WO2020075986A2 - 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법 - Google Patents

알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법 Download PDF

Info

Publication number
WO2020075986A2
WO2020075986A2 PCT/KR2019/012326 KR2019012326W WO2020075986A2 WO 2020075986 A2 WO2020075986 A2 WO 2020075986A2 KR 2019012326 W KR2019012326 W KR 2019012326W WO 2020075986 A2 WO2020075986 A2 WO 2020075986A2
Authority
WO
WIPO (PCT)
Prior art keywords
gene
strain
seq
lactic acid
acid
Prior art date
Application number
PCT/KR2019/012326
Other languages
English (en)
French (fr)
Other versions
WO2020075986A3 (ko
Inventor
박재연
이태영
이기성
Original Assignee
에스케이이노베이션 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 에스케이이노베이션 주식회사 filed Critical 에스케이이노베이션 주식회사
Priority to CN201980065667.0A priority Critical patent/CN112789353B/zh
Priority to JP2021520201A priority patent/JP7530891B2/ja
Priority to US17/276,306 priority patent/US12084665B2/en
Priority to EP19872165.6A priority patent/EP3865577A4/en
Publication of WO2020075986A2 publication Critical patent/WO2020075986A2/ko
Publication of WO2020075986A3 publication Critical patent/WO2020075986A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C12N1/165—Yeast isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/56—Lactic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01001—Alcohol dehydrogenase (1.1.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01027—L-Lactate dehydrogenase (1.1.1.27)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01001—Pyruvate decarboxylase (4.1.1.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to a method for producing lactic acid using an acid-resistant yeast in which ethanol production is suppressed, more specifically, lactic acid production ability is imparted, conversion of pyruvate to acetaldehyde is suppressed, and as a result, acid resistance is suppressed. It relates to a method for producing yeast and lactic acid using the same.
  • PLA Polylacic Acid
  • PLA is a biodegradable polymer made by converting lactic acid into lactide and ring-opening and polymerizing it, and its raw material, lactic acid, is produced through fermentation.
  • PLA can be widely used in disposable food containers, and has the strength that can be used alone or in the form of a composition or copolymer as a variety of industrial plastics including the automobile industry.
  • it is a representative polymer that is also used in 3D printing in recent years. It is an eco-friendly polymer that generates less harmful gases and less odor when using 3D printers.
  • biodegradable polymers are promising polymers that can solve the reality that environmental destruction is accelerating with waste plastics and micro plastics, which have become global problems in recent years, and advanced countries are pushing for expansion, and in order to produce PLA at a lower cost, Efforts are being made to improve the productivity of the monomer lactic acid.
  • the traditional lactic acid production process is produced using lactic acid bacteria, and various types of Ca salts / Mg salts or neutralizing agents such as ammonia are used to prevent the growth of lactic acid produced by lactic acid bacteria or to stop the growth of bacteria.
  • pH a neutral pH of 6 to 8
  • fermentation proceeds.
  • microorganisms are separated.
  • sulfuric acid is added to convert lactate to lactic acid, and Ca salt is removed in the form of CaSO4. This process produces a larger amount of by-product CaSO4 than lactic acid and degrades process economy.
  • lactic acid has L- and D-type optical isomers. Even in the case of lactic acid bacteria mainly producing L-type, about 5 to 10% of D-type are often produced together, and in the case of strains mainly producing D-type, D and L-type and D and ethanol There are many groups of microorganisms that have many varieties, such as being in the form of producing (Ellen I. Garvie, Microbiological Reviews , 106-139, 1980).
  • D-form was mainly used for medical / drug delivery, but when applied to PLA, the crystallization rate by D-type lactide increased, and a phenomenon in which thermal properties were improved was found. Also, pure L-type polymer and pure water When stereocomplex PLA is structurally formed according to the processing conditions in which D-type polymer is mixed, the crystallinity caused by D-type is increased and the physical properties of the PLA are enhanced by increasing the heat resistance of existing PLA and PE / PP. Research and commercialization of methods are progressing rapidly and the field of application of PLA is expanding.
  • PLA is a process in which lactic acid is produced through fermentation and then converted to lactide through a purification process.
  • a process of converting lactic acid into a hydrogenated form is necessary, and since the pH for normal neutral fermentation is 6-7, it is converted to acidic pH using a large amount of sulfuric acid.
  • a large amount of neutral salts are generated, and the economic efficiency is lowered due to the low value of the neutral salts along with the process investment cost for removing these neutral salts.
  • acid-resistant yeast When lactic acid is produced using acid-grown yeast (hereinafter referred to as acid-resistant yeast), the fermentation process is simplified because it is not necessary to maintain the medium at a pH of 6 to 7 using a neutralizing agent during fermentation, and also removes a trailing neutralizing agent. No purification process is required. In addition, since yeast makes many components necessary for metabolism by itself, it can be cultured even in a medium having a relatively low nutritional level compared to bacteria, especially Lactobacillus, and thus a large number of post-purification processes can be omitted, thereby significantly reducing production cost.
  • acid-resistant yeast which can reduce the cost of the process, must be able to finish fermentation with a pH of the fermentation broth below pKa value without using a neutralizing agent or in a minimal amount, and the meaning of commercial application only when the three major indicators of fermentation achieve similar levels to lactic acid bacteria There is.
  • yeast when fermenting glucose, yeast metabolizes ethanol as a main product, and rarely produces lactic acid.
  • a yeast strain having excellent acid resistance was selected, and the selected strain was made to have lactic acid production capacity by genetic engineering method.
  • all ethanol-producing strains were selected.
  • the metabolic circuit of lactic acid production consists of a one-step reaction in pyruvate, which is generated by the lactate dehydrogenase enzyme and then released out of the cell by active / diffusion through transport.
  • pyruvate which is generated by the lactate dehydrogenase enzyme and then released out of the cell by active / diffusion through transport.
  • the yeast proceeds in a two-step reaction that converts from pyruvate to ethanol, and a method of removing the PDC gene converting pyruvate to acetaldehyde and introducing LDH has been attempted.
  • the present inventors tried to improve the ability of lactic acid production in acid-resistant yeast, and as a result of diligent efforts, the gene encoding lactate dehydrogenase was deleted while deleting the alcohol dehydrogenase enzyme from the acid-resistant yeast, thereby improving the ability to produce lactic acid.
  • a gene encoding pyruvate decarboxylase was deleted, a recombinant strain in which a gene encoding lactate dehydrogenase was additionally introduced was prepared, and lactic acid was prepared using the recombinant strain.
  • Another object of the present invention is to provide a method for producing lactic acid using the recombinant acid-resistant yeast.
  • Another object of the present invention is to provide a gene having pyruvate decarboxylase activity derived from the acid-resistant yeast.
  • the present invention is a gene encoding a pyruvate decarboxylase in the acid-resistant yeast YBC strain (KCTC13508BP) is deleted or weakened, and a lactate dehydrogenase-encoding gene is introduced. It provides a recombinant strain having the ability to produce.
  • the present invention also, (a) culturing the recombinant strain to produce lactic acid; And (b) obtaining the produced lactic acid.
  • the present invention also provides a gene encoding a protein having a pyruvate decarboxylase activity and having an amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4.
  • the present invention also provides a protein having an amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4, which has pyruvate decarboxylase activity.
  • the present invention also provides a captive motor of the g3002 gene having the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 6.
  • Figure 1 shows an example of a cassette (cassette) structure for removing the target gene from the YBC strain, (a) and (b) for the cassette to introduce LDH while removing the ORF of the target gene targeting g4423 It shows the case where two types of selection markers are used, and (c) shows an example of a cassette for removing the target gene.
  • Figure 2 shows the results of confirming the PDC activity of the recombinant strains ⁇ g460, ⁇ g3002-1, ⁇ g3002-2 and ⁇ g6004 strains in which the PDC gene candidate is knocked out from the YBC strain.
  • Figure 3 is a comparison of the growth, ethanol production yield, sugar consumption rate and ethanol productivity of the recombinant strains ⁇ g3002-1, ⁇ g3002-2 in which the PDC gene candidate is knocked out in the YBC strain.
  • Figure 4 shows the growth curve (A) and ethanol production capacity (B) of the recombinant strains ⁇ g460, ⁇ g3002-2 and ⁇ g6004 strains in which the PDC gene candidate is knocked out from the YBC strain.
  • Figure 5 shows the lactic acid production yield (A), ethanol production yield (B) and lactic acid productivity (C) of the recombinant strains YBC1, YBC2 and YBC3 under pH 3 Flask culture conditions.
  • Figure 6 shows the lactic acid production yield (A), ethanol production yield (B) and lactic acid productivity (C) of the recombinant strains YBC1, YBC2 and YBC3 under pH 4 Flask culture conditions.
  • Figure 7 shows the glucose consumption (A) and lactic acid production capacity (B) of the recombinant strains YBC1 and YBC2 in the fermenter.
  • Figure 8 shows the glucose consumption and lactic acid production capacity of the recombinant strain YBC2 after optimizing the culture conditions in the fermenter.
  • Acid-resistant yeast rapidly consumes sugar even at an acidic pH and exhibits a high growth rate, and has the characteristic of converting the consumed sugar to metabolites under fermentation conditions.
  • yeasts having these characteristics were selected through several yeast libraries, and the selected strains showed high growth and sugar consumption rate even under conditions of lactic acid concentration of 40 g / L to 80 g / L.
  • the selected strains were subjected to metabolic circuit regulation using genetic engineering.
  • a recombinant strain was prepared by additionally deleting the PDC gene and additionally introducing a gene encoding lactate dehydrogenase, thereby minimizing the toxicity of the intermediate product while minimizing the cytotoxicity of Cytosolic Acetyl-CoA
  • a strain was developed without further affecting the supply of ethanol, while further reducing the ethanol production capacity and further improving the milk production capacity.
  • the gene encoding pyruvate decarboxylase is deleted or weakened in the acid-resistant yeast YBC strain (KCTC13508BP), and the ability to generate lactic acid is introduced with a gene encoding lactate dehydrogenase. It relates to a recombinant strain having.
  • the gene encoding the pyruvate decarboxylase may be characterized as a g3002 gene.
  • the g3002 gene which is the gene having the greatest decrease in PDC activity when deleted in the YBC strain, was selected as the main PDC gene (main PDC gene).
  • the g3002 gene is a gene of a very unique structure in which ORFs exist in two different places in the genome of the YBC strain, a gene in the scaffold 27 position and the scaffold 72 position in the genome sequence. , And the ORFs before and after on the genome are different genes and are separate independent genes.
  • the two g3002 genes have a homology of 98.46% gene level to each other, and the promoter portion of the front end of the two genes has very different sequences, and it is estimated that expression is regulated by different mechanisms. It was estimated that one of the two genes would act as the primary PDC gene.
  • the g3002 gene (hereinafter referred to as g3002-1 gene) located at 72 scaffold of the YBC1 strain is removed, and the recombinant strain YBC2 introducing the LDH gene and the g3002 gene located at 27 scaffold again from the recombinant strain YBC2 (hereinafter g3002- 2) (referred to as gene 2), while removing the LDH gene to prepare a recombinant strain YBC3, and culturing the recombinant strains, it was confirmed that lactic acid and ethanol production capacity and lactic acid productivity is improved.
  • the g3002 gene may be characterized by being a gene at the scaffold 27 (g3002-2) position and the scaffold 72 (g3002-1) position on the genomic sequence of the YBC strain (KCTC13508BP), It can be characterized in that the g3002-1 gene at the scaffold 72 position is deleted or weakened.
  • the recombinant strain may be characterized in that only one or both of the g3002-1 gene at the scaffold 72 position and the g3002-2 gene at the scaffold 27 position is deleted.
  • the g3002-1 gene may be characterized in that it is a gene encoding the amino acid sequence represented by SEQ ID NO: 3, the g3002-2 gene is a gene encoding the amino acid sequence represented by SEQ ID NO: 4 It can be characterized by.
  • the gene encoding the lactate dehydrogenase may be introduced by substituting the g3002 gene and being regulated by the promoter of the g3002 gene.
  • the sequence of the promoter region of each of g3002-1 and g3002-2 is shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.
  • the gene encoding the lactate dehydrogenase is preferably L. helveticus- derived LDH gene, R. oryzae- derived LDH gene or L. plantarum- derived LDH gene, and more preferably L. plantarum- derived It is preferred that it is an LDH gene.
  • the recombinant strain may be characterized in that the gene encoding the alcohol dehydrogenase (ADH gene) is further deleted, and the gene encoding the alcohol dehydrogenase is the g4423 gene. It can be characterized as.
  • the recombinant strain may be characterized in that the LDH gene is additionally introduced in place of the ADH gene.
  • the ability to produce ethanol may be reduced compared to the YBC strain (KCTC13508BP), which is the parent strain, by deletion or attenuation of the g3002 gene.
  • the present invention in another aspect, (a) culturing the recombinant strain to produce lactic acid; And (b) obtaining the produced lactic acid.
  • the present invention relates to a gene encoding a protein having pyruvate decarboxylase activity and having 90% homology with the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.
  • the present invention relates to a gene encoding a protein having a pyruvate decarboxylase activity and having an amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4.
  • the gene may be characterized by having a nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.
  • the present invention relates to a protein having pyruvate decarboxylase activity and having an amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4.
  • the present invention relates to a captive motor of the g3002 gene having the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 6.
  • the term 'acid-resistant yeast' means that at a pH of less than the pKa value of the organic acid, when the medium contains 1M or more organic acid (particularly lactic acid), at least 10% bio It is defined as yeast that can maintain a mass consumption rate (such as sugar consumption rate) or a specific growth rate of at least 10%. More specifically, in the present invention, 'acid resistant yeast' is a yeast capable of maintaining a biomass consumption rate of at least 10% (such as sugar consumption rate) or a specific growth rate of at least 10% at pH 2 to 4, compared to a case of pH 5 or higher. define.
  • the recombinant yeast according to the present invention can be prepared by inserting the gene on the chromosome of the host yeast or introducing a vector containing the gene into the host yeast according to a conventional method.
  • the host yeast a host cell having high DNA introduction efficiency and high expression efficiency of the introduced DNA is commonly used, and in one embodiment of the present invention, acid-resistant yeast is used, but is not limited thereto, and the target DNA is sufficiently Any yeast that can be expressed may be used.
  • the recombinant yeast can be prepared according to any transformation method.
  • Transformation refers to a phenomenon in which DNA is introduced into a host to cause DNA to be cloned as a factor of a chromosome or by chromosomal integration, thereby introducing an external DNA into a cell and causing an artificial genetic change.
  • the conversion method includes an electroporation method, a lithium acetate-PEG method, and the like.
  • any commonly known genetic manipulation method can be used, and examples thereof include retrovirus vector, adenovirus vector, adeno-associated virus vector, and herpes simplex.
  • Rex virus vectors, poxvirus vectors, lentiviral vectors, and non-viral vectors are used.
  • Vector means a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host.
  • the vector can be a plasmid, phage particle, or simply a potential genomic insert.
  • the vector When transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Plasmids are currently the most commonly used form of vector, and linearized DNA is also the form commonly used for genomic integration of yeast.
  • Typical plasmid vectors include (a) a replication initiation point for efficient replication to include a plasmid vector per host cell, (b) an antibiotic resistance gene or a nutritional demand marker allowing selection of host cells transformed with the plasmid vector. It has a structure that includes a restriction enzyme cleavage site that allows insertion of a gene (auxotrophic marker gene) and (c) a foreign DNA fragment. Even if a suitable restriction enzyme cleavage site does not exist, a vector and foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or linker according to a conventional method (Gibson assembly) ), If necessary, a method of synthesizing and using the entire desired sequence is also commonly used.
  • the gene is "operably linked" when placed in a functional relationship with other nucleic acid sequences.
  • This can be a gene and regulatory sequence (s) linked in a manner that enables gene expression when an appropriate molecule (eg, a transcriptional activation protein) is coupled to the regulatory sequence (s).
  • DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence when it affects transcription of the sequence;
  • a ribosome binding site is operably linked to a coding sequence when it affects transcription of the sequence;
  • the ribosome binding site is operably linked to the coding sequence when arranged to facilitate translation.
  • operably linked means that the linked DNA sequences are in contact, and in the case of a secretory leader, they are in contact and are present in the reading frame. However, the enhancer does not need to be in contact. Linking these sequences is accomplished by ligation (linking) at convenient restriction enzyme sites. If such a site does not exist, a synthetic oligonucleotide adapter or linker according to a conventional method is used.
  • the carbon source may be characterized by at least one selected from the group consisting of glucose, xylose, arabinose, sucrose, fructose, cellulose, galactose, glucose oligomer, and glycerol, but is not limited thereto.
  • the culture may be performed in a condition that prevents microorganisms, such as E. coli, etc. from acting anymore (eg, impossible to produce metabolites).
  • the culture may be characterized in that the pH is 1.0 to 6.5, preferably pH 1.0 to 6.0, more preferably 2.6 to 4.0, but is not limited thereto.
  • Example 1 Confirming the expression rate of the gene encoding the pyruvate decarboxylase (PDC) in the YBC strain to identify the main expression gene
  • the present inventors have selected a group of strains having acid resistance through tests on various yeast strains (Korean Patent Publication No. 2017-0025315).
  • yeast fungus lactic acid was added to the medium at the beginning of the culture to check the growth and sugar consumption rate of microorganisms, and the strain having the best acid resistance was selected, and deposited as KCTC13508BP to the Korea Research Institute of Bioscience and Biotechnology Resource Center. have.
  • KCTC13508BP is a strain similar to S. cerevisiae , has a diploid gene (Diploid), and has Crab-tree positive characteristics.
  • G4136 Excluded as a gene attached to other PDC candidate genes.
  • G5237 is 250 bp, so it is not possible to make the proper size of PDC.
  • G460, g2550, g3002 and g6004 tentatively determined as primary PDC candidates.
  • the g3002 gene was the closest to PDC1 at the annotation and the similarity was compared based on this.
  • the g460 gene, the g3002 gene and the g6004 gene showed the highest similarity to the PDC1 gene of S. cerevisiae .
  • genetic manipulation was performed to delete the target gene from the genome of the YBC strain.
  • Example 2 Confirming the effect of lowering ethanol production by removing the target PDC gene from the YBC strain
  • a recombinant strain knocking out the target PCD gene of the YBC strain identified in Example 1 was prepared, and the effect of PDC gene removal on the growth of the strain was confirmed.
  • the ORF of each gene is removed and a gene cassette similar to Fig. 1 (c) with 5 'and 3' UTR and antibiotic markers is prepared to make Donor DNA It was used as.
  • the 5'-UTR and 3'-UTR of the g460 gene are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, and the 5'-UTR of the g3002 gene is shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the sequence of 3'-UTR is shown. It is shown in No. 9 and SEQ ID No. 10.
  • the 5'-UTR and 3'-UTR of the g6004 gene are shown in SEQ ID NO: 11 and SEQ ID NO: 12, respectively.
  • g460 ORF inside-fwd CCAGACAATTGGTTGATATCACC (SEQ ID NO: 13)
  • g6004 ORF inside-rev CATATCTTCGGACAGCTTAC (SEQ ID NO: 19)
  • PDC activity was measured using the obtained ⁇ g460, ⁇ g3002 and ⁇ g6004 strains. PDC activity of the target strain was measured based on a well-known literature method (TC Hoppner, HW Doelle, European Journal of Applied Microbiology and Biotechnology , 17: 152-157, 1983).
  • the solution required for activity measurement was prepared as follows.
  • TPP Thiamine pyrophosphate
  • Protein enzyme solution was prepared as follows.
  • yeast cells are recovered by centrifugation.
  • Vortexing was performed 5 times in total for 30 seconds, and the crushing solution was stored in ice for 1 minute between each vortexing to maintain a low temperature.
  • Solution 1 was prepared prior to the PDC assay and maintained at room temperature and mixed with the following composition.
  • PDC Activity Unit The definition of PDC Activity Unit is as follows.
  • PDC activity of 1 unit is defined as an enzyme activity capable of oxidizing 1 ⁇ mol of NADH in 1 minute.
  • the light path length is 0.6cm (96well plate, 0.2ml volume).
  • PDC activity is defined as Unit / mg protein, and is calculated by dividing the measured total protein concentration.
  • Unit / mg protein (Unit / ml enzyme) / (mg protein / ml enzyme)
  • the obtained ⁇ g3002-1 strain and ⁇ g3002-2 strain were cultured at 150 ml in YP medium having a glucose concentration of 40 g / L and cultured at 30 ° C. and 200 rpm.
  • the obtained ⁇ g460, ⁇ g3002-2 and ⁇ g6004 strains were cultured at 150 ml in YP medium with a glucose concentration of 40 g / L and cultured at 30 ° C. and 200 rpm.
  • the g3002 gene is the main PDC (main PDC) gene in the YBC strain by synthesizing the results of cultivation and enzyme activity analysis of the strain in which each gene is deleted, and in particular, it was confirmed that the g3002-1 gene plays the main role. .
  • Example 3 Production of lactic acid using recombinant strain in which PDC gene is removed and LDH is introduced
  • the g3002-1 gene is the main PDC gene, but when the lactate dehydrogenase gene (LDH gene) is introduced for lactic acid production, the expression intensity of LDH is derived from the promoter at the front of the gene. LDH gene was introduced while removing the ORF of the target gene, so the effect on LDH expression was confirmed.
  • LDH gene lactate dehydrogenase gene
  • the target strain was a strain (YBC1) that introduced the LDH gene while removing the primary alcohol dehydrogenase (ADH) gene in the existing wild type rather than the wild type strain.
  • Candidate genes of the LDH gene to be introduced into the YBC strain were selected through literature (N. Ishida et. Al., Appl. Environ. Micobiol ., 1964-1970, 2005; M. Sauer et al., Biotechnology and Genetic Engineering Reviews , 27: 1, 229-256, 2010). Finally, the LDH gene derived from L. plantarum represented by SEQ ID NO: 4 was selected and introduced.
  • the YBC1 strain is a strain that removes the main ADH gene g4423 gene of the YBC strain and introduces the LDH gene of SEQ ID NO: 28 derived from Lactobacillus plantarum at the position g4423, based on the information of g4423 and their UTR.
  • FIGS. 1 (a) and 1 (b) Gene cassettes of FIGS. 1 (a) and 1 (b) with the ORF of the gene removed and 5 ′ and 3 ′ UTR and antibiotic markers were prepared and used as Donor DNA.
  • the corresponding 5 'UTR for each allele of g4423 is shown in SEQ ID NO: 29 and SEQ ID NO: 30, and the 3' UTR is shown in SEQ ID NO: 31 and SEQ ID NO: 32.
  • cloning method using restriction enzyme, Gibson assembly, and method using gene synthesis were used for the production of donor DNA. After synthesizing and introducing LDH of SEQ ID NO: 28 into the ORF site of g4423, Donor DNA was prepared and introduced into YBC to produce recombinant strain YBC1.
  • the g3002 gene is a gene of a very unique structure in which two ORFs are present in the genome of the YBC strain, and in the genomic sequencing results, the gene is located at the scaffold 27 and scaffold 72 positions.
  • the two g3002 genes have a homology of 98.46% gene level to each other, but the promoter portion of the front end of the two genes has very different sequences, and it is estimated that the expression is regulated by different mechanisms. It was estimated that one of the two genes would act as the primary PDC gene.
  • inoculation OD was 0.5
  • medium was YP medium (20g / L Peptone, 10g / L Yeast extract) using Glucose 6%
  • Glucose 9% and CaCO3 3% were used for the recombinant strains having an inoculation OD value of 2 and a medium of YP medium (20 g / L Peptone, 10 g / L Yeast extract), and cultured at 30 ° C and 150 rpm with 100 ml of Flask culture. .
  • the notable fact in this example is for an increase in lactic acid yield compared to a decrease in ethanol yield.
  • the ethanol yield was reduced from 0.093 g / g to 0.075 g / g, 0.018 g / g.
  • the decrease in yields of other by-products such as glycerol and acetate was reflected as an increase in lactic acid yield.
  • g3002 confirmed a large increase in lactic acid production capacity (0.59 g / L-> 0.67 g / L without pH adjustment), and the expression of LDH with a decrease in PDC activity. It was found that there was an increase in yield and performance.
  • YBC1 strain is Hestrin and Schramme medium (Glucose 120g / L, Peptone 5g / L, Yeast extract 5g / L, citric acid 1.15 g / L, K2HPO4 2.7g / L, MgSO4 ⁇ 7H2O 1g / L), 1L volume
  • Glucose 120g / L Peptone 5g / L
  • Yeast extract 5g / L citric acid 1.15 g / L
  • K2HPO4 2.7g / L citric acid 1.15 g / L
  • K2HPO4 2.7g / L citric acid 1.15 g / L
  • K2HPO4 2.7g / L citric acid 1.15 g / L
  • K2HPO4 2.7g / L citric acid 1.15 g / L
  • K2HPO4 2.7g / L citric acid 1.15 g / L
  • the YBC2 strain was cultured in a 1 L volume using a Hestrin and Schramme medium at a sugar concentration of 120 g / L in a fermenter, the culture temperature was 30 ° C, and air was supplied at 0.1 vvm to 3.6% of CaCO3 and adjusted to pH 4 400 The rpm level was maintained.
  • the cultivation optimization was mainly carried out mainly on the condition change for the initial OD and oxygen supply rate, and the two best results were shown in FIG. 8.
  • the medium was cultured at a sugar concentration of 120 g / L in a fermenter in a 1 L volume in YP medium (20 g / L Peptone, 10 g / L Yeast extract) for the YBC2 strain.
  • Incubation temperature is 30 °C and supplying air at 0.025 ⁇ 0.05 vvm, dividing 3.6% of CaCO 3 into 3 times and adding it to fermentation time 5 hours, 13 hours and 23 hours, adjusted to pH 4 and maintaining the level of 300 ⁇ 400 rpm Did.
  • the medium was cultured at a sugar concentration of 120 g / L in a fermenter in a 1 L volume in YP medium (20 g / L Peptone, 10 g / L Yeast extract) for the YBC2 strain.
  • the incubation temperature was 30 ° C, and while supplying air at 0.05 vvm, 3.6% of CaCO3 was added to adjust the pH to 4 to maintain 400 rpm.
  • Recombinant acid-resistant yeast according to the present invention inhibits ethanol production, increases the pyruvate pool in cells, strongly expresses LDH enzyme, and can produce lactic acid with high yield.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 발명은 젖산 생성능이 부여되고, 피루베이트에서 아세트알데하이드로의 전환이 억제되어, 결과적으로 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법에 관한 것이다.

