WO2020180132A1 - D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법 - Google Patents

D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법 Download PDF

Info

Publication number
WO2020180132A1
WO2020180132A1 PCT/KR2020/003127 KR2020003127W WO2020180132A1 WO 2020180132 A1 WO2020180132 A1 WO 2020180132A1 KR 2020003127 W KR2020003127 W KR 2020003127W WO 2020180132 A1 WO2020180132 A1 WO 2020180132A1
Authority
WO
WIPO (PCT)
Prior art keywords
coli
strain
gene
glutamate
plasmid
Prior art date
Application number
PCT/KR2020/003127
Other languages
English (en)
French (fr)
Inventor
이대희
이승구
김성근
우승균
나유진
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2020180132A1 publication Critical patent/WO2020180132A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01047—GDP-mannose 4,6-dehydratase (4.2.1.47), i.e. GMD

Definitions

  • the present invention relates to D-glutamate auxotrophic Escherichia coli, a method for preparing the same, and a method for producing a target substance using the Escherichia coli.
  • known prokaryotic expression plasmids contain, in addition to one or several antibiotic resistance gene(s), an additional DNA sequence that is not necessary and imposes a burden on cellular metabolism.
  • These sequences are multipurpose vectors such as DNA sequences generated during the cloning process, and origins of replication of specific phages for the synthesis of single strand DNA and specific promoters, for example, for the in vitro synthesis of mRNA. It includes DNA fragments that are the remnants of, and broadly includes incompletely replicated vector sequences that may cause undesirable plasmid recombination.
  • plasmids especially expression vectors, places an additional metabolic burden on the cells. This provides the selection pressure to induce the generation of plasmid-free cells, which can be prevented by antibiotic selection.
  • the most commonly used selection marker for gene recombination of microorganisms is an antibiotic resistance gene.
  • Host cells having an antibiotic resistance gene can grow in a medium supplemented with antibiotics that can be degraded by the corresponding antibiotic resistance gene product, but cells that do not have the antibiotic resistance gene are killed by antibiotics, so that microorganisms can be selected.
  • antibiotics commonly used for screening such as ampicillin, tetracycline, kanamycin, and chloramphenicol
  • antibiotics added to the medium are easily degraded by externally secreted antibiotic resistance gene products. Accordingly, the stability of the plasmid is weakened, and the amount of protein expressed by the introduced foreign gene is reduced.
  • a protein to be expressed is related to a food additive, a process of removing antibiotics added during the culture period is required for expression.
  • IPTG isopropyl- ⁇ -D-thiogalactopyranoside
  • auxotrophic selection markers have emerged as an alternative to antibiotic screening, but some laboratories and The research institute introduced limited auxotrophic markers to yeast ( Saccharomyces cerevisiae ) (KR 10-2002-0096574 A, etc.), but was not applied to industrial yeast, and Escherichia coli , which is widely used in the production of useful products. In the case of, several cases of failure to introduce auxotrophic markers have been reported, and even the developed strains are extremely limited in industrial application.
  • the present inventors produced D-glutamate auxotrophic Escherichia coli as a result of intensive research efforts, and confirmed that the produced Escherichia coli has fewer reverting mutants and maintains high plasmid stability and protein productivity.
  • the present invention was completed by confirming that the method for producing D-glutamate auxotrophic E. coli of the present invention can be applied to various E. coli strains.
  • Another object of the present invention is to provide a method for producing the E. coli.
  • Another object of the present invention is to provide a composition for producing a target substance, including the E. coli.
  • Another object of the present invention is to provide a method for producing a target substance, comprising the step of culturing the E. coli.
  • the D-glutamate auxotrophic Escherichia coli of the present invention has fewer revertants, maintains high plasmid stability and protein productivity, and can effectively produce useful products without the use of antibiotics, and can be applied to clean production of useful products including proteins. Do.
  • FIG. 1 schematically shows the process of introducing a mutant gltS gene ( mGltS ) while deleting the murI gene using homologous recombination in E. coli DH5 ⁇ strain. Since FRT sites exist on both sides of the CAT gene, the CAT gene is removed by flippase.
  • FIG. 2A shows the amplification product of 953bp in the D-glutamate auxotrophic candidate strain by performing PCR using pMurOut-F and pMurIn-R primers.
  • M is a DNA marker and Neg is a wild type DH5 ⁇ .
  • 2B is a result of culturing the recombinant strain in an LB medium containing (+) or not (-) 50 ⁇ g/mL of D-glutamate for 24 hours.
  • FIG. 3 is a result of culturing DH5 ⁇ KI or WM335 strain in LB, 2XYT, or TB medium containing (+) or not containing D-glutamate 50 ⁇ g/mL, and measuring OD 600 values.
  • Figure 5 shows the GFP protein expression was confirmed after constructing the pT-GFP-DAAT plasmid without using an antibiotic in the DH5 ⁇ KI strain.
  • V amplification from pT-GFP
  • I amplification from pGESS-DAAT
  • Figure 6 is the growth and fluorescence according to the IPTG concentration of the DH5 ⁇ KI strain (Antibiotic-free selection) introduced with the pT-GFP-DAAT plasmid or the wild-type DH5 ⁇ strain (Antibiotics selection) introduced the pT-GFP plasmid containing the ampicillin resistance gene. It is a curve.
  • Figure 7 relates to the production of (-)- ⁇ -bisabolol using the DH5 ⁇ KI strain
  • Figure 7A is a schematic diagram of the (-)- ⁇ -bisabolol production pathway and plasmid
  • Figure 7B is a low (-)- ⁇ -bisabolol Cell growth (OD 600 ; bar graph) and (-)- ⁇ -bisabolol production (line graph) during the passage of the production strain will be measured
  • Figure 7C is a high (-)- ⁇ -bisabolol production strain of Cell growth (OD 600 ; bar graph) and (-)- ⁇ -bisabolol production (line graph) were measured during the subculture process.
  • FIG. 8 is a measurement of single cell fluorescence of the GFP protein fluorescence of the strains of FIG. 7 using a flow cytometer.
  • Figure 9 relates to the production of (-)- ⁇ -bisabolol using WM335, the strain growth bar graph, (-)- ⁇ -bisabolol production amount is shown as a line graph.
  • 9A is a measurement result of a low (-)- ⁇ -bisabolol-producing strain
  • FIG. 9B is a measurement result of a high (-)- ⁇ -bisabolol-producing strain.
  • FIG. 10 is a measurement of single cell fluorescence of the GFP protein of the strains of FIG. 9 using a flow cytometer.
  • FIG. 11 shows the reduction of the selection pressure in the D-glutamate-rich environment and the maintenance of stable plasmid using the removal of mGltS as a way to overcome this. Since FRT sites exist in both the mGltS gene and the CAT gene, the mGltS gene and the CAT gene are simultaneously removed by flippase .
  • Figure 12 is a measurement of the growth of the D-glutamate auxotrophic DH5 ⁇ KI strain with or without D-glutamate in which mGltS and CAT genes were introduced between FRT sites.
  • FIG. 13 shows a 481 bp amplification product by performing PCR using pMurOut-F and pMurOut-R primers on a strain from which mGltS and CAT were removed by expressing Flippase.
  • the GFP protein expressed from the pT-GFP-DAAT plasmid was confirmed in an LB plate without antibiotics.
  • One aspect of the present invention provides a D-glutamate auxotrophic variant E. coli in which the murI gene is deleted.
  • Another aspect of the present invention provides a method for producing D-glutamate auxotrophic mutant E. coli, comprising the step of deleting the murI gene in E. coli.
  • D-glutamate auxotroph of the present invention is a strain in which the ability to synthesize D-glutamate, an essential component of the cell wall, has been removed or decreased, and can grow in a medium from which D-glutamate is removed. No, it refers to a strain having selectivity capable of growing in a medium in which D-glutamate is present.
  • murI gene of the present invention is a gene encoding glutamate racemase, and is known as a gene essential for the biosynthesis of D-glutamate (J Bacteriol. 1993 May;175(10):2970-9.) .
  • sequence information can be obtained from GenBank of NCBI, a known database, specifically, the nucleotide sequence of SEQ ID NO: 1 or at least 80%, 90%, 95%, 96 %, 97%, 98%, or 99% may contain a nucleotide sequence having homology or identity.
  • polynucleotide has the meaning of comprehensively including DNA or RNA molecules, and nucleotides, which are basic structural units in polynucleotides, may include not only natural nucleotides but also analogs with modified sugar or base moieties.
  • Homology and identity refer to the degree to which two given base sequences are related and can be expressed as a percentage.
  • sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms, and the default gap penalty established by the program used can be used together.
  • Substantially, homologous or identical sequences are generally in moderate or high stringent conditions along at least about 50%, 60%, 70%, 80% or 90% of the sequence or full-length. (stringent conditions) can be hybridized. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotide.
  • GAP program defines the total number of symbols in the shorter of two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a monolithic comparison matrix (contains values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps.
  • the term “homology” or “identity” refers to the relevance between sequences.
  • the polynucleotide of the present invention has various modifications to the coding region within a range that does not change the polynucleotide sequence due to the degeneracy of the codon or in consideration of the codon preferred in the organism to express the polynucleotide. This may be achieved, and may be included without limitation as long as it exhibits the same activity as the protein encoded by the polynucleotide of SEQ ID NO: 1, or the strain in which the corresponding polynucleotide is deleted shows auxotroph for a specific amino acid.
  • a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the nucleotide sequence, and hydride under stringent conditions to obtain the same activity as the protein encoded by the polynucleotide of SEQ ID NO: 1 It may be included without limitation as long as it is shown or the strain in which the corresponding polynucleotide is deleted exhibits an auxotroph for a specific amino acid.
  • stringent condition means a condition that enables specific hybridization between polynucleotides.
  • Hybridization requires that two nucleic acids have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
  • the appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art.
  • All of the gene or protein sequences referred to in the present invention may include a gene or protein sequence having 80% or more homology.
  • gene deletion of the present invention may be used interchangeably with terms such as gene deletion, deletion, and the like, and includes the expression of a target gene being reduced or eliminated to a lower level compared to the wild strain.
  • the gene deletion can be performed by any inactivation method known in the art.
  • the "loss of the murI gene” can be performed by a method of replacing the murI gene on the chromosome, specifically using the method of deleting a gene by homologous recombination, or a method in which is replaced by any other gene However, it is not limited thereto. Methods for causing homologous recombination are known in the art.
  • the gene deletion may be performed by replacing the murI gene sequence with a polynucleotide or a marker gene from which some nucleic acid sequences have been deleted.
  • the "partial nucleic acid sequence" may be different depending on the type of polynucleotide, specifically 1 to 300, more specifically 1 to 100, and even more specifically 1 to 50, but specifically limited thereto no.
  • the gene deletion is performed by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution of the murI gene sequence, or a combination thereof, or an improved gene sequence to further inactivate or an improved gene sequence without activity. It can be replaced with, but is not limited thereto.
  • the gene deletion is performed by inducing a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination of the nucleic acid sequence so that the activity of the expression control sequence of the murI gene is further weakened, or It can be performed by replacing with a nucleic acid sequence having an activity, but is not limited thereto.
  • the expression control sequence may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling termination of transcription and translation.
  • vector refers to a DNA product containing a nucleotide sequence of a polynucleotide encoding the protein of interest operably linked to a suitable control sequence so that the protein of interest can be expressed in a suitable host.
  • regulatory sequences include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling termination of transcription and translation.
  • Vectors can be transformed into a suitable host and then replicated or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present invention is not particularly limited as long as it is replicable in the host, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, ⁇ MBL3, ⁇ MBL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, and Charon21A can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescript II system , pGEM system, pTZ system, pCL system, pKD system, pT system, pET system, etc. can be used.
  • pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pKD3, pT7, pKD46, pCP20, GESS (Korean Patent Registration No. 10-1222056) vectors, etc. may be used, but the present disclosure is not limited thereto.
  • transformation refers to a series of operations in which a vector containing a polynucleotide encoding a protein of interest is introduced into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the polynucleotide introduced into the host cell may be in any form as long as it can be introduced into the host cell and expressed.
  • the polynucleotide is a structure comprising all elements necessary for self-expression (promoter operably linked to the polynucleotide, transcription termination signal, ribosome binding site, translation termination signal, etc.) It may be introduced into a host cell in the form of an expression cassette, and the expression cassette may be in the form of an expression vector capable of self-replicating.
  • operably linked in the above means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the protein of interest of the present invention.
  • Methods of introducing the vector include calcium phosphate method, calcium chloride/rubidium chloride method, lithium acetate method, electroporation method, electroinjection method, chemical treatment method such as PEG, gene gun, etc. Methods widely used in the industry can be applied.
  • Any gene that causes the strain to exhibit D-glutamate auxotroph may be inserted at the location of the deleted murI gene of the strain.
  • the gene inserted at the position of the deleted murI gene may be included without limitation as long as the strain exhibits auxotroph, specifically may be a gltS sequence, more specifically a mutated gltS sequence, and more specifically May be a mutant gltS ( mGltS ) sequence of WM335 , but is not limited thereto, and more specifically, may have a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 or more than 80% homology or identity thereto, Not limited.
  • the insert any gene can be carried out simultaneously or in steps after step murI defect in which the defect murI.
  • the strain may exhibit D-glutamate auxotroph even if no other gene is inserted at the location of the defective murI gene.
  • the method for producing glutamate auxotrophic Escherichia coli of the present invention may further include a step of deleting the gene when replacing the murI gene with another gene. The gene deletion step may improve the stability of the plasmid in glutamate auxotrophic Escherichia coli.
  • the "D-glutamate auxotrophic E. coli" of the present invention is not limited as long as it is E. coli that can be used for the production of useful products, and specifically, may be an E. coli strain other than WM335, and more specifically BL21(DE3), SBA01 or It may be DH5 ⁇ , and more specifically, it may be a DH5 ⁇ strain, but is not limited thereto.
  • D-glutamate auxotrophic DH5 ⁇ was produced by replacing the murI gene of SEQ ID NO: 1 with the nucleotide sequence of SEQ ID NO: 3 (FIG. 2B), and in another embodiment of the present invention, the It was confirmed that D-glutamate auxotroph DH5 ⁇ with improved plasmid stability was produced by additionally deleting the nucleotide sequence of SEQ ID NO: 3 in DH5 ⁇ KI in which the murI gene of SEQ ID NO: 1 was replaced with the nucleotide sequence of SEQ ID NO: 3 , It was confirmed that D-glutamate auxotrophic Escherichia coli was produced through the murI defect.
  • Another aspect of the present invention provides a composition for producing a target substance comprising E. coli of the present invention.
