e.g., RADOOl
  • an, allosteric inhibitor e.g., RADOOl
  • a method disclosed herein comprises administering to a subject an mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RADOOl, at a dosage that provides a target trough level of 0.4 to 10 ng/ml, 0.4 to 5 ng/ml, 0.4 to 3ng/ml, 0.4 to 2 ng/ml, or 0.4 to 1 ng/ml.
  • an mTOR inhibitor e.g., an allosteric inhibitor, e.g., RADOOl
  • a method disclosed herein comprises administering to a subject an mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RADOOl, at a dosage that provides a target trough level of 0.5 to 10 ng/ml, 0.5 to 5 ng/ml, 0.5 to 3ng/ml, 0.5 to 2 ng/ml, or 0.5 to 1 ng/ml.
  • an mTOR inhibitor e.g., an allosteric inhibitor, e.g., RADOOl
  • a method disclosed herein comprises administering to a subject an mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RADOOl, at a dosage that provides a target trough level of 1 to 10 ng/ml, 1 to 5 ng/ml, 1 to 3ng/ml, or 1 to 2 ng/ml.
  • an mTOR inhibitor e.g., an allosteric inhibitor, e.g., RADOOl
  • trough level refers to the concentration of a drug in plasma just before the next dose, or the minimum drug concentration between two doses.
  • a target trough level of RADOOl is in a range of between about 0.1 and 4.9 ng/ml. In some embodiments, a target trough level of RADOOl is in a range of between about 0.1 and 3 ng/ml. In an embodiment, the target trough level is below 3ng/ml, e.g., is between 0.3 or less and 3 ng/ml. In an embodiment, the target trough level is below 3ng/ml, e.g., is between 0.3 or less and 1 ng/ml. In some embodiments, a target trough level of RADOOl is in a range of between about 2.4 and 3 ng/ml.
  • a target trough level of RADOOl is in a range of between about 0.1 and 2.4 ng/ml. In some embodiments, a target trough level of RADOOl is in a range of between about 0.1 and 1.5 ng/ml. In some
  • a target trough level of RADOOl is in a range of between 0.1 and 3 ng/ml. In some embodiments, a target trough level of RADOOl is in a range of between 2.4 and 3 ng/ml. In some embodiments, a target trough level of RADOOl is in a range of between 0.1 and 2.4 ng/ml. In some embodiments, a target trough level of RADOOl is in a range of between 0.1 and 1.5 ng/ml. In some embodiments, a target trough level of RADOOl is 0.1 ng/ml. In some embodiments, a target trough level of RADOOl is 0.2 ng/ml.
  • a target trough level of RADOOl is 0.3 ng/ml. In some embodiments, a target trough level of RADOOl is 0.4 ng/ml. In some embodiments, a target trough level of RADOOl is 0.5 ng/ml. In some embodiments, a target trough level of RADOOl is 0.6 ng/ml. In some embodiments, a target trough level of RADOOl is 0.7 ng/ml. In some embodiments, a target trough level of RADOOl is 0.8 ng/ml. In some embodiments, a target trough level of RADOOl is 0.9 ng/ml.
  • a target trough level of RADOOl is 1.0 ng/ml. In some embodiments, a target trough level of RADOOl is 1.1 ng/ml. In some embodiments, a target trough level of RADOOl is 1.2 ng/ml. In some embodiments, a target trough level of RADOOl is 1.3 ng/ml. In some embodiments, a target trough level of RADOOl is 1.4 ng/ml. In some embodiments, a target trough level of RADOOl is 1.5 ng/ml. In some embodiments, a target trough level of RADOOl is less than 5 ng/ml.
  • a target trough level of RADOOl is less than 2.5 ng/ml. In some embodiments, a target trough level of RADOOl is less than 3 ng/ml, 2 ng/ml, 1.9 ng/ml, 1.8 ng/ml, 1.7 ng/ml, 1.6 ng/ml, 1.5 ng/ml, 1.4 ng/ml, 1.3 ng/ml, 1.2 ng/ml, 1.1 ng/ml, 1.0 ng/ml, 0.9 ng/ml, 0.8 ng/ml, 0.7 ng/ml, 0.6 ng/ml, 0.5 ng/ml, 0.4 ng/ml, 0.3 ng/ml, 0.2 ng/ml, or 0.1 ng/ml.
  • the invention can utilize an mTOR inhibitor other than RADOOl in an amount that is associated with a target trough level that is bioequivalent to the specified target trough level for RADOOl .
  • the target trough level for an mTOR inhibitor other than RADOOl is a level that gives the same level of mTOR inhibition (e.g., as measured by a method described herein, e.g., the inhibition of P70 S6K) as does a trough level of RADOOl described herein.
  • a low, immune enhancing dose of an mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RADOOl, or a catalytic inhibitor, in combination with an immune effector cell, e.g., a T cell or a NK cell, engineered to express a CAR.
  • an mTOR inhibitor e.g., an allosteric inhibitor, e.g., RADOOl, or a catalytic inhibitor
  • an immune effector cell e.g., a T cell or a NK cell
  • the cell is engineered to express a CAR, and in embodiments, expresses the CAR by the time at which it is administered to the subject. In other embodiments, expression initiates after administration.
  • the cell is a T cell engineered to express a CAR, wherein the CAR T cell ("CART”) exhibits an anticancer property.
  • compositions of matter and methods of use for the treatment of a disease such as cancer using immune effector cells (e.g., T cells, NK cells) engineered with CARs in combination with administration of a low, imune enhancing dose, of an mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RAD001, or a catalytic inhibitor.
  • an mTOR inhibitor e.g., an allosteric inhibitor, e.g., RAD001, or a catalytic inhibitor.
  • CAR chimeric antigen receptors
  • an antigen binding domain e.g., antibody or antibody fragment, TCR or TCR fragment
  • an immune effector cell e.g., T cell, NK cell
  • a cell is transformed with the CAR and the CAR is expressed on the cell surface.
  • the cell e.g., T cell, NK cell
  • the cell is transduced with a viral vector encoding a CAR.
  • the viral vector is a retroviral vector.
  • the viral vector is a lentiviral vector.
  • the cell may stably express the CAR.
  • the cell e.g., T cell, NK cell
  • a nucleic acid e.g., mRNA, cDNA, DNA, encoding a CAR.
  • the cell may transiently express the CAR.
  • the antigen binding domain of the CARs described herein is a scFv antibody fragment.
  • antibody fragments are functional in that they retain the equivalent binding affinity, e.g., they bind the same antigen with comparable affinity, as the IgG antibody from which it is derived.
  • antibody fragments are functional in that they provide a biological response that can include, but is not limited to, activation of an immune response, inhibition of signal-transduction origination from its target antigen, inhibition of kinase activity, and the like, as will be understood by a skilled artisan.
  • the antigen binding domain of the CAR is a scFv antibody fragment that is humanized compared to the murine sequence of the scFv from which it is derived.
  • the parental murine scFv sequence is the CAR19 construct provided in PCT publication WO2012/079000 (incorporated herein by reference) and provided herein as SEQ ID NO:43.
  • the anti-CD 19 binding domain is a scFv described in WO2012/079000 and provided in SEQ ID NO:43.
  • the antibodies of the invention are incorporated into a chimeric antigen receptor (CAR).
  • the CAR comprises the polypeptide sequence provided as SEQ ID NO: 12 in PCT publication WO2012/079000, and provided herein as SEQ ID NO: 42, wherein the scFv domain is substituted by one or more sequences selected from SEQ ID NOS: 44-55.
  • the scFv domains of SEQ ID NOS:44-55 are humanized variants of the scFv domain of SEQ ID NO:43, which is an scFv fragment of murine origin that specifically binds to human CD19.
  • mouse-specific residues may induce a human-anti-mouse antigen (HAMA) response in patients who receive CART19 treatment, e.g., treatment with T cells transduced with the CAR 19 construct.
  • HAMA human-anti-mouse antigen
  • CD19 CAR provided as SEQ ID NO: 12 in PCT publication WO2012/079000 is:
  • the antigen binding domain of a CAR of the invention is encoded by a transgene whose sequence has been codon optimized for expression in a mammalian cell.
  • entire CAR construct of the invention is encoded by a transgene whose entire sequence has been codon optimized for expression in a mammalian cell.
  • Codon optimization refers to the discovery that the frequency of occurrence of synonymous codons (i.e., codons that code for the same amino acid) in coding DNA is biased in different species. Such codon degeneracy allows an identical polypeptide to be encoded by a variety of nucleotide sequences.
  • a variety of codon optimization methods is known in the art, and include, e.g., methods disclosed in at least US Patent Numbers 5,786,464 and 6,114,148.
  • the CARs of the invention combine an antigen binding domain of a specific antibody with an intracellular signaling molecule.
  • the intracellular signaling molecule includes, but is not limited to, CD3-zeta chain, 4- IBB and CD28 signaling modules and combinations thereof.
  • the antigen binding domain binds to a tumor marker as described herein.
  • the present invention provides CAR-expressing cell compositions and a low, immune enhancing, dose of mTOR inhibitor, e.g., an allosteric inhibitor, e.g., RAD001, or a catalytic inhibitor, and their use in medicaments or methods for treating, among other diseases, cancer or any malignancy or autoimmune diseases involving cells or tissues which express a tumor marker as described herein.
  • mTOR inhibitor e.g., an allosteric inhibitor, e.g., RAD001, or a catalytic inhibitor
  • the CAR of the invention can be used with administration of a low, immune enhancing, dose of an mTOR inhibitor, to eradicate normal cells that express a tumor marker as described herein, thereby applicable for use as a cellular conditioning therapy prior to cell transplantation.
  • the normal cells that express a tumor marker as described herein is a normal stem cell and the cell transplantation is a stem cell transplantation.
  • the invention provides an immune effector cell (e.g., T cell, NK cell) engineered to express a chimeric antigen receptor (CAR), wherein the engineered immune effector cell exhibits an anticancer property.
  • a preferred antigen is a cancer associated antigen (i.e., tumor marker) as described herein.
  • the antigen binding domain of the CAR comprises a partially humanized antibody fragment.
  • the antigen binding domain of the CAR comprises a partially humanized scFv. Accordingly, the invention provides CARs that comprises a humanized antigen binding domain and is engineered into an immune effector cell, e.g., a T cell or an NK cell, and methods of their use for adoptive therapy.
  • the CARs of the invention comprise at least one intracellular domain selected from the group of a CD 137 (4- IBB) signaling domain, a CD28 signaling domain, a CD3zeta signal domain, and any combination thereof.
  • the CARs of the invention comprise at least one intracellular signaling domain is from one or more co- stimulatory molecule(s) other than a CD137 (4-1BB) or CD28.
  • CD 8 ATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGG 56
  • CAR scFv fragments are cloned into lentiviral vectors to create a full length CAR construct in a single coding frame, and using a promoter, e.g., EF1 alpha promoter, for expression (SEQ ID NO: 1).
  • a promoter e.g., EF1 alpha promoter
  • the present invention provides immune effector cells (e.g., T cells, NK cells) that are engineered to contain one or more CARs that direct the immune effector cells to cancer for administration in combination with administration of a low, immune enhancing, dose of an mTOR inhibitor.
  • This is achieved through a binding domain on CARs that are specific for cancer associated antigens.
  • cancer associated antigens tumor markers or antigens
  • cancer associated antigens can be targeted by the CARs of the instant invention: (1) cancer associated antigens that are expressed on the surface of cancer cells; and (2) cancer associated antigens that itself is intracellar, however, a fragment of such antigen (peptide) is presented on the surface of the cancer cells by MHC (major histocompatibility complex).
  • the present invention provides CARTs that target the following cancer associated antigens (tumor markers): CD19, CD123, CD22, CD30, CD171, CS-1, CLL-1, CD33, EGFRvIII , GD2, GD3, BCMA, Tn Ag, PSMA, ROR1, FLT3, FAP, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3, KIT, IL-13Ra2, Mesothelin, IL-l lRa, PSCA, VEGFR2, LewisY, CD24, PDGFR-beta, SSEA-4, CD20, Folate receptor alpha, ERBB2 (Her2/neu), MUC1, EGFR, NCAM, Prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, Fucosyl GM1, sLe,
  • cancer associated antigens
  • the tumor antigen is a tumor antigen described in International Application PCT/US2015/020606, which is herein incorporated by reference in its entirety.
  • the tumor antigen is chosen from one or more of: CD19; CD123; CD22; CD30; CD171; CS-1 (also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule- 1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2- 3)bDGalp(l-4)bDGlcp(l-l)Cer); TNF receptor family member B cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAca-Ser/Thr)); pro state- specific membrane antigen (PSMA);
  • EPCAM Epithelial cell adhesion molecule
  • B7H3 CD276
  • KIT CD117
  • Interleukin- 13 receptor subunit alpha-2 IL-13Ra2 or CD213A2
  • Mesothelin Interleukin 11 receptor alpha
  • PSCA prostate stem cell antigen
  • Protease Serine 21 Testisin or PRSS21
  • vascular endothelial growth factor receptor 2 VEGFR2
  • Lewis(Y) antigen CD24
  • PDGFR-beta Stage- specific embryonic antigen-4 (SSEA-4);
  • CD20 Folate receptor alpha; Receptor tyrosine -protein kinase ERBB2 (Her2/neu); Mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); Prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); Ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (LMP2); glycoprotein 100 (gplOO); oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type-A receptor 2 (EphA2); Fu
  • transglutaminase 5 TSS5
  • HMWMAA high molecular weight-melanoma-associated antigen
  • OAcGD2 o-acetyl-GD2 ganglioside
  • Folate receptor beta tumor endothelial marker 1
  • TEM1/CD248 tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); Polysialic acid; placenta- specific 1 (PLAC1); hexasaccharide portion of globoH glycoceramide (GloboH); mammary gland differentiation antigen (NY-BR-1);
  • uroplakin 2 UPK2
  • HAVCR1 Hepatitis A virus cellular receptor 1
  • ADRB3 adrenoceptor beta 3
  • PANX3 pannexin 3
  • GPR20 G protein-coupled receptor 20
  • LY6K lymphocyte antigen 6 complex, locus K 9
  • OR51E2 Olfactory receptor 51E2
  • TCR Gamma Alternate Reading Frame Protein TARP
  • WT1 Cancer/testis antigen 1
  • Cytochrome P450 1B1 (CYP1B1); CCCTC-Binding Factor (Zinc Finger Protein)-Like (BORIS or Brother of the Regulator of Imprinted Sites), Squamous Cell Carcinoma Antigen Recognized By T Cells 3 (SART3); Paired box protein Pax-5 (PAX5); proacrosin binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4); synovial sarcoma, X breakpoint 2 (SSX2); Receptor for Advanced
  • RAGE-1 renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2);
  • LAIR1 Leukocyte-associated immunoglobulin-like receptor 1
  • FCAR Fc fragment of IgA receptor
  • LILRA2 Leukocyte immunoglobulin-like receptor subfamily A member 2
  • CD300LF CD300 molecule-like family member f
  • CLEC12A C-type lectin domain family 12 member A
  • BST2 bone marrow stromal cell antigen 2
  • EMR2 EGF-like module-containing mucin- like hormone receptor-like 2
  • LY75 lymphocyte antigen 75
  • Glypican-3 Glypican-3
  • Fc receptor-like 5 FCRL5
  • IGLL1 immunoglobulin lambda-like polypeptide 1
  • tumor antigen bound by the encoded CAR molecule is chosen from one or more of: TSHR, CD171, CS-1, CLL-1, GD3, Tn Ag, FLT3, CD38, CD44v6, B7H3, KIT, IL-13Ra2, IL-l lRa, PSCA, PRSS21, VEGFR2, LewisY, CD24, PDGFR-beta, SSEA-4, MUC1, EGFR, NCAM, CAIX, LMP2, EphA2, Fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o- acetyl-GD2, Folate receptor beta, TEM1/CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2,
  • the tumor antigen bound by the encoded CAR molecule is chosen from one or more of: TSHR, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, and OR51E2.
  • a CAR as described herein includes a CAR comprising an antigen binding domain (e.g., antibody or antibody fragment) that binds to a MHC presented-peptide.
  • an antigen binding domain e.g., antibody or antibody fragment
  • peptides derived from endogenous proteins fill the pockets of Major histocompatibility complex (MHC) class I molecules, and are recognized by T cell receptors (TCRs) on CD8 + T lymphocytes.
  • TCRs T cell receptors
  • the MHC class I complexes are constitutively expressed by all nucleated cells.
  • virus- specific and/or tumor- specific peptide/MHC complexes represent a unique class of cell surface targets for immunotherapy.
  • HLA-like antibodies targeting peptides derived from viral or tumor antigens in the context of human leukocyte antigen (HLA)-Al or HLA-A2 have been described (see, e.g., Sastry et al., J Virol. 2011 85(5):1935-1942; Sergeeva et al., Bood, 2011
  • TCR-like antibody can be identified from screening a library, such as a human scFv phage displayed library.
  • the present invention provides a CAR, e.g., a RCAR described herein, that comprises an antigen binding domain that binds to a MHC presented peptide of a molecule selected from any tumor antigen described above that is expressed intracellularly, e.g., p53, BCR-Abl, Ras, K-ras, and c-met.
  • a CAR e.g., a RCAR described herein
  • an antigen binding domain that binds to a MHC presented peptide of a molecule selected from any tumor antigen described above that is expressed intracellularly, e.g., p53, BCR-Abl, Ras, K-ras, and c-met.
  • the present invention encompasses the use of a low, immune enhancing, dose of an mTOR inhibitor together with an immune effector cell, e.g., a T cell or NK cell, comprising a CAR.
  • an immune effector cell e.g., a T cell or NK cell, comprising a CAR.
  • the immune effector cell can be engineered to express a CAR by insertion of a recombinant DNA construct comprising sequences encoding a CAR, wherein the CAR comprises an antigen binding domain (e.g., antibody or antibody fragment, TCR or TCR fragment) that binds specifically to a cancer associated antigen as described herein, wherein the sequence of the antibody fragment is contiguous with and in the same reading frame as a nucleic acid sequence encoding an intracellular signaling domain.
  • an antigen binding domain e.g., antibody or antibody fragment, TCR or TCR fragment
  • the intracellular signaling domain can comprise a costimulatory signaling domain and/or a primary signaling domain, e.g., a zeta chain.
  • the costimulatory signaling domain refers to a portion of the CAR comprising at least a portion of the intracellular domain of a costimulatory molecule.
  • the antigen binding domain is a murine antibody or antibody fragment described herein.
  • the antigen binding domain is a humanized antibody or antibody fragment.
  • a CAR construct of the invention comprises a scFv domain, wherein the scFv may be preceded by an optional leader sequence such as provided in SEQ ID NO: 2, and followed by an optional hinge sequence such as provided in SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 or SEQ ID NO: 10, a transmembrane region such as provided in SEQ ID NO: 12, an intracellular signalling domain that includes SEQ ID NO: 14 or SEQ ID NO: 16 and a CD3 zeta sequence that includes SEQ ID NO: 18 or SEQ ID NO:20, wherein the domains are contiguous with and in the same reading frame to form a single fusion protein.
  • an optional leader sequence such as provided in SEQ ID NO: 2