Description

알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
본 발명은 에탄올 생산이 억제된 내산성 효모를 이용한 젖산의 제조방법에 관한 것으로, 더욱 자세하게는 젖산 생성능이 부여되고, 피루베이트에서 아세트알데하이드로의 전환이 억제되어, 결과적으로 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법에 관한 것이다.
PLA(Polylacic Acid)는 젖산(lactic acid)을 락타이드(lactide)로 전환하고 이를 개환중합하여 만드는 생분해성 폴리머이며, 그 원료인 젖산은 발효를 통하여 생산하고 있다. PLA는 일회용 식품용기에 광범위하게 사용될 수 있으며, 단독 혹은 조성물이나 공중합체의 형태로 자동차 산업을 포함한 다양한 산업적 플라스틱으로도 사용이 가능한 강도를 갖고 있다. 또한 최근에는 3D 프린팅에서도 사용되는 대표적인 폴리머로 특히 3D 프린터 사용시 유해 가스 발생 및 냄새 발생이 적은 친환경 폴리머이다. 이러한 생분해성 폴리머는 최근 세계적인 문제가 되고 있는 폐 플라스틱 및 미세 플라스틱으로 환경파괴가 가속화되고 있는 현실을 해결할 수 있는 유망 폴리머로 선진 각국이 도입 확대를 추진 중에 있으며, PLA를 보다 저가로 생산하기 위하여, 단량체인 젖산의 생산성을 향상시키기 위한 노력이 진행되고 있다.
전통적인 젖산 생산 공정은 유산균을 이용하여 생산하며, 유산균에 의해 생성되는 젖산의 축적에 의하여, 산에 의한 균주 사멸 혹은 성장 멈춤을 방지하기 위하여 다양한 형태의 Ca염/Mg염이나 암모니아와 같은 중화제를 이용하여 pH를 중성 pH인 6~8 로 맞추면서 발효를 진행하게 된다. 발효가 종료되면 미생물을 분리하게 되며 염(salt) 형태로는 물에서의 분리 및 락타이드 전환이 어렵기 때문에 황산을 첨가하여 락테이트를 젖산으로 전환시키면서 Ca염은 CaSO4 형태로 제거하게 된다. 이와 같은 과정은 젖산보다도 많은 양의 부산물인 CaSO4가 발생하며, 공정 경제성을 떨어뜨리게 된다.
한편, 젖산은 L형과 D형의 광학 이성질체를 가지고 있다. L형을 주로 생산하는 유산균의 경우에도 약 5~10%의 D형을 같이 생산하는 경우가 많으며, D형을 주로 생산하는 균주의 경우 D형과 L형을 같이 생산하는 형태와 D형과 에탄올을 같이 생산하는 형태로 존재하는 등 많은 다양성을 갖고 있는 미생물 군이 있다(Ellen I. Garvie, Microbiological Reviews, 106-139, 1980).
이러한 광학이성질체 젖산 중 D형은 주로 의료용/약물전달용으로만 사용하였으나, PLA에 적용시 D형 락타이드에 의한 결정화율이 높아지면서 열적 특성이 좋아지는 현상이 발견되고, 또한 순수 L형 폴리머와 순수 D형 폴리머를 혼합한 가공조건에 따라 구조적으로 Stereocomplex PLA가 형성될 경우 내열성이 기존의 PLA는 물론 PE/PP 보다 높아지는 새로운 폴리머가 발견되는 등 D형에 의한 결정화도 증가 및 이를 통한 PLA 물성을 강화하는 방법에 대한 연구 및 상업화가 빠르게 진행되고 있으며 PLA의 적용 분야가 확장되고 있다.
PLA는 발효를 통하여 젖산을 생산한 후, 정제 공정을 거쳐 락타이드로 전환하는 공정이 일반적이다. 락타이드 전환을 위해서는 젖산을 Hydrogenated form으로 전환하는 공정이 필요하며, 일반적인 중성 발효에의 pH는 6~7이기에 다량의 황산을 이용하여 산성 pH로 전환하게 된다. 이 과정에서 다량의 중화염이 발생하게 되며 이러한 중화염을 제거하기 위한 공정 투자비와 함께 중화염의 낮은 가치로 인하여 경제성의 저하가 발생하게 된다.
한편, 자연계에서 젖산을 생산하는 Lactobacillus의 경우 상업적 수준으로 젖산 생산을 하기 위해서는 많은 양의 고가 영양분(nutrient)을 배지로 사용하여야 하며 이러한 과량의 nutrient 성분은 후단 공정의 중합(polymerization) 공정 혹은 락타이드를 중간체로 하는 경우에는 락타이드 전환 공정에 큰 저해를 주게 되어 고수율, 고순도의 폴리머 또는 그 전구체를 얻기 위해서는 흡착, 증류, 이온교환과 같은 정제 공정 비용이 필요하게 되어 역시 높은 생산 비용의 원인이 된다. 이러한 문제를 해결하기 위하여 제시된 방법으로 효모(Yeast)를 이용한 연구가 제시되었다. 효모의 경우 저가의 nutrient를 사용하여도 원활히 성장/발효를 진행하는 것으로 알려져 있으며 산성에서의 내성도 높은 것으로 알려져 있다.
산성에서 잘 자라는 효모(이하, 내산성 효모)를 이용하여 젖산을 생산할 경우, 발효 시 중화제를 이용하여 배지를 pH 6~7로 유지할 필요가 없기 때문에 발효 공정이 단순해 지고, 또한 후단 중화제를 제거하는 정제 공정이 필요 없어진다. 또한, 효모는 대사에 필요한 많은 성분을 스스로 만들기 때문에 세균 특히 락토바실러스에 대비하여 비교적 영양 수준이 낮은 배지에서도 배양이 가능하여, 많은 후단 정제 공정을 생략할 수 있어, 생산 단가를 크게 낮출 수 있다.
그러나 효모를 이용하는 젖산 생산 기술에 대하여 전제 조건이 있는데 그것은 상업화에 적용하기 위해서는 균주 발효 성능 지표인 수율, 생산성, 젖산의 농도가 유산균을 사용한 경우와 유사한 수준으로 높게 유지되어야 한다는 전제 조건이 있다.
효모를 사용한 내산성 젖산 기술 개발이 시도되고 있으나, 실제적으로는 발효에서 중화반응을 수반하여 pH를 젖산의 pKa value 이상인 3.7 이상으로 유지하여 발효를 해야만 고성능의 발효능을 보이는 경우가 많아서 실제적인 내산성 기술이라고 표현하기에는 어렵고 공정에서의 생산비 절감 효과를 보기도 어렵다(Michael Sauer et al., Biotechnology and Genetic Engineering Reviews, 27:229-256, 2010).
따라서 공정 비용의 절감할 수 있는 내산성 효모는 중화제를 사용하지 않거나 최소량으로 사용하면서 발효액의 pH가 pKa value 이하에서 발효를 마칠수 있어야 하며, 발효 3대 지표가 유산균과 유사한 수준을 달성해야만 상업적 적용의 의미가 있다.
일반적 효모는 글루코오스를 발효하면 에탄올을 주 생산물로 대사하며, 젖산을 생산하는 경우는 매우 드물다. 또한 높은 내산성을 갖고 있는 미생물에서 젖산을 생산하는 균주를 선택할 확률이 매우 낮기 때문에, 본 발명에서는 내산성이 우수한 효모 균주를 선별하고, 선별된 균주를 유전공학적인 방법으로 젖산 생산능을 갖도록 하였다. 또한 실제로 선정된 내산성 균주 library 에서는 모두 에탄올을 생산하는 균주가 선정이 되었다.
젖산의 생산 대사회로는 피루베이트에서 1단계 반응으로 이루어지며 이 단계는 락테이트 디하이드로게나아제 효소에 의하여 발생되며 이후 transport를 통하여 능동/확산으로 세포 밖으로 배출된다. 이러한 젖산을 주 생산물로 발효하기 위해서는 젖산 생산능을 도입함과 동시에 기존 에탄올 생산능을 제거하기 위한 조작도 수반되어야 한다. 일반적으로 효모에서는 피루베이트에서 에탄올로의 전환되는 2단계 반응으로 진행이 되며, 피루베이트에서 아세트알데하이드로 전환하는 PDC 유전자를 제거하고 LDH를 도입하는 방법이 시도되고 있다.
그러나 사카로마이세스 세레비지에와 같은 Crab-tree 양성 효모의 경우에는 PDC(pyruvate decarboxylase)를 완전히 차단할 경우 세포의 지질 합성에 필요한 Cytosolic 아세틸-CoA의 공급이 진행되지 않아 성장이 크게 저해가 되며, PDC를 완전 차단하지 않는다면 LDH와 피루베이트라는 동일 기질에 대한 경쟁으로 에탄올 생산을 완전히 차단할 수 없고, 따라서 수율을 유산균 수준으로 높일 수 없는 문제가 발생하게 된다.
이에, 본 발명자들은 내산성 효모에서 젖산 생산능을 향상시키고자, 예의 노력한 결과, 상기 내산성 효모에서 알코올 디하이드로게나제 효소를 결실하면서 락테이트 디하이드로게나아제를 코딩하는 유전자를 도입하여 젖산 생성능을 향상시킨 재조합 균주에서, 피루베이트 디카르복실라아제를 코딩하는 유전자를 결실시키고, 락테이트 디하이드로게나아제를 코딩하는 유전자를 추가로 도입한 재조합 균주를 제작하고, 상기 재조합 균주를 이용하여 젖산을 제조하는 경우, 젖산 생성능이 향상되고, 에탄올 생성능이 감소하는 것을 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 내산성 효모에서 젖산 생성능이 증가하면서 에탄올 생성능이 감소된 재조합 균주를 제공하는데 있다.
본 발명의 다른 목적은 상기 재조합 내산성 효모를 이용하여 젖산을 제조하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 내산성 효모 유래의 피루베이트 디카르복실라아제 활성을 가지는 유전자를 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 내산성 효모 YBC 균주(KCTC13508BP)에서 피루베이트 디카르복실라아제를 코딩하는 유전자가 결실 또는 약화되고, 락테이트 디하이드로게나아제를 코딩하는 유전자가 도입되어 있는 젖산 생성능을 가지는 재조합 균주를 제공한다.
본 발명은 또한, (a) 상기 재조합 균주를 배양하여 젖산을 생성시키는 단계; 및 (b) 상기 생성된 젖산을 수득하는 단계를 포함하는 젖산의 제조방법을 제공한다.
본 발명은 또한, 피루베이트 디카르복실라아제 활성을 가지고, 서열번호 3 또는 서열번호 4로 표시되는 아미노산 서열을 가지는 단백질을 코딩하는 유전자를 제공한다.
본 발명은 또한, 피루베이트 디카르복실라아제 활성을 가지고, 서열번호 3 또는 서열번호 4로 표시되는 아미노산 서열을 가지는 단백질을 제공한다.
본 발명은 또한, 서열번호 5 또는 서열번호 6으로 표시되는 염기서열을 가지는 g3002 유전자의 포로모터를 제공한다.
도 1은 YBC 균주에서 대상 유전자를 제거하기 위한 카세트(cassette) 구조에 대한 예를 나타낸 것으로, (a)와 (b)는 g4423을 대상으로 대상 유전자의 ORF를 제거하면서 LDH를 도입하는 카세트에 대하여 2종의 선택 마커를 사용하는 경우를 나타내며, (c)는 대상 유전자를 제거하기 위한 카세트의 일예를 나타낸 것이다.
도 2는 YBC 균주에서 PDC 유전자 후보가 넉아웃된 재조합 균주 Δg460, Δg3002-1, Δg3002-2 및 Δ g6004 균주의 PDC 활성을 확인한 결과를 나타낸 것이다.
도 3는 YBC 균주에서 PDC 유전자 후보가 넉아웃된 재조합 균주 Δg3002-1, Δg3002-2 균주의 성장, 에탄올 생산 수율, 당소모속도 및 에탄올 생산성을 비교한 것이다.
도 4는 YBC 균주에서 PDC 유전자 후보가 넉아웃된 재조합 균주 Δg460, Δg3002-2 및 Δg6004 균주의 성장 곡선(A) 및 에탄올 생산능(B)을 나타낸 것이다.
도 5는 pH 3 Flask 배양 조건에서 재조합 균주 YBC1, YBC2 및 YBC3의 젖산 생산 수율(A), 에탄올 생산수율(B) 및 젖산 생산성(C)을 나타낸 것이다.
도 6는 pH 4 Flask 배양 조건에서 재조합 균주 YBC1, YBC2 및 YBC3의 젖산 생산 수율(A), 에탄올 생산수율(B) 및 젖산 생산성(C)을 나타낸 것이다.
도 7는 발효기에서 재조합 균주 YBC1 및 YBC2의 글루코오스 소비량(A) 및 젖산 생산능(B)을 나타낸 것이다.
도 8은 발효기에서 배양 조건 최적화 후 재조합 균주 YBC2의 글루코오스 소비량 및 젖산 생산능을 나타낸 것이다.
발명의 상세한 설명 및 구체적인 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
내산성 효모는 산성 pH 에서도 당을 빠른 속도로 소모하며 높은 성장률을 나타내고 발효 조건에서는 소모한 당을 대사산물로 전환하는 특징을 가진다. 본 발명에서는 이러한 특징을 가지는 효모를 여러 효모 라이브러리를 통하여 선별하였으며, 선별된 균주들은 젖산 농도가 40g/L~80g/L인 조건에서도 높은 성장성 및 당소모속도를 보였다. 이러한 선별된 균주를 대상으로 하여 유전 공학을 이용한 대사 회로 조절을 실시하였다.