  • the composition may additionally include any suitable excipients commonly used in the preparation of the target substance, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffering agent, a stabilizer or an isotonic agent, etc. It is not.
  • Another aspect of the present invention provides a method for producing a target substance, comprising the step of culturing E. coli of the present invention.
  • the E. coli may be a vector containing a gene encoding a D-amino acid transferase (DAAT) and a target gene in the D-glutamate auxotrophic E. coli of the present invention.
  • DAAT D-amino acid transferase
  • target gene refers to a gene encoding a target substance, and refers to encoding a polypeptide with a specific target nucleic acid to be transcribed.
  • the target gene may be any gene desired by a person skilled in the art, and may be a gene derived from an exotic species or other strain other than the host strain, E. coli, or a gene in a modified form, but is not limited thereto.
  • the target substance may be a protein, but is not limited thereto.
  • a gene encoding an enzyme involved in bisabolol synthesis was used as a target gene.
  • D-amino acid transferase of the present invention is used interchangeably with "DAAT” and is an enzyme that enables the synthesis of D-glutamate.
  • DAAT is an enzyme that enables the synthesis of D-glutamate.
  • a vector containing a gene encoding DAAT is introduced into a D-glutamate auxotroph, prototrophic strain of the D-glutamate auxotroph is restored, and growth is possible even in a medium in which D-glutamate does not exist.
  • the host strains in which the gene encoding DAAT and the gene of interest are not successfully introduced are still in a state in which D-glutamate cannot be synthesized and cannot grow in a medium that does not contain D-glutamate.
  • a vector including the gene and the gene of interest can be used as a marker for transformation, and the recombinant strain can be easily selected without antibiotics.
  • a gene encoding DAAT (nucleotide sequence of SEQ ID NO: 4) and green fluorescent protein in a D-glutamate auxotrophic strain produced by replacing the murI gene of SEQ ID NO: 1 with the nucleotide sequence of SEQ ID NO: 3
  • the target gene introduced strain can be selected without antibiotics (Figs. 5 and 6).
  • a vector encoding DAAT and (-)- ⁇ -bisabolol synthase in a D-glutamate auxotrophic strain produced by replacing the murI gene of SEQ ID NO: 1 with the nucleotide sequence of SEQ ID NO: 3 was introduced, and it was confirmed that the bisabolol production and cell growth were maintained high.
  • These bisabolol production and cell growth rates were compared to the previously known D-glutamate auxotrophic strain WM335 strain as well as the strain using antibiotics as a marker. As it was confirmed that it is high (FIGS. 7 and 9), it can be seen that the D-glutamate auxotrophic strain of the present invention can be used for efficient production of the target substance.
  • the method for producing the target substance comprises the steps of culturing E. coli of the present invention; And it may be a method comprising the step of recovering the target material from the microorganism or medium.
  • the "culture” means growing the E. coli in an appropriately controlled environmental condition.
  • the cultivation process of the present application may be made according to a suitable medium and culture conditions known in the art, and may be easily adjusted and used by those skilled in the art.
  • the step of culturing the E. coli is not particularly limited thereto, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like.
  • the culture conditions are not particularly limited thereto, but a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) is used to provide an appropriate pH (eg, pH 5 to 9, specifically PH 6 to 8) can be adjusted.
  • a basic compound eg, sodium hydroxide, potassium hydroxide or ammonia
  • an acidic compound eg, phosphoric acid or sulfuric acid
  • an antifoaming agent such as fatty acid polyglycol ester can be used to suppress the generation of air bubbles.
  • oxygen or oxygen-containing gas is injected into the culture, or the anaerobic and microaerobic state
  • nitrogen, hydrogen or carbon dioxide gas may be injected without injection of gas.
  • Incubation temperature may be maintained at 20 to 45 °C, specifically 25 to 40 °C, but is not limited thereto.
  • the cultivation period may be continued until the production amount of the desired useful substance is obtained, specifically, the cultivation may be performed for about 10 to 160 hours, but is not limited thereto.
  • the culture medium used is a carbon source such as sugar and carbohydrates (e.g.
  • fats and fats e.g., soybean oil, sunflower seeds.
  • Oil, peanut oil and coconut oil fatty acids (such as palmitic acid, stearic acid and linoleic acid), alcohols (such as glycerol and ethanol) and organic acids (such as acetic acid) can be used individually or in combination. , Is not limited thereto.
  • the method can be readily determined by a person skilled in the art in an optimized medium and culture conditions known in the art.
  • the step of recovering the target substance may be performed using a suitable method known in the art. For example, centrifugation, filtration, distillation, ion exchange chromatography, crystallization and HPLC may be used, but are not limited thereto.
  • the recovery step may include a purification process, and may be performed using a suitable method known in the art.
  • bacterial strains and reagents used in the examples of the present invention are as follows.
  • Escherichia coli DH5 ⁇ or D-glutamate auxotrophic Escherichia coli DH5 ⁇ (DH5 ⁇ KI) strain was used.
  • E. coli WM335 strain was additionally used for producing (-)- ⁇ -bisabolol.
  • Luria-Bertani (LB) medium (10 g/L tryptone, 5 g/L yeast extract and 10 g/L sodium chloride) was used for culture.
  • LB medium 2X YT (16 g/L tryptone, 10 g/L yeast extract and 5 g/L sodium chloride) medium or terrific broth (TB) medium (12 g/L enzymatic casein digest, 24 g/L yeast extract, 9.4 g/LK 2 HPO 4 , 2.2 g/L KH 2 PO 4 and 1% (w/v) glycerol) were used.
  • 2X YT (16 g/L tryptone, 10 g/L yeast extract and 5 g/L sodium chloride
  • TB terrific broth
  • Ampicillin and chloramphenicol were used at concentrations of 100 ⁇ g/mL and 10 ⁇ g/mL.
  • 50 ⁇ g/mL of D-glutamate was added if necessary.
  • PCR polymerase chain reaction
  • KOD-Plus-Neo polymerase Toyobo, Osaka, Japan
  • All restriction enzymes and modifying enzymes were purchased from New England BioLabs (Ipswich, MA, USA).
  • plasmid for use in the examples of the present invention was prepared as follows.
  • the pKI- mGltS- Cm plasmid required to construct D-glutamate auxotrophic Escherichia coli DH5 ⁇ KI was constructed as follows.
  • the plasmid backbone region was amplified from the pKD3/I- Sce I plasmid using pKI-VF and pKI-VR primers.
  • the mutant gltS gene region was amplified using pKI-IF and pKI-IR primers from genomic DNA of E. coli WM335 strain. Thereafter, the two PCR products were combined by the Gibson assembly method (New England BioLabs (Ipswich, MA, USA)) according to the manufacturer's instructions.
  • the pKI -FRT- mGltS- Cm plasmid required to construct the D-glutamate auxotrophic Escherichia coli DH5 ⁇ KI from which the mGltS gene was removed was constructed as follows. The first fragment was amplified using the pFRT-VF and VR-pFRT primers from pKI- mGltS -Cm second plasmid fragment was amplified using the pFRT-IF and IR primers from pFRT-pKI- mGltS -Cm plasmid. Thereafter, the two PCR products were combined by the Gibson assembly method.
  • the green fluorescent protein expression plasmid pT-GFP was constructed as follows. The backbone portion of the pT-BBS plasmid was amplified with pTG-VF and pTG-VR primers, and the green fluorescent protein portion of the pK7 sfGFP plasmid was amplified with pTG-IF and pTG-IR primers. Thereafter, the two amplification products were linked by the Gibson assembly method.
  • pT-GFP-DAAT in which the antibiotic resistance gene was replaced with a D-amino acid transferase (DAAT) gene in the pT-GFP plasmid
  • DAAT D-amino acid transferase
  • the backbone of the pT-GFP plasmid excluding the ampicillin resistance gene was pAF.
  • -VF and pAF-VR primers were used to amplify, and the DAAT gene site of the pGESS-DAAT plasmid was amplified with pAF-IF and pAF-IR primers. Thereafter, the two amplification products were linked by the Gibson assembly method.
  • the linked plasmid was transformed into an Escherichia coli DH5 ⁇ KI strain, plated on an LB plate containing no antibiotics, and cultured overnight. After PCR was performed using the grown colonies with pAFout-F and pAF-IR primers, the recombination success rate was measured by confirming the amplification product of 981 bp.
  • DAAT protein and green fluorescent protein regions were amplified from pGESS-DAAT plasmid using pDG-F and pDG-R primers, and the amplified fragment was cut with SbfI restriction enzyme.
  • the pTM-BBS-IspA plasmid was ligated using the Gibson assembly method.
  • pTM2-BBS-IspA-DAAT-GFP plasmid was cut with XbaI to remove mevalonate pathway enzymes including mvaK1 derived from Staphylococcus aureus, and then pTM2-BBS- in the mevalonate pathway enzymes, including mvaK1 of Methanosarcina mazei-derived IspA obtained by cutting the plasmid with XbaI were connected by using T4 DNA ligase.
  • Plasmid pKD46 Plasmid expressing ⁇ -Red recombinase, P araB , Amp R pCP20 Plasmid expressing Flippase, Amp R , Cm R pKD3/I- Sce I PKD3 plasmid derivatives with I- Sce I restriction enzyme recognition sequences on both sides of the chloramphenicol resistance gene, Cm R , Amp R pT-BBS PTrc99A derivative containing codon-optimized Matricaria recutita MrBBS gene pK7 sfGFP Plasmid expressing superfolder GFP pTM-BBS-IspA PT -BBS plasmid containing E.
  • E. coli ispA , S. aureus mvaK1 , S. pneumoniae mvaD , S. pneumoniae mvaK2 , E. coli idi , E. faecalis mvaE , E. faecalis mvaS pTM2-BBS-IspA PT -BBS plasmid containing E. coli ispA , M. mazei mvaK1 , S. pneumoniae mvaD , S. pneumoniae mvaK2 , E. coli idi , E. faecalis mvaE , E.
  • Homologous recombination was used to express the mutant GltS protein while deleting the murI gene of E. coli DH5 ⁇ strain.
  • the manufacturing method is briefly shown in FIG. 1.
  • the region containing the mutant gltS and chloramphenicol resistance gene of the pKI- mGltS- Cm plasmid prepared in Example 2 was PCR-amplified using pMurKI-F and pMurKI-R primers.
  • a region containing a chloramphenicol resistance gene was PCR-amplified using pMurKO-F and pMurKI-R primers.
  • bands of the correct size were respectively purified using Wizard® SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA).
  • the purified PCR fragment was treated with DpnI, and then purified once again using Wizard® SV Gel and PCR Clean-Up system.
  • the purified PCR product was transformed into an E. coli DH5 ⁇ strain transformed with pKD46 by electroporation.
  • the strain prepared by introducing the murI deletion and mutant gltS ( mGltS ) gene was a D-glutamate auxotrophic strain, and the pCP20 plasmid of Example 2 was introduced into the prepared D-glutamate auxotrophic strain to chloramphenicol.
  • the DH5 ⁇ KI strain was completed by removing the resistance gene.
  • 1% of the suspended cells were inoculated into 3 types of complex media (LB, 2X YT or TB) or 3 types of complex media (LB, 2X YT or TB) containing 50 ⁇ g/mL of D-glutamate, respectively, at 37 degrees, Incubated at 200 rpm. Cell growth was observed by measuring absorbance at a wavelength of 600 nm using a spectrophotometer (GE Healthcare) (FIG. 3).
  • DH5 ⁇ KI maintained the selectivity for D-glutamate in all media for 24 hours of culture, and this selectivity was maintained for up to 48 hours in 2X YT medium and TB medium.
  • the WM335 strain as a control group did not show selectivity for the presence or absence of D-glutamate in the LB medium, and the selectivity was remarkably low in the TB medium.
  • Escherichia coli DH5 ⁇ KI was streaked on an LB plate containing 50 ⁇ g/mL of D-glutamate, and cultured overnight at 37°C and 200 rpm.
  • the cultured cells were centrifuged at 3,000 rpm for 20 minutes to remove the supernatant and then suspended in LB medium.
  • 1% of the suspended cells were inoculated into LB medium containing 50 ⁇ g/mL of LB or D-glutamate, and cultured at 37 degrees in a plate reader (Infinite 200 Pro, Tecan) to measure absorbance at a wavelength of 600 nm (FIG. 4).
  • the DH5 ⁇ KI strain of the present invention maintains high selectivity for the presence or absence of D-glutamate in the medium for a long time regardless of the type of the complex medium, and in particular, the selectivity in 2X YT and TB medium is maintained for 48 hours or more. And, it can be seen that this selectivity is superior to the previously known D-glutamate auxotrophic strain, WM335 strain.
  • Example 5 Cloning of recombinant plasmid expressing green fluorescent protein (GFP) from which antibiotic resistance gene was removed using DH5 ⁇ KI strain and confirmation of GFP expression
  • a recombinant plasmid expressing a GFP protein from which an antibiotic resistance gene was removed was constructed using the DH5 ⁇ KI strain.
  • the ampicillin antibiotic resistance gene in the pT-GFP plasmid was substituted with the DAAT gene, which is a transformation marker of the D-glutamate auxotrophic strain, through the Gibson assembly method, and then transformed into the DH5 ⁇ KI strain. Incubated overnight on LB plates containing no antibiotics. As a result, it was confirmed that all the grown colonies successfully expressed the GFP protein, and 22 colonies were selected and PCR-amplified with pAFout-F and pAF-IR primers specific to the pT-GFP-DAAT plasmid. The amplification product of 981bp predicted in was formed (FIG. 5). As a result of sequencing the plasmids by separating the plasmids from 10 colonies, it was confirmed that the DAAT gene was present instead of the antibiotic resistance gene in all 10 colonies.
  • the DH5 ⁇ KI strain introduced with the pT-GFP-DAAT plasmid prepared above (n 3) was inoculated into LB medium and cultured overnight at 37°C and 200 rpm. 1% of the cultured cells were inoculated in LB medium containing various concentrations of IPTG (0, 63, 125, 250, 500, 1000 ⁇ M) and cultured in a plate reader (Infinite 200 Pro, Tecan) at 37 degrees, while fluorescence and OD 600 was measured for 24 hours.
  • the pT-GFP plasmid (including the ampicillin resistance gene) was introduced into the wild-type DH5 ⁇ strain, and in a medium containing ampicillin and various concentrations of IPTG (0, 63, 125, 250, 500, 1000 ⁇ M) as described above. It was cultured (Fig. 6).
  • the expression level of the fluorescent protein was regulated according to the amount of IPTG in the DH5 ⁇ KI strain introduced with the pT-GFP-DAAT plasmid in the same manner as the DH5 ⁇ strain transformed with the plasmid containing the antibiotic resistance gene, and cell growth was also problematic. It was confirmed that there was no.
  • the pTM-BBS-IspA-DAAT-GFP plasmid expresses mvaK1 derived from Staphylococcus aureus , thus exhibiting low (-)- ⁇ -bisabolol productivity and pTM2
  • the -BBS-IspA-DAAT-GFP plasmid expresses mvaK1 derived from Methanosarcina mazei and exhibits high (-)- ⁇ -bisabolol productivity.
  • the strain of the invention can be usefully used in the production of various compounds.
  • Example 7 Preparation of a glutamate nutrient supplement with enhanced plasmid stability
  • a useful product can be produced when the gene encoding the target product and the plasmid in which the DAAT gene are cloned are introduced into the DH5 ⁇ KI strain of the present invention.
  • a strain in which mGltS a transporter of D-glutamate, was removed from DH5 ⁇ KI, that is, a strain in which murI was deleted from the wild-type DH5 ⁇ strain was prepared .
  • the FRT site which is the flippase recognition sequence
  • the mGltS gene and the CAT gene are simultaneously deleted when the DAAT- expressing recombinant plasmid and the flippase-expressing plasmid are simultaneously transformed into this strain. .
  • the manufacturing method is simply shown in FIG. 11.
  • the pT-GFP-DAAT plasmid and pCP20 plasmid were introduced, and the FRT site was recombined by flippase expressed in the pCP20 plasmid to knock out mGltS and CAT genes, which were 481 bp using pMurOut-F and pMurOut-R primers. It was confirmed that the mGltS and CAT genes were successfully removed through the failure of the strain to grow in the plate containing the PCR amplification product of the size and chloramphenicol (FIG. 13). This strain was cultured at 37 degrees to remove the pCP20 plasmid, and it was confirmed that the pCP20 plasmid was removed through the failure of the strain to grow in the plate containing ampicillin (FIG. 13).
  • D-glutamate auxotrophic strains can be produced in E. coli other than E. coli DH5 ⁇ strain, BL21 (DE3) strain, which is widely used for recombinant protein production, and SBA01, a strain using acetic acid derived from MG1655 (deposited by the KCTC Biological Resource Center No.: KCTC13040BP) according to the method of Example 4, D-glutamate auxotrophic BL21 (DE3) KI and SBA01 KI strains were prepared.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 murI 유전자가 결실된 D-글루타메이트 영양요구성 변이형 대장균, 이의 제조 방법 및 상기 대장균을 이용한 목적 물질 생산 방법에 관한 것이다. 본 발명의 D-글루타메이트 영양요구성 대장균은 복귀돌연변이체가 적고, 플라스미드 안정성 및 단백질 생산성이 높게 유지되어, 항생제 사용 없이도 효과적으로 유용한 산물을 생산할 수 있는 것으로, 단백질을 포함한 유용 산물의 청정 생산에 응용이 가능하다.

