WO2016200207A1 - 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법 - Google Patents

젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법 Download PDF

Info

Publication number
WO2016200207A1
WO2016200207A1 PCT/KR2016/006187 KR2016006187W WO2016200207A1 WO 2016200207 A1 WO2016200207 A1 WO 2016200207A1 KR 2016006187 W KR2016006187 W KR 2016006187W WO 2016200207 A1 WO2016200207 A1 WO 2016200207A1
Authority
WO
WIPO (PCT)
Prior art keywords
activity
microorganism
lactic acid
seq
enzyme
Prior art date
Application number
PCT/KR2016/006187
Other languages
English (en)
French (fr)
Inventor
김선혜
이태희
양영렬
양은빈
나경수
하철웅
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to AU2016277014A priority Critical patent/AU2016277014B2/en
Priority to BR112017026596-6A priority patent/BR112017026596B1/pt
Priority to PL16807847T priority patent/PL3309254T3/pl
Priority to CN201680034476.4A priority patent/CN108138193A/zh
Priority to EP16807847.5A priority patent/EP3309254B1/en
Priority to JP2017564351A priority patent/JP6892395B2/ja
Priority to MYPI2017001793A priority patent/MY193411A/en
Priority to US15/735,074 priority patent/US10227618B2/en
Priority to RU2017145858A priority patent/RU2711983C2/ru
Publication of WO2016200207A1 publication Critical patent/WO2016200207A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/56—Lactic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01002—Alcohol dehydrogenase (NADP+) (1.1.1.2), i.e. aldehyde reductase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01028—D-Lactate dehydrogenase (1.1.1.28)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01037—Malate dehydrogenase (1.1.1.37)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/03—Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/03008—ATP citrate synthase (2.3.3.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/0104—Pyruvate kinase (2.7.1.40)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01001—Pyruvate decarboxylase (4.1.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01032—Phosphoenolpyruvate carboxykinase (GTP) (4.1.1.32)

