US20140030292A1 - Antigen delivery platforms - Google Patents
Antigen delivery platforms Download PDFInfo
- Publication number
- US20140030292A1 US20140030292A1 US13/878,835 US201113878835A US2014030292A1 US 20140030292 A1 US20140030292 A1 US 20140030292A1 US 201113878835 A US201113878835 A US 201113878835A US 2014030292 A1 US2014030292 A1 US 2014030292A1
- Authority
- US
- United States
- Prior art keywords
- fragment
- protein
- self
- replicating rna
- rna molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
- WDEQGFSUEJVISF-UHFFFAOYSA-N C.C.C.C.C.C.C.C.C.C Chemical compound C.C.C.C.C.C.C.C.C.C WDEQGFSUEJVISF-UHFFFAOYSA-N 0.000 description 10
- BQMUWNMDGNVFNI-UHFFFAOYSA-N C.C.C.C.C.C.C.C.C.C.C Chemical compound C.C.C.C.C.C.C.C.C.C.C BQMUWNMDGNVFNI-UHFFFAOYSA-N 0.000 description 5
- BNAHAJLCQVKWIQ-UHFFFAOYSA-N C.C.C.C.C.C.C.C.C.C.C.C Chemical compound C.C.C.C.C.C.C.C.C.C.C.C BNAHAJLCQVKWIQ-UHFFFAOYSA-N 0.000 description 4
- VNWKTOKETHGBQD-UHFFFAOYSA-N C Chemical compound C VNWKTOKETHGBQD-UHFFFAOYSA-N 0.000 description 2
- XEMPOXGCXURTGS-UHFFFAOYSA-N C.C.C.C.C.C.C.C Chemical compound C.C.C.C.C.C.C.C XEMPOXGCXURTGS-UHFFFAOYSA-N 0.000 description 2
- BMPLYQCOXFDTSK-UHFFFAOYSA-N C.C.C.C.C.C.C.C.C Chemical compound C.C.C.C.C.C.C.C.C BMPLYQCOXFDTSK-UHFFFAOYSA-N 0.000 description 2
- CREMABGTGYGIQB-UHFFFAOYSA-N C.C Chemical compound C.C CREMABGTGYGIQB-UHFFFAOYSA-N 0.000 description 1
- ZJCFNHIEEPXKSO-UHFFFAOYSA-N C.C.C Chemical compound C.C.C ZJCFNHIEEPXKSO-UHFFFAOYSA-N 0.000 description 1
- GRPUBDDSELRCNH-UHFFFAOYSA-N C.C.C.C Chemical compound C.C.C.C GRPUBDDSELRCNH-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/90—Fusion polypeptide containing a motif for post-translational modification
- C07K2319/92—Fusion polypeptide containing a motif for post-translational modification containing an intein ("protein splicing")domain
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
- C12N2710/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
- C12N2710/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
- C12N2710/16722—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
- C12N2710/16734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/36011—Togaviridae
- C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
- C12N2770/36141—Use of virus, viral particle or viral elements as a vector
- C12N2770/36143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/20—Vector systems having a special element relevant for transcription transcription of more than one cistron
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
- C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
Definitions
- Herpes viruses are widespread and cause a wide range of diseases in humans that in the worst cases can lead to substantial morbidity and mortality, primarily in immunocompromised individuals (e.g., transplant recipients and HIV-infected individuals). Humans are susceptible to infection by at least eight herpes viruses.
- Herpes simplex virus-1 HSV-1, HHV-1
- Herpes simplex virus-2 HSV-2, HHV-2
- VZV, HHV-3 are alpha-subfamily viruses
- cytomegalovirus CMV, HHV-5
- Roseoloviruses HHV-6 and HHV-7
- EBV, HHV-4 Epstein-Barr virus
- KSHV, HHV-8 Kaposi's sarcoma-associated herpesvirus
- CMV infection leads to substantial morbidity and mortality in immunocompromised individuals (e.g., transplant recipients and HIV-infected individuals) and congenital infection can result in devastating defects in neurological development in neonates.
- CMV envelope glycoproteins gB, gH, gL, gM and gN represent attractive vaccine candidates as they are expressed on the viral surface and can elicit protective virus-neutralizing humoral immune responses.
- Some CMV vaccine strategies have targeted the major surface glycoprotein B (gB), which can induce a dominant antibody response. (Go and Pollard, JID 197:1631-1633 (2008)).
- CMV glycoprotein gB can induce a neutralizing antibody response, and a large fraction of the antibodies that neutralize infection of fibroblasts in sera from CMV-positive patients is directed against gB (Britt 1990).
- gH and gM/gN are targets of the immune response to natural infection (Urban et al (1996) J. Gen. Virol. 77(Pt. 7):1537-47; Mach et al (2000) J. Virol. 74(24):11881-92).
- CMV proteins are also attractive vaccine candidates because they appear to be involved in important processes in the viral life cycle.
- the gH/gL/gO complex seems to have important roles in both fibroblast and epithelial/endothelial cell entry.
- the prevailing model suggests that the gH/gL/gO complex mediates infection of fibroblasts.
- hCMV gO-null mutants produce small plaques on fibroblasts and very low titer virus indicating a role in entry (Dunn (2003), Proc. Natl. Acad. Sci. USA 100:14223-28; Hobom (2000) J. Virol. 74:7720-29).
- CMV gH/gL can also associate with UL128, UL130, and UL131A (referred to here as UL131) and form a pentameric complex that is required for entry into several cell types, including epithelial cells, endothelial cells, and dendritic cells (Hahn et al (2004) J. Virol. 78(18):10023-33; Wang and Shenk (2005) Proc. Natl. Acad. Sci. USA 102(50):18153-8; Gerna et al (2005). J. Gen. Virol. 84(Pt 6):1431-6; Ryckman et al (2008) J. Virol. 82:60-70).
- UL131 UL131
- U.S. Pat. No. 5,767,250 discloses methods for making certain CMV protein complexes that contain gH and gL.
- the complexes are produced by introducing a DNA construct that encodes gH and a DNA construct that encodes gL into a cell so that the gH and gL are co-expressed.
- WO 2004/076645 describes recombinant DNA molecules that encode CMV proteins. According to this document, combinations of distinct DNA molecules that encode different CMV proteins, can be introduced into cells to cause co-expression of the encoded CMV proteins. When gM and gN were co-expressed in this way, they formed a disulfide-linked complex. Rabbits immunized with DNA constructs that produced the gM/gN complex or with a DNA construct encoding gB produced equivalent neutralizing antibody responses.
- the invention relates to platforms for co-delivery of two or more herpesvirus proteins, such as cytomegalovirus (CMV) proteins, to cells, particularly proteins that form complexes in vivo.
- CMV cytomegalovirus
- the invention is a recombinant polycistronic nucleic acid molecules that contain a first sequence encoding a first herpesvirus (e.g., CMV) protein or fragment thereof, and a second sequence encoding a second herpesvirus (e.g., CMV) protein or fragment thereof.
- the invention provides a self-replicating RNA molecule comprising a polynucleotide which comprises a) a first nucleotide sequence encoding a first protein or fragment thereof from a herpes virus; and b) a second nucleotide sequence encoding a second protein or fragment thereof from the herpes virus.
- the first nucleotide sequence and second nucleotide sequence are operably linked to one or more control elements so that when the self-replicating RNA molecule is introduced into a suitable cell, the first and second herpes virus proteins or fragments thereof are produced in an amount sufficient for the formation of a complex in the cell that contains the first and second proteins or fragments.
- the first protein and the second protein are not the same protein or fragments of the same protein, the first protein is not a fragment of the second protein, and the second protein is not a fragment of the first protein.
- the first nucleotide sequence can be operably linked to a first control element and the second nucleotide sequence can be operably linked to a second control element.
- the self-replicating RNA molecule can further comprise a third nucleotide sequence encoding a third protein or fragment thereof from said herpes virus, optionally a fourth nucleotide sequence encoding a fourth protein or fragment thereof from said herpes virus; and optionally a fifth nucleotide sequence encoding a fifth protein or fragment thereof from said herpes virus.
- sequences encoding additional proteins or fragments from a herpes virus are present (i.e., the third, fourth and fifth nucleotide sequences) they are operably linked to one or more control elements.
- the first nucleotide sequence is operably linked to a first control element
- the second nucleotide sequence is operably linked to a second control element
- the third nucleotide sequence is operably linked to a third control element
- the fourth nucleotide sequence is operably linked to a fourth control element
- the fifth nucleotide sequence is operably linked to a fifth control element.
- the control elements present in the construct e.g., first, second, third, fourth and fifth control elements
- the herpes virus can be HSV-1, 1, HSV-2, VZV, EBV type 1, EBV type 2, CMV, HHV-6 type A, HHV-6 type B, HHV-7 and HHV-8.
- the recombinant polycistronic nucleic acid molecule e.g., self replicating RNA
- the herpes virus is CMV or VZV.
- the proteins can be selected from the group consisting of gB, gE, gH, gI, gL and a fragment (e.g., of at least 10 amino acids) thereof.
- the recombinant polycistronic nucleic acid molecule e.g., self replicating RNA
- the recombinant polycistronic nucleic acid molecule encodes VZV gH or a fragment thereof and VZV gL or a fragment thereof.
- the invention provides a self-replicating RNA molecule comprising a polynucleotide which comprises a) a first sequence encoding a first cytomegalovirus (CMV) protein or fragment thereof; and b) a second sequence encoding a second CMV protein or fragment thereof.
- the first sequence and second sequence are operably linked to one or more control elements so that when the self-replicating RNA molecule is introduced into a suitable cell, the first and second CMV proteins are produced in an amount sufficient for the formation of a complex in the cell that contains the first and second CMV proteins or fragments.
- the first CMV protein and the second CMV protein are independently selected from the group consisting of gB, gH, gL; gO; gM, gN; UL128, UL130, UL131, and a fragment of any one of the foregoing.
- the first CMV protein and the second CMV protein are not the same protein or fragments of the same protein, the first CMV protein is not a fragment of the second CMV protein, and the second CMV protein is not a fragment of the first CMV protein.
- the self-replicating RNA molecule can further comprise a third sequence encoding a third CMV protein, wherein the third sequences is operably linked to a control element.
- additional sequences encoding additional CMV proteins can be included.
- the control elements can be independently selected from the group consisting of a subgenomic promoter, and IRES, and a viral 2A site.
- the self replicating nucleic acid molecule encodes the CMV proteins gH and gL. In other embodiments, the self-replicating RNA molecule encodes the CMV proteins gH, gL, and gO. In other embodiments, the self-replicating RNA molecule encodes the CMV proteins gH, gL, UL128, UL130 and UL131.
- the self replicating RNA molecules can be an alphavirus replicon.
- the alphavirus replicon can be delivered in the form of an alphavirus replicon particle (VRP).
- VRP alphavirus replicon particle
- the self replicating RNA molecule can also be in the form of a “naked” RNA molecule.
- the invention also relates to a recombinant DNA molecule that encodes a self replicating RNA molecule as described herein.
- the recombinant DNA molecule is a plasmid.
- the recombinant DNA molecule includes a mammalian promoter that drive transcription of the encoded self replicating RNA molecule.
- the invention also relates to compositions that comprise a self-replicating RNA molecule as described herein and a pharmaceutically acceptable vehicle.
- the self-replicating RNA molecule can be “naked.”
- the composition comprises a self-replicating RNA molecule that encodes the CMV proteins gH and gL.
- the composition further comprises a self-replicating RNA molecule that encodes the CMV protein gB.
- the composition can also contain an RNA delivery system such as a liposome, a polymeric nanoparticle, an oil-in-water cationic nanoemulsion or combinations thereof.
- the self-replicating RNA molecule can be encapsulated in a liposome.
- the composition comprises a VRP that contains a alphavirus replicon that encodes two or more CMV proteins.
- the VRP comprises a replicon that encodes CMV gH and gL.
- the composition can further comprising a second VRP containing a replicon that encodes CMV gB.
- the composition can also comprise an adjuvant.
- the invention also relates to methods of forming a CMV protein complex.
- a self-replicating RNA encoding two or more CMV proteins is delivered to a cell, the cell is maintained under conditions suitable for expression of the CMV proteins, wherein a CMV protein complex is formed.
- a VRP that contains a self-replicating RNA encoding two or more CMV proteins is delivered to a cell, the cell is maintained under conditions suitable for expression of the CMV proteins, wherein a CMV protein complex is formed.
- the method can be used to form a CMV protein complex in a cell in vivo.
- the invention also relates to a method for inducing an immune response in an individual.
- a self-replicating RNA encoding two or more CMV proteins is administered to the individual.
- the self-replicating RNA molecule can be administered as a composition that contains an RNA delivery system, such as a liposome.
- a VRP that contains a self-replicating RNA encoding two or more CMV proteins is administered to the individual.
- the self-replicating RNA molecule encodes CMV proteins gH and gL.
- the induced immune response comprises the production of neutralizing anti-CMV antibodies. More preferably, the neutralizing antibodies are complement-independent.
- the invention also relates to a method of inhibiting CMV entry into a cell comprising contacting the cell with a self-replicating RNA molecule that encodes two or more CMV proteins, such as gH and gL.
- the cell can be selected from the group consisting of an epithelial cell, an endothelial cell, a fibroblast and combinations thereof.
- the cell is contacted with a VRP that contains a self-replicating RNA encoding two or more CMV proteins.
- the invention also relates to the use of a self-replicating RNA molecule that encodes two or more CMV proteins (e.g., a VRP, a composition comprising the self-replicating RNA molecule and a liposome) form a CMV protein complex in a cell, to induce an immune response or to inhibit CMV entry into a cell.
- a self-replicating RNA molecule that encodes two or more CMV proteins e.g., a VRP, a composition comprising the self-replicating RNA molecule and a liposome
- FIG. 1 is a schematic of CMV identifying known glycoprotein complexes involved in CMV entry into target cells.
- Envelope glycoproteins represent attractive vaccine candidates as they are expressed on the viral surface and can elicit protective and long lasting virus-neutralizing humoral immune responses.
- the structural glycoproteins mediating these processes can be divided into two classes; those that are conserved throughout the herpes virus family and those that are not. Among those that are conserved are gB, gH, gL, gM and gN.
- glycoproteins form complexes with one another (gH/gL/ ⁇ gO; gH/gL/UL 128/UL 130/UL131; gM/gN) to facilitate localization to the viral surface and to carry out their functions in viral attachment, entry and cell fusion.
- FIGS. 2A-2F are schematics of CMV constructs.
- FIG. 2A Schematic of the gB constructs (“gB FL”, full-length gB; soluble gBs “gB sol 750” and “gB sol 692”) described in Example 1. Two different soluble versions of gB were constructed; gB sol 750 lacks the transmembrane spanning domain and cytoplasmic domain, gB sol 692 also lacks a hydrophobic region and is similar to the gB sol described in Reap et al. (2007) Clin. Vacc. Immunol. 14:748-55.
- FIG. 2B Schematic of the gB replicon vectors used to produce viral replicaton particles (VRPs).
- VRPs viral replicaton particles
- FIGS. 2B , 2 D and 2 F Schematic of the gH constructs (“gH FL”, full-length gH; soluble gH “gH sol”) described in Example 1. A single soluble version of gH was constructed which lacked the transmembrane spanning domain.
- FIG. 2D Schematic of the gH replicon vectors used to produce VRPs.
- FIG. 2E Schematic of gL construct described in Example 1.
- FIG. 2F Schematic of the gL replicon vector used to produce VRPs.
- “NSP1,” “NSP2,” “NSP3,” and “NSP4,” are alphavirus nonstructural proteins 1-4, respectively, required for replication of the virus.
- FIGS. 3A and 3B show that mice immunized with gB (FL, sol 750, sol 692) or gH (FL, sol) VRPs induced antibody responses that were neutralizing in the presence of guinea pig complement.
- the neutralization assay was done by pre-incubating the CMV virus strain TB40UL32E-GFP (which encodes the enhanced green fluorescent protein-GFP, Sampaio et al (2005) J. Virol. 79(5):2754-67), with mouse sera and guinea pig complement before infection of ARPE-19 epithelial cells. Five days post-infection, the number of GFP positive cells was determined.
- FIG. 3A Serum dilution curves for all sera analyzed in ARPE-19 cells in the presence of complement.
- FIG. 3B 50% neutralization titers for the sera samples. Virus incubated with pre-immune sera yielded low neutralization at low dilutions (1:40-1:80).
- gB (FL, sol 750, sol 692) sera had very strong neutralizing activity with 50% neutralization titers between 1:1800-1:2100. All gB immunized mice yielded a similar neutralization profile.
- gH (FL, sol) sera had neutralizing activity with 50% neutralization titers around 1:160. See Example 1.
- FIG. 4A is a schematic illustration of monocistronic replicons encoding green fluorescent protein (GFP) or red fluorescent protein (mCherry) and a bicistronic replicon encoding GFP and mCherry.
- GFP green fluorescent protein
- mCherry red fluorescent protein
- NSP1 alphavirus nonstructural proteins 1-4, respectively.
- the polycistronic alphavirus replicon system was designed by making modifications to the existing alphavirus replicon system to accommodate multiple subgenomic promoters driving genes of interest.
- FIG. 4B are fluorescence plots showing FACS analysis of BHKV cells infected with VRPs containing mono- and bicistronic RNAs.
- Polycistronic alphavirus VRPs yield more cells expressing both genes of interest at approximately equal amounts (GFP and mCherry; 72.48%) than co-infection of GFP VRP+mCherry VRP (26.30%). See Example 2.
- FIG. 5A is a schematic illustration of construction of polycistronic alphavirus replicon constructs encoding gH/gL and gH/gL/gO.
- FIG. 5B show that gH/gL form a complex in vitro.
- VRPs containing replicons encoding gH, gL, gO, gH/gL or gH/gL/gO were produced in BHKV cells. The resulting VRPs were used to infect ARPE-19 cells to demonstrate complex formation in vitro. The alphavirus infected ARPE-19 cells were harvested and analyzed for the presence of gH and gL. ARPE-19 cells infected with VRPs encoding gH/gL produced disulfide linked complexes of gH/gL (see in the absence of DTT, heat). gO did not detectably alter the gH/gL association.
- the left hand blot shows expression of gH protein.
- the right hand blot shows expression of gL protein.
- FIG. 5C shows immunoprecipitation of gH and gH/gL complexes from BHKV cells infected with VRPs.
- Immunoprecipitation was performed using mouse IgG antibodies as a control (Lanes 2, 4, 7, and 10) or mouse anti-gH antibodies (Genway) to immunoprecipitate gH (Lanes 3, 5, 8, and 11).
- Western blots were performed using pooled rabbit anti-gL antibody and rabbit anti-gH antibody.
- Lanes 1, 6, and 9 show gH protein (upper band ⁇ 75 kDa) and gL protein (lower band ⁇ 30 kDa) for reference.
- Lanes 2 and 3 are lysates infected with gH-VRP.
- Lane 2 shows that the control antibody did not immunoprecipitate gH.
- Lane 3 shows the anti-gH antibody immunoprecipitated gH.
- Lanes 4 and 5 are from lysates infected with gL-VRP only. No gH protein was immunoprecipitated.
- Lanes 7 and 8 are from lysates infected with bicistronic gH/gL-VRP. Lane 8 shows that gL was immunoprecipitated using the gH antibody. (See asterisk).
- Lanes 10 and 11 are from lysates infected with tricistronic gH/gL/gO-VRP. Lane 11 shows that gL was immunoprecipitated using the gH antibody. (See asterisk).
- Molecular Weight markers are also shown (MW). See Example 3.
- FIG. 6 shows that VRPs that affect gH/gL complex formation in vitro induce potent immune response to CMV which is qualitatively and quantitatively superior to the response to gB VRPs.
- FIG. 6A and FIG. 6B show serum dilution curves for gH, gL, gO, gH+gL, gH+gL+gO, gH/gL and gH/gL/gO VRP-immunized mice in neutralization of TB40-UL32-EGFP infection of ARPE-19 cells in the presence ( FIG. 6A ) or absence ( FIG. 6B ) of complement.
- FIG. 6C is a graph showing 50% neutralization titers obtained in the presence and absence of complement. “3wp3,” three weeks post-third immunization. VRPs expressing single CMV proteins (gH, gL, gO VRPs or co-administered gH, gL and gO VRPs) did not enhance neutralizing activity beyond that of gH alone.
- FIG. 7 shows that VRPs that affect gH/gL complex formation in vitro induced antibodies that potently neutralized infection of MRC-5 fibroblast cells.
- FIG. 7A shows serum dilution curves for gH, gL, gO, gH+gL, gH+gL+gO, gH/gL and gH/gL/gO VRP-immunized mice in MRC-5 cells in the absence of complement.
- Various dilutions of sera were pre-incubated with TB40GFP in the presence or absence of guinea pig complement and then added to MRC-5 fibroblast cells. After 5 day infection with the virus, GFP-positive cells were counted.
- FIG. 7A shows serum dilution curves for gH, gL, gO, gH+gL, gH+gL+gO, gH/gL and gH/gL/gO VRP-immunized mice in
- FIG. 7B is a graph showing 50% neutralization titers obtained in a MRC-5 fibroblast cell model in the absence of complement. “3wp3,” three weeks post-third immunization. VRPs expressing single CMV proteins (gH, gL, gO VRPs or co-administered gH, gL and gO VRPs) did not enhance neutralizing activity beyond that of gH alone. In contrast, sera from mice immunized with bicistronic gH/gL or tricistronic gH/gL/gO VRPs demonstrated extremely potent neutralizing responses. See Example 4.
- FIGS. 8A and 8B are graphs showing that the neutralizing antibodies induced by delivery of the polycistronic VRPs were cross-neutralizing antibodies.
- the sera from mice immunized with gH/gL and gH/gL/gO VRPs were able to neutralize TB40UL32E-GFP and VR1814 clinical strains of CMV in both ARPE-19 epithelial cells ( FIG. 8A ) and MRC-5 fibroblast cells ( FIG. 8B ) in the absence of guinea pig complement in an IE-1 neutralization assay.
- FIG. 9 is a graph showing that the neutralizing antibodies elicited against gH FL/gL are complement-independent and similar to natural immunity in titer.
- Mice were immunized with gB FL or gH FL/gL VRPs at 1 ⁇ 10 6 IU, 3 times, 3 weeks apart before the terminal bleed.
- Sera was analyzed for ability to neutralize TB40UL32E-EGFP CMV infection of ARPE-19 cells in the presence and absence of guinea pig complement in a neutralization assay.
- antibodies elicited by gB are complement-independent.
- gH FL/gL antibodies in these vaccinated mice were similar in titer to those found in naturally infected human subjects.
- FIG. 10 shows a plasmid map for pVCR modified gH-SGPgL-SGPgO.
- FIG. 11 show a plasmid map for pVCR modified gH-SGPgL.
- FIG. 12 show a plasmid map for pVCR modified gH sol-SGPgL.
- FIG. 13 show a plasmid map for pVCR modified gH sol-SGPgL-SGPgO.
- FIG. 14A-14G show the nucleotide sequence (SEQ ID NO:_______) of the plasmid encoding the A160 self-replicating RNA molecule which encodes CMV surface glycoprotein H (gH) and CMV surface glycoprotein L (gL).
- the nucleotide sequences encoding gH and gL are underlined.
- FIG. 15A-15H show the nucleotide sequence (SEQ ID NO:______) of the plasmid encoding the A322 self-replicating RNA molecule which encodes the soluble form of CMV surface glycoprotein H (gHsol) and CMV surface glycoprotein L (gL).
- the nucleotide sequences encoding gHsol and gL are underlined.
- FIG. 16A-16H show the nucleotide sequence (SEQ ID NO:______) of the plasmid encoding the A323 self-replicating RNA molecule which encodes CMV surface glycoprotein B (gB).
- the nucleotide sequence encoding gB is underlined.
- FIGS. 17A and 17B are histograms showing 50% neutralizing titers of sera from mice that were immunized with VRP or self-replicating RNA.
- FIG. 17A shows 50% neutralizing titers against human CMV strain TB40UL32E-EGFP (“TB40) on ARPE-19 cells
- FIG. 17B shows 50% neutralizing titers against human CMV strain 8819 on ARPE-19 cells
- FIG. 18 is a schematic of petacistronic RNA replicons, A526, A527, A554, A555 and A556, that encode five CMV proteins. Subgenomic promoters are shown by arrows, other control elements are labeled.
- FIG. 19 is a fluorescence histogram showing that BHKV cells transfected with the A527 RNA replicon express the gH/gL/UL128/UL130/UL131 pentameric complex. Cell stain was performed using antibodies that bind a conformational epitope present on the pentameric complex (Macagno (2010) J. Virol. 84(2):1005-13).
- FIG. 20 is a schematic and graph.
- the schematic shows bicistronic RNA replicons, A160 and A531-A537, that encode CMV gH and gL.
- the graph shows neutralizing activity of immune sera from mice immunized with VRPs that contained the replicons.
- FIG. 21 is a graph showing anti-VZV protein antibody response in immune sera from mice immunized with monocistronic RNA replicons that encoded VZV proteins or bicistronic RNA replicons that encoded VZV gE and gI, or gH and gL.
- the mice were immunized with 7 ⁇ g RNA formulated with a CNE (see, Example 7).
- FIG. 22 is a graph showing anti-VZV protein antibody response in immune sera from mice immunized with monocistronic RNA replicons that encoded VZV proteins or bicistronic RNA replicons that encoded VZV gE and gI, or gH and gL.