Description

D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법
본 발명은 D-글루타메이트 영양요구성 대장균, 이의 제조방법 및 상기 대장균을 이용한 목적 물질 생산 방법에 관한 것이다.
기존 알려진 원핵세포 발현 플라스미드는 하나 또는 몇 가지 항생제 저항성 유전자(들) 이외에도, 반드시 필요하지 않으면서 세포 대사에 부담을 주는 추가의 DNA 서열을 포함하는 경우가 대부분이다. 이들 서열은 클로닝 과정중 생성된 DNA 서열, 및 예를 들어 mRNA의 시험관내 합성을 위한 특정 프로모터(promoter) 및 단일 스트랜드(strand) DNA의 합성을 위한 특정 파지(phage)의 복제 기원과 같은 다목적 벡터의 잔재인 DNA 단편을 포함하고, 넓게는 바람직하지 않은 플라스미드 재조합의 원인이 될 수 있는, 불완전하게 복제되는 벡터 서열까지 포함한다.
플라스미드, 특히 발현 벡터의 존재는 세포에게 추가의 대사적 부담이 된다. 이것은 플라스미드가 없는 세포가 생성되도록 유도하는 선별 압력을 제공하는데, 이러한 현상은 항생제 선별에 의해서 방지될 수 있다.
미생물의 유전자 재조합시 가장 통상적으로 사용되는 선별 마커는 항생제 내성 유전자이다. 항생제 내성 유전자를 가지는 숙주 세포는 해당 항생제 내성 유전자 생성물에 의해 분해될 수 있는 항생제가 보충된 배지 중에서 성장할 수 있으나, 항생제 내성 유전자를 가지지 않는 세포는 항생제에 의해 사멸되므로 미생물의 선별이 가능하다. 그러나 암피실린, 테트라사이클린, 카나마이신 및 클로람페니콜 등 선별에 일반적으로 사용되는 항생제의 경우 산물을 생산(발효)하는데 문제가 될 수 있고, 상기와 같은 항생제 내성 유전자는 연속발효공정에서 숙주세포에 의한 플라스미드의 분해 또는 계대수 증가에 의한 희석 등의 이유로 시간이 경과하면서 기능이 소멸한다. 또한, 배지에 첨가한 항생제는 외부로 분비된 항생제 내성 유전자 생성물에 의해서 쉽게 분해된다. 이에 따라 플라스미드의 안정성이 약화되어, 도입한 외래 유전자의 발현 단백질량이 감소하게 된다. 또한, 발현하고자 하는 단백질이 식품첨가물과 관련된 경우 발현을 위하여 배양기간 동안 첨가한 항생제의 제거 공정이 요구된다. 그리고, 유전자 물질의 대량 생산을 위한 고가의 유도물질인 IPTG(이소프로필-β-D-티오갈락토피라노시드)의 사용 및 항생제 내성 유전자의 자연계로의 유포 등 여러 문제점을 내포하고 있다.
항생제 내성 유전자를 이용한 선별이 상기와 같은 환경, 조절 및 상업적 문제들을 야기하며 생물학적 안전성에 대해 잠재적인 위험이 있는 것으로 알려지면서, 영양요구성 선별 마커가 항생제 선별에 대한 대안으로 떠올랐으나, 일부 실험실 및 연구소에서 제한적으로 영양요구성 마커를 효모(Saccharomyces cerevisiae)에 도입하였을 뿐(KR 10-2002-0096574 A 등), 산업용 효모에는 적용하지 못하였으며, 유용산물의 생산에 널리 이용되는 대장균(Escherichia coli)의 경우는 영양요구성 마커 도입에 실패한 사례가 수차례 보고되었으며 개발된 균주마저도 산업상 적용이 극히 제한적인 실정이다.
이러한 배경 하에, 본 발명자들은 예의 연구 노력한 결과 D-글루타메이트 영양요구성 대장균을 제작하였으며, 제작된 대장균이 복귀돌연변이체가 적고, 플라스미드 안정성 및 단백질 생산성이 높게 유지되는 것을 확인하였고, 이를 이용해 항생제 사용 없이도 효과적으로 유용한 산물을 생산할 수 있음을 확인하였을 뿐만 아니라 본 발명의 D-글루타메이트 영양요구성 대장균 제작 방법이 다양한 대장균 균주에 적용될 수 있음을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 D-글루타메이트 영양요구성 대장균을 제공하는 것이다.
본 발명의 다른 목적은 상기 대장균의 제조 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 대장균을 포함하는, 목적 물질 생산용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 대장균을 배양하는 단계를 포함하는, 목적 물질 생산 방법을 제공하는 것이다.
본 발명의 D-글루타메이트 영양요구성 대장균은 복귀돌연변이체가 적고, 플라스미드 안정성 및 단백질 생산성이 높게 유지되어, 항생제 사용 없이도 효과적으로 유용한 산물을 생산할 수 있는 것으로, 단백질을 포함한 유용 산물의 청정 생산에 응용이 가능하다.
도 1은 대장균 DH5α 균주에 상동재조합을 이용하여 murI 유전자를 결손시키면서 변이 gltS 유전자(mGltS)를 도입하는 과정을 간략히 나타낸 것이다. CAT 유전자 양쪽에 FRT site가 존재하기 때문에 flippase에 의해 CAT 유전자가 제거된다.
도 2A는 pMurOut-F 및 pMurIn-R 프라이머를 이용한 PCR을 수행하여 D-글루타메이트 영양요구성 후보 균주에서 953bp의 증폭산물을 확인한 것이다. M은 DNA 마커, Neg은 야생형 DH5α이다. 도 2B는 상기 재조합균주를 D-글루타메이트 50 μg/mL 를 포함하거나(+) 포함하지 않는(-) LB 배지에서 24시간 배양한 결과이다.
도 3은 D-글루타메이트 50 μg/mL를 포함하거나(+) 포함하지 않는(-) LB, 2XYT, TB 배지에서 DH5α KI 또는 WM335 균주를 배양하여 OD600 값을 측정한 결과이다.
도 4는 DH5α KI 균주를 글루타메이트를 포함하거나(+) 포함하지 않는(-) LB 배지에서 배양하여 시간에 따른 OD600 값의 변화를 측정한 결과이다.
도 5는 DH5α KI 균주에서 항생제를 사용하지 않고 pT-GFP-DAAT 플라스미드를 제작한 후 GFP 단백질 발현을 확인한 것이다. V: pT-GFP로부터 증폭, I: pGESS-DAAT로부터 증폭
도 6은 pT-GFP-DAAT 플라스미드를 도입한 DH5α KI 균주(Antibiotic-free selection) 또는 앰피실린 저항성 유전자를 포함한 pT-GFP 플라스미드를 도입한 야생형 DH5α 균주(Antibiotics selection)의 IPTG 농도에 따른 생장 및 형광곡선이다.
도 7은 DH5α KI 균주를 이용한 (-)-α-비사볼롤 생산에 관한 것으로, 도 7A는 (-)-α-비사볼롤 생산 경로 및 플라스미드 모식도, 도 7B는 낮은 (-)-α-비사볼롤 생산 균주의 계대배양 과정 동안 세포생장(OD600; 막대그래프) 및 (-)-α-비사볼롤 생산량(꺾은선그래프)을 측정 것이며, 도 7C는 높은 (-)-α-비사볼롤 생산 균주의 계대배양 과정 동안 세포생장(OD600; 막대그래프) 및 (-)-α-비사볼롤 생산량(꺾은선그래프)을 측정한 것이다.
도 8은 도 7의 균주들의 GFP 단백질 형광을 유세포분석기를 이용하여 단일세포 형광을 측정한 것이다.
도 9는 WM335를 이용한 (-)-α-비사볼롤 생산에 관한 것으로 균주 생장은 막대그래프, (-)-α-비사볼롤 생산량은 꺾은선 그래프로 나타내었다. 도 9A는 낮은 (-)-α-비사볼롤 생산 균주의 측정 결과, 도 9B는 높은 (-)-α-비사볼롤 생산 균주의 측정 결과이다.
도 10은 도 9의 균주들의 GFP 단백질 형광을 유세포분석기를 이용하여 단일세포 형광을 측정한 것이다.
도 11은 D-글루타메이트가 풍부한 환경에서의 선택 압력의 감소와 이를 극복하기 위한 방안으로 mGltS의 제거를 이용한 안정적인 플라스미드 유지를 도시한 것이다. mGltS 유전자와 CAT 유전자 양쪽에 FRT site가 존재하기 때문에 flippase에 의해 mGltS 유전자와 CAT 유전자가 동시에 제거된다.
도 12는 FRT site 사이에 mGltS, CAT 유전자를 도입한 D-글루타메이트 영양요구성 DH5α KI 균주의 D-글루타메이트 유무에 따른 생장을 측정한 것이다.
도 13은 Flippase를 발현시켜 mGltS 및 CAT을 제거한 균주를 pMurOut-F 및 pMurOut-R 프라이머를 이용한 PCR을 수행하여 481bp의 증폭산물을 확인한 것이다. mGltS와 CAT이 제거된 DH5α KI 균주에서 항생제를 사용하지 않은 LB 플레이트에서 pT-GFP-DAAT 플라스미드로부터 발현된 GFP 단백질을 확인한 것이다.
도 14는 BL21(DE3) KI 균주와 SBA01 KI 균주의 D-글루타메이트 유무에 따른 생장을 측정한 것이다.
본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 발명에 기재된 본 발명의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 발명에 포함되는 것으로 의도된다.
본 발명의 하나의 양태는 murI 유전자가 결실된 D-글루타메이트 영양요구성 변이형 대장균을 제공한다.
본 발명의 다른 하나의 양태는 대장균에서 murI 유전자를 결손시키는 단계를 포함하는, D-글루타메이트 영양요구성 변이형 대장균의 제조 방법을 제공한다.
본 발명의 용어 "영양요구성"이란 성장 및 대사에 요구되는 특정 물질을 제조하는 능력이 제거되거나 감소되도록 변형된 세포를 지칭한다. 이와 대비하여, "원영양성(prototrophy)"이란, 성장 및 대사에 필요한 특정 물질을 제조할 수 있는 세포를 지칭한다. 본 발명의 용어 "D-글루타메이트 영양요구성"은 세포벽의 필수 구성 성분인 D-글루타메이트(D-glutamate)를 합성하는 능력이 제거되거나 감소된 균주로, D-글루타메이트가 제거된 배지에서는 생장할 수 없고, D-글루타메이트가 존재하는 배지에서는 생장할 수 있는 선택성을 갖는 균주를 의미한다.
본 발명의 용어 "murI 유전자"는 글루타메이트 라세메이즈(glutamate racemase)를 코딩하는 유전자로, D-글루타메이트의 생합성에 필수적인 유전자로 알려져 있다(J Bacteriol. 1993 May;175(10):2970-9.). 글루타메이트 라세메이즈 및 이를 코딩하는 murI 유전자에 관한 정보는 공지의 데이터베이스인 NCBI의 GenBank 등에서 서열 정보를 얻을 수 있으며, 구체적으로는 서열번호 1의 염기서열 또는 이와 적어도 80%, 90%, 95%, 96%, 97%, 98%, 또는 99% 상동성 또는 동일성을 가지는 염기서열을 포함하는 것일 수 있다.
본 발명에서 용어 "폴리뉴클레오티드"는 DNA 또는 RNA 분자를 포괄적으로 포함하는 의미를 가지며, 폴리뉴클레오티드에서 기본 구성 단위인 뉴클레오티드는 천연 뉴클레오티드 뿐만 아니라, 당 또는 염기 부위가 변형된 유사체도 포함할 수 있다.
본 발명에서 '특정 서열번호로 기재된 뉴클레오티드 서열을 갖는 폴리뉴클레오티드'라고 기재되어 있다 하더라도, 해당 서열번호의 뉴클레오티드 서열로 이루어진 폴리뉴클레오티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환 또는 부가된 뉴클레오티드 서열을 갖는 폴리뉴클레오티드도 본 발명에서 사용될 수 있음은 자명하다.
상동성(homology) 및 동일성(identity)은 두 개의 주어진 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다.
본 발명의 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48 : 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본원에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 서열들간의 관련성(relevance)를 나타낸다.
또한, 본 발명의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리뉴클레오티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리뉴클레오티드 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있으며, 서열번호 1의 폴리뉴클레오티드에 의해 코딩되는 단백질과 동일한 활성을 나타내거나, 해당 폴리뉴클레오티드가 결실된 균주가 특정 아미노산에 대해 영양요구성을 나타내도록 하는 것이라면 제한 없이 포함할 수 있다. 또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여 서열번호 1의 폴리뉴클레오티드에 의해 코딩되는 단백질과 동일한 활성을 나타내거나, 해당 폴리뉴클레오티드가 결실된 균주가 특정 아미노산에 대해 영양요구성을 나타내도록 하는 것이라면 제한 없이 포함할 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 당업계에 공지되어 있으며, 예를 들어, 상동성(homology) 또는 동일성(identity)이 높은 유전자끼리, 40% 이상, 구체적으로는 80% 이상, 85% 이상, 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1XSSC, 0.1% SDS, 구체적으로는 60℃, 0.1XSSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1XSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 폴리뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 폴리뉴클레오티드 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다.
본 발명에서 언급되는 유전자 또는 단백질 서열은 모두 80% 이상의 상동성을 갖는 유전자 또는 단백질 서열을 포함할 수 있다.