대사 회로 조절 방법에 대하여 전술한 바와 같이 지금까지 많은 연구자 들은 피루베이트에서 경쟁반응으로 진행되는 피루베이트 디카르복실라아제(pyruvatae decarboxylase) 효소를 제거하여 에탄올을 감소하는 연구를 진행하였으며 이에 대하여 Cargill, Toyota, 삼성 등 많은 선행 연구들이 발표된 바 있으나(US7534597, US7141410B2, US9353388B2, JP4692173B2, JP2001-204464A, JP4095889B2, KR1686900B1), PDC의 제거에 의한 에탄올 감소의 효과는 매우 직접적이고 효과가 크나, 효모의 경우 PDC를 완전 제거할 경우, 지방산 생성이 중단되어 세포의 성장이 저해되게 되며 일부의 PDC가 남아 있는 경우에는 에탄올 생성을 완전 차단할 수 없다. 따라서 본 발명자 들은 LDH를 강하게 발현하여 피루베이트로부터 락테이트로의 전환력을 높이면서 ADH를 결실하여 에탄올 생성능을 80% 차단한 균주를 개발하였다 (한국특허출원제2018-0044508호, 한국특허출원 제2018-0044509호). 여기에 중간 산물인 아세트 알데하이드의 축적을 방지하고자 추가적으로 PDC 유전자를 결실하고, 락테이트 디하이드로게나아제를 코딩하는 유전자를 추가로 도입한 재조합 균주를 제작하여, 중간산물 독성은 최소화하면서 Cytosolic 아세틸-CoA의 공급에는 영향이 없이, 에탄올 생성능을 더욱 감소시키면서 젖상 생산능은 더욱 향상시킨 균주를 개발하였다.
본 발명에서는 PDC의 경우 해당과정(glycolysis) 이후 에탄올 생성에서 ADH와 함께 중요한 역할을 하는 2개의 유전자 중 하나로 ADH만큼 강하게 발현되는 유전자이므로, PDC 유전자의 프로모터에 의해 조절되는 상기 재조합 균주에서 LDH가 강하게 발현될 것이고, 또한 PDC 활성의 감소로 인하여, 세포 내 피루베이트 pool이 증가되고, 이로 인해 젖산 생성이 증가되는 것을 확인하였다.
따라서, 본 발명은 일 관점에서, 내산성 효모 YBC 균주(KCTC13508BP)에서 피루베이트 디카르복실라아제를 코딩하는 유전자가 결실 또는 약화되고, 락테이트 디하이드로게나아제를 코딩하는 유전자가 도입되어 있는 젖산 생성능을 가지는 재조합 균주에 관한 것이다.
본 발명에 있어서, 상기 피루베이트 디카르복실라아제를 코딩하는 유전자는 g3002 유전자인 것을 특징으로 할 수 있다.
본 발명에서는 YBC 균주에서 존재하는 12개 PDC 유전자 후보 중에, YBC 균주에서 결실되었을 때, 가장 크게 PDC 활성이 감소하는 유전자인 g3002 유전자를 주 PDC 유전자(main PDC 유전자)로 선별하였다.
상기 g3002 유전자는 YBC 균주의 게놈에서 서로 다른 2군데에 ORF가 존재하는 매우 독특한 구조의 유전자로, 게놈 시퀀스 상에서, 스캐폴드 27(Scaffold 27)의 위치 및 스캐폴드 72(Scaffold 72) 위치에 있는 유전자이며, 게놈 상에서 전후의 ORF가 서로 다른 유전자로 별도의 독립적 유전자다. 상기 2군데의 g3002 유전자는 서로 98.46%의 유전자 수준의 상동성을 가지고 있으며, 2 군데 유전자의 전단부의 프로모터 부분은 서로 매우 다른 서열을 가지고 있어, 서로 다른 기작으로 발현이 조절되는 것으로 추정되며, 상기 두 군데의 유전자 중 하나의 유전자가 주 PDC 유전자로 작동할 것으로 추정되었다.
이렇게 매우 유사한 두 유전자가 존재하는 이유는 S. cerevisiae에서 알려진 PDC1과 PDC5간의 상호 보완 기작과 유사하게, 하나의 유전자가 소실되거나 작동되지 않을 때 이를 보상(compensation)하는 유전자로 작동하기 위한 진화의 결과일 가능성이 매우 높다. 본 발명에서 72 스캐폴드에 위치한 g3002 유전자를 제거한 경우, 에탄올 생산량 및 글루코오스 소비량과 성장 등 전반적인 표현형에도 영향을 미치는 것으로 나타났다.
본 발명의 일 양태에서는 YBC1 균주의 72scaffold에 위치한 g3002 유전자 (이하, g3002-1 유전자로 칭한다)를 제거하며 LDH 유전자를 도입한 재조합 균주 YBC2와 재조합 균주 YBC2에서 다시 27scaffold에 위치한 g3002 유전자 (이하 g3002-2 유전자로 칭한다) 를 제거하면서 LDH 유전자를 도입한 재조합 균주 YBC3를 제작하고, 상기 재조합 균주들을 배양하여, 젖산과 에탄올 생산능 및 젖산 생산성이 향상되는 것을 확인하였다.
본 발명에 있어서, 상기 g3002 유전자는 YBC 균주(KCTC13508BP)의 게놈 시퀀스 상 에서, 스캐폴드 27 (g3002-2) 위치 및 스캐폴드 72 (g3002-1) 위치에 있는 유전자인 것을 특징으로 할 수 있으며, 상기 scaffold 72 위치의 g3002-1 유전자가 결실 또는 약화되어 있는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 재조합 균주는 상기 스캐폴드 72 위치의 g3002-1 유전자 및 상기 스캐폴드 27 위치의 g3002-2 유전자 중 하나만 결실되거나 모두 결실되어 있는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 g3002-1 유전자는 서열번호 3으로 표시되는 아미노산 서열을 코딩하는 유전자인 것을 특징으로 할 수 있고, 상기 g3002-2 유전자는 서열번호 4로 표시되는 아미노산 서열을 코딩하는 유전자인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 락테이트 디하이드로게나아제를 코딩하는 유전자는 g3002 유전자와 치환하여 도입되어 g3002 유전자의 프로모터에 의하여 조절되는 것을 특징으로 할 수 있다. 각 g3002-1과 g3002-2의 프로모터 region 의 서열을 각각 서열번호 5 및 서열번호 6에 나타내었다.
본 발명에 있어서, 상기 락테이트 디하이드로게나아제를 코딩하는 유전자는 L. helveticus 유래 LDH 유전자, R. oryzae 유래 LDH 유전자 또는 L. plantarum 유래 LDH 유전자인 것이 바람직하며, 더욱 바람직하게는 L. plantarum 유래 LDH 유전자인 것이 바람직하다.
본 발명에 있어서, 상기 재조합 균주는 알코올 디하이드로게나아제를 코딩하는 유전자(ADH 유전자)가 추가로 결실되어 있는 것을 특징으로 할 수 있으며, 상기 알코올 디하이드로게나아제를 코딩하는 유전자는 g4423 유전자인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 재조합 균주는 상기 ADH 유전자를 대신하여 LDH 유전자가 추가적으로 도입되어 있는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 g3002 유전자의 결실 또는 약화에 의하여 모균주인 YBC 균주(KCTC13508BP) 보다 에탄올 생성능이 감소되는 것을 특징으로 할 수 있다.
따라서, 본 발명은 다른 관점에서, (a) 상기 재조합 균주를 배양하여 젖산을 생성시키는 단계; 및 (b) 상기 생성된 젖산을 수득하는 단계를 포함하는 젖산의 제조방법에 관한 것이다.
본 발명을 통하여 락테이트 생산이 크게 증가하고 에탄올 생산이 크게 감소한 우수한 내산성 균주를 확보할 수 있다.
또 다른 관점에서, 본 발명은 피루베이트 디카르복실라아제 활성을 가지는 단백질을 코딩하고, 서열번호 1 또는 서열번호 2로 표시되는 염기서열과 90%의 상동성을 가지는 유전자에 관한 것이다.
또 다른 관점에서, 본 발명은 피루베이트 디카르복실라아제 활성을 가지고, 서열번호 3 또는 서열번호 4로 표시되는 아미노산 서열을 가지는 단백질을 코딩하는 유전자에 관한 것이다.
본 발명에 있어서, 상기 유전자는 서열번호 1 또는 서열번호 2로 표시되는 염기서열을 가지는 것을 특징으로 할 수 있다.
또 다른 관점에서, 본 발명은 피루베이트 디카르복실라아제 활성을 가지고, 서열번호 3 또는 서열번호 4로 표시되는 아미노산 서열을 가지는 단백질에 관한 것이다.
또 다른 관점에서, 본 발명은 서열번호 5 또는 서열번호 6으로 표시되는 염기서열을 가지는 g3002 유전자의 포로모터에 관한 것이다.
본 발명에 있어서,'내산성 효모'란 유기산의 pKa 값 미만의 pH에서, 배지에 유기산이 함유되지 않은 경우에 비해, 배지에 1M 이상의 유기산(특히, 젖산)이 함유된 경우, 적어도 10%의 바이오매스 소모율 (당소모율 등) 또는 적어도 10%의 비생장률을 유지할 수 있는 효모로 정의한다. 보다 구체적으로, 본 발명에서,'내산성 효모'란 pH 5 이상인 경우에 비해, pH 2~4에서 적어도 10%의 바이오매스 소모율 (당소모율 등) 또는 적어도 10%의 비생장률을 유지할 수 있는 효모로 정의한다.
본 발명에 따른 재조합효모는 통상의 방법에 따라 상기 유전자를 숙주 효모의 염색체(chromosome) 상에 삽입시키거나, 상기 유전자를 포함하는 벡터를 숙주 효모에 도입시킴으로써 제조할 수 있다.
상기 숙주효모는 DNA의 도입효율이 높고, 도입된 DNA의 발현 효율이 높은 숙주세포가 통상적으로 사용되며, 본 발명의 일 실시예에서는 내산성 효모를 이용하였으나, 이에 한정되는 것은 아니고, 목적 DNA가 충분히 발현될 수 있는 것이라면 어떠한 종류의 효모라도 무방하다.
상기 재조합효모는 임의의 형질전환(transformation) 방법에 따라 제조할 수 있다. "형질전환"이란 DNA를 숙주로 도입하여 DNA가 염색체의 인자로서 또는 염색체 통합완성에 의해 복제가능하게 되는 것으로 외부의 DNA를 세포 내로 도입하여 인위적으로 유전적인 변화를 일으키는 현상을 의미하며, 일반적인 형질전환 방법에는 전기천공법(electroporation), 초산 리튬-PEG법 등이 있다.
또한, 본 발명에서 유전자를 숙주 미생물의 염색체 상에 삽입하는 방법으로는 통상적으로 알려진 임의의 유전자 조작방법을 사용할 수 있으며, 일 예로는 레트로바이러스벡터, 아데노바이러스벡터, 아데노-연관 바이러스벡터, 헤르페스심플렉스 바이러스벡터, 폭스바이러스벡터, 렌티바이러스벡터, 비바이러스성벡터 등을 이용하는 방법이 있다. "벡터"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자 또는 간단하게 잠재적 게놈 삽입물 일 수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이며 또한 Linearized DNA 또한 효모의 게놈 Integration을 위하여 통상적으로 사용하는 형태이다.
전형적인 플라스미드 벡터는 (a) 숙주세포당 플라스미드 벡터를 포함하도록 복제가 효율적으로 이루어지도록하는 복제 개시점, (b) 플라스미드 벡터로 형질전환된 숙주세포가 선발될 수 있도록 하는 항생제 내성 유전자 또는 영양 요구 마커 유전자 (auxotrophic marker gene) 및 (c) 외래 DNA 절편이 삽입될 수 있도록 하는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고뉴클레오타이드어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation) 할 수 있으며 (Gibson assembly), 필요에 따라서는 원하는 전체의 Sequence 를 합성하여 사용하는 방법도 통상적으로 이용되고 있다.
아울러, 상기 유전자는 다른 핵산 서열과 기능적 관계로 배치될 때 "작동가능하게 연결(operably linked)"된다. 이것은 적절한 분자(예를 들면, 전사 활성화 단백질)가 조절 서열(들)에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 조절 서열(들)일 수 있다. 예를 들면, 전서열(pre-sequence) 또는 분비리더(leader)에 대한 DNA는 폴리펩타이드의 분비에 참여하는 전단백질로서 발현되는 경우 폴리펩타이드에 대한 DNA에 작동가능하게 연결되고; 프로모터 또는 인핸서는 서열의 전사에 영향을 끼치는 경우 코딩서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 서열의 전사에 영향을 끼치는 경우 코딩 서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 번역을 용이하게 하도록 배치되는 경우 코딩 서열에 작동가능하게 연결된다.
일반적으로 "작동가능하게 연결된"은 연결된 DNA 서열이 접촉하고, 또한 분비 리더의 경우 접촉하고 리딩 프레임 내에 존재하는 것을 의미한다. 그러나, 인핸서(enhancer)는 접촉할 필요가 없다. 이들 서열의 연결은 편리한 제한 효소 부위에서 라이게이션 (연결)에 의해 수행된다. 그러한 부위가 존재하지 않는 경우, 통상의 방법에 따른 합성 올리고뉴클레오티드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용한다.