- the mice were immunized with 1 ⁇ g RNA formulated with a CNE (see, Example 7).
- the invention provides platforms for co-delivery of herpesvirus proteins, such as cytomegalovirus (CMV) proteins, to cells, particularly proteins that form complexes in vivo. In some embodiments, these proteins and the complexes they form elicit potent neutralizing antibodies.
- CMV cytomegalovirus
- the immune response produced by co-delivery of herpesvirus (e.g., CMV) proteins, particularly those that form complexes in vivo (e.g., gH/gL), can be superior to the immune response produced using other approaches.
- an RNA molecule (e.g., a replicon) that encodes both gH and gL of CMV can induce better neutralizing titers and/or protective immunity in comparison to an RNA molecule that encodes gB, an RNA molecule that encodes gH, an RNA molecule that encodes gL, or even a mixture of RNA molecules that individually encode gH or gL.
- a replicon encoding gH/gL/UL128/UL130/UL131 can provide responses superior to those encoding only gH/gL.
- the invention relates to platforms for delivery of two or more herpesvirus (e.g., CMV) proteins to cells.
- the platforms comprise recombinant polycistronic nucleic acid molecules that contain a first sequence encoding a first herpesvirus (e.g., CMV) protein or fragment thereof, and a second sequence encoding a second herpesvirus (e.g., CMV) protein or fragment thereof.
- one or more additional sequences encoding additional proteins for example, a third herpesvirus (e.g., CMV) protein or fragment thereof, a fourth herpesvirus (e.g., CMV) protein or fragment thereof, a fifth herpesvirus (e.g., CMV) protein or fragment thereof etc. can be present in the recombinant polycistronic nucleic acid molecule.
- the sequences encoding herpesvirus (e.g., CMV) proteins or fragments thereof are operably linked to one or more suitable control elements so that the herpesvirus (e.g., CMV) proteins or fragments are produced by a cell that contains the recombinant polycistronic nucleic acid.
- the encoded first and second herpesvirus proteins or fragments, and the encoded third, forth and fifth herpes virus proteins or fragments, if present, generally and preferably are from the same herpes virus.
- all herpes virus proteins or fragments encoded by a polycistronic vector are CMV proteins or VZV proteins.
- the recombinant polycistronic nucleic acid molecules described herein provide the advantage of delivering sequences that encode two or more herpesvirus (e.g., CMV) proteins to a cell, and driving the expression of the herpesvirus (e.g., CMV) proteins at sufficient levels to result in the formation of a protein complex containing the two or more herpesvirus (e.g., CMV) proteins in vivo.
- the two or more encoded herpesvirus (e.g., CMV) proteins can be expressed at sufficient intracellular levels for the formation of herpesvirus (e.g., CMV) protein complexes (e.g., gH/gL).
- the encoded herpesvirus (e.g., CMV) proteins or fragments thereof can be expressed at substantially the same level, or if desired, at different levels by selecting appropriate expression control sequences (e.g., promoters, IRES, 2A site etc.). This is significantly more efficient way to produce protein complexes in vivo than by co-delivering two or more individual DNA molecules that encode different herpesvirus (e.g., CMV) to the same cell, which can be inefficient and highly variable. See, e.g., WO 2004/076645.
- the recombinant polycistronic nucleic acid molecule can be based on any desired nucleic acid such as DNA (e.g., plasmid or viral DNA) or RNA. Any suitable DNA or RNA can be used as the nucleic acid vector that carries the open reading frames that encode herpesvirus (e.g., CMV) proteins or fragments thereof. Suitable nucleic acid vectors have the capacity to carry and drive expression of more than one protein gene. Such nucleic acid vectors are known in the art and include, for example, plasmids, DNA obtained from DNA viruses such as vaccinia virus vectors (e.g., NYVAC, see U.S. Pat. No.
- the recombinant polycistronic nucleic acid molecule can be modified, e.g., contain modified nucleobases and or linkages as described further herein.
- the polycistronic nucleic acid molecule is an RNA molecule.
- the recombinant polycistronic nucleic acid molecule is a DNA molecule such as plasmid DNA.
- DNA molecules can, for example, encode a polycistronic replicon and contain a mammalian promoter that drives transcription of the replicon.
- Recombinant polycistronic nucleic acid molecules or this type can be administered to a mammal and then be transcribed in situ to produce a polycistronic replicon that expresses herpesvirus proteins.
- the invention is a polycistronic nucleic acid molecule that contains a sequence encoding a herpesvirus gH or fragment thereof, and a herpesvirus gL or a fragment thereof.
- the gH and gL proteins, or fragments thereof can be from any desired herpes virus such as HSV-1, HSV-2, VZV, EBV type 1, EBV type 2, CMV, HHV-6 type A, HHV-6 type B, HHV-7, KSHV, and the like.
- the herpesvirus is VZV, HSV-2, HSV-1, EBV (type 1 or type 2) or CMV. More preferably, the herpesvirus is VZV, HSV-2 or CMV.
- the herpesvirus is CMV.
- the sequences of gH and gL proteins and of nucleic acids that encode the proteins from these viruses are well known in the art. Exemplary sequences are identified in Table 1.
- the polycistronic nucleic acid molecule can contain a first sequence encoding a gH protein disclosed in Table 1, or a fragment thereof, or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.
- the polycistronic nucleic acid molecule can also contain a second sequence encoding a gL protein disclosed in Table 1, or a fragment thereof, or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.
- Virus gH accession number gL accession number HSV-1 (HHV-1) NP_044623.1 NP_044602.1 HSV-2 (HHV-2) NP_044491.1 NP_044470.1 VZV (HHV-3) NP_040160.1 NP_040182.1 EBV type 1 (HHV-4) YP_401700.1 YP_401678.1 EBV type 2 (HHV-4) YP_001129496.1 YP_001129472.1 CMV (HHV-5) YP_081523.1 YP_081555.1 HHV-6 type A NP_042941.1 NP_042975.1 HHV-6 type B NP_050229.1 NP_050261.1 HHV-7 YP_073788.1 YP_073820.1 KSHV (HHV-8) YP_001129375.1 YP_001129399.1
- first sequence a “second sequence,” etc.
- first and second sequences can appear in any desired order or orientation, and that no particular order or orientation is intended by the words “first”, “second” etc.
- protein complexes are referred to by listing the proteins that are present in the complex, e.g., gH/gL. This is intended to describe the complex by the proteins that are present in the complex and does not indicate relative amounts of the proteins or the order or orientation of sequences that encode the proteins on a recombinant nucleic acid.
- alphavirus VRP and self-replicating RNA that contain sequences encoding CMV proteins are further described herein. It is intended that the sequences encoding CMV proteins in such preferred embodiments, can be replaced with sequences encoding proteins, such as gH and gL from other herpesviruses.
- CMV proteins are delivered to a cell using alphavirus replicon particles (VRP) which employ polycistronic replicons (or vectors) as described below.
- VRP alphavirus replicon particles
- polycistronic includes bicistronic vectors as well as vectors comprising three or more cistrons.
- Cistrons in a polycistronic vector can encode CMV proteins from the same CMV strains or from different CMV strains.
- the cistrons can be oriented in any 5′-3′ order. Any nucleotide sequence encoding a CMV protein can be used to produce the protein. Exemplary sequences useful for preparing the polycistronic nucleic acids that encode two or more CMV proteins or fragments thereof are described herein.
- alphavirus has its conventional meaning in the art and includes various species such as Venezuelan equine encephalitis virus (VEE; e.g., Trinidad donkey, TC83CR, etc.), Semliki Forest virus (SFV), Sindbis virus, Ross River virus, Western equine encephalitis virus, Eastern equine encephalitis virus, Chikungunya virus, S.A.
- VEE Venezuelan equine encephalitis virus
- SFV Semliki Forest virus
- Sindbis virus Sindbis virus
- Ross River virus Western equine encephalitis virus
- Western equine encephalitis virus Venezuelan equine encephalitis virus
- Eastern equine encephalitis virus Chikungunya virus
- alphavirus may also include chimeric alphaviruses (e.g., as described by Perri et al., (2003) J. Virol. 77(19):10394-403) that contain genome sequences from more than one alphavirus.
- VRP alphavirus replicon particle
- replicon particle is an alphavirus replicon packaged with alphavirus structural proteins.
- an “alphavirus replicon” is an RNA molecule which can direct its own amplification in vivo in a target cell.
- the replicon encodes the polymerase(s) which catalyze RNA amplification (nsP1, nsP2, nsP3, nsP4) and contains cis RNA sequences required for replication which are recognized and utilized by the encoded polymerase(s).
- An alphavirus replicon typically contains the following ordered elements: 5′ viral sequences required in cis for replication, sequences which encode biologically active alphavirus nonstructural proteins (nsP1, nsP2, nsP3, nsP4), 3′ viral sequences required in cis for replication, and a polyadenylate tract.
- An alphavirus replicon also may contain one or more viral subgenomic “junction region” promoters directing the expression of heterologous nucleotide sequences, which may, in certain embodiments, be modified in order to increase or reduce viral transcription of the subgenomic fragment and heterologous sequence(s) to be expressed.
- Other control elements can be used, as described below.
- Alphavirus replicons encoding CMV proteins are used to produce VRPs.
- Such alphavirus replicons comprise sequences encoding at least two CMV proteins or fragments thereof. These sequences are operably linked to one or more suitable control elements, such as a subgenomic promoter, an IRES (e.g., EMCV, EV71), and a viral 2A site, which can be the same or different. Delivery of components of these complexes using the polycistronic vectors disclosed herein is an efficient way of providing nucleic acid sequences that encode two or more CMV proteins in desired relative amounts; whereas if multiple alphavirus constructs were used to deliver individual CMV proteins for complex formation, efficient co-delivery of VRPs would be required.
- a single subgenomic promoter is operable linked to two sequences encoding two different CMV proteins, and an IRES is positioned between the two coding sequences.
- two sequences that encode two different CMV proteins are operably linked to separate promoters.
- the two sequences that encode two different CMV proteins are operably linked to a single promoter.
- the two sequences that encode two different CMV proteins are linked to each other through a nucleotide sequence encoding a viral 2A site, and thus encode a single amino acid chain that contain the amino acid sequences of both CMV proteins.
- the viral 2A site in this context is used to generate two CMV proteins from encoded polyprotein.
- Subgenomic promoters also known as junction region promoters can be used to regulate protein expression.
- Alphaviral subgenomic promoters regulate expression of alphaviral structural proteins. See Strauss and Strauss, “The alphaviruses: gene expression, replication, and evolution,” Microbiol Rev. 1994 September; 58(3):491-562.
- a polycistronic polynucleotide can comprise a subgenomic promoter from any alphavirus. When two or more subgenomic promoters are present in a polycistronic polynucleotide, the promoters can be the same or different.
- the subgenomic promoter can have the sequence CTCTCTACGGCTAACCTGAATGGA (SEQ ID NO:______).
- subgenomic promoters can be modified in order to increase or reduce viral transcription of the proteins. See U.S. Pat. No. 6,592,874.
- one or more control elements is an internal ribosomal entry site (IRES).
- IRES allows multiple proteins to be made from a single mRNA transcript as ribosomes bind to each IRES and initiate translation in the absence of a 5′′-cap, which is normally required to initiate translation of protein in eukaryotic cells.
- the IRES can be EV71 or EMCV.
- the FMDV 2A protein is a short peptide that serves to separate the structural proteins of FMDV from a nonstructural protein (FMDV 2B).
- FMDV 2B nonstructural protein
- Early work on this peptide suggested that it acts as an autocatalytic protease, but other work (e.g., Donnelly et al., (2001), J. Gen. Virol. 82, 1013-1025) suggest that this short sequence and the following single amino acid of FMDV 2B (Gly) acts as a translational stop-start. Regardless of the precise mode of action, the sequence can be inserted between two polypeptides, and effect the production of multiple individual polypeptides from a single open reading frame.
- FMDV 2A sequences can be inserted between the sequences encoding at least two CMV proteins, allowing for their synthesis as part of a single open reading frame.
- the open reading frame may encode a gH protein and a gL protein separated by a sequence encoding a viral 2A site.
- a single mRNA is transcribed then, during the translation step, the gH and gL peptides are produced separately due to the activity of the viral 2A site.
- Any suitable viral 2A sequence may be used.
- a viral 2A site comprises the consensus sequence Asp-Val/Ile-Glu-X-Asn-Pro-Gly-Pro, where X is any amino acid (SEQ ID NO:_______).
- the Foot and Mouth Disease Virus 2A peptide sequence is DVESNPGP (SEQ ID NO:_______). See Trichas et al., “Use of the viral 2A peptide for bicistronic expression in transgenic mice,” BMC Biol. 2008 Sep. 15; 6:40, and Halpin et al., “Self-processing 2A-polyproteins—a system for co-ordinate expression of multiple proteins in transgenic plants,” Plant J. 1999 February; 17(4):453-9.
- an alphavirus replicon is a chimeric replicon, such as a VEE-Sindbis chimeric replicon (VCR) or a VEE strain TC83 replicon (TC83R) or a TC83-Sindbis chimeric replicon (TC83CR).
- VCR VEE-Sindbis chimeric replicon
- T83R VEE strain TC83 replicon
- TC83-Sindbis chimeric replicon TC83CR.
- a VCR contains the packaging signal and 3′ UTR from a Sindbis replicon in place of sequences in nsP3 and at the 3′ end of the VEE replicon; see Perri et al., J. Virol. 77, 10394-403, 2003.
- a TC83CR contains the packaging signal and 3′ UTR from a Sindbis replicon in place of sequences in nsP3 and at the 3′ end
- an alphavirus is assembled into a VRP using a packaging cell.
- An “alphavirus packaging cell” is a cell that contains one or more alphavirus structural protein expression cassettes and that produces recombinant alphavirus particles after introduction of an alphavirus replicon, eukaryotic layered vector initiation system (e.g., U.S. Pat. No. 5,814,482), or recombinant alphavirus particle.
- the one or more different alphavirus structural protein cassettes serve as “helpers” by providing the alphavirus structural proteins.
- alphavirus structural protein cassette is an expression cassette that encodes one or more alphavirus structural proteins and comprises at least one and up to five copies (i.e., 1, 2, 3, 4, or 5) of an alphavirus replicase recognition sequence.
- Structural protein expression cassettes typically comprise, from 5′ to 3′, a 5′ sequence which initiates transcription of alphavirus RNA, an optional alphavirus subgenomic region promoter, a nucleotide sequence encoding the alphavirus structural protein, a 3′ untranslated region (which also directs RNA transcription), and a polyA tract. See, e.g., WO 2010/019437.
- an alphavirus structural protein cassette encodes the capsid protein (C) but not either of the glycoproteins (E2 and E1). In some embodiments an alphavirus structural protein cassette encodes the capsid protein and either the E1 or E2 glycoproteins (but not both). In some embodiments an alphavirus structural protein cassette encodes the E2 and E1 glycoproteins but not the capsid protein. In some embodiments an alphavirus structural protein cassette encodes the E1 or E2 glycoprotein (but not both) and not the capsid protein.
- VRPs are produced by the simultaneous introduction of replicons and helper RNAs into cells of various sources. Under these conditions, for example, BHKV cells (1 ⁇ 10 7 ) are electroporated at, for example, 220 volts, 1000 ⁇ F, 2 manually pulses with 10 ⁇ g replicon RNA:6 ⁇ g defective helper Cap RNA:10 ⁇ g defective helper Gly RNA, alphavirus containing supernatant is collected ⁇ 24 hours later. Replicons and/or helpers can also be introduced in DNA forms which launch suitable RNAs within the transfected cells.
- a packaging cell may be a mammalian cell or a non-mammalian cell, such as an insect (e.g., SF9) or avian cell (e.g., a primary chick or duck fibroblast or fibroblast cell line). See U.S. Pat. No. 7,445,924.
- Avian sources of cells include, but are not limited to, avian embryonic stem cells such as EB66® (VIVALIS); chicken cells, including chicken embryonic stem cells such as EBx® cells, chicken embryonic fibroblasts, and chicken embryonic germ cells; duck cells such as the AGE1.CR and AGE1.CR.pIX cell lines (ProBioGen) which are described, for example, in Vaccine 27:4975-4982 (2009) and WO2005/042728); and geese cells.
- a packaging cell is a primary duck fibroblast or duck retinal cell line, such as AGE.CR (PROBIOGEN).
- Mammalian sources of cells for simultaneous nucleic acid introduction and/or packaging cells include, but are not limited to, human or non-human primate cells, including PerC6 (PER.C6) cells (CRUCELL N.V.), which are described, for example, in WO 01/38362 and WO 02/40665, as well as deposited under ECACC deposit number 96022940); MRC-5 (ATCC CCL-171); WI-38 (ATCC CCL-75); fetal rhesus lung cells (ATCC CL-160); human embryonic kidney cells (e.g., 293 cells, typically transformed by sheared adenovirus type 5 DNA); VERO cells from monkey kidneys); cells of horse, cow (e.g., MDBK cells), sheep, dog (e.g., MDCK cells from dog kidneys, ATCC CCL34 MDCK (NBL2) or MDCK 33016, deposit number DSM ACC 2219 as described in WO 97/37001); cat, and rodent (e.g.,
- a packaging cell is stably transformed with one or more structural protein expression cassette(s).
- Structural protein expression cassettes can be introduced into cells using standard recombinant DNA techniques, including transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome-mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, “gene gun” methods, and DEAE- or calcium phosphate-mediated transfection.
- Structural protein expression cassettes typically are introduced into a host cell as DNA molecules, but can also be introduced as in vitro-transcribed RNA. Each expression cassette can be introduced separately or substantially simultaneously.
- stable alphavirus packaging cell lines are used to produce recombinant alphavirus particles. These are alphavirus-permissive cells comprising DNA cassettes expressing the defective helper RNA stably integrated into their genomes. See Polo et al., Proc. Natl. Acad. Sci. USA 96, 4598-603, 1999.
- the helper RNAs are constitutively expressed but the alphavirus structural proteins are not, because the genes are under the control of an alphavirus subgenomic promoter (Polo et al., 1999).
- replicase enzymes are produced and trigger expression of the capsid and glycoprotein genes on the helper RNAs, and output VRPs are produced.
- Introduction of the replicon can be accomplished by a variety of methods, including both transfection and infection with a seed stock of alphavirus replicon particles.
- the packaging cell is then incubated under conditions and for a time sufficient to produce packaged alphavirus replicon particles in the culture supernatant.
- packaging cells allow VRPs to act as self-propagating viruses.
- This technology allows VRPs to be produced in much the same manner, and using the same equipment, as that used for live attenuated vaccines or other viral vectors that have producer cell lines available, such as replication-incompetent adenovirus vectors grown in cells expressing the adenovirus E1A and E1B genes.
- a two-step process comprises producing a seed stock of alphavirus replicon particles by transfecting a packaging cell with a replicon RNA or plasmid DNA-based replicon. A much larger stock of replicon particles is then produced in a second step, by infecting a fresh culture of packaging cells with the seed stock.
- replicon particles can be harvested from packaging cells infected with the seed stock. In some embodiments, replicon particles can then be passaged in yet larger cultures of naive packaging cells by repeated low-multiplicity infection, resulting in commercial scale preparations with the same high titer.
- Two or more CMV proteins can be produced by expression of recombinant nucleic acids that encode the proteins in the cells of a subject.
- the recombinant nucleic acid molecules encode two or more CMV proteins, e.g., are polycistronic.
- polycistronic includes bicistronic.
- Preferred nucleic acids that can be administered to a subject to cause the production of CMV proteins are self-replicating RNA molecules.
- the self-replicating RNA molecules of the invention are based on the genomic RNA of RNA viruses, but lack the genes encoding one or more structural proteins.
- the self-replicating RNA molecules are capable of being translated to produce non-structural proteins of the RNA virus and CMV proteins encoded by the self-replicating RNA.
- the self-replicating RNA generally contains at least one or more genes selected from the group consisting of viral replicase, viral proteases, viral helicases and other nonstructural viral proteins, and also comprise 5′- and 3′-end cis-active replication sequences, and a heterologous sequences that encodes two or more desired CMV proteins.
- a subgenomic promoter that directs expression of the heterologous sequence(s) can be included in the self-replicating RNA.
- a heterologous sequence may be fused in frame to other coding regions in the self-replicating RNA and/or may be under the control of an internal ribosome entry site (IRES).
- Self-replicating RNA molecules of the invention can be designed so that the self-replicating RNA molecule cannot induce production of infectious viral particles. This can be achieved, for example, by omitting one or more viral genes encoding structural proteins that are necessary for the production of viral particles in the self-replicating RNA.
- an alpha virus such as Sindbis virus (SIN), Semliki forest virus and Venezuelan equine encephalitis virus (VEE)
- Sindbis virus Sindbis virus
- VEE Venezuelan equine encephalitis virus
- one or more genes encoding viral structural proteins, such as capsid and/or envelope glycoproteins can be omitted.
- self-replicating RNA molecules of the invention can be designed to induce production of infectious viral particles that are attenuated or virulent, or to produce viral particles that are capable of a single round of subsequent infection.
- a self-replicating RNA molecule can, when delivered to a vertebrate cell even without any proteins, lead to the production of multiple daughter RNAs by transcription from itself (or from an antisense copy of itself).
- the self-replicating RNA can be directly translated after delivery to a cell, and this translation provides a RNA-dependent RNA polymerase which then produces transcripts from the delivered RNA.
- the delivered RNA leads to the production of multiple daughter RNAs.
- These transcripts are antisense relative to the delivered RNA and may be translated themselves to provide in situ expression of encoded CMV protein, or may be transcribed to provide further transcripts with the same sense as the delivered RNA which are translated to provide in situ expression of the encoded CMV protein(s).
- RNA replicon such as an alphavirus replicon as described herein.
- These + stranded replicons are translated after delivery to a cell to produce a replicase (or replicase-transcriptase).
- the replicase is translated as a polyprotein which auto cleaves to provide a replication complex which creates genomic ⁇ strand copies of the + strand delivered RNA.
- These ⁇ strand transcripts can themselves be transcribed to give further copies of the + stranded parent RNA and also to give rise to one or more subgenomic transcript which encodes two or more CMV proteins.
- Suitable alphavirus replicons can use a replicase from a Sindbis virus, a Semliki forest virus, an eastern equine encephalitis virus, a Venezuelan equine encephalitis virus, etc.
- a preferred self-replicating RNA molecule thus encodes (i) a RNA-dependent RNA polymerase which can transcribe RNA from the self-replicating RNA molecule and (ii) two or more CMV proteins or fragments thereof.
- the polymerase can be an alphavirus replicase e.g. comprising alphavirus protein nsP4. Protein nsP4 is the key catalytic component of the replicase.
- an alphavirus based self-replicating RNA molecule of the invention does not encode all alphavirus structural proteins.
- the self replicating RNA can lead to the production of genomic RNA copies of itself in a cell, but not to the production of RNA-containing alphavirus virions.
- the inability to produce these virions means that, unlike a wild-type alphavirus, the self-replicating RNA molecule cannot perpetuate itself in infectious form.
- the alphavirus structural proteins which are necessary for perpetuation in wild-type viruses are absent from self replicating RNAs of the invention and their place is taken by gene(s) encoding the desired gene product (CMV protein or fragment thereof), such that the subgenomic transcript encodes the desired gene product rather than the structural alphavirus virion proteins.
- RNA molecule useful with the invention have two sequences that encode different CMV proteins or fragments thereof.
- the sequences encoding the CMV proteins or fragments can be in any desired orientation, and can be operably linked to the same or separate promoters. If desired, the sequences encoding the CMV proteins or fragments can be part of a single open reading frame.
- the RNA may have one or more additional (downstream) sequences or open reading frames e.g. that encode other additional CMV proteins or fragments thereof.
- a self-replicating RNA molecule can have a 5′ sequence which is compatible with the encoded replicase.
- the self-replicating RNA molecule is derived from or based on an alphavirus, such as an alphavirus replicon as defined herein.
- the self-replicating RNA molecule is derived from or based on a virus other than an alphavirus, preferably, a positive-stranded RNA viruses, and more preferably a picornavirus, flavivirus, rubivirus, pestivirus, hepacivirus, calicivirus, or coronavirus.
- Suitable wild-type alphavirus sequences are well-known and are available from sequence depositories, such as the American Type Culture Collection, Rockville, Md.
- alphaviruses include Aura (ATCC VR-368), Bebaru virus (ATCC VR-600, ATCC VR-1240), Cabassou (ATCC VR-922), Chikungunya virus (ATCC VR-64, ATCC VR-1241), Eastern equine encephalomyelitis virus (ATCC VR-65, ATCC VR-1242), Fort Morgan (ATCC VR-924), Getah virus (ATCC VR-369, ATCC VR-1243), Kyzylagach (ATCC VR-927), Mayaro virus (ATCC VR-66; ATCC VR-1277), Middleburg (ATCC VR-370), Mucambo virus (ATCC VR-580, ATCC VR-1244), Ndumu (ATCC VR-371), Pixuna virus (ATCC VR-372, ATCC VR-1245), Ross River virus (ATCC VR-373, ATCC VR-1246), Semliki Forest (ATCC VR-67, ATCC VR-1247), Sindbis virus (ATCC VR-68, ATCC VR-1248), Tonate
- the self-replicating RNA molecules of the invention can contain one or more modified nucleotides and therefore have improved stability and be resistant to degradation and clearance in vivo, and other advantages. Without wishing to be bound by any particular theory, it is believed that self-replicating RNA molecules that contain modified nucleotides avoid or reduce stimulation of endosomal and cytoplasmic immune receptors when the self-replicating RNA is delivered into a cell. This permits self-replication, amplification and expression of protein to occur.