본 발명의 용어 "유전자 결손(deletion)" 은 유전자 삭제, 결실 등의 용어와 상호교환적으로 사용될 수 있고, 목표로 하는 유전자의 발현이 야생 균주에 비하여 낮은 수준으로 감소하거나 제거되는 것을 포함한다.
상기 유전자 결손은 당업계에 알려진 임의의 불활성화 방법에 의해 수행될 수 있다. 구체적으로, 상기 "murI 유전자의 결손"은 염색체 상의 murI 유전자를 대체하는 방법에 의해 수행될 수 있으며, 구체적으로는 상동재조합에 의하여 유전자를 결실시키는 방법을 사용하거나, 다른 유전자로 대체하는 방법을 사용할 수 있으나, 이에 한정되지 않는다. 상동재조합을 일으키는 방법은 당업계에 공지되어 있다. 또한, 상기 유전자 결손은 murI 유전자 서열을 일부 핵산 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체하여 수행될 수 있다. 상기 "일부 핵산 서열"은 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 보다 구체적으로는 1 내지 100개, 보다 더 구체적으로는 1 내지 50개일 수 있으나, 특별히 이에 제한되는 것은 아니다. 또한, 상기 유전자 결손은 murI 유전자 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 불활성화되도록 개량된 유전자 서열 또는 활성이 없도록 개량된 유전자 서열로 교체할 수 있으나 이에 제한되지 않는다. 또한, 상기 유전자 결손은 상기 murI 유전자의 발현 조절서열의 활성이 더욱 약화되도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 핵산 서열로 교체함으로써 수행할 수 있으나 이에 제한되지 않는다. 상기 발현 조절서열은 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함할 수 있으나, 이에 제한되지 않는다.
본 발명의 용어 "벡터"란, 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 암호화하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 생산물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 벡터는 적당한 숙주 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 발명에서 사용되는 벡터는 숙주 중에서 복제 가능한 것이면 특별히 한정되지 않으며 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계, pKD계, pT계, pET계 등을 사용할 수 있다. 일 예로, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pKD3, pT7, pKD46, pCP20, GESS(한국등록특허 10-1222056) 벡터 등을 사용할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 용어 "형질전환"이란, 목적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포에 도입하여 숙주 세포 내에서 상기 폴리뉴클레오티드가 암호화하는 단백질이 발현할 수 있도록 하는 일련의 작업을 의미한다. 상기 숙주세포에 도입되는 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 한, 어떠한 형태라도 무방하다. 예를 들면, 상기 폴리뉴클레오티드는, 자체적으로 발현되는데 필요한 모든 요소(상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결 신호, 리보좀 결합부위, 번역 종결신호 등)를 포함하는 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있는데, 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 발명의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
상기 벡터의 도입 방법으로는 인산칼슘법 또는 염화캄슘/염화루비듐법, 리튬아세테이트법, 일렉트로포레이션법(electroporation), 전기주입법(electroinjection), PEG 등의 화학적 처리 방법, 유전자총(gene gun) 등 당 업계에서 널리 사용되는 방법들을 적용할 수 있다.
상기 균주의 결손된 murI 유전자 위치에는 균주가 D-글루타메이트 영양요구성을 나타내도록 하는 임의의 유전자가 삽입될 수 있다. 상기 결손된 murI 유전자 위치에 삽입되는 유전자는 균주가 영양요구성을 나타내도록 하는 것이면 제한없이 포함될 수 있으며, 구체적으로 gltS 서열일 수 있고, 보다 구체적으로는 변이된 gltS 서열일 수 있고, 더욱 구체적으로는 WM335의 변이 gltS(mGltS) 서열일 수 있으나, 이에 제한되지 않는다, 보다 더욱 구체적으로는, 서열번호 2 또는 서열번호 3의 염기서열 또는 이와 80% 이상의 상동성 또는 동일성을 갖는 것일 수 있으나, 이에 제한되지 않는다. 임의의 유전자를 삽입하는 것은 murI를 결손시키는 단계에서 동시에 혹은 murI 결손 단계 이후에 수행될 수 있다.
한편, 결손된 murI 유전자 위치에 다른 유전자가 삽입되어 있지 않더라도 균주는 D-글루타메이트 영양요구성을 나타낼 수 있다. 일 구현예로, 본 발명의 글루타메이트 영양요구성 대장균의 제조방법은 murI 유전자를 다른 유전자로 대체하는 경우, 해당 유전자를 결손시키는 단계를 추가로 더 포함할 수 있다. 상기 유전자 결손 단계는 글루타메이트 영양요구성 대장균에서 플라스미드의 안정성을 향상시킬 수 있다.
본 발명의 "D-글루타메이트 영양요구성 대장균"은 유용 산물 생산에 이용될 수 있는 대장균이면 제한되지 않으며, 구체적으로는 WM335 이외의 대장균 균주일 수 있고, 보다 구체적으로는 BL21(DE3), SBA01 또는 DH5α일 수 있고, 더욱 구체적으로는 DH5α 균주일 수 있으나 이에 제한되지 않는다.
본 발명의 일 구현예에서는 서열번호 1의 murI 유전자를 서열번호 3의 염기서열로 대체함으로써 D-글루타메이트 영양요구성 DH5α가 제작되는 것을 확인하였으며(도 2B), 본 발명의 다른 일 구현예에서는 상기와 같이 서열번호 1의 murI 유전자를 서열번호 3의 염기서열로 대체한 DH5α KI에서 추가적으로 서열번호 3의 염기서열을 결손시켜, 플라스미드 안정성이 향상된 D-글루타메이트 영양요구성 DH5α가 제작되는 것을 확인하였는 바, murI 결손을 통해서 D-글루타메이트 영양요구성 대장균이 제작됨을 확인하였다. 또한, 기존 공지된 글루타메이트 영양요구성 WM335 대장균 균주에 비해 다양한 배지에서 글루타메이트 유무에 대한 선택성이 우수하고 이와 같은 선택성이 장기간 유지되는 것을 확인하였는 바(도 3), 기존 균주에 비해 유용하게 사용될 수 있음을 알 수 있다.
본 발명의 다른 하나의 양태는 본 발명의 대장균을 포함하는 목적 물질 생산용 조성물을 제공한다.
상기 조성물은 목적 물질의 제조에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 예를 들어, 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 다른 하나의 양태는 본 발명의 대장균을 배양하는 단계를 포함하는, 목적 물질 생산 방법을 제공한다.
상기 대장균은 본 발명의 D-글루타메이트 영양요구성 대장균에 DAAT(D-amino acid transferase)를 코딩하는 유전자와 목적 유전자를 포함하는 벡터가 추가로 도입된 것일 수 있다.
본 발명의 용어 "목적 유전자"란, 목적 물질을 코딩하는 유전자로, 전사될 특정 목적 핵산으로 폴리펩타이드를 코딩하는 것을 의미한다. 목적 유전자는 당업자가 원하는 모든 유전자가 가능하며, 숙주 균주인 대장균이 아닌 외래종 또는 다른 균주로부터 유래되는 유전자, 또는 변형된 형태의 유전자일 수 있으나 제한되지 않는다. 구체적으로, 상기 목적 물질은 단백질일 수 있으나, 이에 제한되지 않는다. 본 발명의 일 구현예에서는 비사볼롤 합성에 관여하는 효소를 코딩하는 유전자를 목적 유전자로 사용하였다.
본 발명의 용어 "D-아미노산 전이효소(D-amino acid transferase)"는 "DAAT"와 상호 교환적으로 사용되며 D-글루타메이트 합성이 가능하도록 하는 효소이다. D-글루타메이트 영양요구주에 DAAT를 코딩하는 유전자를 포함한 벡터를 도입하는 경우, D-글루타메이트 영양요구성 균주의 원영양성이 복구되어 D-글루타메이트가 존재하지 않는 배지에서도 생장이 가능해진다. 반면, DAAT를 코딩하는 유전자와 목적 유전자가 성공적으로 도입되지 않은 숙주 균주들은 여전히 D-글루타메이트를 합성할 수 없는 상태에 있게 되어 D-글루타메이트를 포함하지 않는 배지에서 생장할 수 없기 때문에, DAAT를 코딩하는 유전자와 목적 유전자를 포함한 벡터를 형질전환의 마커로 사용할 수 있으며, 이를 이용해 항생제 없이도 유전자 재조합 균주를 용이하게 선별할 수 있다.
본 발명의 일 구현예에서는 서열번호 1의 murI 유전자를 서열번호 3의 염기서열로 대체하여 제작한 D-글루타메이트 영양요구성 균주에 DAAT를 코딩하는 유전자(서열번호 4의 염기서열) 및 녹색형광단백질을 코딩하는 유전자를 포함하는 벡터를 도입하여, 항생제 없이도 목적 유전자 도입 균주를 선별할 수 있음을 확인하였다(도 5 및 도 6). 본 발명의 또 다른 구현예에서는 서열번호 1의 murI 유전자를 서열번호 3의 염기서열로 대체하여 제작한 D-글루타메이트 영양요구성 균주에 DAAT 및 (-)-α-비사볼롤 합성효소를 코딩하는 벡터를 도입하여, 비사볼롤 생산량 및 세포 생장이 높게 유지되는 것을 확인하였으며 이와 같은 비사볼롤 생산량 및 세포 생장률은 기존 공지된 D-글루타메이트 영양요구성 균주인 WM335 균주뿐 아니라 항생제를 마커로 사용하는 균주에 비해서도 높은 것임을 확인하였는 바(도 7 및 도 9), 본 발명의 D-글루타메이트 영양요구성 균주를 목적 물질의 효율적인 생산에 사용할 수 있음을 알 수 있다.
상기 목적 물질 생산 방법은 본 발명의 대장균을 배양하는 단계; 및 상기 미생물 또는 배지로부터 목적 물질을 회수하는 단계를 포함하는 방법일 수 있다.
상기 "배양"은 상기 대장균을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있으며, 당업자가 용이하게 조정하여 사용할 수 있다. 상기 대장균을 배양하는 단계는, 특별히 이에 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물 (예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물 (예: 인산 또는 황산)을 사용하여 적정 pH (예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8)를 조절할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있고, 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다. 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있으나, 이에 제한되지 않는다. 배양기간은 원하는 유용 물질의 생산량이 수득될 때까지 계속될 수 있으며, 구체적으로는 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 제한되지 않는다. 아울러, 사용되는 배양용 배지는 탄소 공급원으로는 당 및 탄수화물 (예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방 (예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산 (예: 팔미트산, 스테아르산 및 리놀레산), 알코올 (예: 글리세롤 및 에탄올) 및 유기산 (예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다.
상기 방법은 당업계에 공지된 최적화된 배지 및 배양 조건에서 당업자에 의해 용이하게 결정될 수 있다. 상기 목적 물질을 회수하는 단계는 당해 분야에 공지된 적합한 방법을 이용하여 수행될 수 있다. 예를 들어, 원심분리, 여과, 증류, 이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 회수 단계는 정제 공정을 포함할 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 수행될 수 있다.
이하 본 발명을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
실시예 1: 박테리아 균주 및 시약
이하 본 발명의 실시예에서 사용한 박테리아 균주 및 시약은 다음과 같다.
클로닝, 플라스미드 유지 및 (-)-α-비사볼롤 생산을 위해 대장균(Escherichia coli) DH5α 혹은 D-글루타메이트 영양요구성 대장균 DH5α (DH5α KI) 균주를 사용하였다. 또한, (-)-α-비사볼롤 생산용으로 대장균 WM335 균주를 추가로 사용하였다. 달리 나타내지 않는 한, 루리아-베르타니(Luria-Bertani, LB) 배지(10 g/L 트립톤, 5 g/L 효모 추출물 및 10 g/L 염화나트륨)를 배양에 사용하였다.