Definitions

  • the present invention relates to a Saccharomyces sp. Microorganism having lactic acid producing ability and a method for producing lactic acid using the same.
  • Lactic acid is widely used in industrial fields such as food, medicine, cosmetics, etc. Recently, the lactic acid is used as a monomer of polylactic acid, and its demand is greatly increased. Methods of producing lactic acid include conventional chemical synthesis and biological fermentation based on carbohydrates, and the latter method has recently been preferred.
  • yeast-based lactic acid producing microorganisms use lactate dehydrogenase (LDH) and pyruvate decarboxylase (PDC) competitively as pyruvate as a substrate.
  • LDH lactate dehydrogenase
  • PDC pyruvate decarboxylase
  • the present inventors have made intensive efforts to develop a method for maintaining smooth growth in lactic acid producing microorganisms and increasing both lactic acid production yield and yield, and thus, from the supply route of acetyl-CoA, and oxaloacetate (OAA)
  • the present invention was completed by confirming that lactic acid production was improved when the feeding route to pyruvate was enhanced.
  • One object of the present invention is to provide a Saccharomyces sp. Microorganism having lactic acid producing ability.
  • Another object of the present invention to provide a method for producing lactic acid using the microorganism.
  • the lactic acid producing strain in which the PDC activity of the present invention is inactivated, and the foreign ACL activity is introduced and mutated to enhance the pyruvate biosynthetic pathway, is compared to the existing strain through minimizing pyruvate escape and blocking of the lactic acid degradation pathway. Since lactic acid fermentation yield and productivity are excellent and growth of production strain is increased, it may be widely used to improve the productivity of various products using lactic acid as a raw material. The lactic acid produced through this can be provided as a raw material for various products.
  • PCK1 PEP carboxykinase, EC 4.1.1.49
  • PYK2 Pyruvate kinase, EC 2.7.1.40
  • Figure 2 is a pyruvate biosynthesis enhancing pathway using the enzyme enrichment of MDH2 (Malate dehydrogenase 2, EC 1.1.1.37) and cytosolic MAE1 (Malic enzyme 1, EC 1.1.1.38) enzymes present in yeast microorganisms, introducing the foreign ACL of the present invention, And MDH, a diagram illustrating a strategy for increasing lactic acid productivity through the cytosolic MAE pathway.
  • the activity of pyruvate decarboxylase is inactivated compared to the intrinsic activity, ATP-citrate lyase (ACL) ) Provides a microorganism of the genus Saccharomyces sp. With lactic acid production capacity, wherein activity is introduced and the pyruvate biosynthetic pathway is mutated to be enhanced relative to the intrinsic biosynthetic pathway.
  • Microorganisms of the genus Saccharomyces having the lactic acid production ability have increased lactic acid fermentation yield and / or sac, compared to strains in which ACL activity is not introduced and / or the pyruvate biosynthetic pathway is not mutated to be enhanced compared to the intrinsic biosynthetic pathway. It may be a microorganism with increased growth of bacteria of the genus Loyces (increased growth of producing microorganisms) and / or increased lactic acid production capacity.
  • lactic acid refers to an organic acid represented by C 2 H 4 OHCOOH.
  • the lactic acid is produced in the form of a racemic mixture containing 50% of D-lactic acid and L-lactic acid, and the composition ratio is not adjustable. It is a low amorphous polymer, so there are many limitations in developing the application.
  • a biological fermentation method using a microorganism can be selectively produced D- or L-type lactic acid according to the strain used or introduced lactate dehydrogenase (LDH).
  • LDH lactate dehydrogenase
  • microorganism having lactic acid producing ability is a microbial strain capable of producing lactic acid for the purposes of the present invention, means a strain capable of converting sugar to lactic acid, for example as a yeast microorganism, It does not limit as long as it contains a lactic acid production route and a production route of acetyl-CoA.
  • Yeast microorganisms are divided into “saccharomyces genus”, “pchia genus”, “candida genus” and “cycaromycoccus genus” by form, and specifically, the present invention includes various species if lactic acid can be produced. Can utilize microorganisms of the genus Saccharomyces.
  • my process is a microorganism of the genus Saccharomyces with the My process bar by Janus Saccharomyces (Saccharomyces bayanus), a saccharide My process bowl radio (Saccharomyces boulardii ), Saccharomyces bulderi), saccharose in my process Carioca Taunus (Saccharomyces cariocanus), a saccharide My process karioh carcass (Saccharomyces cariocus), in my process serenity busy as Saccharomyces (Saccharomyces cerevisiae ), Saccharomyces chevalieri), the seventh norbornene My process as Saccharomyces System (Saccharomyces dairenensis), saccharose in my process ellipsis Soy Ranges (Saccharomyces ellipsoideus), a saccharide My process yuba Janus (Saccharomyces eubayanus ), Saccharo
  • microorganism of the genus Saccharomyces having lactic acid producing ability of the present invention is inactivated pyruvate decarboxylase activity compared to endogenous activity, ATP-citric acid degrading enzyme activity is introduced, and pyruvate biosynthetic pathway is intrinsic biosynthesis Microorganisms, which are mutated to be enhanced relative to the pathway.
  • the microorganism of the genus Saccharomyces having the lactic acid production capacity is specifically, (i) the pyruvate decarboxylase is mutated so that the activity is inactivated compared to the intrinsic activity, and (ii) ATP-citric acid degrading enzyme is introduced.
  • the pyruvate biosynthetic pathway is mutated to be enhanced relative to the intrinsic biosynthetic pathway, as well as (iv) lactate dehydrogenase (LDH) activity is introduced; (v) the activity of alcohol dehydrogenase 1 is weakened or inactivated relative to intrinsic activity; (vi) the activity of pyruvate decarboxylase 1 is weakened or inactivated relative to intrinsic activity; And / or (vii) the microorganism, wherein the activity of D-lactate dehydrogenase 1 has been mutated to attenuate or inactivate relative to intrinsic activity.
  • LDH lactate dehydrogenase
  • the microorganism of the present invention is additionally (i) mutated such that the activity of alcohol dehydrogenase 1 (ADH1) is inactivated compared to the intrinsic activity; (ii) the activity of Pyruvate decarboxylase 1 (PDC1) is altered to inactivate relative to intrinsic activity; And (iii) the activity of D-lactate dehydrogenase 1 (DLD1) is mutated to inactivate relative to intrinsic activity.
  • ADH1 alcohol dehydrogenase 1
  • PDC1 Pyruvate decarboxylase 1
  • DLD1 D-lactate dehydrogenase 1
  • pyruvate decarboxylase may be used interchangeably with “pyruvate decarboxylase” and converts pyruvate to acetaldehyde and carbon dioxide (CO 2 ).
  • the enzyme is an enzyme that acts on the fermentation process occurring in yeast, in particular Saccharomyces genus, under anoxic conditions, and is an enzyme that produces ethanol by fermentation.
  • Microorganisms exist in three isozyme forms: PDC1, PDC5, and PDC6.
  • the protein and gene sequences can be obtained from a known database, and examples thereof include GenBank of NCBI, but are not limited thereto.
  • the enzyme may include a protein consisting of amino acids of SEQ ID NO: 39, PDC5 of SEQ ID NO: 41, and PDC6 of SEQ ID NO: 43, but include any restriction as long as the sequence has the activity of the enzyme.
  • the genes encoding the PDC1, PDC5 and PDC6 may be represented by the nucleotide sequence of SEQ ID NO: 40, 42, and 44, respectively, as a specific example, if the sequence capable of encoding the enzyme is included without limitation.
  • ATP-citrate lyase As used herein, the term "ATP-citrate lyase, ACL, EC 2.3.3.8) is an enzyme that converts citric acid to oxaloacetate (OAA) and acetyl-CoA, and is known to be present in higher organisms and in some yeasts (ATP-citrate lyase: A mini-review, Biochemical and Biophysical Research Communications 422 (2012) 1-2).
  • the reaction scheme is as follows.
  • Acetyl-CoA (acetyl-CoA) is an essential enzyme for the growth of strains, the importance of which has recently emerged in various documents.
  • a typical example is the use of non-natural pathways in the eukaryotic organisms producing 1,3-BDO (1,3-butanediol) to remove the cell substrate acetyl-CoA (Cotosol acetyl-coA).
  • 1,3-BDO 1,3-BDO (1,3-butanediol)
  • acetyl-CoA Cotosol acetyl-coA
  • the protein and gene sequences can be obtained from a known database, and examples thereof include GenBank of NCBI, but are not limited thereto.
  • the ATP-citric acid degrading enzyme may have an amino acid sequence of SEQ ID NO: 29, but a protein sequence having the enzymatic activity may be included without limitation.
  • the gene encoding the ACL may be represented by a nucleotide sequence of SEQ ID NO: 30 as a specific example, and any sequence capable of encoding the enzyme may be included without limitation.
  • pyruvate biosynthetic pathway is a biosynthetic pathway capable of supplying pyruvate in a microorganism of yeast, ie, Saccharomyces genus, and may be a supply route from OAA to pyruvate. Specific examples are as shown in FIGS. 1 and 2.
  • the enhancement of the pyruvate biosynthetic pathway may be achieved by enhancing the activity of Phosphoenolpyruvate carboxykinase 1 (PCK1) or pyruvate kinase 2 (PYK2) or both of the enzymes relative to the intrinsic activity. It may be carried out by changing as much as possible.
  • PCK1 Phosphoenolpyruvate carboxykinase 1
  • PYK2 pyruvate kinase 2
  • the enrichment of the pyruvate biosynthetic pathway is enhanced by the activity of malate dehydrogenase 2 (MDH2) or cell substrate malic enzyme 1 (cytosolic MAE1) or both of the enzymes compared to the intrinsic activity. It may be carried out by changing as much as possible.
  • MDH2 malate dehydrogenase 2
  • cytosolic MAE1 cell substrate malic enzyme 1
  • PCK1 Phosphoenolpyruvate carboxykinase 1
  • PCK1 is an enzyme required for gluconeogenesis that converts OAA to PEP in yeast microorganisms and is known as an enzyme that inhibits expression in the presence of glucose (Differential post-transcriptional regulation of yeast mRNAs in response to high and low glucose concentrations. Mol Microbiol 35 (3): 553-65 (2000)).
  • PYK2 Pyruvate kinase 2
  • PYK2 is the last stage of glycolysis that converts PEP to pyruvate in yeast microorganisms.
  • PYK2 is also known as an enzyme that inhibits expression in the presence of glucose (Characterization of a glucose-repressed pyruvate kinase ( Pyk2p) in Saccharomyces cerevisiae that is catalytically insensitive to fructose-1,6-bisphosphate, J Bacteriol. 1997 May; 179 (9): 2987-93).
  • the PCK1 may have an amino acid sequence of SEQ ID NO: 31, but a protein sequence having the enzyme activity may be included without limitation.
  • the gene encoding the PCK1 may be represented by a nucleotide sequence of SEQ ID NO: 32 as a specific example, if the sequence capable of encoding the enzyme is included without limitation.
  • the PYK2 may have an amino acid sequence of SEQ ID NO: 33, but a protein sequence having the enzyme activity may be included without limitation.
  • the gene encoding the PYK2 may be represented by a nucleotide sequence of SEQ ID NO: 34 as a specific example, but is included without limitation as long as the sequence capable of encoding the enzyme.
  • MDH2 (Malate dehydrogenase 2) refers to a reversible enzyme that converts OAA to malate.
  • the MDH2 is an enzyme originally located in the cytosol.
  • the term "Cytosolic Malic Enzyme 1" is an enzyme that is modified so that the mitochondrial targeting sequence in MAE1, which is an enzyme that replaces malate with pyruvate, is removed and placed in the cell substrate.
  • the MAE1 enzyme is a protein originally located in the mitochondria, and is an enzyme that replaces malate, an intermediate of the tricarboxylic acid, with pyruvate in the mitochondria (Metabolic Engineering, 6 (2004) 352-363).
  • Each protein and gene sequence can be obtained from a known database, and examples thereof include GenBank of NCBI, but are not limited thereto.
  • the MDH2 may have an amino acid sequence of SEQ ID NO: 35, but a protein sequence having the enzymatic activity may be included without limitation.
  • the gene encoding the MDH2 may be represented by a nucleotide sequence of SEQ ID NO: 36 as a specific example, and any sequence capable of encoding the enzyme may be included without limitation.
  • the MAE1 may have an amino acid sequence of SEQ ID NO: 37, but a protein sequence having the enzyme activity may be included without limitation.
  • MAE1 may be a sequence from which amino acids up to 30th of amino acids of SEQ ID NO: 37 have been removed (ie, a sequence from which the amino acid sequence of SEQ ID NO: 51, which is a mitochondrial target sequence, has been removed), so that MAE1 may be present in the cell substrate. Is indicated by SEQ ID NO: 52.
  • the gene encoding the MAE1 may be represented by a nucleotide sequence of SEQ ID NO: 38 as a specific example, and any sequence capable of encoding the enzyme is included without limitation.
  • LDH lactate dehydrogenase
  • the LDH may have an amino acid sequence of SEQ ID NO: 49, but a protein sequence having the enzyme activity may be included without limitation.
  • the gene encoding the LDH may be represented by a nucleotide sequence of SEQ ID NO: 50 as a specific example, and any sequence capable of encoding the enzyme is included without limitation.
  • Each of the enzymes in addition to the amino acid sequences described by SEQ ID NO: 70% or more, specifically 80% or more, more specifically 90% or more, more specifically 95% or more, more specifically Is an amino acid sequence showing at least 98%, even more specifically, at least 99% homology, and may be included without limitation as long as the enzyme exhibits substantially the same or equivalent potency as each enzyme.
  • enzyme variants having amino acid sequences in which some sequences are deleted, modified, substituted or added are also included within the scope of the present invention.
  • each of the enzymes is 80% or more, specifically 90% or more, more specifically 95% or more, 98% or more with the sequence as well as the nucleotide sequence described in the sequence numbers As described above, more specifically, any base sequence having 99% or more homology may be included without limitation as long as it is a gene sequence encoding an enzyme having substantially the same or equivalent potency as each of the above enzymes. In addition, as long as the base sequence having such homology, it is obvious that the base sequence in which some sequences are deleted, modified, substituted or added is also included in the scope of the present invention.
  • homology refers to the percent identity between two polynucleotide or polypeptide moieties. Homology between sequences from one moiety to another may be determined by known techniques. For example, homology may be sequence information between two polynucleotide molecules or two polypeptide molecules, such as score, identity, and similarity, using a computer program that aligns the sequence information and is readily available. Parameters can be determined by direct alignment (eg BLAST 2.0). In addition, homology between polynucleotides can be determined by hybridization of polynucleotides under conditions of stable double-stranding between homologous regions, followed by digestion with single-strand-specific nucleases to determine the size of the digested fragments.
  • intrinsic activity refers to the active state of an enzyme that a microorganism possesses in its natural state or before modification of the enzyme.
  • the "mutated enzyme activity to be inactivated compared to the intrinsic activity" is that the expression of the gene encoding the enzyme is not at all or even if the expression is not expressed or reduced compared to the native strain or strain before modification Means that.
  • the decrease is due to mutation of the gene encoding the enzyme, such that the activity of the enzyme itself is reduced compared to the activity of the enzyme originally possessed by the microorganism, and the inhibition of expression or translation of the gene encoding the same in the cell. If the overall degree of enzymatic activity is low compared to the native strain or the strain before modification, the concept also includes a combination thereof.
  • Inactivation of such enzyme activity can be accomplished by the application of various methods well known in the art.
  • Examples of the method include a method of replacing a gene encoding the enzyme on a chromosome with a mutated gene such that the activity of the enzyme is reduced, including when the activity of the enzyme is removed; Introducing a mutation into an expression control sequence of a gene on a chromosome encoding said enzyme; Replacing the expression control sequence of the gene encoding the enzyme with a sequence having weak or no activity; Deleting all or part of a gene on a chromosome that encodes the enzyme; Introducing an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to a transcript of a gene on the chromosome to inhibit translation from the mRNA to an enzyme; The method of artificially adding a sequence complementary to the SD sequence in front of the SD sequence of the gene encoding the enzyme to form a secondary structure to make the attachment of ribosomes impossible and
  • the method of deleting part or all of a gene encoding an enzyme replaces a polynucleotide encoding an endogenous target protein in a chromosome with a polynucleotide or marker gene in which a part of a nucleic acid sequence is deleted through a chromosome insertion vector in a strain.
  • This can be done by.
  • a method of deleting part or all of such genes a method of deleting genes by homologous recombination may be used.
  • part may vary depending on the type of polynucleotide, but may be specifically 1 to 300, specifically 1 to 100, and more specifically 1 to 50, but is not particularly limited thereto.
  • homologous recombination refers to genetic recombination occurring through linkage exchange at the locus of gene chains having homology with each other.
  • the method of modifying an expression control sequence is carried out by inducing a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, in the nucleic acid sequence of the expression control sequence, or by replacement with a weaker promoter. It may be carried out by a method such as.
  • the expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence that controls the termination of transcription and translation.
  • a method of modifying a gene sequence on a chromosome may be performed by inducing a mutation on the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to reduce the activity of the enzyme, or to have a weaker activity. This can be done by replacing with an improved gene sequence or an improved gene sequence such that there is no activity.
  • the term "activity is enhanced compared to endogenous activity” means that the microorganism modifies the cellular activity of the protein (or enzyme) by modifying it to enhance intracellular activity as compared to the state in which the protein retains its activity. It means to increase.
  • Such “strengthening” includes not only the enhanced activity of the protein (or enzyme) itself, leading to effects beyond its original function, but also an increase in the number of copies of the polynucleotide encoding the protein (or enzyme), the protein (or A method of introducing a mutation into a gene regulatory sequence on a chromosome encoding an enzyme), a method of replacing a regulatory sequence of a gene on a chromosome encoding the protein (or an enzyme) with an active sequence, the activity of the protein (or enzyme) This method replaces a gene encoding the protein (or enzyme) with a mutated gene to increase and introduces a mutation into a gene on the chromosome that encodes the protein (or enzyme) to enhance the activity of the protein (or enzyme).
  • Protein can be performed by any one or more methods selected from the group consisting of (Or enzyme) activity or may be enhanced compared to the endogenous activity, a known method for enhancing the activity of introduction include, without limitation.
  • introducing a protein (or enzyme) activity means that the microorganisms do not have a specific protein (or enzyme) activity, or that the protein does not have a specific protein (or enzyme) activity. After the microorganism is given its protein (or enzyme) activity, it is meant to increase the intracellular activity of the protein (or enzyme) by modifying it to further enhance its intracellular activity.
  • introducing protein (or enzyme) activity can be carried out by a variety of methods well known in the art, for example inserting a polynucleotide comprising a nucleotide sequence encoding the protein (or enzyme) into the chromosome. Or a method for increasing the copy number of the polynucleotide, introducing a promoter exhibiting improved activity upstream of the nucleotide sequence encoding the protein (or enzyme) by introducing the polynucleotide into a vector system and introducing the same into a microorganism.
  • a method of introducing the protein (or enzyme) mutated to a promoter, a method of introducing a variant of the nucleotide sequence encoding the protein (or enzyme) protein, or the like, may be used.
  • Known methods that can introduce activity include, without limitation.
  • the increase in the number of copies of the polynucleotide is not particularly limited thereto, but may be performed in a form operably linked to a vector or by insertion into a chromosome in a host cell.
  • a host capable of being cloned and functioning independently of a host, to which a polynucleotide encoding a protein of the present invention is operably linked may be performed by introducing into a host cell, or the host is operably linked to the polynucleotide.
  • a vector capable of inserting the polynucleotide into the chromosome in the cell may be introduced into the host cell to increase the copy number of the polynucleotide in the chromosome of the host cell.
  • the vector is a DNA preparation containing a nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable control sequence to allow expression of the target protein in a suitable host, wherein the control sequence is capable of initiating transcription.
  • Promoter any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation.
  • the yeast expression vector may be both an integrative yeast plasmid (YIp) and an extrachromosomal plasmid vector.
  • the extrachromosomal plasmid vector may include an episomal yeast plasmid (YEp), a replicative yeast plasmid (YRp), and a yeast centroider plasmid (YCp).
  • YACs Artificial yeast chromosomes
  • the available vectors are pESC-HIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAP ⁇ A, pGAP ⁇ B, pGAP ⁇ C, pPIC3 .5K, pPIC6 A, pPIC6 B, pPIC6 C, pPIC6 ⁇ A, pPIC6 ⁇ B, pPIC6 ⁇ C, pPIC9K, pYC2 / CT, pYD1 Yeast Display Vector, pYES2, pYES2 / CT, pYES2 / NT A, pYES2 / NT B, pYES2 / NT B NT C, pYES2 / CT, pYES2.1, pYES-DEST52, pTEF1
  • yeast vectors may be yeast replication plasmids that can be grown and selected in E. coli containing the origin of replication ori and an antibiotic resistance cassette.
  • the expression vector may comprise expression constructs of a promoter-gene-transcription sequence.
  • the promoters available in the expression construct may include TEF1 promoter, TEF2 promoter, GAL10 promoter, GAL1 promoter, ADH1 promoter, ADH2 promoter, PHO5 promoter, GAL1-10 promoter, TDH3 promoter ( GPD promoter), TDH2 promoter, TDH1 promoter, PGK1 promoter, PYK2 promoter, ENO1 promoter, ENO2 promoter and TPI1 promoter.
  • Transcription termination sequences available in the expression construct include, but are not limited to, ADH1 terminator, CYC1 terminator, GAL10 terminator, PGK1 terminator, PHO5 terminator, ENO1 terminator, ENO2 terminator, and TPI1 terminator.