- RNA molecules produced as a result of self-replication are recognized as foreign nucleic acids by the cytoplasmic immune receptors.
- self-replicating RNA molecules that contain modified nucleotides provide for efficient amplification of the RNA in a host cell and expression of CMV proteins, as well as adjuvant effects.
- the RNA sequence can be modified with respect to its codon usage, for example, to increase translation efficacy and half-life of the RNA.
- a poly A tail e.g., of about 30 adenosine residues or more
- the 5′ end of the RNA may be capped with a modified ribonucleotide with the structure m7G (5′) ppp (5′) N (cap 0 structure) or a derivative thereof, which can be incorporated during RNA synthesis or can be enzymatically engineered after RNA transcription (e.g., by using Vaccinia Virus Capping Enzyme (VCE) consisting of mRNA triphosphatase, guanylyl-transferase and guanine-7-methylransferase, which catalyzes the construction of N7-monomethylated cap 0 structures).
- VCE Vaccinia Virus Capping Enzyme
- Cap 0 structure can provide stability and translational efficacy to the RNA molecule.
- the 5′ cap of the RNA molecule may be further modified by a 2′-O-Methyltransferase which results in the generation of a cap 1 structure (m7 Gppp [m2′-O] N), which may further increases translation efficacy.
- a cap 1 structure may also increase in vivo potency.
- modified nucleotide refers to a nucleotide that contains one or more chemical modifications (e.g., substitutions) in or on the nitrogenous base of the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)).
- a self replicating RNA molecule can contain chemical modifications in or on the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, six-membered sugar analog, or open-chain sugar analog), or the phosphate.
- the self-replicating RNA molecules can contain at least one modified nucleotide, that preferably is not part of the 5′ cap (e.g., in addition to the modification that are part of the 5′′ cap). Accordingly, the self-replicating RNA molecule can contain a modified nucleotide at a single position, can contain a particular modified nucleotide (e.g., pseudouridine, N6-methyladenosine, 5-methylcytidine, 5-methyluridine) at two or more positions, or can contain two, three, four, five, six, seven, eight, nine, ten or more modified nucleotides (e.g., each at one or more positions). Preferably, the self-replicating RNA molecules comprise modified nucleotides that contain a modification on or in the nitrogenous base, but do not contain modified sugar or phosphate moieties.
- a modified nucleotide e.g., pseudouridine, N6-methyladenosine, 5-methylcyt
- nucleotides in a self-replicating RNA molecule are modified nucleotides.
- 0.001%-25%, 0.01%-25%, 0.1%-25%, or 1%-25% of the nucleotides in a self-replicating RNA molecule are modified nucleotides.
- a particular unmodified nucleotide in a self-replicating RNA molecule is replaced with a modified nucleotide.
- about 1% of the nucleotides in the self-replicating RNA molecule that contain uridine can be modified, such as by replacement of uridine with pseudouridine.
- the desired amount (percentage) of two, three, or four particular nucleotides (nucleotides that contain uridine, cytidine, guanosine, or adenine) in a self-replicating RNA molecule are modified nucleotides.
- 0.001%-25%, 0.01%-25%, 0.1%-25, or 1%-25% of a particular nucleotide in a self-replicating RNA molecule are modified nucleotides.
- 0.001%-20%, 0.001%-15%, 0.001%-10%, 0.01%-20%, 0.01%-15%, 0.1%-25, 0.01%-10%, 1%-20%, 1%-15%, 1%-10%, or about 5%, about 10%, about 15%, about 20% of a particular nucleotide in a self-replicating RNA molecule are modified nucleotides.
- nucleotides in a self-replicating RNA molecule are modified nucleotides. It is also preferred that less than 100% of a particular nucleotide in a self-replicating RNA molecule are modified nucleotides. Thus, preferred self-replicating RNA molecules comprise at least some unmodified nucleotides.
- nucleoside modifications found on mammalian RNA. See, e.g., Limbach et al., Nucleic Acids Research, 22(12):2183-2196 (1994).
- the preparation of nucleotides and modified nucleotides and nucleosides are well-known in the art, e.g. from U.S. Pat. Nos. 4,373,071, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530, 5,700,642 all of which are incorporated herein by reference in their entirety, and many modified nucleosides and modified nucleotides are commercially available.
- Modified nucleobases which can be incorporated into modified nucleosides and nucleotides and be present in the RNA molecules include: m5C (5-methylcytidine), m5U (5-methyluridine), m6A (N6-methyladenosine), s2U (2-thiouridine), Um (2′-O-methyluridine), m1A (1-methyladenosine); m2A (2-methyladenosine); Am (2-1-O-methyladenosine); ms2m6A (2-methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A (2-methylthio-N6 isopentenyladenosine); io6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl) adenos
- the self-replicating RNA molecule can contain phosphoramidate, phosphorothioate, and/or methylphosphonate linkages.
- Self-replicating RNA molecules that comprise at least one modified nucleotide can be prepared using any suitable method.
- suitable methods are known in the art for producing RNA molecules that contain modified nucleotides.
- a self-replicating RNA molecule that contains modified nucleotides can be prepared by transcribing (e.g., in vitro transcription) a DNA that encodes the self-replicating RNA molecule using a suitable DNA-dependent RNA polymerase, such as T7 phage RNA polymerase, SP6 phage RNA polymerase, T3 phage RNA polymerase, and the like, or mutants of these polymerases which allow efficient incorporation of modified nucleotides into RNA molecules.
- the transcription reaction will contain nucleotides and modified nucleotides, and other components that support the activity of the selected polymerase, such as a suitable buffer, and suitable salts.
- nucleotide analogs into a self-replicating RNA may be engineered, for example, to alter the stability of such RNA molecules, to increase resistance against RNases, to establish replication after introduction into appropriate host cells (“infectivity” of the RNA), and/or to induce or reduce innate and adaptive immune responses.
- Suitable synthetic methods can be used alone, or in combination with one or more other methods (e.g., recombinant DNA or RNA technology), to produce a self-replicating RNA molecule that contain one or more modified nucleotides.
- Suitable methods for de novo synthesis are well-known in the art and can be adapted for particular applications. Exemplary methods include, for example, chemical synthesis using suitable protecting groups such as CEM (Masuda et al., (2007) Nucleic Acids Symposium Series 51:3-4), the ⁇ -cyanoethyl phosphoramidite method (Beaucage S L et al.
- Nucleic acid synthesis can also be performed using suitable recombinant methods that are well-known and conventional in the art, including cloning, processing, and/or expression of polynucleotides and gene products encoded by such polynucleotides. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic polynucleotides are examples of known techniques that can be used to design and engineer polynucleotide sequences.
- Site-directed mutagenesis can be used to alter nucleic acids and the encoded proteins, for example, to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations and the like. Suitable methods for transcription, translation and expression of nucleic acid sequences are known and conventional in the art. (See generally, Current Protocols in Molecular Biology, Vol. 2, Ed. Ausubel, et al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13, 1988; Glover, DNA Cloning, Vol. II, IRL Press, Wash., D.C., Ch.
- a self-replicating RNA can be digested to monophosphates (e.g., using nuclease P1) and dephosphorylated (e.g., using a suitable phosphatase such as CIAP), and the resulting nucleosides analyzed by reversed phase HPLC (e.g., usings a YMC Pack ODS-AQ column (5 micron, 4.6 ⁇ 250 mm) and elute using a gradient, 30% B (0-5 min) to 100% B (5-13 min) and at 100% B (13-40) min, flow Rate (0.7 ml/min), UV detection (wavelength: 260 nm), column temperature (30° C.). Buffer A (20 mM acetic acid ⁇ ammonium acetate pH 3.5), buffer B (20 mM acetic acid ⁇ ammonium acetate pH 3.5/methanol [90/10]
- the self-replicating RNA may be associated with a delivery system.
- the self-replicating RNA may be administered with or without an adjuvant.
- the self-replicating RNA described herein are suitable for delivery in a variety of modalities, such as naked RNA delivery or in combination with lipids, polymers or other compounds that facilitate entry into the cells.
- Self-replicating RNA molecules can be introduced into target cells or subjects using any suitable technique, e.g., by direct injection, microinjection, electroporation, lipofection, biolystics, and the like.
- the self-replicating RNA molecule may also be introduced into cells by way of receptor-mediated endocytosis. See e.g., U.S. Pat. No. 6,090,619; Wu and Wu, J. Biol. Chem., 263:14621 (1988); and Curiel et al., Proc. Natl.
- U.S. Pat. No. 6,083,741 discloses introducing an exogenous nucleic acid into mammalian cells by associating the nucleic acid to a polycation moiety (e.g., poly-L-lysine having 3-100 lysine residues), which is itself coupled to an integrin receptor-binding moiety (e.g., a cyclic peptide having the sequence Arg-Gly-Asp (SEQ ID NO:_______).
- a polycation moiety e.g., poly-L-lysine having 3-100 lysine residues
- an integrin receptor-binding moiety e.g., a cyclic peptide having the sequence Arg-Gly-Asp (SEQ ID NO:_______).
- RNA molecules can be delivered into cells via amphiphiles. See e.g., U.S. Pat. No. 6,071,890.
- a nucleic acid molecule may form a complex with the cationic amphiphile. Mammalian cells contacted with the complex can readily take it up.
- the self-replicating RNA can be delivered as naked RNA (e.g. merely as an aqueous solution of RNA) but, to enhance entry into cells and also subsequent intercellular effects, the self-replicating RNA is preferably administered in combination with a delivery system, such as a particulate or emulsion delivery system.
- a delivery system such as a particulate or emulsion delivery system.
- delivery systems include, for example liposome-based delivery (Debs and Zhu (1993) WO 93/24640; Mannino and Gould-Fogerite (1988) BioTechniques 6(7): 682-691; Rose U.S. Pat. No.
- Three particularly useful delivery systems are (i) liposomes, (ii) non-toxic and biodegradable polymer microparticles, and (iii) cationic submicron oil-in-water emulsions.
- RNA-containing aqueous core can have an anionic, cationic or zwitterionic hydrophilic head group. Formation of liposomes from anionic phospholipids dates back to the 1960s, and cationic liposome-forming lipids have been studied since the 1990s. Some phospholipids are anionic whereas other are zwitterionic.
- Suitable classes of phospholipid include, but are not limited to, phosphatidylethanolamines, phosphatidylcholines, phosphatidylserines, and phosphatidylglycerols, and some useful phospholipids are listed in Table 2.
- Useful cationic lipids include, but are not limited to, dioleoyl trimethylammonium propane (DOTAP), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,Ndimethyl-3-aminopropane (DODMA), 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane (DLenDMA).
- Zwitterionic lipids include, but are not limited to, acyl zwitterionic lipids and ether zwitterionic lipids. Examples of useful zwitterionic lipids are DPPC, DOPC and dodecylphosphocholine. The lipids can be saturated or unsaturated.
- Liposomes can be formed from a single lipid or from a mixture of lipids.
- a mixture may comprise (i) a mixture of anionic lipids (ii) a mixture of cationic lipids (iii) a mixture of zwitterionic lipids (iv) a mixture of anionic lipids and cationic lipids (v) a mixture of anionic lipids and zwitterionic lipids (vi) a mixture of zwitterionic lipids and cationic lipids or (vii) a mixture of anionic lipids, cationic lipids and zwitterionic lipids.
- a mixture may comprise both saturated and unsaturated lipids.
- a mixture may comprise DSPC (zwitterionic, saturated), DlinDMA (cationic, unsaturated), and/or DMPG (anionic, saturated).
- DSPC zwitterionic, saturated
- DlinDMA cationic, unsaturated
- DMPG anionic, saturated
- the hydrophilic portion of a lipid can be PEGylated (i.e. modified by covalent attachment of a polyethylene glycol). This modification can increase stability and prevent non-specific adsorption of the liposomes.
- lipids can be conjugated to PEG using techniques such as those disclosed in Heyes et al. (2005) J Controlled Release 107:276-87.
- a mixture of DSPC, DlinDMA, PEG-DMPG and cholesterol can be used to form liposomes.
- a separate aspect of the invention is a liposome comprising DSPC, DlinDMA, PEG-DMG and cholesterol.
- This liposome preferably encapsulates RNA, such as a self-replicating RNA e.g. encoding an immunogen.
- Liposomes are usually divided into three groups: multilamellar vesicles (MLV); small unilamellar vesicles (SUV); and large unilamellar vesicles (LUV).
- MLVs have multiple bilayers in each vesicle, forming several separate aqueous compartments.
- SUVs and LUVs have a single bilayer encapsulating an aqueous core; SUVs typically have a diameter ⁇ 50 nm, and LUVs have a diameter >50 nm.
- Liposomes useful with of the invention are ideally LUVs with a diameter in the range of 50-220 nm.
- compositions comprising a population of LUVs with different diameters: (i) at least 80% by number should have diameters in the range of 20-220 nm, (ii) the average diameter (Zav, by intensity) of the population is ideally in the range of 40-200 nm, and/or (iii) the diameters should have a polydispersity index ⁇ 0.2.
- Liposomes Methods and Protocols, Volume 1: Pharmaceutical Nanocarriers: Methods and Protocols. (ed. Weissig). Humana Press, 2009. ISBN 160327359X; Liposome Technology, volumes I, II & III. (ed. Gregoriadis). Informa Healthcare, 2006; and Functional Polymer Colloids and Microparticles volume 4 (Microspheres, microcapsules & liposomes). (eds. Arshady & Guyot). Citus Books, 2002.
- One useful method involves mixing (i) an ethanolic solution of the lipids (ii) an aqueous solution of the nucleic acid and (iii) buffer, followed by mixing, equilibration, dilution and purification (Heyes et al. (2005) J Controlled Release 107:276-87.).
- RNA is preferably encapsulated within the liposomes, and so the liposome forms a outer layer around an aqueous RNA-containing core. This encapsulation has been found to protect RNA from RNase digestion.
- the liposomes can include some external RNA (e.g. on the surface of the liposomes), but preferably, at least half of the RNA (and ideally substantially all of it) is encapsulated.
- RNA molecules can form microparticles to encapsulate or adsorb RNA.
- the use of a substantially non-toxic polymer means that a recipient can safely receive the particles, and the use of a biodegradable polymer means that the particles can be metabolised after delivery to avoid long-term persistence.
- Useful polymers are also sterilisable, to assist in preparing pharmaceutical grade formulations.
- Suitable non-toxic and biodegradable polymers include, but are not limited to, poly( ⁇ -hydroxy acids), polyhydroxy butyric acids, polylactones (including polycaprolactones), polydioxanones, polyvalerolactone, polyorthoesters, polyanhydrides, polycyanoacrylates, tyrosine-derived polycarbonates, polyvinyl-pyrrolidinones or polyester-amides, and combinations thereof.
- the microparticles are formed from poly( ⁇ -hydroxy acids), such as a poly(lactides) (“PLA”), copolymers of lactide and glycolide such as a poly(D,L-lactide-co-glycolide) (“PLG”), and copolymers of D,L-lactide and caprolactone.
- PLG polymers include those having a lactide/glycolide molar ratio ranging, for example, from 20:80 to 80:20 e.g. 25:75, 40:60, 45:55, 55:45, 60:40, 75:25.
- Useful PLG polymers include those having a molecular weight between, for example, 5,000-200,000 Da e.g. between 10,000-100,000, 20,000-70,000, 40,000-50,000 Da.
- microparticles ideally have a diameter in the range of 0.02 ⁇ m to 8 ⁇ m.
- a composition comprising a population of microparticles with different diameters at least 80% by number should have diameters in the range of 0.03-7 ⁇ m.
- a microparticle may include a cationic surfactant and/or lipid e.g.
- Microparticles of the invention can have a zeta potential of between 40-100 mV.
- RNA can be adsorbed to the microparticles, and adsorption is facilitated by including cationic materials (e.g. cationic lipids) in the microparticle.
- Oil-in-water emulsions are known for adjuvanting influenza vaccines e.g. the MF59TM adjuvant in the FLUADTM product, and the AS03 adjuvant in the PREPANDRIXTM product.
- RNA delivery can be accomplished with the use of an oil-in-water emulsion, provided that the emulsion includes one or more cationic molecules.
- a cationic lipid can be included in the emulsion to provide a positively charged droplet surface to which negatively-charged RNA can attach.
- the emulsion comprises one or more oils.
- Suitable oil(s) include those from, for example, an animal (such as fish) or a vegetable source.
- the oil is ideally biodegradable (metabolizable) and biocompatible.
- Sources for vegetable oils include nuts, seeds and grains. Peanut oil, soybean oil, coconut oil, and olive oil, the most commonly available, exemplify the nut oils.
- Jojoba oil can be used e.g. obtained from the jojoba bean.
- Seed oils include safflower oil, cottonseed oil, sunflower seed oil, sesame seed oil and the like.
- corn oil is the most readily available, but the oil of other cereal grains such as wheat, oats, rye, rice, teff, triticale and the like may also be used.
- 6-10 carbon fatty acid esters of glycerol and 1,2-propanediol, while not occurring naturally in seed oils, may be prepared by hydrolysis, separation and esterification of the appropriate materials starting from the nut and seed oils. Fats and oils from mammalian milk are metabolizable and so may be used. The procedures for separation, purification, saponification and other means necessary for obtaining pure oils from animal sources are well known in the art.
- cod liver oil cod liver oil
- shark liver oils and whale oil such as spermaceti exemplify several of the fish oils which may be used herein.
- a number of branched chain oils are synthesized biochemically in 5-carbon isoprene units and are generally referred to as terpenoids.
- Squalane the saturated analog to squalene
- Fish oils, including squalene and squalane, are readily available from commercial sources or may be obtained by methods known in the art.
- oils are the tocopherols, particularly in combination with squalene.
- the oil phase of an emulsion includes a tocopherol
- any of the ⁇ , ⁇ , ⁇ , ⁇ , ⁇ or ⁇ tocopherols can be used, but ⁇ -tocopherols are preferred.
- D- ⁇ -tocopherol and DL- ⁇ -tocopherol can both be used.
- a preferred ⁇ -tocopherol is DL- ⁇ -tocopherol.
- An oil combination comprising squalene and a tocopherol (e.g. DL- ⁇ -tocopherol) can be used.
- Preferred emulsions comprise squalene, a shark liver oil which is a branched, unsaturated terpenoid (C 30 H 50 ; [(CH 3 ) 2 C[ ⁇ CHCH 2 CH 2 C(CH 3 )] 2 ⁇ CHCH 2 —] 2 ; 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22-tetracosahexaene; CAS RN 7683-64-9).
- squalene a shark liver oil which is a branched, unsaturated terpenoid (C 30 H 50 ; [(CH 3 ) 2 C[ ⁇ CHCH 2 CH 2 C(CH 3 )] 2 ⁇ CHCH 2 —] 2 ; 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22-tetracosahexaene; CAS RN 7683-64-9).
- the oil in the emulsion may comprise a combination of oils e.g. squalene and at least one further oil.
- the aqueous component of the emulsion can be plain water (e.g. w.f.i.) or can include further components e.g. solutes. For instance, it may include salts to form a buffer e.g. citrate or phosphate salts, such as sodium salts.
- Typical buffers include: a phosphate buffer; a Tris buffer; a borate buffer; a succinate buffer; a histidine buffer; or a citrate buffer.
- a buffered aqueous phase is preferred, and buffers will typically be included in the 5-20 mM range.
- the emulsion also includes a cationic lipid.
- this lipid is a surfactant so that it can facilitate formation and stabilization of the emulsion.
- Useful cationic lipids generally contains a nitrogen atom that is positively charged under physiological conditions e.g. as a tertiary or quaternary amine. This nitrogen can be in the hydrophilic head group of an amphiphilic surfactant.
- Useful cationic lipids include, but are not limited to: 1,2-dioleoyloxy-3-(trimethylammonio)propane (DOTAP), 3′-[N—(N′,N′-Dimethylaminoethane)-carbamoyl]Cholesterol (DC Cholesterol), dimethyldioctadecyl-ammonium (DDA e.g. the bromide), 1,2-Dimyristoyl-3-Trimethyl-AmmoniumPropane (DMTAP), dipalmitoyl(C16:0)trimethyl ammonium propane (DPTAP), distearoyltrimethylammonium propane (DSTAP).
- DOTAP 1,2-dioleoyloxy-3-(trimethylammonio)propane
- DC Cholesterol 3′-[N—(N′,N′-Dimethylaminoethane)-carbamoyl]Cholesterol
- DDA dimethyldio
- benzalkonium chloride BAK
- benzethonium chloride cetramide (which contains tetradecyltrimethylammonium bromide and possibly small amounts of dedecyltrimethylammonium bromide and hexadecyltrimethyl ammonium bromide)
- cetylpyridinium chloride CPC
- cetyl trimethylammonium chloride CAC
- N,N′,N′-polyoxyethylene (10)-N-tallow-1,3-diaminopropane dodecyltrimethylammonium bromide, hexadecyltrimethyl-ammonium bromide, mixed alkyl-trimethyl-ammonium bromide, benzyldimethyldodecylammonium chloride, benzyldimethylhexadecyl-ammonium chloride, benzyltrimethylammonium methoxide, cetyldimethyleth
- cetylpyridinium bromide and cetylpyridinium chloride N-alkylpiperidinium salts, dicationic bolaform electrolytes (C12Me6; C12BU6), dialkylglycetylphosphorylcholine, lysolecithin, L- ⁇ dioleoylphosphatidylethanolamine, cholesterol hemisuccinate choline ester, lipopolyamines, including but not limited to dioctadecylamidoglycylspermine (DOGS), dipalmitoyl phosphatidylethanol-amidospermine (DPPES), lipopoly-L (or D)-lysine (LPLL, LPDL), poly(L (or D)-lysine conjugated to N-glutarylphosphatidylethanolamine, didodecyl glutamate ester with pendant amino group ( ⁇ GluPhCnN), ditetradecyl glutamate ester with pendant amino group (C14GluCn
- an emulsion can include a non-ionic surfactant and/or a zwitterionic surfactant.
- surfactants include, but are not limited to: the polyoxyethylene sorbitan esters surfactants (commonly referred to as the Tweens), especially polysorbate 20 and polysorbate 80; copolymers of ethylene oxide (EO), propylene oxide (PO), and/or butylene oxide (BO), sold under the DOWFAXTM tradename, such as linear EO/PO block copolymers; octoxynols, which can vary in the number of repeating ethoxy (oxy-1,2-ethanediyl) groups, with octoxynol-9 (Triton X-100, or t-octylphenoxypolyethoxyethanol) being of particular interest; (octylphenoxy)polyethoxyethanol (IGEPAL CA-630/NP-40); phospholipids such
- ком ⁇ онент can be included in the emulsion e.g. Tween 80/Span 85 mixtures, or Tween 80/Triton-X100 mixtures.
- a combination of a polyoxyethylene sorbitan ester such as polyoxyethylene sorbitan monooleate (Tween 80) and an octoxynol such as t-octylphenoxy-polyethoxyethanol (Triton X-100) is also suitable.
- Another useful combination comprises laureth 9 plus a polyoxyethylene sorbitan ester and/or an octoxynol.
- Useful mixtures can comprise a surfactant with a HLB value in the range of 10-20 (e.g. polysorbate 80, with a HLB of 15.0) and a surfactant with a HLB value in the range of 1-10 (e.g. sorbitan trioleate, with a HLB of 1.8).
- Preferred amounts of oil (% by volume) in the final emulsion are between 2-20% e.g. 5-15%, 6-14%, 7-13%, 8-12%.
- a squalene content of about 4-6% or about 9-11% is particularly useful.
- Preferred amounts of surfactants (% by weight) in the final emulsion are between 0.001% and 8%.
- polyoxyethylene sorbitan esters such as polysorbate 80
- polysorbate 80 0.2 to 4%, in particular between 0.4-0.6%, between 0.45-0.55%, about 0.5% or between 1.5-2%, between 1.8-2.2%, between 1.9-2.1%, about 2%, or 0.85-0.95%, or about 1%
- sorbitan esters such as sorbitan trioleate
- 0.02 to 2% in particular about 0.5% or about 1%
- octyl- or nonylphenoxy polyoxyethanols such as Triton X-100
- polyoxyethylene ethers such as laureth 9 0.1 to 8%, preferably 0.1 to 10% and in particular 0.1 to 1% or about 0.5%.
- the absolute amounts of oil and surfactant, and their ratio, can be varied within wide limits while still forming an emulsion.
- a skilled person can easily vary the relative proportions of the components to obtain a desired emulsion, but a weight ratio of between 4:1 and 5:1 for oil and surfactant is typical (excess oil).
- the oil droplet size (diameter).
- the most effective emulsions have a droplet size in the submicron range.
- the droplet sizes will be in the range 50-750 nm.
- the average droplet size is less than 250 nm e.g. less than 200 nm, less than 150 nm.
- the average droplet size is usefully in the range of 80-180 nm.
- at least 80% (by number) of the emulsion's oil droplets are less than 250 nm in diameter, and preferably at least 90%.
- Apparatuses for determining the average droplet size in an emulsion, and the size distribution are commercially available. These typically use the techniques of dynamic light scattering and/or single-particle optical sensing e.g. the AccusizerTM and NicompTM series of instruments available from Particle Sizing Systems (Santa Barbara, USA), or the ZetasizerTM instruments from Malvern Instruments (UK), or the Particle Size Distribution Analyzer instruments from Horiba (Kyoto, Japan).