대장균의 D-글루타메이트 영양 요구성 확인을 위하여, LB 배지, 2X YT (16 g/L 트립톤, 10 g/L 효모 추출물 및 5 g/L 염화나트륨) 배지 혹은 테리픽 브로스(terrific broth, TB) 배지(12 g/L 효소적 카제인 소화물, 24 g/L 효모 추출물, 9.4 g/L K2HPO4, 2.2 g/L KH2PO4 및 1%(w/v) 글리세롤)를 사용하였다.
(-)-α-비사볼롤 생산을 위하여, 글리세롤을 함유하는 테리픽 브로스 배지(terrific broth medium containing glycerol, TBG)(12 g/L 효소적 카제인 소화물, 24 g/L 효모 추출물, 9.4 g/L K2HPO4, 2.2 g/L KH2PO4 및 3.5%(w/v) 글리세롤)를 사용하였다. 형질전환 후의 회수 배지(recovery medium)로서 SOC 배지(20 g/L 트립톤, 5 g/L 효모 추출물 및 0.5 g/L 염화나트륨, 2.4 g/L 황산마그네슘, 186 ㎎/L 염화칼륨, 4 g/L 글루코오스)를 사용하였다.
암피실린 및 클로람페니콜은 100 ㎍/mL 및 10 ㎍/mL 농도로 사용하였다. 또한 D-글루타메이트 영양요구성 (auxotroph) 대장균의 경우 필요시 D-글루타메이트를 50 ㎍/mL 첨가하였다.
중합효소 연쇄 반응(PCR)을 위하여, 고정밀도의 KOD-Plus-Neo 폴리머라제(Toyobo, Osaka, Japan)를 표준 프로토콜로서 사용하였다. 모든 제한 효소 및 변형 효소는 New England BioLabs(Ipswich, MA, USA)로부터 구입하였다.
실시예 2: 플라스미드 제작
이하 본 발명의 실시예에서 사용하기 위한 플라스미드를 다음과 같이 제조하였다.
D-글루타메이트 영양요구성 대장균 DH5α KI을 제작하기 위해 필요한 pKI-mGltS-Cm 플라스미드는 다음과 같이 구축하였다. 플라스미드 백본(backbone) 영역을 pKD3/I-SceI 플라스미드로부터 pKI-VF 및 pKI-VR 프라이머를 이용해 증폭하였다. 변이 gltS 유전자 영역을 대장균 WM335 균주의 genomic DNA로부터 pKI-IF 및 pKI-IR 프라이머를 이용해 증폭하였다. 이후, 상기 2가지 PCR 산물을 제조사의 설명서에 따라 Gibson 조립 방법 (New England BioLabs(Ipswich, MA, USA))에 의해 결합하였다.
mGltS 유전자가 제거된 D-글루타메이트 영양요구성 대장균 DH5α KI을 제작하기 위해 필요한 pKI-FRT-mGltS-Cm 플라스미드는 다음과 같이 구축하였다. 첫번째 단편은 pKI-mGltS-Cm 플라스미드로부터 pFRT-VF 및 pFRT-VR 프라이머를 이용해 증폭하였고 두번째 단편은 pKI-mGltS-Cm 플라스미드로부터 pFRT-IF 및 pFRT-IR 프라이머를 이용해 증폭하였다. 이후, 상기 2가지 PCR 산물을 Gibson 조립 방법에 의해 결합하였다.
녹색형광 단백질 발현 플라스미드인 pT-GFP는 다음과 같이 제작하였다. pT-BBS 플라스미드의 백본(backbone) 부위를 pTG-VF 및 pTG-VR 프라이머로 증폭하고, pK7 sfGFP 플라스미드의 녹색형광 단백질 부위를 pTG-IF 및 pTG-IR 프라이머로 증폭하였다. 이후, 상기 두 증폭 산물을 Gibson 조립 방법으로 연결시켰다.
pT-GFP 플라스미드에서 항생제 저항성 유전자를 D-아미노산 트랜스퍼라제(D-amino acid transferase, DAAT) 유전자로 교체한 pT-GFP-DAAT를 제작하기 위하여, 암피실린 저항성 유전자를 제외한 pT-GFP 플라스미드 백본 부위를 pAF-VF 및 pAF-VR 프라이머로 증폭하고, pGESS-DAAT 플라스미드의 DAAT 유전자 부위를 pAF-IF 및 pAF-IR 프라이머로 증폭하였다. 이후, 상기 두 증폭 산물을 Gibson 조립 방법으로 연결시켰다. 연결된 플라스미드를 대장균 DH5α KI 균주에 형질전환한 후 항생제를 포함하지 않는 LB 플레이트에 도말하여 밤새 배양하였다. 생장한 콜로니를 pAFout-F 및 pAF-IR 프라이머를 이용하여 PCR한 후 981 bp의 증폭산물을 확인함으로써 재조합 성공률을 측정하였다.
pTM-BBS-IspA-DAAT-GFP 플라미드 구축을 위하여, DAAT 단백질과 녹색형광 단백질 부위를 pGESS-DAAT 플라스미드로부터 pDG-F 및 pDG-R 프라이머를 이용해 증폭하였고, 증폭된 절편을 SbfI 제한효소로 절단된 pTM-BBS-IspA 플라미드에 Gibson 조립 방법을 사용하여 연결시켰다.
pTM2-BBS-IspA-DAAT-GFP 플라미드 구축을 위하여, pTM-BBS-IspA-DAAT-GFP 플라스미드를 XbaI으로 절단하여 Staphylococcus aureus 유래의 mvaK1을 포함하는 메발로네이트 경로 효소들을 제거한 후 pTM2-BBS-IspA 플라스미드를 XbaI 으로 절단하여 획득한 Methanosarcina mazei 유래의 mvaK1을 포함하는 메발로네이트 경로 효소들로 T4 DNA ligase를 사용하여 연결시켰다.
사용된 프라이머 및 플라스미드를 하기 표 1 및 2에 요약하였다.
프라이머 올리고뉴클레오티드 서열(5'→3') 표시 서열번호
pKI-VF gcgtcggaagtaaggtaccatggtaggtcc pKI-mGltS-Cm 플라스미드 5
pKI-VR attgttttcgatttcgcgggatcgagatcc 6
pKI-IF cccgcgaaatcgaaaacaatcccgtggtag 7
pKI-IR tggtaccttacttccgacgctttttcattt 8
pFRT-VF ttcctattccggcgcgcctacctgtgacgg pKI-FRT-mGltS-Cm 플라스미드 9
pFRT-VR ctatactttctagagaataggaacttcgatttcgcgggatcgagatcc 10
pFRT-IF ctattctctagaaagtataggaacttcgcgaaaacaatcccgtggtag 11
pFRT-IR taggcgcgccggaataggaactaactatat 12
pTG-VF cgaaaaataatctagagtcgacctgcaggc pT-GFP 플라스미드 13
pTG-VR ctttgctcatggtttaacctcctgtgtgaa 14
pTG-IF aggttaaaccatgagcaaaggtgaagaact 15
pTG-IR cgactctagattatttttcgaactgcggat 16
pAF-VF agcagcttaactgtcagaccaagtttactc pT-GFP-DAAT 플라스미드 17
pAF-VR gttccaacatactcttcctttttcaatatt 18
pAF-IF aaggaagagtatgttggaacaaccaatagg 19
pAF-IR ggtctgacagttaagctgctaaagcgtagt 20
pAFout-F ggcctttttgcgtttctaca 21
pDG-F taatctagagtcgacctgcaatccgccaacctggagaagg pSNA-MrBBS-IspA-DAAT-GFP 플라스미드 22
pDG-R gccaagcttgcatgcctgcattacttgtacagcttgtcca 23
pMurKI-F accacgtcccaccgtgctggtgtttgactccggcgtcggtgggttgtcgg cgaaaacaatcccgtggtag murI 유전자 위치에 변이 gltS 유전자 knock-in 24
pMurKI-R tcagcctaaaactgccagtttttcgagcgtttcgaagccgtaacgctgta ggaatacggttagccatttg 25
pMurKO-F accacgtcccaccgtgctggtgtttgactccggcgtcggtgggttgtcgg ggtccatatgaatatcctcc 26
pMurOut-F ggtgtgagcttgtgggatct 27
pMurOut-R gttgttccgtgtcagtggtg 28
pMurIn-R ggtgaagccataacgttcaa 29
pMurKI-FRT-F accacgtcccaccgtgctggtgtttgactccggcgtcggtgggttgtcgg ggatctcgatcccgcgaaat murI 유전자 위치에 변이 gltS 유전자 knock-in 후 flippase로 제거용 30
이름 설명
플라스미드
pKD46 λ-Red recombinase를 발현하는 플라스미드, ParaB, AmpR
pCP20 Flippase를 발현하는 플라스미드, AmpR, CmR
pKD3/I-SceI 클로람페니콜 저항성 유전자 양 옆에 I-SceI 제한효소 인식 서열이 존재하는 pKD3 플라스미드 유도체, CmR, AmpR
pT-BBS 코돈 최적화된 Matricaria recutita MrBBS 유전자를 함유하는 pTrc99A 유도체
pK7 sfGFP 수퍼폴더 GFP를 발현하는 플라스미드
pTM-BBS-IspA E. coli ispA, S. aureus mvaK1, S. pneumoniae mvaD, S. pneumoniae mvaK2, E. coli idi, E. faecalis mvaE, E. faecalis mvaS를 함유하는 pT-BBS 플라스미드
pTM2-BBS-IspA E. coli ispA, M. mazei mvaK1, S. pneumoniae mvaD, S. pneumoniae mvaK2, E. coli idi, E. faecalis mvaE, E. faecalis mvaS를 함유하는 pT-BBS 플라스미드
pGESS-DAAT DAAT 유전자를 함유하는 pGESSv4 유도체
pKI-mGltS-Cm 변이 GltS 단백질 및 클로람페니콜 저항성 유전자를 발현하는 pKD3/I-SceI 플라스미드 유도체, CmR, AmpR
pKI-FRT-mGltS-Cm 변이 GltS 단백질 및 클로람페니콜 저항성 유전자 양쪽에 FRT site가 존재하는 pKI-mGltS-Cm 플라스미드 유도체, CmR, AmpR
pT-GFP 수퍼폴더 GFP를 발현하는 pTrc99A 유도체
pT-GFP-DAAT DAAT 유전자를 발현하는 pT-GFP 유도체
pTM-BBS-IspA-DAAT-GFP DAAT 유전자 및 GFP를 발현하는 pTM-BBS-IspA 유도체
pTM2-BBS-IspA-DAAT-GFP DAAT 유전자 및 GFP를 발현하는 pTM2-BBS-IspA 유도체
실시예 3: D-글루타메이트 영양요구성 균주 제작
대장균 DH5α 균주의 murI 유전자를 결손시키면서 변이 GltS 단백질을 발현하도록 하기 위하여 상동재조합을 이용하였다. 제작 방법을 도 1에 간략히 나타내었다.
구체적으로, 실시예 2에서 제작한 pKI-mGltS-Cm 플라스미드의 변이 gltS와 클로람페니콜 저항성 유전자 (chloramphenicol resistance gene)를 포함한 영역을 pMurKI-F 및 pMurKI-R 프라이머를 이용해 PCR-증폭하였다. 대조군으로 클로람페니콜 저항성 유전자 (chloramphenicol resistance gene)를 포함하는 영역을 pMurKO-F 및 pMurKI-R 프라이머를 이용해 PCR-증폭하였다. 증폭 후, 올바른 크기의 밴드를 Wizard® SV Gel 및 PCR Clean-Up 시스템(Promega, Madison, WI, USA)을 이용해 각각 정제하였다. 정제된 PCR 절편을 DpnI으로 처리하였고, 이후 Wizard® SV Gel 및 PCR Clean-Up 시스템을 이용해 다시 한번 정제하였다. 정제된 PCR 산물을 pKD46으로 형질전환된 대장균 DH5α 균주에 전기천공법(electroporation)으로 형질전환 하였다.
그 후 클로람페니콜 10 ㎍/mL 및 D-글루타메이트 50 ㎍/mL를 포함하는 LB 배지에 도말하여 37℃에서 밤새 배양하였다. 대조군인 클로람페니콜 저항성 유전자 PCR 산물을 형질전환한 대장균에서는 콜로니를 형성하지 않은 반면 변이 gltS와 클로람페니콜 저항성 유전자를 포함한 PCR 산물을 형질전환한 대장균에서 콜로니를 형성하였다. 이중 7개의 생장한 콜로니를 선별한 후 변이 균주인지 확인하기 위하여 pMurOut-F 및 pMurIn-R 프라이머로 PCR-증폭한 결과 변이 gltS 일부를 포함하는 953bp의 증폭산물이 생성됨을 확인하였다(도 2A). 이후, 선별된 균주를 50 ㎍/mL 글루타메이트를 포함하거나(+) 포함하지 않은(-) LB 배지에서의 배양한 결과 953bp의 증폭산물을 생성하는 균주가 LB 배지에서 생장하지 못하고 D-글루타메이트를 첨가한 LB 배지에서 선택적으로 생장하는 것을 확인하였다(도 2B).
이를 통해, murI 결손 및 변이 gltS(mGltS) 유전자를 도입하여 제조된 균주가 D-글루타메이트 영양요구성 균주임을 확인하였으며, 제조된 D-글루타메이트 영양요구성 균주에 실시예 2의 pCP20 플라스미드를 도입하여 클로람페니콜 저항성 유전자를 제거함으로써 DH5α KI 균주를 완성하였다.
실시예 4: 복합배지에서 DH5α KI 균주의 D-글루타메이트 영양요구성 확인
대장균 DH5α KI 균주의 D-글루타메이트 영양요구성을 확인하기 위하여, 복합배지에서의 실시예 3에서 제조한 대장균 DH5α KI 균주의 성장을 확인하였다.
먼저, 복합배지 별 세포성장을 확인하기 위하여, 대장균 DH5α KI 혹은 WM335 균주(대조군)를 D-글루타메이트 50 ㎍/mL를 포함하는 LB 플레이트에 스트리킹하여 37도, 200 rpm으로 밤새 배양하였다. 단일 콜로니 3개를(n=3) D-글루타메이트 50 ㎍/mL를 포함하는 LB 배지에 각각 접종하여 37도, 200 rpm으로 밤새 배양하였다. 배양된 세포를 3,000 rpm으로 20분간 원심분리하여 상등액을 제거한 후 LB 배지로 현탁하였다. 현탁된 세포 1%를 3종류의 복합 배지(LB, 2X YT 혹은 TB) 혹은 D-글루타메이트 50 ㎍/mL를 포함하는 3종류의 복합 배지(LB, 2X YT 혹은 TB)에 각각 접종하여 37도, 200 rpm으로 배양하였다. 세포 성장은 분광광도계(spectrophotometer, GE Healthcare)를 이용하여 600nm 파장의 흡광도를 측정하여 관측하였다(도 3).