  • an optional hinge sequence such as provided in SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 or SEQ ID NO: 10
  • a transmembrane region such as provided in SEQ ID NO: 12
  • an intracellular signalling domain
  • an exemplary CAR construct comprises an optional leader sequence, an extracellular antigen binding domain, a hinge, a transmembrane domain, and an intracellular stimulatory domain.
  • an exemplary CAR construct comprises an optional leader sequence, an extracellular antigen binding domain, a hinge, a transmembrane domain, an intracellular co stimulatory domain and an intracellular stimulatory domain.
  • An exemplary leader sequence is provided as SEQ ID NO: 2.
  • An exemplary hinge/spacer sequence is provided as SEQ ID NO: 4 or SEQ ID NO:6 or SEQ ID NO: 8 or SEQ ID NO: 10.
  • An exemplary transmembrane domain sequence is provided as SEQ ID NO: 12.
  • An exemplary sequence of the intracellular signaling domain of the 4-1BB protein is provided as SEQ ID NO: 14.
  • An exemplary sequence of the intracellular signaling domain of CD27 is provided as SEQ ID NO: 16.
  • An exemplary CD3zeta domain sequence is provided as SEQ ID NO: 18 or SEQ ID NO:20.
  • the present invention encompasses a recombinant nucleic acid construct comprising a nucleic acid molecule encoding a CAR, wherein the nucleic acid molecule comprises the nucleic acid sequence encoding an antigen binding domain, e.g., described herein, that is contiguous with and in the same reading frame as a nucleic acid sequence encoding an intracellular signaling domain.
  • the present invention encompasses the use of a recombinant nucleic acid construct comprising a transgene encoding a CAR, wherein the nucleic acid molecule comprises a nucleic acid sequence encoding an antigen binding domain, wherein the sequence is contiguous with and in the same reading frame as the nucleic acid sequence encoding an intracellular signaling domain.
  • An exemplary intracellular signaling domain that can be used in the CAR includes, but is not limited to, one or more intracellular signaling domains of, e.g., CD3-zeta, CD28, 4-1BB, and the like. In some instances, the CAR can comprise any combination of CD3-zeta, CD28, 4-1BB, and the like.
  • nucleic acid sequences coding for the desired molecules can be obtained using recombinant methods known in the art, such as, for example by screening libraries from cells expressing the gene, by deriving the gene from a vector known to include the same, or by isolating directly from cells and tissues containing the same, using standard techniques.
  • nucleic acid of interest can be produced synthetically, rather than be cloned.
  • the present invention includes the use of retroviral and lentiviral vector constructs expressing a CAR that can be directly transduced into a cell.
  • the present invention also includes the use of an RNA construct that can be directly transfected into a cell.
  • a method for generating mRNA for use in transfection involves in vitro transcription (IVT) of a template with specially designed primers, followed by polyA addition, to produce a construct containing 3' and 5' untranslated sequence ("UTR"), a 5' cap and/or Internal Ribosome Entry Site (IRES), the nucleic acid to be expressed, and a polyA tail, typically 50- 2000 bases in length (SEQ ID NO:32).
  • RNA so produced can efficiently transfect different kinds of cells.
  • the template includes sequences for the CAR.
  • an RNA CAR vector is transduced into a T cell by electroporation.
  • the CAR used in the invention comprises a target- specific binding element otherwise referred to as an antigen binding domain.
  • the choice of moiety depends upon the type and number of ligands that define the surface of a target cell.
  • the antigen binding domain may be chosen to recognize an antigen that acts as a cell surface marker on target cells associated with a particular disease state.
  • cell surface markers that may act as ligands for the antigen binding domain in a CAR of the invention include those associated with viral, bacterial and parasitic infections, autoimmune disease and cancer cells.
  • the CAR-mediated T-cell response can be directed to an antigen of interest by way of engineering an antigen binding domain that specifically binds a desired antigen into the CAR.
  • the portion of the CAR comprising the antigen binding domain comprises an antigen binding domain that targets a tumor marker as described above.
  • the portion of the CAR comprising the antigen binding domain comprises an antigen binding domain that targets CD 19.
  • the antigen binding domain targets human CD 19.
  • the antigen binding domain of the CAR has the same or a similar binding specificity as the FMC63 scFv fragment described in Nicholson et al. Mol. Immun. 34 (16-17): 1157-1165 (1997).
  • the antigen binding domain of the CAR includes the scFv fragment described in Nicholson et al. Mol. Immun. 34 (16-17): 1157-1165 (1997).
  • a CD19 antibody molecule can be, e.g., an antibody molecule (e.g., a humanized anti-CD19 antibody molecule) described in WO2014/153270, which is incorporated herein by reference in its entirety.
  • WO2014/153270 also describes methods of assaying the binding and efficacy of various CART constructs.
  • the antigen binding domain can be any domain that binds to the antigen including but not limited to a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a human antibody, a humanized antibody, and a functional fragment thereof, including but not limited to a single-domain antibody such as a heavy chain variable domain (VH), a light chain variable domain (VL) and a variable domain (VHH) of camelid derived nanobody, and to an alternative scaffold known in the art to function as antigen binding domain, such as a recombinant fibronectin domain, a T cell receptor (TCR), or a fragment there of, e.g., single chain TCR, and the like.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • VHH variable domain of camelid derived nanobody
  • an alternative scaffold known in the art to function as antigen binding domain such as a recombinant fibronectin domain, a T cell receptor (TCR), or a fragment there of,
  • the antigen binding domain it is beneficial for the antigen binding domain to be derived from the same species in which the CAR will ultimately be used in.
  • the antigen binding domain of the CAR it may be beneficial for the antigen binding domain of the CAR to comprise human or humanized residues for the antigen binding domain of an antibody or antibody fragment.
  • the antigen binding domain against CD22 is derived from antibodies as described in, e.g., Haso et al., Blood, 121(7): 1165-1174 (2013); Wayne et al., Clin Cancer Res 16(6): 1894-1903 (2010); Kato et al., Leuk Res 37(l):83-88 (2013); Creative BioMart (creativebiomart.net): MOM-18047-S(P).
  • the antigen binding domain against CS-1 is derived from
  • the antigen binding domain against CLL-1 is derived from antibodies that are available from R&D, ebiosciences, Abeam, for example, PE-CLLl-hu Cat# 353604 (BioLegend); and PE-CLL1 (CLEC12A) Cat# 562566 (BD).
  • the antigen binding domain against CD33 is derived from antibodies as described in, e.g., Bross et al., Clin Cancer Res 7(6): 1490-1496 (2001)
  • the antigen binding domain against GD2 is derived from antibodies as described in, e.g., Mujoo et al., Cancer Res.
  • the antigen binding domain against BCMA is derived from antibodies as described in, e.g., WO2012163805, WO200112812, and WO2003062401.
  • the antigen binding domain against Tn antigen is derived from antibodies as described in, e.g., US8,440,798, Brooks et al., PNAS 107(22): 10056-10061 (2010), and Stone et al., Oncolmmunology 1(6):863-873(2012).
  • the antigen binding domain against PSMA is derived from antibodies as described in, e.g., Parker et al., Protein Expr Purif 89(2):136-145 (2013), US 20110268656 (J591 ScFv); Frigerio et al, European J Cancer 49(9):2223-2232 (2013)
  • the antigen binding domain against ROR1 is derived from antibodies as described in, e.g., Hudecek et al., Clin Cancer Res 19(12):3153-3164 (2013); WO 2011159847; and US20130101607.
  • the antigen binding domain against FLT3 is derived from antibodies as described in, e.g., WO2011076922, US5777084, EP0754230, US20090297529, and several commercial catalog antibodies (R&D, ebiosciences, Abeam).
  • the antigen binding domain against TAG72 is derived from antibodies as described in, e.g., Hombach et al., Gastroenterology 113(4):1163-1170 (1997); and Abeam ab691.
  • the antigen binding domain agaist FAP is derived from antibodies described in, e.g., Ostermann et al., Clinical Cancer Research 14:4584-4592 (2008) (FAP5), US Pat. Publication No. 2009/0304718; sibrotuzumab (see e.g., Hofheinz et al., Oncology Research and Treatment 26(1), 2003); and Tran et al., J Exp Med 210(6):1125-1135 (2013).
  • the antigen binding domain against CD38 is derived from daratumumab (see, e.g., Groen et al., Blood 116(21):1261-1262 (2010); MOR202 (see, e.g., US8,263,746); or antibodies described in US8,362,211.
  • the antigen binding domain against CD44v6 is derived from antibodies as described in, e.g., Casucci et al., Blood 122(20):3461-3472 (2013).
  • the antigen binding domain against CEA is derived from antibodies as described in, e.g., Chmielewski et al., Gastoenterology 143(4): 1095-1107 (2012).
  • the antigen binding domain against EPCAM is derived from MT110, EpCAM-CD3 bispecific Ab (see, e.g., clinicaltrials.gov/ct2/show/NCT00635596); Edrecolomab; 3622W94; ING-1; and adecatumumab (MT201).
  • the antigen binding domain against B7H3 is derived from MGA271 (Macrogenics).
  • the antigen binding domain against KIT is derived from antibodies as described in, e.g., US7915391, US20120288506 , and several commercial catalog antibodies.
  • the antigen binding domain against IL-13Ra2 is derived from antibodies as described in, e.g., WO2008/146911, WO2004087758, several commercial catalog antibodies, and WO2004087758.
  • the antigen binding domain against CD30 is derived from antibodies as described in, e.g., US7090843 Bl, and EP0805871.
  • the antigen binding domain against GD3 is derived from antibodies as described in, e.g., US7253263; US 8,207,308; US 20120276046; EP1013761; WO2005035577; and US6437098.
  • the antigen binding domain against CD171 is derived from antibodies as described in, e.g., Hong et al., J Immunother 37(2):93-104 (2014).
  • the antigen binding domain against IL-1 IRa is derived from antibodies that are available from Abeam (cat# ab55262) and Novus Biologicals (cat#
  • the antigen binding domain again IL-1 IRa is a peptide, see, e.g., Huang et al., Cancer Res 72(1):271-281 (2012).
  • the antigen binding domain against PSCA is derived from antibodies as described in, e.g., Morgenroth et al., Prostate 67(10): 1121-1131 (2007) (scFv 7F5); Nejatollahi et al., J of Oncology 2013(2013), article ID 839831 (scFv C5-II); and US Pat Publication No. 20090311181.
  • the antigen binding domain against VEGFR2 is derived from antibodies as described in, e.g., Chinnasamy et al., J Clin Invest 120(11):3953-3968 (2010).
  • the antigen binding domain against LewisY is derived from antibodies as described in, e.g., Kelly et al., Cancer Biother Radiopharm 23(4):411-423 (2008) (hu3S193 Ab (scFvs)); Dolezal et al., Protein Engineering 16(l):47-56 (2003) (NC10 scFv).
  • the antigen binding domain against CD24 is derived from antibodies as described in, e.g., Maliar et al., Gastroenterology 143(5): 1375-1384 (2012).
  • the antigen binding domain against PDGFR-beta is derived from Abeam ab32570.
  • the antigen binding domain against SSEA-4 is derived from MC813 (Cell Signaling), and other commercially available antibody reagent.
  • the antigen binding domain against CD20 is derived from Rituximab, Ofatumumab, Ocrelizumab, Veltuzumab, or GA101.
  • the antigen binding domain against Folate receptor alpha is derived from antibody component of IMGN853, US20120009181; US4851332, LK26:
  • the antigen binding domain against ERBB2 (Her2/neu) is derived from trastuzumab, or pertuzumab.
  • the antigen binding domain against MUC1 is derived from the antibody component of SAR566658.
  • the antigen binding domain against EGFR is derived from cetuximab, panitumumab, zalutumumab, nimotuzumab, or matuzumab.
  • the antigen binding domain against NCAM is derived from clone 2-2B: MAB5324 (EMD milipore)
  • the antigen binding domain against Ephrin B2 is derived from antibodies as described in, e.g., Abengozar et al., Blood 119(19):4565-4576 (2012).
  • the antigen binding domain against IGF-I receptor is derived from antibodies as described in, e.g., US8344112 B2; EP2322550 Al; WO 2006/138315, and PCT/US2006/022995.
  • the antigen binding domain against CAIX is derived from clone 303123 (R&D Systems).
  • the antigen binding domain against LMP2 is derived from antibodies as described in, e.g., US7,410,640, and US20050129701.
  • the antigen binding domain against gplOO is derived from HMB45, NKIbetaB, those described in WO2013165940, or US20130295007
  • the antigen binding domain against tyrosinase is derived from antibodies as described in, e.g., US5843674; or US19950504048.
  • the antigen binding domain against EphA2 is derived from antibodies as described in, e.g., Yu et al., Mol Ther 22(1): 102-111 (2014).
  • the antigen binding domain against GD3 is derived from antibodies as described in, e.g., US7253263; US 8,207,308; US 20120276046; EP1013761 A3; 20120276046; WO2005035577; or US6437098.
  • the antigen binding domain against fucosyl GM1 is derived from antibodies as described in, e.g., US20100297138; or WO2007/067992.
  • the antigen binding domain against sLe is derived from G193 (for lewis Y), see Scott AM et al, Cancer Res 60: 3254-61 (2000), also as described in Neeson et al, J Immunol May 2013 190 (Meeting Abstract Supplement) 177.10.
  • the antigen binding domain against GM3 is derived from CA 2523449 (mAb 14F7).
  • the antigen binding domain against HMWMAA is derived from antibodies as described in, e.g., Kmiecik et al., Oncoimmunology 3(l):e27185 (2014) (PMID: 24575382) (mAb9.2.27); US6528481; WO2010033866; or US 20140004124.
  • the antigen binding domain against o-acetyl-GD2 is derived from 8B6.
  • the antigen binding domain against TEM1/CD248 is derived from antibodies as described in, e.g., Marty et al., Cancer Lett 235(2):298-308 (2006); Zhao et al., J Immunol Methods 363(2):221-232 (2011).
  • the antigen binding domain against CLDN6 is derived from IMAB027 (Ganymed Pharmaceuticals), see e.g., clinicaltrial.gov/show/NCT02054351.
  • the antigen binding domain against TSHR is derived from antibodies as described in, e.g., US8,603,466; US8,501,415; or US8,309,693.
  • the antigen binding domain against GPRC5D is derived from FAB6300A (R&D Systems); or LS-A4180 (Lifespan Biosciences).
  • the antigen binding domain against CD97 is derived from antibodies as described in, e.g., US6,846,911;de Groot et al., J Immunol 183(6):4127-4134 (2009); antibody from R&D:MAB3734.
  • the antigen binding domain against ALK is derived from antibodies as described in, e.g., Mino-Kenudson et al., Clin Cancer Res 16(5):1561-1571 (2010).
  • the antigen binding domain against plysialic acid is derived from antibodies as described in, e.g., Nagae et al., J Biol Chem 288(47):33784-33796 (2013).
  • the antigen binding domain against PLAC1 is derived from antibodies as described in, e.g., Ghods et al., Biotechnol Appl Biochem 2013
  • the antigen binding domain against GloboH is derived from VK9; or those described in, e.g., Kudryashov V et al, Glycoconj J.15(3):243-9 ( 1998), Lou et al., Proc Natl Acad Sci USA l l l(7):2482-2487 (2014) ; MBrl: Bremer E-G et al. J Biol Chem 259:14773-14777 (1984).
  • the antigen binding domain against NY-BR-1 is derived from antibodies as described in, e.g., Jager et al., Appl Immunohitochem Mol Morphol 15(l):77-83 (2007).
  • the antigen binding domain against WT-1 is derived from antibodies as described in, e.g., Dao et al., Sci Transl Med 5(176): 176ra33 (2013); or
  • the antigen binding domain against MAGE-A1 is derived from antibodies as described in, e.g., Willemsen et al., J Immunol 174(12):7853-7858 (2005) (TCR- like scFV).
  • the antigen binding domain against sperm protein 17 is derived from antibodies as described in, e.g., Song et al., Target Oncol 2013 Aug 14 (PMID: 23943313); Song et al., Med Oncol 29(4):2923-2931 (2012).
  • the antigen binding domain against Tie 2 is derived from AB33 (Cell Signaling Technology).
  • the antigen binding domain against MAD-CT-2 is derived from antibodies as described in, e.g., PMID: 2450952; US7635753.
  • the antigen binding domain against Fos-related antigen 1 is derived froml2F9 (Novus Biologicals).
  • the antigen binding domain against MelanA/MARTl is derived from antibodies as described in, EP2514766 A2; US 7,749,719.
  • the antigen binding domain against sarcoma translocation breakpoints is derived from antibodies as described in, e.g., Luo et al, EMBO Mol. Med.
  • the antigen binding domain against TRP-2 is derived from antibodies as described in, e.g., Wang et al, J Exp Med. 184(6):2207-16 (1996).
  • the antigen binding domain against CYP1B1 is derived from antibodies as described in, e.g., Maecker et al, Blood 102 (9): 3287-3294 (2003).
  • the antigen binding domain against RAGE-1 is derived from MAB5328 (EMD Milipore).
  • the antigen binding domain against human telomerase reverse transcriptase is derived from cat no: LS-B95-100 (Lifespan Biosciences)
  • the antigen binding domain against intestinal carboxyl esterase is derived from 4F12: cat no: LS-B6190-50 (Lifespan Biosciences).
  • the antigen binding domain against mut hsp70-2 is derived from Lifespan Biossciences: monoclonal: cat no: LS-C133261-100 (Lifespan Biosciences).
  • An antigen binding domain can comprise a sequence from Table 3.
  • the antigen binding domain comprises any antibody, or a fragment thereof, e.g., an scFv, known in the art that targets or specifically binds to any one of the following: BCMA (also known as TNFRSF17, Tumor Necrosis Factor Receptor Superfamily, Member 17, or B Cell Maturation Antigen), CD33, CLL-1 (also known as C-type Lectin- Like domain family 1, or CLECL1), claudin-6 (CLDN6) or WT-1 (Wilms tumor 1).
  • BCMA also known as TNFRSF17, Tumor Necrosis Factor Receptor Superfamily, Member 17, or B Cell Maturation Antigen
  • CD33 also known as TNFRSF17, Tumor Necrosis Factor Receptor Superfamily, Member 17, or B Cell Maturation Antigen
  • CLL-1 also known as C-type Lectin- Like domain family 1, or CLECL1
  • CLDN6 claudin-6
  • WT-1 Wild T-1
  • the antigen binding domain comprises an anti-CD 19 antibody, or fragment thereof, e.g., an scFv.
  • the antigen binding domain comprises a variable heavy chain and a variable light chain listed inTable 8.
  • the linker sequence joining the variable heavy and variable light chains can be any of the linker sequences described herein, or alternatively, can be GSTSGSGKPGSGEGSTKG (SEQ ID NO: 76).
  • any known CD19 CAR e.g., the CD19 antigen binding domain of any known CD19 CAR, in the art can be used in accordance with the instant invention.
  • CD19 CAR described in the US Pat. No.8,399,645; US Pat.
  • the antigen binding domain comprises one, two three (e.g., all three) heavy chain CDRs, HC CDRl, HC CDR2 and HC CDR3, from an antibody listed above, and/or one, two, three (e.g., all three) light chain CDRs, LC CDRl, LC CDR2 and LC CDR3, from an antibody listed above.