- the distribution of droplet sizes has only one maximum i.e. there is a single population of droplets distributed around an average (mode), rather than having two maxima.
- Preferred emulsions have a polydispersity of ⁇ 0.4 e.g. 0.3, 0.2, or less.
- Suitable emulsions with submicron droplets and a narrow size distribution can be obtained by the use of microfluidization.
- This technique reduces average oil droplet size by propelling streams of input components through geometrically fixed channels at high pressure and high velocity. These streams contact channel walls, chamber walls and each other. The results shear, impact and cavitation forces cause a reduction in droplet size. Repeated steps of microfluidization can be performed until an emulsion with a desired droplet size average and distribution are achieved.
- thermal methods can be used to cause phase inversion. These methods can also provide a submicron emulsion with a tight particle size distribution.
- Preferred emulsions can be filter sterilized i.e. their droplets can pass through a 220 nm filter. As well as providing a sterilization, this procedure also removes any large droplets in the emulsion.
- the cationic lipid in the emulsion is DOTAP.
- the cationic oil-in-water emulsion may comprise from about 0.5 mg/ml to about 25 mg/ml DOTAP.
- the cationic oil-in-water emulsion may comprise DOTAP at from about 0.5 mg/ml to about 25 mg/ml, from about 0.6 mg/ml to about 25 mg/ml, from about 0.7 mg/ml to about 25 mg/ml, from about 0.8 mg/ml to about 25 mg/ml, from about 0.9 mg/ml to about 25 mg/ml, from about 1.0 mg/ml to about 25 mg/ml, from about 1.1 mg/ml to about 25 mg/ml, from about 1.2 mg/ml to about 25 mg/ml, from about 1.3 mg/ml to about 25 mg/ml, from about 1.4 mg/ml to about 25 mg/ml, from about 1.5 mg/ml to about 25 mg/ml, from about
- the cationic oil-in-water emulsion comprises from about 0.8 mg/ml to about 1.6 mg/ml DOTAP, such as 0.8 mg/ml, 1.2 mg/ml, 1.4 mg/ml or 1.6 mg/ml.
- the cationic lipid is DC Cholesterol.
- the cationic oil-in-water emulsion may comprise DC Cholesterol at from about 0.1 mg/ml to about 5 mg/ml DC Cholesterol.
- the cationic oil-in-water emulsion may comprise DC Cholesterol from about 0.1 mg/ml to about 5 mg/ml, from about 0.2 mg/ml to about 5 mg/ml, from about 0.3 mg/ml to about 5 mg/ml, from about 0.4 mg/ml to about 5 mg/ml, from about 0.5 mg/ml to about 5 mg/ml, from about 0.62 mg/ml to about 5 mg/ml, from about 1 mg/ml to about 5 mg/ml, from about 1.5 mg/ml to about 5 mg/ml, from about 2 mg/ml to about 5 mg/ml, from about 2.46 mg/ml to about 5 mg/ml, from about 3 mg/ml to about 5 mg/ml,
- the cationic lipid is DDA.
- the cationic oil-in-water emulsion may comprise from about 0.1 mg/ml to about 5 mg/ml DDA.
- the cationic oil-in-water emulsion may comprise DDA at from about 0.1 mg/ml to about 5 mg/ml, from about 0.1 mg/ml to about 4.5 mg/ml, from about 0.1 mg/ml to about 4 mg/ml, from about 0.1 mg/ml to about 3.5 mg/ml, from about 0.1 mg/ml to about 3 mg/ml, from about 0.1 mg/ml to about 2.5 mg/ml, from about 0.1 mg/ml to about 2 mg/ml, from about 0.1 mg/ml to about 1.5 mg/ml, from about 0.1 mg/ml to about 1.45 mg/ml, from about 0.2 mg/ml to about 5 mg/ml, from about 0.3 mg/ml to about 5 mg/ml, from about 0.4 mg/m
- the cationic oil-in-water emulsion may comprise DDA at about 20 mg/ml, about 21 mg/ml, about 21.5 mg/ml, about 21.6 mg/ml, about 25 mg/ml.
- the cationic oil-in-water emulsion comprises from about 0.73 mg/ml to about 1.45 mg/ml DDA, such as 1.45 mg/ml.
- RNA molecules of the invention may be used to deliver the self-replicating RNA molecules of the invention, as naked RNA or in combination with a delivery system, into a target organ or tissue.
- Suitable catheters are disclosed in, e.g., U.S. Pat. Nos. 4,186,745; 5,397,307; 5,547,472; 5,674,192; and 6,129,705, all of which are incorporated herein by reference.
- the present invention includes the use of suitable delivery systems, such as liposomes, polymer microparticles or submicron emulsion microparticles with encapsulated or adsorbed self-replicating RNA, to deliver a self-replicating RNA molecule that encodes two or more CMV proteins, for example, to elicit an immune response alone, or in combination with another macromolecule.
- suitable delivery systems such as liposomes, polymer microparticles or submicron emulsion microparticles with encapsulated or adsorbed self-replicating RNA, to deliver a self-replicating RNA molecule that encodes two or more CMV proteins, for example, to elicit an immune response alone, or in combination with another macromolecule.
- the invention includes liposomes, microparticles and submicron emulsions with adsorbed and/or encapsulated self-replicating RNA molecules, and combinations thereof.
- the self-replicating RNA molecules associated with liposomes and submicron emulsion microparticles can be effectively delivered to a host cell, and can induce an immune response to the protein encoded by the self-replicating RNA.
- RNA molecules that encode CMV proteins can be used to form CMV protein complexes in a cell.
- Complexes include, but are not limited to, gB/gH/gL; gH/gL; gH/gL/gO; gM/gN; gH/gL/UL128/UL130/UL131; and UL128/UL130/UL131.
- combinations of VRPs are delivered to a cell. Combinations include, but are not limited to:
- combinations of self-replicating RNA molecules are delivered to a cell.
- Combinations include, but are not limited to:
- Suitable CMV proteins include gB, gH, gL, gO, and can be from any CMV strain.
- Other suitable CMV proteins include UL128, UL130 and UL131, and can be from any CMV strain.
- CMV proteins can be from Merlin, AD169, VR1814, Towne, Toledo, TR, PH, TB40, or Fix strains of CMV.
- Exemplary CMV proteins and fragments are described herein. These proteins and fragments can be encoded by any suitable nucleotide sequence, including sequences that are codon optimized or deoptimized for expression in a desired host, such as a human cell. Exemplary sequences of CMV proteins and nucleic acids encoding the proteins are provided in Table 2
- a gB protein can be full length or can omit one or more regions of the protein. Alternatively, fragments of a gB protein can be used. gB amino acids are numbered according to the full-length gB amino acid sequence (CMV gB FL) shown in SEQ ID NO:______, which is 907 amino acids long.
- CMV gB FL full-length gB amino acid sequence
- Suitable regions of a gB protein which can be excluded from the full-length protein or included as fragments include: the signal sequence (amino acids 1-24), a gB-DLD disintegrin-like domain (amino acids 57-146), a furin cleavage site (amino acids 459-460), a heptad repeat region (679-693), a membrane spanning domain (amino acids 751-771), and a cytoplasmic domain from amino acids 771-906.
- a gB protein includes amino acids 67-86 (Neutralizing Epitope AD2) and/or amino acids 532-635 (Immunodominant Epitope AD1).
- gB fragments include “gB sol 692,” which includes the first 692 amino acids of gB, and “gB sol 750,” which includes the first 750 amino acids of gB.
- the signal sequence, amino acids 1-24, can be present or absent from gB sol 692 and gB sol 750 as desired.
- the gB protein can be a gB fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, or 875 amino acids.
- a gB fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- a gB fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a gB fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- a gH protein is a full-length gH protein (CMV gH FL, SEQ ID NO:______, for example, which is a 743 amino acid protein).
- gH has a membrane spanning domain and a cytoplasmic domain starting at position 716 to position 743. Removing amino acids from 717 to 743 provides a soluble gH (e.g., CMV gH sol, SEQ ID NO:_______).
- the gH protein can be a gH fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, or 725 amino acids.
- the gH protein can be a gH fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, or 725 amino acids.
- a gH fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- gH residues are numbered according to the full-length gH amino acid sequence (CMV gH FL) shown in SEQ ID NO:_______.
- a gH fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a gH fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- a gL protein is a full-length gL protein (CMV gL FL, SEQ ID NO:______, for example, which is a 278 amino acid protein).
- a gL fragment can be used.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, or 250 amino acids.
- a gL fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- gL residues are numbered according to the full-length gL amino acid sequence (CMV gL FL) shown in SEQ ID NO:_______.
- a gL fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a gL fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- a gO protein is a full-length gO protein (CMV gO FL, SEQ ID NO:______, for example, which is a 472 amino acid protein).
- the gO protein can be a gO fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, or 450 amino acids.
- a gO fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- gO residues are numbered according to the full-length gO amino acid sequence (CMV gO FL) shown in SEQ ID NO:_______.
- a gO fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a gO fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- a gM protein is a full-length gM protein (CMV gM FL, SEQ ID NO:______, for example, which is a 371 amino acid protein).
- the gM protein can be a gM fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, or 350 amino acids.
- a gM fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- gM residues are numbered according to the full-length gM amino acid sequence (CMV gM FL) shown in SEQ ID NO:_______.
- a gM fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a gM fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- a gN protein is a full-length gN protein (CMV gN FL, SEQ ID NO:______, for example, which is a 135 amino acid protein).
- the gN protein can be a gN fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 125 amino acids.
- a gN fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- gN residues are numbered according to the full-length gN amino acid sequence (CMV gN FL) shown in SEQ ID NO:_______.
- a gN fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a gN fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- a UL128 protein is a full-length UL128 protein (CMV UL128 FL, SEQ ID NO:______, for example, which is a 171 amino acid protein).
- the UL128 protein can be a UL128 fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, or 150 amino acids.
- a UL128 fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- UL128 residues are numbered according to the full-length UL128 amino acid sequence (CMV UL128 FL) shown in SEQ ID NO:_______.
- a UL128 fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a UL128 fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- a UL130 protein is a full-length UL130 protein (CMV UL130 FL, SEQ ID NO:______, for example, which is a 214 amino acid protein).
- the UL130 protein can be a UL130 fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, or 200 amino acids.
- a UL130 fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- UL130 residues are numbered according to the full-length UL130 amino acid sequence (CMV UL130 FL) shown in SEQ ID NO:_______.
- a UL130 fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a UL130 fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- a UL131 protein is a full-length UL131 protein (CMV UL131, SEQ ID NO:______, for example, which is a 129 amino acid protein).
- the UL131 protein can be a UL131 fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, or 200 amino acids.
- a UL131 fragment can begin at any of residue number: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
- UL131 residues are numbered according to the full-length UL131 amino acid sequence (CMV UL131 FL) shown in SEQ ID NO:_______.
- a UL131 fragment can extend further into the N-terminus by 5, 10, 20, or 30 amino acids from the starting residue of the fragment.
- a UL 131 fragment can extend further into the C-terminus by 5, 10, 20, or 30 amino acids from the last residue of the fragment.
- the invention relates to recombinant polycistronic nucleic acid molecules that contain a first sequence encoding a first herpesvirus protein or fragment thereof, and a second sequence encoding a second herpesvirus protein or fragment thereof. Accordingly, the foregoing description of certain preferred embodiments, such as alphavirus VRPs and self-replicating RNAs that contain sequences encoding two or more CMV proteins or fragments thereof, is illustrative of the invention but does not limit the scope of the invention.
- sequences encoding CMV proteins in such preferred embodiments can be replaced with sequences encoding proteins, such as gH and gL, or fragments thereof that are 10 amino acids long or longer, from other herpesviruses such as HHV-1, HHV-2, HHV-3, HHV-4, HHV-6, HHV-7 and HHV-8.
- suitable VZV (HHV-3) proteins include gB, gE, gH, gI, and gL, and fragments thereof that are 10 amino acids long or longer, and can be from any VZV strain.
- VZV proteins or fragments thereof can be from pOka, Dumas, HJO, CA123, or DR strains of VZV.
- These exemplary VZV proteins and fragments thereof can be encoded by any suitable nucleotide sequence, including sequences that are codon optimized or deoptimized for expression in a desired host, such as a human cell. Exemplary sequences of VZV proteins are provided herein.
- the polycistronic nucleic acid molecule contains a first sequence encoding a VZV gH protein or fragment thereof, and a second sequence encoding a VZV gL protein or fragment thereof.
- each of the sequences encoding a herpes virus protein or fragment that are present in the polycistronic nucleic acid molecule is operably linked to its own control elements.
- each sequences encoding a herpes virus protein or fragment is operably linked to its own subgenomic promoter.
- the polycistronic nucleic acid molecule such as an alphavirus replicon
- this type of polycistronic nucleic acid molecule is a self replicating RNA, such as an alphavirus replicon, it can be packaged as a VRP, or associate or formulated with an RNA delivery system.
- self-replicating RNA molecules or VRPs are administered to an individual to stimulate an immune response.
- self-replicating RNA molecules or VRPs typically are present in a composition which may comprise a pharmaceutically acceptable carrier and, optionally, an adjuvant. See, e.g., U.S. Pat. No. 6,299,884; U.S. Pat. No. 7,641,911; U.S. Pat. No. 7,306,805; and US 2007/0207090.
- the immune response can comprise a humoral immune response, a cell-mediated immune response, or both.
- an immune response is induced against each delivered CMV protein.
- a cell-mediated immune response can comprise a Helper T-cell (T h ) response, a CD8+ cytotoxic T-cell (CTL) response, or both.
- the immune response comprises a humoral immune response, and the antibodies are neutralizing antibodies.
- Neutralizing antibodies block viral infection of cells. CMV infects epithelial cells and also fibroblast cells.
- the immune response reduces or prevents infection of both cell types.
- Neutralizing antibody responses can be complement-dependent or complement-independent.
- the neutralizing antibody response is complement-independent.
- the neutralizing antibody response is cross-neutralizing; i.e., an antibody generated against an administered composition neutralizes a CMV virus of a strain other than the strain used in the composition.
- a useful measure of antibody potency in the art is “50% neutralization titer.”
- serum from immunized animals is diluted to assess how dilute serum can be yet retain the ability to block entry of 50% of viruses into cells.
- a titer of 700 means that serum retained the ability to neutralize 50% of virus after being diluted 700-fold.
- higher titers indicate more potent neutralizing antibody responses.
- this titer is in a range having a lower limit of about 200, about 400, about 600, about 800, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 5500, about 6000, about 6500, or about 7000.
- the 50% neutralization titer range can have an upper limit of about 400, about 600, about 800, about 1000, about 1500, about 200, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 5500, about 6000, about 6500, about 7000, about 8000, about 9000, about 10000, about 11000, about 12000, about 13000, about 14000, about 15000, about 16000, about 17000, about 18000, about 19000, about 20000, about 21000, about 22000, about 23000, about 24000, about 25000, about 26000, about 27000, about 28000, about 29000, or about 30000.
- the 50% neutralization titer can be about 3000 to about 6500.
- “About” means plus or minus 10% of the recited value. Neutralization titer can be measured as described in the specific examples, below.
- An immune response can be stimulated by administering VRPs or self-replicating RNA to an individual, typically a mammal, including a human.
- the immune response induced is a protective immune response, i.e., the response reduces the risk or severity of CMV infection.
- Stimulating a protective immune response is particularly desirable in some populations particularly at risk from CMV infection and disease.
- at-risk populations include solid organ transplant (SOT) patients, bone marrow transplant patients, and hematopoietic stem cell transplant (HSCT) patients.
- SOT solid organ transplant
- HSCT hematopoietic stem cell transplant
- VRPs can be administered to a transplant donor pre-transplant, or a transplant recipient pre- and/or post-transplant. Because vertical transmission from mother to child is a common source of infecting infants, administering VRPs or self-replicating RNA to a woman who can become pregnant is particularly useful.
- compositions can be administered intra-muscularly, intra-peritoneally, sub-cutaneously, or trans-dermally. Some embodiments will be administered through an intra-mucosal route such as intra-orally, intra-nasally, intra-vaginally, and intra-rectally. Compositions can be administered according to any suitable schedule.
- Each CMV antigen was cloned into a pcDNA-6H is vector (Invitrogen) and tested for protein expression before cloning into an alphavirus replicon vector, pVCR 2.1 SalI/XbaI derived from the plasmid described by Perri et al. (J. Virol 77(19)10394-10403 (2003)) producing the constructs shown in FIG. 2 .
- pVCR 2.1 SalI/XbaI is a self-replicating RNA vector that, when electroporated with defective helper capsid and glycoprotein RNA, forms an infectious alphavirus particle.
- pVCR vectors were used to make RNA which was electroporated into baby hamster kidney (BHKV) cells in the presence of defective helper capsid and glycoprotein RNAs derived from Venezuelan equine encephalitis virus (VEE). After electroporation, the supernatant containing secreted alphavirus vector particles (VRPs) was collected, purified, titered, and used for mouse immunization studies. Mice were immunized with 1 ⁇ 10 6 infectious units (IU)/mouse in a series of two immunizations, three weeks apart. The terminal bleed was three weeks after the second immunization.
- VEE Venezuelan equine encephalitis virus
- gB sol 750 lacks the transmembrane spanning domain and cytoplasmic domain
- gB sol 692 also lacks a hydrophobic region ( FIG. 2A ) and is similar to the Reap et al. construct.
- a soluble gH which lacks the transmembrane spanning domain and cytoplasmic domain (“gH sol 716”) was also constructed ( FIG. 2C ).
- Sera from immunized mice were screened in several assays. Immunoblot (data not shown) and immunofluorescence assays were used to confirm specific antibody responses to the antigens. Neutralization assays were used to demonstrate that the elicited antibody responses were able to neutralize CMV infection.
- Sera from immunized mice were examined by immunofluorescence for recognition of gB in 293T cells transfected with constructs expressing gB-6H is.
- Cells were probed with either anti-His antibodies (“anti-6H is”), a monoclonal gB antibody (“anti-gB 27-156”), or collected pooled mouse sera. Pre-immune serum was negative in all cases.
- anti-6H is staining revealed an expression pattern of surface expression with a punctate cytoplasmic pattern most likely corresponding to the endocytic/exocytic trafficking pathway. Both anti-gB 27-156 and the pooled mouse sera showed a similar expression pattern.
- Sera from mice immunized with each of gB FL VRPs, gB sol 750 VRPs, and gB sol 692 VRPs showed the same expression pattern.
- mice immunized with gH FL VRPs and gH sol 716 VRPs produced antibodies specific to gH.
- Immunofluorescence analysis of 293T cells transfected with constructs expressing gH FL-6H is detected strong recognition of gH by anti-6H is, anti-gH, and pooled mouse sera.
- Sera collected from mice immunized with gL VRPs produced a specific antibody response as determined by immunoblot analysis and immunofluorescence.
- gL VRPs failed to elicit a neutralizing response.
- Sera from mice immunized with gB VRPs or gH VRPs were analyzed for the presence of neutralizing antibodies using a CMV neutralization assay.
- Sera at various dilutions were pre-incubated with CMV virus TB40UL32EGFP (“TB40-GFP,” a clinical isolate engineered to express GFP and then added to ARPE-19 epithelial cells and incubated for 5 days. At 5 days post-infection, the GFP-positive cells were counted.
- TB40-GFP CMV virus TB40UL32EGFP
- TB40-GFP a clinical isolate engineered to express GFP and then added to ARPE-19 epithelial cells and incubated for 5 days.
- the GFP-positive cells were counted.
- cells incubated with serum containing neutralizing antibodies have fewer GFP-positive cells compared to cells incubated with virus alone or with virus incubated with pre-immune sera.
- CMV produces several multi-protein complexes during infection.
- a single replicon expressing all components of a desired complex can be used to produce the CMV complex in a subject, or whether components of the complex could be co-delivered from multiple replicon vectors, we designed a platform that allows controlled expression of multiple CMV proteins.
- An alphavirus vector (pVCR 2.1 SalI/XbaI) was modified to allow assembly of multiple subgenomic promoters (SGP) and genes of interest (GOI).
- pVCR 2.1SalI/XbaI ApaI site at 11026-31 bp was changed from GGGCCC (SEQ ID NO:______) to GGCGCC (SEQ ID NO:______). ClaI and PmlI restriction sites added in the region immediately downstream of the first subgenomic promoter and SalI-XbaI insert sites.
- sequence at 7727-7754 bp was changed from ctcgatgtacttccgaggaactgatgtg (SEQ ID NO:______) to ATCGATGTACTTCCGAGGAACTCACGTG (SEQ ID NO:______).
- a shuttling vector system was designed to allow insertion of a GOI directly downstream of a SGP using the SalI-XbaI sites.
- pcDNA 3.1 ( ⁇ ) C was modified as follows. Three SalI sites were deleted: positions 1046-1051 bp, 3332-3337 bp and 5519-21, 1-3 bp from GTCGAC (SEQ ID NO:______) to GTCTAC (SEQ ID NO:_______).
- pcDNA 3.1 ( ⁇ ) C was modified to mutate an XbaI site at position 916-921 bp from TCTAGA (SEQ ID NO:______) to TCAAGA (SEQ ID NO:______).
- pcDNA 3.1 ( ⁇ ) C was modified to add a ClaI site and SacII site at positions 942-947 (ClaI) and 950-955 (SacII) by from ctggatatctgcag (SEQ ID NO:_____) to ATCGATATCCGCGG (SEQ ID NO:______).
- the amplified regions were added into the modified pcDNA 3.1( ⁇ )C vector to make shuttling vectors (pcDNA SV) between appropriate sites (NotI-ClaI or ClaI-SacII). Insertion of the NotI-SGP Sal-Xba-ClaI forms pcDNA SV cassette 2, insertion of the ClaI-SGP Sal-Xba-SacII forms pcDNA SV cassette 3. These SV cassettes were sequenced.
- the pcDNA SV cassette 2 contains an additional 12 bp between the XbaI site and the ClaI site (CCACTGTGATCG) (SEQ ID NO:_______) because the ClaI site was not cut in the pcDNA SV cassette 2 vector.
- a PmlI site was therefore added.
- the PmlI site was inserted at by 1012 (CACGTG) (SEQ ID NO:_______).
- PmlI site was added at by 935-940 (ACTGTG (SEQ ID NO:______) was changed to CACGTG (SEQ ID NO:______).
- the first gene was inserted directly into the pVCR 2.1 modified vector using the SalI-XbaI sites.
- the second gene was ligated into pcDNA SV cassette 2 using SalI-XbaI and excised using NotI-PmlI, NotI-SacII or PCRed using primers for NotI-ClaI and digested using NotI and ClaI.
- the resulting insert SGP-SalI-GOI-Xba was ligated into the modified pVCR 2.1 vector using NotI-PmlI, NotI-SacII, or NotI-ClaI sites.
- the NotI-ClaI insert was used only when a desired gene in the construct contained a PmlI site.
- a third gene was ligated into pcDNA SV cassette 3 using SalI-XbaI and excised using PmlI-SacII or PCRed using primers for ClaI-SacII and digested using ClaI and SacII.
- the resulting insert SGP-SalI-GOI-XbaI was ligated into the modified pVCR 2.1 using PmlI-SacII or ClaI-SacII.
- SalI-XbaI digestion was used to validate construction of the polycistronic vector DNA. After digestion with SalI-XbaI, agarose gel electrophoresis was performed to confirm the presence of the GOIs. The polycistronic vector DNA was then linearized with PmeI overnight, purified using Qiagen's PCR purification kit, and used as template to make RNA using the Ambion mMessage mMachine kit. RNA quality was checked by running a sample aliquot on an RNA agarose gel.
- GFP green fluorescent protein
- mCherry red fluorescent protein
- the second polynucleotide (mCherry) was inserted first into a shuttling vector that contains a subgenomic promoter directly upstream of the coding sequence.
- a fragment containing both the second subgenomic promoter and the second polynucleotide was isolated and ligated into the modified alphavirus replicon vector containing the first polynucleotide, providing an alphavirus replicon with multiple subgenomic promoters.
- VRPs were produced in BHKV cells by electroporating replicon RNAs with defective helper RNAs for Cap and Gly. The VRPs were harvested 24 hours after electroporation and used to infect BHKV cells at a multiplicity of infection (MOI) of 20 infectious units (IU) per cell.
- MOI multiplicity of infection
- VRP-infected BHKV cells were examined 24 hours post-infection to determine percent of colocalization. Nearly all the cells were positive for GFP or mCherry when singly infected. Cells infected with two separate VRPs appeared either green or red. Very few cells were yellow, indicating that few cells expressed GFP and mCherry at equal levels and that there was a low level of co-infection. These data were confirmed using FACS analysis ( FIG. 4B ).
- CMV protein complexes can be formed in a cell after delivery of the complex components from a polycistronic alphavirus replicon vector.
- VRPs containing gH, gL, gO, gH/gL and gH/gL/gO encoding replicons were produced in BHKV cells as described above and used to infect BHKV cells to demonstrate complex formation in vitro.
- VRP infected ARPE-19 cells produced disulfide linked complexes of gH/gL. gO did not detectably alter gH/gL association ( FIG. 5B ).
- gH/gL association was examined via immunoprecipitation.