물론 모든 벡터가 본 발명의 DNA 서열을 발현하는데 모두 동등하게 기능을 발휘하지는 않고, 마찬가지로 모든 숙주가 동일한 발현 시스템에 대해 동일하게 기능을 발휘하지는 않는다. 그러나, 당업자라면 과도한 실험적 부담없이 본 발명의 범위를 벗어나지 않는 상태에서, 다른 여러 벡터, 발현 조절 서열 및 숙주 중에서 적절한 선택하여 적용할 수 있다. 예를 들어, 벡터를 선택함에 있어서는 숙주를 고려하여야 하는데, 이는 벡터가 그 안에 서 복제되어야만 하기 때문이고, 벡터의 복제 수, 복제 수를 조절할 수 있는 능력 및 당해 벡터에 의해 코딩되는 다른 단백질, 예를 들어 항생제 마커의 발현도 또한 고려되어야만 한다.
본 발명에 있어서, 탄소원은 글루코즈, 자일로즈, 아라비노즈, 수크로즈, 프룩토즈, 셀룰로오즈, 갈락토오스, 글루코즈 올리고머 및 글리세롤로 구성된 군에서 선택된 하나 이상인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 배양은 미생물 예를 들어 대장균 등이 더 이상 작용하지 못하도록 (예를 들어, 대사체 생산 불가능) 하는 조건에서 이루어질 수 있다. 예를 들어, 배양은 pH 1.0 내지 6.5, 바람직하게 pH 1.0 내지 6.0, 보다 바람직하게는 2.6 내지 4.0인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: YBC 균주에서 피루베이트 디카르복실레이즈(PDC)를 코딩하는 유전자의 발현율을 확인하여 주 발현 유전자 확인
본 발명자들은 다양한 효모 균주에 대한 테스트를 통하여 내산성을 갖는 균주 군을 선별한바 있다(대한민국 특허공개 제2017-0025315호). 상기 선별된 효모 균에 대하여 젖산을 배양 초기에 배지에 첨가하여 미생물의 성장 및 당소모 속도를 확인하면서 내산성이 가장 우수한 균주인 YBC 균주를 선정하고, 한국생명공학연구원 생물자원센터에 KCTC13508BP으로 기탁한바 있다.
계통분석을 통하여 YBC 균주(KCTC13508BP)는 S. cerevisiae와 유사한 균주이며 2배체의 유전자를 갖고 있고 (Diploid), Crab-tree positive 한 특성을 갖고 있다는 것을 확인하였다.
YBC 균주의 게놈에서 PDC로 어노테이션(annotation)되는 유전자는 복수개로 존재하며, 주요 유전자를 표 1에 나타내었다.
Figure PCTKR2019012326-appb-T000001
Genome Full sequencing Data에서 S. cerevisiae 및 Bioinformatics 정보를 이용하여 YBC 균주의 게놈에 존재하는 PDC 유전자 후보 12종을 선별하였으며, 이들을 아래와 같이 검토하여 주 PDC 후보를 선별하였다.
G2335 : PDC2 : PDC의 조효소 역할
G1574 : THI3 : 조절 단백질
G4072 : Phehylpyruvate Decarboxylase
G4136 : 다른 PDC 후보 유전자와 붙어 있는 유전자로 제외함.
G4822, g5809 및 g3917은 추가 게놈 시퀀싱에서 ORF에서 제외.
G5237은 250 bp 로 PDC 의 적정 사이즈를 만들 수 없어 제외함.
G460, g2550, g3002 및 g6004: 주 PDC 후보로 잠정 결정함.
상기 g3002 유전자가 아노테이션에서 PDC1에 가장 가깝게 나타나 이를 기준으로 유사성을 비교한 결과 표 2에 나타난 바와 같이, g460 유전자, g3002 유전자 및 g6004 유전자가 S. cerevisiae 의 PDC1 유전자와 유사성이 가장 높게 나타나 이를 우선 타겟으로 선정하여, 상기 타겟 유전자를 YBC 균주의 게놈에서 결실시키는 유전자 조작을 수행하였다.
Figure PCTKR2019012326-appb-T000002
Figure PCTKR2019012326-appb-T000003
실시예 2: YBC 균주에서 타겟 PDC 유전자를 제거하여 에탄올 생성 저하 효과 확인
실시예 1에서 확인된 YBC 균주의 타겟 PCD 유전자를 넉아웃시킨 재조합 균주를 제작하고, PDC 유전자 제거가 균주의 성장에 미치는 영향을 확인하였다.
g460 유전자, g3002 유전자 및 g6004 유전자 및 이들의 UTR의 정보를 바탕으로 하여 각 유전자의 ORF가 제거되고 5' 과 3' UTR 및 항생제 마커가 있는 도 1(c)와 유사한 유전자 카세트를 제작하여 Donor DNA로 사용하였다.
g460 유전자의 5'-UTR 및 3'-UTR을 각각 서열번호 7 및 서열번호 8에 나타내었으며, g3002 유전자의 5'-UTR을 서열번호 5 및 서열번호 6에 나타내었고, 3'-UTR을 서열번호 9 및 서열번호 10에 나타내었다. g6004 유전자의 5'-UTR 및 3'-UTR을 각각 서열번호 11 및 서열번호 12에 나타내었다.
Donor DNA의 제작에는 전술한 바와 같이 제한효소를 이용한 클로닝 방법과 Gibson assembly, 유전자 합성을 이용한 방법이 사용되었다. 제작된 Donor DNA를 도입하고 마커유전자에 대응하는 플레이트에서 자란 콜로니에 대하여 각 유전자가 제거된 것을 확인하기 위하여 아래와 같은 ORF용 프라이머를 이용하여 PCR 로 ORF가 제거된 것을 확인하고 Δg460, Δg3002 및 Δ g6004 균주를 수득하였다. 이때 사용한 프라이머에서 각 유전자의 ORF inside는 각 ORF의 내부의 서열을 이용하여 ORF의 존재 유무를 확인할 수 있으며, ORF outside는 각 유전자의 UTR 부분을 측정하여 결실(Deletion) 이후 크기의 변화를 통하여 ORF가 실제로 제거된 것을 확인할 수 있었다. 또한 해당 균주가 Diploidity를 갖고 있는 것을 고려하여 Allele variation 이 없는 곳은 2개의 Allele를 동시에 확인할 수 있으며 경우에 따라서는 Allele 별로 별도의 Primer를 제작하여 사용하였다.
g460 ORF inside - fwd: CCAGACAATTGGTTGATATCACC (서열번호 13)
g460 ORF inside(A1) - rev: GTAAAAAGGAACTTAGATGTCTCC(서열번호 14)
g460 ORF inside(A2) - rev: GTAAGAATGAACTTAGATGTCTCC(서열번호 15)
g460 ORF outside -fwd: TGAGGCAGAGTTCGAGAA(서열번호 16)
g460 ORF outside - rev : TAAAACACCCGCACACGA(서열번호 17)
g6004 ORF inside - fwd : CCAGGCAATTAGTTGATATCACT(서열번호 18)
g6004 ORF inside - rev : CATATCTTCGGACAGCTTAC(서열번호 19)
g6004 ORF outside - fwd : GTGCCCACATTAAAGTCT(서열번호 20)
g6004 ORF outside - rev : CCCGGTACACATTTCCTC (서열번호 21)
g3002 ORF inside - fwd : GAAGTCGAAGGTATGAGA(서열번호 22)
g3002 ORF inside- rev : ATAGAGAAGCTGGAACAG(서열번호 23)
g3002-1 ORF outside - fwd : GCAGGATATCAGTTGTTTG(서열번호 24)
g3002-1 ORF outside - rev : CAGAATCTTAGAAAGGAGG (서열번호 25)
g3002-2 ORF outside - fwd : ATGTTAAGCGACCTTTCG(서열번호 26)
g3002-2 ORF outside - rev : GTCGTGTCTAATGTTAGC (서열번호 27)
상기 수득된 Δg460, Δg3002 및 Δ g6004 균주를 이용하여 PDC 활성을 측정하였다. 대상 균주의 PDC활성은 잘 알려진 문헌상의 방법을 바탕으로 측정하였다(T. C. Hoppner, H. W. Doelle, European Journal of Applied Microbiology and Biotechnology, 17:152-157, 1983).
활성측정에 필요한 용액은 다음과 같이 준비하였다.
1. 200mM Tris-HCl 버퍼, 20% KOH용액으로 pH6.0으로 조정한다.
2. 15mM Thiamine pyrophosphate (TPP)용액을 제조하여 1ml씩 분주하여 -20℃ 냉동 보관한다.
3. 100mM MgCl2-dihydrates 용액을 제조하여 4℃ 냉장 보관한다.
4. 1.0M sodium pyruvate 용액을 제조하여 1ml씩 분주하여 -20℃ 냉동 보관한다.
5. 4.0mM β-nicotinamide adenine dinucleotidedisidium salt hydrate ~98% 용액을 제조하여 차광 용기에 1ml씩 분주하여 -20℃ 냉동 보관한다.
6. 200U/ml의 농도로 Alcohol dehydrogenase 용액을 제조하여 1ml 씩 분주하여 -20℃ 냉동 보관한다.
단백질 효소액은 다음과 같이 준비하였다.
1. 50mM Tris-HCl, pH6.5, Lysis buffer 용액을 제조하여 냉장 보관
1mM PMSF (100mM PMSF in isopropanol stock을 사용직전에 희석하여 사용) 투입
2. YPD 배지에서 효모균을 배양하여 exponential phase에 진입하였을 때, 원심 분리하여 효모균체를 회수.
3. 회수된 효모균체를 cold Lysis buffer로 세척하고 동일 용액에 재현탁
4. 효모 현탁액 5ml에 냉장 보관된 Acid washed glass beads 2.0g을 투입
5. 30초간 총 5회 vortexing 을 수행하였으며, 매 vortexing 사이에 파쇄액을 1분간 ice에 보관하여 저온을 유지
Glass beads가 제거된 파쇄액을 취하여 초고속원심분리(4℃ for 30min at 30,000g)를 통하여 cell debris를 제거하고 상등액을 효소액으로 사용하였다. 효소액 내의 총단백질 정량은 Bovine serum albumin 용액을 표준용액으로 하여 BCA법으로 정량 하였다. 투명 plat bottom 96 well plate에서 아래 표의 위에서 아래 방향순으로 시약을 투입하여 총 200μl 부피로 30℃에서 5분간 반응하여 15초 간격으로 340nm에서 흡광도 변화 추이를 관찰하였다.
Figure PCTKR2019012326-appb-T000004
용액 1(Solution 1)은 PDC assay 이전에 제조하여 상온으로 유지하며 아래의 조성으로 혼합하여 사용하였다.
Figure PCTKR2019012326-appb-T000005
PDC Activity Unit 의 정의는 다음과 같다.
1 unit의 PDC activity는 1분동안에 1μmol의 NADH를 산화시킬 수 있는 효소 활성으로 정의한다.
-dA/dt=[Rate]experimental-[Rate]blank
PDC(Unit/ml enzyme)={dA/dt x (Vtotal,ml)}/(6.22xVsample,ml)
본 분석의 경우 Light path length는 0.6cm (96well plate, 0.2ml 부피)이므로
PDC(Unit/ml enzyme) Activity = 5.36 x dA/dt로 계산된다.
또한, specific PDC activity는 Unit/mg protein으로 정의되며, 측정된 총단백질 농도를 나누어 구한다.
Unit/mg protein =(Unit/ml enzyme)/(mg protein/ ml enzyme)
이와 같은 PDC의 측정 결과, 도 2에 나타난 바와 같이, Δg3002-1 균주에서 PDC 활성이 가장 크게 감소하는 것으로 나타났으며, Δg3002-2 균주에서도 활성 이 감소하는 것으로 확인되었다.
상기 수득된 Δg3002-1 균주와 Δg3002-2 균주를 40g/L의 글루코오스 농도를 갖는 YP 배지에서 150ml 배양하였으며 30℃, 200rpm 에서 배양하였다.
그 결과, 도 3에서 나타난 바와 같이, 균주 성장에 있어서 Δg3002-2의 넉아웃 균주와 야생형 YBC 균주와의 사이에 약간의 성능 감소 정도만 보였고 큰 차이가 없었으나, 특이하게도 Δg3002-1의 균주는 성장속도와 Glucose 소비 속도 및 Ethanol 수율도 유의미하게 감소하는 것으로 나타나서 기존 S. cerevisiae에서 PDC1 이 제거가 되어도 PDC5에 의한 compensation 효과에 의하여 그 제거 효과가 phenotype 에서는 잘 나타나지 않는 것과는 다르게 Compensation 유전자에 의한 보완 작용이 적은 것으로 판단된다.