  • the antigen binding domain comprises a heavy chain variable region and/or a variable light chain region of an antibody listed above.
  • the antigen binding domain comprises a HC CDRl, a HC CDR2, and a HC CDR3 of any heavy chain binding domain amino acid sequences listed in Table 3.
  • the antigen binding domain further comprises a LC CDRl, a LC CDR2, and a LC CDR3.
  • the antigen binding domain comprises a LC CDRl, a LC CDR2, and a LC CDR3 of any light chain binding domain amino acid sequences listed in Table 3.
  • the antigen binding domain comprises one, two or all of
  • the CDRs are defined according to the Kabat numbering scheme, the Chothia numbering scheme, or a combination thereof.
  • the order in which the VL and VH domains appear in the scFv is varied (i.e., VL-VH, or VH-VL orientation), and where either three or four copies of the "G4S" (SEQ ID NO:25) subunit, in which each subunit comprises the sequence GGGGS (SEQ ID NO:28) (e.g., (G4S)3 (SEQ ID NO:30) or (G4S)4(SEQ ID NO:29)), connect the variable domains to create the entirety of the scFv domain.
  • the CAR construct can include, for example, a linker including the sequence GSTSGSGKPGSGEGSTKG (SEQ ID NO: 95)
  • Exemplary sequences of various scFv fragments and other CAR components are provided herein. It is noted that these CAR components (e.g., of SEQ ID Nos. 42, 26) without a leader sequence (e.g., without the amino acid sequence of SEQ ID NO: 2 or the nucleotide sequence of SEQ ID NO:3), are also provided herein.
  • the CAR sequences described herein contain a Q/K residue change in the signal domain of the co-stimulatory domain derived from CD3zeta chain.
  • the antigen binding domain comprises a humanized antibody or an antibody fragment.
  • a non-human antibody is humanized, where specific sequences or regions of the antibody are modified to increase similarity to an antibody naturally produced in a human or fragment thereof.
  • the antigen binding domain is humanized.
  • a humanized antibody can be produced using a variety of techniques known in the art, including but not limited to, CDR-grafting (see, e.g., European Patent No. EP 239,400;
  • framework substitutions are identified by methods well-known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089; and Riechmann et al., 1988, Nature, 332:323, which are incorporated herein by reference in their entireties.)
  • a humanized antibody or antibody fragment has one or more amino acid residues remaining in it from a source which is nonhuman. These nonhuman amino acid residues are often referred to as "import” residues, which are typically taken from an "import” variable domain.
  • humanized antibodies or antibody fragments comprise one or more CDRs from nonhuman immunoglobulin molecules and framework regions wherein the amino acid residues comprising the framework are derived completely or mostly from human germline.
  • variable domains both light and heavy
  • the choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is to reduce antigenicity.
  • sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences.
  • the human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol., 151:2296 (1993); Chothia et al., J. Mol. Biol., 196:901 (1987), the contents of which are incorporated herein by reference herein in their entirety).
  • Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains.
  • the same framework may be used for several different humanized antibodies (see, e.g., Nicholson et al. Mol. Immun. 34 (16-17): 1157-1165 (1997); Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993), the contents of which are incorporated herein by reference herein in their entirety).
  • the framework region e.g., all four framework regions, of the heavy chain variable region are derived from a VH4_4-59 germline sequence.
  • the framework region can comprise, one, two, three, four or five modifications, e.g., substitutions, e.g., from the amino acid at the corresponding murine sequence.
  • the framework region e.g., all four framework regions of the light chain variable region are derived from a VK3_1.25 germline sequence.
  • the framework region can comprise, one, two, three, four or five modifications, e.g., substitutions, e.g., from the amino acid at the corresponding murine sequence.
  • the portion of a CAR composition of the invention that comprises an antibody fragment is humanized with retention of high affinity for the target antigen and other favorable biological properties.
  • humanized antibodies and antibody fragments are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences.
  • Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, e.g., the analysis of residues that influence the ability of the candidate immunoglobulin to bind the target antigen.
  • FR residues can be selected and combined from the recipient and import sequences so that the desired antibody or antibody fragment characteristic, such as increased affinity for the target antigen, is achieved.
  • the CDR residues are directly and most substantially involved in influencing antigen binding.
  • a humanized antibody or antibody fragment may retain a similar antigenic specificity as the original antibody, e.g., in the present invention, the ability to bind human a cancer associated antigen as described herein.
  • a humanized antibody or antibody fragment may have improved affinity and/or specificity of binding to human a cancer associated antigen as described herein.
  • the antigen binding domain of the invention is characterized by particular functional features or properties of an antibody or antibody fragment.
  • the portion of a CAR composition of the invention that comprises an antigen binding domain specifically binds a tumor marker as described herein.
  • the anti- cancer associated antigen as described herein binding domain is a fragment, e.g., a single chain variable fragment (scFv).
  • the anti- cancer associated antigen as described herein binding domain is a Fv, a Fab, a (Fab')2, or a bi-functional (e.g. bi-specific) hybrid antibody (e.g., Lanzavecchia et al., Eur. J. Immunol. 17, 105 (1987)).
  • the antibodies and fragments thereof of the invention binds a cancer associated antigen as described herein protein with wild-type or enhanced affinity.
  • scFvs can be prepared according to method known in the art (see, for example, Bird et al., (1988) Science 242:423-426 and Huston et al., (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883).
  • ScFv molecules can be produced by linking VH and VL regions together using flexible polypeptide linkers.
  • the scFv molecules comprise a linker (e.g., a Ser- Gly linker) with an optimized length and/or amino acid composition. The linker length can greatly affect how the variable regions of a scFv fold and interact.
  • WO2007/024715 is incorporated herein by reference.
  • An scFv can comprise a linker of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more amino acid residues between its VL and VH regions.
  • the linker sequence may comprise any naturally occurring amino acid.
  • the linker sequence comprises amino acids glycine and serine.
  • the linker sequence comprises sets of glycine and serine repeats such as (Gly 4 Ser) n , where n is a positive integer equal to or greater than 1 (SEQ ID NO:22).
  • the linker can be (Gly 4 Ser) 4 (SEQ ID NO:29) or (Gly 4 Ser) 3 (SEQ ID NO:30). Variation in the linker length may retain or enhance activity, giving rise to superior efficacy in activity studies.
  • the antigen binding domain is a T cell receptor ("TCR"), or a fragment thereof, for example, a single chain TCR (scTCR).
  • TCR T cell receptor
  • scTCR single chain TCR
  • scTCR can be engineered that contains the Va and ⁇ genes from a T cell clone linked by a linker (e.g., a flexible peptide).
  • a linker e.g., a flexible peptide
  • an anti- cancer associated antigen as described herein binding domain e.g., scFv molecules (e.g., soluble scFv) can be evaluated in reference to the biophysical properties (e.g., thermal stability) of a conventional control scFv molecule or a full length antibody.
  • the humanized scFv has a thermal stability that is greater than about 0.1, about 0.25, about 0.5, about 0.75, about 1, about 1.25, about 1.5, about 1.75, about 2, about 2.5, about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, about 9, about 9.5, about 10 degrees, about 11 degrees, about 12 degrees, about 13 degrees, about 14 degrees, or about 15 degrees Celsius than a control binding molecule (e.g. a conventional scFv molecule) in the described assays.
  • a control binding molecule e.g. a conventional scFv molecule
  • the improved thermal stability of the anti- cancer associated antigen as described herein binding domain is subsequently conferred to the entire CART19 construct, leading to improved therapeutic properties of the CART19 construct.
  • the thermal stability of the anti- cancer associated antigen as described herein binding domain, e.g., scFv can be improved by at least about 2°C or 3°C as compared to a conventional antibody.
  • the anti- cancer associated antigen as described herein binding domain, e.g., scFv has a 1°C improved thermal stability as compared to a conventional antibody.
  • the anti- cancer associated antigen as described herein binding domain e.g., scFv has a 2°C improved thermal stability as compared to a conventional antibody.
  • the scFv has a 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15°C improved thermal stability as compared to a conventional antibody. Comparisons can be made, for example, between the scFv molecules disclosed herein and scFv molecules or Fab fragments of an antibody from which the scFv VH and VL were derived.
  • Thermal stability can be measured using methods known in the art. For example, in one embodiment, Tm can be measured. Methods for measuring Tm and other methods of determining protein stability are described in more detail below.
  • the binding capacity of the mutant scFvs can be determined using assays described in the Examples.
  • the anti- cancer associated antigen as described herein binding domain e.g., scFv comprises at least one mutation arising from the humanization process such that the mutated scFv confers improved stability to the CAR construct.
  • the anti- cancer associated antigen as described herein binding domain e.g., scFv comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 mutations arising from the humanization process such that the mutated scFv confers improved stability to the CAR construct.
  • the stability of an antigen binding domain may be assessed using, e.g., the methods described below. Such methods allow for the determination of multiple thermal unfolding transitions where the least stable domain either unfolds first or limits the overall stability threshold of a multidomain unit that unfolds cooperatively (e.g., a multidomain protein which exhibits a single unfolding transition).
  • the least stable domain can be identified in a number of additional ways. Mutagenesis can be performed to probe which domain limits the overall stability. Additionally, protease resistance of a multidomain protein can be performed under conditions where the least stable domain is known to be intrinsically unfolded via DSC or other spectroscopic methods (Fontana, et al., (1997) Fold.
  • thermal stability of the compositions may be analyzed using a number of non- limiting biophysical or biochemical techniques known in the art. In certain embodiments, thermal stability is evaluated by analytical spectroscopy.
  • DSC Differential Scanning Calorimetry
  • Calorimeter which is sensitive to the heat absorbances that accompany the unfolding of most proteins or protein domains (see, e.g. Sanchez-Ruiz, et al., Biochemistry, 27: 1648-52, 1988).
  • To determine the thermal stability of a protein a sample of the protein is inserted into the calorimeter and the temperature is raised until the Fab or scFv unfolds. The temperature at which the protein unfolds is indicative of overall protein stability.
  • CD Circular Dichroism
  • CD spectrometry measures the optical activity of a composition as a function of increasing temperature.
  • Circular dichroism (CD) spectroscopy measures differences in the absorption of left-handed polarized light versus right-handed polarized light which arise due to structural asymmetry.
  • a disordered or unfolded structure results in a CD spectrum very different from that of an ordered or folded structure.
  • the CD spectrum reflects the sensitivity of the proteins to the denaturing effects of increasing temperature and is therefore indicative of a protein's thermal stability (see van Mierlo and Steemsma, J. Biotechnol., 79(3):281-98, 2000).
  • Another exemplary analytical spectroscopy method for measuring thermal stability is Fluorescence Emission Spectroscopy (see van Mierlo and Steemsma, supra).
  • Yet another exemplary analytical spectroscopy method for measuring thermal stability is Nuclear Magnetic Resonance (NMR) spectroscopy (see, e.g. van Mierlo and Steemsma, supra).
  • NMR Nuclear Magnetic Resonance
  • the thermal stability of a composition can be measured biochemically.
  • An exemplary biochemical method for assessing thermal stability is a thermal challenge assay.
  • a composition is subjected to a range of elevated temperatures for a set period of time.
  • test scFv molecules or molecules comprising scFv molecules are subject to a range of increasing temperatures, e.g., for 1-1.5 hours.
  • the activity of the protein is then assayed by a relevant biochemical assay.
  • the protein is a binding protein (e.g. an scFv or scFv-containing polypeptide) the binding activity of the binding protein may be determined by a functional or quantitative ELISA.
  • Such an assay may be done in a high-throughput format, e.g., using E. coli and high throughput screening.
  • a library of anti- cancer associated antigen as described herein binding domain, e.g., scFv variants may be created using methods known in the art.
  • Anti- cancer associated antigen as described herein binding domain, e.g., scFv expression may be induced and the anti- cancer associated antigen as described herein binding domain, e.g., scFv may be subjected to thermal challenge.
  • the challenged test samples may be assayed for binding and those anti- cancer associated antigen as described herein binding domain, e.g., scFvs which are stable may be scaled up and further characterized.
  • Thermal stability is evaluated by measuring the melting temperature (Tm) of a composition using any of the above techniques (e.g. analytical spectroscopy techniques).
  • the melting temperature is the temperature at the midpoint of a thermal transition curve wherein 50% of molecules of a composition are in a folded state (See e.g., Dimasi et al. (2009) J. Mol Biol. 393: 672-692).
  • Tm values for an anti- cancer associated antigen as described herein binding domain are about 40°C, 41 °C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 81°C, 82°C, 83°C, 84°C, 85°C, 86°C, 87°C, 88°C,
  • Tm values for an IgG is about 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 81°C, 82°C, 83°C, 84°C, 85°C, 86°C, 87°C, 88°C, 89°C, 90°C, 91°C, 92°C, 93
  • Tm values for an multivalent antibody is about 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 81°C, 82°C, 83°C, 84°C, 85°C, 86°C, 87°C, 88°C, 89°C, 90°C, 91°C, 92°C, 93
  • Thermal stability is also evaluated by measuring the specific heat or heat capacity (Cp) of a composition using an analytical calorimetric technique (e.g. DSC).
  • the specific heat of a composition is the energy (e.g. in kcal/mol) is required to rise by 1°C, the temperature of 1 mol of water.
  • the change in heat capacity (ACp) of a composition is measured by determining the specific heat of a composition before and after its thermal transition.
  • Thermal stability may also be evaluated by measuring or determining other parameters of thermodynamic stability including Gibbs free energy of unfolding (AG), enthalpy of unfolding (AH), or entropy of unfolding (AS).
  • One or more of the above biochemical assays e.g. a thermal challenge assay
  • the temperature i.e. the T c value
  • 50% of the composition retains its activity e.g. binding activity
  • mutations to the anti- cancer associated antigen as described herein binding domain alter the thermal stability of the anti- cancer associated antigen as described herein binding domain, e.g., scFv compared with the unmutated anti- cancer associated antigen as described herein binding domain, e.g., scFv.
  • the humanized anti- cancer associated antigen as described herein binding domain e.g., scFv is incorporated into a CART19 construct
  • the anti- cancer associated antigen as described herein binding domain e.g., humanized scFv confers thermal stability to the overall anti-CARs of the present invention.
  • the anti- cancer associated antigen as described herein binding domain e.g., scFv comprises a single mutation that confers thermal stability to the anti- cancer associated antigen as described herein binding domain, e.g., scFv.
  • the anti- cancer associated antigen as described herein binding domain, e.g., scFv comprises multiple mutations that confer thermal stability to the anti- cancer associated antigen as described herein binding domain, e.g., scFv.
  • the multiple mutations in the anti- cancer associated antigen as described herein binding domain e.g., scFv have an additive effect on thermal stability of the anti- cancer associated antigen as described herein binding domain, e.g., scFv. b) % Aggregation
  • the stability of a composition can be determined by measuring its propensity to aggregate. Aggregation can be measured by a number of non-limiting biochemical or biophysical techniques. For example, the aggregation of a composition may be evaluated using
  • SEC Size-Exclusion Chromatography
  • the large aggregates move more rapidly through the column, and in this way the mixture can be separated or fractionated into its components.
  • Each fraction can be separately quantified (e.g. by light scattering) as it elutes from the gel.
  • the % aggregation of a composition can be determined by comparing the concentration of a fraction with the total concentration of protein applied to the gel. Stable compositions elute from the column as essentially a single fraction and appear as essentially a single peak in the elution profile or chromatogram. c) Binding Affinity
  • the stability of a composition can be assessed by determining its target binding affinity.
  • a wide variety of methods for determining binding affinity are known in the art.
  • An exemplary method for determining binding affinity employs surface plasmon resonance.
  • Surface plasmon resonance is an optical phenomenon that allows for the analysis of real-time biospecific interactions by detection of alterations in protein concentrations within a biosensor matrix, for example using the BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, N.J.). For further descriptions, see Jonsson, U., et al. (1993) Ann. Biol. Clin.
  • the antigen binding domain of the CAR comprises an amino acid sequence that is homologous to an antigen binding domain amino acid sequence described herein, and the antigen binding domain retains the desired functional properties of the anticancer associated antigen as described herein antibody fragments described herein.
  • the CAR composition of the invention comprises an antibody fragment.
  • that antibody fragment comprises a scFv.
  • the antigen binding domain of the CAR is engineered by modifying one or more amino acids within one or both variable regions (e.g., VH and/or VL), for example within one or more CDR regions and/or within one or more framework regions.
  • the CAR composition of the invention comprises an antibody fragment.
  • that antibody fragment comprises a scFv.
  • the antibody or antibody fragment of the invention may further be modified such that they vary in amino acid sequence (e.g., from wild-type), but not in desired activity.
  • additional nucleotide e.g., from wild-type, but not in desired activity.
  • substitutions leading to amino acid substitutions at "non-essential" amino acid residues may be made to the protein
  • a nonessential amino acid residue in a molecule may be replaced with another amino acid residue from the same side chain family.
  • a string of amino acids can be replaced with a structurally similar string that differs in order and/or composition of side chain family members, e.g., a conservative substitution, in which an amino acid residue is replaced with an amino acid residue having a similar side chain, may be made.
  • Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid
  • Percent identity in the context of two or more nucleic acids or polypeptide sequences refers to two or more sequences that are the same. Two sequences are "substantially identical" if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 60% identity, optionally 70%, 71%. 72%.
  • the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. Math.
  • BESTFIT FASTA
  • TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, e.g., Brent et al., (2003) Current Protocols in Molecular Biology).
  • BLAST and BLAST 2.0 algorithms Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402; and Altschul et al., (1990) J. Mol. Biol. 215:403-410, respectively.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
  • the percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller, (1988) Comput. Appl. Biosci. 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (1970) J. Mol. Biol.
  • the present invention contemplates modifications of the starting antibody or fragment (e.g., scFv) amino acid sequence that generate functionally equivalent molecules.
  • the VH or VL of an anti- cancer associated antigen as described herein binding domain, e.g., scFv, comprised in the CAR can be modified to retain at least about 70%, 71%. 72%.
  • the present invention contemplates modifications of the entire CAR construct, e.g., modifications in one or more amino acid sequences of the various domains of the CAR construct in order to generate functionally equivalent molecules.
  • the CAR construct can be modified to retain at least about 70%, 71%. 72%.
  • a multispecific antibody molecule is a bispecific antibody molecule.
  • a bispecific antibody has specificity for no more than two antigens.
  • a bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence which has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.
  • the first and second epitopes are on the same antigen, e.g., the same protein (or subunit of a multimeric protein).
  • the first and second epitopes overlap.
  • the first and second epitopes do not overlap.
  • the first and second epitopes are on different antigens, e.g., different proteins (or different subunits of a multimeric protein).
  • a bispecific antibody molecule comprises a heavy chain variable domain sequence and a light chain variable domain sequence which have binding specificity for a first epitope and a heavy chain variable domain sequence and a light chain variable domain sequence which have binding specificity for a second epitope.
  • a bispecific antibody molecule comprises a half antibody having binding specificity for a first epitope and a half antibody having binding specificity for a second epitope.
  • a bispecific antibody molecule comprises a half antibody, or fragment thereof, having binding specificity for a first epitope and a half antibody, or fragment thereof, having binding specificity for a second epitope.
  • a bispecific antibody molecule comprises a scFv, or fragment thereof, have binding specificity for a first epitope and a scFv, or fragment thereof, have binding specificity for a second epitope.
  • the antibody molecule is a multi- specific (e.g., a bispecific or a trispecific) antibody molecule.
  • Protocols for generating bispecific or heterodimeric antibody molecules are known in the art; including but not limited to, for example, the "knob in a hole" approach described in, e.g., US 5731168; the electrostatic steering Fc pairing as described in, e.g., WO 09/089004, WO 06/106905 and WO 2010/129304; Strand Exchange Engineered Domains (SEED) heterodimer formation as described in, e.g., WO 07/110205; Fab arm exchange as described in, e.g., WO 08/119353, WO 2011/131746, and WO 2013/060867; double antibody conjugate, e.g., by antibody cross-linking to generate a bi-specific structure using a
  • heterobifunctional reagent having an amine-reactive group and a sulfhydryl reactive group as described in, e.g., US 4433059; bispecific antibody determinants generated by recombining half antibodies (heavy-light chain pairs or Fabs) from different antibodies through cycle of reduction and oxidation of disulfide bonds between the two heavy chains, as described in, e.g., US 4433059; bispecific antibody determinants generated by recombining half antibodies (heavy-light chain pairs or Fabs) from different antibodies through cycle of reduction and oxidation of disulfide bonds between the two heavy chains, as described in, e.g., US
  • trifunctional antibodies e.g., three Fab' fragments cross-linked through sulfhdryl reactive groups, as described in, e.g., US5273743; biosynthetic binding proteins, e.g., pair of scFvs cross-linked through C-terminal tails preferably through disulfide or amine-reactive chemical cross-linking, as described in, e.g., US5534254; bifunctional antibodies, e.g., Fab fragments with different binding specificities dimerized through leucine zippers (e.g., c-fos and c-jun) that have replaced the constant domain, as described in, e.g., US5582996; bispecific and oligospecific mono-and oligovalent receptors, e.g., VH-CH1 regions of two antibodies (two Fab fragments) linked through a polypeptide spacer between the CHI region of one antibody and the VH region of the other antibody typically with associated light
  • multivalent and multispecific binding proteins e.g., dimer of polypeptides having first domain with binding region of Ig heavy chain variable region, and second domain with binding region of Ig light chain variable region, generally termed diabodies (higher order structures are also encompassed creating for bispecifc, trispecific, or tetraspecific molecules, as described in, e.g., US5837242; minibody constructs with linked VL and VH chains further connected with peptide spacers to an antibody hinge region and CH3 region, which can be dimerized to form
  • bispecific/multivalent molecules as described in, e.g., US5837821; VH and VL domains linked with a short peptide linker (e.g., 5 or 10 amino acids) or no linker at all in either orientation, which can form dimers to form bispecific diabodies; trimers and tetramers, as described in, e.g., US5844094; String of VH domains (or VL domains in family members) connected by peptide linkages with crosslinkable groups at the C-terminus futher associated with VL domains to form a series of FVs (or scFvs), as described in, e.g., US5864019; and single chain binding polypeptides with both a VH and a VL domain linked through a peptide linker are combined into multivalent structures through non-covalent or chemical crosslinking to form, e.g.,
  • the VH can be upstream or downstream of the VL.
  • the upstream antibody or antibody fragment e.g., scFv
  • VH1 upstream of its VL
  • VL2 VL2
  • VH2 VH2
  • the upstream antibody or antibody fragment (e.g., scFv) is arranged with its VL (VL1) upstream of its VH (VH1) and the downstream antibody or antibody fragment (e.g., scFv) is arranged with its VH (VH2) upstream of its VL (VL2), such that the overall bispecific antibody molecule has the arrangement VL1- VH1-VH2-VL2.
  • a linker is disposed between the two antibodies or antibody fragments (e.g., scFvs), e.g., between VL1 and VL2 if the construct is arranged as VH1-VL1- VL2-VH2, or between VH1 and VH2 if the construct is arranged as VL1-VH1-VH2-VL2.
  • the linker may be a linker as described herein, e.g., a (Gly 4 -Ser) n linker, wherein n is 1, 2, 3, 4, 5, or 6, preferably 4 (SEQ ID NO: 29).
  • the linker between the two scFvs should be long enough to avoid mispairing between the domains of the two scFvs.
  • a linker is disposed between the VL and VH of the first scFv.
  • a linker is disposed between the VL and VH of the second scFv.
  • any two or more of the linkers can be the same or different.
  • a bispecific CAR comprises VLs, VHs, and optionally one or more linkers in an arrangement as described herein.
  • the bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence, e.g., a scFv, which has binding specificity for a first cancer-associated antigen, e.g., comprises a scFv as described herein, e.g., as described in Table 3, or comprises the light chain CDRs and/or heavy chain CDRs from a scFv described herein, and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope on a different antigen.
  • the second immunoglobulin variable domain sequence has binding specificity for an antigen expressed on AML cells.
  • the second immunoglobulin variable domain sequence has binding specificity for CD 123.
  • the second immunoglobulin variable domain sequence has binding specificity for CD33.
  • the second immunoglobulin variable domain sequence has binding specificity for CLL-1.
  • the second immunoglobulin variable domain sequence has binding specificity for CD34.
  • the second immunoglobulin variable domain sequence has binding specificity for FLT3.
  • the second immunoglobulin variable domain sequence has binding specificity for CD 123.
  • the second immunoglobulin variable domain sequence has binding specificity for CD33.
  • the second immunoglobulin variable domain sequence has binding specificity for CLL-1.
  • the second immunoglobulin variable domain sequence has binding specificity for CD34.
  • the second immunoglobulin variable domain sequence has binding specificity for FLT3.
  • the second immunoglobulin variable domain sequence has binding specificity for CD 123.
  • the second immunoglobulin variable domain sequence has binding specificity for CD33.
  • the second immunoglobulin variable domain sequence has binding specificity for CLL-1.
  • immunoglobulin variable domain sequence has binding specificity for folate receptor beta.
  • the second immunoglobulin variable domain sequence has binding specificity for an antigen expressed on B-cells, for example, CD 19, CD20, CD22 or ROR1.
  • the antibodies and antibody fragments disclosed herein can be grafted to one or more constant domain of a T cell receptor (“TCR") chain, for example, a TCR alpha or TCR beta chain, to create an chimeric TCR that binds specifically to a cancer associated antigen.
  • TCR T cell receptor
  • chimeric TCRs will signal through the TCR complex upon antigen binding.
  • an scFv as disclosed herein can be grafted to the constant domain, e.g., at least a portion of the extracellular constant domain, the transmembrane domain and the cytoplasmic domain, of a TCR chain, for example, the TCR alpha chain and/or the TCR beta chain.
  • an antibody fragment for example a VL domain as described herein, can be grafted to the constant domain of a TCR alpha chain
  • an antibody fragment for example a VH domain as described herein
  • a VL domain may be grafted to the constant domain of the TCR beta chain
  • a VH domain may be grafted to a TCR alpha chain
  • the CDRs of an antibody or antibody fragment e.g., the CDRs of an antibody or antibody fragment as described in Table 3 may be grafted into a TCR alpha and/or beta chain to create a chimeric TCR that binds specifically to a cancer associated antigen.
  • the LC CDRs disclosed herein may be grafted into the variable domain of a TCR alpha chain and the HC CDRs disclosed herein may be grafted to the variable domain of a TCR beta chain, or vice versa.
  • Such chimeric TCRs may be produced by any appropriate method (For example, Willemsen RA et al, Gene Therapy 2000; 7: 1369-1377; Zhang T et al, Cancer Gene Ther 2004; 11: 487-496; Aggen et al, Gene Ther. 2012
  • a CAR can be designed to comprise a transmembrane domain that is attached to the extracellular domain of the CAR.
  • a transmembrane domain can include one or more additional amino acids adjacent to the transmembrane region, e.g., one or more amino acid associated with the extracellular region of the protein from which the transmembrane was derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the extracellular region) and/or one or more additional amino acids associated with the intracellular region of the protein from which the transmembrane protein is derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the intracellular region).
  • the transmembrane domain is one that is associated with one of the other domains of the CAR e.g., in one embodiment, the transmembrane domain may be from the same protein that the signaling domain, costimulatory domain or the hinge domain is derived from. In another aspect, the transmembrane domain is not derived from the same protein that any other domain of the CAR is derived from. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, e.g., to minimize interactions with other members of the receptor complex.
  • the transmembrane domain is capable of homodimerization with another CAR on the cell surface of a CAR-expressing cell.
  • the amino acid sequence of the transmembrane domain may be modified or substituted so as to minimize interactions with the binding domains of the native binding partner present in the same CAR-expressing cell.
  • the transmembrane domain may be derived either from a natural or from a recombinant source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. In one aspect the transmembrane domain is capable of signaling to the intracellular domain(s) whenever the CAR has bound to a target.
  • transmembrane domain of particular use in this invention may include at least the
  • a transmembrane domain may include at least the transmembrane region(s) of, e.g., KIRDS2, OX40, CD2, CD27, LFA-1 (CDl la, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CDl ld, ITGAE, CD103, rfGAL, CDl la, LFA-1, ITGAM, CDl lb, ⁇ , CDl lc, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR
  • the transmembrane domain can be attached to the extracellular region of the CAR, e.g., the antigen binding domain of the CAR, via a hinge, e.g., a hinge from a human protein.
  • a hinge e.g., a hinge from a human protein.
  • the hinge can be a human Ig
  • the hinge or spacer comprises (e.g., consists of) the amino acid sequence of SEQ ID NO:4.
  • the transmembrane domain comprises (e.g., consists of) a transmembrane domain of SEQ ID NO: 12.
  • the hinge or spacer comprises an IgG4 hinge.
  • the hinge or spacer comprises a hinge of the amino acid sequence
  • the hinge or spacer comprises a hinge encoded by a nucleotide sequence of
  • the hinge or spacer comprises an IgD hinge.
  • the hinge or spacer comprises a hinge of the amino acid sequence
  • the hinge or spacer comprises a hinge encoded by a nucleotide sequence of
  • the transmembrane domain may be recombinant, in which case it will comprise predominantly hydrophobic residues such as leucine and valine.
  • a triplet of phenylalanine, tryptophan and valine can be found at each end of a recombinant
  • a short oligo- or polypeptide linker may form the linkage between the transmembrane domain and the cytoplasmic region of the CAR.
  • a glycine-serine doublet provides a particularly suitable linker.
  • the linker comprises the amino acid sequence of GGGGSGGGGS (SEQ ID NO: 10).
  • the linker is encoded by a nucleotide sequence of
  • the hinge or spacer comprises a KIR2DS2 hinge.
  • the cytoplasmic domain or region of a CAR of the present invention includes an intracellular signaling domain.
  • An intracellular signaling domain is generally responsible for activation of at least one of the normal effector functions of the immune cell in which the CAR has been introduced.
  • Examples of intracellular signaling domains for use in the CAR of the invention include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any recombinant sequence that has the same functional capability.
  • TCR T cell receptor
  • T cell activation can be said to be mediated by two distinct classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation through the TCR (primary intracellular signaling domains) and those that act in an antigen-independent manner to provide a secondary or costimulatory signal (secondary cytoplasmic domain, e.g., a costimulatory domain).
  • a primary signaling domain regulates primary activation of the TCR complex either in a stimulatory way, or in an inhibitory way.
  • Primary intracellular signaling domains that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs.
  • Examples of IT AM containing primary intracellular signaling domains that are of particular use in the invention include those of CD3 zeta, common FcR gamma (FCER1G), Fc gamma Rlla, FcR beta (Fc Epsilon Rib), CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS”), FcsRI, DAP10, DAP12, and CD66d.
  • a CAR of the invention comprises an intracellular signaling domain, e.g., a primary signaling domain of CD3-zeta.
  • molecules containing a primary intracellular signaling domain include those of DAP10, DAP12, and CD32.
  • a primary signaling domain comprises a modified ITAM domain, e.g., a mutated ITAM domain which has altered (e.g., increased or decreased) activity as compared to the native ITAM domain.
  • a primary signaling domain comprises a modified ITAM-containing primary intracellular signaling domain, e.g., an optimized and/or truncated ITAM-containing primary intracellular signaling domain.
  • a primary signaling domain comprises one, two, three, four or more ITAM motifs.
  • the intracellular signalling domain of the CAR can comprise the CD3-zeta signaling domain by itself or it can be combined with any other desired intracellular signaling domain(s) useful in the context of a CAR of the invention.
  • the intracellular signaling domain of the CAR can comprise a CD3 zeta chain portion and a costimulatory signaling domain.
  • the costimulatory signaling domain refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule.
  • a costimulatory molecule is a cell surface molecule other than an antigen receptor or its ligands that is required for an efficient response of lymphocytes to an antigen.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP15753232.6A 2014-07-21 2015-07-21 Kombinationen aus niedrigen, immunfördernden dosen von mtor-inhibitoren und cars Withdrawn EP3193915A1 (de)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201462027152P 2014-07-21 2014-07-21
US201462076197P 2014-11-06 2014-11-06
US201562164357P 2015-05-20 2015-05-20
PCT/US2015/041330 WO2016014530A1 (en) 2014-07-21 2015-07-21 Combinations of low, immune enhancing. doses of mtor inhibitors and cars