- a commercial gH antibody (Genway) was used to investigate the association of gH and gL. In all cases, the gH antibody efficiently immunoprecipitated gH ( FIG. 5C ). When no gH was present, gL was not immunoprecipitated. When gL was expressed in the presence of gH or gH/gO, there was association of gL with gH ( FIG. 5C ).
- This example demonstrates the induction of robust immune responses to complexes formed by delivering polycistronic gH/gL VRPs or gH/gL/gO VRPs compared with immune responses obtained using VRPs delivering single components or single-component VRPs administered in combination or to responses elicited by gB VRPs.
- mice were infected three times with VRPs administered 3 weeks apart (10 6 IU per mouse; 5 BalbC mice/group).
- Sera collected from immunizations with single and polycistronic VRPs were screened for neutralizing antibodies using a CMV neutralization assay as described above.
- Neutralization titer was measured as follows. Various dilutions of sera were pre-incubated with TB40-UL32-EGFP in the presence or absence of guinea pig complement and then added to ARPE-19 epithelial cells or MRC-5 fibroblast cells and incubated for 5 days. After 5 days infection with the virus, GFP-positive cells were counted. Results for the ARPE-19 cells are shown in FIG. 6 A, FIG. 6B , and FIG. 6C . Results for the MRC-5 cells are shown in FIG. 7A and FIG. 7B .
- FIG. 6A and FIG. 6B Sera from mice immunized with gH FL VRPs had low complement-independent neutralizing activity.
- FIG. 6C Pooled sera from immunization with several CMV gB proteins (gB FL, gB sol 750, and gB sol 692) demonstrated strong neutralizing activity in the presence of guinea pig complement, with a 50% neutralization titer at 1:1280 sera dilution. However, there was no neutralizing activity in the absence of guinea pig complement in ARPE-19 cells for the pooled gB sera.
- VRPs expressing single CMV proteins did not enhance neutralizing activity beyond that of gH alone.
- mice immunized with bicistronic gH/gL or tricistronic gH/gL/gO VRPs (1 ⁇ 10 6 IU/mouse) demonstrated robust neutralizing responses.
- the responses were similar in the presence and absence of guinea pig complement, showing that polycistronic VRPs successfully induced a complement-independent immune response.
- FIG. 6C The 50% neutralization titer was 1:3500-6400+ sera dilution in ARPE-19 cells with TB40-GFP CMV virus. This titer is approximately 3-4 fold higher titer than the 50% complement-dependent neutralization titer for gB pooled sera.
- results in the MRC-5 fibroblast cells were similar to those in ARPE-19 cells ( FIGS. 7A and 7B ).
- Sera from mice immunized with bicistronic gH/gL or tricistronic gH/gL/gO VRPs demonstrated strong neutralizing activity compared to sera from mice immunized with VRPs encoding gH alone, gL alone, or gO alone and to sera from mice immunized by coadministration of gH VRPs and gL VRPs, or coadministration of gH VRPs, gL VRPs, and gO VRPs.
- Alphavirus replicons serve as a template for synthesis of RNA in vitro.
- Alphavirus replicons contain the genetic elements required for RNA replication but lack those encoding gene products necessary for particle assembly; the structural genes of the alphavirus genome are replaced by sequences encoding a heterologous protein.
- the positive-stranded RNA is translated to produce four non-structural proteins, which together replicate the genomic RNA and transcribe abundant subgenomic mRNAs encoding the heterologous gene product or gene of interest (GOI).
- a bacteriophage (T7 or SP6) promoter upstream of the alphavirus cDNA facilitates the synthesis of the replicon RNA in vitro and the hepatitis delta virus (HDV) ribozyme immediately downstream of the poly(A)-tail generates the correct 3′-end through its self-cleaving activity.
- HDV hepatitis delta virus
- the expression of the individual components of said complex in the same cell is of paramount importance. In theory, this can be accomplished by co-transfecting cells with the genes encoding the individual components.
- this strategy is hampered by inefficient co-delivery of multiple RNAs to the same cell or, alternatively, by inefficient launch of multiple self-replicating RNAs in an individual cell.
- a potentially more efficient way to facilitate co-expression of components of a protein complex is to deliver the respective genes as part of the same self-replicating RNA molecule.
- run-off transcripts were synthesized in vitro using T7 bacteriophage derived DNA-dependent RNA polymerase. Transcriptions were performed for 2 hours at 37° C. in the presence of 7.5 mM of each of the nucleoside triphosphates (ATP, CTP, GTP and UTP) following the instructions provided by the manufacturer (Ambion, Austin, Tex.). Following transcription, the template DNA was digested with TURBO DNase (Ambion, Austin, Tex.). The replicon RNA was precipitated with LiCl and reconstituted in nuclease-free water.
- T7 bacteriophage derived DNA-dependent RNA polymerase Transcriptions were performed for 2 hours at 37° C. in the presence of 7.5 mM of each of the nucleoside triphosphates (ATP, CTP, GTP and UTP) following the instructions provided by the manufacturer (Ambion, Austin, Tex.). Following transcription, the template DNA was digested with TURBO DNase (Ambi
- Uncapped RNA was capped post-transcripionally with Vaccinia Capping Enzyme (VCE) using the ScriptCap m 7 G Capping System (Epicentre Biotechnologies, Madison, Wis.) as outlined in the user manual. Post-transcriptionally capped RNA was precipitated with LiCl and reconstituted in nuclease-free water. The concentration of the RNA samples was determined by measuring the optical density at 260 nm. Integrity of the in vitro transcripts was confirmed by denaturing agarose gel electrophoresis.
- VCE Vaccinia Capping Enzyme
- 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane was synthesized using a previously published procedure [Heyes, J., Palmer, L., Bremner, K., MacLachlan, I. Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids. Journal of Controlled Release, 107: 276-287 (2005)].
- 1,2-Diastearoyl-sn-glycero-3-phosphocholine (DSPC) was purchased from Genzyme. Cholesterol was obtained from Sigma-Aldrich (St. Lois, Mo.).
- LNPs (RV01(14)) were formulated using the following method. 150 ⁇ g batch, (PES hollow fibers and no mustang): Fresh lipid stock solutions in ethanol were prepared. 37 mg of DlinDMA, 11.8 mg of DSPC, 27.8 mg of Cholesterol and 8.07 mg of PEG DMG 2000 were weighed and dissolved in 7.55 mL of ethanol. The freshly prepared lipid stock solution was gently rocked at 37° C. for about 15 min to form a homogenous mixture. Then, 453 ⁇ l of the stock was added to 1.547 mL ethanol to make a working lipid stock solution of 2 mL.
- lipids This amount of lipids was used to form LNPs with 150 ⁇ g RNA at a 8:1 N:P (Nitrogen to Phosphate) ratio.
- the protonatable nitrogen on DlinDMA (the cationic lipid) and phosphates on the RNA are used for this calculation.
- Each ⁇ g of self-replicating RNA molecule was assumed to contain 3 nmoles of anionic phosphate, each ⁇ g of DlinDMA was assumed to contains 1.6 nmoles of cationic nitrogen.
- a 2 mL working solution of RNA was also prepared from a stock solution of ⁇ 1 ⁇ g/ ⁇ L in 100 mM citrate buffer (pH 6) (Teknova).
- RNA and the lipids were connected to a T mixer (PEEKTM 500 ⁇ m ID junction) using FEP tubing ([fluorinated ethylene-propylene] 2 mm ID ⁇ 3 mm OD, Idex Health Science, Oak Harbor, Wash.). The outlet from the T mixer was also FEP tubing (2 mm ID ⁇ 3 mm). The third syringe containing the citrate buffer was connected to a separate piece of tubing (2 mm ID ⁇ 3 mm OD). All syringes were then driven at a flow rate of 7 mL/min using a syringe pump (from kdScientific, model no. KDS-220).
- the tube outlets were positioned to collect the mixtures in a 20 mL glass vial (while stirring).
- the stir bar was taken out and the ethanol/aqueous solution was allowed to equilibrate to room temperature for 1 h.
- the mixture was loaded in a 5 cc syringe (BD Medical), which was fitted to a piece of FEP tubing (2 mm ID ⁇ 3 mm OD) and in another 5 cc syringe with equal length of FEP tubing, an equal volume of 100 mM citrate buffer (pH 6) was loaded.
- the two syringes were driven at 7 mL/min flow rate using a syringe pump and the final mixture collected in a 20 mL glass vial (while stirring).
- LNPs were concentrated to 2 mL and dialyzed against 10-15 volumes of 1 ⁇ PBS (from Teknova) using the Tangential Flow Filtration (TFF) system before recovering the final product.
- TFF Tangential Flow Filtration
- the TFF system and hollow fiber filtration membranes were purchased from Spectrum Labs and were used according to the manufacturer's guidelines.
- Polyethersulfone (PES) hollow fiber filtration membranes (part number P-C1-100E-100-01N) with a 100 kD pore size cutoff and 20 cm 2 surface area were used.
- PES Polyethersulfone
- formulations were diluted to the required RNA concentration with 1 ⁇ PBS (from Teknova).
- Particle size was measured using a Zetasizer Nano ZS (Malvern Instruments, Worcestershire, UK) according to the manufacturer's instructions. Particle sizes are reported as the Z average with the polydispersity index (pdi). Liposomes were diluted in 1 ⁇ PBS before measurement.
- the percentage of encapsulated RNA and RNA concentration were determined by
- Quant-iT RiboGreen RNA reagent kit (Invitrogen). Manufacturer's instructions were followed in the assay. The ribosomal RNA standard provided in the kit was used to generate a standard curve.
- LNPs either obtained from method 1 or methods 2-5 were diluted ten fold or one hundred fold respectively in lx TE buffer (from kit), before addition of the dye. Separately, LNPs were diluted ten or 100 fold in 1 ⁇ TE buffer containing 0.5% Triton X (Sigma-Aldrich), before addition of the dye. Thereafter an equal amount of dye was added to each solution and then ⁇ 180 ⁇ L of each solution after dye addition was loaded in duplicate into a 96 well tissue culture plate (obtained from VWR, catalog #353072). The fluorescence (Ex 485 nm, Em 528 nm) was read on a microplate reader (from BioTek Instruments, Inc.).
- Triton X was used to disrupt the LNPs, providing a fluorescence reading corresponding to the total RNA amount and the sample without Triton X provided fluorescence corresponding to the unencapsulated RNA.
- VRP Viral Replicon Particles
- VRPs viral replicon particles
- VCR alphavirus chimeric replicons
- VEEV Venezuelan equine encephalitis virus
- PS Sindbis virus packaging signal
- the replicons were packaged into VRPs by co-electroporating them into baby hamster kidney (BHK) cells along with defective helper RNAs encoding the Sindbis virus capsid and glycoprotein genes (see FIG. 2 of Perri et al).
- the VRPs were then harvested and partially purified by ultracentrifugation on a sucrose cushion and concentrated on an Amicon concentrator.
- the resulting VRP stock was titrated by standard methods and inoculated into animals in culture fluid or other isotonic buffers.
- An alphavirus replicon particle chimera derived from venezuelan equine encephalitis and Sindbis viruses is a potent gene-based vaccine delivery vector. J. Virol. 77, 10394-10403.
- mice Groups of 10 female BALB/c mice aged 8-10 weeks and weighing about 20 g were immunized with 1 ⁇ 10 6 IU (VRP) or 1.0 ⁇ g (RNA) at day 0, 21 and 42 with bleeds taken 3 weeks after the 2 nd and 3 weeks after the 3 rd vaccinations. All animals were injected in the quadriceps in the two hind legs each getting an equivalent volume (50 ⁇ l per site).
- VRP 1 ⁇ 10 6 IU
- RNA 1.0 ⁇ g
- Serum samples were tested for the presence of neutralizing antibodies by an infection reduction neutralization test. Two-fold serial dilutions of HI-serum (in DMEM with 10% HI FBS) were added to an equal volume of CMV (strain TB40 or clinical isolate 8819) previously titered to give approximately 200 IU/50 ⁇ l. The VR1814, Towne, AD169 strains and the clinical isolate 8822 were also used. Serum/virus mixtures were incubated for 2 hours at 37° C. and 5% CO2, to allow virus neutralization to occur, and then 50 ⁇ l of this mixture (containing approximately 200 IU) was inoculated on duplicate wells of ARPE-19 cells in 96 half well plates. Plates were incubated for 40-44 hours.
- the number of positive infected foci was determined by immunostaining with an AlexaFluor 488 conjugated IE1 CMV monoclonal antibody followed by automated counting.
- the neutralization titer is defined as the reciprocal of the serum dilution producing a 50% reduction in number of positive virus foci per well, relative to controls (no serum).
- the A323 replicon that expresses the surface glycoprotein B (gB) of CMV, the A160 replicon that expresses the membrane complex of the full-length glycoprotein H and L (gH/gL) and the A322 replicon that expresses the membrane complex of the soluble form of glycoprotein H and L (gHsol/gL) were used for this experiment.
- BALB/c mice, 10 animals per group were given bilateral intramuscular vaccinations (50 ⁇ L per leg) on days 0, 21 and 42 with VRPs expressing gB (1 ⁇ 10 6 IU), VRPs expressing gH/gL (1 ⁇ 10 6 IU), VRP's expressing gHsol/gL (1 ⁇ 10 6 IU) and PBS as the controls.
- RNA lipid (nm) pdI Encapsulation RV01 (14) DlinDMA 40%, DSPC- gB FL 5.8 170 0.098 88.3 10%, Chol- 48%, PEG DMG 2k-2% RV01 (14) DlinDMA 40%, DSPC- gH FL/gL 5.8 168.8 0.144 87.4 10%, Chol- 48%, PEG DMG 2k-2% RV01 (14) DlinDMA 40%, DSPC- gHsol/gL 5.8 162 0.131 90 10%, Chol- 48%, PEG DMG 2k-2%
- RNA expressing either a full-length or a presumed soluble form of the HCMV gH/gL complex elicit high titers of neutralizing antibody, as assayed on epithelial cells using two different HCMV strains.
- the average titers elicited by the gH/gL RNAs are at least as high as the average titer for the corresponding gH/gL VRPs (see FIG. 17 ).
- Additional bicistronic and pentacistronic alphavirus replicons that express glycoprotein complexes from human cytomegalovirus (HCMV) were prepared, and are shown schematically in FIGS. 18 and 20 .
- the alphavirus replicons were based on venezuelan equine encephalitis virus (VEE).
- VEE venezuelan equine encephalitis virus
- the replicons were packaged into viral replicon particles (VRPs), encapsulated in lipid nanoparticles (LNP), or formulated with a cationic nanoemulsion (CNE).
- VRPs viral replicon particles
- LNP encapsulated in lipid nanoparticles
- CNE cationic nanoemulsion
- FIG. 19 shows that these antibodies bind to BHKV cells transfected with replicon RNA expressing the HCMV gH/gL/UL128/UL130/UL131 pentameric complex (A527). Similar results were obtained when cells were infected with VRPs made from the same replicon construct. This shows that replicons designed to express the pentameric complex do indeed express the desired antigen and not the potential byproduct gH/gL.
- the VRPs, RNA encaspulated in LNPs, and RNA formulated with CNE were used to immunize Balb/c mice by intramuscular injections in the rear quadriceps.
- the mice were immunized three times, three weeks apart, and serum samples were collected prior to each immunization as well as three weeks after the third and final immunization.
- the sera were evaluated in microneutralization assays to measure the potency of the neutralizing antibody response that was elicited by the vaccinations.
- the titers are expressed as 50% neutralizing titer.
- FIG. 20 shows that VRPs expressing the membrane-anchored, full-length gH/gL complex elicited potent neutralizing antibodies at slightly higher titers than the soluble complex (gHsol/gL) expressed from a similar bicistronic expression cassette. Changing the order of the genes encoding gHsol and gL or replacing one of the subgenomic promoters with an IRES or an FMDV 2A site did not substantially improve immunogenicity.
- mice immunized with VEE/SIN VRPs expressing gH/gL were assessed by using the sera to block infection of fibroblasts and epithelial cells with different strains of HCMV.
- Table 5 shows that gH/gL immune sera were broadly and potently neutralizing against six different strains of HCMV on both cell types in the absence of complement. Addition of complement had a slight negative effect on the neutralizing potency of the sera.
- the pentacistronic VEE-based RNA replicon that elicited the highest titers of neutralizing antibodies was packaged as VRPs and the immunogenicity of the VRPs were compared to gH/gL-expressing VRPs and LNP-encapsulated replicons expressing gH/gL and pentameric complex.
- Table 7 shows that VRPs expressing the pentameric complex elicited higher titers of neutralizing antibodies than VRPs expressing gH/gL.
- 10 6 infectious units of VRPs are at least as potent as 1 ⁇ g of LNP-encapsulated RNA when the VRPs and the RNA encoded the same protein complexes.
- HCMV neutralizing activity was assessed by using the sera to block infection of fibroblasts and epithelial cells with different strains of HCMV.
- Table 8 shows that anti-gH/gL/UL128/UL130/UL131 immune sera broadly and potently neutralized infection of epithelial cells. This effect was complement independent. In contrast, the sera had a reduced or not detectable effect on infection of fibroblasts.
- Nucleic acids encoding VZV proteins were cloned into a VEE replicon vector to produce monocystronic replicons that encode gB, gH, gL, gE, and gI, and to produce bicistronic replicons that encode gH/gL or gE/gI.
- expression of each VZV open reading frame was driven by a separate subgenomic promoter.
- plasmid encoding the replicon was linearized by digestion with PmeI, and the linearized plasmid was extracted with phenol/chloroform/isoamylalchohol, precipitated in sodium acetate/ethanol and resuspended in 20 ⁇ l of RNase-free water.
- RNA was prepared by In vitro transcription of 1 ⁇ g of linearized DNA using the MEGAscript T7 kit (AMBION# AM1333). A 20 ⁇ l reaction was set up according to the manufacturer's instruction without cap analog and incubated for 2 hours at 32° C. TURBO DNase (1 ⁇ l) was added and the mixture was incubate for 30 min. at 32° C. RNase-free water (30 ⁇ l) and ammonium acetate solution (30 ⁇ l) were added. The solution was mixed and chilled for at least 30 min at ⁇ 20° C. Then the solution was centrifuged at maximum speed for 25 min. at 4° C.
- RNA was capped using the ScriptCap m7G Capping System (Epicentre #SCCE0625). The reaction was scaled by combining the RNA and RNase-free water. The RNA was then denatured for 5-10 min. at 65° C. The denatured RNA was transferred quickly to ice and the following reagents were added in the following order: ScriptCap Capping Buffer, 10 mM GTP, 2 mM SAM fresh prepared, ScriptGuard RNase inhibitor, and ScriptCap Capping Enzyme. The mixture was incubated for 60 min. at 37° C. The reaction was stopped by adding RNase-free water and 7.5 M LiCl, mixing well and storing the mixture for at least 30 min at ⁇ 20° C.
- the mixture was centrifuged at maximum speed for 25 min. at 4° C., the pellet was rinsed with 70% ethanol, again centrifuged at maximum speed for 10 min. at 4° C. and the pellet was air dried.
- the pellet was resuspended in RNase-free water. The concentration of RNA was measured and quality was checked on a denaturing gel.
- RNA-Lipofectamine complex was placed onto the cells, and mixed by gently rocking the plate. The plates were incubated for 24 hours at 37° C. in a CO 2 incubator.
- VZV proteins in transfected cells were assessed by western blot and immunofluorescence.
- western blots lysates of transfected cells were separated by electrophoresis (5 ⁇ g total proteins/lane) and blotted.
- a cleared viral suspension (7 ⁇ g total protein/lane) derived from the OKA/Merck vaccine strain was used as a positive control. Blots were probed using commercially available antibodies (1:1000 dilution) that bind VZV proteins.
- transfected cells were harvested and seeded in 96 well plate, and intracellular staining was performed using commercially available mouse mAbs (dilution range 1:100 1:400). Cell pellets were fixed and permeabilized with Citofix-Citoperm solutions. A secondary reagent, Alexa488 labelled goat anti-mouse F(ab′) 2 (1:400 final dilution), was used.
- VZV proteins gE and gI were detected in cells transfected with monocistronic constructs (gE or gI), and expression of both gE and gI was detected in cells transfected with a bicistronic gE/gI construct in western blots using commercially available mouse antibodies, 13B1 for gE and 8C4 for gI.
- Expression of VZV protein gB was detected in cells transfected with a monocistronic construct encoding gB, by immunofluorescence using commercially available antibody 10G6.
- VZV protein complex gH/gL was detected by immunofluorescence in cells transfected with monocistronic gH and monocistronic gL, or with a bicistronic gH/gL construct.
- the gH/gL complex was detected using commercially available antibody SG3.
- Groups of 8 female BALB/c mice aged 6-8 weeks and weighing about 20 g were immunized intramuscularly with 7.0 or 1.0 ⁇ g of replicon RNA formulated with a CNE or LNP(RV01) at day 0, 21 and 42. Blood samples were taken from the immunized animals 3 weeks after the 2nd immunization and 3 weeks after the 3rd immunization. The groups are shown in Table 10.
- Serum samples were tested for the presence of antibodies to gB, by intracellular staining of VZV-replicon transfected MRC-5 cells.
- MRC-5 cells were maintained in Dulbecco Modified Eagle's Medium with 10% fetal bovine serum.
- VZV Oka strain inoculum obtained from ATCC was used to infect MRC-5 cell culture and infected whole cells were used for subpassage of virus. The ratio between infected and un-infected cells was 1:10.
- 30 hrs post infection cells were trypsin-dispersed for seeding in a 96 well plate to perform an intracellular staining with pools of mice sera (dilution range 1:200 to 1:800) obtained after immunization.
- gB (10G6), gH(SG3), and gE 13B1 (SBA) and 8612 (Millipore) were used as positive controls, and each intracellularly stained infected MRC-5 cells.
- Immune sera obtained 3 weeks after the third immunization with either 1 or 7 ⁇ g of RNA formulated with CNE or LNP were diluted 1/200, 1/400 and 1/800 and used to intracellulary stain infected MRC-5 cells. The results are shown in FIG. 21 (Study 1, groups 1, 5, 7, 9, 11, 13 and 15, CNE formulation) and FIG. 22 (Study 2, groups 1-7, LNP formulation).
- Each immunized mouse serum was serially diluted by two fold increments starting at 1:20 in standard culture medium, and added to the equal volume of VZV suspension in the presence of guinea pig complement. After incubation for 1 hour at 37° C., the human epithelial cell line A549, was added. Infected cells can be measured after one week of culture by counting plaques formed in the culture under microscope. From the plaque number the % inhibition at each serum dilution was calculated. A chart for each serum sample was made by plotting the value of % inhibition against the logarithmic scale the dilution factor. Subsequently an approximate line of relationship between dilution factor and % inhibition was drawn. Then the 50% neutralization titer was determined as the dilution factor where the line crossed at the value of 50% inhibition.
- Table 11 shows that sera obtained from mice immunized with monocistronic gE, bicistrnic gE/gl, and bicistronic gH/gL contained robust neutralizing antibody titers.