  • a vector for inserting a chromosome in a host cell may replace a polynucleotide encoding an endogenous target protein in a chromosome with a mutated polynucleotide.
  • polynucleotides encoding foreign target proteins to be introduced into the chromosome can be replaced with mutated polynucleotides. Insertion of the polynucleotide into the chromosome can be by any method known in the art, for example by homologous recombination.
  • the vector of the present invention may be inserted into a chromosome by causing homologous recombination
  • the vector may further include a selection marker for confirming whether the chromosome is inserted.
  • Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a polynucleotide of interest, and confer a selectable phenotype such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers can be used. In an environment in which a selective agent is treated, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.
  • transformation in the present invention means introducing a vector comprising a polynucleotide encoding a target protein into a host cell to allow the protein encoded by the polynucleotide to be expressed in the host cell.
  • Transformed polynucleotides include all of them, as long as they can be expressed in the host cell, whether they are inserted into or located outside the chromosome of the host cell.
  • the polynucleotide also includes DNA and RNA encoding the target protein.
  • the polynucleotide may be introduced in any form as long as it can be expressed by being introduced into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self expression.
  • the expression cassette typically includes a promoter, transcription termination signal, ribosomal binding site and translation termination signal operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell.
  • operably linked means that the gene sequence and the promoter sequence for initiating and mediating the transcription of the polynucleotide encoding the protein of interest of the present invention.
  • Methods for transforming a vector of the present invention include any method for introducing nucleic acids into cells, and can be carried out by selecting appropriate standard techniques as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but is not limited thereto.
  • electroporation calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but is not limited thereto.
  • the host cell it is preferable to use a host having a high DNA introduction efficiency and a high expression efficiency of the introduced DNA.
  • a host having a high DNA introduction efficiency and a high expression efficiency of the introduced DNA.
  • it may be a microorganism of the genus Saccharomyces.
  • introducing a mutation in the expression control sequence to increase the expression of the polynucleotide is not particularly limited, but deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence to further enhance the activity of the expression control sequence or Combinations of these may be performed by inducing variations in the sequence or by replacing with nucleic acid sequences having stronger activity.
  • the expression control sequences include, but are not limited to, promoters, operator sequences, sequences encoding ribosomal binding sites, sequences that control the termination of transcription and translation, and the like.
  • a strong heterologous promoter can be linked in place of the original promoter.
  • Introduction or enrichment of such protein activity is generally at least 10%, 25%, 50%, 75%, 100, where the activity or concentration of the corresponding protein is based on activity or concentration in the wild type protein or the initial microbial strain. %, 150%, 200%, 300%, 400% or 500%, up to 1000% or 2000% may be increased.
  • the present invention provides a method of incorporating (i) the activity of the novel pyruvate decarboxylase as compared to endogenous activity, introducing ATP-citric acid degrading enzyme activity, and introducing the pyruvate biosynthetic pathway into endogenous biosynthesis.
  • a method of incorporating i) the activity of the novel pyruvate decarboxylase as compared to endogenous activity, introducing ATP-citric acid degrading enzyme activity, and introducing the pyruvate biosynthetic pathway into endogenous biosynthesis.
  • Saccharomyces sp. Microorganisms having the lactic acid producing ability are as described above.
  • culture in the present invention means to grow microorganisms under environmental conditions that are appropriately artificially controlled.
  • Microorganisms can be performed using a method well known in the art. Specifically, the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto.
  • the medium and other culture conditions used for the culture of the microorganism of the present invention can be used without any particular limitation as long as it is a medium used for the culture of the microorganism of the genus Saccharomyces, specifically, the microorganism of the present invention may be a suitable carbon source, It can be cultured under aerobic conditions by adjusting the temperature, pH, etc. in a conventional medium containing a nitrogen source, a person, an inorganic compound, amino acids and / or vitamins and the like.
  • carbon sources examples may include sucrose or glucose, molasses containing a large amount of sucrose may also be used as the carbon source, and other suitable amounts of carbon sources may be used in various ways.
  • nitrogen sources may include organic nitrogen sources and urea such as peptone, yeast extract, gravy, malt extract, corn steep liquor, and soybean wheat, inorganic nitrogen sources such as ammonium sulfate, ammonium chloride, ammonium phosphate, anmonium carbonate, and ammonium nitrate have. These nitrogen sources may be used alone or in combination.
  • the medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate and the corresponding sodium-containing salts as personnel. It may also include metal salts such as magnesium sulfate or iron sulfate.
  • amino acids, vitamins and appropriate precursors may be included. These media or precursors may be added batchwise or continuously to the culture.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture.
  • antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without injecting gas to maintain anaerobic and unaerobic conditions.
  • the temperature of the culture may be usually 20 °C to 40 °C, specifically 25 °C to 35 °C, more specifically 30 °C, it can be changed without limitation depending on the intended purpose.
  • the incubation period can be continued until the desired amount of useful substance is reached, specifically 10 to 100 hours, but is not limited thereto.
  • the method for producing lactic acid of the present invention may include recovering lactic acid from the medium or the microorganism according to the culture.
  • Methods for recovering lactic acid from microorganisms or media may include, but are not limited to, methods known in the art, such as centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC.
  • the recovery step may comprise a purification process.
  • Example 1 Preparation of lactic acid producing strain
  • alcohol dehydrogenase 1 ADH1
  • PDC1 pyruvate decarboxylase 1
  • DLD1 D-type lactic acid degradation Strains deficient in D-lactate dehydrogenase 1 (DLD1) were used as the underlying strains of the present invention for blocking the pathway.
  • DLD1 is not a factor that directly affects growth, but it is known as a major enzyme that converts pyruvate using NAD + as a dehydrogenase of D-lactic acid. Therefore, subsequent strains were prepared based on the strain lacking the DLD1 gene, an enzyme that consumes lactic acid, to compare the lactic acid fermentation productivity.
  • Genetic engineering of the present invention used a general molecular cloning method.
  • PCR used wild-type yeast genomic DNA as a template. PCR was performed using primers of SEQ ID NO: 1 and SEQ ID NO: 2 for ADH1 deletion, cloned into pWAL100 using BamHI, NcoI restriction enzyme, and PCR was performed using primers of SEQ ID NO: 3 and SEQ ID NO: 4 Then cloned into pWBR100 using BamHI, NcoI restriction enzyme. PCR was performed under conditions of 5 minutes of heat denaturation at 95 ° C., 1 minute of binding at 53 ° C., and 1 minute 30 seconds of polymerization at 72 ° C.
  • PCR was performed using primers SEQ ID NO: 5 and SEQ ID NO: 6 for PDC1 deletion, cloned into pWAL100 using BamHI, NcoI restriction enzymes, and PCR was performed using primers SEQ ID NO: 7 and SEQ ID NO: 8 Then cloned into pWBR100 using BamHI, NcoI restriction enzyme. PCR was carried out under conditions of 5 minutes of thermal denaturation at 95 ° C., 1 minute of binding at 53 ° C., and 1 minute 30 seconds of polymerization at 72 ° C.
  • the HIS3 marker gene was introduced into a double crossover for deletion of the gene of DLD1.
  • the DNA fragments used were obtained by PCR using genomic DNA of wild type yeast as a template and prepared using primers SEQ ID NO: 9 and SEQ ID NO: 10. PCR was performed under conditions of 5 minutes of heat denaturation at 95 ° C., 1 minute of binding at 53 ° C., and 1 minute 30 seconds of polymerization at 72 ° C.
  • the primers used for the genetic manipulation are summarized in Table 1 below.
  • ADH1 upstream forward primer (SEQ ID NO: 1) CGGGATCCACTGTAGCCCTAGACTTGATAGCC ADH1 upstream reverse primer (SEQ ID NO: 2) ATAAGAATGCGGCCGCTGTATATGAGATAGTTGATTGTATGCTT ADH1 downstream forward primer (SEQ ID NO: 3) GACTAGTGCGAATTTCTTATGATTTATGATTTTTATT ADH1 downstream reverse primer (SEQ ID NO: 4)
  • ACATGCCATGgAAGCATGCACGTATACACTTGAGTAA PDC1 upstream forward primer (SEQ ID NO: 5) CGGGATCCATTATGTATGCTCTTCTGACTTTTCGT PDC1 upstream reverse primer (SEQ ID NO: 6) ATAAGAATGCGGCCGCTTTGATTGATTTGACTGTGTTATTTTGC PDC1 downstream forward primer (SEQ ID NO: 7) CGGGATCCGCGATTTAATCTCTAATTATTAGTTAAAG
  • D-lactate dehydrogenase a gene for lactic acid production. Cloned into the p413TEF1 vector at the 5 'and 3' ends, respectively, to contain the ldhD gene from Lb. plantarum between the TEF1 promoter from S. cerevisiae and the CYC1 terminator, where a double cleavage of Sax / PvuII The insert was prepared. The vector was blunt end of Mungbean nuclease from DNA fragments double-cut with BamH / NotI at p- ⁇ -neo, and then treated with Sac to make a vector part with Sac stick end and BamH blunt end.
  • pTL573 vector was completed by ligating the vector and insert obtained by the above procedure. This completion vector was named pTL573.
  • pTL573 plasmid was identified as Lb. It contains the plantarum- derived ldhD gene and is designed to insert multiple copies at random into ⁇ -sequence, a region of the retrotransposable element of S. cerevisiae CEN.PK2-1D pdc1 adh1 dld1 strain.
  • plasmid pTL573 was digested with Sal restriction enzyme to construct a DNA fragment that induces a single crossover on ⁇ -sequence.
  • Example 1 In the CC02-0064 strain prepared in Example 1, which is a base strain, a strain lacking PDC5, a PDC isozyme, and a strain lacking both PDC5 and PDC6, were prepared to reduce or inactivate the titer of PDC.
  • pWAL100 and pWBR100 plasmids J. Microbiol. Biotechnol., (2006) 16 (6), 979-982 were used.
  • PCR was performed using primers of SEQ ID NO: 11 and SEQ ID NO: 12 for PDC5 deletion, cloned into pWAL100 using BamHI, NotI restriction enzyme, and PCR was performed using primers of SEQ ID NO: 13 and SEQ ID NO: 14 Then, cloned into pWBR100 using SpeI, NcoI restriction enzyme. PCR was performed under conditions of 5 minutes of heat denaturation at 95 ° C., 1 minute of binding at 53 ° C., and 1 minute 30 seconds of polymerization at 72 ° C.
  • PCR was performed using primers of SEQ ID NO: 15 and SEQ ID NO: 16 for PDC6 deletion, cloned into pWAL100 using BamHI, NcoI restriction enzyme, and PCR was performed using primers of SEQ ID NO: 17 and SEQ ID NO: 18. Then cloned into pWBR100 using BamHI, NcoI restriction enzyme. PCR was performed under conditions of 5 minutes of heat denaturation at 95 ° C., 1 minute of binding at 53 ° C., and 1 minute 30 seconds of polymerization at 72 ° C.
  • novel strains produced as described above were named CC02-0256 and CC02-0553, respectively, and the genetic traits of the novel strains are summarized in Table 3 below.
  • the medium used for the evaluation of the strain is SC (Synthetic Complex media), a restriction medium for yeast.
  • SC Synthetic Complex media
  • the amino acid dropout mix Sigma
  • Leucine was added at 380 mg / L, Uracil, Tryptophan and Histidine at 76 mg / L, and 8% glucose as carbon source and 1% CaCO 3 as neutralizer were added.
  • the medium thus prepared was used for yeast strain lactic acid fermentation evaluation.
  • Conditions for the evaluation of lactic acid fermentation ability of the strain was inoculated with 25 ml per flask of lactic acid fermentation evaluation medium inoculated with the yeast, incubated for 30 to 48 hours, and then analyzed by HPLC for the amount of lactic acid present in the fermentation broth. .
  • Example 4 based on PDC inactivation strain ACL (ATP-Citrate Lyase ), And PCK1 ( Phosphoenolpyruvate carboxykinase 1) and PYK2 ( Pyruvate kinase 2) Construction of Fortified Strains
  • Recombinant vectors were prepared to introduce foreign ACL enzymes and simultaneously overexpress one of the pyruvate biosynthetic pathways, PCK1 and PYK2.
  • Exotic ACL Mammals Mus A gene derived from musculus was used, and the gene was confirmed by NCBI (Accession no. NP_001186225).
  • amino acid sequence of SEQ ID NO: 29 (nucleotide sequence of SEQ ID NO: 30) was synthesized, and a vector was prepared using the GPD promoter based on the pRS415, which is a gene expression vector for yeast, and the vector having the gene inserted therein was p415GPDpro-ACL. Named this.
  • Recombinant vectors were constructed for simultaneous overexpression of PCK1 and PYK2 to enhance the pyruvate biosynthetic pathway.
  • PYK2 is a gene present in the yeast microorganism and may be represented by SEQ ID NO: 33.
  • SEQ ID NOs: 19 and 20 PCR was performed using S. cerevisiae genomic DNA as a template to obtain a PYK2 gene fragment.
  • PCR was performed under conditions of 5 minutes of heat denaturation at 95 ° C., 1 minute of binding at 53 ° C., and 1 minute 30 seconds of polymerization at 72 ° C.
  • the gene fragment was cloned using restriction enzymes SpeI and XhoI in a yeast expression vector derived from pRS416, and overexpressed using a TEF1 promoter.
  • the recombinant vector was named pRS416-TEF1pro-PYK2.
  • PCK1 may also be represented by SEQ ID NO: 31 as a gene present in the yeast microorganism.
  • S. cerevisiae using primers SEQ ID NOs: 23 and 24 PCR was performed using genomic DNA as a template to obtain a PCK1 gene fragment.
  • PCR was performed under conditions of 5 minutes of heat denaturation at 95 ° C., 1 minute of binding at 53 ° C., and 1 minute 30 seconds of polymerization at 72 ° C.
  • PCR was performed under the same conditions as those for obtaining PCK1 fragments using S. cerevisiae genomic DNA as a template with primers of SEQ ID NOs: 21 and 22 so that PCK1 could be expressed using the TEF2 promoter, and a TEF2 promoter fragment was obtained.
  • the pRS416-TEF1pro-PYK2 recombinant vector prepared above was cut with XhoI, and the TEF2 promoter fragment and PCK1 fragment obtained therefrom were obtained from Clontech. Cloning was performed using an In-Fusion cloning kit. Finally, one recombinant vector capable of overexpressing PCK1 and PYK2 with the TEF2 and TEF1 promoters, respectively, was named pRS416-TEF1pro-PYK2-TEF2pro-PCK1.
  • the primers used in the production of the PCK1 and PYK2 overexpression vectors of this example are summarized in Table 5 below.
  • Example 4 Based on the CC02-0553 strain prepared in Example 2, the introduction of the foreign ACL prepared in Example 4- (1), and transformation of the PCK1 / PYK2 co-overexpression vector produced in Example 4- (2) Inserted through.
  • Transformation was carried out using the CC02-0553 strain grown for 18 hours in YPD (1% yeast extract, 2% bacto-peptone, 2% glucose) medium with 0.1M Lithum Acetate, 0.01M Tris-HCl, 0.001M EDTA LiAc / TE buffer) was used, followed by heat treatment at 42 ° C. for 15 minutes with LiAc / TE buffer to which 40% PEG was added.
  • YPD 1% yeast extract, 2% bacto-peptone, 2% glucose
  • Lithum Acetate 0.01M Tris-HCl, 0.001M EDTA LiAc / TE buffer
  • the produced strains were named CC02-0652 and CC02-0765, respectively, and the genetic traits thereof are summarized in Table 6 below.
  • Example 5 PDC inactivation strain based ACL introduction , And PCK1 And PYK2 Fermentation Evaluation of Fortified Strains
  • Example 7 Evaluation of the ACL-PCK1-PYK2 enriched strain in the PDC titer inactivating strain prepared in Example 4- (3) was applied in the same manner as in Example 3 above to evaluate the lactic acid fermentation ability. The results of the experiment are summarized in Table 7 below.
  • the productivity of lactic acid fermentation can be further increased through the enhancement of pyruvate biosynthesis, through the acetyl-CoA production and pyruvate biosynthesis strategy of the new route of the present invention.
  • the lactic acid production method was confirmed to be a method of increasing lactic acid fermentation yield, enhancing the growth of producing microorganisms, and increasing lactic acid fermentation productivity.
  • CC02-0765 strain was deposited with the Korea Microorganism Conservation Center (KCCM), an international depository institution, under the Treaty of Budapest on November 28, 2014 and received accession number KCCM 11616P.
  • KCCM Korea Microorganism Conservation Center
  • Example 6 PDC inactivation strain based ACL Introduction, and MDH2 ( Malate dehydrogenase2) and cytosolic MAE1 ( Malic emzyme 1) Construction of Fortified Strains
  • Example 5 Through the results of Example 5, it was confirmed that the new route of acetyl-CoA production and pyruvate biosynthesis strategy through the introduction of foreign ACL is effective lactic acid fermentation yield increase, production microorganism growth and lactic acid fermentation productivity increase method, This study was also conducted to confirm whether such a result is found in enhancing pyruvate biosynthesis using genes.
  • OAAs generated by foreign ACL introduction can be biosynthesized into pyruvate using another pathway, overexpressing MDH2 located in the cytosol, and relocating MAE1, an enzyme located in the mitochondria, to the cytosol. To overexpress. For this purpose, a recombinant vector was produced.
  • MDH2 is a gene present in the yeast microorganism and may be represented by the amino acid sequence of SEQ ID 35.
  • MDH2 gene segments were obtained by PCR using S. cerevisiae genomic DNA as a template using primers SEQ ID NOs: 25 and 26. PCR was performed under conditions of 5 minutes of thermal denaturation at 95 ° C., 1 minute of binding at 53 ° C., and 1 minute of polymerization at 72 ° C.
  • the obtained MDH2 gene fragment was cloned based on the pRS414 vector using SpeI and XhoI restriction enzymes, and overexpressed using the TEF1 promoter.
  • the recombinant vector thus produced was named pRS414-TEF1pro-MDH2.
  • MAE1 is an enzyme originally located in the mitochondria in the yeast microorganism and may be represented by the amino acid sequence of SEQ ID NO: 37. To express MAE1 in the cytosol, it was cloned except for the mitochondrial target sequence (amino acid sequence of SEQ ID NO: 51) consisting of 90 base sequences from the start codon of the gene. S using the primers of SEQ ID NOs: 27 and 28 . cerevisiae PCR was performed using genomic DNA as a template, and the conditions were the same as 5 minutes for heat denaturation at 95 ° C, 1 minute for binding at 53 ° C, and 2 minutes for polymerization at 72 ° C.
  • the obtained PCR fragment was cloned based on the pRS416 vector using SpeI and XmaI restriction enzymes.
  • SEQ ID NO: 27 The preparation method of the primer was to be obtained from the 91 st nucleotide sequence to remove 90 nucleotide sequences from the MAE1 ORF start codon.
  • the cytosolic MAE1 was overexpressed using the TEF1 promoter.
  • the recombinant vector thus produced was named pRS416-TEF1pro-cytosolic MAE1.
  • the primers used to prepare pRS414-TEF1pro-MDH2 and pRS416-TEF1pro-cytosolic MAE1 recombinant vectors are summarized in Table 8 below.
  • Example 2 Based on the CC02-0553 strain prepared in Example 2, the foreign ACL introduction vector prepared in Example 4- (1) and the MDH2 overexpression vector and cytosolic MAE1 overexpression vector prepared in Example 6- (1) were transfected. Inserted via conversion. Transformation was performed using the method described in Example 4- (3) above.
  • the prepared strain was named CC02-0821, and the genetic traits thereof are summarized in Table 9 below.
  • the lactic acid fermentation capacity was evaluated by the method used in Example 2 to evaluate lactic acid productivity enhanced strain through ACL-MDH2-cytosolic MAE1 enhancement in the PDC inactivated strain prepared in Example 6.
  • Table 10 summarizes the results of the above experiment.
  • Example 8 PDC activity Reduced In strain ACL Introduction, and PCK1 And PYK2 Fortified strains And MDH2 And cytosolic MAE1 is Construction of Fortified Strains
  • Example 4 Based on the PDC activity reducing strain prepared in Example 2 CC02-0256, the recombinant vectors pRS415-GPDpro-ACL, pRS416-TEF1pro-PYK2-TEF2p-PCK1 prepared in Example 4 were carried out in Example 4- (3 ) And the prepared strains were named CC02-0819 and CC02-0820, respectively.
  • pRS414-TEF1pro-MDH2 and pRS416-TEF1pro-cytosolic MAE1 were inserted in the same manner as in Example 4- (3).
  • the produced strain was named CC02-0831. Its traits are summarized in Table 11 below.
  • ACL introduction based on CC02-0256 strain with reduced PDC activity, and pyruvate biosynthetic pathway-enhancing strains Strain name Genotype CC02-0819 CC02-0256 pRS415-GPDpro-ACL CC02-0820 CC02-0256 pRS415-GPDpro-ACL, pRS416-TEF1p-PYK2-TEF2p-PCK1 CC02-0831 CC02-0256 pRS415-GPDpro-ACL, pRS414-TEF1pro-MDH2, pRS416-TEF1 pro-cytosolic MAE1
  • Example 9 PDC activity Reduced In strain ACL Introduction, and PCK1 And PYK2 Fortified strains Fermentation evaluation
  • Example 8 The CC02-0819 and CC02-0820 strains prepared in Example 8 were evaluated for the lactic acid fermentation ability by the method used in Example 3 together with the control group CC02-0256. Table 12 summarizes the results of the experiment.
  • CC02-0256 did not significantly increase the productivity of foreign ACL introduction and pyruvate biosynthetic pathways as in CC02-0553, but also improved lactic acid fermentation yield and cells of producing microorganisms. Growth and lactate fermentation productivity increased.
  • CC02-0820 with foreign ACL introduction and enhanced PCK1 and PYK2, the cell growth of OD 600 increased by 80% and the amount of glucose consumed was increased by 40% compared to the strain with reduced PDC titer. Fermentation yield was also improved by 2%. In addition, the productivity of lactic acid finally showed an effect of 40% improvement.
  • the CC02-0820 improved both the OD, glucose consumed at the same time, and the yield of lactic acid fermentation, compared to the strain CC02-0819 in which only foreign ACL was introduced, and the productivity was increased by 20%.
  • Example 10 PDC activity is Reduced In strain ACL Introduction, and MDH2 And cytosolic Comparison of Fermentation Evaluation of Strains Enhanced with MAE1
  • CC02-0831 strain prepared in Example 8 was evaluated for the lactic acid fermentation ability by the method used in Example 3 together with the control CC02-0256, CC02-0819.
  • Table 13 shows the results of the above experiment.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 젖산 생산능을 갖는 사카로마이세스 속 (Saccharomyces sp.) 미생물 및 이를 이용한 젖산 제조 방법에 관한 것이다. 보다 구체적으로, 본 발명은 피루베이트 디카르복실라아제 (Pyruvate decarboxylase, PDC)의 활성이 내재적 활성에 비해 약화 또는 불활성화되고, ATP-시트르산 분해효소 (ATP-citrate lyase, ACL) 활성이 도입되고, 피루베이트 생합성 경로가 내재적 생합성 경로에 비하여 강화되도록 변이된, 젖산 생산능을 갖는 사카로마이세스 속 미생물 및 이를 이용한 젖산 제조 방법에 관한 것이다.