Publications (1)

Publication Number Publication Date
EP3193915A1 true EP3193915A1 (de) 2017-07-26

Family

ID=53887188

Family Applications (1)

Application Number Title Priority Date Filing Date
EP15753232.6A Withdrawn EP3193915A1 (de) 2014-07-21 2015-07-21 Kombinationen aus niedrigen, immunfördernden dosen von mtor-inhibitoren und cars

Country Status (3)

Country Link
EP (1) EP3193915A1 (de)
JP (1) JP2017528433A (de)
WO (1) WO2016014530A1 (de)

Families Citing this family (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2708032C2 (ru) 2013-02-20 2019-12-03 Новартис Аг ЛЕЧЕНИЕ РАКА С ИСПОЛЬЗОВАНИЕМ ХИМЕРНОГО АНТИГЕНСПЕЦИФИЧЕСКОГО РЕЦЕПТОРА НА ОСНОВЕ ГУМАНИЗИРОВАННОГО АНТИТЕЛА ПРОТИВ EGFRvIII
EP2958942B1 (de) 2013-02-20 2020-06-03 Novartis AG Effektives targeting primärer humaner leukämie mit durch den chimären anti-cd123-antigen-rezeptor veränderten t-zellen
WO2014145252A2 (en) 2013-03-15 2014-09-18 Milone Michael C Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy
TWI654206B (zh) 2013-03-16 2019-03-21 諾華公司 使用人類化抗－ｃｄ１９嵌合抗原受體治療癌症
CN116478927A (zh) 2013-12-19 2023-07-25 诺华股份有限公司 人间皮素嵌合抗原受体及其用途
EP3087101B1 (de) 2013-12-20 2024-06-05 Novartis AG Regulierbarer chimärer antigenrezeptor
US11028143B2 (en) 2014-01-21 2021-06-08 Novartis Ag Enhanced antigen presenting ability of RNA CAR T cells by co-introduction of costimulatory molecules
SG10202109752XA (en) 2014-04-07 2021-10-28 Novartis Ag Treatment of cancer using anti-cd19 chimeric antigen receptor
US11542488B2 (en) 2014-07-21 2023-01-03 Novartis Ag Sortase synthesized chimeric antigen receptors
BR112017000939A2 (pt) 2014-07-21 2017-11-14 Novartis Ag tratamento de câncer usando um receptor antigênico quimérico de cll-1
WO2016014576A1 (en) 2014-07-21 2016-01-28 Novartis Ag Treatment of cancer using a cd33 chimeric antigen receptor
MY181834A (en) 2014-07-21 2021-01-08 Novartis Ag Treatment of cancer using humanized anti-bcma chimeric antigen receptor
RU2724999C2 (ru) 2014-08-19 2020-06-29 Новартис Аг Химерный антигенный рецептор (car) против cd123 для использования в лечении злокачественных опухолей
WO2016044605A1 (en) 2014-09-17 2016-03-24 Beatty, Gregory Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy
WO2016057705A1 (en) 2014-10-08 2016-04-14 Novartis Ag Biomarkers predictive of therapeutic responsiveness to chimeric antigen receptor therapy and uses thereof
CN113429484A (zh) 2014-12-05 2021-09-24 纪念斯隆-凯特琳癌症中心 靶向g-蛋白偶联受体的抗体和使用方法
WO2016090312A1 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Chimeric antigen receptors targeting g-protein coupled receptor and uses thereof
IL253149B2 (en) 2014-12-29 2023-11-01 Novartis Ag Methods for preparing cells expressing a chimeric receptor antigen
US11459390B2 (en) 2015-01-16 2022-10-04 Novartis Ag Phosphoglycerate kinase 1 (PGK) promoters and methods of use for expressing chimeric antigen receptor
US11161907B2 (en) 2015-02-02 2021-11-02 Novartis Ag Car-expressing cells against multiple tumor antigens and uses thereof
DK3280729T3 (da) 2015-04-08 2022-07-25 Novartis Ag Cd20-behandlinger, cd22-behandlinger og kombinationsbehandlinger med en cd19-kimær antigenreceptor (car)-udtrykkende celle
AU2016249005B2 (en) 2015-04-17 2022-06-16 Novartis Ag Methods for improving the efficacy and expansion of chimeric antigen receptor-expressing cells
CN107847491A (zh) 2015-05-20 2018-03-27 诺华公司 依维莫司(everolimus)与达托里昔布(dactolisib)的医药组合
CN109476722A (zh) 2015-07-21 2019-03-15 诺华股份有限公司 用于改善免疫细胞的功效和扩张的方法
WO2017027392A1 (en) 2015-08-07 2017-02-16 Novartis Ag Treatment of cancer using chimeric cd3 receptor proteins
US11747346B2 (en) 2015-09-03 2023-09-05 Novartis Ag Biomarkers predictive of cytokine release syndrome
SG10202109655VA (en) 2015-12-04 2021-10-28 Novartis Ag Compositions and methods for immunooncology
MA44140A (fr) 2015-12-22 2021-05-19 Dana Farber Cancer Inst Inc Récepteur d'antigène chimérique (car) contre la mésothéline et anticorps contre l'inhibiteur de pd-l1 pour une utilisation combinée dans une thérapie anticancéreuse
WO2017133175A1 (en) * 2016-02-04 2017-08-10 Nanjing Legend Biotech Co., Ltd. Engineered mammalian cells for cancer therapy
EP3422945B1 (de) 2016-03-01 2020-12-09 North Carolina State University Verbesserte krebsimmuntherapie durch mikronadel-patch-unterstützte verabreichung
KR20180118175A (ko) 2016-03-04 2018-10-30 노파르티스 아게 다중 키메라 항원 수용체 (car) 분자를 발현하는 세포 및 그에 따른 용도
EP3432924A1 (de) 2016-03-23 2019-01-30 Novartis AG Zellsekretierte minikörper und verwendungen davon
US10654934B2 (en) 2016-04-01 2020-05-19 Innovative Cellular Therapeutics CO., LTD. Use of chimeric antigen receptor modified cells to treat cancer
WO2017167217A1 (en) 2016-04-01 2017-10-05 Innovative Cellular Therapeutics CO., LTD. Use of chimeric antigen receptor modified cells to treat cancer
US11446398B2 (en) 2016-04-11 2022-09-20 Obsidian Therapeutics, Inc. Regulated biocircuit systems
BR112018074152A8 (pt) 2016-05-25 2023-01-31 Hoffmann La Roche Métodos para determinar um regime de dosagem, métodos para tratar um indivíduo, método para otimizar o tratamento terapeuticamente, agente terapêutico e sistema de rede para determinar uma dose eficaz ou um regime de dosagem para um indivíduo sendo tratado com um agente terapêutico
EP3462883B1 (de) 2016-06-07 2023-08-16 The Pacific Heart, Lung,&Blood Institute Zusammensetzungen und deren verwendung zur behandlung von krebs
AU2017295886C1 (en) * 2016-07-15 2024-05-16 Novartis Ag Treatment and prevention of cytokine release syndrome using a chimeric antigen receptor in combination with a kinase inhibitor
WO2018064921A1 (en) * 2016-10-06 2018-04-12 Innovative Cellular Therapeutics CO., LTD. Use of chimeric antigen receptor modified cells to treat cancer
TW202340473A (zh) 2016-10-07 2023-10-16 瑞士商諾華公司 利用嵌合抗原受體之癌症治療
TW201825090A (zh) 2016-11-23 2018-07-16 瑞士商諾華公司 增強免疫反應之方法
MA46995A (fr) 2016-12-03 2019-10-09 Acerta Pharma Bv Méthodes et compositions pour l'utilisation de lymphocytes t thérapeutiques en association avec des inhibiteurs de kinase
ES2912408T3 (es) 2017-01-26 2022-05-25 Novartis Ag Composiciones de CD28 y métodos para terapia con receptores quiméricos para antígenos
MX2019011272A (es) 2017-03-22 2019-10-24 Novartis Ag Composiciones y metodos para inmunooncologia.
EP4327878A3 (de) * 2017-05-01 2024-05-01 Juno Therapeutics, Inc. Kombination aus einer zelltherapie und einer immunmodulatorischen verbindung
KR101847779B1 (ko) * 2017-06-02 2018-04-12 이종균 이분형 로지스틱 회귀분석 알고리즘을 적용하여 말초혈액 면역력을 단계별로 구분하여 평가하고 암 발병 유무에 대한 정보를 제공하는 방법 및 이를 이용한 진단키트
KR101847778B1 (ko) * 2017-06-02 2018-04-12 이종균 이분형 로지스틱 회귀분석 알고리즘을 적용한 말초혈액 면역력 평가 및 암 발병 유무에 대한 정보를 제공하는 방법 및 이를 이용한 진단키트
TW202428622A (zh) 2017-10-18 2024-07-16 瑞士商諾華公司 用於選擇性蛋白質降解的組合物及方法
US11851679B2 (en) 2017-11-01 2023-12-26 Juno Therapeutics, Inc. Method of assessing activity of recombinant antigen receptors
TW201932482A (zh) 2017-11-01 2019-08-16 美商奇諾治療有限公司 對b細胞成熟抗原具特異性之嵌合抗原受體及編碼聚核苷酸
WO2019089969A2 (en) 2017-11-01 2019-05-09 Juno Therapeutics, Inc. Antibodies and chimeric antigen receptors specific for b-cell maturation antigen
TW202016139A (zh) 2018-06-13 2020-05-01 瑞士商諾華公司 Bcma 嵌合抗原受體及其用途
CN108949695A (zh) * 2018-08-14 2018-12-07 杭州荣泽生物科技有限公司 一种非病毒载体共表达il18的car-t细胞构建及其应用
WO2021009273A1 (en) * 2019-07-16 2021-01-21 Université Cote D'azur Method of assessing the sensitivity or resistance of a subject to an oncolytic virus, recombinant virus, preparation and uses thereof
BR112022009679A2 (pt) 2019-11-26 2022-08-09 Novartis Ag Receptores de antígeno quimérico cd19 e cd22 e usos dos mesmos
CN117964650B (zh) * 2024-03-28 2024-06-07 成都硕德药业有限公司 一种枸橼酸伊沙佐米的制备方法