- CMV gB FL 1 - atggaaagccggatctggtgcctggtcgtgtgcgtgaacctgtgcatcgtgtgcctgggagc cgccgtgagcagcagcaccagaggcaccagcgccacacagccacagccaca ccacctctgccgcccacagcagatccggcagcgtgtcccagagagtgaccagcagccagacc gtgtcccacggcgtgaacgagacaatctacaacaccaccctgaagtacggcgacgtcgtggg cgtgaataccaccaccaagtacccctacagagtgtgcagcatggcccagggcaccgacctgatca gattcgagcggaacatggcccagggaaacatcgtgtgtgca
- CMV gO FL 1- atgggcaagaaagaaatgatcatggtcaagggcatccccaagatcatgctgctgattagcat cacctttctgctgctgtccctgatcaactgcaacgtgctggtcaacagccggggcaccagaa gatcctggccctacaccgtgctgtcctaccggggcaaagagatcctgaagaagcagag gacatcctgaagcggctgatgagcaccagcagcgacggctaccggttcctgatgtaccccag ccagcagaaattccacgccatcgtgatcagcatggacaagttccccaggactacatcctgg cggacccatccggaacgacagcatcacccacatgtggttcgacttctacagcacccacatgtggttcgactt
- CMV UL130 FL 1- atgctgcggctgctgctgagacaccacttccactgcctgctgtgtgccgtgtgggccac cccttgtctggccagcccttggagcaccctgaccgccaaccagaaccctagccccccttggt ccaagctgacctacagcaagccccacgacgccaccttctactgcccctttctgtacccc agccctcccagaagccccctgcagttcagcggcttccagagagtgtccaccggccctgagtg ccaccggccctgagtg ccggaacgagacactgtacctgctgtacaaccgggagggccagacactggtggagcggagca gc
- A526 Vector SGP-gH-SGP-gL-SGP-UL128-2A-UL130-2Amod-UL131 ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCC ACGT
- A527 Vector SGP-gH-SGP-gL-SGP-UL128-EMCV-UL130-EV71-UL131 ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCCCT
- A531 Vector SGP-gHsol-SGP-gL ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCC ACGACGACGAGTCGTGTCGCTACGAAGGGCAAGTCGACC
- A532 Vector SGP-gHsol-2A-gL ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCC ACGACGACGAGTCGTGTCGCTACGAAGGGCAAGTCGCTCC
- A533 Vector SGP-gHsol-EV71-gL ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCC ACGACGACGAGTCGTGTCGCTACGAAGGGCAAGTCGACC
- A534 Vector SGP-gL-EV71-gH ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCC ACGACGACGAGTCGTGTCGCTACGAAGGGCAAGTCGCTCC
- A535 Vector SGP-342-EV71-gHsol-2A-gL ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCC ACGACGACGAGTCGTGTCGCTACGAAGGAA
- A536 Vector SGP-342-EV71-gHsol-EMCV-gL ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCC ACGACGACGAGTCGTGTCGCTACGAAAA
- A554 Vector SGP-gH-SGP-gL-SGP-UL128-SGP-UL130-SGP-UL131 ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCC
- A555 Vector SGP-gHsol-SGP-gL-SGP-UL128-SGP-UL130-SGP-UL131 ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCCCT
- A556 Vector SGP-gHsol6His-SGP-gL-SGP-UL128-SGP-UL130-SGP-UL131 ATAGGCGGCGCATGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG ACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATG ACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGA TCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAAAACTGTAAGGAAATAACTGATAAGG AATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGATAAGG
- VZV VEERep.SGPgB 1 ataggcggcgcatgagagaagcccagaccaattacctacccaaaatggagaaagttcacgttgacatc gaggaagacagcccattcctcagagctttgcagcggagcttcccgcagtttgaggtagaagccaagca ggtcactgataatgaccatgctaatgccagagcgttttcgcatctggcttcaaaactgatcgaaacgg aggtggacccatccgacacgatccttgacattggaagtgcgcccgcgcagaatgtattctaagcac aagtatcattgtggaagtgcgccccgcagaatgtattctaagcac aagtatcattgtg
- VZV VEERep.SGPgH 1 ataggcggcgcatgagagaagcccagaccaattacctacccaaaatggagaaagttcacgttgacatc gaggaagacagcccattcctcagagctttgcagcggagcttcccgcagtttgaggtagaagccaagca ggtcactgataatgaccatgctaatgccagagcgttttcgcatctggcttcaaaactgatcgaaacgg aggtggacccatccgacacgatccttgacattggaagtgcgcccgcgcagaatgtattctaagcac aagtatcattgtggaagtgcgccccgcagaatgtattctaagcac aagtatcattgtg
- VZV VEERep.SGPgL 1 ataggcggcgcatgagagaagcccagaccaattacctacccaaaatggagaaagttcacgttgacatc gaggaagacagcccattcctcagagctttgcagcggagcttcccgcagtttgaggtagaagccaagca ggtcactgataatgaccatgctaatgccagagcgttttcgcatctggcttcaaaactgatcgaaacgg aggtggacccatccgacacgatccttgacattggaagtgcgcccgcgcagaatgtattctaagcac aagtatcattgtatctgtcggagatgtattctaagcac aagtatcattgtatctgtcgatg
- VZV VEERep.SGPgE 1 ataggcggcgcatgagagaagcccagaccaattacctacccaaaatggagaaagttcacgttgacatc gaggaagacagcccattcctcagagctttgcagcggagcttcccgcagtttgaggtagaagccaagca ggtcactgataatgaccatgctaatgccagagcgttttcgcatctggcttcaaaactgatcgaaacgg aggtggacccatccgacacgatccttgacattggaagtgcgcccgcgcagaatgtattctaagcac aagtatcattgtggaagtgcgccccgcagaatgtattctaagcac aagtatcattgtg
- VZV VEERep.SGPgI 1 ataggcggcgcatgagagaagcccagaccaattacctacccaaaatggagaaagttcacgttgacatc gaggaagacagcccattcctcagagctttgcagcggagcttcccgcagtttgaggtagaagccaagca ggtcactgataatgaccatgctaatgccagagcgttttcgcatctggcttcaaaactgatcgaaacgg aggtggacccatccgacacgatccttgacattggaagtgcgcccgcgcagaatgtattctaagcac aagtatcattgtggaagtgcgccccgcagaatgtattctaagcac aagtatcattgtg
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/878,835 US20140030292A1 (en) | 2010-10-11 | 2011-10-11 | Antigen delivery platforms |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US39196010P | 2010-10-11 | 2010-10-11 | |
| PCT/US2011/055834 WO2012051211A2 (en) | 2010-10-11 | 2011-10-11 | Antigen delivery platforms |
| US13/878,835 US20140030292A1 (en) | 2010-10-11 | 2011-10-11 | Antigen delivery platforms |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/055834 A-371-Of-International WO2012051211A2 (en) | 2010-10-11 | 2011-10-11 | Antigen delivery platforms |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/114,621 Continuation US11078237B2 (en) | 2010-10-11 | 2018-08-28 | Antigen delivery platforms |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20140030292A1 true US20140030292A1 (en) | 2014-01-30 |
Family
ID=45002110
Family Applications (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/878,835 Abandoned US20140030292A1 (en) | 2010-10-11 | 2011-10-11 | Antigen delivery platforms |
| US16/114,621 Active US11078237B2 (en) | 2010-10-11 | 2018-08-28 | Antigen delivery platforms |
| US17/360,320 Active US11639370B2 (en) | 2010-10-11 | 2021-06-28 | Antigen delivery platforms |
| US17/696,143 Abandoned US20220213149A1 (en) | 2010-10-11 | 2022-03-16 | Antigen delivery platforms |
| US18/952,185 Pending US20250206785A1 (en) | 2010-10-11 | 2024-11-19 | Antigen delivery platforms |
Family Applications After (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/114,621 Active US11078237B2 (en) | 2010-10-11 | 2018-08-28 | Antigen delivery platforms |
| US17/360,320 Active US11639370B2 (en) | 2010-10-11 | 2021-06-28 | Antigen delivery platforms |
| US17/696,143 Abandoned US20220213149A1 (en) | 2010-10-11 | 2022-03-16 | Antigen delivery platforms |
| US18/952,185 Pending US20250206785A1 (en) | 2010-10-11 | 2024-11-19 | Antigen delivery platforms |
Country Status (15)
| Country | Link |
|---|---|
| US (5) | US20140030292A1 (https=) |
| EP (4) | EP4098324A1 (https=) |
| JP (3) | JP2013544504A (https=) |
| KR (2) | KR102266691B1 (https=) |
| CN (1) | CN103269713B (https=) |
| AU (2) | AU2011316707A1 (https=) |
| BR (1) | BR112013008700B8 (https=) |
| CA (1) | CA2814386C (https=) |
| CL (1) | CL2013000984A1 (https=) |
| ES (2) | ES2945135T3 (https=) |
| MX (1) | MX363307B (https=) |
| RU (1) | RU2597974C2 (https=) |
| TR (1) | TR201903651T4 (https=) |
| WO (1) | WO2012051211A2 (https=) |
| ZA (1) | ZA201302548B (https=) |
Cited By (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140193484A1 (en) * | 2013-01-10 | 2014-07-10 | Sylvie Carine Bertholet Girardin | Influenza virus immunogenic compositions and uses thereof |
| US20140227346A1 (en) * | 2011-07-06 | 2014-08-14 | Andrew Geall | Immunogenic combination compositions and uses thereof |
| US20140271829A1 (en) * | 2011-10-11 | 2014-09-18 | Anders Lilja | Recombinant self-replicating polycistronic rna molecules |
| US9095552B2 (en) | 2012-04-02 | 2015-08-04 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1 |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9181319B2 (en) | 2010-08-06 | 2015-11-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9512456B2 (en) | 2012-08-14 | 2016-12-06 | Modernatx, Inc. | Enzymes and polymerases for the synthesis of RNA |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US9701965B2 (en) | 2010-10-01 | 2017-07-11 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US10023626B2 (en) | 2013-09-30 | 2018-07-17 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10022436B2 (en) | 2016-01-11 | 2018-07-17 | Verndari, Inc. | Microneedle compositions and methods of using same |
| WO2018140733A1 (en) * | 2017-01-27 | 2018-08-02 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Vaccine compositions of herpesvirus envelope protein combinations to induce immune response |
| US10258698B2 (en) | 2013-03-14 | 2019-04-16 | Modernatx, Inc. | Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions |
| WO2020092387A1 (en) * | 2018-10-30 | 2020-05-07 | Nantbio, Inc. | Self replicating rna system |
| US10849920B2 (en) | 2015-10-05 | 2020-12-01 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US20220125723A1 (en) | 2010-07-06 | 2022-04-28 | Glaxosmithkline Biologicals Sa | Lipid formulations with viral immunogens |
| US11384137B2 (en) | 2015-09-10 | 2022-07-12 | City Of Hope | MVA-gH/gL-PC vaccine derived antibodies neutralizing human cytomegalovirus infectivity and methods thereof |
| US11389529B2 (en) * | 2017-07-13 | 2022-07-19 | City Of Hope | Expression system for expressing herpesvirus glycoprotein complexes |
| US20220409720A1 (en) * | 2017-03-15 | 2022-12-29 | Modernatx, Inc. | Varicella zoster virus (vzv) vaccine |
| US11541114B2 (en) | 2009-06-05 | 2023-01-03 | City Of Hope | Genetically stable recombinant modified vaccinia Ankara (rMVA) vaccines and methods of preparation thereof |
| US11596645B2 (en) | 2010-07-06 | 2023-03-07 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11603399B2 (en) | 2013-03-13 | 2023-03-14 | Modernatx, Inc. | Long-lived polynucleotide molecules |
| US11639329B2 (en) | 2017-08-16 | 2023-05-02 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
| US11639370B2 (en) | 2010-10-11 | 2023-05-02 | Glaxosmithkline Biologicals Sa | Antigen delivery platforms |
| US11655475B2 (en) | 2010-07-06 | 2023-05-23 | Glaxosmithkline Biologicals Sa | Immunisation of large mammals with low doses of RNA |
| US11717568B2 (en) | 2012-07-27 | 2023-08-08 | City Of Hope | MVA vaccine for delivery of a UL128 complex and preventing CMV infection |
| US11759422B2 (en) | 2010-08-31 | 2023-09-19 | Glaxosmithkline Biologicals Sa | Pegylated liposomes for delivery of immunogen-encoding RNA |
| US12054736B2 (en) | 2018-05-11 | 2024-08-06 | City Of Hope | Genetically modified recombinant vaccinia ankara (RMVA) vaccines of improved stability and methods of preparation thereof |
| US12129223B2 (en) | 2021-12-16 | 2024-10-29 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
| US12410121B2 (en) | 2020-07-16 | 2025-09-09 | Acuitas Therapeutics, Inc. | Cationic lipids for use in lipid nanoparticles |
| US12491261B2 (en) | 2016-10-26 | 2025-12-09 | Acuitas Therapeutics, Inc. | Lipid nanoparticle formulations |
| US12527858B2 (en) | 2018-05-11 | 2026-01-20 | City Of Hope | MVA vectors for expressing multiple cytomegalovirus (CMV) antigens and use thereof |
| US12569553B2 (en) | 2020-03-09 | 2026-03-10 | Dynavax Technologies Corporation | Shingles vaccines comprising a TLR9 agonist |
Families Citing this family (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012018628A1 (en) | 2010-07-26 | 2012-02-09 | Board Of Regents, The University Of Texas System | Methods for inducing an immune response via buccal and/or sublingual administration of a vaccine |
| CA2878344A1 (en) * | 2012-07-06 | 2014-01-09 | Novartis Ag | Complexes of cytomegalovirus proteins |
| US9974850B2 (en) | 2013-01-25 | 2018-05-22 | Board Of Regents, The University Of Texas System | Immunogenic compositions and uses thereof |
| PL4023249T3 (pl) | 2014-04-23 | 2025-03-10 | Modernatx, Inc. | Szczepionki z kwasem nukleinowym |
| MX2016014660A (es) * | 2014-05-08 | 2017-02-28 | Pfizer | Medios y metodos para el tratamiento de cmv. |
| EP3015475A1 (en) * | 2014-10-31 | 2016-05-04 | Novartis AG | Mammalian cells expressing cytomegalovirus antigens |
| EP3048114A1 (en) | 2015-01-22 | 2016-07-27 | Novartis AG | Cytomegalovirus antigens and uses thereof |
| WO2017070601A1 (en) * | 2015-10-22 | 2017-04-27 | Modernatx, Inc. | Nucleic acid vaccines for varicella zoster virus (vzv) |
| AU2016342045A1 (en) | 2015-10-22 | 2018-06-07 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| EP3365009A4 (en) * | 2015-10-22 | 2019-07-03 | ModernaTX, Inc. | VACCINES AGAINST HERPES SIMPLEX VIRUS |
| US10611800B2 (en) | 2016-03-11 | 2020-04-07 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| WO2017162265A1 (en) * | 2016-03-21 | 2017-09-28 | Biontech Rna Pharmaceuticals Gmbh | Trans-replicating rna |
| WO2017162266A1 (en) | 2016-03-21 | 2017-09-28 | Biontech Rna Pharmaceuticals Gmbh | Rna replicon for versatile and efficient gene expression |
| EP3528821A4 (en) * | 2016-10-21 | 2020-07-01 | ModernaTX, Inc. | HUMAN CYTOMEGALOVIRUS VACCINE |
| WO2018170256A1 (en) * | 2017-03-15 | 2018-09-20 | Modernatx, Inc. | Herpes simplex virus vaccine |
| WO2018200737A1 (en) * | 2017-04-26 | 2018-11-01 | Modernatx, Inc. | Herpes simplex virus vaccine |
| US11524069B2 (en) * | 2017-09-13 | 2022-12-13 | Sanofi Pasteur | Human cytomegalovirus immunogenic composition |
| EP3801610A1 (en) * | 2018-06-08 | 2021-04-14 | Vakzine Projekt Management GmbH | Viral particle - based vaccine |
| US11629172B2 (en) | 2018-12-21 | 2023-04-18 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| US12070495B2 (en) | 2019-03-15 | 2024-08-27 | Modernatx, Inc. | HIV RNA vaccines |
| WO2021014385A1 (en) | 2019-07-24 | 2021-01-28 | Glaxosmithkline Biologicals Sa | Modified human cytomegalovirus proteins |
| MX2022007905A (es) | 2019-12-31 | 2022-08-25 | Elixirgen Therapeutics Inc | Administracion transitoria basada en temperatura de acidos nucleicos y proteinas a celulas y tejidos. |
| KR20230009466A (ko) * | 2020-05-11 | 2023-01-17 | 얀센 파마슈티칼즈, 인코포레이티드 | SARS-CoV-2 백신 |
| WO2021245611A1 (en) | 2020-06-05 | 2021-12-09 | Glaxosmithkline Biologicals Sa | Modified betacoronavirus spike proteins |
| TWI810589B (zh) | 2020-06-21 | 2023-08-01 | 美商輝瑞股份有限公司 | 人巨細胞病毒糖蛋白B(gB)多肽 |
| US11406703B2 (en) | 2020-08-25 | 2022-08-09 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| WO2022236008A1 (en) * | 2021-05-07 | 2022-11-10 | Board Of Regents, The University Of Texas System | Methods and compositions for transport, storage, and delivery of adeno-associated viral vector and other molecules |
| CA3240127A1 (en) * | 2021-12-07 | 2023-06-15 | Zihao Wang | Rna formulations and lipids |
| WO2023144665A1 (en) | 2022-01-28 | 2023-08-03 | Glaxosmithkline Biologicals Sa | Modified human cytomegalovirus proteins |
| WO2024120490A1 (en) * | 2022-12-07 | 2024-06-13 | Immorna (hangzhou) Biotechnology Co., Ltd. | Self-replicating rna vaccines and methods of use |
| GB202400648D0 (en) * | 2024-01-17 | 2024-02-28 | Uea Enterprises Ltd | Protein replacement therapy |
| CN118240844B (zh) * | 2024-05-27 | 2024-12-13 | 北京悦康科创医药科技股份有限公司 | 带状疱疹mRNA疫苗及其制备方法和应用 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040228842A1 (en) * | 2003-02-27 | 2004-11-18 | Shan Lu | Compositions and methods for cytomegalovirus treatment |
| US20090075384A1 (en) * | 2007-06-21 | 2009-03-19 | Alphavax, Inc. | Promoterless cassettes for expression of alphavirus structural proteins |
Family Cites Families (279)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4186745A (en) | 1976-07-30 | 1980-02-05 | Kauzlarich James J | Porous catheters |
| US5132418A (en) | 1980-02-29 | 1992-07-21 | University Patents, Inc. | Process for preparing polynucleotides |
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US4500707A (en) | 1980-02-29 | 1985-02-19 | University Patents, Inc. | Nucleosides useful in the preparation of polynucleotides |
| US4668777A (en) | 1981-03-27 | 1987-05-26 | University Patents, Inc. | Phosphoramidite nucleoside compounds |
| US4973679A (en) | 1981-03-27 | 1990-11-27 | University Patents, Inc. | Process for oligonucleo tide synthesis using phosphormidite intermediates |
| US4373071A (en) | 1981-04-30 | 1983-02-08 | City Of Hope Research Institute | Solid-phase synthesis of polynucleotides |
| US6090406A (en) | 1984-04-12 | 2000-07-18 | The Liposome Company, Inc. | Potentiation of immune responses with liposomal adjuvants |
| US4797368A (en) | 1985-03-15 | 1989-01-10 | The United States Of America As Represented By The Department Of Health And Human Services | Adeno-associated virus as eukaryotic expression vector |
| US5153319A (en) | 1986-03-31 | 1992-10-06 | University Patents, Inc. | Process for preparing polynucleotides |
| US4853228A (en) | 1987-07-28 | 1989-08-01 | Micro-Pak, Inc. | Method of manufacturing unilamellar lipid vesicles |
| US5262530A (en) | 1988-12-21 | 1993-11-16 | Applied Biosystems, Inc. | Automated system for polynucleotide synthesis and purification |
| US5047524A (en) | 1988-12-21 | 1991-09-10 | Applied Biosystems, Inc. | Automated system for polynucleotide synthesis and purification |
| US6867195B1 (en) | 1989-03-21 | 2005-03-15 | Vical Incorporated | Lipid-mediated polynucleotide administration to reduce likelihood of subject's becoming infected |
| CA2489769A1 (en) | 1989-03-21 | 1990-10-04 | Philip L. Felgner | Expression of exogenous polynucleotide sequences in a vertebrate |
| CA2017507C (en) | 1989-05-25 | 1996-11-12 | Gary Van Nest | Adjuvant formulation comprising a submicron oil droplet emulsion |
| US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| EP0452457B1 (en) | 1989-11-03 | 1997-08-20 | Vanderbilt University | Method of in vivo delivery of functioning foreign genes |
| US5674192A (en) | 1990-12-28 | 1997-10-07 | Boston Scientific Corporation | Drug delivery |
| US5279833A (en) | 1990-04-04 | 1994-01-18 | Yale University | Liposomal transfection of nucleic acids into animal cells |
| US5264618A (en) | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| DE69233158T2 (de) | 1991-03-07 | 2004-05-13 | Connaught Technology Corp., Greenville | Gentechnologisch hergestellter stamm für impfstoffe |
| FR2676072B1 (fr) * | 1991-05-03 | 1994-11-18 | Transgene Sa | Vecteur de delivrance d'arn. |
| US5750390A (en) | 1992-08-26 | 1998-05-12 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for treatment of diseases caused by expression of the bcl-2 gene |
| US5693535A (en) | 1992-05-14 | 1997-12-02 | Ribozyme Pharmaceuticals, Inc. | HIV targeted ribozymes |
| US5587308A (en) | 1992-06-02 | 1996-12-24 | The United States Of America As Represented By The Department Of Health & Human Services | Modified adeno-associated virus vector capable of expression from a novel promoter |
| EP0646178A1 (en) | 1992-06-04 | 1995-04-05 | The Regents Of The University Of California | expression cassette with regularoty regions functional in the mammmlian host |
| EP0786522A2 (en) | 1992-07-17 | 1997-07-30 | Ribozyme Pharmaceuticals, Inc. | Enzymatic RNA molecules for treatment of stenotic conditions |
| US5474914A (en) | 1992-07-29 | 1995-12-12 | Chiron Corporation | Method of producing secreted CMV glycoprotein H |
| US20020102273A1 (en) | 1995-08-08 | 2002-08-01 | Robert B. Grieve | Use of alphavirus expression vectors to produce parasite anitgens |
| EP1624068A1 (en) | 1993-06-01 | 2006-02-08 | Life Technologies Inc. | Genetic immunization with cationic lipids |
| US6015686A (en) | 1993-09-15 | 2000-01-18 | Chiron Viagene, Inc. | Eukaryotic layered vector initiation systems |
| US5397307A (en) | 1993-12-07 | 1995-03-14 | Schneider (Usa) Inc. | Drug delivery PTCA catheter and method for drug delivery |
| JP3403233B2 (ja) | 1994-01-20 | 2003-05-06 | テルモ株式会社 | バルーンカテーテル |
| IL112820A0 (en) * | 1994-03-07 | 1995-05-26 | Merck & Co Inc | Coordinate in vivo gene expression |
| AU2215995A (en) | 1994-04-07 | 1995-10-30 | Akzo Nobel N.V. | Freeze-dried compositions comprising rna |
| US5993850A (en) | 1994-09-13 | 1999-11-30 | Skyepharma Inc. | Preparation of multivesicular liposomes for controlled release of encapsulated biologically active substances |
| US5885613A (en) | 1994-09-30 | 1999-03-23 | The University Of British Columbia | Bilayer stabilizing components and their use in forming programmable fusogenic liposomes |
| AU3876695A (en) | 1994-11-17 | 1996-06-17 | Imperial College Of Science, Technology And Medicine | Internalisation of dna, using conjugates of poly-l-lysine and an integrin receptor ligand |
| AU4594996A (en) | 1994-11-30 | 1996-06-19 | Chiron Viagene, Inc. | Recombinant alphavirus vectors |
| JPH11504802A (ja) * | 1994-11-30 | 1999-05-11 | カイロン コーポレイション | 組換えアルファウイルスベクター |
| US6071890A (en) | 1994-12-09 | 2000-06-06 | Genzyme Corporation | Organ-specific targeting of cationic amphiphile/DNA complexes for gene therapy |
| US5965434A (en) | 1994-12-29 | 1999-10-12 | Wolff; Jon A. | Amphipathic PH sensitive compounds and delivery systems for delivering biologically active compounds |
| US5664701A (en) | 1995-01-25 | 1997-09-09 | Uniplast, Inc. | Glue gun system with removable cartridges |
| US5700642A (en) | 1995-05-22 | 1997-12-23 | Sri International | Oligonucleotide sizing using immobilized cleavable primers |
| US5792462A (en) | 1995-05-23 | 1998-08-11 | University Of North Carolina At Chapel Hill | Alphavirus RNA replicon systems |
| US5981501A (en) | 1995-06-07 | 1999-11-09 | Inex Pharmaceuticals Corp. | Methods for encapsulating plasmids in lipid bilayers |
| US7422902B1 (en) | 1995-06-07 | 2008-09-09 | The University Of British Columbia | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| US6264957B1 (en) | 1995-09-27 | 2001-07-24 | The United States Of America As Represented By The Department Of Health And Human Services | Product of infectious respiratory syncytial virus from cloned nucleotide sequences |
| JP2000503527A (ja) * | 1995-11-28 | 2000-03-28 | ザ ジョンズ ホプキンズ ユニヴァーシティ スクール オヴ メディシン | 条件付き複製ウイルスベクターおよびその用途 |
| EP0880360B1 (en) | 1996-02-12 | 2002-10-09 | Cobra Therapeutics Limited | Novel methods of vaccination and vaccines therefore comprising a nucleic acid encoding a first epitope and a peptide containing a second epitope |
| DE19605548A1 (de) | 1996-02-15 | 1997-09-04 | Boehringer Ingelheim Int | Zusammensetzung für die Transfektion höherer eukaryotischer Zellen |
| DE19612967A1 (de) | 1996-04-01 | 1997-10-02 | Behringwerke Ag | Verfahren zur Vermehrung von Influenzaviren in Zellkultur, sowie die durch das Verfahren erhältlichen Influenzaviren |