Description

젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법
본 발명은 젖산 생산능을 갖는 사카로마이세스 속 (Saccharomyces sp.) 미생물 및 이를 이용한 젖산 제조 방법에 관한 것이다.
젖산은 식품 분야, 의약분야, 화장품 분야 등 산업 분야에서 다양하게 이용되고 최근에는 폴리유산의 단량체로 활용되어 그 요구량이 크게 증가하고 있다. 젖산을 생산하는 방법으로는 전통적인 화학합성법과 탄수화물을 기질로 하는 생물학적 발효법이 있으며, 최근에는 후자의 방법이 선호되고 있다.
일반적으로, 효모 기반의 젖산 생산 미생물은 락테이트 디히드로게네이즈 (Lactate dehydrogenase, LDH) 및 피루베이트 디카르복실라아제(Pyruvate decarboxylase, PDC)가 경쟁적으로 피루베이트 (pyruvate)를 기질로 사용한다. 이에, 제조 수율을 극대화하기 위해서는 피루베이트가 LDH에 의해 젖산 (Lactic acid, LA)으로 많이 생산될 수 있도록, PDC의 기능을 최소화하는 것이 필요하다. 사카로마이세스 세레비지애 (Saccharomyces cerevisiae)에서 PDC는 PDC1, PDC5, 및 PDC6라는 세가지 아이소자임 (isozyme)으로 존재한다. 이에, 젖산 생산량을 극대화하기 위하여 PDC1, PDC5 및 PDC6를 동시 결손한 삼중 결손 균주를 제작하는 방법이 사용될 수 있다. 그러나, PDC의 활성이 불활성화되면, 젖산의 수율은 증가하지만, 생산성이 하락하고 균주의 원활한 생장이 불가능한 단점이 보고되고 있어 (유럽특허 제EP2041264호), 상기 방법으로는 목적하는 만큼의 젖산을 생산하기 어렵다. 또한, 사카로마이세스 속 같은 효모는 박테리아와 같은 원핵세포와 달리 다양한 세포 소기관 및 다양한 유기적 체계에 의해 단순 유전자 조작으로는 목적하는 양의 젖산을 생산할 수 있을 수 있는지를 명확히 예측할 수 없다.
본 발명자들은 젖산 생산 미생물에서 원활한 성장이 유지되며, 젖산 생산 수율 및 생산량을 모두 증가시킬 수 있는 방법을 개발하기 위해 예의 노력한 결과, 아세틸-CoA의 공급 경로, 및 옥살로아세테이트 (Oxaloacetate, OAA)로부터 피루베이트로의 공급 경로를 강화하였을 때, 젖산 생산량이 향상되는 것을 확인함으로써 본 발명을 완성하였다.
본 발명의 하나의 목적은 젖산 생산능을 갖는 사카로마이세스 속 (Saccharomyces sp.) 미생물을 제공하는 것이다.
본 발명의 또 하나의 목적은 상기 미생물을 이용하여 젖산을 제조하는 방법을 제공하는 것이다.
본 발명의 PDC 활성이 불활성화되고, 외래 ACL 활성이 도입 및 피루베이트 생합성 경로가 강화되도록 변이된, 젖산 생산 균주는 기존 균주에 비해 알코올 활성 경로의 피루베이트 이탈 최소화 및 젖산 분해 경로의 차단을 통해 젖산 발효 수율 및 생산성이 우수하며 생산 균주의 생장이 증가하므로, 젖산을 원료로 사용하는 각종 제품의 생산성을 향상시키는데 널리 활용될 수 있을 것이다. 이를 통해 생산된 젖산은 다양한 제품의 원료로서 제공될 수 있다.
도 1은 효모 미생물 내 존재하는 PCK1 (PEP carboxykinase, EC 4.1.1.49)과 PYK2 (Pyruvate kinase, EC 2.7.1.40) 효소의 과발현을 이용한 피루베이트 생합성 강화 경로로, 본 발명의 외래 ACL 도입, 및 PCK 및 PYK 경로 강화를 통한 젖산 생산성 증가 전략을 도식화한 도이다.
도 2는 효모 미생물 내 존재하는 MDH2 (Malate dehydrogenase 2, EC 1.1.1.37) 및 cytosolic MAE1 (Malic enzyme 1, EC 1.1.1.38) 효소 강화를 이용한 피루베이트 생합성 강화 경로로, 본 발명의 외래 ACL 도입, 및 MDH, cytosolic MAE 경로를 통한 젖산 생산성 증가 전략을 도식화한 도이다.
상기 목적을 달성하기 위하여, 본 발명은 하나의 양태로서 피루베이트 디카르복실라아제 (Pyruvate decarboxylase, PDC)의 활성이 내재적 활성에 비해 불활성화되고, ATP-시트르산 분해효소 (ATP-citrate lyase, ACL) 활성이 도입되고, 피루베이트 생합성 경로가 내재적 생합성 경로에 비하여 강화되도록 변이된, 젖산 생산능을 갖는 사카로마이세스 속 (Saccharomyces sp.) 미생물을 제공한다.
상기 젖산 생산능을 갖는 사카로마이세스 속 미생물은 ACL 활성이 도입되지 않고/또는 피루베이트 생합성 경로가 내재적 생합성 경로에 비하여 강화되도록 변이되지 않은 균주에 비해, 젖산 발효 수율이 증가하거나/하고, 사카로마이세스 속 균체의 성장이 증가 (생산 미생물의 생장 증가)하거나/하고, 젖산 생산능이 증가된, 미생물일 수 있다.
본 발명에서 용어, "젖산 (lactic acid, LA)"은 C2H4OHCOOH로 표시되는 유기산을 의미한다. 이와 같은 젖산은 화학합성법을 이용하여 젖산을 생산할 경우, D형 젖산과 L형 젖산이 50%씩 섞여있는 라세믹(racemic) 혼합물 형태로 생성되고 조성비 조절이 불가능하여 폴리유산을 제조할 경우 용융점이 낮은 무정형의 고분자가 되어 용도 개발 시에도 제한이 많다. 반면, 미생물을 이용한 생물학적 발효법의 경우 사용하는 균주 또는 도입되는 락테이트 디히드로게네이즈 (Lactate dehydrogenase,LDH)에 따라서 D형 또는 L형의 젖산을 선택적으로 생산할 수 있다.
본 발명에서 용어, "젖산 생산능을 갖는 미생물"은 본 발명의 목적상 젖산을 생산할 수 있는 미생물 균주로서, 당을 젖산으로 전환시킬 수 있는 균주를 의미하며, 그 예로 효모 미생물로, 본 발명의 젖산 생산 경로, 아세틸-CoA의 생산 경로를 포함하는 이상 제한되지 않는다.
효모 미생물은 형태에 의해 "사카로마이세스 속", "피치아속", "캔디다 속" 및 "사이카로마이코프시스 속" 등으로 나뉘며, 구체적으로 본 발명에서는 젖산을 생산할 수 있다면 다양한 종을 포함하는 "사카로마이세스 속" 미생물을 활용할 수 있다. 구체적으로 상기 사카로마이세스 속 미생물은 사카로마이세스 바야누스(Saccharomyces bayanus), 사카로마이세스 보울라디(Saccharomyces boulardii), 사카로마이세스 불데리(Saccharomyces bulderi), 사카로마이세스 카리오카누스(Saccharomyces cariocanus), 사카로마이세스 카리오커스(Saccharomyces cariocus), 사카로마이세스 세레비지에(Saccharomyces cerevisiae), 사카로마이세스 시바리에리(Saccharomyces chevalieri), 사카로마이세스 다이레넨시스(Saccharomyces dairenensis), 사카로마이세스 엘립소이더스(Saccharomyces ellipsoideus), 사카로마이세스 유바야누스(Saccharomyces eubayanus), 사카로마이세스 엑시구스(Saccharomyces exiguus), 사카로마이세스 플로렌티누스(Saccharomyces florentinus), 사카로마이세스 클루이베리(Saccharomyces kluyveri), 사카로마이세스 마르티니에(Saccharomyces martiniae), 사카로마이세스 모나센시스(Saccharomyces monacensis), 사카로마이세스 노르벤시스(Saccharomyces norbensis), 사카로마이세스 파라독수스(Saccharomyces paradoxus), 사카로마이세스 파스토리아누그(Saccharomyces pastorianus), 사카로마이세스 스펜세로럼(Saccharomyces spencerorum), 사카로마이세스 츄리센시스(Saccharomyces turicensis), 사카로마이세스 유니스포러스(Saccharomyces unisporus), 사카로마이세스 우바럼(Saccharomyces uvarum), 및 사카로마이세스 조나투스(Saccharomyces zonatus)로 이루어진 군으로부터 선택된 것일 수 있으며, 더욱 구체적으로는 사카로마이세스 세레비지에일 수 있다.
본 발명의 젖산 생산능을 갖는 사카로마이세스 속 미생물은 피루베이트 디카르복실라아제의 활성이 내재적 활성에 비해 불활성화되고, ATP-시트르산 분해효소 활성이 도입되고, 피루베이트 생합성 경로가 내재적 생합성 경로에 비하여 강화되도록 변이된, 미생물일 수 있다.
상기 젖산 생산능을 갖는 사카로마이세스 속 미생물은 구체적으로, (i) 피루베이트 디카르복실라아제의 활성이 내재적 활성에 비해 불활성화되도록 변이되고, (ii) ATP-시트르산 분해효소 활성이 도입되고, (iii) 피루베이트 생합성 경로가 내재적 생합성 경로에 비하여 강화되도록 변이된 것뿐 아니라, 추가적으로 (iv) 락테이트 디히드로게네이즈 (Lactate dehydrogenase, LDH) 활성이 도입되고; (v) 알코올 디히드로게네이즈 1의 활성이 내재적 활성에 비해 약화 또는 불활성화; (vi) 피루베이트 디카르복실라아제 1의 활성이 내재적 활성에 비해 약화 또는 불활성화; 및/또는 (vii) D-락테이트 디히드로게네이즈 1의 활성이 내재적 활성에 비해 약화 또는 불활성화되도록 변이된, 미생물일 수 있다.
또한 본 발명의 상기 미생물은 추가적으로, (i) 알코올 디히드로게네이즈 1 (Alcohol dehydrogenase 1, ADH1)의 활성이 내재적 활성에 비해 불활성화되도록 변이됨; (ii) 피루베이트 디카르복실라아제 1 (Pyruvate decarboxylase 1, PDC1)의 활성이 내재적 활성에 비해 불활성화되도록 변이됨; 및 (iii) D-락테이트 디히드로게네이즈 1 (D-lactate dehydrogenase 1, DLD1)의 활성이 내재적 활성에 비해 불활성화되도록 변이된 것인, 미생물일 수 있다.
본 발명에서 용어, "피루베이트 디카르복실라아제 (Pyruvate decarboxylase, PDC)"는 "피루베이트 탈탄산효소"와 혼용될 수 있으며, 피루베이트를 아세트알데하이드 (Acetaldehyde) 및 이산화탄소 (CO2)로 전환시키는 효소를 의미한다. 상기 효소는 무산소 조건에서 효모, 특히 사카로마이세스 속 내에서 발생되는 발효 과정에 작용하는 효소로, 발효에 의해 에탄올을 생성하는 효소이다. 일반적으로 사카로마이세스 속 미생물의 PDC는 PDC1, PDC5 및 PDC6의 3가지 아이소자임 (isozyme) 형태로 존재한다. 상기 단백질 및 유전자 서열은 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되지 않는다. 상기 효소는 구체적으로 PDC1은 서열번호 39, PDC5는 서열번호 41, PDC6는 서열번호 43의 아미노산으로 이루어진 단백질일 수 있으나, 상기 효소의 활성을 갖는 서열이라면 제한 없이 포함된다. 또한 상기 PDC1, PDC5 및 PDC6을 코딩하는 유전자는 각각 구체적인 예로 서열번호 40, 42, 및 44의 염기서열로 나타낼 수 있으나, 상기 효소를 코딩할 수 있는 서열이라면 제한 없이 포함된다.
본 발명에서 용어, "ATP-시트르산 분해효소 (ATP-citrate lyase, ACL, EC 2.3.3.8)"는 시트르산 (citrate)을 옥살로아세테이트 (oxaloacetate, OAA)와 아세틸-CoA로 변환시키는 효소로, 고등생물 및 일부 효모에 존재한다고 알려져 있다 (ATP-citrate lyase: A mini-review, Biochemical and Biophysical Research Communications 422 (2012) 1-2).
이의 반응식은 다음과 같다.
시트르산 + ATP + CoA + H2O → OAA + Acetyl-CoA + A + Pi
아세틸-CoA (acetyl-CoA)는 균주의 생장에 필수적인 효소로, 이의 중요성은 최근 다양한 문헌에서 크게 대두되고 있다. 대표적인 예로 1,3-BDO (1,3-butanediol)를 생산하는 진핵세포 생물체 (eukaryotic organism)에서 비-자연적인 경로 (non-natural pathway)를 이용해 세포 기질 아세틸-CoA (cytosol acetyl-coA)를 공급하여 생산성을 높이려는 연구가 보고되고 있다 (국제공개 특허 제WO2013/036764호).
이에, 외래 ACL 도입을 통해 PDC의 활성이 약화 혹은 제거된 균주에서 생장에 필수적인 아세틸-CoA의 공급을 가능하게 하여, 이를 통해 PDC의 활성에 비의존적으로 미생물이 생장할 수 있도록 하는 것이다. 상기 단백질 및 유전자 서열은 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되지 않는다. 상기 ATP-시트르산 분해효소는 서열번호 29의 아미노산 서열을 가질 수 있으나, 상기 효소 활성을 갖는 단백질 서열은 제한 없이 포함될 수 있다. 또한 상기 ACL을 코딩하는 유전자는 구체적인 예로 서열번호 30의 염기서열로 나타낼 수 있으나, 상기 효소를 코딩할 수 있는 서열이라면 제한 없이 포함된다.
본 발명에서 용어, "피루베이트 생합성 경로"는 효모, 즉 사카로마이세스 속 미생물 내의 피루베이트를 공급할 수 있는 생합성 경로로, OAA로부터 피루베이트로의 공급 경로일 수 있다. 구체적인 예는 도 1 및 2에 나타낸 바와 같다.
일례로서 상기 피루베이트 생합성 경로의 강화는 포스포에놀 피루베이트 카르복시키나아제 1 (Phosphoenolpyruvate carboxykinase 1, PCK1) 또는 피루베이트 키나아제 2 (Pyruvate kinase 2, PYK2) 또는 상기 효소 모두의 활성이 내재적 활성에 비하여 강화되도록 변이시켜 수행될 수 있다.
또는 상기 피루베이트 생합성 경로의 강화는 말레이트 디히드로게네이즈 2 (Malate dehydrogenase 2, MDH2) 또는 세포 기질 말릭 효소 1 (cytosolic Malic enzyme 1, cytosolic MAE1) 또는 상기 효소 모두의 활성이 내재적 활성에 비하여 강화되도록 변이시켜 수행될 수 있다.
본 발명에서 용어, "포스포에놀 피루베이트 카르복시키나아제 1 (Phosphoenolpyruvate carboxykinase 1, PCK1)"는 OAA로부터 PEP (Phosphoenolpyruvate)로 전환을 촉매하는 효소를 의미한다. PCK1은 효모 미생물에서 OAA를 PEP로 전환하는 포도당신생과정 (gluconeogenesis)에서 필요한 효소로 포도당이 존재하는 조건에서 발현의 저해를 받는 효소로 알려져 있다 (Differential post-transcriptional regulation of yeast mRNAs in response to high and low glucose concentrations. Mol Microbiol 35(3):553-65 (2000)).
본 발명에서, 용어, "피루베이트 키나아제 2 (Pyruvate kinase 2, PYK2)"는 PEP로부터 ADP로 인산기 (Phosphate group)을 전달하여, 피루베이트 및 ATP 생산을 촉매하는 효소를 의미한다. PYK2는 효모 미생물에서 PEP를 피루베이트로 전환하는 해당과정 (glycolysis)의 마지막 단계 효소로, PYK2 역시 포도당이 존재하는 조건에서 발현의 저해를 받는 효소로 알려져 있다 (Characterization of a glucose-repressed pyruvate kinase (Pyk2p) in Saccharomyces cerevisiae that is catalytically insensitive to fructose-1,6-bisphosphate, J Bacteriol. 1997 May;179(9):2987-93).
상기 각 단백질 및 유전자 서열은 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되지 않는다. 상기 PCK1은 서열번호 31의 아미노산 서열을 가질 수 있으나, 상기 효소 활성을 갖는 단백질 서열은 제한 없이 포함될 수 있다. 또한 상기 PCK1을 코딩하는 유전자는 구체적인 예로 서열번호 32의 염기서열로 나타낼 수 있으나, 상기 효소를 코딩할 수 있는 서열이라면 제한 없이 포함된다. 상기 PYK2은 서열번호 33의 아미노산 서열을 가질 수 있으나, 상기 효소 활성을 갖는 단백질 서열은 제한 없이 포함될 수 있다. 또한 상기 PYK2를 코딩하는 유전자는 구체적인 예로 서열번호 34의 염기서열로 나타낼 수 있으나, 상기 효소를 코딩할 수 있는 서열이라면 제한 없이 포함된다.
본 발명에서 용어, "MDH2 (Malate dehydrogenase 2)"는 OAA를 말레이트 (Malate)로 바꾸는 가역적인 효소를 의미한다. 상기 MDH2는 본래 세포 기질 (cytosol)에 위치하는 효소이다.
본 발명에서 용어, "세포 기질 MAE1 (Cytosolic Malic Enzyme 1)"는 말레이트를 피루베이트로 치환하는 효소인 MAE1 중 미토콘드리아 표적 서열 (mitochondrial targeting sequence)이 제거되어 세포 기질에 위치하도록 변경된 효소이다. 상기 MAE1 효소의 경우, 본래 미토콘드리아에 위치하는 단백질로, 미토콘드리아 내에서 TCA 회로 (tricarboxylic acid)의 중간물질인 말레이트를 피루베이트로 치환하는 효소이다 (Metabolic Engineering, 6 (2004) 352-363). 상기 각 단백질 및 유전자 서열은 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되지 않는다. 상기 MDH2는 서열번호 35의 아미노산 서열을 가질 수 있으나, 상기 효소 활성을 갖는 단백질 서열은 제한 없이 포함될 수 있다. 또한 상기 MDH2를 코딩하는 유전자는 구체적인 예로 서열번호 36의 염기서열로 나타낼 수 있으나, 상기 효소를 코딩할 수 있는 서열이라면 제한 없이 포함된다. 상기 MAE1은 서열번호 37의 아미노산 서열을 가질 수 있으나, 상기 효소 활성을 갖는 단백질 서열은 제한 없이 포함될 수 있다. 아울러, MAE1이 세포 기질에 존재하기 위해서는 서열번호 37의 아미노산 중 30번째까지의 아미노산이 제거된 서열 (즉, 미토콘드리아 표적 서열인 서열번호 51의 아미노산 서열이 제거된 서열)일 수 있으며, 이와 같은 서열을 서열번호 52로 표시하였다. 또한 상기 MAE1을 코딩하는 유전자는 구체적인 예로 서열번호 38의 염기서열로 나타낼 수 있으나, 상기 효소를 코딩할 수 있는 서열이라면 제한 없이 포함된다.
본 발명에서 용어 "락테이트 디히드로게네이즈 (Lactate dehydrogenase, LDH)"는 피루베이트 및 락테이트를 상호 전환할 수 있는 효소로, 상기 단백질 및 유전자 서열은 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되지 않는다. 상기 LDH는 서열번호 49의 아미노산 서열을 가질 수 있으나, 상기 효소 활성을 갖는 단백질 서열은 제한 없이 포함될 수 있다. 또한 상기 LDH를 코딩하는 유전자는 구체적인 예로 서열번호 50의 염기서열로 나타낼 수 있으나, 상기 효소를 코딩할 수 있는 서열이라면 제한 없이 포함된다.
상기 각 효소들은 상기 서열번호로 기재한 아미노산 서열들뿐만 아니라, 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더 구체적으로는 98% 이상, 더욱 더 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 상기 각 효소와 동일하거나 상응하는 효능을 나타내는 효소라면 제한없이 포함할 수 있다. 또한 이러한 상동성을 갖으며 각 효소에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 효소 변이체도 본 발명의 범위 내에 포함됨은 자명하다.
또한, 상기 각 효소들을 코딩하는 유전자는 상기 서열번호들로 기재한 염기서열뿐만 아니라, 상기 서열과 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 98% 이상, 보다 더욱 구체적으로는 99% 이상의 상동성을 나타내는 염기 서열로서 실질적으로 상기 각 효소와 동일하거나 상응하는 효능을 나타내는 효소를 코딩하는 유전자 서열이라면 제한없이 포함할 수 있다. 또한 이러한 상동성을 갖는 염기서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 염기서열도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명에서 용어, "상동성"은 두 개의 폴리뉴클레오티드 또는 폴리펩타이드 모이티 사이의 동일성의 퍼센트를 말한다. 하나의 모이티로부터 다른 하나의 모이티까지의 서열 간 상동성은 알려진 당해 기술에 의해 결정될 수 있다. 예를 들면, 상동성은 서열정보를 정렬하고 용이하게 입수 가능한 컴퓨터 프로그램을 이용하여 두 개의 폴리뉴클레오티드 분자 또는 두 개의 폴리펩티드 분자 간의 서열 정보, 예로는 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)를 직접 정렬하여 결정될 수 있다(예: BLAST 2.0). 또한, 폴리뉴클레오티드 간 상동성은 상동 영역 간의 안정된 이중가닥을 이루는 조건하에서 폴리뉴클레오티드의 혼성화한 후, 단일-가닥-특이적 뉴클레아제로 분해시켜 분해된 단편의 크기를 결정함으로써 결정할 수 있다.
본 발명에서 용어, "내재적 활성"은 미생물이 천연의 상태 또는 해당 효소의 변형 전에 가지고 있는 효소의 활성 상태를 의미한다.
상기 "효소의 활성이 내재적 활성에 비해 불활성화되도록 변이된"은 효소를 코딩하는 유전자의 발현이 천연형 균주 또는 변형전의 균주에 비하여 전혀 발현이 되지 않는 경우 또는 발현이 되더라도 그 활성이 없거나 감소된 것을 의미한다.
상기 감소는 상기 효소를 코딩하는 유전자의 변이 등으로 효소 자체의 활성이 본래 미생물이 가지고 있는 효소의 활성에 비해 감소한 경우와, 이를 코딩하는 유전자의 발현 저해 또는 번역(translation) 저해 등으로 세포 내에서 전체적인 효소 활성 정도가 천연형 균주 또는 변형 전의 균주에 비하여 낮은 경우, 이들의 조합 역시 포함하는 개념이다.
이러한 효소 활성의 불활성화는, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 상기 효소의 활성이 제거된 경우를 포함하여 상기 효소의 활성이 감소되도록 돌연변이된 유전자로, 염색체상의 상기 효소를 코딩하는 유전자를 대체하는 방법; 상기 효소를 코딩하는 염색체상의 유전자의 발현 조절 서열에 변이를 도입하는 방법; 상기 효소를 코딩하는 유전자의 발현 조절 서열을 활성이 약하거나 없는 서열로 교체하는 방법; 상기 효소를 코딩하는 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 상기 염색체상의 유전자의 전사체에 상보적으로 결합하여 상기 mRNA로부터 효소로의 번역을 저해하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)를 도입하는 방법; 상기 효소를 코딩하는 유전자의 SD 서열 앞단에 SD 서열과 상보적인 서열을 인위적으로 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착이 불가능하게 만드는 법 및 해당 서열의 ORF(open reading frame)의 3' 말단에 역전사되도록 프로모터를 부가하는 RTE(Reverse transcription engineering) 방법 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 상기 예에 의해 특별히 제한되는 것은 아니다.
구체적으로, 효소를 코딩하는 유전자의 일부 또는 전체를 결실하는 방법은, 균주 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 코딩하는 폴리뉴클레오티드를 일부 핵산 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 이러한 유전자의 일부 또는 전체를 결실하는 방법의 일례로 상동 재조합에 의하여 유전자를 결실시키는 방법을 사용할 수 있다.
상기에서 "일부"란, 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 구체적으로는 1 내지 100개, 더욱 구체적으로는 1 내지 50개일 수 있으나, 특별히 이에 제한되는 것은 아니다.
상기에서 "상동 재조합(homologous recombination)"이란, 서로 상동성을 지닌 유전자 사슬의 좌위에서 연결 교환을 통해 일어나는 유전자 재조합을 의미한다.
구체적으로, 발현 조절 서열을 변형하는 방법은 상기 발현 조절 서열의 핵산 서열에 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절 서열상의 변이를 유도하여 수행하거나, 더욱 약한 프로모터로 교체하는 등의 방법으로써 수행할 수 있다. 상기 발현 조절서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함한다.
아울러, 염색체상의 유전자 서열을 변형하는 방법은 상기 효소의 활성이 감소하도록 유전자 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 유전자 서열 또는 활성이 없도록 개량된 유전자 서열로 교체함으로써 수행할 수 있다.
본 발명에서 용어, "활성이 내재적 활성에 비하여 강화"한다는 것은, 미생물이 그 단백질의 활성을 보유하고 있는 상태에 비하여 세포 내 활성을 향상시키도록 변형시킴으로써 상기 단백질 (또는 효소)의 세포 내 활성을 증가시키는 것을 의미한다. 이와 같은 "강화"는 단백질 (또는 효소) 자체의 활성이 증대되어 본래 기능 이상의 효과를 도출하는 것을 포함할 뿐 아니라, 상기 단백질 (또는 효소)을 코딩하는 폴리뉴클레오티드의 카피수 증가, 상기 단백질 (또는 효소)을 코딩하는 염색체상의 유전자 조절 서열에 변이를 도입하는 방법, 상기 단백질 (또는 효소)을 코딩하는 염색체상의 유전자의 조절 서열을 활성이 강력한 서열로 교체하는 방법, 상기 단백질 (또는 효소)의 활성이 증가하도록 돌연변이된 유전자로 상기 단백질 (또는 효소)을 코딩하는 유전자를 대체하는 방법 및 상기 단백질 (또는 효소)의 활성이 강화되도록 상기 단백질 (또는 효소)을 코딩하는 염색체상의 유전자에 변이를 도입시키는 방법으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법에 의해 수행될 수 있으나, 단백질 (또는 효소) 활성이 내재적 활성에 비하여 강화시킬 수 있거나, 도입된 활성을 강화시킬 수 있는 공지의 방법은 제한 없이 포함된다.
본 발명에서 용어, "단백질 (또는 효소) 활성을 도입 "한다는 것은, 특정 단백질 (또는 효소) 활성을 가지고 있지 않은 미생물에 그 단백질의 활성을 부여하거나, 특정 단백질 (또는 효소) 활성을 가지고 있지 않은 미생물에 그 단백질 (또는 효소) 활성이 부여된 후, 이의 세포 내 활성을 더욱 향상시키도록 변형시킴으로써, 상기 단백질 (또는 효소)의 세포 내 활성을 증가시키는 것을 의미한다.
이러한 "단백질 (또는 효소) 활성을 도입"한다는 것은, 당해 분야에서 잘 알려진 다양한 방법으로 수행될 수 있는데, 예를 들어 상기 단백질 (또는 효소)을 코딩하는 염기서열을 포함하는 폴리뉴클레오티드를 염색체에 삽입하는 방법, 상기 폴리뉴클레오티드를 벡터 시스템에 도입하여 미생물에 도입하는 방법 등으로 폴리뉴클레오티드의 카피수 증가 방법, 상기 단백질 (또는 효소)을 코딩하는 염기서열의 상류에 개량된 활성을 나타내는 프로모터를 도입하거나, 프로모터에 변이를 준 상기 단백질 (또는 효소)을 도입하는 방법, 상기 단백질 (또는 효소)단백질 (또는 효소)을 코딩하는 염기서열의 변이체를 도입하는 방법 등을 사용할 수 있으나, 단백질 (또는 효소) 활성을 도입시킬 수 있는 공지의 방법은 제한 없이 포함된다.
상기에서 폴리뉴클레오티드의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 본 발명의 단백질을 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있거나, 상기 폴리뉴클레오티드가 작동가능하게 연결된, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 상기 숙주세포의 염색체 내 상기 폴리뉴클레오티드의 카피수를 증가하는 방법으로 수행될 수 있다.
상기 벡터는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물로, 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
상기 효모 발현 벡터는 조합 효모 플라스미드(YIp: integrative yeast plasmid) 및 염색체 외 플라스미드 벡터(extrachromosomal plasmid vector)가 모두 가능하다. 상기 염색체 외 플라스미드 벡터는 에피솜 효모 플라스미드(YEp: episomal yeast plasmid), 복제 효모 플라스미드(YRp: replicative yeast plasmid) 및 효모 중심체 플라스미드(YCp: yeast centromer plasmid)를 포함할 수 있다. 또한, 인위적 효모 염색체들(YACs: artificial yeast chromosomes)도 본 발명에 따른 발현 벡터로서 가능하다. 구체적인 예로서, 이용 가능한 벡터는 pESC-HIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAPα A, pGAPα B, pGAPα C, pPIC3.5K, pPIC6 A, pPIC6 B, pPIC6 C, pPIC6α A, pPIC6α B, pPIC6α C, pPIC9K, pYC2/CT, pYD1 Yeast Display Vector, pYES2, pYES2/CT, pYES2/NT A, pYES2/NT B, pYES2/NT C, pYES2/CT, pYES2.1, pYES-DEST52, pTEF1/Zeo, pFLD1, PichiaPinkTM, p427-TEF, p417-CYC, pGAL-MF, p427-TEF, p417-CYC, PTEF-MF, pBY011, pSGP47, pSGP46, pSGP36, pSGP40, ZM552, pAG303GAL-ccdB, pAG414GAL-ccdB, pAS404, pBridge, pGAD-GH, pGAD T7, pGBK T7, pHIS-2, pOBD2, pRS408, pRS410, pRS418, pRS420, pRS428, yeast micron A form, pRS403, pRS404, pRS405, pRS406, pYJ403, pYJ404, pYJ405 및 pYJ406를 포함하나, 이에 한정되는 것은 아니다.
보다 구체적인 효모 벡터는 복제 원점 ori 및 항생물질 저항성 카세트(antibiotic resistance cassette)를 함유하여 대장균(E. coli)에서 증식되고 선택될 수 있는 효모 복제 플라스미드(yeast replication plasmid)일 수 있다. 일반적으로, 발현 벡터는 프로모터-유전자-전사 종결서열의 발현 컨스트럭트를 포함할 수 있다.
예를 들어, 숙주 세포가 효모인 경우, 상기 발현 컨스트럭트에서 이용가능한 프로모터는 TEF1 프로모터, TEF2 프로모터, GAL10 프로모터, GAL1 프로모터, ADH1 프로모터, ADH2 프로모터, PHO5 프로모터, GAL1-10 프로모터, TDH3 프로모터(GPD 프로모터), TDH2 프로모터, TDH1 프로모터, PGK1 프로모터, PYK2 프로모터, ENO1 프로모터, ENO2 프로모터 및 TPI1 프로모터를 포함하나, 이에 한정되는 것은 아니다.
상기 발현 컨스트럭트에서 이용가능한 전사 종결서열은 ADH1 터미네이터, CYC1 터미네이터, GAL10 터미네이터, PGK1 터미네이터, PHO5 터미네이터, ENO1 터미네이터, ENO2 터미네이터 및 TPI1 터미네이터를 포함하나, 이에 한정되는 것은 아니다.
또한, 숙주세포 내 염색체 삽입용 벡터를 통해 염색체 내에 내재적 목적 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 또는 염색체 내에 도입시키고자 하는 외래 목적 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다. 본 발명의 벡터는 상동재조합을 일으켜서 염색체 내로 삽입될 수 있으므로 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 폴리뉴클레오티드의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 발명에서 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함한다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함한다. 상기 발현 카세트는 자체 복제가 가능한 발현벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어, 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 발명의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 발명의 벡터를 형질전환시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
상기 숙주 세포로는 DNA의 도입효율이 높고, 도입된 DNA의 발현 효율이 높은 숙주를 사용하는 것이 좋은데, 본 발명의 목적상 사카로마이세스 속 미생물일 수 있다.
다음으로, 폴리뉴클레오티드의 발현이 증가하도록 발현 조절서열에 변이를 도입하는 것은, 특별히 이에 제한되지 않으나, 상기 발현 조절서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 핵산 서열로 교체하여 수행될 수 있다. 상기 발현 조절서열은, 특별히 이에 제한되지 않으나, 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함한다.
상기 폴리뉴클레오티드 발현 단위의 상류에는 본래의 프로모터 대신 강력한 이종 프로모터가 연결될 수 있다.
이와 같은 단백질 활성의 도입 또는 강화는, 상응하는 단백질의 활성 또는 농도가 야생형 단백질이나 초기의 미생물 균주에서의 활성 또는 농도를 기준으로 하여 일반적으로 최소 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% 또는 500%, 최대 1000% 또는 2000%까지 증가되는 것일 수 있다.
본 발명은 또 하나의 양태로서, (i) 상기 신규한 피루베이트 디카르복실라아제의 활성이 내재적 활성에 비해 불활성화되고, ATP-시트르산 분해효소 활성이 도입되고, 피루베이트 생합성 경로가 내재적 생합성 경로에 비하여 강화되도록 변이된, 젖산 생산능을 갖는 사카로마이세스 속 미생물을 배지에서 배양하는 단계; 및 (ii) 상기 배양에 따른 배지 또는 상기 미생물로부터 젖산을 회수하는 단계를 포함하는, 젖산 제조 방법을 제공한다.
상기 젖산 생산능을 갖는 사카로마이세스 속 미생물은 상기에서 설명한 바와 같다.
본 발명에서 용어 "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 발명에서 사카로마이세스 속 미생물을 이용하여 젖산을 배양하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 사카로마이세스 속 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 구체적으로는 본 발명의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
사용될 수 있는 탄소원의 예는 수쿠로오스 또는 글루코오스를 이용할 수 있으며, 수쿠로오스를 다량으로 포함한 당밀 또한 탄소원으로 이용될 수 있으며, 그 외의 적적량의 탄소원이 다양하게 이용될 수 있다.
질소원의 예로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 및 대두밀과 같은 유기 질소원 및 요소, 황산암모늄, 염화암모늄, 인산암모늄, 탄산안모늄, 및 질산암모늄과 같은 무기질소원이 포함될 수 있다. 이들 질소원은 단독 또는 조합되어 사용될 수 있다. 상기 배지에는 인원으로서 인산이수소칼륨, 인산수소이칼륨 및 대응되는 소듐-함유 염이 포함될 수 있다. 또한, 황산마그네슘 또는 황산 철과 같은 금속염을 포함할 수 있다. 그 외에 아미노산, 비타민 및 적절한 전구체 등이 포함될 수 있다. 이들 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있다.
배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한 배양 중에는 지방산 폴리클리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다.
배양물의 온도는 보통 20 ℃ 내지 40 ℃, 구체적으로는 25 ℃ 내지 35 ℃, 더욱 구체적으로는 30 ℃일 수 있으나, 목적하는 목적에 따라 제한 없이 변경될 수 있다. 배양 기간은 원하는 유용 물질의 생성량에 도달할 때까지 계속 할 수 있으며, 구체적으로는 10 내지 100 시간일 수 있으나, 이에 제한되지 않는다.
본 발명의 젖산을 생산하는 방법은, 상기 배양에 따른 배지 또는 상기 미생물로부터 젖산을 회수하는 단계를 포함할 수 있다. 미생물 또는 배지로부터 젖산을 회수하는 방법은 당업계에 알려진 방법, 예컨대 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으나, 이들 예에 한정되는 것은 아니다.
상기 회수 단계는 정제 공정을 포함할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
실시예 1: 젖산 생산 균주 제작
본 발명에서 사용할 대표적인 젖산 생산 균주를 제작하기 위하여, Euroscarf에서 분양받은 야생형 효모 중 대표적인 사카로마이세스 세레비지애 (Saccharomyces cerevisiae) CEN.PK2-1D에 일련의 유전자 조작을 가하였다.
구체적으로는, 알코올 합성 경로로의 피루베이트의 이탈을 최소화하기 위하여 알코올 탈수소효소 1 (alcohol dehydrogenase 1; ADH1) 및 피루베이트 탈탄산효소 1 (pyruvate decarboxylase 1; PDC1)을 결손시키고, D형 젖산 분해 경로의 차단을 위해 D-젖산 탈수소효소 1 (d-lactate dehydrogenase 1; DLD1)을 결손한 균주를 본 발명의 기반 균주로 사용하였다.
DLD1은 생장 개선에 직접적인 영향을 미치는 요소는 아니나, D형 젖산의 탈수소효소로 NAD+를 이용하여 피루베이트로 전환시키는 주된 효소로 알려져 있다. 따라서, 젖산을 소모하는 효소인 DLD1 유전자를 결손한 균주를 기반으로 후속 균주를 제작하여, 젖산 발효 생산성을 비교하였다.
본 발명의 유전자 조작은 일반적인 molecular cloning 방법을 이용하였다. 먼저, 효모의 ADH1 및 PDC1 유전자 결손에 관한 실험은 Lee TH, et al.(J. Microbiol. Biotechnol. (2006), 16(6), 979-982) 논문에 개시된 내용을 참고로 하여 pWAL100 및 pWBR100 플라스미드를 이용하였다. 벡터에 삽입한 각 insert는 각각에 해당하는 프라이머 (서열번호 1 내지 서열번호 8)를 이용하여 PCR(중합효소연쇄반응, Polymerase chain reaction)을 통해 제조하였다.
PCR은 야생형 효모의 genomic DNA를 주형으로 사용하였다. ADH1 결손을 위하여 서열번호 1 및 서열번호 2의 프라이머를 이용하여 PCR을 수행한 뒤 BamHI, NcoI 제한효소를 이용하여 pWAL100에 클로닝하고, 서열번호 3 및 서열번호 4의 프라이머를 이용하여 PCR을 수행한 뒤 BamHI, NcoI 제한효소를 이용하여 pWBR100에 클로닝하였다. PCR은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72 ℃에서 중합과정 1분 30초의 조건으로 수행하였다.
PDC1 결손을 위하여 서열번호 5 및 서열번호 6의 프라이머를 이용하여 PCR을 수행한 뒤 BamHI, NcoI 제한효소를 이용하여 pWAL100에 클로닝하고, 서열번호 7 및 서열번호 8의 프라이머를 이용하여 PCR을 수행한 뒤 BamHI, NcoI 제한효소를 이용하여 pWBR100에 클로닝하였다. PCR은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72°C에서 중합과정 1분 30초의 조건으로 수행하였다.
또한, DLD1의 유전자 결손을 위하여 HIS3 마커 유전자를 double crossover로 도입하여 결손시켰다. 이에 사용된 DNA 단편은 야생형 효모의 genomic DNA를 주형으로 하는 PCR을 통해 수득하였으며 서열번호 9 및 서열번호 10의 프라이머를 이용하여 제조하였다. PCR은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72 ℃에서 중합과정 1분 30초의 조건으로 수행하였다.
상기 유전자 조작에 사용한 프라이머를 정리하면 하기 표 1과 같다.
젖산 생산 기반균주 제작을 위한 프라이머 서열
프라이머 5'-> 3' 서열
ADH1 upstream forward primer(서열번호 1) CGGGATCCACTGTAGCCCTAGACTTGATAGCC
ADH1 upstream reverse primer(서열번호 2) ATAAGAATGCGGCCGCTGTATATGAGATAGTTGATTGTATGCTT
ADH1 downstream forward primer(서열번호 3) GACTAGTGCGAATTTCTTATGATTTATGATTTTTATT
ADH1 downstream reverse primer(서열번호 4) ACATGCCATGgAAGCATGCACGTATACACTTGAGTAA
PDC1 upstream forward primer(서열번호 5) CGGGATCCATTATGTATGCTCTTCTGACTTTTCGT
PDC1 upstream reverse primer(서열번호 6) ATAAGAATGCGGCCGCTTTGATTGATTTGACTGTGTTATTTTGC
PDC1 downstream forward primer(서열번호 7) CGGGATCCGCGATTTAATCTCTAATTATTAGTTAAAG
PDC1 downstream reverse primer(서열번호 8) ATAAGAATGCGGCCGCTTTCAATCATTGGAGCAATCATTTTACA
DLD1-HIS3 upstream linking primer(서열번호 9) GCGTAGTTGGCCCCAACTGGTGCAGTAATACGTTTTAAGAGCTTGGTGAG
DLD1-HIS3 downstream linking primer(서열번호 10) CGTGAAGGGTGAAAAAGGAAAATCAGATACCTACATAAGAACACCTTTGG
상기와 같이 3개의 유전자 (ADH1, PDC1, 및 DLD1)를 결손시킨 균주를 바탕으로, 젖산 생산을 위한 유전자인 D-젖산 탈수소효소(d-lactate dehydrogenase, D-LDH)를 도입하였다. S. cerevisiae 유래의 TEF1 프로모터와 CYC1 터미네이터 사이에 락토바실러스 플란타럼(Lb. plantarum) 유래 ldhD 유전자를 함유하도록 각각 5' 및 3' 말단에 p413TEF1 벡터에 클로닝하였으며, 여기서 Sax/PvuⅡ의 이중 절단으로 insert를 준비하였다. 그리고 벡터는 p-δ-neo에서 BamH/NotⅠ으로 이중 절단된 DNA 절편에서 Mungbean nuclease로 blunt end를 만든 다음, 다시 Sac로 처리하여 Sac stick end와 BamH blunt end를 갖는 벡터 부분을 만들었다.
상기의 과정으로 수득한 벡터와 insert를 라이게이션하여, pTL573 벡터를 완성하였다. 이 완성 벡터를 pTL573으로 명명하였다. pTL573 플라스미드는 Lb. plantarum 유래 ldhD 유전자를 포함하고 있으며, S. cerevisiae CEN.PK2-1D pdc1 adh1 dld1 균주의 retrotransposable element 중 일부 영역인 δ-sequence에 무작위적으로 다수의 카피가 삽입되도록 설계되었다. 해당 유전자의 다중 삽입을 위하여 플라스미드 pTL573을 Sal 제한효소로 절단하여, δ-sequence 상에 single crossover를 유도하는 DNA 단편을 제작하였다. 이를 형질전환으로 모균주 내에 도입하여 최대 5 ㎎/㎖ G418 농도의 YPD (1 % yeast extract, 2% bacto-peptone, 2% glucose) 배지에서 다수의 콜로니들을 얻었다. 이렇게 얻어진 균주는 최종적으로 D형 젖산 생산능 부여를 위해 락토바실러스 플란타럼(Lb. plantarum) 유래의 D-LDH가 복수로 삽입되어 있는 것을 확인하였으며, 이를 CC02-0064 균주라 명명하였다.
실시예 2: PDC 역가 감소 혹은 불활성화 균주의 제작
기반 균주인 상기 실시예 1에서 제조된 CC02-0064 균주에 PDC isozyme인 PDC5를 결손한 균주 및 PDC5와 PDC6를 모두 결손한 균주를 제작함으로써 PDC의 역가를 감소 혹은 불활성화한 균주를 제작하였다.
구체적으로, 효모의 상기 유전자 결손을 위하여, pWAL100 및 pWBR100 플라스미드 (J. Microbiol. Biotechnol., (2006) 16(6), 979-982)를 이용하였다.
PDC5 결손을 위하여 서열번호 11 및 서열번호 12의 프라이머를 이용하여 PCR을 수행한 뒤 BamHI, NotI 제한효소를 이용하여 pWAL100에 클로닝하고, 서열번호 13 및 서열번호 14의 프라이머를 이용하여 PCR을 수행한 뒤 SpeI, NcoI 제한효소를 이용하여 pWBR100에 클로닝하였다. PCR은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72 ℃에서 중합과정 1분 30초의 조건으로 수행하였다.
PDC6 결손을 위하여 서열번호 15 및 서열번호 16의 프라이머를 이용하여 PCR을 수행한 뒤 BamHI, NcoI 제한효소를 이용하여 pWAL100에 클로닝하고, 서열번호 17 및 서열번호 18의 프라이머를 이용하여 PCR을 수행한 뒤 BamHI, NcoI 제한효소를 이용하여 pWBR100에 클로닝하였다. PCR은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72 ℃에서 중합과정 1분 30초의 조건으로 수행하였다.
PDC isozyme 결손을 위한 프라이머 서열
프라이머 5'-> 3' 서열
F-ALPDC5-BamHI(서열번호 11) GAGCTCGGATCCAAGGAAATAAAGCAAATAACAATAACACC
R-ALPDC5-NotI(서열번호 12) ACCATGGCGGCCGCTTTGTTCTTCTTGTTATTGTATTGTGTTG
F-BRPDC5-SpeI(서열번호 13) GGATCCACTAGTGCTAATTAACATAAAACTCATGATTCAACG
R-BRPDC5-NcoI(서열번호 14) CAGCTGCCATGGTATTCTAAATAAGATGTAAGGCCTTGTAAT
F-ALPDC6-BamHI(서열번호 15) GAGCTCGGATCCATTAAAATCATGGAAATTAAGTATTACAG
R-ALPDC6-NcoI(서열번호 16) CAGCTGCCATGGTTTGTTGGCAATATGTTTTTGCTATATTA
F-BRPDC6-BamHI(서열번호 17) GAGCTCGGATCCGCCATTAGTAGTGTACTCAAACGAATTA
R-BRPDC6-NcoI(서열번호 18) CAGCTGCCATGGACCTCAAAACATTCTTTTCAATCTTAACC
상기와 같이 제작한 신규 균주를 각각 CC02-0256 및 CC02-0553으로 명명하였고, 상기 신규 균주의 유전 형질을 정리하면 하기의 표 3과 같다.
PDC 활성이 감소 혹은 불활성화된 균주
균주명 유전형질
CC02-0256 Saccharomyces cerevisiae δ:: ldhD adh1 △ dld1 △ pdc1 △ pdc5 △
CC02-0553 Saccharomyces cerevisiae δ:: ldhD adh1 △ dld1 △ pdc1 △ pdc5 △ pdc6 △
실시예 3: PDC 활성 감소 및 불활성화 균주의 젖산 발효 평가
균주의 평가를 위하여 사용된 배지는 효모용 제한 배지인 SC 배지 (Synthetic Complex media)이다. 해당 배지를 제작하기 위하여 0.67 % yeast nitrogen base without amino acid를 기반으로 여기에 아미노산 dropout mix (Sigma)를 제조사의 프로토콜에 따라 혼합하고 필요에 따라, 제외된 아미노산을 첨가하였다. 류신 (leucine)은 380 ㎎/L, 우라실(Uracil), 트립토판(Tryptophan) 및 히스티딘(Histidine)은 76 ㎎/L가 되게 첨가하였고, 탄소원으로서 포도당 8%와 중화제로서 1% CaCO3를 첨가하였다. 이렇게 제조한 배지를 효모 균주 젖산 발효 평가에 이용하였다.
균주의 젖산 발효능 평가를 위한 조건은 제작된 젖산 발효평가용 배지를 한 플라스크당 25 ㎖로 분주하여 효모균을 접종하고 30 에서 48 시간 동안 호기배양한 뒤 발효액에 존재하는 젖산의 양을 HPLC 분석하였다.
상기 실험의 결과를 정리하면 하기 표 4와 같다.
PDC 활성 감소 및 불활성화 균주의 발효 결과 비교
균주 OD(600nm) 소모당(g/L) 젖산(g/L) 수율(%) 생산성(g/L/h)
CC02-0064 10.5 75.5 36.5 48.4 0.76
CC02-0256 3.6 49.5 29.1 58.7 0.61
CC02-0553 2.6 34.5 20.8 60.2 0.43
그 결과, 상기 표 4에서 확인할 수 있듯이, PDC의 활성이 감소함에 따라 그 수율이 증가하였으나, 생산성은 감소하는 결과를 보였다.
실시예 4: PDC 불활성화 균주 기반의 ACL (ATP-Citrate Lyase ) 도입, 및 PCK1 ( Phosphoenolpyruvate carboxykinase 1) 및 PYK2 ( Pyruvate kinase 2)가 강화된 균주의 제작
(1) 외래 ACL을 젖산 생산 균주에 도입하기 위한 벡터 제작
외래의 ACL 효소를 도입하고 피루베이트 생합성 경로 중 하나인 PCK1과 PYK2를 동시에 과발현하기 위한 재조합 벡터를 제작하였다.
외래의 ACL은 포유류 Mus musculus 유래의 유전자를 사용하였으며, 해당 유전자는 NCBI (Accession no. NP_001186225)에서 확인하였다.
구체적으로 서열번호 29의 아미노산 서열 (서열번호 30의 염기서열)로 합성하였으며, 효모용 유전자 발현벡터인 pRS415를 기반으로 GPD 프로모터를 사용하여 벡터를 제작하여, 상기 유전자가 삽입된 벡터를 p415GPDpro-ACL이라 명명하였다.
(2) pyruvate 생합성 경로 강화를 위한 PCK1 및 PYK2 강화 벡터 제작
피루베이트 생합성 경로 강화를 위한 PCK1 및 PYK2의 동시 과발현을 위한 재조합 벡터를 제작하였다.
PYK2는 효모 미생물 내 존재하는 유전자로 서열번호 33으로 표시될 수 있다. 서열번호 19 및 20의 프라이머를 이용하여, S. cerevisiae genomic DNA를 주형으로 PCR을 수행하였으며, PYK2유전자 절편을 수득하였다. PCR은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72 ℃에서 중합과정 1분 30초의 조건으로 수행하였다. 상기 유전자 절편과 pRS416 유래의 효모 발현벡터 내 제한효소 SpeI, XhoI을 이용하여 클로닝하였고, TEF1 프로모터를 이용하여 과발현되도록 하였다. 해당 재조합 벡터는 pRS416-TEF1pro-PYK2라 명명하였다.
PCK1 역시 효모 미생물 내 존재하는 유전자로 서열번호 31로 표시될 수 있다. 서열번호 23 및 24의 프라이머를 이용하여 S. cerevisiae genomic DNA를 주형으로 하는 PCR을 수행하여 PCK1 유전자 절편을 수득하였다. PCR은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72 ℃에서 중합과정 1분 30초의 조건으로 수행하였다. PCK1이 TEF2 프로모터를 이용하여 발현될 수 있도록 서열번호 21 및 22의 프라이머로 S. cerevisiae genomic DNA를 주형으로 하여 PCK1 절편을 수득한 조건과 동일한 조건으로 PCR을 수행하였고, TEF2 프로모터 절편을 수득하였다. 이후 PCK1과 PYK2가 한 개의 재조합 벡터에서 동시에 발현될 수 있도록 하기 위해, 상기에서 제조한 pRS416-TEF1pro-PYK2 재조합 벡터를 XhoI으로 절단한 후, 그 사이에 수득한 TEF2 프로모터 절편과 PCK1 절편을 Clontech 사의 In-Fusion cloning kit를 이용하여 클로닝하였다. 최종적으로는 PCK1과 PYK2를 각각 TEF2, TEF1 프로모터로 과발현할 수 있는 한 개의 재조합 벡터를 제작하였고, 이를 pRS416-TEF1pro-PYK2-TEF2pro-PCK1이라 명명하였다. 본 실시예의 PCK1과 PYK2 과발현 벡터 제작에 사용된 프라이머를 정리하면 하기 표 5과 같다.
PCK1과 PYK2 과발현 벡터 제작에 사용된 프라이머
프라이머 5'-> 3' 서열
F-PYK2-SpeI(서열번호 19) AAAACTAGTATGCCAGAGTCCAGATTGCAGAGA
R-PYK2-XhoI(서열번호 20) AAAACTCGAGCTAGAATTCTTGACCAACAGTAGAAAT
F-PYK2-ADH1t-infusion(서열번호 21) TGTTGGTCAAGAATTCTAGGCGAATTTCTTATGATTTATGAT
R-TEF2p-PCK1-infusion(서열번호 22) TTCATTTTAGAAGGGGACATGTTTAGTTAATTATAGTTCGTTGAC
F-PCK1-TEF2-infusion(서열번호 23) AACGAACTATAATTAACTAAACATGTCCCCTTCTAAAATGAATGCT
R-PCK1-infusion(서열번호 24) ATAACTAATTACATGACTCGAGTTACTCGAATTGAGGACCAGCGGC
(3) PDC가 불활성화된 젖산 균주에 외래 ACL 도입, 및 PCK1 및 PYK2 강화된 균주 제작
상기 실시예 2에서 제조한 CC02-0553 균주를 기반으로, 실시예 4-(1)에서 제작된 외래 ACL 도입, 및 실시예 4-(2)에서 제작된 PCK1/PYK2 동시 과발현 벡터를 형질전환을 통하여 삽입하였다.
형질 전환은 YPD (1 % yeast extract, 2% bacto-peptone, 2% glucose) 배지에서 18시간 키운 CC02-0553 균주를 0.1M Lithum Acetate, 0.01M Tris-HCl, 0.001M EDTA가 첨가된 용액 (이하 LiAc/TE 버퍼)을 처리한 후, 40% PEG가 첨가된 LiAc/TE 버퍼와 함께 42 ℃에서 15분간 열처리하여 재조합 벡터가 삽입될 수 있도록 하는 방법을 사용하였다. 이를 통해 제작된 균주를 각각 CC02-0652, CC02-0765로 명명하였고, 이의 유전 형질을 정리하면 하기의 표 6과 같다.
PDC 역가 불활성화 균주 기반의 ACL도입 및 PCK1 및 PYK2 강화된 균주
균주명 유전형질
CC02-0652 CC02-0553 pRS415-GPDpro-ACL
CC02-0765 CC02-0553 pRS415-GPDpro-ACL, pRS416-TEF1p-PYK2-TEF2p-PCK1
실시예 5: PDC 불활성화 균주 기반의 ACL도입 , 및 PCK1 및 PYK2 강화된 균주의 발효 평가
상기 실시예 4-(3)에서 제조한 PDC 역가 불활성화 균주에서의 ACL-PCK1-PYK2 강화 균주 평가를, 상기 실시예 3에서 사용한 방법과 동일하게 적용하여, 젖산 발효능을 평가하였다. 상기 실험의 결과를 정리하면 하기 표 7과 같다.
PDC 역가 불활성화 균주 기반의 ACL 도입, 및 PCK1 및 PYK2 강화된 균주 평가
균주 OD(600nm) 소모당(g/L) 젖산(g/L) 수율(%) 생산성(g/L/h)
CC02-0553 2.6 34.5 20.8 60.2 0.43
CC02-0652 5.0 56.0 31.6 62.5 0.66
CC02-0765 6.1 69.1 45.6 66.0 0.95
그 결과, 상기 표 7에서 확인할 수 있듯이, PDC불활성화 균주에 외래 ACL을 도입하고 PCK1 및 PYK2를 강화한 결과, PDC 불활성화 균주 대비 균체 생장인 OD600 값이 130% 증가하고, 동시간 소모한 포도당의 양은 100% 증가하였으며, 젖산의 발효 수율도 10% 향상되었다. 또한, 젖산의 생산성은 최종적으로 120% 향상하였다. CC02-0652 균주의 젖산 발효 결과를 통해, 외래의 ACL 도입시 새로운 경로의 아세틸-CoA 생산으로 인한 효모 미생물의 생장 강화 효과를 확인할 수 있었다. 또한, 생장 강화뿐 아니라 생산성도 증가하는 것을 확인할 수 있었다.
아울러, CC02-0765 균주의 젖산 발효 결과를 통해, 피루베이트 생합성 강화를 통해 추가적으로 젖산 발효의 생산성을 높일 수 있음을 확인하여, 본 발명의 새로운 경로의 아세틸-CoA 생산 및 피루베이트 생합성 강화 전략을 통한 젖산 생산 방법은 기존 기술과 달리, 젖산 발효 수율 증가, 생산 미생물의 생장 강화뿐 아니라 젖산 발효 생산성까지 증가시키는 방법임을 확인하였다.
이에, CC02-0765 균주를 부다페스트 조약 하에 국제기탁기관인 한국미생물보존센터 (KCCM)에 2014년 11월 28일자에 기탁하여 수탁번호 KCCM 11616P를 부여받았다.
실시예 6: PDC 불활성화 균주 기반의 ACL 도입, 및 MDH2 ( Malate dehydrogenase2) 및 cytosolic MAE1 ( Malic emzyme 1)이 강화된 균주의 제작
상기 실시예 5의 결과를 통해, 외래 ACL 도입을 통한 새로운 경로의 아세틸-CoA 생산 및 피루베이트 생합성 강화 전략이 효과적인 젖산 발효 수율 증가, 생산 미생물의 생장 강화 및 젖산 발효 생산성 증가 방법임을 확인하여, 다른 유전자들을 이용한 피루베이트 생합성 강화 시에도 이와 같은 결과가 있는지 확인하고자 하였다.
(1) MDH2 및 cytosolic MAE1 강화된 벡터 제작
외래 ACL 도입에 의해 생성된 OAA는 또 다른 경로를 이용하여 피루베이트로 생합성 될 수 있는데, 본래 세포 기질 (cytosol)에 위치하는 MDH2를 과발현하고, 미토콘드리아 내에 위치하는 효소인 MAE1을 cytosol로 위치를 변경하여 과발현하고자 하였다. 이를 위해 재조합 벡터를 제작하였다.
MDH2는 효모 미생물 내 존재하는 유전자로 서열번호 35의 아미노산 서열로 표시될 수 있다. 서열번호 25 및 26의 프라이머를 이용하여 S. cerevisiae genomic DNA를 주형으로 하는 PCR을 수행하여 MDH2 유전자 절편을 수득하였다. PCR은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72 ℃에서 중합과정 1분의 조건으로 수행하였다. 수득한 MDH2 유전자 절편을 SpeI, XhoI 제한효소를 이용하여 pRS414 벡터를 기반으로 클로닝하고, 이때 TEF1 프로모터를 이용하여 과발현 되도록 하였다. 이를 통해 제작된 재조합 벡터는 pRS414-TEF1pro-MDH2로 명명하였다.
MAE1은 효모 미생물 내에서 본래 미토콘드리아에 위치하는 효소로 서열번호 37의 아미노산 서열로 표시될 수 있다. MAE1을 cytosol에서 발현하기 위하여, 상기 유전자의 시작 코돈으로부터 90개 염기서열로 구성된 mitochondrial target sequence (아미노산 서열은 서열번호 51임)를 제외하고 클로닝하였다. 서열번호 27 및 28의 프라이머를 이용하여 S. cerevisiae genomic DNA를 주형으로 PCR을 수행하였으며 그 조건은 95 ℃에서 열변성 과정 5분, 53 ℃에서 결합과정 1분, 72 ℃에서 중합과정 2분과 같다. 얻어진 PCR 절편을 SpeI, XmaI 제한효소를 이용하여 pRS416 벡터를 기반으로 클로닝 하였다. 서열번호 27의 프라이머의 제작방법은 MAE1 ORF 시작코돈부터 90개의 염기서열을 제거하기 위해 91번째 염기서열부터 수득될 수 있도록 하였다. 또한 상기 cytosolic MAE1이 TEF1 프로모터를 이용하여 과발현 되도록 하였다. 이를 통해 제작된 재조합 벡터는 pRS416-TEF1pro-cytosolic MAE1로 명명하였다. pRS414-TEF1pro-MDH2 및 pRS416-TEF1pro-cytosolic MAE1 재조합 벡터 제작에 사용된 프라이머를 정리하면 하기 표 8과 같다.
MDH2와 cytosolic MAE1을 과발현하기 위한 프라이머
프라이머 5'-> 3' 서열
F-MDH2-SpeI(서열번호 25) CTAGAACTAGTATGCCTCACTCAGTTACACCATCCATA
R-MDH2-XhoI(서열번호26) GGGGGCCCGGGTTAAGATGATGCAGATCTCGATGCAAC
F-cytMAE1-SpeI(서열번호 27) TTTCTAGAACTAGTATGTGGCCTATTCAGCAATCGCGTT
R-cytMAE1-XmaI(서열번호 28) AGAGACCCGGGCTACAATTGGTTGGTGTGCACCGAT
(2) PDC가 불활성화된 젖산 균주에 MDH2 및 cytosolic MAE1 강화된 균주 제작
상기 실시예 2에서 제조한 CC02-0553 균주를 기반으로, 실시예 4-(1)에서 제작된 외래 ACL 도입 벡터 및 실시예 6-(1)에서 제작된 MDH2 과발현 벡터와 cytosolic MAE1 과발현 벡터를 형질전환을 통하여 삽입하였다. 형질전환은 상기 실시예 4-(3)에서 설명된 방법을 사용하였다. 상기 제조된 균주를 CC02-0821로 명명하였고, 이의 유전 형질을 정리하면 하기의 표 9와 같다.
PDC 불활성화 균주 ACL도입 및 MDH2 및 cytosolic MAE1 강화균주
균주명 유전형질
CC02-0821 CC02-0553 pRS415-GPDpro-ACL, pRS414-TEF1pro-MDH2, pRS416-TEF1pro-cytosolic MAE1
실시예 7. PDC 불활성화 균주 기반의 ACL 도입, 및 MDH2 및 cytosolic MAE1이 강화된 균주의 발효 평가
상기 실시예 6에서 제조된 PDC 불활성화 균주에서의 ACL-MDH2-cytosolic MAE1 강화를 통한 젖산 생산성 강화주 평가를 상기 실시예 2에서 사용한 방법으로 젖산 발효능을 평가하였다. 상기 실험의 결과를 정리하면 표 10과 같다.
PDC 불활성화 균주 기반의 ACL-MDH2-cytosolic MAE1 강화균주 발효 평가
균주 OD(600nm) 소모당(g/L) 젖산(g/L) 수율(%) 생산성(g/L/h)
CC02-0553 2.6 34.5 20.8 60.2 0.43
CC02-0652 5.0 56.0 31.6 62.5 0.66
CC02-0821 5.4 62.1 39.7 64.0 0.82
그 결과, 상기 표 10에서 나타낸 바와 같이, MDH2 및 cytosolic MAE1의 과발현을 통하여 피루베이트의 생합성을 강화한 CC02-0821 균주의 발효평가 결과 역시, CC02-0765와 마찬가지로 PDC 활성이 제거된 균주 대비 균체 생장인 OD600 값이 110% 증가하고, 동시간 소모한 포도당의 양은 80% 증가하였으며, 젖산의 발효 수율도 6% 향상되었다. 또한, 젖산의 생산성은 최종적으로 90% 향상된 효과를 나타내었다. 본 결과를 통하여 효모 미생물에서 젖산 생산성의 향상을 위해 외래 ACL의 도입뿐 아니라 다양한 경로를 통하여 피루베이트 생합성 경로를 강화하는 것이 추가적인 젖산 생산성 향상에 효과가 있음을 확인하였다.
실시예 8: PDC 활성이 감소된 균주에서의 ACL 도입, 및 PCK1 및 PYK2 강화 균주 및 MDH2 및 cytosolic MAE1이 강화된 균주의 제작
상기 실시예들의 결과를 종합하여 PDC의 역가가 제거된 균주에서 외래 ACL 도입 및 피루베이트 생합성 경로의 강화를 통해 효모 미생물에서 젖산 발효 생산성을 높일 수 있음을 확인하였다. 이에 PDC 역가가 제거된 균주 뿐 아니라 PDC의 역가가 감소된 균주에서도 동일한 결과를 얻을 수 있는지에 대한 검증을 진행하였다.
상기 실시예 2에서 제조된 PDC 활성 감소 균주인 CC02-0256을 기반으로 상기 실시예 4에서 제작한 재조합 벡터인 pRS415-GPDpro-ACL, pRS416-TEF1pro-PYK2-TEF2p-PCK1를 실시예 4-(3)과 동일한 방법으로 삽입하였고, 제작된 균주를 각각 CC02-0819, CC02-0820로 명명하였다. 아울러, 상기 실시예 2에 제조된 PDC 활성 감소 균주인 CC02-0256을 기반으로 상기 실시예 4에서 제작한 재조합 벡터인 pRS415-GPDpro-ACL과 상기 실시예 6-(1)에서 제작한 재조합 벡터인 pRS414-TEF1pro-MDH2, pRS416-TEF1pro-cytosolic MAE1를 상기 실시예 4-(3)과 같은 방법으로 삽입하였다. 제작된 균주를 CC02-0831로 명명하였다. 이의 형질은 하기 표 11에 정리하였다.
PDC 활성이 감소된 CC02-0256 균주 기반의 ACL 도입, 및 피루베이트 생합성 경로 강화 균주
균주명 유전형질
CC02-0819 CC02-0256 pRS415-GPDpro-ACL
CC02-0820 CC02-0256 pRS415-GPDpro-ACL, pRS416-TEF1p-PYK2-TEF2p-PCK1
CC02-0831 CC02-0256 pRS415-GPDpro-ACL, pRS414-TEF1pro-MDH2, pRS416-TEF1pro-cytosolic MAE1
실시예 9: PDC 활성이 감소된 균주에서의 ACL 도입, 및 PCK1 및 PYK2 강화 균주 발효 평가
상기 실시예 8에서 제조한 CC02-0819, CC02-0820 균주를 대조군인 CC02-0256과 함께 상기 실시예 3에서 사용한 방법으로 젖산 발효능을 평가하였다. 상기 실험의 결과를 정리하면 표 12와 같다.
PDC 역가가 감소된 균주 기반의 ACL 도입 및 PCK1 및 PYK2 강화 균주 발효 평가
균주 OD(600nm) 소모당(g/L) 젖산(g/L) 수율(%) 생산성(g/L/h)
CC02-0256 3.6 49.5 29.1 58.7 0.61
CC02-0819 5.9 60.1 35.7 59.4 0.74
CC02-0820 6.6 69.8 41.9 60.1 0.87
그 결과, 상기 표 12에 나타낸 바와 같이, CC02-0256은 외래 ACL 도입 및 피루베이트 생합성 경로의 강화 효과가 CC02-0553에서처럼 큰 폭으로 생산성이 증가하지는 않았으나, 역시 젖산 발효 수율 향상, 생산 미생물의 균체 생장 증가 및 젖산 발효 생산성이 증가하였다.
외래 ACL 도입, 및 PCK1 및 PYK2가 강화된 CC02-0820의 경우, PDC 역가가 감소된 균주 대비 균체 생장인 OD600 값이 80% 증가하고, 동시간 소모한 포도당의 양은 40% 증가하였으며, 젖산의 발효 수율도 2% 향상되었다. 또한, 젖산의 생산성은 최종적으로 40% 향상된 효과를 나타내었다. 상기 CC02-0820은 외래 ACL만이 도입된 균주 CC02-0819에 대비하여서도 OD, 동시간 소모한 포도당, 젖산 발효 수율 모두 향상되었으며, 생산성은 20% 증가하였다.
실시예 10: PDC 활성이 감소된 균주에서의 ACL 도입, 및 MDH2 및 cytosolic MAE1이 강화된 균주의 발효 평가 비교
상기 실시예 8에서 제조한 CC02-0831 균주는 대조군인 CC02-0256, CC02-0819과 함께 상기 실시예 3에서 사용한 방법으로 젖산 발효능을 평가하였다. 상기 실험의 결과를 정리하면 표 13과 같다.
PDC 역가가 감소된 균주 기반의 ACL 도입, 및 MDH2 및 cytosolic MAE1 강화균주 발효 평가
균주 OD(600nm) 소모당(g/L) 젖산(g/L) 수율(%) 생산성(g/L/h)
CC02-0256 3.6 49.5 29.1 58.7 0.61
CC02-0819 5.9 60.1 35.7 59.4 0.74
CC02-0831 6.3 66.2 39.8 60.1 0.82
그 결과, 상기 표 13에 나타낸 바와 같이, 외래 ACL 도입, 및 MDH2, cytosolic MAE1이 강화된 CC02-0831의 경우, 모균주인 CC02-0256 대비 OD600 값이 80% 증가하고, 동시간 소모한 포도당의 양은 30% 증가하였으며, 젖산의 발효 수율도 2% 향상되었다. 또한, 젖산의 생산성은 최종적으로 30% 향상된 효과를 나타내었다. 상기 CC02-0831은 외래 ACL만이 도입된 균주 CC02-0819에 대비하여서도 OD, 동시간 소모한 포도당, 젖산 발효수율 모두 향상되었으며, 생산성은 20% 증가 하였다.
상기와 같은 결과들은 본 발명의 새로운 경로의 아세틸-CoA 생산 및 피루베이트 생합성 강화 전략을 통한 젖산 생산 방법은 기존 기술과 달리, 젖산 발효 수율 증가, 생산 미생물의 생장 강화뿐 아니라 젖산 발효 생산성까지 증가시키는 방법임을 뒷받침하는 것이다. 특히, PDC 활성이 감소 또는 불활성화된 상태에서 외래 ACL 도입에 의한 새로운 경로의 아세틸-CoA 생산 및 피루베이트 생합성 강화 전략을 통하여 제조된 미생물이, 젖산 발효 수율 증가, 생산 미생물의 생장 강화뿐 아니라 젖산 발효 생산성까지 증가시켜, 우수한 젖산 생산 미생물로 제공될 수 있음을 시사하는 것이다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2016006187-appb-I000001

Claims (12)

  1. 피루베이트 디카르복실라아제 (Pyruvate decarboxylase, PDC)의 활성이 내재적 활성에 비해 불활성화되고, ATP-시트르산 분해효소 (ATP-citrate lyase, ACL) 활성이 도입되고, 피루베이트 생합성 경로가 내재적 생합성 경로에 비하여 강화되도록 변이된, 젖산 생산능을 갖는 사카로마이세스 속 (Saccharomyces sp.) 미생물.
  2. 제1항에 있어서, 상기 피루베이트 생합성 경로의 강화는 포스포에놀 피루베이트 카르복시키나아제 1 (Phosphoenolpyruvate carboxykinase 1, PCK1) 또는 피루베이트 키나아제 2 (Pyruvate kinase 2, PYK2), 또는 모두의 활성이 내재적 활성에 비하여 강화되도록 변이시킨, 미생물.
  3. 제1항에 있어서, 상기 피루베이트 생합성 경로의 강화는 말레이트 디히드로게네이즈 2 (Malate dehydrogenase 2, MDH2) 또는 세포 기질 말릭 효소 1 (cytosolic Malic enzyme 1, cytosolic MAE1), 또는 모두의 활성이 내재적 활성에 비하여 강화되도록 변이시킨, 미생물.
  4. 제1항에 있어서, 상기 피루베이트 디카르복실라아제는 서열번호 39, 41, 및 43의 아미노산 서열로 이루어진 군에서 선택된 1개 이상의 아미노산 서열로 기재되는 효소인, 미생물.
  5. 제1항에 있어서, 상기 ATP-시트르산 분해효소는 서열번호 29의 아미노산 서열로 기재되는 효소인, 미생물.
  6. 제2항에 있어서, 상기 포스포에놀 피루베이트 카르복시키나아제 1은 서열번호 31의 아미노산의 서열로 기재되는 효소이며, 피루베이트 키나아제 2는 서열번호 33의 서열로 기재되는 효소인, 미생물.
  7. 제3항에 있어서, 상기 말레이트 디히드로게네이즈 2는 서열번호 35의 아미노산 서열로 기재되는 효소이며, 세포 기질 말릭 효소 1은 서열번호 37의 아미노산 서열 또는 서열번호 52의 아미노산 서열로 기재되는 효소인, 미생물.
  8. 제1항에 있어서, 상기 미생물은 추가적으로 락테이트 디히드로게네이즈 (Lactate dehydrogenase, LDH) 활성이 도입된, 미생물.
  9. 제8항에 있어서, 상기 락테이트 디히드로게네이즈는 서열번호 49의 아미노산 서열로 기재되는 효소인, 미생물.
  10. 제1항에 있어서, 상기 미생물은 추가적으로
    (i) 알코올 디히드로게네이즈 1 (Alcohol dehydrogenase 1, ADH1)의 활성이 내재적 활성에 비해 불활성화되도록 변이됨;
    (ii) 피루베이트 디카르복실라아제 1 (Pyruvate decarboxylase 1, PDC1)의 활성이 내재적 활성에 비해 불활성화되도록 변이됨; 및
    (iii) D-락테이트 디히드로게네이즈 1 (D-lactate dehydrogenase 1, DLD1)의 활성이 내재적 활성에 비해 불활성화되도록 변이된 것인, 미생물.
  11. 제1항에 있어서, 상기 사카로마이세스 속 미생물은 사카로마이세스 세레비지애 (Saccharomyces cerevisiase)인 미생물.
  12. (i) 제1항 내지 제11항 중 어느 한 항의 사카로마이세스 속 (Saccharomyces sp.) 미생물을 배지에서 배양하는 단계; 및
    (ii) 상기 배양에 따른 배지 또는 상기 미생물로부터 젖산을 회수하는 단계를 포함하는, 젖산 제조 방법.
PCT/KR2016/006187 2015-06-12 2016-06-10 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법 WO2016200207A1 (ko)

Priority Applications (9)

Application Number Priority Date Filing Date Title
AU2016277014A AU2016277014B2 (en) 2015-06-12 2016-06-10 Microorganism producing lactic acid and method for producing lactic acid using same
BR112017026596-6A BR112017026596B1 (pt) 2015-06-12 2016-06-10 Microrganismo do gênero saccharomyces e método para produzir ácido lático
PL16807847T PL3309254T3 (pl) 2015-06-12 2016-06-10 Mikroorganizm wytwarzający kwas mlekowy i sposób wytwarzania kwasu mlekowego przy jego zastosowaniu
CN201680034476.4A CN108138193A (zh) 2015-06-12 2016-06-10 产乳酸微生物及使用其生产乳酸的方法
EP16807847.5A EP3309254B1 (en) 2015-06-12 2016-06-10 Microorganism producing lactic acid and method for producing lactic acid using same
JP2017564351A JP6892395B2 (ja) 2015-06-12 2016-06-10 乳酸を生産する微生物及びそれを用いた乳酸の製造方法
MYPI2017001793A MY193411A (en) 2015-06-12 2016-06-10 Microorganism producing lactic acid and method for producing lactic acid using same
US15/735,074 US10227618B2 (en) 2015-06-12 2016-06-10 Microorganism producing lactic acid and method for producing lactic acid using same
RU2017145858A RU2711983C2 (ru) 2015-06-12 2016-06-10 Микроорганизм, продуцирующий молочную кислоту, и способ продуцирования молочной кислоты с его использованием

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0083658 2015-06-12
KR1020150083658A KR101704212B1 (ko) 2015-06-12 2015-06-12 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법

Publications (1)

Publication Number Publication Date
WO2016200207A1 true WO2016200207A1 (ko) 2016-12-15

Family

ID=57504247

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/006187 WO2016200207A1 (ko) 2015-06-12 2016-06-10 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법

Country Status (12)

Country Link
US (1) US10227618B2 (ko)
EP (1) EP3309254B1 (ko)
JP (2) JP6892395B2 (ko)
KR (1) KR101704212B1 (ko)
CN (1) CN108138193A (ko)
AU (1) AU2016277014B2 (ko)
BR (1) BR112017026596B1 (ko)
MY (1) MY193411A (ko)
PL (1) PL3309254T3 (ko)
RU (1) RU2711983C2 (ko)
TW (1) TWI608097B (ko)
WO (1) WO2016200207A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102120992B1 (ko) * 2019-05-03 2020-06-10 (주)위바이오트리 신규한 금속 층상수산화물 복합체 및 이의 제조방법
CN112789353A (zh) * 2018-10-08 2021-05-11 Sk新技术株式会社 抑制乙醇产生的重组耐酸酵母以及使用其制备乳酸的方法
JP2021520836A (ja) * 2018-04-17 2021-08-26 エスケー イノベーション カンパニー リミテッドＳｋ Ｉｎｎｏｖａｔｉｏｎ Ｃｏ．，Ｌｔｄ． エタノール生産経路が抑制された耐酸性酵母及びこれを用いた乳酸の製造方法

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TWI719317B (zh) * 2018-06-13 2021-02-21 遠東新世紀股份有限公司 用於生產乳酸的方法
TWI730383B (zh) * 2019-08-21 2021-06-11 遠東新世紀股份有限公司 重組型假絲酵母菌菌株及其製備方法與用途
KR20210158676A (ko) 2020-06-24 2021-12-31 에스케이이노베이션 주식회사 젖산 생산능이 증가된 재조합 내산성 효모
RU2752896C1 (ru) * 2020-12-04 2021-08-11 Федеральное государственное бюджетное учреждение "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов Национального исследовательского центра "Курчатовский институт" - ГосНИИгенетика) Штамм дрожжей Schizosaccharomyces pombe, продуцирующий L-молочную кислоту, содержащий в составе хромосомы гены трех различных гетерологичных лактатдегидрогеназ
JPWO2023286776A1 (ko) * 2021-07-13 2023-01-19
CN114854612B (zh) * 2022-03-25 2024-02-27 江南大学 一株产l-乳酸的酿酒酵母的改造及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101295369B1 (ko) * 2011-10-14 2013-08-09 한국화학연구원 Ｌ―형 젖산 생성 변이 균주 및 이를 이용한 젖산 제조 방법

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070031950A1 (en) * 1998-09-11 2007-02-08 Winkler Aaron A Production of D-lactic acid with yeast
US6485947B1 (en) * 1999-05-21 2002-11-26 Cargill Dow Polymers, Llc Production of lactate using crabtree negative organisms in varying culture conditions
CA2430270A1 (en) * 2000-11-22 2002-05-30 Cargill Dow Polymers, Llc Methods and materials for the synthesis of organic products
US20050112737A1 (en) * 2003-11-20 2005-05-26 A. E. Staley Manufacturing Co. Lactic acid producing yeast
RU2268304C1 (ru) * 2004-06-24 2006-01-20 Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП ГосНИИгенетика) Способ микробиологического синтеза молочной кислоты и рекомбинантный штамм дрожжей schizosaccharomyces pombe для его осуществления
EP1975232A4 (en) * 2005-10-14 2009-07-29 Toray Industries YEAST AND METHOD FOR THE PRODUCTION OF L-MILKY ACID
JP2013021940A (ja) * 2011-07-19 2013-02-04 Showa Denko Kk 遺伝子欠損酵母の製造方法
MX2014002787A (es) 2011-09-08 2014-12-08 Genomatica Inc Organismos eucarioticos y metodos para producir 1, 3 -butanodiol.
KR102208959B1 (ko) * 2013-08-09 2021-01-28 삼성전자주식회사 락테이트 데히드로게나제가 활성화된 효모 세포 및 그를 이용한 락테이트를 생산하는 방법
WO2015057154A2 (en) * 2013-10-18 2015-04-23 Biopetrolia Ab ENGINEERING OF ACETYL-CoA METABOLISM IN YEAST
KR20150078989A (ko) * 2013-12-31 2015-07-08 한화종합화학 주식회사 숙신산 생산용 재조합 효모균주 및 이를 이용한 숙신산의 제조방법
KR102163724B1 (ko) * 2014-02-13 2020-10-08 삼성전자주식회사 내산성을 갖는 효모 세포 및 이의 용도

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101295369B1 (ko) * 2011-10-14 2013-08-09 한국화학연구원 Ｌ―형 젖산 생성 변이 균주 및 이를 이용한 젖산 제조 방법

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
CAO, YUJIN ET AL.: "Fermentative Succinate Production: An Emerging Technology to Replace the Traditional Petrochemical Processes", BIOMED RESEARCH INTERNATIONAL, vol. 2013, 2013, pages 1 - 12, XP055093617 *
DATABASE NCBI [O] 11 February 2011 (2011-02-11), XP055333668, Database accession no. EGA85775.1 *
DATABASE NCBI [O] 15 February 2015 (2015-02-15), XP055333672, Database accession no. NP_598798.1 *
DATABASE NCBI [O] 18 February 2015 (2015-02-18), XP055333670, Database accession no. NP_013235.1 *
DATABASE NCBI [O] 18 February 2015 (2015-02-18), XP055333671, Database accession no. NP_011601.3 *
DATABASE NCBI [O] 18 February 2015 (2015-02-18), XP055333674, Database accession no. NP_013023.3 *
DATABASE NCBI [O] 18 February 2015 (2015-02-18), XP055333684, Database accession no. NP_014992.3 *
DATABASE NCBI [O] 18 February 2015 (2015-02-18), XP055333686, Database accession no. NP_014515.2 *
DATABASE NCBI [O] 18 February 2015 (2015-02-18), XP055333689, Database accession no. NP_012896.1 *
DATABASE NCBI [O] 3 June 2015 (2015-06-03), XP055333692, Database accession no. WP_003640741.1 *
ISHIDA, NOBUHIRO ET AL.: "The Effect of Pyruvate Decarboxylase Gene Knockout in Saccharomyces Cerevisiae on L-Lactic Acid Production", BIOSCIENCE, BIOTECHNOLOGY, AND BIOCHEMISTRY, vol. 70, no. 5, 2006, pages 1148 - 1153, XP008129166 *
LIAN, JIAZHANG ET AL.: "Recent Advances in Biosynthesis of Fatty Acids Derived Products in Saccharomyces Cerevisiae via Enhanced Supply of Precursor Metabolites", JOURNAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY, vol. 42, no. 3, 2014, pages 437 - 451, XP035446323 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2021520836A (ja) * 2018-04-17 2021-08-26 エスケー イノベーション カンパニー リミテッドＳｋ Ｉｎｎｏｖａｔｉｏｎ Ｃｏ．，Ｌｔｄ． エタノール生産経路が抑制された耐酸性酵母及びこれを用いた乳酸の製造方法
JP7395501B2 (ja) 2018-04-17 2023-12-11 エスケー イノベーション カンパニー リミテッド エタノール生産経路が抑制された耐酸性酵母及びこれを用いた乳酸の製造方法
CN112789353A (zh) * 2018-10-08 2021-05-11 Sk新技术株式会社 抑制乙醇产生的重组耐酸酵母以及使用其制备乳酸的方法
KR102120992B1 (ko) * 2019-05-03 2020-06-10 (주)위바이오트리 신규한 금속 층상수산화물 복합체 및 이의 제조방법

Also Published As

Publication number Publication date
AU2016277014A1 (en) 2017-12-14
JP6892395B2 (ja) 2021-06-23
US20180320206A1 (en) 2018-11-08
BR112017026596A2 (ko) 2018-08-14
RU2017145858A (ru) 2019-07-12
JP2020043867A (ja) 2020-03-26
RU2711983C2 (ru) 2020-01-23
EP3309254B1 (en) 2020-10-07
BR112017026596B1 (pt) 2024-02-06
MY193411A (en) 2022-10-12
JP2018518175A (ja) 2018-07-12
EP3309254A4 (en) 2018-10-31
TWI608097B (zh) 2017-12-11
KR20160147193A (ko) 2016-12-22
KR101704212B1 (ko) 2017-02-08
CN108138193A (zh) 2018-06-08
AU2016277014B2 (en) 2019-06-27
PL3309254T3 (pl) 2021-04-19
EP3309254A1 (en) 2018-04-18
US10227618B2 (en) 2019-03-12
TW201712116A (zh) 2017-04-01
RU2017145858A3 (ko) 2019-07-17

Similar Documents

Publication Publication Date Title
WO2016200207A1 (ko) 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법
KR101946649B1 (ko) 산화환원효소 활성을 갖는 폴리펩티드 및 그의 용도
WO2020111890A1 (ko) 바이오레티놀을 생산하는 미생물 및 이를 이용한 바이오레티놀의 생산방법
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
WO2015170914A1 (ko) 젖산 생산이 향상된 미생물 및 이를 이용하여 젖산을 생산하는 방법
WO2019203435A1 (ko) 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법
WO2013105802A2 (ko) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
WO2014003439A1 (ko) 에탄올 생산 경로가 봉쇄된 클루이베로마이세스 막시아누스 균주 및 이의 용도
WO2019035612A1 (ko) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
CN112725210A (zh) 抑制乳酸代谢和乙醇产生的重组耐酸酵母及使用其生产乳酸的方法
WO2012046924A1 (ko) 아라비노스 대사경로가 도입된 자일리톨 생산균주 및 이를 이용한 자일리톨 생산방법
WO2015156583A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2022145623A1 (ko) 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법
KR102617168B1 (ko) 쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법
US20110318795A1 (en) Dicarboxylic acid production in a filamentous fungus
WO2022149865A2 (ko) GlxR 단백질 변이체 또는 이를 이용한 쓰레오닌 생산방법
WO2016199966A1 (ko) 젖산 생산이 향상된 미생물 및 이를 이용하여 젖산을 생산하는 방법
KR101951557B1 (ko) 활성형 d-프롤린 리덕타제를 발현하는 미생물 및 활성형 d-프롤린 리덕타제를 생산하는 방법
WO2022098163A1 (ko) 포도당으로부터 3-히드록시프로피온산의 생산능을 가지는 미생물 및 이의 용도
WO2022260403A1 (ko) 슈퍼옥사이드 디스뮤테이즈 1 변이체 및 이를 이용한 글루타치온 또는 그 유도체의 생산방법
KR20150028121A (ko) Ｎａｄ＋ 의존성 포르메이트 데히드로게나제 유전자를 포함하는 코리네박테리움 및 이를 이용한 ｃ4 디카르복실산 생산 방법
KR101763820B1 (ko) 글리세롤의 생성이 억제된 2,3-부탄다이올이 생산방법
EP3394251B1 (en) Host cells for dicarboxylic acid production
WO2018212366A1 (ko) 캔디다 트로피칼리스 유래의 피루베이트 데카르복실라아제가 도입된 2,3-부탄다이올 생산용 재조합 효모 및 이를 이용한 2,3-부탄다이올의 생산방법
KR20150018227A (ko) 외인성 푸마라아제 유전자를 포함하는 코리네박테리움 및 이를 이용한 c4 디카르복실산의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16807847

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 15735074

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2017564351

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016277014

Country of ref document: AU

Date of ref document: 20160610

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017145858

Country of ref document: RU

Ref document number: 2016807847

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017026596

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112017026596

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20171208