이와 대비하는 실험으로 상기 수득된 Δg460, Δg3002-2 및 Δ g6004 균주를 40g/L의 글루코오스 농도를 갖는 YP 배지에서 150ml 배양하였으며 30℃, 200rpm 에서 배양하였다.
그 결과, 도 4의 A에 나타난 바와 같이, 균주 성장에 있어서 각 PDC 넉아웃 균주와 야생형 YBC 균주와의 사이에 큰 차이가 없었으며, 에탄올 생산도 유의미한 차이가 발생하지는 않는 것을 알 수 있었다.
이와 같이 각 유전자가 결실된 균주의 배양 결과 및 효소 활성 분석결과를 종합하여 YBC 균주에서 g3002 유전자가 주 PDC(main PDC) 유전자인 것을 확인하고 특히 g3002-1유전자가 가장 주된 역할을 하는 것으로 확인되었다.
실시예 3: PDC 유전자가 제거되고 LDH가 도입된 재조합 균주를 이용한 젖산 생산
YBC 균주에서 g3002-1 유전자가 주 PDC 유전자인 것으로 확인되었으나, 젖산 생산을 위하여 락테이트 디하이드로게나아제 유전자(LDH 유전자)를 도입시키는 경우, LDH의 발현 강도는 유전자의 앞부분에 있는 프로모터로부터 유래하는 특성이므로 타겟 유전자의 ORF를 제거하면서 LDH 유전자를 도입하여, LDH 발현에 대한 영향을 확인하였다.
다만 이때는 타겟 유전자가 제거되는 동시에, LDH가 발현되기에, 이 유전자의 소실에 따른 영향이 같이 나타나서 LDH만의 단독 발현 효과로 판단하기는 어렵다.
대상 균주는 Wild type 균주가 아닌 기존의 Wild type 에 주 ADH(alcohol dehydrogenase) 유전자를 제거하면서 LDH 유전자를 도입한 균주 (YBC1) 를 대상으로 하였다.
YBC 균주에 도입할 LDH 유전자의 후보 유전자를 문헌을 통하여 선별하였으며 (N. Ishida et. al., Appl. Environ. Micobiol., 1964-1970, 2005; M. Sauer et al., Biotechnology and Genetic Engineering Reviews, 27:1, 229-256, 2010), 최종적으로 서열번호 4로 표시되는 L. plantarum 유래 LDH 유전자를 선택하여 도입하였다. 상기 YBC1 균주는 YBC 균주의 주 ADH 유전자인 g4423 유전자를 제거하고 상기 g4423 위치에 락토바실러스 플랜타룸 유래의 서열번호 28의 LDH 유전자를 도입한 균주로, g4423 및 이들의 UTR의 정보를 바탕으로 하여 각 유전자의 ORF가 제거되고 5' 과 3' UTR 및 항생제 마커가 있는 도 1(a) 및 1(b)의 유전자 카세트를 제작하여 Donor DNA로 사용하였다. g4423의 각 allele 에 대하여 상응하는 5' UTR은 서열번호 29 및 서열번호 30에 나타내었고, 3' UTR은 서열번호 31 및 서열번호 32에 나타내었다. Donor DNA의 제작에는 전술한 바와 같이 제한효소를 이용한 클로닝 방법과 Gibson assembly, 유전자 합성을 이용한 방법이 사용되었다. g4423의 ORF 자리에 서열번호 28의 LDH를 합성한 뒤 도입하여 Donor DNA를 제작하고 이를 YBC에 도입하여 재조합 균주 YBC1을 제작하였다.
아울러, g3002 유전자는 YBC 균주의 게놈에서 서로 다른 2군데에 ORF가 존재하는 매우 독특한 구조의 유전자로, 게놈 시퀀싱 결과에서, 스캐폴드 27 및 스캐폴드 72 위치에 있는 유전자이다. 상기 2군데의 g3002 유전자는 서로 98.46%의 유전자 수준의 상동성을 가지고 있지만, 2 군데 유전자의 전단부의 프로모터 부분은 서로 매우 다른 서열을 가지고 있어, 서로 다른 기작으로 발현이 조절되는 것으로 추정되며, 상기 두 군데의 유전자 중 하나의 유전자가 주 PDC 유전자로 작동할 것으로 추정되었다.
이렇게 매우 유사한 두 유전자가 존재하는 이유는 S. cerevisiae에서 알려진 PDC1과 PDC5간의 상호 보완 기작과 유사하게, 하나의 유전자가 소실되거나 작동되지 않을 때 이를 보상(compensation)하는 유전자로 작동하기 위한 진화의 결과일 가능성도 높기 때문에, YBC1 균주의 g3002-1 유전자 (스캐폴드 상 72 에 위치한 유전자) 를 제거하며 서열번호 4의 LDH 유전자를 도입한 재조합 균주 YBC2와 재조합 균주 YBC2에서 다시 g3002-2 (스캐폴드 상 27 에 위치한 유전자) 유전자를 제거하면서 LDH 유전자를 도입한 재조합 균주 YBC3를 제작하고, 상기 재조합 균주들을 배양하여, 젖산과 에탄올 생산능 및 젖산 생산성을 확인하였다.
특히 이러한 g3002 의 유전자의 치환을 확인하기 위하여 상기의 YBC1 의 g4423 유전자 (ADH)의 자리에 LDH를 도입하는 방법과 유사하게 g3002-1 및 g3002-2의 UTR을 이용하여 제작하였다. 단, 당해 유전자의 치환에서는 과정의 단순화를 위하여 allele variation을 고려하지 않고 하나의 allele를 대상으로 하여 Donor cassette를 제작하였으나, allele 별로 제작도 가능하다. 또한 유전자 치환에 사용하는 프라이머에 대해서도 상기의 결실균주 제작에 사용한 프라이머 이외에 다음과 같이 g3002-1 및 g3002-2의 UTR과 LDH를 같이 확인할 수 있는 프라이머쌍을 별도로 사용하여 유전자 치환 확인의 정확도를 높였다.
g3002-1 UTR-LDH-fwd : GCAGGATATCAGTTGTTTG(서열번호 33)
g3002-1 UTR-LDH-rev : AATACCTTGTTGAGCCATAG(서열번호 34)
g3002-2 UTR-LDH-fwd : ATGTTAAGCGACCTTTCG(서열번호 35)
g3002-2 UTR-LDH-rev : ACCATCACCAACCAAAACAA(서열번호 36)
상기 재조합 균주에 대하여 접종 OD는 0.5, 배지는 YP 배지(20g/L Peptone, 10g/L Yeast extract)에 Glucose 6%를 사용하여 100ml의 Flask culture로 30℃, 175 rpm 조건 4시간 배양 후 125rpm 조건에서 배양하였다.
그 결과, 도 5에 나타난 바와 같이, YBC1 균주에 비하여 g3002 유전자가 결실되고, LDH 유전자가 추가로 삽입된 YBC2 및 YBC3 균주에서 젖산 생성량이 증가되는 것을 확인하였으며, 에탄올 생성량은 YBC2 및 YBC3 균주가 YBC1 균주에 비하여 감소한 것을 확인하였다. 젖산의 생산성(productivity)은 YBC2 균주가 가장 높으나 균주간 큰 차이가 있지는 않은 것으로 확인되었다.
아울러, 부분 중화를 통하여 pH를 조정하였을 때의 성능 비교를 위하여 기존 젖산 발효에서 사용하는 CaCO3를 소량 첨가 하였다. 첨가량은 CaCO3를 글루코오스 투입량 대비 30% 수준에서 첨가를 하여 최종 pH가 4 수준이 되도록 조절하였으며 자세한 배양 조건은 다음과 같다. 상기 재조합 균주들은 접종 OD 값은 2, 배지는 YP 배지(20g/L Peptone, 10g/L Yeast extract)에 Glucose 9%, CaCO3 3%를 사용하였으며 100ml의 Flask culture로 30℃, 150 rpm 에서 배양하였다.
그 결과, 도 6에서 나타난 바와 같이, YBC1 균주에 비하여 g3002 유전자가 결실되고, LDH 유전자가 추가로 삽입된 YBC2 및 YBC3 균주에서 젖산 생성량이 pH 4 조건에서도 증가되는 것을 확인하였으며, 에탄올 생성량 또한 YBC2 및 YBC3 균주가 YBC1 균주에 비하여 현저하게 감소한 것을 확인하였다. 또한 접종 OD 및 부분 중화의 효과로 생산성(productivity)이 도 5의 결과 대비 도 6에서 증가를 하는 것을 확인할 수 있었다.
PDC의 경우 해당과정(glycolysis) 이후 에탄올 생성에서 ADH와 함께 중요한 역할을 하는 2개의 유전자 중 하나로 ADH 만큼 강하게 발현되는 유전자이므로, PDC 유전자의 프로모터에 의해 조절되는 YBC2 균주 및 YBC3 균주에서 LDH가 강하게 발현할 것으로 판단하였으며, 또한 PDC 활성의 감소로 인하여, 세포 내 피루베이트 pool이 증가되고, 이로 인해 젖산 생성이 증가되는 것으로 판단된다.
본 실시예에서 주목할 만한 사실은 에탄올 수율의 감소 대비 젖산 수율 증가에 대한 것이다. 도 5의 YBC1과 YBC2를 기준으로 볼 때 에탄올 수율은 0.093g/g에서 0.075g/g로 0.018g/g 감소하였다. 에탄올과 젖산의 분자량을 고려하면 이는 0.018*90/46=0.035의 젖산 수율 증가로 연결될 것으로 예상하여 0.62g/g 의 수율이 증가될 것으로 예상되었으나, 실제는 0.67g/g의 수율 증가가 있었으며 이는 글리세롤 및 아세테이트와 같은 다른 부산물들의 수율 감소가 젖산 수율 증가로 반영된 것으로 에탄올 생성 차단 이외에 젖산의 추가 발현에 따른 NADH Balance 회복과 이에 따른 글리세롤의 생산량 감소 및 젖산생산 플러스(Flux)의 강화로 인한 수율 증가로 인한 것으로 판단되며, g3002의 프로모터가 LDH 유전자를 잘 발현하고, 이로부터 LDH 효소가 강화되었음을 알 수 있다.
이를 기준으로 상기 도 5의 배양 결과를 판단할 때 g3002는 젖산 생성능에서 큰 수율 증가 (pH 조절 없이 0.59g/L -> 0.67 g/L)를 확인하여, PDC 활성의 감소와 함께 LDH의 발현으로 인한 수율 증가 및 성능 증가가 있었음을 알 수 있었다.
실시예 4: pH 4에서의 재조합 균주의 젖산 생성능 확인
산성 조건에서의 젖산 생성능을 확인하기 위하여, 배양액을 pH 4로 조절한 후, YBC1 균주와 YBC2 균주의 발효를 통한 젖산 생성능 향상을 확인하였다.
YBC1 균주는 Hestrin and Schramme 배지(Glucose 120g/L, Peptone 5g/L, Yeast extract 5g/L, citric acid 1.15 g/L, K2HPO4 2.7g/L, MgSO4ㅇ7H2O 1g/L)를 사용하여, 1L 부피로 발효기에서 120g/L의 당농도로 배양하였다. 배양 온도는 30℃ 이고 0.2 vvm으로 공기를 공급하면서 NaOH로 pH 4로 조절하였으며 350~450 rpm 수준을 유지하였다.
YBC2 균주는 Hestrin and Schramme 배지를 사용하여 1L 부피로 발효기에서 120g/L 의 당농도로 배양하였으며, 배양 온도는 30℃ 이고 0.1 vvm 으로 공기를 공급하면서 CaCO3를 3.6% 투입하여 pH 4로 조절하였으며 400 rpm 수준을 유지하였다.
그 결과, 도 7에 나타난 바와 같이 동일 조건에서 YBC1 균주와 비교하였을 때, YBC2 균주의 젖산 생성능이 크게 향상되는 것을 확인할 수 있었다.
실시예 5: YBC2 균주의 발효성능 최적화
YBC2 균주의 젖산 발효성능을 향상시키기 위하여, 배양조건 최적화를 수행하였다.
배양 최적화는 주로 초기 OD 및 산소 공급 속도에 대한 조건 변화를 위주로 실시를 하였으며 그 중 가장 성능이 좋았던 2개의 결과를 도 8 에 나타내었다.
도 8의 A 조건은 YBC2 균주에 대하여 배지는 YP 배지(20g/L Peptone, 10g/L Yeast extract)에 1L 부피로 발효기에서 120g/L의 당농도로 배양을 하였다. 배양 온도는 30℃ 이고 0.025~0.05 vvm 으로 공기를 공급하면서 CaCO3를 3.6%를 3회로 나누어 발효시간 5시간, 13시간 및 23시간에 투입하여, pH 4로 조절하였으며 300~400 rpm 수준을 유지하였다.
도 8의 B 조건은 YBC2 균주에 대하여 배지는 YP 배지(20g/L Peptone, 10g/L Yeast extract)에 1L 부피로 발효기에서 120g/L의 당농도로 배양을 하였다. 배양 온도는 30℃ 이고 0.05 vvm으로 공기를 공급하면서 CaCO3를 3.6%를 투입하여 pH 4로 조절하였으며 400 rpm 을 유지하였다.
그 결과, 도 8 및 표 4에 나타난 바와 같이, 도 8A의 조건에서 배양하였을 때 수율이 가장 높은 것을 확인하였으나 생산성 및 젖산 농도는 도 8B의 조건이 가장 좋은 것으로 확인되었다.
Figure PCTKR2019012326-appb-T000006
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시태양일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명에 따른 재조합 내산성 효모는 에탄올 생성을 억제하여, 세포 내 피루베이트 pool이 증가되고, LDH 효소를 강하게 발현하여, 젖산을 높은 수율로 생산할 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (12)

  1. 내산성 효모 YBC 균주(KCTC13508BP)에서 피루베이트 디카르복실라아제를 코딩하는 유전자가 결실 또는 약화되고, 락테이트 디하이드로게나아제를 코딩하는 유전자가 도입되어 있는 젖산 생성능을 가지는 재조합 균주.
  2. 제1항에 있어서, 상기 피루베이트 디카르복실라아제를 코딩하는 유전자는 g3002 유전자인 것을 특징으로 하는 재조합 균주.
  3. 제2항에 있어서, 상기 g3002 유전자는 서열번호 1 또는 서열번호 2의 염기서열을 가지는 것을 특징으로 하는 재조합 균주.
  4. 제1항에 있어서, 알코올 디하이드로게나아제를 코딩하는 유전자가 추가로 결실되어 있는 것을 특징으로 하는 재조합 균주.
  5. 제4항에 있어서, 상기 알코올 디하이드로게나아제를 코딩하는 유전자는 g4423 유전자인 것을 특징으로 하는 재조합 균주.
  6. 제1항에 있어서, 상기 락테이트 디하이드로게나아제를 코딩하는 유전자는 g3002 유전자와 치환하여 도입되어 g3002 유전자의 프로모터에 의하여 조절되는 것을 특징으로 하는 재조합 균주.
  7. 제1항에 있어서, 상기 g3002 유전자의 결실 또는 약화에 의하여 모균주인 YBC 균주(KCTC13508BP) 보다 에탄올 생성능이 감소되는 것을 특징으로 하는 재조합 균주.
  8. 다음을 단계를 포함하는 젖산의 제조방법;
    (a) 제1항 내지 제7항 중 어느 한 항의 재조합 균주를 배양하여 젖산을 생성시키는 단계; 및
    (b) 상기 생성된 젖산을 수득하는 단계.
  9. 피루베이트 디카르복실라아제 활성을 가지고, 서열번호 3 또는 서열번호 4로 표시되는 아미노산 서열을 가지는 단백질을 코딩하는 유전자.
  10. 제9항에 있어서, 서열번호 1 또는 서열번호 2로 표시되는 염기서열을 가지는 것을 특징으로 하는 유전자.
  11. 피루베이트 디카르복실라아제 활성을 가지고, 서열번호 3 또는 서열번호 4로 표시되는 아미노산 서열을 가지는 단백질.
  12. 서열번호 5 또는 서열번호 6으로 표시되는 염기서열을 가지는 g3002 유전자 프로모터.
PCT/KR2019/012326 2018-10-08 2019-09-23 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법 WO2020075986A2 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN201980065667.0A CN112789353B (zh) 2018-10-08 2019-09-23 抑制乙醇产生的重组耐酸酵母以及使用其制备乳酸的方法
JP2021520201A JP7530891B2 (ja) 2018-10-08 2019-09-23 アルコール生成が抑制された組換え耐酸性酵母及びこれを用いた乳酸の製造方法
US17/276,306 US12084665B2 (en) 2018-10-08 2019-09-23 Recombinant acid-resistant yeast in which alcohol production is inhibited and method for producing lactic acid by using same
EP19872165.6A EP3865577A4 (en) 2018-10-08 2019-09-23 RECOMBINANT ACID RESISTANT YEAST WITH INHIBITING ALCOHOL PRODUCTION AND PROCESS FOR THE MANUFACTURE OF LACTIC ACID USING THE SAME

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180119721A KR20200040017A (ko) 2018-10-08 2018-10-08 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
KR10-2018-0119721 2018-10-08

Publications (2)

Publication Number Publication Date
WO2020075986A2 true WO2020075986A2 (ko) 2020-04-16
WO2020075986A3 WO2020075986A3 (ko) 2020-05-28

Family

ID=70164968

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/012326 WO2020075986A2 (ko) 2018-10-08 2019-09-23 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법

Country Status (6)

Country Link
US (1) US12084665B2 (ko)
EP (1) EP3865577A4 (ko)
JP (1) JP7530891B2 (ko)
KR (1) KR20200040017A (ko)
CN (1) CN112789353B (ko)
WO (1) WO2020075986A2 (ko)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3929282A3 (en) * 2020-06-24 2022-03-16 SK Innovation Co., Ltd. Recombinant acid-resistant yeast having improved lactic-acid-producing ability
EP4008771A1 (en) * 2020-11-12 2022-06-08 SK Innovation Co., Ltd. Synthetic promoter based on gene from acid-resistant yeast
US11655478B2 (en) 2018-04-17 2023-05-23 Sk Innovation Co., Ltd. Promoter derived from organic acid-resistant yeast and method for expression of target gene by using same
US11680270B2 (en) 2019-10-08 2023-06-20 Sk Innovation Co., Ltd. Recombinant acid-resistant yeast with inhibited lactate metabolism and alcohol production and method of producing lactic acid using the same

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001204464A (ja) 2000-01-27 2001-07-31 Toyota Motor Corp 乳酸の製造方法
US7141410B2 (en) 2000-11-22 2006-11-28 Natureworks Llc Methods and materials for the production of organic products in cells of Candida species
JP4095889B2 (ja) 2002-12-13 2008-06-04 トヨタ自動車株式会社 高光学純度な乳酸の製造方法
US7534597B2 (en) 2002-05-30 2009-05-19 Cargill, Inc. Methods and materials for the production of L-lactic acid in yeast
JP4692173B2 (ja) 2005-09-13 2011-06-01 東レ株式会社 Ｄ−乳酸デヒドロゲナーゼ活性を有するポリペプチド、これをコードする遺伝子およびｄ−乳酸の製造方法
US9353388B2 (en) 2013-02-05 2016-05-31 Samsung Electronics Co., Ltd. Microorganism over-expressing lactic acid transporter gene and having inhibitory pathway of lactic acid degradation, and method of producing lactic acid using the microorganism
KR101686900B1 (ko) 2014-06-20 2016-12-16 한국생명공학연구원 신규한 피키아 쿠드리압즈비 ng7 균주 및 이의 용도
KR20170025315A (ko) 2014-08-29 2017-03-08 에스케이이노베이션 주식회사 3-hp를 생산할 수 있는 재조합 효모 및 이를 이용한 3-hp의 제조방법
KR20180044508A (ko) 2016-10-24 2018-05-03 (주) 한호기술 접이식 휠체어
KR20180044509A (ko) 2016-10-24 2018-05-03 와토스코리아 주식회사 앵글밸브

Family Cites Families (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT1294728B1 (it) 1997-09-12 1999-04-12 Biopolo S C A R L Ceppi di lievito per la riproduzione di acido lattico
JP4460876B2 (ja) 2003-11-07 2010-05-12 株式会社豊田中央研究所 有機酸存在下におけるプロモーター及びその利用
US20050112737A1 (en) 2003-11-20 2005-05-26 A. E. Staley Manufacturing Co. Lactic acid producing yeast
JP4700395B2 (ja) 2005-04-13 2011-06-15 株式会社豊田中央研究所 酸性条件下で使用するためのプロモーター及びその利用
EP1960516B1 (en) 2005-11-23 2012-12-26 Cargill, Incorporated Lactic acid-producing yeast cells having nonfunctional l-or d-lactate: ferricytochrome c oxidoreductase gene
CA2645361A1 (en) 2006-03-13 2007-09-20 Cargill Inc. Yeast cells having disrupted pathway from dihydroxyacetone phosphate to glycerol
EP2060632A1 (en) 2007-10-29 2009-05-20 Technische Universität Berlin Method of modifying a yeast cell for the production of ethanol
JP2010075171A (ja) * 2008-08-25 2010-04-08 Kirin Holdings Co Ltd キャンディダ・ユティリスによる高効率乳酸製造法
IN2012DN01521A (ko) * 2009-08-21 2015-06-05 Asahi Glass Co Ltd
WO2011038364A1 (en) 2009-09-27 2011-03-31 Opx Biotechnologies, Inc. Method for producing 3-hydroxypropionic acid and other products
JP2012061006A (ja) * 2011-12-22 2012-03-29 Toyota Motor Corp 耐酸性微生物を用いた有機酸及びアルコールの製造方法
WO2014003439A1 (ko) 2012-06-26 2014-01-03 한국생명공학연구원 에탄올 생산 경로가 봉쇄된 클루이베로마이세스 막시아누스 균주 및 이의 용도
KR102144998B1 (ko) 2013-08-30 2020-08-14 삼성전자주식회사 효모에 내산성을 부여하는 폴리펩티드, 그를 코딩하는 폴리뉴클레오티드, 그 양이 증가되어 있는 효모 세포, 상기 효모 세포를 이용한 산물의 생산 방법 및 내산성 효모 세포를 생산하는 방법
US9617569B2 (en) 2013-11-15 2017-04-11 Samsung Electronics Co., Ltd. Genetically engineered yeast cell producing lactate including acetaldehyde dehydrogenase, method of producing yeast cell, and method of producing lactate using the same
KR20150064802A (ko) 2013-12-03 2015-06-12 삼성전자주식회사 글리세롤-3-포스페이트 데히드로게나제가 불활성화되고 글리세르알데히드-3-포스페이트 데히드로게나제가 활성화된 효모 세포 및 그를 이용한 락테이트를 생산하는 방법
KR102163724B1 (ko) 2014-02-13 2020-10-08 삼성전자주식회사 내산성을 갖는 효모 세포 및 이의 용도
KR101577134B1 (ko) * 2014-05-09 2015-12-14 씨제이제일제당 (주) 젖산 생산이 향상된 미생물 및 이를 이용하여 젖산을 생산하는 방법
KR102277898B1 (ko) 2014-07-03 2021-07-15 삼성전자주식회사 산물 생산능이 향상된 효모 및 그를 이용한 산물을 생산하는 방법
KR20160012561A (ko) 2014-07-24 2016-02-03 삼성전자주식회사 Erg5의 활성이 증가되도록 유전적으로 조작된, 내산성을 갖는 효모 세포 및 그를 이용하여 락테이트를 생산하는 방법
KR102227975B1 (ko) 2014-07-24 2021-03-15 삼성전자주식회사 방사선 감수성 보완 키나아제의 활성이 증가되도록 유전적으로 조작된, 내산성을 갖는 효모 세포 및 그를 이용하여 락테이트를 생산하는 방법
EP3205721B1 (en) * 2014-10-10 2019-08-28 JMTC Enzyme Corporation Transformant and method for producing same, and method for producing lactic acid
KR102303832B1 (ko) 2015-05-12 2021-09-17 삼성전자주식회사 내산성을 갖는 효모 세포, 상기 효모 세포를 제조하는 방법 및 이의 용도
KR101704212B1 (ko) * 2015-06-12 2017-02-08 씨제이제일제당 (주) 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법
KR20170008151A (ko) 2015-07-13 2017-01-23 에스케이이노베이션 주식회사 메틸말로닐-CoA 리덕테이즈 코딩 유전자를 함유하는 미생물 변이체 및 이의 용도
KR101759673B1 (ko) 2015-12-28 2017-07-31 서울대학교산학협력단 생장 속도가 증대된 유전적으로 조작된 효모 세포 및 그를 사용하여 목적 물질을 생산하는 방법
KR101965364B1 (ko) 2016-08-03 2019-04-03 한국생명공학연구원 Upc2를 발현하는 재조합 균주 및 이의 용도
KR102140596B1 (ko) 2018-04-17 2020-08-04 에스케이이노베이션 주식회사 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법
KR102140597B1 (ko) 2018-04-17 2020-08-03 에스케이이노베이션 주식회사 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
KR20210041903A (ko) 2019-10-08 2021-04-16 에스케이이노베이션 주식회사 락테이트 대사 및 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
KR20210128742A (ko) 2020-04-17 2021-10-27 에스케이이노베이션 주식회사 글리세롤 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
KR20210158676A (ko) 2020-06-24 2021-12-31 에스케이이노베이션 주식회사 젖산 생산능이 증가된 재조합 내산성 효모

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001204464A (ja) 2000-01-27 2001-07-31 Toyota Motor Corp 乳酸の製造方法
US7141410B2 (en) 2000-11-22 2006-11-28 Natureworks Llc Methods and materials for the production of organic products in cells of Candida species
US7534597B2 (en) 2002-05-30 2009-05-19 Cargill, Inc. Methods and materials for the production of L-lactic acid in yeast
JP4095889B2 (ja) 2002-12-13 2008-06-04 トヨタ自動車株式会社 高光学純度な乳酸の製造方法
JP4692173B2 (ja) 2005-09-13 2011-06-01 東レ株式会社 Ｄ−乳酸デヒドロゲナーゼ活性を有するポリペプチド、これをコードする遺伝子およびｄ−乳酸の製造方法
US9353388B2 (en) 2013-02-05 2016-05-31 Samsung Electronics Co., Ltd. Microorganism over-expressing lactic acid transporter gene and having inhibitory pathway of lactic acid degradation, and method of producing lactic acid using the microorganism
KR101686900B1 (ko) 2014-06-20 2016-12-16 한국생명공학연구원 신규한 피키아 쿠드리압즈비 ng7 균주 및 이의 용도
KR20170025315A (ko) 2014-08-29 2017-03-08 에스케이이노베이션 주식회사 3-hp를 생산할 수 있는 재조합 효모 및 이를 이용한 3-hp의 제조방법
KR20180044508A (ko) 2016-10-24 2018-05-03 (주) 한호기술 접이식 휠체어
KR20180044509A (ko) 2016-10-24 2018-05-03 와토스코리아 주식회사 앵글밸브

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ELLEN I. GARVIE, MICROBIOLOGICAL REVIEWS, 1980, pages 106 - 139
MICHAEL SAUER ET AL., BIOTECHNOLOGY AND GENETIC ENGINEERING REVIEWS, vol. 27, no. 1, 2010, pages 229 - 256
N. ISHIDA, APPL. ENVIRON. MICOBIOL., 2005, pages 1964 - 1970
See also references of EP3865577A4
T. C. HOPPNERH. W. DOELLE, EUROPEAN JOURNAL OF APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 17, 1983, pages 152 - 157

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11655478B2 (en) 2018-04-17 2023-05-23 Sk Innovation Co., Ltd. Promoter derived from organic acid-resistant yeast and method for expression of target gene by using same
US11680270B2 (en) 2019-10-08 2023-06-20 Sk Innovation Co., Ltd. Recombinant acid-resistant yeast with inhibited lactate metabolism and alcohol production and method of producing lactic acid using the same
EP3929282A3 (en) * 2020-06-24 2022-03-16 SK Innovation Co., Ltd. Recombinant acid-resistant yeast having improved lactic-acid-producing ability
US11898173B2 (en) 2020-06-24 2024-02-13 Sk Innovation Co., Ltd. Recombinant acid-resistant yeast having improved lactic-acid-producing ability
EP4008771A1 (en) * 2020-11-12 2022-06-08 SK Innovation Co., Ltd. Synthetic promoter based on gene from acid-resistant yeast
US11788095B2 (en) 2020-11-12 2023-10-17 Sk Innovation Co., Ltd. Synthetic promoter based on gene from acid-resistant yeast

Also Published As

Publication number Publication date
CN112789353A (zh) 2021-05-11
WO2020075986A3 (ko) 2020-05-28
CN112789353B (zh) 2024-08-16
EP3865577A4 (en) 2022-08-17
KR20200040017A (ko) 2020-04-17
EP3865577A2 (en) 2021-08-18
JP7530891B2 (ja) 2024-08-08
US20220056459A1 (en) 2022-02-24
JP2022504813A (ja) 2022-01-13
US12084665B2 (en) 2024-09-10

Similar Documents

Publication Publication Date Title
WO2020075986A2 (ko) 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
WO2019203436A1 (ko) 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
WO2019203435A1 (ko) 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2013162274A1 (ko) 신규한 ｄ형 젖산 생산균주 및 그의 용도
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
WO2016024771A1 (ko) O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법
WO2013105802A2 (ko) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
US11680270B2 (en) Recombinant acid-resistant yeast with inhibited lactate metabolism and alcohol production and method of producing lactic acid using the same
US20210324346A1 (en) Recombinant acid-resistant yeast with suppressed glycerol production and method of producing lactic acid using the same
WO2016200207A1 (ko) 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법
WO2014003439A1 (ko) 에탄올 생산 경로가 봉쇄된 클루이베로마이세스 막시아누스 균주 및 이의 용도
WO2015170914A1 (ko) 젖산 생산이 향상된 미생물 및 이를 이용하여 젖산을 생산하는 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2010104224A1 (ko) 글리세롤 산화대사경로를 차단시킨 재조합 균주를 이용한 １、3-프로판디올의 제조방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022004953A1 (ko) 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법
WO2020116941A2 (ko) 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법
WO2020085556A1 (ko) 재조합 코리네박테리움 글루타미쿰 균주 및 이를 이용한 카다베린의 생산방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2015046978A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
WO2020180132A1 (ko) D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19872165

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2101001985

Country of ref document: TH

ENP Entry into the national phase

Ref document number: 2021520201

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019872165

Country of ref document: EP

Effective date: 20210510