| US6451592B1 (en) | 1996-04-05 | 2002-09-17 | Chiron Corporation | Recombinant alphavirus-based vectors with reduced inhibition of cellular macromolecular synthesis |
| CA2259179C (en) | 1996-07-03 | 2008-09-23 | University Of Pittsburgh | Emulsion formulations for hydrophilic active agents |
| CN1138533C (zh) | 1996-09-13 | 2004-02-18 | 利普森有限公司 | 脂质体 |
| US7384923B2 (en) | 1999-05-14 | 2008-06-10 | Lipoxen Technologies Limited | Liposomes |
| US6395302B1 (en) | 1996-11-19 | 2002-05-28 | Octoplus B.V. | Method for the preparation of microspheres which contain colloidal systems |
| AU733310C (en) | 1997-05-14 | 2001-11-29 | University Of British Columbia, The | High efficiency encapsulation of charged therapeutic agents in lipid vesicles |
| US6048546A (en) | 1997-07-31 | 2000-04-11 | Sandia Corporation | Immobilized lipid-bilayer materials |
| US6060308A (en) | 1997-09-04 | 2000-05-09 | Connaught Laboratories Limited | RNA respiratory syncytial virus vaccines |
| US6090619A (en) | 1997-09-08 | 2000-07-18 | University Of Florida | Materials and methods for intracellular delivery of biologically active molecules |
| US6129705A (en) | 1997-10-01 | 2000-10-10 | Medtronic Ave, Inc. | Drug delivery and gene therapy delivery system |
| CA2311395C (en) | 1997-11-28 | 2006-11-28 | Replikun Biotech Pty Ltd | Flavivirus expression and delivery system |
| US6009406A (en) | 1997-12-05 | 1999-12-28 | Square D Company | Methodology and computer-based tools for re-engineering a custom-engineered product line |
| GB9726555D0 (en) | 1997-12-16 | 1998-02-11 | Smithkline Beecham Plc | Vaccine |
| WO1999055310A1 (en) | 1998-04-27 | 1999-11-04 | Altus Biologics Inc. | Stabilized protein crystals, formulations containing them and methods of making them |
| US6432925B1 (en) | 1998-04-16 | 2002-08-13 | John Wayne Cancer Institute | RNA cancer vaccine and methods for its use |
| WO2000000616A2 (en) | 1998-06-29 | 2000-01-06 | U.S. Medical Research Institute Of Infectious Diseases | Marburg virus vaccines |
| AU747597B2 (en) | 1998-07-20 | 2002-05-16 | Inex Pharmaceuticals Corporation | Liposomal encapsulated nucleic acid-complexes |
| AU2221600A (en) * | 1998-12-31 | 2000-07-31 | Chiron Corporation | Improved expression of hiv polypeptides and production of virus-like particles |
| US6492169B1 (en) | 1999-05-18 | 2002-12-10 | Crucell Holland, B.V. | Complementing cell lines |
| ES2238799T3 (es) | 1999-09-09 | 2005-09-01 | Curevac Gmbh | Transferencia de arn-m. |
| EP1222289B1 (en) | 1999-10-20 | 2008-04-16 | The Johns Hopkins University School Of Medicine | Chimeric immunogenic compositions and nucleic acids encoding them |
| US8541008B2 (en) | 1999-11-19 | 2013-09-24 | Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center | Pharmaceutical compositions and methods to vaccinate against candidiasis |
| EP1103610A1 (en) | 1999-11-26 | 2001-05-30 | Introgene B.V. | Production of vaccines from immortalised mammalian cell lines |
| US20030212022A1 (en) | 2001-03-23 | 2003-11-13 | Jean-Marie Vogel | Compositions and methods for gene therapy |
| EP1287015A1 (en) | 2000-04-18 | 2003-03-05 | Human Genome Sciences, Inc. | Extracellular matrix polynucleotides, polypeptides, and antibodies |
| AU2001275423B2 (en) | 2000-06-09 | 2007-01-11 | Regulon, Inc. | Encapsulation of polynucleotides and drugs into targeted liposomes |
| JP2004502415A (ja) | 2000-07-03 | 2004-01-29 | カイロン エセ.ピー.アー. | Chlamydiapneumoniaeに対する免疫化 |
| AU2001290520A1 (en) | 2000-08-01 | 2002-02-13 | The Johns Hokpins University | Intercellular transport protein linked to an antigen as a molecular vaccine |
| US20040142474A1 (en) | 2000-09-14 | 2004-07-22 | Expression Genetics, Inc. | Novel cationic lipopolymer as a biocompatible gene delivery agent |
| ES2260291T3 (es) | 2000-09-28 | 2006-11-01 | Chiron Corporation | Microparticulas para la administracion de acidos nucleicos heterologos. |
| CA2881568C (en) | 2000-10-27 | 2019-09-24 | Novartis Vaccines And Diagnostics, Inc. | Nucleic acids and proteins from streptococcus groups a & b |
| US7445924B2 (en) | 2000-11-23 | 2008-11-04 | Bavarian Nordic A/S | Modified Vaccinia Ankara virus variant and cultivation method |
| US7731975B2 (en) | 2001-01-31 | 2010-06-08 | The United States Of America As Represented By The Secretary Of The Army | Chimeric filovirus glycoprotein |
| WO2002061113A2 (en) | 2001-02-01 | 2002-08-08 | The Johns Hopkins University | Nucleic acid derived vaccine that encodes an antigen linked to a polypeptide that promotes antigen presentation |
| US20030040498A1 (en) | 2001-03-14 | 2003-02-27 | Ansardi David Calvert | Oncolytic RNA replicons |
| WO2002074920A2 (en) | 2001-03-16 | 2002-09-26 | Johns Hopkins University | A replication-defective alphavirus vaccine linking antigen with an immunogenicity-potentiating polypeptide and a method of delivery the same |
| JP2004535388A (ja) | 2001-04-30 | 2004-11-25 | ターゲティッド ジェネティクス コーポレイション | 脂質含有薬物送達複合体およびそれらの生成方法 |
| US20030077251A1 (en) | 2001-05-23 | 2003-04-24 | Nicolas Escriou | Replicons derived from positive strand RNA virus genomes useful for the production of heterologous proteins |
| ES2340499T3 (es) | 2001-06-05 | 2010-06-04 | Curevac Gmbh | Arnm de antigeno tumoral estabilizado con un contenido de g/c aumentado. |
| WO2003018054A1 (en) | 2001-08-31 | 2003-03-06 | Chiron Srl. | Helicobacter pylori vaccination |
| ES2330202T5 (es) | 2001-09-06 | 2014-01-20 | Alphavax, Inc. | Sistemas vectores basados en replicones de alfavirus |
| AU2003211103A1 (en) | 2002-02-13 | 2003-09-04 | Northeastern University | Intracellular delivery of therapeutic agents |
| DE10207177A1 (de) | 2002-02-19 | 2003-09-04 | Novosom Ag | Fakultativ kationische Lipide |
| US6861410B1 (en) | 2002-03-21 | 2005-03-01 | Chiron Corporation | Immunological adjuvant compositions |
| MXPA04011249A (es) | 2002-05-14 | 2005-06-06 | Chiron Srl | Vacunas mucosales con adyuvante de quitosano y antigenos meningococicos. |
| EP1519714B1 (en) | 2002-06-28 | 2010-10-20 | Protiva Biotherapeutics Inc. | Method and apparatus for producing liposomes |
| US7604803B2 (en) | 2002-07-05 | 2009-10-20 | Lipoxen Technologies Limited | Method to enhance an immune response of nucleic acid vaccination |
| WO2004018506A2 (en) | 2002-08-22 | 2004-03-04 | Cytos Biotechnology Ag | Inducible alphaviral/orip based gene expression system |
| BR0314236A (pt) | 2002-09-13 | 2005-08-09 | Replicor Inc | Formulação de oligonucleotìdeo, composição farmacêutica, kit, composto antiviral, preparação de oligonucleotìdeo e métodos para seleção de um oligonucleotìdeo antiviral para uso como um agente antiviral, para profilaxia ou tratamento de uma infecção viral em um paciente, para tratamento profilático de câncer causado por oncovìrus, para identificação de um composto que altera a ligação de um oligonucleotìdeo a pelo menos um componente viral, para purificação da ligação de oligonucleotìdeos a pelo menos um componente viral e para enriquecimento de oligonucleotìdeos a partir de um agrupamento de oligonucleotìdeos |
| US20040208848A1 (en) * | 2002-12-13 | 2004-10-21 | Smith Jonathan F. | Multi-antigenic alphavirus replicon particles and methods |
| DK2311848T3 (da) | 2002-12-23 | 2013-10-14 | Vical Inc | Kodon-optimerede polynukleotidbaserede vacciner mod human cytomegalovirus-infektion |
| WO2004069148A2 (en) | 2003-02-04 | 2004-08-19 | Bar-Ilan University | Snornai-small nucleolar rna degradation by rna interference in trypanosomatids |
| US7442381B2 (en) | 2003-03-20 | 2008-10-28 | Alphavax, Inc. | Alphavirus replicons and helper constructs |
| WO2004087749A2 (en) | 2003-03-27 | 2004-10-14 | Children's Hospital, Inc. | Nontypeable haemophilus influenzae virulence factors |
| US7731967B2 (en) | 2003-04-30 | 2010-06-08 | Novartis Vaccines And Diagnostics, Inc. | Compositions for inducing immune responses |
| EP1637144A4 (en) | 2003-05-30 | 2010-01-13 | Nippon Shinyaku Co Ltd | OLIGONUCLEIC ACID CONTAINING COMPOSITE AND PHARMACEUTICAL COMPOSITION CONTAINING THE SAME |
| MXPA05013260A (es) | 2003-06-26 | 2006-03-09 | Chiron Corp | Composiciones inmunogenicas para chlamydia trachomatis. |
| DE602004021260D1 (de) * | 2003-07-11 | 2009-07-09 | Alphavax Inc | Cytomegalovirusimpfstoffe, die auf dem alphavirus basieren |
| US7368537B2 (en) | 2003-07-15 | 2008-05-06 | Id Biomedical Corporation Of Quebec | Subunit vaccine against respiratory syncytial virus infection |
| CA2532228C (en) | 2003-07-16 | 2017-02-14 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering rna |
| ES2505695T3 (es) | 2003-07-31 | 2014-10-10 | Novartis Vaccines And Diagnostics, Inc. | Composiciones inmunógenas para Streptococcus pyogenes |
| EP1512393A1 (de) | 2003-09-08 | 2005-03-09 | BOEHRINGER INGELHEIM PHARMA GMBH & CO. KG | Verfahren zur Herstellung von homogenen Liposomen und Lipoplexen |
| EP1528101A1 (en) | 2003-11-03 | 2005-05-04 | ProBioGen AG | Immortalized avian cell lines for virus production |
| EP1687033A4 (en) | 2003-11-12 | 2008-06-11 | Us Navy | IMPROVEMENT OF VACCINE-INDUCED IMMUNE REACTIONS AND PROTECTION THROUGH HETEROLOGY REINFORCEMENT WITH ALPHAVIRUS REPLICON VACCINE |
| US20120027841A1 (en) | 2004-01-07 | 2012-02-02 | Biomedical Research Models, Inc. | Novel mucosal vaccination approach for herpes simplex virus type-2 |
| US7303881B2 (en) | 2004-04-30 | 2007-12-04 | Pds Biotechnology Corporation | Antigen delivery compositions and methods of use |
| GB0410866D0 (en) | 2004-05-14 | 2004-06-16 | Chiron Srl | Haemophilius influenzae |
| JP5331340B2 (ja) | 2004-05-18 | 2013-10-30 | バイカル インコーポレイテッド | インフルエンザウィルスワクチン組成物、及びその使用方法 |
| CN1989250B (zh) * | 2004-05-18 | 2013-11-20 | 阿尔法瓦克斯公司 | Tc-83衍生的甲病毒属载体、颗粒和方法 |
| EP2848692B1 (en) | 2004-05-21 | 2017-08-16 | Novartis Vaccines and Diagnostics, Inc. | Alphavirus vectors for influenza virus vaccines |
| GB0411428D0 (en) | 2004-05-21 | 2004-06-23 | Got A Gene Ab | Vectors |
| JP4764426B2 (ja) | 2004-06-07 | 2011-09-07 | プロチバ バイオセラピューティクス インコーポレイティッド | カチオン性脂質および使用方法 |
| CA2569664C (en) | 2004-06-07 | 2013-07-16 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering rna |
| EP1773403B1 (en) | 2004-07-09 | 2018-04-25 | The University of North Carolina At Chapel Hill | Alphavirus-based adjuvants |
| US20060051405A1 (en) | 2004-07-19 | 2006-03-09 | Protiva Biotherapeutics, Inc. | Compositions for the delivery of therapeutic agents and uses thereof |
| JP5086082B2 (ja) | 2004-10-01 | 2012-11-28 | ノバルティス ヴァクシンズ アンド ダイアグノスティクス エスアールエル | C型肝炎ウイルス複製系 |
| JP2008520600A (ja) | 2004-11-19 | 2008-06-19 | ノヴォソム アクチェンゲゼルシャフト | 局所投与のための医薬組成物におけるまたはそれに関する改善 |
| GB2421025A (en) | 2004-12-09 | 2006-06-14 | Oxxon Therapeutics Ltd | HSV vaccination vectors |
| WO2007086881A2 (en) | 2005-02-14 | 2007-08-02 | Sirna Therapeutics, Inc. | Cationic lipids and formulated molecular compositions containing them |
| US7404969B2 (en) | 2005-02-14 | 2008-07-29 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| SI1858920T1 (sl) | 2005-02-18 | 2016-07-29 | Glaxosmithkline Biologicals S.A. | Proteini in nukleinske kisline iz escherichia coli, povezane z meningitisom/sepso |
| JP2008530245A (ja) | 2005-02-18 | 2008-08-07 | ノバルティス ヴァクシンズ アンド ダイアグノスティクス, インコーポレイテッド | 尿路病原性菌株由来の抗原 |
| US20080138431A1 (en) | 2005-03-02 | 2008-06-12 | James Edward Eyles | Pharmaceutical Composition |
| GB0504436D0 (en) | 2005-03-03 | 2005-04-06 | Glaxosmithkline Biolog Sa | Vaccine |
| EP1871888A4 (en) | 2005-03-30 | 2013-08-21 | Novartis Vaccines & Diagnostic | HAEMOPHILUS INFLUENZAE OF TYPE B |
| AU2006236910B2 (en) * | 2005-04-11 | 2012-06-07 | Purdue Research Foundation | Vaccine against pandemic strains of influenza viruses |
| US7618393B2 (en) | 2005-05-03 | 2009-11-17 | Pharmajet, Inc. | Needle-less injector and method of fluid delivery |
| RU2007146137A (ru) | 2005-05-12 | 2009-06-27 | Новартис Вэксинес Энд Дайэгностикс, Инк. (Us) | Иммуногенные композиции на основе chlamydia trachomatis |
| US8703095B2 (en) | 2005-07-07 | 2014-04-22 | Sanofi Pasteur S.A. | Immuno-adjuvant emulsion |
| EP1909758A1 (en) | 2005-08-02 | 2008-04-16 | I.D.M. Immuno-Designed Molecules | Process for the preparation of liposomal formulations |
| US7951384B2 (en) | 2005-08-05 | 2011-05-31 | University Of Massachusetts | Virus-like particles as vaccines for paramyxovirus |
| PL2578685T3 (pl) | 2005-08-23 | 2020-01-31 | The Trustees Of The University Of Pennsylvania | Rna zawierający zmodyfikowane nukleozydy i sposoby jego zastosowania |
| EP1764089A1 (en) | 2005-09-15 | 2007-03-21 | Novosom AG | Serum stable liposomes comprising amphoter II lipid mixtures |
| DE102005046490A1 (de) | 2005-09-28 | 2007-03-29 | Johannes-Gutenberg-Universität Mainz | Modifikationen von RNA, die zu einer erhöhten Transkriptstabilität und Translationseffizienz führen |
| BRPI0616687A2 (pt) | 2005-09-29 | 2011-06-28 | Elan Pharm Inc | compostos de pirimidinil amida que inibem a adesão leucocitária mediada por vla-4 |
| CA2626253A1 (en) | 2005-10-18 | 2007-04-26 | Novartis Vaccines And Diagnostics, Inc. | Mucosal and systemic immunizations with alphavirus replicon particles |
| JP2007112768A (ja) | 2005-10-24 | 2007-05-10 | Kyoto Univ | 肝指向性リポソーム組成物 |
| EP1954306A2 (en) | 2005-10-25 | 2008-08-13 | Novartis Vaccines and Diagnostics S.r.l. | Compositions comprising yersinia pestis antigens |
| ES2514316T3 (es) | 2005-11-22 | 2014-10-28 | Novartis Vaccines And Diagnostics, Inc. | Partículas similares a virus (VLPs) de Norovirus y Sapovirus |
| CA2631714C (en) | 2005-12-02 | 2014-09-16 | Novartis Ag | Nanoparticles for use in immunogenic compositions |
| EP2004141A2 (en) | 2006-03-17 | 2008-12-24 | Novosom AG | An efficient method for loading amphoteric liposomes with nucleic acid active substances |
| EP3031469B1 (en) * | 2006-06-07 | 2023-08-23 | The Trustees Of Princeton University | Cytomegalovirus surface protein complex for use in vaccines and as a drug target |
| US7915399B2 (en) | 2006-06-09 | 2011-03-29 | Protiva Biotherapeutics, Inc. | Modified siRNA molecules and uses thereof |
| PT2035581E (pt) | 2006-06-21 | 2012-12-06 | Scripps Research Inst | Composição de adn contra o antigénio do estroma tumoral fap e métodos de utilização desta |
| CA3057039C (en) * | 2006-07-28 | 2023-02-28 | The Trustees Of The University Of Pennsylvania | Hiv consensus envelope sequences and methods for using same |
| EP2586790A3 (en) | 2006-08-16 | 2013-08-14 | Novartis AG | Immunogens from uropathogenic Escherichia coli |
| CA2663295C (en) | 2006-09-12 | 2020-03-10 | Alphavax, Inc. | Alphavirus replicon particles matched to protein antigens as immunological adjuvants |
| DE102007001370A1 (de) | 2007-01-09 | 2008-07-10 | Curevac Gmbh | RNA-kodierte Antikörper |
| CA2689042A1 (en) | 2007-02-16 | 2008-08-28 | Merck & Co., Inc. | Compositions and methods for potentiated activity of biologicaly active molecules |
| US20100196492A1 (en) | 2007-03-08 | 2010-08-05 | Green Jordan J | Electrostatic coating of particles for drug delivery |
| US8877206B2 (en) | 2007-03-22 | 2014-11-04 | Pds Biotechnology Corporation | Stimulation of an immune response by cationic lipids |
| EP2905336A1 (en) | 2007-03-29 | 2015-08-12 | Alnylam Pharmaceuticals Inc. | Compositions and methods for inhibiting expression of a gene from the ebola |
| US8748591B2 (en) | 2007-04-17 | 2014-06-10 | The Board Of Regents Of The University Of Texas System | Chimeric sindbis-western equine encephalitis virus and uses thereof |
| HUE040417T2 (hu) | 2007-05-04 | 2019-03-28 | Marina Biotech Inc | Aminosavlipidek és alkalmazásuk |
| WO2008148068A1 (en) | 2007-05-23 | 2008-12-04 | Mannkind Corporation | Multicistronic vectors and methods for their design |
| DE102007029471A1 (de) | 2007-06-20 | 2008-12-24 | Novosom Ag | Neue fakultativ kationische Sterole |
| EP2173771A1 (en) | 2007-07-04 | 2010-04-14 | Ribovax Biotechnologies SA | Antibodies against human cytomegalovirus (hcmv) |
| GB0714963D0 (en) | 2007-08-01 | 2007-09-12 | Novartis Ag | Compositions comprising antigens |
| WO2009026328A2 (en) | 2007-08-21 | 2009-02-26 | Immune Disease Institute, Inc. | Methods of delivery of agents to leukocytes and endothelial cells |
| GB0717187D0 (en) | 2007-09-04 | 2007-10-17 | Novartis Ag | Compositions comprising yersinia pestis antigens |
| CA2704153A1 (en) | 2007-09-26 | 2009-04-02 | Vanderbilt University | Vaccine for rsv and mpv |
| EP2042193A1 (en) | 2007-09-28 | 2009-04-01 | Biomay AG | RNA Vaccines |
| AU2008338803B2 (en) | 2007-11-26 | 2015-02-05 | Glaxosmithkline Biologicals S.A. | Methods of generating alphavirus particles |
| EP2067749A1 (en) | 2007-11-29 | 2009-06-10 | Total Petrochemicals France | Process for purification of an aqueous phase containing polyaromatics |
| WO2009074861A2 (en) | 2007-12-10 | 2009-06-18 | Powderject Research Limited | Improved vaccine |
| WO2009086558A1 (en) | 2008-01-02 | 2009-07-09 | Tekmira Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
| WO2009111088A2 (en) | 2008-01-02 | 2009-09-11 | The Johns Hopkins University | Antitumor immunization by liposomal delivery of vaccine to the spleen |
| ITMI20081249A1 (it) | 2008-07-09 | 2010-01-09 | Novartis Vaccines & Diagnostic | Immunogeni di escherichia coli con solubilità migliorata. |
| WO2009109860A2 (en) | 2008-03-06 | 2009-09-11 | Novartis Ag | Mutant forms of chlamydia htra |
| CA2721333C (en) | 2008-04-15 | 2020-12-01 | Protiva Biotherapeutics, Inc. | Novel lipid formulations for nucleic acid delivery |
| WO2009127230A1 (en) | 2008-04-16 | 2009-10-22 | Curevac Gmbh | MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION |
| WO2009132131A1 (en) | 2008-04-22 | 2009-10-29 | Alnylam Pharmaceuticals, Inc. | Amino lipid based improved lipid formulation |
| WO2009132206A1 (en) | 2008-04-25 | 2009-10-29 | Liquidia Technologies, Inc. | Compositions and methods for intracellular delivery and release of cargo |
| US20100040650A1 (en) | 2008-05-30 | 2010-02-18 | Crowe Jr James E | Virus-Like paramyxovirus particles and vaccines |
| EP2130912A1 (en) | 2008-06-04 | 2009-12-09 | Institut für Viruskrankeiten und Immunprophylaxe | Pestivirus replicons providing an RNA-based viral vector system |
| EP2310045A1 (en) | 2008-06-25 | 2011-04-20 | Novartis AG | Rapid responses to delayed booster immunisations |
| US20110229969A1 (en) * | 2008-06-25 | 2011-09-22 | Volker Sandig | Cell Line for Propagation of Highly Attenuated AlphaViruses |
| DK2352759T3 (en) * | 2008-07-16 | 2017-12-18 | Inst Res Biomedicine | ANTIBODIES THAT NEUTRALIZE HUMAN CYTOMEGALOVIRUS AND USE THEREOF |
| AU2008359583B2 (en) * | 2008-07-16 | 2012-04-05 | Institute For Research In Biomedicine | Human cytomegalovirus neutralising antibodies and use thereof |
| JP2010025644A (ja) | 2008-07-16 | 2010-02-04 | Kochi Univ Of Technology | 硝酸イオンの呈色試薬並びにこれを用いた硝酸イオンの検出及び定量方法 |
| CA2733147A1 (en) | 2008-08-06 | 2010-02-11 | Novartis Ag | Microparticles for use in immunogenic compositions |
| CL2008002322A1 (es) | 2008-08-07 | 2009-06-05 | Univ Concepcion | Formulacion farmaceutica veterinaria que comprende un sistema vectorial viral constituido por una particula recombinante de arn que codifica una cu/zn superoxido dismutasa de la bacteria patogena de bovinos brucella abortus, y al menos un alfavirus arn perteneciente a la familia del virus semliki forest (sfv), util como vacuna. |
| US8557292B2 (en) | 2008-08-13 | 2013-10-15 | California Institute Of Technology | Carrier nanoparticles and related compositions, methods and systems |
| EP2331557B1 (en) | 2008-08-15 | 2013-12-18 | Novartis AG | Alphavirus packaging cell lines |
| WO2010036948A2 (en) | 2008-09-26 | 2010-04-01 | The United States Of America, As Represented By The Secretary, Department Of Health & Human Services | Dna prime/inactivated vaccine boost immunization to influenza virus |
| CA2740000C (en) | 2008-10-09 | 2017-12-12 | Tekmira Pharmaceuticals Corporation | Improved amino lipids and methods for the delivery of nucleic acids |
| EP3269395A1 (en) | 2008-11-07 | 2018-01-17 | Massachusetts Institute Of Technology | Aminoalcohol lipidoids and uses thereof |
| CN111808084A (zh) | 2008-11-10 | 2020-10-23 | 阿布特斯生物制药公司 | 用于递送治疗剂的新型脂质和组合物 |
| JP6046348B2 (ja) | 2008-11-18 | 2016-12-14 | タケダ ヴァクシーンズ, インコーポレイテッド | Rsvfvlpならびにその製造および使用の方法 |
| EP3243504A1 (en) | 2009-01-29 | 2017-11-15 | Arbutus Biopharma Corporation | Improved lipid formulation |
| EP3263128A3 (en) | 2009-04-14 | 2018-01-24 | GlaxoSmithKline Biologicals S.A. | Compositions for immunising against staphylococcus aureus |
| CA3045126A1 (en) | 2009-05-05 | 2010-11-11 | Arbutus Biopharma Corporation | Methods of delivering oligonucleotides to immune cells |
| KR101766408B1 (ko) | 2009-06-10 | 2017-08-10 | 알닐람 파마슈티칼스 인코포레이티드 | 향상된 지질 조성물 |
| WO2011000107A1 (en) | 2009-07-01 | 2011-01-06 | Protiva Biotherapeutics, Inc. | Novel lipid formulations for delivery of therapeutic agents to solid tumors |
| EP2450031B1 (en) | 2009-07-02 | 2018-08-29 | Konica Minolta Holdings, Inc. | Method for producing liposomes by two-stage emulsification method using outer aqueous phase containing specific dispersing agent, method for producing liposome dispersion or dry powder thereof using the method for producing liposomes, and liposome dispersion or dry powder thereof produced thereby |
| CA2766907A1 (en) | 2009-07-06 | 2011-01-13 | Novartis Ag | Self replicating rna molecules and uses thereof |
| CA2768186A1 (en) | 2009-07-15 | 2011-01-20 | Novartis Ag | Rsv f protein compositions and methods for making same |
| US9642903B2 (en) | 2009-07-16 | 2017-05-09 | Lior Carmon | Antigen specific multi epitope-based anti-infective vaccines |
| CA2769670C (en) | 2009-07-31 | 2018-10-02 | Ethris Gmbh | Rna with a combination of unmodified and modified nucleotides for protein expression |
| WO2011027222A2 (en) | 2009-09-02 | 2011-03-10 | Novartis Ag | Immunogenic compositions including tlr activity modulators |
| JO3257B1 (ar) | 2009-09-02 | 2018-09-16 | Novartis Ag | مركبات وتركيبات كمعدلات لفاعلية tlr |
| US20110070260A1 (en) | 2009-09-09 | 2011-03-24 | Baric Ralph S | Multivalent Immunogenic Compositions Against Noroviruses and Methods of Use |
| CN107028886A (zh) | 2009-11-04 | 2017-08-11 | 不列颠哥伦比亚大学 | 含有核酸的脂质粒子及相关的方法 |
| US20110112353A1 (en) | 2009-11-09 | 2011-05-12 | Circulite, Inc. | Bifurcated outflow cannulae |
| EP3318248B1 (en) | 2009-12-01 | 2019-04-10 | Translate Bio, Inc. | Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases |
| EP3296398A1 (en) | 2009-12-07 | 2018-03-21 | Arbutus Biopharma Corporation | Compositions for nucleic acid delivery |