Family Cites Families (300)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ZA737247B (en) 1972-09-29 1975-04-30 Ayerst Mckenna & Harrison Rapamycin and process of preparation
US4433059A (en) 1981-09-08 1984-02-21 Ortho Diagnostic Systems Inc. Double antibody conjugate
US4444878A (en) 1981-12-21 1984-04-24 Boston Biomedical Research Institute, Inc. Bispecific antibody determinants
GB2116183B (en) 1982-03-03 1985-06-05 Genentech Inc Human antithrombin iii dna sequences therefore expression vehicles and cloning vectors containing such sequences and cell cultures transformed thereby a process for expressing human antithrombin iii and pharmaceutical compositions comprising it
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4851332A (en) 1985-04-01 1989-07-25 Sloan-Kettering Institute For Cancer Research Choriocarcinoma monoclonal antibodies and antibody panels
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US6548640B1 (en) 1986-03-27 2003-04-15 Btg International Limited Altered antibodies
GB8607679D0 (en) 1986-03-27 1986-04-30 Winter G P Recombinant dna product
US5869620A (en) 1986-09-02 1999-02-09 Enzon, Inc. Multivalent antigen-binding proteins
JPH021556A (ja) 1988-06-09 1990-01-05 Snow Brand Milk Prod Co Ltd ハイブリッド抗体及びその作製方法
US5858358A (en) 1992-04-07 1999-01-12 The United States Of America As Represented By The Secretary Of The Navy Methods for selectively stimulating proliferation of T cells
US6905680B2 (en) 1988-11-23 2005-06-14 Genetics Institute, Inc. Methods of treating HIV infected subjects
US6534055B1 (en) 1988-11-23 2003-03-18 Genetics Institute, Inc. Methods for selectively stimulating proliferation of T cells
US6352694B1 (en) 1994-06-03 2002-03-05 Genetics Institute, Inc. Methods for inducing a population of T cells to proliferate using agents which recognize TCR/CD3 and ligands which stimulate an accessory molecule on the surface of the T cells
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5703055A (en) 1989-03-21 1997-12-30 Wisconsin Alumni Research Foundation Generation of antibodies through lipid mediated DNA delivery
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
DE3920358A1 (de) 1989-06-22 1991-01-17 Behringwerke Ag Bispezifische und oligospezifische, mono- und oligovalente antikoerperkonstrukte, ihre herstellung und verwendung
US5585362A (en) 1989-08-22 1996-12-17 The Regents Of The University Of Michigan Adenovirus vectors for gene therapy
AU6290090A (en) 1989-08-29 1991-04-08 University Of Southampton Bi-or trispecific (fab)3 or (fab)4 conjugates
GB8928874D0 (en) 1989-12-21 1990-02-28 Celltech Ltd Humanised antibodies
US5273743A (en) 1990-03-09 1993-12-28 Hybritech Incorporated Trifunctional antibody-like compounds as a combined diagnostic and therapeutic agent
GB9012995D0 (en) 1990-06-11 1990-08-01 Celltech Ltd Multivalent antigen-binding proteins
US5582996A (en) 1990-12-04 1996-12-10 The Wistar Institute Of Anatomy & Biology Bifunctional antibodies and method of preparing same
DE69233482T2 (de) 1991-05-17 2006-01-12 Merck & Co., Inc. Verfahren zur Verminderung der Immunogenität der variablen Antikörperdomänen
DE4118120A1 (de) 1991-06-03 1992-12-10 Behringwerke Ag Tetravalente bispezifische rezeptoren, ihre herstellung und verwendung
US5199942A (en) 1991-06-07 1993-04-06 Immunex Corporation Method for improving autologous transplantation
US6511663B1 (en) 1991-06-11 2003-01-28 Celltech R&D Limited Tri- and tetra-valent monospecific antigen-binding proteins
WO1992022653A1 (en) 1991-06-14 1992-12-23 Genentech, Inc. Method for making humanized antibodies
US5637481A (en) 1993-02-01 1997-06-10 Bristol-Myers Squibb Company Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell
CA2078539C (en) 1991-09-18 2005-08-02 Kenya Shitara Process for producing humanized chimera antibody
ES2136092T3 (es) 1991-09-23 1999-11-16 Medical Res Council Procedimientos para la produccion de anticuerpos humanizados.
US5932448A (en) 1991-11-29 1999-08-03 Protein Design Labs., Inc. Bispecific antibody heterodimers
CA2103887C (en) 1991-12-13 2005-08-30 Gary M. Studnicka Methods and materials for preparation of modified antibody variable domains and therapeutic uses thereof
US5910573A (en) 1992-01-23 1999-06-08 Merck Patent Gesellschaft Mit Beschrankter Haftung Monomeric and dimeric antibody-fragment fusion proteins
CA2372813A1 (en) 1992-02-06 1993-08-19 L.L. Houston Biosynthetic binding protein for cancer marker
GB9203459D0 (en) 1992-02-19 1992-04-08 Scotgen Ltd Antibodies with germ-line variable regions
US5646253A (en) 1994-03-08 1997-07-08 Memorial Sloan-Kettering Cancer Center Recombinant human anti-LK26 antibodies
EP0640130B1 (de) 1992-05-08 1998-04-15 Creative Biomolecules, Inc. Mehrwertige Chimäre Proteine Anologe und Verfahren zu deren Anwendungen
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
WO1994004678A1 (en) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulins devoid of light chains
US5350674A (en) 1992-09-04 1994-09-27 Becton, Dickinson And Company Intrinsic factor - horse peroxidase conjugates and a method for increasing the stability thereof
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
EP1550729B1 (de) 1992-09-25 2009-05-27 Avipep Pty Limited Zielmoleküle-bindende Polypeptide bestehend aus einer IG-artigen VL Domäne die an eine IG-artige VH Domäne gebunden ist
GB9221220D0 (en) 1992-10-09 1992-11-25 Sandoz Ag Organic componds
GB9221657D0 (en) 1992-10-15 1992-11-25 Scotgen Ltd Recombinant bispecific antibodies
EP0627932B1 (de) 1992-11-04 2002-05-08 City Of Hope Antikörperkonstrukte
GB9323648D0 (en) 1992-11-23 1994-01-05 Zeneca Ltd Proteins
WO1994013804A1 (en) 1992-12-04 1994-06-23 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US6476198B1 (en) 1993-07-13 2002-11-05 The Scripps Research Institute Multispecific and multivalent antigen-binding polypeptide molecules
US5635602A (en) 1993-08-13 1997-06-03 The Regents Of The University Of California Design and synthesis of bispecific DNA-antibody conjugates
WO1995009917A1 (en) 1993-10-07 1995-04-13 The Regents Of The University Of California Genetically engineered bispecific tetravalent antibodies
EP0679660A4 (de) 1993-11-16 2000-08-16 Pola Chem Ind Inc Monoklonaler antikörper gegen tyrosinase aus mensche
WO1995014023A1 (en) 1993-11-19 1995-05-26 Abbott Laboratories Semisynthetic analogs of rapamycin (macrolides) being immunomodulators
JP3745772B2 (ja) 1993-12-17 2006-02-15 ノバルティス アクチエンゲゼルシャフト 免疫抑制剤として有用なラパマイシン誘導体
US5635388A (en) 1994-04-04 1997-06-03 Genentech, Inc. Agonist antibodies against the flk2/flt3 receptor and uses thereof
US5362718A (en) 1994-04-18 1994-11-08 American Home Products Corporation Rapamycin hydroxyesters
CA2188432C (en) 1994-04-22 2011-02-01 Yutaka Kawakami Melanoma antigens
US7175843B2 (en) 1994-06-03 2007-02-13 Genetics Institute, Llc Methods for selectively stimulating proliferation of T cells
US5786464C1 (en) 1994-09-19 2012-04-24 Gen Hospital Corp Overexpression of mammalian and viral proteins
JP3659261B2 (ja) 1994-10-20 2005-06-15 モルフォシス・アクチェンゲゼルシャフト 組換体タンパク質の多機能性複合体への標的化ヘテロ結合
EP0805871B2 (de) 1995-01-18 2006-02-22 Roche Diagnostics GmbH Antikörper gegen cd30, die proteolytische spaltung und abgabe des membrangebundenen cd30 antigens verhindern
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
US7067318B2 (en) 1995-06-07 2006-06-27 The Regents Of The University Of Michigan Methods for transfecting T cells
US6692964B1 (en) 1995-05-04 2004-02-17 The United States Of America As Represented By The Secretary Of The Navy Methods for transfecting T cells
JPH11508126A (ja) 1995-05-23 1999-07-21 モルフォシス ゲゼルシャフト ファー プロテインオプティマイルング エムベーハー 多量体タンパク質
US5741677A (en) 1995-06-07 1998-04-21 Geron Corporation Methods for measuring telomere length
DK0833828T3 (da) 1995-06-09 2003-03-17 Novartis Ag Rapamycinderivater
BE1009856A5 (fr) 1995-07-14 1997-10-07 Sandoz Sa Composition pharmaceutique sous la forme d'une dispersion solide comprenant un macrolide et un vehicule.
US5989830A (en) 1995-10-16 1999-11-23 Unilever Patent Holdings Bv Bifunctional or bivalent antibody fragment analogue
DE19608769C1 (de) 1996-03-07 1997-04-10 Univ Eberhard Karls Antikörper BV10A4H2
ES2225961T3 (es) 1996-04-04 2005-03-16 Unilever N.V. Proteina de union a antigeno multivalente y multiespecifica.
EP0937082A2 (de) 1996-07-12 1999-08-25 Ariad Pharmaceuticals, Inc. Nicht immunhemmende antifungale rapaloge
EP1947183B1 (de) 1996-08-16 2013-07-17 Merck Sharp & Dohme Corp. Säugerzelloberflächenantigene und damit zusammenhängende Reagenzien
US6111090A (en) 1996-08-16 2000-08-29 Schering Corporation Mammalian cell surface antigens; related reagents
US6114148C1 (en) 1996-09-20 2012-05-01 Gen Hospital Corp High level expression of proteins
EP0938557B1 (de) 1996-10-25 2000-09-13 THE GOVERNMENT OF THE UNITED STATES OF AMERICA as represented by the SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Verfahren und zusammensetzungen zur verhinderung von entzündungen und angiogenese enthaltend säugetieren cd97 alpha untereinheit
EP0979102A4 (de) 1997-04-30 2005-11-23 Enzon Inc Einzelsträngige polypeptide modifiziert durch polyalkylenoxid
US20030207346A1 (en) 1997-05-02 2003-11-06 William R. Arathoon Method for making multispecific antibodies having heteromultimeric and common components
US20020062010A1 (en) 1997-05-02 2002-05-23 Genentech, Inc. Method for making multispecific antibodies having heteromultimeric and common components
CA2304254C (en) 1997-06-11 2012-05-22 Hans Christian Thogersen Trimerising module
CA2293632C (en) 1997-06-12 2011-11-29 Research Corporation Technologies, Inc. Artificial antibody polypeptides
US6015815A (en) 1997-09-26 2000-01-18 Abbott Laboratories Tetrazole-containing rapamycin analogs with shortened half-lives
TW557297B (en) 1997-09-26 2003-10-11 Abbott Lab Rapamycin analogs having immunomodulatory activity, and pharmaceutical compositions containing same
EP1025228A4 (de) 1997-10-21 2002-09-18 Human Genome Sciences Inc Menschliche, dem tumor-nekrosis-faktor rezeptor ähnliche proteine tr11, tr11sv1 und tr11sv2
AU2152299A (en) 1997-10-27 1999-05-24 Unilever Plc Multivalent antigen-binding proteins
DE69922159T2 (de) 1998-01-23 2005-12-01 Vlaams Interuniversitair Instituut Voor Biotechnologie Mehrzweck-antikörperderivate
JP2002502607A (ja) 1998-02-09 2002-01-29 ジェネンテク・インコーポレイテッド 新規な腫瘍壊死因子レセプター相同体及びそれをコードする核酸
CZ121599A3 (cs) 1998-04-09 1999-10-13 Aventis Pharma Deutschland Gmbh Jednořetězcová molekula vázající několik antigenů, způsob její přípravy a léčivo obsahující tuto molekulu
ES2246567T3 (es) 1998-04-15 2006-02-16 Brigham & Womens Hospital Composiciones para receptores inhibidores de celulas t y usos de las mismas.
DE19819846B4 (de) 1998-05-05 2016-11-24 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Multivalente Antikörper-Konstrukte
GB9812545D0 (en) 1998-06-10 1998-08-05 Celltech Therapeutics Ltd Biological products
US6803448B1 (en) 1998-07-22 2004-10-12 Vanderbilt University GBS toxin receptor
JP2002521053A (ja) 1998-07-28 2002-07-16 マイクロメット アーゲー ヘテロミニ体
US6333396B1 (en) 1998-10-20 2001-12-25 Enzon, Inc. Method for targeted delivery of nucleic acids
US6528481B1 (en) 1999-02-16 2003-03-04 The Burnam Institute NG2/HM proteoglycan-binding peptides that home to angiogenic vasculature and related methods
US7527787B2 (en) 2005-10-19 2009-05-05 Ibc Pharmaceuticals, Inc. Multivalent immunoglobulin-based bioactive assemblies
US7534866B2 (en) 2005-10-19 2009-05-19 Ibc Pharmaceuticals, Inc. Methods and compositions for generating bioactive assemblies of increased complexity and uses
EP1196186B1 (de) 1999-07-12 2007-10-31 Genentech, Inc. Stimulierung oder hemmung von angiogenese und herzvaskularisierung mit tumor nekrose faktor ligand/rezeptor homologen
BR0013391A (pt) 1999-08-17 2002-07-09 Biogen Inc Uso do receptor baff (bcma) como um agente imunoregulador
ES2219388T3 (es) 1999-08-24 2004-12-01 Ariad Gene Therapeutics, Inc. 28-epi-rapalogos.
WO2001023432A1 (fr) 1999-09-30 2001-04-05 Kyowa Hakko Kogyo Co., Ltd. Anticorps humain de transplantation d'une region de determination de la complementarite agissant contre le ganglioside gd3, et derives dudit anticorps
WO2001029058A1 (en) 1999-10-15 2001-04-26 University Of Massachusetts Rna interference pathway genes as tools for targeted genetic interference
US6326193B1 (en) 1999-11-05 2001-12-04 Cambria Biosciences, Llc Insect control agent
US6867041B2 (en) 2000-02-24 2005-03-15 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
US6797514B2 (en) 2000-02-24 2004-09-28 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
IL151287A0 (en) 2000-02-24 2003-04-10 Xcyte Therapies Inc A method for stimulation and concentrating cells
US7572631B2 (en) 2000-02-24 2009-08-11 Invitrogen Corporation Activation and expansion of T cells
US20040002068A1 (en) 2000-03-01 2004-01-01 Corixa Corporation Compositions and methods for the detection, diagnosis and therapy of hematological malignancies
EP1272647B1 (de) 2000-04-11 2014-11-12 Genentech, Inc. Multivalente antikörper und deren verwendung
US20020103345A1 (en) 2000-05-24 2002-08-01 Zhenping Zhu Bispecific immunoglobulin-like antigen binding proteins and method of production
WO2001096584A2 (en) 2000-06-12 2001-12-20 Akkadix Corporation Materials and methods for the control of nematodes
WO2002002781A1 (en) 2000-06-30 2002-01-10 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Heterodimeric fusion proteins
AU2001283496A1 (en) 2000-07-25 2002-02-05 Immunomedics, Inc. Multivalent target binding protein
US20040242847A1 (en) 2000-10-20 2004-12-02 Naoshi Fukushima Degraded agonist antibody
US7090843B1 (en) 2000-11-28 2006-08-15 Seattle Genetics, Inc. Recombinant anti-CD30 antibodies and uses thereof
US7829084B2 (en) 2001-01-17 2010-11-09 Trubion Pharmaceuticals, Inc. Binding constructs and methods for use thereof
AU2002247826A1 (en) 2001-03-13 2002-09-24 University College London Specific binding members
CN1294148C (zh) 2001-04-11 2007-01-10 中国科学院遗传与发育生物学研究所 环状单链三特异抗体
DE60237282D1 (de) 2001-06-28 2010-09-23 Domantis Ltd Doppelspezifischer ligand und dessen verwendung
US6833441B2 (en) 2001-08-01 2004-12-21 Abmaxis, Inc. Compositions and methods for generating chimeric heteromultimers
JP5133494B2 (ja) 2001-08-10 2013-01-30 アバディーン ユニバーシティ 抗原結合ドメイン
ES2736165T3 (es) 2001-08-23 2019-12-26 Rsr Ltd Regiones epítopo de un receptor de tirotropina (TSH), sus usos y anticuerpos para las mismas
ATE346866T1 (de) 2001-09-14 2006-12-15 Affimed Therapeutics Ag Multimerische, einzelkettige, tandem-fv- antikörper
GB0123400D0 (en) 2001-09-28 2001-11-21 Novartis Ag Organic compounds
WO2003048337A2 (en) 2001-12-04 2003-06-12 Dana-Farber Cancer Institute, Inc. Antibody to latent membrane proteins and uses thereof
US20030211078A1 (en) 2001-12-07 2003-11-13 Heavner George A. Pseudo-antibody constructs
US7745140B2 (en) 2002-01-03 2010-06-29 The Trustees Of The University Of Pennsylvania Activation and expansion of T-cells using an engineered multivalent signaling platform as a research tool
PL216224B1 (pl) 2002-02-01 2014-03-31 Ariad Pharmaceuticals Pochodne rapamycyny zawierające fosfor, kompozycja je zawierająca oraz ich zastosowanie
AU2003209446B2 (en) 2002-03-01 2008-09-25 Immunomedics, Inc. Bispecific antibody point mutations for enhancing rate of clearance
GB0208104D0 (en) 2002-04-09 2002-05-22 Univ Dundee Method
AU2003227504A1 (en) 2002-04-15 2003-10-27 Chugai Seiyaku Kabushiki Kaisha METHOD OF CONSTRUCTING scDb LIBRARY
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
US20040047858A1 (en) 2002-09-11 2004-03-11 Blumberg Richard S. Therapeutic anti-BGP(C-CAM1) antibodies and uses thereof
WO2004033021A1 (en) 2002-10-07 2004-04-22 Biovalve Technologies, Inc. Microneedle array patch
WO2004048415A1 (de) 2002-11-26 2004-06-10 B.R.A.H.M.S Aktiengesellschaft Nachweis von tsh-rezeptor-autoantikörpern mit affinitätsgereinigten antikörpern
ATE514713T1 (de) 2002-12-23 2011-07-15 Wyeth Llc Antikörper gegen pd-1 und ihre verwendung
GB0230203D0 (en) 2002-12-27 2003-02-05 Domantis Ltd Fc fusion
GB0305702D0 (en) 2003-03-12 2003-04-16 Univ Birmingham Bispecific antibodies
WO2004087758A2 (en) 2003-03-26 2004-10-14 Neopharm, Inc. Il 13 receptor alpha 2 antibody and methods of use
US20050003403A1 (en) 2003-04-22 2005-01-06 Rossi Edmund A. Polyvalent protein complex
BRPI0410785A (pt) 2003-05-23 2006-06-20 Wyeth Corp molécula de ácido nucleico isolada, célula hospedeira, animal transgênico não humano, proteìna isolada, oligonucleotìdeo anti-sentido, molécula de sirna, anticorpo isolado, métodos de triagem quanto aos compostos de teste capazes de inibir, de intensificar ou imitar a interação do gitrl com o gitr, para diagnosticar doenças, para tratar um paciente em risco ou diagnosticado com uma doença, para induzir e para inibir a proliferação de uma população celular contendo células t efetoras, de bloquear a supressão e de supressão de uma população celular que inclua células t efetoras na presença de células t reguladoras cd4+cd25+, e para tratar uma doença, composição farmacêutica, e, adjuvante de vacina
WO2005000898A2 (en) 2003-06-27 2005-01-06 Biogen Idec Ma Inc. Use of hydrophobic-interaction-chromatography or hinge-region modifications for the production of homogeneous antibody-solutions
AU2004255216B2 (en) 2003-07-01 2010-08-19 Immunomedics, Inc. Multivalent carriers of bi-specific antibodies
US20050048054A1 (en) 2003-07-11 2005-03-03 Shino Hanabuchi Lymphocytes; methods
US7696322B2 (en) 2003-07-28 2010-04-13 Catalent Pharma Solutions, Inc. Fusion antibodies
WO2005042743A2 (en) 2003-08-18 2005-05-12 Medimmune, Inc. Humanization of antibodies
WO2005035575A2 (en) 2003-08-22 2005-04-21 Medimmune, Inc. Humanization of antibodies
WO2005035577A1 (ja) 2003-10-08 2005-04-21 Kyowa Hakko Kogyo Co., Ltd. ガングリオシドｇｄ３に特異的に結合する抗体組成物
EP1688439A4 (de) 2003-10-08 2007-12-19 Kyowa Hakko Kogyo Kk Zusammensetzung kondensierter proteine
US7435596B2 (en) 2004-11-04 2008-10-14 St. Jude Children's Research Hospital, Inc. Modified cell line and method for expansion of NK cell
US7220755B2 (en) 2003-11-12 2007-05-22 Biosensors International Group, Ltd. 42-O-alkoxyalkyl rapamycin derivatives and compositions comprising same
JP2007518399A (ja) 2003-12-02 2007-07-12 ジェンザイム コーポレイション 肺癌を診断および治療する組成物並びに方法
US20050136051A1 (en) 2003-12-22 2005-06-23 Bernard Scallon Methods for generating multimeric molecules
GB0329825D0 (en) 2003-12-23 2004-01-28 Celltech R&D Ltd Biological products
US20050266425A1 (en) 2003-12-31 2005-12-01 Vaccinex, Inc. Methods for producing and identifying multispecific antibodies
US8383575B2 (en) 2004-01-30 2013-02-26 Paul Scherrer Institut (DI)barnase-barstar complexes
SI2511297T1 (sl) 2004-02-06 2015-07-31 Morphosys Ag Proti -CD38 humana protitelesa in njihova uporaba
GB0409799D0 (en) 2004-04-30 2004-06-09 Isis Innovation Method of generating improved immune response
WO2005118788A2 (en) 2004-05-27 2005-12-15 The Trustees Of The University Of Pennsylvania Novel artificial antigen presenting cells and uses therefor
WO2006083289A2 (en) 2004-06-04 2006-08-10 Duke University Methods and compositions for enhancement of immunity by in vivo depletion of immunosuppressive cell activity
JP2008512352A (ja) 2004-07-17 2008-04-24 イムクローン システムズ インコーポレイティド 新規な四価の二重特異性抗体
MX2007002856A (es) 2004-09-02 2007-09-25 Genentech Inc Metodos para el uso de ligandos receptores de muerte y anticuerpos c20.
MY146381A (en) 2004-12-22 2012-08-15 Amgen Inc Compositions and methods relating relating to anti-igf-1 receptor antibodies
DK1866339T3 (da) 2005-03-25 2013-09-02 Gitr Inc GTR-bindende molekyler og anvendelser heraf
EP3050963B1 (de) 2005-03-31 2019-09-18 Chugai Seiyaku Kabushiki Kaisha Verfahren zur herstellung von polypeptiden durch regulierung der anordnung
JP5011277B2 (ja) 2005-04-06 2012-08-29 アイビーシー・ファーマシューティカルズ・インコーポレーテッド ホモダイマー、ホモテトラマーまたはダイマーのダイマーのからなる安定に連結された複合体を発生させるための方法および使用
ES2707152T3 (es) 2005-04-15 2019-04-02 Macrogenics Inc Diacuerpos covalentes y usos de los mismos
NZ563193A (en) 2005-05-09 2010-05-28 Ono Pharmaceutical Co Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
GB0510390D0 (en) 2005-05-20 2005-06-29 Novartis Ag Organic compounds
US20060263367A1 (en) 2005-05-23 2006-11-23 Fey Georg H Bispecific antibody devoid of Fc region and method of treatment using same
EP1726650A1 (de) 2005-05-27 2006-11-29 Universitätsklinikum Freiburg Monoklonale Antikörper und Einzelkettenantikörper Fragments gegen das zelloberflächen Prostataspezifische Membranantigen
CN101287761A (zh) 2005-06-15 2008-10-15 先灵公司 抗-igf1r抗体制剂
DK1907424T3 (en) 2005-07-01 2015-11-09 Squibb & Sons Llc HUMAN MONOCLONAL ANTIBODIES TO PROGRAMMED death ligand 1 (PD-L1)
US20070036773A1 (en) 2005-08-09 2007-02-15 City Of Hope Generation and application of universal T cells for B-ALL
MY169746A (en) 2005-08-19 2019-05-14 Abbvie Inc Dual variable domain immunoglobulin and uses thereof
US7612181B2 (en) 2005-08-19 2009-11-03 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
ATE452913T1 (de) 2005-08-26 2010-01-15 Pls Design Gmbh Bivalente igy antikörperkonstrukte für diagnostische und therapeutische anwendungen
KR20140033237A (ko) 2005-10-07 2014-03-17 엑셀리시스, 인코포레이티드 포스파티딜이노시톨 3-키나아제 억제제 및 이의 사용 방법
WO2007044887A2 (en) 2005-10-11 2007-04-19 Transtarget, Inc. Method for producing a population of homogenous tetravalent bispecific antibodies
EP1962961B1 (de) 2005-11-29 2013-01-09 The University Of Sydney Demikörper: dimerisations-aktivierte therapeutische mittel
PT2529747T (pt) 2005-12-02 2018-05-09 Icahn School Med Mount Sinai Vírus da doença de newcastle quiméricos que apresentam proteínas de superfície não nativas e suas utilizações
ES2390476T3 (es) 2005-12-08 2012-11-13 Medarex, Inc. Anticuerpos monoclonales frente a fucosil-GM1 y procedimientos de uso de anti-fucosil-GM1
EP1806365A1 (de) 2006-01-05 2007-07-11 Boehringer Ingelheim International GmbH Antikörper spezifisch für Fibroblasten-Aktivierungsprotein und Immunokonjugaten, die diese Antikörper enthalten
WO2007133822A1 (en) 2006-01-19 2007-11-22 Genzyme Corporation Gitr antibodies for the treatment of cancer
MX2008010561A (es) 2006-02-15 2009-03-02 Imclone Systems Inc Anticuerpos funcionales.
JP5374359B2 (ja) 2006-03-17 2013-12-25 バイオジェン・アイデック・エムエイ・インコーポレイテッド 安定化されたポリペプチド化合物
EP1996716B1 (de) 2006-03-20 2011-05-11 The Regents of the University of California Manipulierte anti-prostatastammzellenantigen (psca)-antikörper für krebs-targeting
JP5474531B2 (ja) 2006-03-24 2014-04-16 メルク パテント ゲゼルシャフト ミット ベシュレンクテル ハフツング 操作されたヘテロ二量体タンパク質ドメイン
WO2007112362A2 (en) 2006-03-24 2007-10-04 The Regents Of The University Of California Construction of a multivalent scfv through alkyne-azide 1,3-dipolar cycloaddition
ES2482145T3 (es) 2006-03-29 2014-08-01 King's College London Anticuerpos agonistas contra TSHR
ES2654040T3 (es) 2006-03-31 2018-02-12 Chugai Seiyaku Kabushiki Kaisha Método de modificación de anticuerpos para la purificación de anticuerpos biespecíficos
TWI395754B (zh) 2006-04-24 2013-05-11 Amgen Inc 人類化之ｃ-ｋｉｔ抗體
JP5189082B2 (ja) 2006-05-25 2013-04-24 バイエル・ファルマ・アクチェンゲゼルシャフト 二量体分子複合体
US20070274985A1 (en) 2006-05-26 2007-11-29 Stefan Dubel Antibody
CA2654317A1 (en) 2006-06-12 2007-12-21 Trubion Pharmaceuticals, Inc. Single-chain multivalent binding proteins with effector function
US8759297B2 (en) 2006-08-18 2014-06-24 Armagen Technologies, Inc. Genetically encoded multifunctional compositions bidirectionally transported between peripheral blood and the cns
WO2008027236A2 (en) 2006-08-30 2008-03-06 Genentech, Inc. Multispecific antibodies
EP2083868A2 (de) 2006-10-04 2009-08-05 Københavns Universitet Erzeugung einer krebsspezifischen immunantwort gegen muc1 und krebsspezifische muc1-antikörper
WO2008140477A2 (en) 2006-11-02 2008-11-20 Capon Daniel J Hybrid immunoglobulins with moving parts
US20100178684A1 (en) 2006-12-21 2010-07-15 Woo Savio L C Transgenic oncolytic viruses and uses thereof
WO2008101234A2 (en) 2007-02-16 2008-08-21 Sloan-Kettering Institute For Cancer Research Anti ganglioside gd3 antibodies and uses thereof
WO2008103645A2 (en) 2007-02-19 2008-08-28 Wisconsin Alumni Research Foundation Prostate cancer and melanoma antigens
WO2008110491A2 (en) 2007-03-09 2008-09-18 University Of Basel Chemotherapy of neoplastic diseases using combinations of rapamycin and compounds modulating mtor pathway alone or in combination with heat
EP2626372B1 (de) 2007-03-29 2018-03-21 Genmab A/S Bispezifische Antikörper und Verfahren zu deren Herstellung
CA2682093A1 (en) 2007-03-29 2008-10-09 Technion Research & Development Foundation Ltd. Antibodies, methods and kits for diagnosing and treating melanoma
EP2144930A1 (de) 2007-04-18 2010-01-20 ZymoGenetics, Inc. Einzelketten-fc sowie herstellungsverfahren dafür und bearbeitungsverfahren dafür
JP2010190572A (ja) 2007-06-01 2010-09-02 Sapporo Medical Univ ＩＬ１３Ｒａ２に対する抗体およびこれを含む診断・治療薬
EP2170959B1 (de) 2007-06-18 2013-10-02 Merck Sharp & Dohme B.V. Antikörper gegen den humanen programmed death rezeptor pd-1
CN101801413A (zh) 2007-07-12 2010-08-11 托勒克斯股份有限公司 采用gitr结合分子的联合疗法
EP2185199A4 (de) 2007-07-31 2010-09-08 Merck Sharp & Dohme Spezifische igf-1r-antikörper für den nachweis und die diagnose von zellproliferationserkrankungen
WO2009018386A1 (en) 2007-07-31 2009-02-05 Medimmune, Llc Multispecific epitope binding proteins and uses thereof
JP5485152B2 (ja) 2007-08-15 2014-05-07 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング 単一特異性および多特異性抗体ならびに使用方法
CA2703947C (en) 2007-10-26 2018-12-04 Governing Council Of The University Of Toronto Therapeutic and diagnostic methods using tim-3
JP2011504740A (ja) 2007-11-27 2011-02-17 アブリンクス エン．ヴェー． ヘテロ二量体サイトカイン及び／又はこれらの受容体に指向性を有するアミノ酸配列、並びにこれを含むポリペプチド
TW200944231A (en) 2007-11-30 2009-11-01 Glaxo Group Ltd Antigen-binding constructs
US8227577B2 (en) 2007-12-21 2012-07-24 Hoffman-La Roche Inc. Bivalent, bispecific antibodies
US9266967B2 (en) 2007-12-21 2016-02-23 Hoffmann-La Roche, Inc. Bivalent, bispecific antibodies
US20090162359A1 (en) 2007-12-21 2009-06-25 Christian Klein Bivalent, bispecific antibodies
US8242247B2 (en) 2007-12-21 2012-08-14 Hoffmann-La Roche Inc. Bivalent, bispecific antibodies
HUE028536T2 (en) 2008-01-07 2016-12-28 Amgen Inc Method for producing antibody to FC heterodimer molecules using electrostatic control effects
CN101970499B (zh) 2008-02-11 2014-12-31 治疗科技公司 用于肿瘤治疗的单克隆抗体
US20110028471A1 (en) 2008-02-21 2011-02-03 Astrazeneca Ab Combination therapy 238
US8168757B2 (en) 2008-03-12 2012-05-01 Merck Sharp & Dohme Corp. PD-1 binding proteins
AR071891A1 (es) 2008-05-30 2010-07-21 Imclone Llc Anticuerpos humanos anti-flt3 (receptor tirosina cinasa 3 tipo fms humano)
CN102203258A (zh) 2008-07-02 2011-09-28 新兴产品开发西雅图有限公司 TGF-β拮抗剂多靶点结合蛋白
EP2318002A4 (de) * 2008-08-05 2012-11-28 Univ Emory Verwendung von mtor-hemmern zur verstärkung von t-zellen-immunreaktionen
AR072999A1 (es) 2008-08-11 2010-10-06 Medarex Inc Anticuerpos humanos que se unen al gen 3 de activacion linfocitaria (lag-3) y los usos de estos
CN102203125A (zh) 2008-08-25 2011-09-28 安普利穆尼股份有限公司 Pd-1拮抗剂及其使用方法
SI2350129T1 (sl) 2008-08-25 2015-11-30 Amplimmune, Inc. Sestavki PD-1 antagonistov in postopek njihove uporabe
WO2010030002A1 (ja) 2008-09-12 2010-03-18 国立大学法人三重大学 外来性ｇｉｔｒリガンド発現細胞
AU2009293007B2 (en) 2008-09-19 2015-10-08 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Monoclonal antibodies for cspg4 for the diagnosis and treatment of basal breast carcinoma
US8476282B2 (en) 2008-11-03 2013-07-02 Intellikine Llc Benzoxazole kinase inhibitors and methods of use
PT2365802T (pt) 2008-11-11 2017-11-14 Univ Texas Microcápsulas de rapamicina e utilização para o tratamento de cancro
CN108997498A (zh) 2008-12-09 2018-12-14 霍夫曼-拉罗奇有限公司 抗-pd-l1抗体及它们用于增强t细胞功能的用途
EP2393921B1 (de) 2009-02-05 2015-07-15 Icahn School of Medicine at Mount Sinai Chimäres newcastle disease virus und seine verwendungen
JP5844159B2 (ja) 2009-02-09 2016-01-13 ユニヴェルシテ デクス−マルセイユＵｎｉｖｅｒｓｉｔｅ Ｄ’Ａｉｘ−Ｍａｒｓｅｉｌｌｅ Ｐｄ−１抗体およびｐｄ−ｌ１抗体ならびにその使用
ES2500643T3 (es) 2009-04-03 2014-09-30 Verastem, Inc. Compuestos de purina sustituidos con pirimidina como inhibidores de las cinasas
EP2424567B1 (de) 2009-04-27 2018-11-21 OncoMed Pharmaceuticals, Inc. Verfahren zur herstellung von heteromultimeren molekülen
DK2424896T3 (en) 2009-04-30 2015-12-14 Tel Hashomer Medical Res Infrastructure & Services Ltd The anti-CEACAM1 antibodies and methods of use thereof
US8709424B2 (en) 2009-09-03 2014-04-29 Merck Sharp & Dohme Corp. Anti-GITR antibodies
US9181527B2 (en) 2009-10-29 2015-11-10 The Trustees Of Dartmouth College T cell receptor-deficient T cell compositions
GB0919054D0 (en) 2009-10-30 2009-12-16 Isis Innovation Treatment of obesity
SI2496698T1 (sl) 2009-11-03 2019-07-31 City Of Hope Skrajšan epiderimalni receptor faktorja rasti (EGFRt) za selekcijo transduciranih T celic
US8956828B2 (en) 2009-11-10 2015-02-17 Sangamo Biosciences, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
US20130017199A1 (en) 2009-11-24 2013-01-17 AMPLIMMUNE ,Inc. a corporation Simultaneous inhibition of pd-l1/pd-l2
CA2782333C (en) 2009-12-02 2019-06-04 Imaginab, Inc. J591 minibodies and cys-diabodies for targeting human prostate specific membrane antigen (psma) and methods for their use
JP5944831B2 (ja) 2009-12-23 2016-07-05 シュニムネ ゲーエムベーハーＳＹＮＩＭＭＵＮＥ ＧｍｂＨ 抗ｆｌｔ３抗体及びその使用方法
ME02505B (me) 2009-12-29 2017-02-20 Aptevo Res & Development Llc Heterodimerni vezujući proteini i njihove upotrebe
KR20220017432A (ko) 2010-02-24 2022-02-11 이뮤노젠 아이엔씨 엽산염 수용체 1 항체와 면역접합체 및 이들의 용도
PT2560993T (pt) 2010-04-20 2024-09-16 Genmab As Proteínas contendo anticorpo heterodimérico fc e métodos para a produção das mesmas
US9242014B2 (en) 2010-06-15 2016-01-26 The Regents Of The University Of California Receptor tyrosine kinase-like orphan receptor 1 (ROR1) single chain Fv antibody fragment conjugates and methods of use thereof
CA2802344C (en) 2010-06-18 2023-06-13 The Brigham And Women's Hospital, Inc. Bi-specific antibodies against tim-3 and pd-1 for immunotherapy in chronic immune conditions
SG186889A1 (en) 2010-07-09 2013-02-28 Exelixis Inc Combinations of kinase inhibitors for the treatment of cancer
AU2011277935B2 (en) 2010-07-16 2015-01-22 Piramal Enterprises Limited Substituted imidazoquinoline derivatives as kinase inhibitors
EP2596011B1 (de) 2010-07-21 2018-10-03 Sangamo Therapeutics, Inc. Verfahren und zusammensetzungen zur veränderung eines hla-locus
US9493740B2 (en) 2010-09-08 2016-11-15 Baylor College Of Medicine Immunotherapy of cancer using genetically engineered GD2-specific T cells
SG190997A1 (en) 2010-12-09 2013-07-31 Univ Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer
JOP20210044A1 (ar) 2010-12-30 2017-06-16 Takeda Pharmaceuticals Co الأجسام المضادة لـ cd38
CN106074601A (zh) * 2011-03-23 2016-11-09 弗雷德哈钦森癌症研究中心 用于细胞免疫治疗的方法和组合物
MY160662A (en) 2011-04-01 2017-03-15 Memorial Sloan Kettering Cancer Center T cell receptor-like antibodies specific for a wt1 peptide presented by hla-a2
JP6076963B2 (ja) 2011-04-08 2017-02-15 アメリカ合衆国 抗上皮成長因子受容体変異体ｉｉｉキメラ抗原受容体及び癌の治療のためのその使用
AR086044A1 (es) 2011-05-12 2013-11-13 Imclone Llc Anticuerpos que se unen especificamente a un dominio extracelular de c-kit y usos de los mismos
US20140105915A1 (en) 2011-05-27 2014-04-17 Glaxo Group Limited Bcma (cd269/tnfrsf17) - binding proteins
EP2532740A1 (de) * 2011-06-11 2012-12-12 Michael Schmück Antigenspezifische CD4+ und CD8+ zentrale Gedächtnis-T-Zellpräparate für adoptive T-Zelltherapie
US8841418B2 (en) 2011-07-01 2014-09-23 Cellerant Therapeutics, Inc. Antibodies that specifically bind to TIM3
CN107266584B (zh) 2011-07-29 2022-05-13 宾夕法尼亚大学董事会 转换共刺激受体
EP2741749A4 (de) 2011-08-11 2015-04-15 Intellikine Llc Kinasehemmende polymorphe
US20130108641A1 (en) 2011-09-14 2013-05-02 Sanofi Anti-gitr antibodies
ES2795023T3 (es) 2011-09-16 2020-11-20 Baylor College Medicine Reconocimiento específico del microambiente tumoral mediante el uso de células NKT manipuladas
WO2013054320A1 (en) 2011-10-11 2013-04-18 Tel Hashomer Medical Research Infrastructure And Services Ltd. Antibodies to carcinoembryonic antigen-related cell adhesion molecule (ceacam)
ITMO20110270A1 (it) 2011-10-25 2013-04-26 Sara Caldrer Una cellula effettrice modificata per il trattamento di neoplasie esprimenti il disialonganglioside gd2
EP3674320A3 (de) 2011-10-27 2020-08-12 Genmab A/S Herstellung von heterodimeren proteinen
US10391126B2 (en) 2011-11-18 2019-08-27 Board Of Regents, The University Of Texas System CAR+ T cells genetically modified to eliminate expression of T-cell receptor and/or HLA
JP6385277B2 (ja) 2011-12-01 2018-09-05 ザ ブリガム アンド ウィメンズ ホスピタル インコーポレイテッドＴｈｅ Ｂｒｉｇｈａｍ ａｎｄ Ｗｏｍｅｎ’ｓ Ｈｏｓｐｉｔａｌ， Ｉｎｃ． 癌治療のための抗ｃｅａｃａｍ１組換え型抗体
US9439768B2 (en) 2011-12-08 2016-09-13 Imds Llc Glenoid vault fixation
JP6850528B2 (ja) 2012-02-13 2021-03-31 シアトル チルドレンズ ホスピタル ドゥーイング ビジネス アズ シアトル チルドレンズ リサーチ インスティテュート 二重特異性キメラ抗原受容体およびその治療的使用
MX2014010183A (es) 2012-02-22 2015-03-20 Univ Pennsylvania Composiciones y metodos para generar una poblacion persistente de celulas t utiles para el tratamiento de cancer.
AU2013256596A1 (en) 2012-05-01 2014-10-09 Genentech, Inc. Anti-PMEL17 antibodies and immunoconjugates
DK2800811T3 (en) 2012-05-25 2017-07-17 Univ Vienna METHODS AND COMPOSITIONS FOR RNA DIRECTIVE TARGET DNA MODIFICATION AND FOR RNA DIRECTIVE MODULATION OF TRANSCRIPTION
WO2013192294A1 (en) 2012-06-20 2013-12-27 Boston 3T Biotechnologies, Inc. Cellular therapies for treating and preventing cancers and other immune system disorders
US10513540B2 (en) 2012-07-31 2019-12-24 The Brigham And Women's Hospital, Inc. Modulation of the immune response
US9365641B2 (en) 2012-10-01 2016-06-14 The Trustees Of The University Of Pennsylvania Compositions and methods for targeting stromal cells for the treatment of cancer
WO2014055657A1 (en) 2012-10-05 2014-04-10 The Trustees Of The University Of Pennsylvania Use of a trans-signaling approach in chimeric antigen receptors
US20150273056A1 (en) 2012-10-12 2015-10-01 The Brigham And Women's Hospital, Inc. Enhancement of the immune response
DK3064585T3 (da) 2012-12-12 2020-04-27 Broad Inst Inc Konstruering og optimering af forbedrede systemer, fremgangsmåder og enzymsammensætninger til sekvensmanipulation
EP4286402A3 (de) 2012-12-12 2024-02-14 The Broad Institute, Inc. Systeme, verfahren und zusammensetzungen mit crispr-cas-komponenten zur sequenzmanipulation
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
WO2014110591A1 (en) 2013-01-14 2014-07-17 Fred Hutchinson Cancer Research Center Compositions and methods for delivery of immune cells to treat un-resectable or non-resected tumor cells and tumor relapse
ES2758227T3 (es) 2013-02-15 2020-05-04 Univ California Receptor de antígeno quimérico y métodos de uso del mismo
MD4655C1 (ro) 2013-03-14 2020-06-30 Icahn School Of Medicine At Mount Sinai Virusurile bolii de Newcastle şi utilizarea acestora
WO2014145252A2 (en) 2013-03-15 2014-09-18 Milone Michael C Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy
TWI654206B (zh) 2013-03-16 2019-03-21 諾華公司 使用人類化抗－ｃｄ１９嵌合抗原受體治療癌症
CA2913052A1 (en) 2013-05-24 2014-11-27 Board Of Regents, The University Of Texas System Chimeric antigen receptor-targeting monoclonal antibodies
US20150140036A1 (en) 2013-11-13 2015-05-21 Novartis Institutes For Biomedical Research, Inc. Low, immune enhancing, dose mtor inhibitors and uses thereof
US9512084B2 (en) 2013-11-29 2016-12-06 Novartis Ag Amino pyrimidine derivatives
EP3087101B1 (de) 2013-12-20 2024-06-05 Novartis AG Regulierbarer chimärer antigenrezeptor
EP3593812A3 (de) * 2014-03-15 2020-05-27 Novartis AG Behandlung von krebs mithilfe eines chimären antigenrezeptors
US10479975B2 (en) * 2014-06-06 2019-11-19 Bluebird Bio, Inc. Methods of making T cell compositions

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None *
See also references of WO2016014530A1 *

Also Published As

Publication number Publication date
JP2017528433A (ja) 2017-09-28
WO2016014530A1 (en) 2016-01-28

Similar Documents

Publication Publication Date Title
US20230312677A1 (en) Cd28 compositions and methods for chimeric antigen receptor therapy
JP7526121B2 (ja) キメラ抗原受容体を使用する癌の処置
US20220064316A1 (en) Treatment of cancer using humanized anti-bcma chimeric antigen receptor
AU2016323985B2 (en) CAR T cell therapies with enhanced efficacy
US20170274014A1 (en) Combinations of low, immune enhancing, doses of mtor inhibitors and cars
AU2015244039B2 (en) Treatment of cancer using anti-CD19 chimeric antigen receptor
EP3193915A1 (de) Kombinationen aus niedrigen, immunfördernden dosen von mtor-inhibitoren und cars
US20200048359A1 (en) Shp inhibitor compositions and uses for chimeric antigen receptor therapy
AU2020201939A1 (en) Treatment of cancer using a CLL-1 chimeric antigen receptor
EP3784351A1 (de) Car-t-zelltherapien mit erhöhter wirksamkeit
EP3286211A1 (de) Behandlung von krebs mit chimärem antigenrezeptor- und proteinkinase-a-blocker
US20210179709A1 (en) Anti-car compositions and methods
US20200390811A1 (en) Compositions to disrupt protein kinase a anchoring and uses thereof
JP2024147554A (ja) 有効性が増強されたｃａｒ ｔ細胞療法

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20170216

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20180523

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20210202