그 결과, DH5α KI는 배양 24시간 동안 모든 배지에서 D-글루타메이트에 대한 선택성을 유지하였으며 2X YT 배지와 TB 배지에서는 48시간까지 이러한 선택성을 유지하였다. 반면, 대조군인 WM335 균주는 D-글루타메이트 유무에 대한 선택성이 LB 배지에서는 나타나지 않았으며, TB 배지에서도 선택성이 현저히 낮았다.
다음으로, 실시간 세포 성장을 관측하기 위하여, 먼저 대장균 DH5α KI를 D-글루타메이트 50 ㎍/mL를 포함하는 LB 플레이트에 스트리킹하여 37도, 200 rpm으로 밤새 배양하였다. 단일 콜로니 6개를(n=6) D-글루타메이트 50 ㎍/mL를 포함하는 LB 배지에 각각 접종하여 37도, 200 rpm으로 밤새 배양하였다. 배양된 세포를 3,000 rpm으로 20분간 원심분리하여 상등액을 제거한 후 LB 배지로 현탁하였다. 현탁된 세포 1%를 LB 혹은 D-글루타메이트 50 ㎍/mL를 포함하는 LB 배지에 각각 접종하여 플레이트 판독기(Infinite 200 Pro, Tecan)에서 37도로 배양하면서 600nm 파장의 흡광도를 측정하였다(도 4).
그 결과, D-글루타메이트를 첨가한 배지에서는 DH5α KI 균주가 잘 생장한 반면, D-글루타메이트가 없는 배지에서 DH5α KI는 약 30시간 가량 거의 생장하지 못하는 것을 확인하였다.
상기와 같은 결과로부터, 본 발명의 DH5α KI 균주는 복합배지의 종류에 관계없이 오랜 시간 동안 배지 내의 D-글루타메이트 유무에 대한 선택성이 높게 유지되며, 특히 2X YT 및 TB 배지에서 선택성이 48시간 이상 유지되고, 이러한 선택성은 기존에 알려진 D-글루타메이트 영양요구성 균주인 WM335 균주에 비해서도 우수한 것임을 알 수 있다.
실시예 5: DH5α KI 균주를 이용한 항생제 저항성 유전자가 제거된 녹색형광단백질(GFP) 발현 재조합 플라스미드 클로닝 및 GFP 발현 확인
DH5α KI 균주를 이용하여 항생제 저항성 유전자가 제거된 GFP 단백질 발현 재조합 플라스미드를 제작하고자 하였다.
먼저, 실시예 2에서 전술한 바와 같이 pT-GFP 플라스미드에서 앰피실린 항생제 저항성 유전자를 D-글루타메이트 영양요구성 균주의 형질전환 마커인 DAAT 유전자로 Gibson 조립 방법을 통해 치환 후 DH5α KI 균주에 형질전환 하여 항생제가 포함되지 않은 LB 플레이트에서 밤새 배양하였다. 그 결과, 생장한 콜로니는 전부 성공적으로 GFP 단백질을 발현하는 것을 확인하였고 22개의 콜로니를 선별하여 pT-GFP-DAAT 플라스미드에 특이적인 pAFout-F와 pAF-IR 프라이머로 PCR-증폭한 결과 22개 콜로니에서 예측된 981bp의 증폭산물이 형성되었다 (도 5). 이중 10개의 콜로니로부터 플라스미드를 분리하여 생어 시퀀싱한 결과 10개의 콜로니 전부 항생제 저항성 유전자 대신 DAAT 유전자가 존재함을 확인하였다.
상기에서 제작한 pT-GFP-DAAT 플라스미드를 도입한 DH5α KI 균주를 (n=3) LB 배지에 접종하여 37도, 200 rpm으로 밤새 배양하였다. 배양된 세포 1%를 다양한 농도의 IPTG (0, 63, 125, 250, 500, 1000 μM)를 함유하는 LB 배지에 접종하여 37도로 플레이트 판독기(Infinite 200 Pro, Tecan)에서 배양하면서 형광 및 OD600을 24시간 동안 측정하였다. 대조군으로 야생형 DH5α 균주에 pT-GFP 플라스미드(앰피실린 저항성 유전자 포함)를 도입하고 앰피실린 및 상기 다양한 농도의 IPTG (0, 63, 125, 250, 500, 1000 μM)를 포함한 배지에서 전술한 바와 같이 배양하였다(도 6).
그 결과, 항생제 저항성 유전자를 포함한 플라스미드로 형질전환된 DH5α 균주와 동일하게 pT-GFP-DAAT 플라스미드를 도입한 DH5α KI 균주에서도 IPTG 양에 따라 형광단백질의 발현량이 조절되는 것을 확인하였으며 세포 생장 역시 문제가 없음을 확인하였다.
이를 통해, 본 발명의 DH5α KI 균주에 DAAT 유전자가 클로닝된 플라스미드를 도입함으로써, 기존 균주와 동일한 효과를 유지하면서 항생제 없이도 재조합 플라스미드를 포함한 대장균의 선별 및 재조합 단백질 발현이 가능하다는 것을 알 수 있다.
실시예 6: D-글루타메이트 영양요구주를 이용한 유용산물 생산
전술한 실시예에서 제조한 D-글루타메이트 영양요구성 DH5α KI 균주를 이용하여 효율적으로 유용 산물을 생산할 수 있는지 확인하고자 (-)-α-비사볼롤((-)-α-bisabolol) 생산 실험을 수행하였다.
pTRC99a 플라스미드의 IPTG-inducible 프로모터 하단에 (-)-α-비사볼롤 신타아제를 코딩하는 MrBBS, 파네실 디포스페이트 신타아제(farnesyl diphosphate synthase)를 코딩하는 ispA 및 메발로네이트(mevalonate) 경로에 관여하는 효소를 코딩하는 mvaE, mvaS, mvaK1, mvaK2, mvaD 및 idi를 클로닝하였으며 선별 마커인 DAAT 및 GFP 코딩 유전자도 클로닝하여 (-)-α-비사볼롤 생산 플라스미드를 제작하였다. 제작된 생산 플라스미드의 구조를 도 7A에 도시하였다.
이때 2종류의 (-)-α-비사볼롤 생산 플라스미드를 제작하였는데 pTM-BBS-IspA-DAAT-GFP 플라스미드는 Staphylococcus aureus 유래의 mvaK1을 발현하기 때문에 낮은 (-)-α-비사볼롤 생산성을 나타내고 pTM2-BBS-IspA-DAAT-GFP 플라스미드는 Methanosarcina mazei 유래의 mvaK1을 발현하여 높은 (-)-α-비사볼롤 생산성을 나타낸다.
제작된 생산 플라스미드를 DH5α KI 균주 또는 대조군인 야생형 DH5α 균주(n=3)에 도입하고, 앰피실린을 첨가하거나 첨가하지 않은 TBG 배지에서 15일 간 계대배양하여(도 7B) 세포생장(OD600) 및 (-)-α-비사볼롤 생산량을 측정하여 평균값을 나타내었다(도 7B와 7C).
그 결과, pTM-BBS-IspA-DAAT-GFP 플라스미드를 함유하는 DH5α KI 균주에서 항생제를 사용하지 않고 배양한 경우, 15일동안 안정적으로 (-)-α-비사볼롤을 생산한 반면 야성형 DH5α 균주의 경우 항생제를 사용한 경우에서도 (-)-α-비사볼롤 생산성이 P4 배양부터 급격히 감소하였다 (도 7B). 이런 안정적인 생산성이 DH5α KI 균주에서의 플라스미드 유지 능력과 관련있는지 확인하기 위하여 pTM-BBS-IspA-DAAT-GFP 플라스미드에서 발현하는 GFP 단백질의 형광을 유세포분석기를 이용하여 단일세포 단위로 측정하였다. 그 결과 DH5α KI 균주에서 플라스미드가 15일 동안 안정적으로 유지되는 반면 야성형 DH5α 균주에서 항생제를 사용한 경우에도 P3 배양부터 플라스미드를 함유하지 않는 세포들이 나타남을 확인하였다 (도 8A).
또한 고농도의 (-)-α-비사볼롤을 생산하는 pTM2-BBS-IspA-DAAT-GFP 플라스미드를 사용하여 동일한 실험을 수행하였다. 이 경우 세포 독성이 존재한다고 알려진 메발로네이트 경로가 크게 활성화 되기 때문에 생산 플라스미드를 지닌 세포의 대사 부담이 가중된다. 실험 결과, DH5α KI 균주에서 항생제를 사용하지 않고 배양한 경우, P3 동안 안정적으로 (-)-α-비사볼롤을 생산한 반면 야성형 DH5α 균주의 경우 항생제를 사용한 경우에서도 (-)-α-비사볼롤 생산성이 P3 배양부터 급격히 감소하였다 (도 7C). 단일세포 형광분석을 통해 생산 플라스미드 안정성을 확인한 결과 DH5α KI 균주의 경우 생산 플라스미드가 15일 동안 안정적으로 유지되는 반면 야성형 DH5α 균주에서 항생제를 사용한 경우에도 P3 배양부터 플라스미드를 함유하지 않는 세포들이 급격히 증가함을 확인하였다 (도 8B).
또 다른 대조군으로 WM335 균주(n=3)에도 상기 플라스미드를 도입하고(대조군: 야생형 DH5α 균주) 12일 간 계대배양하여 마찬가지로 세포생장 및 (-)-α-비사볼롤 생산량을 측정하였다(도 9).
그 결과, pTM-BBS-IspA-DAAT-GFP 플라스미드를 사용하여 생산한 경우 3개의 실험 샘플중 1개만이 (-)-α-비사볼롤을 안정적으로 생산한 반면 2개의 실험 샘플은 야생형 DH5α 균주보다 더 불안정하게 P3 배양부터 생산성을 상실하였다 (도 9A). 고농도의 (-)-α-비사볼롤을 생산하는 pTM2-BBS-IspA-DAAT-GFP 플라스미드를 사용한 경우에도 WM335 균주에서 3개의 실험샘플중 1개만이 (-)-α-비사볼롤을 안정적으로 생산하였다 (도 9B). 그리고, 단일세포 형광분석을 통해 생산 플라스미드 안정성을 실험한 결과 비록 WM335 균주에서 12일동안 지속적으로 플라스미드를 유지하였지만, 단일 세포별 형광 세기를 비교하였을 때, 야생형 DH5α 균주에서는 GFP 단백질 발현이 균질한 반면 WM335 균주의 경우 GFP 단백질 발현 양상이 단일 세포별로 차이가 크면서 전체적으로 비균질함을 확인할 수 있었다 (도 10A 와 10B). 이는 (-)-α-비사볼롤 생산의 경우 WM335 균주보다 DH5α 균주가 더 적합함을 나타낸다.
이를 통해, 본 발명의 DH5α KI 균주에 목표 산물을 코딩하는 유전자 및 DAAT 유전자가 클로닝된 플라스미드를 도입함으로써, 대장균 세대가 거듭되어도 플라스미드 안정성이 유지되어 효율적으로 목표 산물을 생산할 수 있음을 나타내는 것으로, 본 발명의 균주가 다양한 화합물의 생산에 유용하게 사용될 수 있음을 알 수 있다.
실시예 7: 플라스미드 안정성이 강화된 글루타메이트 영양요구주 제작
실시예 5 및 6에서 확인한 바와 같이 본 발명의 DH5α KI 균주에 목표 산물을 코딩하는 유전자 및 DAAT 유전자가 클로닝된 플라스미드를 도입하는 경우 유용한 산물을 생산할 수 있다.
상기 플라스미드가 D-글루타메이트가 풍부한 환경에서도 안정적으로 유지될 수 있도록 하기 위해, DH5α KI에서 D-글루타메이트의 수송체인 mGltS를 제거한 균주, 즉 야생형 DH5α 균주로부터 murI가 결실된 균주를 제작하고자 하였다. 이를 위해 mGltS 유전자와 CAT 유전자 양쪽 바깥에 flippase 인식 서열인 FRT site를 삽입할 경우, 이 균주에 DAAT 발현 재조합 플라스미드와 flippase 발현 플라스미드를 동시에 형질전환시 mGltS 유전자와 CAT 유전자가 동시에 결손되는 방법을 고안하였다. 제조방법을 도 11에 간단히 나타내었다.
먼저 실시예 2에서 제작한 pKI-FRT-mGltS-Cm 플라스미드로부터 pMurKI-FRT-F 및 pMurKI-R 프라이머를 이용해 PCR-증폭하였고, 이 증폭 산물을 실시예 3과 유사하게 대장균 DH5α 균주 chromosome의 murI 유전자 위치에 mGltS, CAT 유전자를 도입한 후 배양하여 D-글루타메이트 영양요구성 균주가 제조됨을 확인하였다(도 12). 이후 pT-GFP-DAAT 플라스미드와 pCP20 플라스미드를 도입하였고, pCP20 플라스미드에서 발현하는 flippase에 의해 FRT site가 재조합되어 mGltS 및 CAT 유전자를 넉아웃시켰으며, 이를 pMurOut-F와 pMurOut-R 프라이머를 이용한 481 bp 크기의 PCR 증폭 산물 및 클로람페니콜을 함유한 플레이트에서 균주가 생장하지 못함을 통해 mGltS 및 CAT 유전자가 성공적으로 제거되었음을 확인하였다(도 13). 이 균주를 37도에서 배양하여 pCP20 플라스미드를 제거하였고 이를 앰피실린을 함유한 플레이트에서 균주가 생장하지 못함을 통해 pCP20 플라스미드가 제거되었음을 확인하였다(도 13).
이렇게 제작된 murI가 결실된 균주는 LB 배지에서 녹색 형광단백질을 성공적으로 발현하였다(도 13).
이를 통해, DH5α 균주에서 murI 유전자를 넉아웃하고 CAT 유전자와 mGltS 유전자를 동시에 제거함에 따라 항생제 사용 없이도 플라스미드 안정성이 높은 D-글루타메이트 영양요구주 제작이 가능하다는 것을 알 수 있다.
실시예 8: 다른 대장균 기반 D-글루타메이트 영양요구주 제작
대장균 DH5α 균주 이외의 다른 대장균에서도 D-글루타메이트 영양요구성 균주 제작이 가능함을 확인하기 위하여, 재조합 단백질 생산에 많이 사용되는 BL21(DE3) 균주와 MG1655 유래의 초산 이용 균주인 SBA01 (KCTC 생물자원센터 기탁번호: KCTC13040BP)에서 실시예 4의 방법에 따라 D-글루타메이트 영양요구성 BL21(DE3) KI과 SBA01 KI 균주를 제작하였다.
그 후, 제조한 대장균 BL21(DE3) KI 과 SBA01 KI 균주의 D-글루타메이트 영양요구성을 배양하면서 플레이트 판독기(Infinite 200 Pro, Tecan)를 사용하여 LB 배지에서 37도로 배양하면서 600nm 파장의 흡광도를 측정하였다 (도 14).
그 결과, D-글루타메이트를 첨가한 배지에서는 BL21(DE3) KI과 SBA01 KI 균주가 잘 생장한 반면, D-글루타메이트가 없는 배지에서 두 균주 모두 약 30시간 가량 거의 생장하지 못하는 것을 확인하였다.
상기와 같은 결과로부터, 본 발명의 D-글루타메이트 영양요구성 제작 방법은 대장균의 종류에 관계없이 적용될 수 있음을 알 수 있다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (12)

  1. 대장균(E.coli)에서 murI 유전자를 결손시키는 단계를 포함하는, D-글루타메이트 영양요구성 변이형 대장균의 제조 방법.
  2. 제1항에 있어서, 상기 제조 방법은 결실된 murI 유전자 자리에 gltS를 도입하는 것을 포함하는, D-글루타메이트 영양요구성 변이형 대장균의 제조 방법.
  3. 제2항에 있어서, 상기 gltS는 서열번호 3의 염기서열을 포함하는 것인, D-글루타메이트 영양요구성 변이형 대장균의 제조 방법.
  4. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 대장균은 BL21(DE3), SBA01 또는 DH5α 균주인, D-글루타메이트 영양요구성 변이형 대장균의 제조 방법.
  5. 제2항에 있어서, 상기 제조 방법은 gltS를 결손시키는 단계를 추가로 더 포함하는, D-글루타메이트 영양요구성 변이형 대장균의 제조 방법.
  6. murI 유전자가 결실된, D-글루타메이트 영양요구성 변이형 대장균.
  7. 제6항에 있어서, 상기 대장균의 결실된 murI 유전자 자리에는 서열번호 3의 변이형 gltS가 도입된 것인, D-글루타메이트 영양요구성 변이형 대장균.
  8. 제6항에 있어서, 상기 대장균은 BL21(DE3), SBA01 또는 DH5α 균주인, D-글루타메이트 영양요구성 변이형 대장균.
  9. 제6항 내지 제8항 중 어느 한 항의 D-글루타메이트 영양요구성 변이형 대장균에 있어서, 추가로 DAAT(D-amino acid transferase)가 도입된 변이형 대장균.
  10. 제9항의 대장균을 포함하는, 목적 물질 생산용 조성물.
  11. 제9항의 대장균을 배양하는 단계를 포함하는, 목적 물질 생산 방법.
  12. 제11항에 있어서, 상기 목적 물질은 단백질인, 목적 물질 생산 방법.
PCT/KR2020/003127 2019-03-06 2020-03-05 D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법 WO2020180132A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190025765A KR102166288B1 (ko) 2019-03-06 2019-03-06 D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법
KR10-2019-0025765 2019-03-06

Publications (1)

Publication Number Publication Date
WO2020180132A1 true WO2020180132A1 (ko) 2020-09-10

Family

ID=72337882

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/003127 WO2020180132A1 (ko) 2019-03-06 2020-03-05 D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법

Country Status (2)

Country Link
KR (1) KR102166288B1 (ko)
WO (1) WO2020180132A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160235834A1 (en) * 2013-10-11 2016-08-18 Servicio Galego De Saúde (Sergas) Live attenuated vaccines
US9708616B2 (en) * 2009-05-11 2017-07-18 Pfenex, Inc. Production of recombinant proteins utilizing non-antibiotic selection methods and the incorporation of non-natural amino acids therein
CN108359630A (zh) * 2018-04-12 2018-08-03 南开大学 一株减毒铜绿假单胞菌的构建方法及其在蛋白质转染中的应用

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9708616B2 (en) * 2009-05-11 2017-07-18 Pfenex, Inc. Production of recombinant proteins utilizing non-antibiotic selection methods and the incorporation of non-natural amino acids therein
US20160235834A1 (en) * 2013-10-11 2016-08-18 Servicio Galego De Saúde (Sergas) Live attenuated vaccines
CN108359630A (zh) * 2018-04-12 2018-08-03 南开大学 一株减毒铜绿假单胞菌的构建方法及其在蛋白质转染中的应用

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LIDONG LIU, YOSHIMURA TOHRU, ENDO KEIJI, KISHIMOTO KAZUHISA, FUCHIKAMI YOSHIHIRO, MANNING JAMES M., ESAKI NOBUYOSHI, SODA KENJI: "Compensation for D-glutamate auxotrophy of Escherichia coli WM3 3 5 by D-amino acid aminotransferase gene and regulation of murI Expression", BIOSCIENCE, BIOTECHNOLOGY, AND BIOCHEMISTRY, vol. 62, no. 1, January 1998 (1998-01-01) - 22 May 2014 (2014-05-22), pages 193 - 195, XP055736328 *
T J DOUGHERTY, THANASSI J A, PUCCI M J: "The Escherichia coli mutant requiring D-glutamic acid is the result of mutations in two distinct genetic loci", JOURNAL OF BACTERIOLOGY, vol. 175, no. 1, January 1993 (1993-01-01), pages 111 - 116, XP055736330 *

Also Published As

Publication number Publication date
KR102166288B1 (ko) 2020-10-15
KR20200107140A (ko) 2020-09-16

Similar Documents

Publication Publication Date Title
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2013162274A1 (ko) 신규한 ｄ형 젖산 생산균주 및 그의 용도
WO2014142463A1 (ko) L-발린 생산능이 향상된 균주 및 이를 이용한 l-발린 생산방법
WO2019117398A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2019190193A1 (ko) 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법
WO2021112469A1 (ko) 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
WO2020075986A2 (ko) 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
WO2015170907A1 (ko) L-라이신 생산능이 향상된 미생물 및 이를 이용한 l-라이신 생산방법
WO2015093831A1 (ko) Ｄ（－）２，３－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 ｄ（－）２，３－부탄디올의 생산 방법
WO2017007159A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2014148754A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
WO2020032590A1 (en) Nucleic acid molecules comprising a variant rpoc coding sequence
WO2014171747A1 (ko) L-트립토판 생산능을 갖는 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법
WO2020180132A1 (ko) D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2018199546A1 (ko) 신규한 피루브산 전달효소
WO2015046978A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
WO2016159536A1 (ko) 신규 프로모터 및 이의 용도
WO2021125494A1 (ko) 다중약물 유출펌프 변이체, 상기 변이체를 코딩하는 폴리뉴클레오티드, 상기 변이체를 포함하는 미생물, 및 이를 이용하여 비올라세인 또는 디옥시비올라세인을 제조하는 방법
WO2021125867A1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
WO2018212627A1 (ko) 숙신산 생산능이 향상된 변이 미생물 및 이를 이용한 숙신산 생산방법
WO2020116941A2 (ko) 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법
WO2022145588A1 (ko) 히스티딘에 의한 피드백 억제가 감소된 atp-prt 변이체 및 이를 발현하는 히스티딘 생산 균주
WO2022145589A1 (ko) 히스티딘에 의한 피드백 억제가 감소된 atp-prt 변이체 및 이를 발현하는 히스티딘 생산 균주

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20766010

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20766010

Country of ref document: EP

Kind code of ref document: A1