| US8808982B2 (en) | 2009-12-07 | 2014-08-19 | Cellscript, Llc | Compositions and methods for reprogramming eukaryotic cells |
| EP3494963A1 (en) | 2009-12-18 | 2019-06-12 | The University of British Columbia | Methods and compositions for delivery of nucleic acids |
| CA3009891C (en) | 2009-12-23 | 2020-09-15 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
| EP2525815B1 (en) | 2010-01-24 | 2015-02-25 | Novartis AG | Irradiated biodegradable polymer microparticles |
| US9744228B2 (en) | 2010-04-07 | 2017-08-29 | Norvartis Ag | Method for generating a parvovirus B19 virus-like particle |
| US9770463B2 (en) | 2010-07-06 | 2017-09-26 | Glaxosmithkline Biologicals Sa | Delivery of RNA to different cell types |
| ES2646669T3 (es) | 2010-07-06 | 2017-12-14 | Glaxosmithkline Biologicals Sa | Procedimientos de aumento de una respuesta inmunitaria mediante el suministro de ARN |
| EP2591114B1 (en) | 2010-07-06 | 2016-06-08 | GlaxoSmithKline Biologicals SA | Immunisation of large mammals with low doses of rna |
| AU2011276328C1 (en) | 2010-07-06 | 2016-01-21 | Novartis Ag | Norovirus derived immunogenic compositions and methods |
| ES2557382T3 (es) | 2010-07-06 | 2016-01-25 | Glaxosmithkline Biologicals Sa | Liposomas con lípidos que tienen un valor de pKa ventajoso para el suministro de ARN |
| MX342608B (es) | 2010-07-06 | 2016-10-06 | Novartis Ag * | Particulas de suministro similares a viriones para moleculas de arn de autorreplicacion. |
| US9192661B2 (en) * | 2010-07-06 | 2015-11-24 | Novartis Ag | Delivery of self-replicating RNA using biodegradable polymer particles |
| NZ606591A (en) | 2010-07-06 | 2015-02-27 | Novartis Ag | Cationic oil-in-water emulsions |
| US8898852B2 (en) | 2010-08-04 | 2014-12-02 | Honeywell International Inc. | Air burst to clear detection window |
| WO2012019168A2 (en) | 2010-08-06 | 2012-02-09 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| MX2013002332A (es) | 2010-08-31 | 2013-03-18 | Novartis Ag | Lipidos apropiados para suministro liposomal del arn que codifica la proteina. |
| LT4226941T (lt) | 2010-08-31 | 2025-01-10 | Glaxosmithkline Biologicals Sa | Pegilintos liposomos, skirtos imunogeną koduojančios rnr pristatymui |
| SI4043040T1 (sl) * | 2010-08-31 | 2023-04-28 | Glaxosmithkline Biologicals Sa | Mali liposomi za dostavo imunogen-kodirajoče RNA |
| EP2614072A4 (en) | 2010-09-09 | 2014-03-19 | Univ Virginia Commonwealth | VACCINE AGAINST THE HUMAN CYTOMEGALOVIRUS |
| EP2625189B1 (en) | 2010-10-01 | 2018-06-27 | ModernaTX, Inc. | Engineered nucleic acids and methods of use thereof |
| WO2012051211A2 (en) | 2010-10-11 | 2012-04-19 | Novartis Ag | Antigen delivery platforms |
| PH12013500764A1 (en) | 2010-10-25 | 2015-09-23 | Stepan Co | Quaternized fatty amines, amidoamines, and their derivatives from natural oil metathesis |
| US9405700B2 (en) | 2010-11-04 | 2016-08-02 | Sonics, Inc. | Methods and apparatus for virtualization in an integrated circuit |
| WO2012103361A1 (en) | 2011-01-26 | 2012-08-02 | Novartis Ag | Rsv immunization regimen |
| EA033467B1 (ru) | 2011-01-31 | 2019-10-31 | Univ Pennsylvania | Молекула нуклеиновой кислоты для индукции иммунного ответа против герпесвируса и ее применение |
| WO2012116714A1 (en) | 2011-03-02 | 2012-09-07 | Curevac Gmbh | Vaccination in elderly patients |
| AU2012236099A1 (en) | 2011-03-31 | 2013-10-03 | Moderna Therapeutics, Inc. | Delivery and formulation of engineered nucleic acids |
| CA2835644C (en) | 2011-05-13 | 2021-06-15 | Novartis Ag | Pre-fusion rsv f antigens |
| CA2835428A1 (en) | 2011-05-17 | 2012-11-22 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof for non-human vertebrates |
| ES2795110T3 (es) | 2011-06-08 | 2020-11-20 | Translate Bio Inc | Lípidos escindibles |
| JP6059220B2 (ja) | 2011-07-06 | 2017-01-18 | ノバルティス アーゲー | 核酸を含む水中油型エマルジョン |
| MX350258B (es) | 2011-07-06 | 2017-08-31 | Novartis Ag | Emulsiones cationicas de aceite en agua. |
| EP2729165B1 (en) | 2011-07-06 | 2017-11-08 | GlaxoSmithKline Biologicals SA | Immunogenic combination compositions and uses thereof |
| EP4115875A1 (en) | 2011-07-06 | 2023-01-11 | GlaxoSmithKline Biologicals S.A. | Liposomes having useful n:p ratio for delivery of rna molecules |
| CA2841047A1 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Immunogenic compositions and uses thereof |
| MX366055B (es) * | 2011-08-31 | 2019-06-26 | Novartis Ag | Liposomas pegilados para admistracion de acido ribonucleico (arn) que codifica para inmunogeno. |
| WO2013039861A2 (en) | 2011-09-12 | 2013-03-21 | modeRNA Therapeutics | Engineered nucleic acids and methods of use thereof |
| DE19216461T1 (de) | 2011-10-03 | 2021-10-07 | Modernatx, Inc. | Modifizierte nukleoside, nukleotide und nukleinsäuren und verwendungen davon |
| RU2014118727A (ru) | 2011-10-11 | 2015-11-20 | Новартис Аг | Рекомбинантные самореплицирующиеся полицистронные молекулы рнк |
| US20140348863A1 (en) | 2011-10-12 | 2014-11-27 | Alessia Bianchi | Cmv antigens and uses thereof |
| WO2013130161A1 (en) | 2011-12-14 | 2013-09-06 | modeRNA Therapeutics | Methods of responding to a biothreat |
| CA3018046A1 (en) | 2011-12-16 | 2013-06-20 | Moderna Therapeutics, Inc. | Modified nucleoside, nucleotide, and nucleic acid compositions |
| CN104968354A (zh) | 2011-12-21 | 2015-10-07 | 现代治疗公司 | 增加器官或器官外植体的活力或寿命的方法 |
| WO2013151665A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins associated with human disease |
| CN104411338A (zh) | 2012-04-02 | 2015-03-11 | 现代治疗公司 | 用于产生与人类疾病相关的生物制剂和蛋白质的修饰多核苷酸 |
| PL2922554T3 (pl) | 2012-11-26 | 2022-06-20 | Modernatx, Inc. | Na zmodyfikowany na końcach |
| CN109045294A (zh) | 2013-01-10 | 2018-12-21 | 思齐乐 | 流感病毒免疫原性组合物及其应用 |
| US9504747B2 (en) | 2013-03-08 | 2016-11-29 | Novartis Ag | Lipids and lipid compositions for the delivery of active agents |
| US20160032316A1 (en) | 2013-03-14 | 2016-02-04 | The Trustees Of The University Of Pennsylvania | Purification and Purity Assessment of RNA Molecules Synthesized with Modified Nucleosides |
| WO2014152211A1 (en) | 2013-03-14 | 2014-09-25 | Moderna Therapeutics, Inc. | Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| EP3083556B1 (en) | 2013-12-19 | 2019-12-25 | Novartis AG | Lipids and lipid compositions for the delivery of active agents |
| JP6948313B6 (ja) | 2015-09-17 | 2022-01-14 | モデルナティエックス インコーポレイテッド | 治療剤の細胞内送達のための化合物および組成物 |
| HRP20230209T1 (hr) | 2015-10-28 | 2023-04-14 | Acuitas Therapeutics Inc. | Novi lipidi i lipidne formulacije nanočestica za isporuku nukleinskih kiselina |
| CA3043033A1 (en) | 2016-11-10 | 2018-05-17 | Translate Bio, Inc. | Improved ice-based lipid nanoparticle formulation for delivery of mrna |
| WO2018170270A1 (en) | 2017-03-15 | 2018-09-20 | Modernatx, Inc. | Varicella zoster virus (vzv) vaccine |
| WO2020106946A1 (en) | 2018-11-21 | 2020-05-28 | Translate Bio, Inc. | TREATMENT OF CYSTIC FIBROSIS BY DELIVERY OF NEBULIZED mRNA ENCODING CFTR |
| EP4021407A1 (en) | 2019-08-30 | 2022-07-06 | GlaxoSmithKline Biologicals S.A. | Jet mixing lipid nanoparticle manufacturing process |
| US11918643B2 (en) | 2020-12-22 | 2024-03-05 | CureVac SE | RNA vaccine against SARS-CoV-2 variants |
-
2011
- 2011-10-11 WO PCT/US2011/055834 patent/WO2012051211A2/en not_active Ceased
- 2011-10-11 BR BR112013008700A patent/BR112013008700B8/pt active IP Right Grant
- 2011-10-11 CA CA2814386A patent/CA2814386C/en active Active
- 2011-10-11 EP EP22175211.6A patent/EP4098324A1/en active Pending
- 2011-10-11 MX MX2013003939A patent/MX363307B/es unknown
- 2011-10-11 AU AU2011316707A patent/AU2011316707A1/en not_active Abandoned
- 2011-10-11 ES ES18212078T patent/ES2945135T3/es active Active
- 2011-10-11 EP EP18212078.2A patent/EP3520813B1/en active Active
- 2011-10-11 US US13/878,835 patent/US20140030292A1/en not_active Abandoned
- 2011-10-11 CN CN201180058783.3A patent/CN103269713B/zh active Active
- 2011-10-11 KR KR1020207027706A patent/KR102266691B1/ko active Active
- 2011-10-11 ES ES11785510T patent/ES2716243T3/es active Active
- 2011-10-11 JP JP2013533016A patent/JP2013544504A/ja not_active Withdrawn
- 2011-10-11 EP EP22175212.4A patent/EP4098325A1/en active Pending
- 2011-10-11 KR KR1020137011527A patent/KR102162111B1/ko active Active
- 2011-10-11 TR TR2019/03651T patent/TR201903651T4/tr unknown
- 2011-10-11 RU RU2013121582/10A patent/RU2597974C2/ru active
- 2011-10-11 EP EP11785510.6A patent/EP2627351B1/en active Active
-
2013
- 2013-04-09 ZA ZA2013/02548A patent/ZA201302548B/en unknown
- 2013-04-11 CL CL2013000984A patent/CL2013000984A1/es unknown
-
2016
- 2016-02-19 JP JP2016030088A patent/JP2016096827A/ja not_active Withdrawn
- 2016-10-07 AU AU2016238966A patent/AU2016238966B2/en active Active
-
2017
- 2017-08-25 JP JP2017162235A patent/JP2017205126A/ja active Pending
-
2018
- 2018-08-28 US US16/114,621 patent/US11078237B2/en active Active
-
2021
- 2021-06-28 US US17/360,320 patent/US11639370B2/en active Active
-
2022
- 2022-03-16 US US17/696,143 patent/US20220213149A1/en not_active Abandoned
-
2024
- 2024-11-19 US US18/952,185 patent/US20250206785A1/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040228842A1 (en) * | 2003-02-27 | 2004-11-18 | Shan Lu | Compositions and methods for cytomegalovirus treatment |
| US20090075384A1 (en) * | 2007-06-21 | 2009-03-19 | Alphavax, Inc. | Promoterless cassettes for expression of alphavirus structural proteins |
Non-Patent Citations (2)
| Title |
|---|
| Kamrud KI, Alterson K, Custer M, Dudek J, Goodman C, Owens G, Smith JF. Development and characterization of promoterless helper RNAs for the production of alphavirus replicon particle. J Gen Virol. 2010 Jul;91(Pt 7):1723-7. Epub 2010 Feb 24. * |
| Reap EA, Morris J, Dryga SA, Maughan M, Talarico T, Esch RE, Negri S, Burnett B, Graham A, Olmsted RA, Chulay JD. Development and preclinical evaluation of an alphavirus replicon particle vaccine for cytomegalovirus. Vaccine. 2007 Oct 16;25(42):7441-9. Epub 2007 Aug 30. * |
Cited By (100)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12337032B2 (en) | 2009-06-05 | 2025-06-24 | City Of Hope | Genetically stable recombinant modified vaccinia Ankara (RMVA) vaccines and methods of preparation thereof |
| US11541114B2 (en) | 2009-06-05 | 2023-01-03 | City Of Hope | Genetically stable recombinant modified vaccinia Ankara (rMVA) vaccines and methods of preparation thereof |
| US11773395B1 (en) | 2010-07-06 | 2023-10-03 | Glaxosmithkline Biologicals Sa | Immunization of large mammals with low doses of RNA |
| US11845925B2 (en) | 2010-07-06 | 2023-12-19 | Glaxosmithkline Biologicals Sa | Immunisation of large mammals with low doses of RNA |
| US12186333B2 (en) | 2010-07-06 | 2025-01-07 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11913001B2 (en) | 2010-07-06 | 2024-02-27 | Glaxosmithkline Biologicals Sa | Immunisation of large mammals with low doses of RNA |
| US11905514B2 (en) | 2010-07-06 | 2024-02-20 | Glaxosmithkline Biological Sa | Immunisation of large mammals with low doses of RNA |
| US11596645B2 (en) | 2010-07-06 | 2023-03-07 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11638694B2 (en) | 2010-07-06 | 2023-05-02 | Glaxosmithkline Biologicals Sa | Vaccine for eliciting immune response comprising lipid formulations and RNA encoding multiple immunogens |
| US20220125723A1 (en) | 2010-07-06 | 2022-04-28 | Glaxosmithkline Biologicals Sa | Lipid formulations with viral immunogens |
| US11891608B2 (en) | 2010-07-06 | 2024-02-06 | Glaxosmithkline Biologicals Sa | Immunization of large mammals with low doses of RNA |
| US11883534B2 (en) | 2010-07-06 | 2024-01-30 | Glaxosmithkline Biologicals Sa | Immunisation with lipid formulations with RNA encoding immunogens |
| US11865080B2 (en) | 2010-07-06 | 2024-01-09 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11857562B2 (en) | 2010-07-06 | 2024-01-02 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11857681B2 (en) | 2010-07-06 | 2024-01-02 | Glaxosmithkline Biologicals Sa | Lipid formulations with RNA encoding immunogens |
| US11759475B2 (en) | 2010-07-06 | 2023-09-19 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11851660B2 (en) | 2010-07-06 | 2023-12-26 | Glaxosmithkline Biologicals Sa | Immunisation of large mammals with low doses of RNA |
| US11638693B2 (en) | 2010-07-06 | 2023-05-02 | Glaxosmithkline Biologicals Sa | Vaccine for eliciting immune response comprising RNA encoding an immunogen and lipid formulations comprising mole percentage of lipids |
| US11655475B2 (en) | 2010-07-06 | 2023-05-23 | Glaxosmithkline Biologicals Sa | Immunisation of large mammals with low doses of RNA |
| US11839686B2 (en) | 2010-07-06 | 2023-12-12 | Glaxosmithkline Biologicals Sa | Lipid formulations with viral immunogens |
| US11786467B2 (en) | 2010-07-06 | 2023-10-17 | Glaxosmithkline Biologicals Sa | Lipid formulations with immunogens |
| US11666534B2 (en) | 2010-07-06 | 2023-06-06 | Glaxosmithkline Biologicals Sa | Methods of administering lipid formulations with viral immunogens |
| US11690865B2 (en) | 2010-07-06 | 2023-07-04 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11690864B2 (en) | 2010-07-06 | 2023-07-04 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11690861B2 (en) | 2010-07-06 | 2023-07-04 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11766401B2 (en) | 2010-07-06 | 2023-09-26 | Glaxosmithkline Biologicals Sa | Methods of administering lipid formulations with immunogens |
| US11850305B2 (en) | 2010-07-06 | 2023-12-26 | Glaxosmithkline Biologicals Sa | Method of making lipid formulations with RNA encoding immunogens |
| US11739334B2 (en) | 2010-07-06 | 2023-08-29 | Glaxosmithkline Biologicals Sa | Immunisation of large mammals with low doses of RNA |
| US11690863B2 (en) | 2010-07-06 | 2023-07-04 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11730754B2 (en) | 2010-07-06 | 2023-08-22 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11717529B2 (en) | 2010-07-06 | 2023-08-08 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11707482B2 (en) | 2010-07-06 | 2023-07-25 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US11696923B2 (en) | 2010-07-06 | 2023-07-11 | Glaxosmithkline Biologicals, Sa | Delivery of RNA to trigger multiple immune pathways |
| US11690862B1 (en) | 2010-07-06 | 2023-07-04 | Glaxosmithkline Biologicals Sa | Delivery of RNA to trigger multiple immune pathways |
| US9181319B2 (en) | 2010-08-06 | 2015-11-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9447164B2 (en) | 2010-08-06 | 2016-09-20 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9937233B2 (en) | 2010-08-06 | 2018-04-10 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US11759422B2 (en) | 2010-08-31 | 2023-09-19 | Glaxosmithkline Biologicals Sa | Pegylated liposomes for delivery of immunogen-encoding RNA |
| US9701965B2 (en) | 2010-10-01 | 2017-07-11 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US11639370B2 (en) | 2010-10-11 | 2023-05-02 | Glaxosmithkline Biologicals Sa | Antigen delivery platforms |
| US9950068B2 (en) | 2011-03-31 | 2018-04-24 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US11896636B2 (en) * | 2011-07-06 | 2024-02-13 | Glaxosmithkline Biologicals Sa | Immunogenic combination compositions and uses thereof |
| US20140227346A1 (en) * | 2011-07-06 | 2014-08-14 | Andrew Geall | Immunogenic combination compositions and uses thereof |
| US20140271829A1 (en) * | 2011-10-11 | 2014-09-18 | Anders Lilja | Recombinant self-replicating polycistronic rna molecules |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| US9295689B2 (en) | 2011-12-16 | 2016-03-29 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US9587003B2 (en) | 2012-04-02 | 2017-03-07 | Modernatx, Inc. | Modified polynucleotides for the production of oncology-related proteins and peptides |
| US9114113B2 (en) | 2012-04-02 | 2015-08-25 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding citeD4 |
| US9095552B2 (en) | 2012-04-02 | 2015-08-04 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1 |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9149506B2 (en) | 2012-04-02 | 2015-10-06 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding septin-4 |
| US9192651B2 (en) | 2012-04-02 | 2015-11-24 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9216205B2 (en) | 2012-04-02 | 2015-12-22 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding granulysin |
| US9221891B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | In vivo production of proteins |
| US9220755B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9220792B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aquaporin-5 |
| US9233141B2 (en) | 2012-04-02 | 2016-01-12 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| US9255129B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9301993B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding apoptosis inducing factor 1 |
| US9303079B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9878056B2 (en) | 2012-04-02 | 2018-01-30 | Modernatx, Inc. | Modified polynucleotides for the production of cosmetic proteins and peptides |
| US9827332B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of proteins |
| US9828416B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9814760B2 (en) | 2012-04-02 | 2017-11-14 | Modernatx, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9782462B2 (en) | 2012-04-02 | 2017-10-10 | Modernatx, Inc. | Modified polynucleotides for the production of proteins associated with human disease |
| US9675668B2 (en) | 2012-04-02 | 2017-06-13 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding hepatitis A virus cellular receptor 2 |
| US11717568B2 (en) | 2012-07-27 | 2023-08-08 | City Of Hope | MVA vaccine for delivery of a UL128 complex and preventing CMV infection |
| US12150987B2 (en) | 2012-07-27 | 2024-11-26 | City Of Hope | MVA vaccine for delivery of a UL128 complex and preventing CMV infection |
| US9512456B2 (en) | 2012-08-14 | 2016-12-06 | Modernatx, Inc. | Enzymes and polymerases for the synthesis of RNA |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US20140193484A1 (en) * | 2013-01-10 | 2014-07-10 | Sylvie Carine Bertholet Girardin | Influenza virus immunogenic compositions and uses thereof |
| US11603399B2 (en) | 2013-03-13 | 2023-03-14 | Modernatx, Inc. | Long-lived polynucleotide molecules |
| US10258698B2 (en) | 2013-03-14 | 2019-04-16 | Modernatx, Inc. | Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10023626B2 (en) | 2013-09-30 | 2018-07-17 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US11384137B2 (en) | 2015-09-10 | 2022-07-12 | City Of Hope | MVA-gH/gL-PC vaccine derived antibodies neutralizing human cytomegalovirus infectivity and methods thereof |
| US10849920B2 (en) | 2015-10-05 | 2020-12-01 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US12246030B2 (en) | 2015-10-05 | 2025-03-11 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US11590157B2 (en) | 2015-10-05 | 2023-02-28 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US10022436B2 (en) | 2016-01-11 | 2018-07-17 | Verndari, Inc. | Microneedle compositions and methods of using same |
| US10363303B2 (en) | 2016-01-11 | 2019-07-30 | Verndari, Inc. | Microneedle compositions and methods of using same |
| US12491261B2 (en) | 2016-10-26 | 2025-12-09 | Acuitas Therapeutics, Inc. | Lipid nanoparticle formulations |
| US11572389B2 (en) * | 2017-01-27 | 2023-02-07 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Vaccine compositions of herpesvirus envelope protein combinations to induce immune response |
| WO2018140733A1 (en) * | 2017-01-27 | 2018-08-02 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Vaccine compositions of herpesvirus envelope protein combinations to induce immune response |
| AU2018213378B2 (en) * | 2017-01-27 | 2025-03-06 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Vaccine compositions of herpesvirus envelope protein combinations to induce immune response |
| US11918644B2 (en) * | 2017-03-15 | 2024-03-05 | Modernatx, Inc. | Varicella zoster virus (VZV) vaccine |
| US20220409720A1 (en) * | 2017-03-15 | 2022-12-29 | Modernatx, Inc. | Varicella zoster virus (vzv) vaccine |
| US11389529B2 (en) * | 2017-07-13 | 2022-07-19 | City Of Hope | Expression system for expressing herpesvirus glycoprotein complexes |
| US11844833B2 (en) | 2017-07-13 | 2023-12-19 | City Of Hope | Expression system for expressing herpesvirus glycoprotein complexes |
| US11639329B2 (en) | 2017-08-16 | 2023-05-02 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
| US12527858B2 (en) | 2018-05-11 | 2026-01-20 | City Of Hope | MVA vectors for expressing multiple cytomegalovirus (CMV) antigens and use thereof |
| US12054736B2 (en) | 2018-05-11 | 2024-08-06 | City Of Hope | Genetically modified recombinant vaccinia ankara (RMVA) vaccines of improved stability and methods of preparation thereof |
| WO2020092387A1 (en) * | 2018-10-30 | 2020-05-07 | Nantbio, Inc. | Self replicating rna system |
| US12569553B2 (en) | 2020-03-09 | 2026-03-10 | Dynavax Technologies Corporation | Shingles vaccines comprising a TLR9 agonist |
| US12410121B2 (en) | 2020-07-16 | 2025-09-09 | Acuitas Therapeutics, Inc. | Cationic lipids for use in lipid nanoparticles |
| US12129223B2 (en) | 2021-12-16 | 2024-10-29 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11639370B2 (en) | Antigen delivery platforms | |
| AU2012322704B2 (en) | Recombinant self-replicating polycistronic RNA molecules | |
| AU2020318680B2 (en) | Therapeutic viral vaccine | |
| US10342862B2 (en) | RSV immunization regimen | |
| US20240091345A1 (en) | Therapeutic Viral Vaccine | |
| HK40085588A (en) | Antigen delivery platforms | |
| HK40084954A (en) | Antigen delivery platforms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: NOVARTIS AG, SWITZERLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NOVARTIS VACCINES AND DIAGNOSTICS INC;REEL/FRAME:039082/0682 Effective date: 20111011 Owner name: GLAXOSMITHKLINE BIOLOGICALS SA, BELGIUM Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NOVARTIS AG;REEL/FRAME:039082/0689 Effective date: 20160615 Owner name: NOVARTIS VACCINES AND DIAGNOSTICS, INC., CALIFORNI Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LILJA, ANDERS;LOOMIS, REBECCA;MASON, PETER;AND OTHERS;SIGNING DATES FROM 20110711 TO 20110929;REEL/FRAME:039082/0629 |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |