WO2016024771A1 - O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법 - Google Patents

O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법 Download PDF

Info

Publication number
WO2016024771A1
WO2016024771A1 PCT/KR2015/008336 KR2015008336W WO2016024771A1 WO 2016024771 A1 WO2016024771 A1 WO 2016024771A1 KR 2015008336 W KR2015008336 W KR 2015008336W WO 2016024771 A1 WO2016024771 A1 WO 2016024771A1
Authority
WO
WIPO (PCT)
Prior art keywords
activity
ops
phosphoserine
microorganism
sequence
Prior art date
Application number
PCT/KR2015/008336
Other languages
English (en)
French (fr)
Inventor
김솔
유인화
장진숙
김혜원
Original Assignee
씨제이제일제당 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 주식회사 filed Critical 씨제이제일제당 주식회사
Priority to UAA201700326A priority Critical patent/UA119985C2/uk
Priority to EP15832358.4A priority patent/EP3181685B1/en
Priority to ES15832358T priority patent/ES2753413T3/es
Priority to JP2017507849A priority patent/JP6570617B2/ja
Priority to RU2017105865A priority patent/RU2663726C1/ru
Priority to US15/329,921 priority patent/US10323262B2/en
Priority to CN201580043665.3A priority patent/CN106795485B/zh
Publication of WO2016024771A1 publication Critical patent/WO2016024771A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01095—Phosphoglycerate dehydrogenase (1.1.1.95)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01065—O-Phosphoserine sulfhydrylase (2.5.1.65)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y206/00—Transferases transferring nitrogenous groups (2.6)
    • C12Y206/01—Transaminases (2.6.1)
    • C12Y206/01052—Phosphoserine transaminase (2.6.1.52)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03003—Phosphoserine phosphatase (3.1.3.3)

Definitions

  • the present invention relates to microorganisms producing O-phosphoserine and methods of producing O-phosphoserine, cysteine or cysteine derivatives using the microorganisms.
  • L-cysteine is an important amino acid in the metabolism of sulfur in all organisms and is used as a precursor for coenzyme A biosynthesis as well as in the synthesis of proteins in vivo such as hair keratin, glutathione, biotin, methionine and other sulfur-containing metabolites. do.
  • the present inventors have newly identified two polypeptides, YhhS and MdtD, having OPS releasing ability, and confirmed that when the activity of the polypeptide is enhanced in OPS producing microorganisms, OPS can be effectively released, and the present invention Was completed.
  • One object of the present invention is to provide an OPS producing microorganism wherein the activity of the polypeptide exhibiting OPS releasing activity is enhanced compared to the intrinsic activity.
  • Another object of the present invention is to provide a method for producing OPS, comprising culturing the OPS producing microorganism in a medium and separating the OPS from the microorganism or a medium thereof.
  • Another object of the present invention is to provide an OPS production or release use of the polypeptide.
  • Still another object of the present invention is to a) produce OPS by culturing OPS-producing microorganisms in which the activity of the polypeptide exhibiting OPS releasing activity is enhanced compared to endogenous activity; And b) reacting the OPS produced in step a) or a medium comprising the same with a sulfide in the presence of OPS sulfhydrylase or a microorganism expressing the same, providing a method of producing cysteine or a derivative thereof.
  • novel polypeptide having the amino acid sequence of SEQ ID NO: 1 or 2 of the present invention has excellent OPS ejection ability, when applied to OPS-producing microorganisms, OPS can be produced with high efficiency, and thus can be usefully used for L-cysteine synthesis. Can be.
  • Figure 1 is a graph of the results of measuring the OPS in the cell using high performance liquid chromatography (HPLC) after removing all OPS discharged from the culture medium of the recombinant microorganism of the present invention to enhance the function of YhhS and MdtD protein It is shown.
  • HPLC high performance liquid chromatography
  • One aspect of the invention provides an OPS producing microorganism having an amino acid sequence of SEQ ID NO: 1 or 2, wherein the activity of the polypeptide exhibiting OPS excretion activity is enhanced compared to the intrinsic activity.
  • OPS O-phosphoserine
  • OPS OPS sulfhydrylase
  • polypeptide showing OPS excretion activity refers to a membrane protein having an activity capable of excreting OPS in a cell out of a cell, and specifically, may be a membrane protein derived from E. coli.
  • Two membrane proteins were identified from Escherichia coli, in which growth degradation was released under conditions in which excess OPS was present.
  • Membrane proteins having the OPS releasing ability thus identified are specifically YhhS major facilitator superfamily (MFS) transporters having the amino acid sequence of SEQ ID NO: 1, and YegB MFS transporters having the amino acid sequence of SEQ ID NO: 2.
  • MFS major facilitator superfamily
  • the YegB MFS transporter may be used interchangeably with MdtD in the present invention.
  • the OPS releasing activity of the protein is not known and was first identified in the present invention.
  • polypeptide may be an amino acid sequence set forth in SEQ ID NO: 1 or 2, at least 70%, specifically at least 80%, more specifically at least 90%, even more specifically at least 95% of the sequence
  • amino acid sequence showing homology any membrane protein which exhibits an OPS releasing ability substantially identical to or corresponding to that of the polypeptide is included without limitation.
  • amino acid sequence substantially showing OPS ability it is obvious that polypeptide variants in which some sequences are deleted, modified, substituted or added are also included in the scope of the present invention.
  • polynucleotide sequence of the polypeptide exhibiting the activating activity of the O-phosphoserine may include a polynucleotide sequence encoding the amino acid set forth in SEQ ID NO: 1 or 2.
  • the polynucleotide may be subjected to various modifications to the coding region within the range of not changing the amino acid sequence of the polypeptide due to degeneracy of the codon or in consideration of the codon preferred in the organism to express the polypeptide. Can be.
  • the polynucleotide sequence may have, for example, a polynucleotide sequence of SEQ ID NO: 3 or 4, and may have a nucleotide sequence having 80% homology thereto, specifically 90% or more. However, it is not limited thereto.
  • homologous sequences thereof having the same or similar activity as a given polypeptide sequence or polynucleotide sequence are denoted as "% homology".
  • % homology For example, using standard software that calculates parameters such as score, identity and similarity, in particular BLAST 2.0, or by hybridization experiments used under defined stringent conditions The appropriate hybridization conditions defined can be determined by methods well known to those skilled in the art (see Sambrook et al., 1989, infra).
  • a positive control RhtB protein (Korean Patent Publication No. 10- 2012-0041115), or compared with the strains fortifying EmrD or YcaD, the MFS transporter of the comparative group was confirmed to have excellent OPS excretion activity.
  • 'RhtB' is a membrane protein that releases homoserine / homoserine lactone and is encoded by the gene rhtB .
  • the terms 'EmrD' and 'YcaD' are MFS transporter proteins of Escherichia coli, which are encoded by the emrD and ycaD genes, respectively.
  • EmrD and YcaD are proteins belonging to the MFS transporter, such as YhhS and MdtD proteins, and were used as a comparison group to check whether other proteins belonging to the MFS transporter can also exhibit OPS emission ability. As a result, it was confirmed that EmrD and YcaD proteins do not exhibit OPS ejection ability unlike YhhS and MdtD proteins.
  • the polypeptide of the present invention has OPS releasing activity, when the activity of the polypeptide is enhanced in comparison to the intrinsic activity in the microorganism having OPS production ability, it is possible to effectively produce OPS.
  • OPS production is a concept that includes not only producing OPS in a strain, but also releasing OPS in a cell outside the cell, such as a medium, and specifically, discharge the OPS out of the cell. I mean.
  • intrinsic activity refers to the active state of a polypeptide in which the microorganism inherently appears in its natural state, that is, in a non-mutated state.
  • Enhanced compared to intrinsic activity means that the activity is increased when compared to the activity of the polypeptide inherently present in the natural state, and the activity of the polypeptide to a microorganism that does not have the activity of a specific polypeptide Granting is a concept that also includes.
  • the “enhancement of activity” includes, but is not particularly limited to, the activity of the polypeptide itself to be increased to elicit effects beyond its original function, as well as an increase in intrinsic gene activity, intrinsic gene amplification from internal or external factors, Its activity is increased by introduction of genes from outside, promoter replacement or modification, and increase in enzyme activity by mutation.
  • an increase in the intracellular copy number of the gene encoding the polypeptide a method of modifying a gene expression control sequence encoding the polypeptide, encoding the polypeptide on the chromosome with a mutated gene to increase the polypeptide activity
  • the method of enhancing such activity may be equally referred to when enhancing the activity of other polypeptides in the present specification.
  • the increase in the number of copies of the gene in the above may be performed in the form operably linked to the vector, or by inserting into the chromosome in the host cell.
  • a vector capable of replicating and functioning independently of the host to which the polynucleotide encoding the protein of the present invention is operably linked may be introduced into the host cell.
  • a vector capable of inserting the polynucleotide into a chromosome in a host cell to which the polynucleotide is operably linked may be introduced into the chromosome of the host cell.
  • Insertion of the polynucleotide into the chromosome can be by any method known in the art, for example by homologous recombination. Since the vector of the present invention may be inserted into a chromosome by causing homologous recombination, the vector may further include a selection marker for confirming whether the chromosome is inserted. Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a polynucleotide of interest, and confer a selectable phenotype such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers may be used, but are not limited thereto. In an environment treated with a selective agent, only cells expressing a selection marker survive or exhibit different expressing traits, so that transformed cells can be selected.
  • the vector may be a DNA preparation containing a nucleotide sequence of the polynucleotide encoding the target protein operably linked to a suitable expression control sequence to enable expression of the target protein in a suitable host.
  • the expression control sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. After being transformed into a suitable host cell, the vector can be replicated or function independent of the host genome and integrated into the genome itself.
  • the vector to be used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, ⁇ MBL3, ⁇ MBL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, and Charon21A can be used as the phage vector or cosmid vector
  • pBR, pUC, and pBluescriptII systems are used as plasmid vectors.
  • pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • transformation in the present invention means introducing a vector comprising a polynucleotide encoding a target protein into a host cell to allow the protein encoded by the polynucleotide to be expressed in the host cell.
  • Transformed polynucleotides include all of them, as long as they can be expressed in the host cell, whether they are inserted into or located outside the chromosome of the host cell.
  • the polynucleotide also includes DNA and RNA encoding the target protein.
  • the polynucleotide may be introduced in any form as long as it can be expressed by being introduced into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression, but is not limited thereto.
  • the expression cassette may include a promoter, a transcription termination signal, a ribosomal binding site, and a translation termination signal, which are typically operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell.
  • operably linked means that the gene sequence and the promoter sequence for initiating and mediating the transcription of the polynucleotide encoding the protein of interest of the present invention.
  • modifying the expression control sequence to increase the expression of the polynucleotide is not particularly limited, but deletion, insertion, non-conservative or conservative substitution or their nucleic acid sequence to further enhance the activity of the expression control sequence. It can be carried out by inducing a variation in sequence in combination or by replacing with a nucleic acid sequence having stronger activity.
  • the expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, a sequence for controlling termination of transcription and translation, and the like.
  • a strong promoter may be linked to the top of the polynucleotide expression unit instead of the original promoter, but is not limited thereto.
  • Examples of known strong promoters may include the cj1 promoter (Korean Patent No. 0620092), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter and the tet promoter.
  • modification of the polynucleotide sequence on the chromosome is not particularly limited, but the mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the polynucleotide sequence. Or by replacing with a polynucleotide sequence that has been modified to have stronger activity.
  • Introduction and enhancement of such protein activity is generally at least 1%, 10%, 25%, 50%, 75, where the activity or concentration of the corresponding protein is based on the activity or concentration in the wild type protein or the initial microbial strain. %, 100%, 150%, 200%, 300%, 400% or 500%, may be increased up to 1000% or 2000%, but is not limited thereto.
  • OPS producing microorganism is a prokaryotic or eukaryotic microorganism strain capable of producing OPS in an organism, and specifically, means a microorganism capable of accumulating OPS by genetic manipulation.
  • the type of microorganism capable of releasing OPS is not particularly limited, and can be either prokaryotic or eukaryotic, Specifically, it may be prokaryotic.
  • micro-organisms belonging to the genus Escherichia (Escherichia), An air Winiah (Erwinia) genus, Serratia marcescens (Serratia) genus, Providencia (Providencia) genus Corynebacterium (Corynebacterium) in and Brevibacterium (Brevibacterium) Strains may be included, specifically Escherichia spp., But examples include E. coli, but are not limited thereto.
  • the microorganism of the genus Escherichia or Corynebacterium can produce OPS and L-serine through the enzymes SerA, SerC and SerB of the biosynthetic pathway of L-serine (Ahmed Zahoor, Computational and structural).
  • the OPS-producing microorganism may additionally have a weakened activity of intrinsic phosphoserine phosphatase (SerB) compared to intrinsic activity.
  • SerB intrinsic phosphoserine phosphatase
  • SerB Since SerB has an activity of converting OPS into L-serine, microorganisms mutated to weaken SerB activity may be useful for the production of OPS due to the accumulation of OPS.
  • the SerB may be a protein having an amino acid sequence set forth in SEQ ID NO: 17 or 18, but is not limited thereto. In addition, as long as it shows the activity of SerB, it may include an amino acid sequence of 80% or more, specifically 90% or more, more specifically 95% or more, even more specifically 99% or more identical to the amino acid sequence. It is not limited.
  • polynucleotide sequence encoding SerB may have a polynucleotide sequence encoding the amino acid set forth in SEQ ID NO: 17 or 18.
  • the polynucleotide may be variously modified in the coding region due to the degeneracy of the codon or in consideration of the codon preferred in the organism to express the polypeptide, without changing the amino acid sequence of the polypeptide.
  • the polynucleotide sequence may have, for example, a polynucleotide sequence of SEQ ID NO: 19 or 20, and may have a nucleotide sequence having 80% homology thereto, specifically 90% or more. However, it is not limited thereto.
  • the term "attenuated compared to the intrinsic activity” means that the activity is reduced when compared to the activity of a protein originally possessed by a microorganism, and includes a case where activity is removed.
  • the weakening may be due to a mutation of the gene encoding the protein or the like, when the activity of the protein itself is reduced or eliminated compared to the activity of the protein originally possessed by the microorganism, and the inhibition of expression or translation of the gene encoding the protein.
  • the gene is not expressed at all, and even if expressed, the concept is also included.
  • Such weakening of protein activity can be achieved by various methods well known in the art.
  • the method include a method of replacing a gene encoding the protein on a chromosome with a mutated gene such that the activity of the enzyme is reduced, including when the activity of the protein is removed; A method of modifying an expression control sequence of a gene encoding said protein; Deleting all or part of a gene on a chromosome that encodes the protein; Introducing an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to a transcript of a gene on the chromosome to inhibit translation from the mRNA to a protein; How to make a secondary structure by the addition of a sequence complementary to the SD sequence in front of the SD sequence of the gene encoding the protein to make the ribosomes impossible to attach and the ORF (open reading frame) of the sequence
  • RTE reverse transcription engineering
  • a method of deleting part or all of a gene encoding a protein replaces a polynucleotide encoding an endogenous target protein in a chromosome with a polynucleotide or marker gene in which a part of a nucleic acid sequence is deleted through a bacterial chromosome insertion vector.
  • This can be done by.
  • a method of deleting genes by homologous recombination may be used.
  • the "part" is different depending on the type of polynucleotide, but may be specifically 1 to 300, preferably 1 to 100, more preferably 1 to 50, but is not particularly limited thereto. .
  • the method of modifying the expression control sequence is carried out by inducing a mutation on the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further weaken the activity of the expression control sequence, or more By replacing with a nucleic acid sequence having weak activity.
  • the expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence that controls the termination of transcription and translation.
  • a method of modifying a gene sequence on a chromosome may be performed by inducing a mutation on the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further weaken the activity of the protein, or to perform weaker activity. It can be carried out by replacing with a gene sequence that has been improved to have or a gene sequence that has been improved so that there is no activity.
  • the OPS-producing microorganism may additionally have enhanced activity of phosphoglycerate dehydrogenase (SERA) or phosphoserine aminotransferase (SerC) compared to intrinsic activity.
  • SERA phosphoglycerate dehydrogenase
  • SerC phosphoserine aminotransferase
  • SerA is a protein having an activity of converting 3-phosphoglycerate to 3-phospho-hydroxypyruvate, and SerA has a feedback on wild type or serine. Released variants can be used.
  • SerC is a protein having an activity of converting 3-phosphohydroxypyruvate to OPS. Therefore, the microorganisms having enhanced SerA or / and SerC activity can be usefully used as OPS producing strains.
  • SerA may include, but is not limited to, an amino acid sequence selected from the group consisting of SEQ ID NOs: 21 to 26.
  • SEQ ID NO: 21 is a sequence of wild-type SerA
  • 22 to 26 are sequences of variants in which feedback to serine has been released.
  • the amino acid sequence and the amino acid sequence are at least 80%, specifically at least 90%, more specifically at least 95%, even more specific. Or more than 99% identical amino acid sequence, but is not limited thereto.
  • the variant in which the feedback is released means a case in which a mutation is introduced into the gene encoding SerA by inserting or replacing a mutation to maintain or enhance the activity from feedback inhibition by serine or glycine, and the feedback is released.
  • Variants are already well known (Grant GA et al., J. Biol. Chem., 39: 5357-5361, 1999; Grant GA et al., Biochem., 39: 7316-7319, 2000; Grant GA et al. J. Biol. Chem., 276: 17844-17850, 2001; Peters-Wendisch P et al., Appl. Microbiol. Biotechnol., 60: 437-441, 2002; European Patent EP0943687B).
  • polynucleotide sequence encoding a variant in which the feedback is released to the wild type or serine of SerA may have a polynucleotide sequence encoding any one amino acid sequence of SEQ ID NO: 21 to 26, but is not limited thereto.
  • the polynucleotide may be variously modified in the coding region due to the degeneracy of the codon or in consideration of the codon preferred in the organism to express the polypeptide, without changing the amino acid sequence of the polypeptide.
  • the polynucleotide sequence may have, for example, any one of the polynucleotide sequences set forth in SEQ ID NOs: 27 to 32, and may have a nucleotide sequence having an homology of 80%, specifically 90% or more. However, it is not limited thereto.
  • the SerC may be, for example, a protein having an amino acid sequence as set forth in SEQ ID NO: 33, but is not limited thereto.
  • the amino acid sequence may include at least 80%, specifically at least 90%, more specifically at least 95%, and more specifically at least 99% of the amino acid sequence. It is not limited.
  • polynucleotide sequence encoding the SerC may have a polynucleotide sequence encoding the amino acid set forth in SEQ ID NO: 33.
  • the polynucleotide may be variously modified in the coding region due to the degeneracy of the codon or in consideration of the codon preferred in the organism to express the polypeptide, without changing the amino acid sequence of the polypeptide.
  • the polynucleotide sequence may have, for example, a polynucleotide sequence of SEQ ID NO: 34, and may have a nucleotide sequence having an homology of 80%, specifically 90% or more. However, it is not limited thereto.
  • microorganism may be a microorganism which further reduced the ability of OPS to enter or degrade the cells.
  • the step of culturing the OPS-producing microorganisms, OPS releasing activity, the activity of the polypeptide having the amino acid sequence of SEQ ID NO: 1 or 2 in the medium, and the O-phosphoserine producing microorganism Or it provides a method for producing OPS, comprising the step of separating O-phosphoserine from the medium thereof.
  • the term "culture” means growing the microorganisms under appropriately controlled environmental conditions. Cultivation process of the present invention can be made according to the appropriate medium and culture conditions known in the art. This culture process can be easily adjusted and used by those skilled in the art according to the strain selected. Specifically, the culture may be batch, continuous and fed-batch, but is not limited thereto.
  • glycine or serine may be additionally included in the medium because the serine requirement of the microorganism is induced.
  • Glycine may be provided in the form of purified glycine, yeast extract containing glycine, tryptone and the concentration contained in the culture medium may be usually 0.1 to 10 g / L, specifically 0.5 to 3 g / L.
  • the serine may be provided in the form of purified serine, yeast extract containing serine, tryptone and the like and the concentration contained in the culture medium may be usually 0.1 to 5 g / L, specifically 0.1 to 1 g / L .
  • Carbon sources included in the medium include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, Stearic acid, fatty acids such as linoleic acid, alcohols such as glycerol, ethanol, organic acids such as acetic acid, and these materials can be used individually or as a mixture. But it is not limited thereto.
  • inorganic nitrogen sources such as peptone, yeast extract, gravy, malt extract, corn steep liquor, and organic nitrogen sources such as soybean wheat, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • organic nitrogen sources such as soybean wheat, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • Potassium diphosphate, dipotassium hydrogen phosphate and corresponding sodium-containing salts may be included as the person included in the medium, but are not limited thereto. It may also include metal salts such as magnesium sulfate or iron sulfate.
  • amino acids, vitamins and appropriate precursors may be included. These media or precursors may be added batchwise or continuously to the culture, but are not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture.
  • antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without injecting gas to maintain anaerobic and unaerobic conditions.
  • the temperature of the culture may usually be from 27 ° C to 37 ° C, specifically 30 ° C to 35 ° C. The incubation period may continue until the desired amount of useful material is obtained, specifically 10 to 100 hours.
  • the present invention can further separate and purify the OPS produced in the culture step, the method using a suitable method known in the art according to the culture method, for example, batch, continuous or fed-batch culture method, etc.
  • the desired OPS can be recovered from the medium, but is not limited thereto.
  • a) OPS is produced by culturing OPS-producing microorganisms in a medium in which the activity of the polypeptide having the amino acid sequence of SEQ ID NO: 1 or 2 is enhanced compared to the endogenous activity.
  • OPSS O-Phosphoserine sulfhydrylase
  • OPS sulfhydrylase refers to a polypeptide that catalyzes a reaction for converting the OPS to cysteine by providing a thiol group (SH group) to the OPS. it means.
  • the enzyme is Aeropyrum pernix ), Mycobacterium tuberculosis ), Mycobacterium smegmatics , Trichomonas vaginalis ) (Mino K and Ishikawa K, FEBSletters, 551: 133-138, 2003; Burns KE et al., J. Am. Chem. Soc., 127: 11602-11603, 2005).
  • the OPSS is a sequence in which some sequences of the polynucleotide sequence encoding the OPSS are deleted, substituted or added, as well as a wild type OPSS protein, and a variant protein exhibiting an activity equal to or greater than the biological activity of the wild type OPSS protein.
  • the OPSS protein disclosed in Korean Patent No. 1361048 and Korean Patent No. 1208267 and all variants thereof are also included.
  • the sulfide is provided in the form of a liquid or a gas due to the difference in pH, pressure and solubility as well as the solids commonly used in the art, so that sulfides (S 2- ), thiolsulfate (S 2 O 3) Any sulfide that can be converted into a thiol group (SH group) in the form of 2- ) and the like can be used. Specifically, Na 2 S, NaSH, H 2 S, (NH 4 ) 2 S and Na 2 S 2 O 3 which provide a thiol group to OPS can be used.
  • the reaction is to produce one cysteine or cysteine derivative by providing one thiol group in one OPS reactor, the amount of sulfide added in the reaction may be 0.1 to 3 times the molar concentration of OPS, specifically 1 to 2 It may be a boat.
  • the present invention further comprises the step of separating and purifying the cysteine produced through the reaction step of step b).
  • the desired cysteine can be separated and purified from the reaction solution by using a suitable reaction known in the art.
  • a feature of the present invention is to enhance the activity of the polypeptide of SEQ ID NO: 1 or 2 in OPS-producing microorganisms to produce OPS in high yield, and to react the produced OPS with OPSS to effectively produce cysteine
  • the cysteines thus prepared can also be produced as various cysteine derivatives by modifying hydrogen atoms or specific atomic groups of cysteine through chemical synthesis reactions known in the art.
  • the term "derivative" is a similar compound obtained by chemically changing a part of a compound, and generally means a compound in which a hydrogen atom or a specific atomic group in the compound is substituted by another atom or atomic group.
  • cyste derivative means a compound in which a hydrogen atom or a specific atomic group of cysteine is replaced by another atom or atomic group.
  • another atom or group of atoms may be attached to the nitrogen atom of the amine group (-NH 2 ) of cysteine or the sulfur atom of the thiol group (-SH).
  • N-acetylcysteine (NAC) and SCMC (S) may be attached to the nitrogen atom of the amine group (-NH 2 ) of cysteine or the sulfur atom of the thiol group.
  • Cysteine can be easily synthesized with N-acetylcysteine (NAC) by reacting with an acetylation agent, and with S-Carboxymetylcysteine (SCMC) by reacting with haloacetic acid under basic conditions.
  • NAC N-acetylcysteine
  • SCMC S-Carboxymetylcysteine
  • the cysteine derivative is mainly used as a pharmaceutical raw material for the treatment of antitussives, cough relievers, bronchitis, bronchial asthma and sore throat.
  • Screening was performed using a genomic DNA library of Escherichia coli K12_W3110 (ATCC27325) to identify membrane proteins of Escherichia coli involved in the release of OPS.
  • a base strain producing OPS was constructed to set up conditions under which growth of E. coli was reduced by OPS.
  • Screening-based strains are recombinant microorganisms that alter the activity of endogenous phosphoserine phosphatase (SerB) in E. coli wild-type strain W3110. US Patent Publication No. 2012-0190081).
  • OPS producing strain KCCM11212P was cultured in a medium containing OPS to establish the optimal screening conditions showing growth inhibition (growth inhibition).
  • W3110 genomic library plasmids were transformed CA07-0012 by electroporation (van der Rest et al. 1999) and colonies were selected to release growth degradation under medium conditions with excess OPS. Plasmids were obtained from selected colonies and sequenced through sequencing techniques. From this, two strains of E. coli membrane proteins involved in releasing growth deterioration under excessive OPS addition conditions were identified.
  • the two E. coli membrane proteins include YhhS major facilitator superfamily (MFS) transporter (amino acid sequence of SEQ ID NO: 1, and nucleotide sequence of SEQ ID NO: 3) and YegB MFS transporter (amino acid sequence of SEQ ID NO: 2, and SEQ ID NO: 2). Nucleotides of 4), respectively, identified by yhhS and mdtD (Pao SS, Paulsen IT, Saier MH (1998). "Major facilitator superfamily.” Microbiol Mol Biol Rev 1998; 62 (1); 1-34.PMID : 9529885).
  • MFS major facilitator superfamily
  • the gene yhhS (SEQ ID NO: 3, Accession Numbers: b3473) encoding the YhhS MFS transporter and the gene mdtD (SEQ ID NO: 4, Accession Numbers: b2077) fragment encoding the YegB MFS transporter were PCR-printed with the W3110 genomic DNA template. Obtained through.
  • the primer used at this time was prepared based on information about the K12 W3110 gene (GenBank accession number AP 003471) and surrounding nucleotide sequences registered in the National Institutes of Health Genebank (NIH GeneBank).
  • PCR for the rhtB , emrD and ycaD genes was also amplified by the corresponding gene fragments using the respective primer pairs described in Table 1 above.
  • the fragments of each amplified gene were treated with the EcoRV and HindIII restriction enzymes, and the EcoRV and HindIII restriction enzyme sites of the pCL-PrhtB-vector containing the promoter of the rhtB gene of Escherichia coli (PrhtB) inserted into the pCL1920 vector (GenBank No AB236930) Cloned into, pCL-PrhtB-rhtB, pCL-PrhtB-yhhS, pCL-PrhtB-mdtD, pCL-PrhtB-emrD, pCL-PrhtB-ycaD, respectively, were prepared.
  • Example 3 Preparation of YhhS MFS Transporter and YegB MFS Transporter Strains and Evaluation of OPS Production Capacity
  • Example 3-1 Preparation of YhhS MFS Transporter and YegB MFS Transporter Strains Using CA07-0012 and Evaluation of OPS Production Capacity>
  • Example 2 Five strains of plasmids prepared in Example 2 were introduced into CA07-0012, which is an OPS producer, to evaluate the production capacity of OPS.
  • the strain named CA07-0012 / pCL-PrhtB-yhhS was named Escherichia coli CA07-0266, and it was deposited on December 9, 2013 to the Korea Microorganism Conservation Center, an international depository organization under the Budapest Treaty. Was given accession number KCCM11495P.
  • Escherichia coli CA07-0012 / pCL-PrhtB-mdtD CA07-0267 which was deposited with the Korea Microorganism Conservation Center, an international depository under the Budapest Treaty, on December 9, 2013, and was assigned accession number KCCM11496P.
  • Example 3-2 Preparation of YhhS MFS transporter and YegB MFS transporter-enhanced strain using SerA and SerC-enhanced strains and evaluation of OPS production capacity>
  • OPS production ability is enhanced by enhancing the activities of SerA (3-phosphoglycerate dehydrogenase) and SerC (3-phosphoserine aminotransferase), which are OPS biosynthetic pathways.
  • SerA 3-phosphoglycerate dehydrogenase
  • SerC 3-phosphoserine aminotransferase
  • the E. coli membrane protein gene was further introduced into CA07-0022 / pCL-Prmf-serA * (G336V)-(RBS) serC, which has improved OPS production ability compared to the CA07-0012 strain derived from E. coli.
  • the YhhS and MdtD fortified strains of the present invention and RhtB fortified strains of the positive control group was confirmed that the production of OPS increased compared to the control.
  • the OPS concentration increased by 145% or more similarly to the results of Table 3 above.
  • the comparison group ErmD fortification and YcaD fortification group showed a decrease in OPS production compared to the control group.
  • Example 3-3 Preparation of YhhS MFS transporter and YegB MFS transporter-enhanced strain according to promoter strength and evaluation of OPS production capacity>
  • Each of the YhhS and mdtD fragments of the pCL-PrhtB-gene was digested with Eco RV, Hind III, and placed in place of the Eco RV and Hind III restriction enzymes of the pCL-Ptrc-GFP vector with trc promoter inserted into the pCL1920 vector.
  • pCL-Ptrc-yhhS and pCL-Ptrc-mdtD were produced.
  • PCR was then carried out using primer pairs of SEQ ID NO: 15 and SEQ ID NO: 16 for each plasmid as a template, followed by restriction enzyme treatment with HindIII to place the Hind III restriction enzyme of pCL-Prmf-serA * (G336V)-(RBS) serC. Cloned.
  • Example 3-4 Preparation of YhhS MFS transporter and YegB MFS transporter-enhanced strain according to chromosome promoter strength and evaluation of OPS production capacity>
  • the recombinant vector prepared to replace the yhhS and mdtD autologous promoters on the chromosome was transformed into O07-producing strain CA07-0022 / pCL-Prmf-serA * (G336V)-(RBS) serC (Korean Patent No. 138104).
  • the cj1 promoter sequence was inserted into the chromosome by replacing the autologous promoter sequence possessed by the parent strain with the promoter sequence on the vector as described above.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 O-포스포세린(O-phosphoserine, OPS)의 배출능을 가지는 폴리펩타이드의 활성이 강화된 미생물 및 상기 미생물을 이용하여 O-포스포세린, 시스테인 또는 시스테인 유도체를 생산하는 방법에 관한 것이다.

Description

O-포스포세린 생산 미생물 및 이를 이용한 O-포스포세린 또는 L-시스테인 생산 방법
본 발명은 O-포스포세린을 생산하는 미생물 및 상기 미생물을 이용하여 O-포스포세린, 시스테인 또는 시스테인 유도체를 생산하는 방법에 관한 것이다.
L-시스테인은 모든 생물체의 황 대사에 있어서 중요한 아미노산으로, 모발의 케라틴 등 생체 내 단백질, 글루타치온, 바이오틴, 메치오닌 및 기타 황을 함유한 대사산물의 합성에 사용될 뿐만 아니라 코엔자임A 생합성의 전구물질로 사용된다.
미생물을 이용하여 L-시스테인을 생산하는 방법으로 1) 미생물을 이용하여 D,L-ATC를 생물학적으로 전환하는 방법, 2) 대장균을 이용한 L-시스테인을 생산하는 직접 발효 방법이 알려져 있다(유럽등록특허 EP0885962B; Wada M and Takagi H, Appl. Microbiol. Biochem., 73:48-54, 2006). 3) 또한, 미생물을 이용하여 O-포스포세린(O-phosphoserine, 이하 "OPS")을 발효 생산한 후, O-포스포세린 설피드릴라아제(O-phosphoserine sulfhydrylase, 이하 "OPSS")의 촉매 작용 하에 황화물과 반응하여 L-시스테인으로 전환시킨 방법이 공지되어 있다(한국등록특허 제1381048호).
이때, 상기 3) 방법으로 고수율의 시스테인을 생산하기 위해서 전구체인 OPS를 과량 생산하여야 한다. 이에 본 발명자들은 OPS 생산 균주에서 생산된 OPS를 세포 밖으로 원활하게 배출시킬 수 있는 적절한 배출 인자를 규명하고자 예의 노력하였다.
이러한 배경 하에, 본 발명자들은 OPS 배출능을 가지는 YhhS 및 MdtD 두 폴리펩타이드를 새롭게 규명하였고, OPS 생산 미생물에서 상기 폴리펩타이드의 활성을 강화시키는 경우, OPS를 효과적으로 배출시킬 수 있음을 확인하고, 본 발명을 완성하였다.
본 발명의 하나의 목적은 OPS 배출 활성을 나타내는 폴리펩타이드의 활성이 내재적 활성에 비하여 강화된, OPS 생산 미생물을 제공하는 것이다.
본 발명의 다른 하나의 목적은 상기 OPS 생산 미생물을 배지에서 배양하는 단계 및 상기 미생물 또는 이의 배지로부터 OPS를 분리하는 단계를 포함하는, OPS의 생산방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 폴리펩타이드의 OPS 생산 또는 배출 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 a) OPS 배출 활성을 나타내는 상기 폴리펩타이드의 활성이 내재적 활성에 비하여 강화된, OPS 생산 미생물을 배지에서 배양하여 OPS를 생산하는 단계; 및 b) OPS 설프하이드릴라아제 또는 이를 발현하는 미생물의 존재 하에, 상기 a) 단계에서 생산된 OPS 또는 이를 포함하는 배지를 황화물과 반응시키는 단계를 포함하는, 시스테인 또는 이의 유도체의 제조 방법을 제공하는 것이다.
본 발명의 서열번호 1 또는 2의 아미노산 서열을 가지는 신규 폴리펩타이드는 우수한 OPS 배출능을 지니므로, 이를 OPS 생산 미생물에 적용하는 경우 OPS를 고효율로 생산할 수 있어, L-시스테인 합성 등에 유용하게 이용될 수 있다.
도 1은, YhhS 및 MdtD 단백질의 기능을 강화시킨 본 발명의 재조합 미생물의 배양액에서 배출된 OPS를 모두 제거한 후, 세포 내부의 OPS를 HPLC(high performance liquid chromatography)를 이용하여 측정한 결과를 그래프로 나타낸 것이다.
본 발명의 일 양태는 서열번호 1 또는 2의 아미노산 서열을 가지는, OPS 배출 활성을 나타내는 폴리펩타이드의 활성이 내재적 활성에 비하여 강화된, OPS 생산 미생물을 제공한다.
본 발명에서 용어, "O-포스포세린(O-phosphoserine, 이하 "OPS")"은 세린 및 인산(phosphoric acid)의 에스터 화합물로서, 여러 단백질의 구성요소이다. 특히, 상기 OPS는 L-시스테인의 전구체로서, OPS 설피드릴라제(OPS sulfhydrylase, OPSS)의 촉매 작용 하에 황화물과 반응하여 시스테인으로 전환될 수 있다(한국등록특허 제1381048호).
본 발명에서 용어, "OPS 배출 활성을 나타내는 폴리펩타이드"는 세포 내의 OPS를 세포 밖으로 배출할 수 있는 활성을 가지는 막 단백질을 의미하며, 구체적으로는 대장균 유래의 막 단백질일 수 있다. 과량의 OPS가 존재하는 조건하에서 생육 저하가 해제되는 대장균으로부터 막 단백질 2종이 동정되었다. 이렇게 규명된 OPS 배출능을 가지는, 막 단백질은 구체적으로, 서열번호 1의 아미노산 서열을 가지는 YhhS MFS(major facilitator superfamily) 트랜스포터, 및 서열번호 2의 아미노산 서열을 가지는 YegB MFS 트랜스포터이다. 상기 YegB MFS 트랜스포터는 본 발명에서 MdtD와 혼용되어 사용될 수 있다. 상기 단백질의 OPS 배출 활성은 알려진 바 없으며, 본 발명에서 최초로 규명되었다.
또한, 상기 폴리펩타이드는 서열번호 1 또는 2로 기재한 아미노산 서열일 수 있으며, 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 상기 폴리펩타이드와 동일하거나 상응하는 OPS 배출능을 나타내는 막 단백질이라면 제한없이 포함한다. 또한 이러한 상동성을 갖는 서열로서 실질적으로 OPS 배출능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 폴리펩타이드 변이체도 본 발명의 범위 내에 포함됨은 자명하다.
또한, 상기 O-포스포세린(O-phosphoserine, OPS)의 배출 활성능을 나타내는 폴리펩타이드의 폴리뉴클레오티드 서열은 상기 서열번호 1 또는 2로 기재한 아미노산을 암호화하는 폴리뉴클레오티드 서열을 포함할 수 있다. 상기 폴리뉴클레오타이드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩타이드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩타이드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있다. 상기 폴리뉴클레오티드 서열은 예를 들면 서열번호 3 또는 4의 폴리뉴클레오티드 서열을 가질 수 있으며, 이와 상동성이 80%, 구체적으로는 90% 이상인 염기서열을 가질 수 있다. 그러나 이에 한정되지는 않는다.
본 발명에서 용어, "상동성"은 주어진 폴리펩티드 서열 또는 폴리뉴클레오티드 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 폴리펩티드 서열 또는 폴리뉴클레오티드 서열과 동일하거나 유사한 활성을 갖는 그의 상동성 서열이 "% 상동성"으로 표시된다. 예를 들면, 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)들을 계산하는 표준 소프트웨어, 구체적으로 BLAST 2.0를 이용하거나, 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은, 당업자에게 잘 알려진 방법으로 결정될 수 있다 (예. Sambrook et al., 1989, infra 참고).
본 발명의 일 구체예에서는, OPS 생산능을 갖는 미생물에서 상기 YhhS 단백질(서열번호 1) 또는 MdtD 단백질(서열번호 2)의 활성을 강화시키는 경우, 양성 대조군인 RhtB 단백질(한국공개특허 제10-2012-0041115호), 또는 비교군인 MFS 트랜스포터인 EmrD 또는 YcaD를 강화시킨 균주에 비하여 우수한 OPS 배출활성을 가짐을 확인하였다. 상기 'RhtB'는 호모세린/호모세린 락톤을 배출하는 막 단백질로 유전자 rhtB로 코딩된다. OPS 생산 균주에서 상기 RhtB의 활성을 강화시켰을 경우, OPS 배출능이 증가함을 확인된바 있으므로(한국등록특허 제138104호), 이를 양성 대조군으로 사용하였다. OPS 생산 균주에서 상기 RhtB 단백질과 본 발명에 따른 YhhS 단백질 및 MdtD 단백질의 활성을 각각 강화시켰을 때, 본 발명에 따른 YhhS 단백질 MdtD 단백질은 상기 RhtB 단백질과 비교하여서도 우수한 OPS 배출능을 나타내었다. 또한 용어 'EmrD' 및 용어 'YcaD'는 대장균의 MFS 트랜스포터 단백질로서, 각각 emrD, ycaD 유전자로 코딩된다. 상기 EmrD 및 YcaD는 YhhS 및 MdtD 단백질과 같이 MFS 트랜스포터에 속하는 단백질로서, MFS 트랜스포터에 속하는 다른 단백질도 OPS 배출능을 나타낼 수 있는지 확인하고자 비교군으로 사용하였다. 그 결과, EmrD 및 YcaD 단백질은 YhhS 및 MdtD 단백질과 달리 OPS 배출능을 나타내지 않음을 확인하였다.
한편, 본 발명의 폴리펩타이드는 OPS 배출 활성을 지니므로, OPS 생산능을 갖는 미생물에서 상기 폴리펩타이드의 활성을 내재적 활성에 비하여 강화시키는 경우, OPS를 효과적으로 생산할 수 있다.
본 발명에서 용어, "OPS 생산"은 OPS를 균주 내에서 만들어내는 것뿐만 아니라, 세포 내의 OPS를 세포 밖, 예컨대 배지로 배출하는 것 역시 포함하는 개념이며, 구체적으로는 OPS를 세포 내에서 밖으로 배출하는 것을 의미한다.
본 발명에서 용어, "내재적 활성"은 본래 미생물이 천연의 상태, 즉 비변이 상태에서 나타내는 폴리펩타이드의 활성 상태를 의미한다. "내재적 활성에 비하여 강화"는 본래 미생물이 천연의 상태에서 나타내는 폴리펩타이드의 활성과 비교하였을 때, 그 활성이 증가된 것을 의미하며, 특정 폴리펩타이드의 활성을 가지지 않는 미생물에 그 폴리펩타이드의 활성을 부여하는 것 역시 포함하는 개념이다.
상기 "활성의 강화"는, 특별히 이에 제한되지 않으나, 폴리펩타이드 자체의 활성이 증대되어 본래 기능 이상의 효과를 도출하는 것을 포함할 뿐만 아니라, 내재적 유전자 활성의 증가, 내부 또는 외부 요인으로부터 내재적 유전자 증폭, 외부로부터의 유전자 도입, 프로모터 교체 또는 변형 및 돌연변이에 의한 효소 활성의 증가 등에 의해 그 활성이 증가되는 것을 포함한다. 구체적으로, 상기 폴리펩타이드를 코딩하는 유전자의 세포 내 카피수 증가, 상기 폴리펩타이드를 암호화하는 유전자 발현 조절 서열을 변형하는 방법, 상기 폴리펩타이드 활성이 증가되도록 돌연변이된 유전자로 염색체상의 상기 폴리펩타이드를 암호화하는 유전자를 대체하는 방법 및 상기 폴리펩타이드의 활성이 강화되도록 상기 폴리펩타이드를 암호화하는 염색체상의 유전자에 변이를 도입시키는 방법 등에 의하여 수행될 수 있으며, 상기 기재된 방법에 제한되는 것은 아니다. 이러한 활성을 강화시키는 방법은 본 명세서 내의 다른 폴리펩타이드의 활성 강화시에도 동일하게 참고될 수 있다.
상기에서 유전자의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 본 발명의 단백질을 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입되는 것일 수 있다. 또는, 상기 폴리뉴클레오티드가 작동가능하게 연결된, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포의 염색체 내에 도입되는 것일 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다. 본 발명의 벡터는 상동재조합을 일으켜서 염색체 내로 삽입될 수 있으므로 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 폴리뉴클레오티드의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있으며, 이에 한정되는 것은 아니다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다
상기 벡터는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 발현 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물일 수 있다. 상기 발현 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 발명에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다.
본 발명에서 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함한다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있으며, 이에 한정되는 것은 아니다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어, 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 발명의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
다음으로, 폴리뉴클레오티드의 발현이 증가하도록 발현 조절서열을 변형하는 것은, 특별히 이에 제한되지 않으나, 상기 발현 조절서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현 조절서열은, 특별히 이에 제한되지 않으나, 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 프로모터가 연결될 수 있으며 이에 한정되는 것은 아니다. 공지된 강력한 프로모터의 예에는 cj1 프로모터(한국등록특허 제 0620092호), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터 및 tet 프로모터가 포함될 수 있다.
아울러, 염색체상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
이와 같은 단백질 활성의 도입 및 증진은, 상응하는 단백질의 활성 또는 농도가 야생형 단백질이나 초기의 미생물 균주에서의 활성 또는 농도를 기준으로 하여 일반적으로 최소 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% 또는 500%, 최대 1000% 또는 2000%까지 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 용어, "OPS 생산 미생물"은 OPS를 생물체 내에서 생산할 수 있는 원핵 또는 진핵 미생물 균주로서, 구체적으로는 유전적 조작에 의하여 OPS를 축적할 수 있는 미생물을 의미한다.
본 발명의 일 구체예로 상기 미생물은 서열번호 1 또는 2의 폴리펩타이드의 활성이 강화되는 경우, OPS를 배출할 수 있는 미생물이면 특별히 그 종류가 제한되지 않으며, 원핵세포 또는 진핵세포 모두 가능하나, 구체적으로 원핵세포일 수 있다. 예로 에스케리키아(Escherichia) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속, 코리네박테리움(Corynebacterium) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 균주가 포함될 수 있으며, 구체적으로는 에스케리키아 속 미생물, 그 예로 대장균을 들 수 있으나, 이에 한정되는 것은 아니다. 특히, 상기 에스케리키아 속 또는 코리네박테리움 속 미생물의 경우, L-세린의 생합성 경로의 효소인 SerA, SerC 및 SerB 을 통해, OPS 및 L-세린을 생산할 수 있다(Ahmed Zahoor, Computational and structural biotechnology journal, vol 3, 2012 october; Wendisch VF et al., Curr Opin Microbiol. 2006 Jun;9(3):268-74; Peters-Wendisch P et al., Appl Environ Microbiol. 2005 Nov;71(11):7139-44.).
또한, 상기 OPS 생산 미생물은 추가적으로 내재적 포스포세린 포스파타아제(phosphoserine phosphatase, SerB)의 활성이 내재적 활성에 비해 약화된 것일 수 있다.
상기 SerB는 OPS를 L-세린(L-serine)으로 전환시키는 활성을 지니므로, 상기 SerB 활성이 약화되도록 변이된 미생물은 OPS를 축적하는 특징을 지녀 OPS의 생산에 유용하게 사용될 수 있다. 상기 SerB는 서열번호 17 또는 18로 기재되는 아미노산 서열을 가지는 단백질일 수 있으나, 이에 제한되는 것은 아니다. 또한, SerB의 활성을 나타내는 한, 상기 아미노산 서열과 80% 이상, 구체적으로는 90% 이상, 더 구체적으로는 95% 이상, 보다 더 구체적으로는 99% 이상 동일한 아미노산 서열을 포함할 수 있으나, 이에 제한되지 않는다.
또한, 상기 SerB를 암호화하는 폴리뉴클레오티드 서열은 상기 서열번호 17 또는 18에 기재된 아미노산을 암호화하는 폴리뉴클레오티드 서열을 가질 수 있다. 상기 폴리뉴클레오티드는 코돈의 축퇴성으로 인하여 또는 상기 폴리펩타이드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩타이드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있다. 상기 폴리뉴클레오티드 서열은 예를 들면 서열번호 19 또는 20의 폴리뉴클레오티드 서열을 가질 수 있으며, 이와 상동성이 80%, 구체적으로는 90% 이상인 염기서열을 가질 수 있다. 그러나 이에 한정되지는 않는다.
본 발명에서 용어, "내재적 활성에 비해 약화"는 본래 미생물이 천연의 상태에서 가지고 있는 단백질의 활성과 비교하였을 때, 그 활성이 감소된 것을 의미하며, 활성이 제거된 경우도 포함한다.
상기 약화는 상기 단백질을 코딩하는 유전자의 변이 등으로 단백질 자체의 활성이 본래 미생물이 가지고 있는 단백질의 활성에 비해 감소 또는 제거된 경우와, 이를 코딩하는 유전자의 발현 저해 또는 번역(translation) 저해 등으로 세포 내에서 전체적인 단백질 활성 정도가 천연형 균주에 비하여 낮은 경우, 상기 유전자의 발현이 전혀 이루어지지 않은 경우, 및 발현이 되더라도 활성이 없는 경우 역시 포함하는 개념이다.
이러한 단백질 활성의 약화는, 당해 분야에 잘 알려진 다양한 방법으로 달성될 수 있다. 상기 방법의 예로, 상기 단백질의 활성이 제거된 경우를 포함하여 상기 효소의 활성이 감소되도록 돌연변이된 유전자로 염색체상의 상기 단백질을 암호화하는 유전자를 대체하는 방법; 상기 단백질을 암호화하는 유전자의 발현 조절 서열을 변형하는 방법; 상기 단백질을 암호화하는 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 상기 염색체상의 유전자의 전사체에 상보적으로 결합하여 상기 mRNA로부터 단백질로의 번역을 저해하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)를 도입하는 방법; 상기 단백질을 암호화하는 유전자의 SD 서열 앞단에 SD 서열과 상보적인 서열을 인위적으로 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착이 불가능하게 만드는 법 및 해당 서열의 ORF(open reading frame)의 3' 말단에 역전사되도록 프로모터를 부가하는 RTE(Reverse transcription engineering) 방법 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 상기 예에 의해 특별히 제한되는 것은 아니다.
구체적으로, 단백질을 암호화하는 유전자의 일부 또는 전체를 결실하는 방법은, 세균 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 폴리뉴클레오티드를 일부 핵산 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 이의 일례로 상동재조합에 의하여 유전자를 결실시키는 방법을 사용할 수 있다. 또한, 상기에서 "일부"란 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 바람직하게는 1 내지 100개, 더욱 바람직하게는 1 내지 50개일 수 있으나, 특별히 이에 제한되는 것은 아니다.
또한, 발현 조절서열을 변형하는 방법은 상기 발현 조절서열의 활성을 더욱 약화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 핵산 서열로 교체함으로써 수행할 수 있다. 상기 발현 조절서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함한다.
아울러, 염색체상의 유전자 서열을 변형하는 방법은 상기 단백질의 활성을 더욱 약화하도록 유전자 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 유전자 서열 또는 활성이 없도록 개량된 유전자 서열로 교체함으로써 수행할 수 있다.
또한, 상기 OPS를 생산하는 미생물은 추가적으로 포스포글리세라이트 디하이드로게나제(phosphoglycerate dehydrogenase, SerA) 또는 포스포세린 아미노트랜스퍼라제(phosphoserine aminotransferase, SerC)의 활성이 내재적 활성에 비해 강화된 것일 수 있다.
상기 SerA는 3-포스포글리세라이트(3-phosphoglycerate)를 3-포스포하이드록시피루베이트(3-phospho-hydroxypyruvate)로 전환하는 활성을 가지는 단백질이며, 상기 SerA는 야생형 또는 세린에 대한 피드백이 해제된 변이체가 사용될 수 있다. 또한, 상기 SerC는 3-포스포하이드록시피루베이트를 OPS로 전환하는 활성을 가지는 단백질이다. 따라서, 상기 SerA 또는/및 SerC의 활성이 강화된 미생물은 OPS 생산 균주로서 유용하게 사용될 수 있다.
상기 SerA는 이에 제한되지는 않으나, 서열번호 21 내지 26으로 이루어진 군으로부터 선택된 아미노산 서열을 가질 수 있다. 상기 서열번호 21은 야생형 SerA의 서열이며, 22 내지 26은 세린에 대한 피드백이 해제된 변이체의 서열이다. 또한, SerA의 야생형 또는 세린에 대한 피드백이 해제된 변이체의 활성을 나타내는 한, 상기 아미노산 서열과 상기 아미노산 서열과 80% 이상, 구체적으로는 90% 이상, 더 구체적으로는 95% 이상, 보다 더 구체적으로는 99% 이상 동일한 아미노산 서열을 포함할 수 있으나, 이에 제한되지 않는다. 상기 피드백이 해제된 변이체는 상기 SerA를 암호화하는 유전자에 삽입, 치환 등의 방법으로 변이를 도입하여 세린 혹은 글리신에 의한 피드백 저해로부터 그 활성을 유지하거나, 강화된 경우를 의미하며, 상기 피드백이 해제된 변이체는 이미 잘 알려져 있다(Grant GA et al., J. Biol. Chem., 39: 5357-5361, 1999; Grant GA et al., Biochem., 39: 7316-7319, 2000; Grant GA et al., J. Biol. Chem., 276: 17844-17850, 2001; Peters-Wendisch P et al., Appl. Microbiol. Biotechnol., 60: 437-441, 2002; 유럽등록특허 EP0943687B).
또한, 상기 SerA의 야생형 또는 세린에 대한 피드백이 해제된 변이체를 암호화하는 폴리뉴클레오티드 서열은 상기 서열번호 21 내지 26에 기재된 어느 하나의 아미노산 서열을 암호화하는 폴리뉴클레오티드 서열을 가질 수 있으나, 이에 제한되지 않는다. 상기 폴리뉴클레오티드는 코돈의 축퇴성으로 인하여 또는 상기 폴리펩타이드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩타이드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있다. 상기 폴리뉴클레오티드 서열은 예를 들면 서열번호 27 내지 32에 기재된 어느 하나의 폴리뉴클레오티드 서열을 가질 수 있으며, 이와 상동성이 80%, 구체적으로는 90% 이상인 염기서열을 가질 수 있다. 그러나 이에 한정되지는 않는다.
상기 SerC는 예를 들어 서열번호 33으로 기재되는 아미노산 서열을 가지는 단백질일 수 있으나, 이에 제한되는 것은 아니다. 또한, SerC의 활성을 나타내는 한, 상기 아미노산 서열과 80% 이상, 구체적으로는 90% 이상, 더 구체적으로는 95% 이상, 보다 더 구체적으로는 99% 이상 동일한 아미노산 서열을 포함할 수 있으나, 이에 제한되지 않는다.
또한, 상기 SerC를 암호화하는 폴리뉴클레오티드 서열은 상기 서열번호 33에 기재된 아미노산을 암호화하는 폴리뉴클레오티드 서열을 가질 수 있다. 상기 폴리뉴클레오티드는 코돈의 축퇴성으로 인하여 또는 상기 폴리펩타이드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩타이드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있다. 상기 폴리뉴클레오티드 서열은 예를 들면 서열번호 34의 폴리뉴클레오티드 서열을 가질 수 있으며, 이와 상동성이 80%, 구체적으로는 90% 이상인 염기서열을 가질 수 있다. 그러나 이에 한정되지는 않는다.
또한, 상기 미생물은 추가로 OPS의 세포 안으로의 유입 또는 분해 능력을 감소시킨 미생물일 수 있다.
상기와 같은 OPS 생산 미생물에 대한 내용은 상기에서 기술된 내용 외에도 한국등록특허 제1381048호 또는 미국공개공보 제2012-0190081호 등에 개시된 내용이 본 발명의 참고자료로서 사용될 수 있다.
본 발명의 다른 일 양태는, OPS 배출 활성을 나타내고, 서열번호 1 또는 2의 아미노산 서열을 가지는 폴리펩타이드의 활성이 강화된, OPS 생산 미생물을 배지에서 배양하는 단계, 및 상기 O-포스포세린 생산 미생물 또는 이의 배지로부터 O-포스포세린을 분리하는 단계를 포함하는, OPS의 생산방법을 제공한다.
본 발명에서 용어, "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 발명의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식일 수 있으나, 이에 제한되는 것은 아니다.
상기 SerB 활성이 내재적 활성에 비해 약화된 재조합 미생물의 배양은, 상기 미생물의 세린 요구성이 유도되어 배지에 글리신 또는 세린이 추가로 포함될 수 있다. 글리신은 정제된 글리신, 글리신을 포함하는 이스트 추출물, 트립톤의 형태로 제공될 수 있으며 배양액에 포함되는 농도는 보통 0.1 내지 10 g/L, 구체적으로는 0.5 내지 3 g/L 일 수 있다. 또한 세린은 정제된 세린, 세린을 함유하는 이스트추출물, 트립톤 등의 형태로 제공될 수 있으며 배양액에 포함되는 농도는 보통 0.1 내지 5 g/L, 구체적으로는 0.1 내지 1 g/L 일 수 있다.
상기 배지에 포함되는 탄소원은 글루코즈, 수크로즈, 락토즈, 프락토즈, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함될 수 있으며, 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다. 그러나 이에 제한 되는 것은 아니다. 상기 배지에 포함되는 질소원으로서 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 및 대두밀과 같은 유기 질소원 및 요소, 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄, 및 질산암모늄과 같은 무기질소원이 포함될 수 있으며, 이들 질소원은 단독 또는 조합되어 사용될 수 있다. 그러나 이에 제한되는 것은 아니다. 상기 배지에 포함되는 인원으로서 인산이수소칼륨, 인산수소이칼륨 및 대응되는 소듐-함유 염이 포함될 수 있으나, 이에 제한되는 것은 아니다. 또한, 황산마그네슘 또는 황산철과 같은 금속염을 포함할 수 있다. 그 외에 아미노산, 비타민 및 적절한 전구체 등이 포함될 수 있다. 이들 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있으나, 이에 한정되는 것은 아니다.
배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한 배양 중에는 지방산 폴리클리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다. 배양물의 온도는 보통 27℃ 내지 37℃, 구체적으로는 30℃ 내지 35℃ 일 수 있다. 배양기간은 원하는 유용 물질의 생산량이 수득될 때까지 계속 될 수 있으며, 구체적으로는 10 내지 100 시간일 수 있다.
본 발명은 상기 배양 단계에서 생산된 OPS를 추가로 분리 및 정제할 수 있으며, 그 방법은 배양방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배지로부터 목적하는 OPS를 회수할 수 있으며 이에 한정되지 않는다.
본 발명의 다른 일 양태로서, 상기 서열번호 1 또는 2의 아미노산 서열을 가지는 폴리펩타이드의 OPS 생산 또는 배출 용도를 제공한다.
본 발명의 또 다른 일 양태로서, a) 상기 서열번호 1 또는 2의 아미노산 서열을 가지는, OPS 배출 활성을 나타내는 폴리펩타이드의 활성이 내재적 활성에 비하여 강화된, OPS 생산 미생물을 배지에서 배양하여 OPS를 생산하는 단계; 및 b) OPS 설프하이드릴라아제(O-Phosphoserine sulfhydrylase, OPSS) 또는 이를 발현하는 미생물의 존재 하에, 상기 a) 단계에서 생산된 OPS 또는 이를 포함하는 배지를 황화물과 반응시키는 단계를 포함하는, 시스테인 또는 이의 유도체의 제조 방법을 제공한다.
본 발명에서 용어, "OPS 설프하이드릴라아제(O-phosphoserine sulfhydrylase, OPSS)"는 OPS에 티올그룹(thiol, group, SH기)을 제공하여 상기 OPS를 시스테인으로 전환하는 반응을 촉매하는 폴리펩타이드를 의미한다. 상기 효소는 애로피룸 페닉스(Aeropyrum pernix), 마이코박테리움 투베쿨로시스(Mycobacterium tuberculosis), 마이코박테리움 스메그마틱스(Mycobacterium smegmatics), 트리코모나스 배기날리스(Trichomonas vaginalis) (Mino K and Ishikawa K, FEBSletters, 551: 133-138, 2003; Burns KE et al., J. Am. Chem. Soc., 127: 11602-11603, 2005)에서 처음으로 밝혀졌다. 또한, 상기 OPSS는 야생형 OPSS 단백질뿐만 아니라, 상기 OPSS를 코딩하는 폴리뉴클레오티드 서열 중 일부 서열이 결실, 치환 또는 부가된 서열로서, 야생형 OPSS 단백질의 생물학적 활성과 동등 또는 그 이상의 활성을 나타내는 변이체 단백질도 포함하며, 예를 들어, 한국등록특허 제1381048호 및 한국등록특허 제1208267호에 개시된 OPSS 단백질 및 이의 변이체 단백질도 모두 포함한다.
상기 황화물은 당해 기술분야에서 통상적으로 사용하는 고형뿐 아니라, pH, 압력, 용해도의 차이로 인해 액체 또는 기체의 형태로 제공되어 설파이드(sulfide, S2-),티올설페이트(thiosulfate, S2O3 2-)등의 형태로 티올그룹(thiol group, SH기)으로 전환될 수 있는 모든 황화물이면 이용 가능하다. 구체적으로는 티올 그룹을 OPS에 제공하는 Na2S, NaSH, H2S, (NH4)2S 및 Na2S2O3를 이용할 수 있다. 상기 반응은 하나의 OPS 반응기에 하나의 티올기를 제공하여 하나의 시스테인 혹은 시스테인 유도체를 제조하는 반응으로, 상기 반응 시 황화물의 첨가량은 OPS 몰농도의 0.1 내지 3배일 수 있으며, 구체적으로는 1 내지 2배일 수 있다.
또한, 본 발명에서는 추가로 상기 단계 b)의 반응 단계를 통하여 생산된 시스테인을 분리 및 정제하는 단계를 포함한다. 이때, 당해 분야에 공지된 적합한 반응을 이용하여 반응액으로부터 목적하는 시스테인을 분리 및 정제하여 회수할 수 있다.
또한, 본 발명의 특징은 서열번호 1 또는 2의 폴리펩타이드의 활성을 OPS 생산 미생물에서 강화시켜 OPS를 고수율로 생산하고, 이렇게 생산된 OPS를 OPSS와 반응시켜 시스테인을 효과적으로 생산할 수 있는 것에 있는 것으로, 이렇게 제조된 시스테인은 또한 당업계에 공지된 화학적 합성 반응을 통하여 시스테인의 수소 원자 또는 특정 원자단을 변형시킴으로써 다양한 시스테인 유도체로 생산될 수 있다.
본 발명에서 용어, "유도체"는 어떤 화합물의 일부를 화학적으로 변화시켜서 얻어지는 유사한 화합물로서, 대개 화합물 중 수소 원자 또는 특정 원자단이 다른 원자 또는 원자단에 의하여 치환된 화합물을 의미한다.
본 발명에서 용어, "시스테인 유도체"는 시스테인의 수소 원자 또는 특정 원자단이 다른 원자 또는 원자단에 의하여 치환된 화합물을 의미한다. 그 예로, 시스테인의 아민기(-NH2)의 질소 원자 또는 티올기(-SH)의 황 원자에 다른 원자 또는 원자단이 부착된 형태일 수 있으며, 그 예로 NAC(N-acetylcysteine), SCMC(S-Carboxymetylcysteine), BOC-CYS(ME)-OH, (R)-S-(2-Amino-2-carboxyethyl)-L-homocysteine, (R)-2-Amino-3-sulfopropionic acid, D-2-Amino-4-(ethylthio)butyric acid, 3-sulfino-L-alanine, Fmoc-Cys(Boc-methyl)-OH, Seleno-L-cystine, S-(2-Thiazolyl)-L-cysteine, S-(2-Thienyl)-L-cysteine, S-(4-Tolyl)-L-cysteine 등이 있으나, 이에 제한되지 않는다. 시스테인은 아세틸레이션 에이젼트(acetylation agent)와 반응하여 NAC(N-acetylcysteine)로 쉽게 합성될 수 있으며, 염기성 조건에서는 할로아세틱 에시드(haloacetic acid)와 반응시킴으로써 SCMC(S-Carboxymetylcysteine)로 합성될 수 있다. 상기 시스테인 유도체는 주로 제약원료로써 진해제, 기침 완화제, 기관지염, 기관지 천식과 인후염 등의 치료제로 사용된다.
이하 본 발명을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1: YhhS MFS 트랜스포터 및 YegB MFS 트랜스포터의 동정
OPS의 배출에 관여하는 대장균의 막 단백질을 동정하기 위해 Escherichia coli K12_W3110(ATCC27325)의 게노믹 DNA 라이브러리를 이용하여 스크리닝을 수행하였다.
OPS에 의해 대장균의 생육이 저하되는 조건을 셋업(set up)하기 위해 OPS를 생산하는 기반 균주를 제작하였다. 스크리닝 기반 균주는 대장균 야생형 균주인 W3110에서 내재적 포스포세린 포스파타아제(phosphoserine phosphatase, SerB)의 활성이 약화되도록 변이시킨 재조합 미생물로, KCCM11212P('CA07-0012'로도 명명, 한국등록특허 제10-1381048호; 미국공개특허 제2012-0190081호)라고 명명한 균주이다.
OPS 생산 균주인 KCCM11212P를 OPS를 포함하는 배지에서 배양시켜 생육 저하(growth inhibition)를 보이는 최적 스크리닝 조건을 수립하였다. W3110 게노믹 라이브러리 플라스미드를 CA07-0012에 전기천공법으로 형질전환시키고(van der Rest et al. 1999), 과량의 OPS가 첨가된 배지 조건에서 생육 저하가 해제되는 콜로니들을 선별하였다. 선별된 콜로니로부터 플라스미드를 획득하여 시퀀싱 기법을 통해 염기서열을 분석하였다. 이로부터 과량의 OPS 첨가 조건에서 생육 저하를 해제시키는데 관여하는 대장균 막 단백질 2종을 동정하였다.
상기의 2종의 대장균 막 단백질은 YhhS major facilitator superfamily (MFS) 트랜스포터(서열번호 1의 아미노산 서열, 및 서열번호 3의 염기서열) 및 YegB MFS 트랜스포터(서열번호 2의 아미노산 서열, 및 서열번호 4의 염기서열)을 각각 코딩하는 yhhS 및 mdtD로 확인되었다(Pao SS, Paulsen IT, Saier MH (1998). "Major facilitator superfamily." Microbiol Mol Biol Rev 1998;62(1);1-34. PMID: 9529885).
실시예 2: yhhS 및 mdtD 과발현 벡터 제작
OPS에 의한 생육 저하를 해제시키는 데 관여하는 YhhS MFS 트랜스포터 및 YegB MFS 트랜스포터를 OPS 생산 균주에서 각각 강화시켜 주었을 경우, OPS 배출능이 향상되는지 확인하기 위하여 각각 유전자의 과발현 벡터를 제작하고자 하였다. 또한, 호모세린 및 호모세린 락톤 트랜스포터인 RhtB를 OPS 생산 균주에서 강화시켜 주었을 경우, OPS 농도가 상승하는 것을 확인하였기 때문에(한국등록특허 제138104호), 이를 양성 대조군(positive control)으로 이용하였다. 그리고 YhhS 및 MdtD와 동일하게, MFS(major facilitator superfamily)에 속하는 대장균 막 단백질 multidrug efflux transporter EmrD와 YcaD MFS transporter 또한 함께 평가하였다. YhhS MFS 트랜스포터를 코딩하는 유전자 yhhS(서열번호 3, Accession Numbers: b3473)와 YegB MFS 트랜스포터를 코딩하는 유전자 mdtD(서열번호 4, Accession Numbers: b2077) 단편은 W3110 게노믹 DNA을 주형으로 PCR을 통하여 획득하였다.
각각의 막 단백질 유전자에 대한 과발현 벡터를 제작하기 위해 사용한 프라이머 서열은 하기 표 1에서 표기한 바와 같다.
표 1
유전자 프라이머 (5'->3') 서열번호 벡터
yhhS GATATCATGCCCGAACCCGTAGC 5 pCL-PrhtB-yhhS
AAGCTTTTAAGATGATGAGGCGGCCT 6
mdtD GATATCATGACAGATCTTCCCGACAGC 7 pCL-PrhtB-mdtD
AAGCTTTCATTGCGCGCTCCTTT 8
rhtB GATATCATGACCTTAGAATGGTGG 9 pCL-PrhtB-rhtB
AAGCTTTCACGCATGCCTCGCCGA 10
emrD GATATCATGAAAAGGCAAAGAAACGTCAA 11 pCL-PrhtB-emrD
AAGCTTTTAAACGGGCTGCCCCT 12
ycaD GATATCATGTCCACGTATACCCAGCCTG 13 pCL-PrhtB-ycaD
AAGCTTTTACACGTGAGCAACGGGTTT 14
pCL-1920 AAGCTTCGGGCCTCTTCGCTATTACGC 15 pCL-PrhtB
AAGCTTAGGCTTACCCGTCTTACTGTC 16
yhhS PCR은 서열번호 5 및 6인 프라이머를, mdtD PCR은 서열번호 7 및 8을 이용하였다. 이때 이용한 프라이머는 미국 국립보건원 진뱅크(NIH GeneBank)에 등록되어 있는 K12 W3110 유전자(GenBank accession number AP 003471) 및 주변 염기서열에 대한 정보를 바탕으로 제작하였다.
rhtB, emrD 및 ycaD 유전자에 대한 PCR 역시 상기 표 1에 개시된 각각의 프라이머 쌍을 이용하여 해당 유전자 단편을 증폭하였다.
증폭된 각 유전자의 단편은 EcoRV와 HindⅢ의 제한 효소로 처리하였으며, pCL1920 벡터(GenBank No AB236930)에 대장균의 rhtB 유전자의 프로모터(PrhtB)가 삽입되어 있는 pCL-PrhtB-벡터의 EcoRV와 HindⅢ 제한 효소 자리에 클로닝하여, pCL-PrhtB-rhtB, pCL-PrhtB-yhhS, pCL-PrhtB-mdtD, pCL-PrhtB-emrD, pCL-PrhtB-ycaD를 각각 제작하였다.
실시예 3: YhhS MFS 트랜스포터 및 YegB MFS 트랜스포터 강화 균주 제작 및 OPS 생산능 평가
<실시예 3-1: CA07-0012를 이용한 YhhS MFS 트랜스포터 및 YegB MFS 트랜스포터 강화 균주 제작 및 OPS 생산능 평가>
실시예 2에서 제작된 5종의 플라스미드를 각각 OPS 생산주인 CA07-0012에 도입한 균주를 제작하여 OPS의 생산능을 평가하였다.
각각의 균주를 LB 고체 배지에 도말한 후 33℃ 배양기에서 밤새 배양하였다. LB 고체 배지에서 밤새 배양한 균주를 하기 표 2의 25 mL 역가 배지에 접종한 다음, 이를 34.5℃, 200 rpm의 배양기에서 40 시간 배양하였으며, 이의 결과를 표 3에 나타내었다.
표 2
조성물 농도 (리터당)
포도당 50 g
KH2PO4 6 g
(NH4)2SO4 17 g
MgSO4·H2O 1 g
FeSO4·7H2O 5 mg
MnSO4·4H2O 10 mg
L-글리신 2.5 g
효모액기스 3 g
탄산칼슘 30 g
pH 6.8
표 3
균주명 OD562nm 소모당 (g/L) O-포스포세린 (g/L)
CA07-0012 35 32 1.1
CA07-0012/pCL-PrhtB-rhtB 40 35 1.3
CA07-0012/pCL-PrhtB-yhhS 37 34 2.1
CA07-0012/pCL-PrhtB-mdtD 41 32 1.8
CA07-0012/pCL-PrhtB-emrD 38 34 1.2
CA07-0012/pCL-PrhtB-ycaD 37 33 0.9
상기 표 3에서 볼 수 있는 바와 같이, 대장균 유래의 CA07-0012 균주에 대장균 막 단백질 유전자를 추가로 도입한 경우 중, RhtB, YhhS 및 MdtD 강화주의 경우 OPS의 생산량이 CA07-0012에 비하여 증가한 결과를 나타내었고, 특히 본 발명의 YhhS 강화주 및 MdtD 강화주의 경우 OPS 농도가 150% 이상 상승하는 것을 확인하였다. 반면, 비교군인 EmrD 강화주 및 YcaD 강화주의 경우에는 OPS의 생산량을 증가시키지 못하는 결과를 나타내었다.
상기 CA07-0012/pCL-PrhtB-yhhS로 명명된 균주를 대장균 CA07-0266(Escherichia coli CA07-0266)으로 명명하고, 이를 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터에 2013년 12월 9일자로 기탁하여 기탁번호 KCCM11495P를 부여받았다.
또한, 상기 CA07-0012/pCL-PrhtB-mdtD를 대장균 CA07-0267(Escherichia coli CA07-0267)로 명명하고, 이를 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터에 2013년 12월 9일자로 기탁하여 기탁번호 KCCM11496P를 부여받았다.
<실시예 3-2: SerA 및 SerC 강화 균주를 이용한 YhhS MFS 트랜스포터 및 YegB MFS 트랜스포터 강화 균주 제작 및 OPS 생산능 평가>
또한, OPS 생합성 경로인 SerA(3-포스포글리세레이트 디하드로제네이즈, D-3-phosphoglycerate dehydrogenase)와 SerC(3-포스포세린 아미노트랜스퍼레이즈, 3-phosphoserine aminotransferase)의 활성을 강화시켜 OPS 생산능이 증가된 OPS 생산 균주인 CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC(한국공개특허 제10-2012-0041115호)를 이용하여 상기의 대장균 막 단백질 유전자의 효과를 파악하고자 하였고, 그 결과를 하기 표 4에 나타내었다.
표 4
균주명 OD562nm 소모당 (g/L) O-포스포세린 (g/L)
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC 30 27 2.4
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-PrhtB-rhtB 32 28 2.8
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-PrhtB-yhhS 28 26 4.0
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-PrhtB-mdtD 27 27 3.5
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-PrhtB-emrD 33 29 2.3
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-PrhtB-ycaD 34 28 1.9
상기 표 4에서 볼 수 있는 바와 같이, 대장균 유래의 CA07-0012 균주보다 OPS 생산능이 향상된 CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC에 대장균 막 단백질 유전자를 추가로 도입한 균주 중, 본 발명의 YhhS 및 MdtD 강화주 및 양성 대조군인 RhtB 강화주의 경우 OPS의 생산량이 대조군 대비 증가하는 것을 다시 한번 확인할 수 있었다. 특히 본 발명의 YhhS 및 MdtD 강화주의 경우 상기 표 3의 결과와 유사하게 OPS 농도가 145% 이상 상승하는 결과를 나타내었다. 반면, 비교군인 ErmD 강화군 및 YcaD 강화군의 경우에는 대조군 대비 OPS 생산량이 감소한 결과를 나타내었다.
<실시예 3-3: 프로모터 세기에 따른 YhhS MFS 트랜스포터 및 YegB MFS 트랜스포터 강화 균주 제작 및 OPS 생산능 평가>
또한, OPS 농도가 대조군 대비 상승된 막 단백질 YhhS, MdtD의 경우, 프로모터 세기를 강화하였을 때, 배출능이 향상될 수 있는지 확인해 보고자 CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC에 yhhS 및 mdtD 유전자를 추가로 도입하면서, 이때 rhtB 프로모터(PrhtB)보다 강한 trc 프로모터(Ptrc)를 사용하였다.
각각의 유전자 YhhS, mdtD 단편은 pCL-PrhtB-gene을 EcoRV, HindIII로 제한 효소 처리하여, pCL1920 벡터에 trc 프로모터가 삽입되어 있는 pCL-Ptrc-GFP 벡터의 EcoRV와 HindIII 제한 효소 자리에 클로닝하여, pCL-Ptrc-yhhS, pCL-Ptrc-mdtD를 제작하였다. 이후 각 플라스미드를 주형으로 서열번호 15 및 서열번호 16의 프라이머쌍을 이용하여 PCR을 수행하고 HindIII로 제한효소 처리하여 pCL-Prmf-serA*(G336V)-(RBS)serC의 HindIII 제한 효소 자리에 클로닝하였다.
표 5
균주명 OD562nm 소모당 (g/L) O-포스포세린 (g/L)
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC 31 30 2.7
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-Ptrc-yhhS 28 33 5.5
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-Ptrc-mdtD 29 31 4.3
그 결과, 상기 표 5에서 볼 수 있는 바와 같이, 프로모터를 강화하여 대장균 막 단백질의 발현을 증가시켰을 경우, 대조군 대비 수율 150% 이상 증가하는 것을 확인할 수 있었으며, rhtB 프로모터를 사용했을 때보다, 120% 이상 수율 증가하는 것을 확인하였다.
<실시예 3-4: 염색체상 프로모터 세기에 따른 YhhS MFS 트랜스포터 및 YegB MFS 트랜스포터 강화 균주 제작 및 OPS 생산능 평가>
또한, 염색체상에서 yhhS와 mdtD의 프로모터를 더 강한 프로모터로 바꿔주었을 경우, 배출능이 향상되는지 확인해보기 위해 자가 프로모터를 cj1 프로모터(한국등록특허 제0620092호)로 치환된 균주를 제작하여 O-포스포세린의 생산능을 평가하였다. Cj1 프로모터를 대장균의 염색체에 도입하는 방법은 통상 이용되는 하기의 방법으로 제작하였다. 염색체에 yhhS와 mdtD 자가 프로모터를 치환하기 위해 제작한 재조합 벡터를 OPS 생산균주인 CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC(한국등록특허 제138104호)에 형질전환시켜 모균주가 가지고 있는 자가 프로모터 서열과 상기한 벡터상의 프로모터 서열을 상동재조합을 통해 치환시킴으로써, 염색체 내로 cj1 프로모터 서열을 삽입시켰다.
각각의 균주를 LB 고체 배지에 도말한 후 33℃ 배양기에서 밤새 배양한 균주를 상기 표 2의 25 mL 역가 배지에 접종한 다음, 이를 34.5℃, 200 rpm의 배양기에서 40 시간 배양하였으며, 이의 결과를 하기 표 6에 나타내었다.
표 6
균주명 OD562nm 소모당 (g/L) O-포스포세린 (g/L)
CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC 30 29 2.7
CA07-0022::Pcj1 yhhs/pCL-Prmf-serA*(G336V)-(RBS)serC 28 30 3.5
CA07-0022::Pcj1 mdtD/pCL-Prmf-serA*(G336V)-(RBS)serC 29 31 3.2
상기 표 6에 나타낸 바와 같이, 염색체상에서 각 막 단백질의 발현을 증가시켰을 경우, 대조군 대비 수율이 최대 130% 증가되는 것을 확인할 수 있었다.
실시예 4:　YhhS MFS 트랜스포터 및 YegB MFS 트랜스포터의 OPS 배출 기능 확인
실시예 3에서 OPS 생산을 확인한 상기의 플라스크 샘플 중 막 단백질을 강화시키지 않은 음성 대조군(negative control)인 CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC와, YhhS 및 MdtD 단백질을 강화시킨 샘플 CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-Ptrc-yhhS와 CA07-0022/pCL-Prmf-serA*(G336V)-(RBS)serC-Ptrc-mdtD를 이용하여 배지 내에 배출된 OPS를 모두 제거한 후 세포만을 수집하여 세포를 파쇄하였다.　이로부터 세포 내부의 OPS 농도를 HPLC(high performance liquid chromatography) 기기를 이용하여 측정하였고, 그 결과를 도 1에 나타내었다.
그 결과, 도 1에 나타낸 바와 같이, 본 발명의 YhhS 및 MdtD 강화주의 경우 대조군 대비 세포 내의 OPS 농도가 30~40%까지 감소하는 것을 확인하여, Yhhs 및 MdtD 단백질은 OPS를 세포 외부로 배출하는 역할을 하고 있음을 알 수 있었다. 이로써, Yhhs 및 MdtD 단백질을 강화시키는 경우, 세포 내부의 OPS를 원활히 배출함으로써, OPS 생산능을 향상시키는 것으로 판단되었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2015008336-appb-I000001
Figure PCTKR2015008336-appb-I000002

Claims (10)

  1. 서열번호 1 또는 2의 아미노산 서열을 가지는 O-포스포세린(O-phosphoserine, OPS) 배출 활성을 나타내는 폴리펩타이드의 활성이 내재적 활성에 비하여 강화된, O-포스포세린 생산 미생물.
  2. 제1항에 있어서, 상기 미생물은 추가로 포스포세린 포스파타아제(phosphoserine phosphatase, SerB)의 활성이 내재적 활성에 비해 약화된 것인 미생물.
  3. 제1항에 있어서, 상기 미생물은 추가로 포스포글리세라이트 디하이드로게나제(phosphoglycerate dehydrogenase, SerA) 또는 포스포세린 아미노트랜스퍼라제(phosphoserine aminotransferase, SerC)의 활성이 내재적 활성에 비해 강화된 것인 미생물.
  4. 제1항에 있어서, 상기 O-포스포세린 생산 미생물은 대장균인 것인 미생물.
  5. O-포스포세린(OPS) 배출 활성을 나타내고, 서열번호 1 또는 2의 아미노산 서열을 가지는 폴리펩타이드의 활성이 강화된, O-포스포세린 생산 미생물을 배지에서 배양하는 단계, 및
    상기 O-포스포세린 생산 미생물 또는 이의 배지로부터 O-포스포세린을 분리하는 단계
    를 포함하는, O-포스포세린의 생산방법.
  6. 제5항에 있어서, 상기 O-포스포세린 생산 미생물은 추가로 포스포세린 포스파타아제(phosphoserine phosphatase, SerB)의 활성이 내재적 활성에 비해 약화된 것인, 생산방법.
  7. 제5항에 있어서, 상기 O-포스포세린 생산 미생물은 추가로 포스포글리세라이트 디하이드로게나제(phosphoglycerate dehydrogenase, SerA) 또는 포스포세린 아미노트랜스퍼라제(phosphoserine aminotransferase, SerC)의 활성이 내재적 활성에 비해 강화된 것인, 생산방법.
  8. 제5항에 있어서, 상기 O-포스포세린 생산 미생물은 대장균인 것인, 생산방법.
  9. a) 제1항 내지 제4항 중 어느 한 항의 미생물을 배지에서 배양하여 O-포스포세린(OPS)을 생산하는 단계; 및 b) O-포스포세린 설프하이드릴라아제(O-Phosphoserine sulfhydrylase, OPSS) 또는 이를 발현하는 미생물의 존재 하에, 상기 a) 단계에서 생산된 O-포스포세린 또는 이를 포함하는 배지를 황화물과 반응시키는 단계를 포함하는, 시스테인 또는 이의 유도체의 생산 방법.
  10. 제9항에 있어서, 상기 황화물은 Na2S, NaSH, (NH4)2S, H2S 및 Na2S2O3로 이루어지는 군으로부터 선택되는 하나 이상인, 시스테인 또는 이의 유도체의 생산 방법.
PCT/KR2015/008336 2014-08-12 2015-08-10 O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법 WO2016024771A1 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
UAA201700326A UA119985C2 (uk) 2014-08-12 2015-08-10 Мікроорганізм, який виробляє о-фосфосерин, та спосіб отримання о-фосфосерину або l-цистеїну з його застосуванням
EP15832358.4A EP3181685B1 (en) 2014-08-12 2015-08-10 O-phosphoserine producing microorganism and method for producing o-phosphoserine or l-cysteine using same
ES15832358T ES2753413T3 (es) 2014-08-12 2015-08-10 Microorganismo productor de O-fosfoserina y procedimiento de producción de O-fosfoserina o L-cisteína mediante el uso del mismo
JP2017507849A JP6570617B2 (ja) 2014-08-12 2015-08-10 Ｏ−ホスホセリン生産微生物及びそれを用いたｏ−ホスホセリンまたはｌ−システイン生産方法
RU2017105865A RU2663726C1 (ru) 2014-08-12 2015-08-10 Микроорганизм, продуцирующий о-фосфосерин, и способ получения о-фосфосерина или l-цистеина с использованием этого микроорганизма
US15/329,921 US10323262B2 (en) 2014-08-12 2015-08-10 Microorganism producing O-phosphoserine and a method for producing O-phosphoserine or L-cysteine using the same
CN201580043665.3A CN106795485B (zh) 2014-08-12 2015-08-10 生产o-磷酸丝氨酸的微生物和利用其生产o-磷酸丝氨酸或l-半胱氨酸的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0104670 2014-08-12
KR1020140104670A KR101677328B1 (ko) 2014-08-12 2014-08-12 O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법

Publications (1)

Publication Number Publication Date
WO2016024771A1 true WO2016024771A1 (ko) 2016-02-18

Family

ID=55304343

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/008336 WO2016024771A1 (ko) 2014-08-12 2015-08-10 O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법

Country Status (11)

Country Link
US (1) US10323262B2 (ko)
EP (1) EP3181685B1 (ko)
JP (2) JP6570617B2 (ko)
KR (1) KR101677328B1 (ko)
CN (1) CN106795485B (ko)
AR (1) AR102049A1 (ko)
ES (1) ES2753413T3 (ko)
RU (1) RU2663726C1 (ko)
TW (1) TWI654305B (ko)
UA (1) UA119985C2 (ko)
WO (1) WO2016024771A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018023358A (ja) * 2016-08-04 2018-02-15 三洋化成工業株式会社 有用物質の生産方法
WO2022055192A1 (ko) 2020-09-09 2022-03-17 씨제이제일제당 (주) 신규 o-포스포세린 배출 단백질 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산 방법

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101677328B1 (ko) * 2014-08-12 2016-11-18 씨제이제일제당 (주) O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법
KR101694632B1 (ko) * 2015-09-11 2017-01-10 씨제이제일제당 (주) 신규 ｏ-포스포세린 배출 단백질 변이체 및 이를 이용한 ｏ-포스포세린, 시스테인 및 이의 유도체의 생산방법
KR101825310B1 (ko) * 2016-12-29 2018-03-15 씨제이제일제당 (주) O-포스포세린을 생산하는 에스케리키아 속 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인을 생산하는 방법
JP7407941B2 (ja) * 2020-06-09 2024-01-04 シージェイ チェイルジェダング コーポレイション Ｏ－ホスホセリン排出タンパク質変異体、並びにそれを用いたｏ－ホスホセリン、システイン及びその誘導体の生産方法
FR3112549A1 (fr) * 2020-07-20 2022-01-21 Arkema France Procede ameliore de synthese de mercaptans fonctionnalises
CN115197954A (zh) * 2021-04-14 2022-10-18 上海凯赛生物技术股份有限公司 用于发酵生产1,5-戊二胺的重组dna、菌株及其用途
KR20220163754A (ko) * 2021-06-03 2022-12-12 씨제이제일제당 (주) 신규한 YhhS 변이체 및 이를 이용한 O-포스포세린, 시스테인 및 이의 유도체의 생산방법
KR20220166947A (ko) * 2021-06-11 2022-12-20 씨제이제일제당 (주) 신규한 MdtH 변이체 및 이를 이용한 O-포스포세린, 시스테인 및 이의 유도체의 생산방법
KR102654301B1 (ko) 2021-06-23 2024-04-04 씨제이제일제당 주식회사 NADH:quinone 산화환원효소의 발현이 조절된 재조합 미생물 및 이를 이용한 O-포스포세린, 시스테인 및 이의 유도체의 생산방법
KR20230103229A (ko) * 2021-12-31 2023-07-07 씨제이제일제당 (주) O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법
WO2023182322A1 (ja) * 2022-03-23 2023-09-28 東レ株式会社 ３－ヒドロキシアジピン酸および／または３－オキソアジピン酸を生産するための遺伝子改変微生物および当該化学品の製造方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120041115A (ko) * 2010-10-20 2012-04-30 씨제이제일제당 (주) Ｏ-포스포세린 생산 균주 및 이로부터 생산된 ｏ-포스포세린으로부터 ｌ-시스테인 또는 이의 유도체의 생산방법
KR20130068135A (ko) * 2011-12-15 2013-06-25 씨제이제일제당 (주) 신규 ｏ-포스포세린 설프하이드릴라아제를 이용하여 시스테인 또는 이의 유도체를 생산하는 방법

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19726083A1 (de) 1997-06-19 1998-12-24 Consortium Elektrochem Ind Mikroorganismen und Verfahren zur fermentativen Herstellung von L-Cystein, L-Cystin, N-Acetyl-Serin oder Thiazolidinderivaten
JP3997631B2 (ja) 1998-01-12 2007-10-24 味の素株式会社 発酵法によるｌ−セリンの製造法
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
EP2489741B1 (en) * 2007-04-06 2016-06-08 Kyowa Hakko Bio Co., Ltd. Method for production of glutathione or gamma-glutamylcysteine
WO2009116566A1 (ja) * 2008-03-18 2009-09-24 協和発酵キリン株式会社 工業的に有用な微生物
RU2458981C2 (ru) * 2010-03-04 2012-08-20 Закрытое акционерное общество "Научно-исследовательский институт "Аджиномото-Генетика" (ЗАО АГРИ) Способ получения l-цистеина с использованием бактерии семейства enterobacteriaceae
WO2012053794A2 (en) * 2010-10-20 2012-04-26 Cj Cheiljedang Corporation Microorganism producing o-phosphoserine and method of producing l-cysteine or derivatives thereof from o-phosphoserine using the same
KR101525663B1 (ko) * 2013-05-10 2015-06-04 씨제이제일제당 (주) 신규 ｏ-포스포세린 배출 단백질 및 이를 이용한 ｏ-포스포세린의 생산방법
KR101493154B1 (ko) * 2013-05-10 2015-02-13 씨제이제일제당 (주) 신규 ＲｈｔＢ 단백질 변이체 및 이를 이용한 Ｏ-포스포세린의 생산방법
KR101677328B1 (ko) * 2014-08-12 2016-11-18 씨제이제일제당 (주) O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120041115A (ko) * 2010-10-20 2012-04-30 씨제이제일제당 (주) Ｏ-포스포세린 생산 균주 및 이로부터 생산된 ｏ-포스포세린으로부터 ｌ-시스테인 또는 이의 유도체의 생산방법
KR20130068135A (ko) * 2011-12-15 2013-06-25 씨제이제일제당 (주) 신규 ｏ-포스포세린 설프하이드릴라아제를 이용하여 시스테인 또는 이의 유도체를 생산하는 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 20 October 2014 (2014-10-20), "Efflux transporter", XP055407517, Database accession no. WP_000130850 *
DATABASE NCBI 20 October 2014 (2014-10-20), "Putative arabinose efflux transporter", Database accession no. WO _001300943 *
See also references of EP3181685A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018023358A (ja) * 2016-08-04 2018-02-15 三洋化成工業株式会社 有用物質の生産方法
WO2022055192A1 (ko) 2020-09-09 2022-03-17 씨제이제일제당 (주) 신규 o-포스포세린 배출 단백질 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산 방법

Also Published As

Publication number Publication date
JP6807976B2 (ja) 2021-01-06
KR101677328B1 (ko) 2016-11-18
RU2663726C1 (ru) 2018-08-08
AR102049A1 (es) 2017-02-01
UA119985C2 (uk) 2019-09-10
JP2017528126A (ja) 2017-09-28
KR20160020050A (ko) 2016-02-23
CN106795485A (zh) 2017-05-31
US10323262B2 (en) 2019-06-18
JP2019150038A (ja) 2019-09-12
TWI654305B (zh) 2019-03-21
EP3181685A1 (en) 2017-06-21
CN106795485B (zh) 2020-10-30
ES2753413T3 (es) 2020-04-08
EP3181685B1 (en) 2019-08-14
EP3181685A4 (en) 2017-12-27
TW201612319A (en) 2016-04-01
JP6570617B2 (ja) 2019-09-04
US20170260556A1 (en) 2017-09-14

Similar Documents

Publication Publication Date Title
WO2016024771A1 (ko) O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
WO2014142463A1 (ko) L-발린 생산능이 향상된 균주 및 이를 이용한 l-발린 생산방법
WO2019004778A2 (ko) 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법
WO2013105802A2 (ko) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2013103268A2 (ko) Ｌ-아미노산을 생산할 수 있는 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
WO2017043915A1 (ko) 신규 ｏ-포스포세린 배출 단백질 변이체 및 이를 이용한 ｏ-포스포세린, 시스테인 및 이의 유도체의 생산방법
KR101525663B1 (ko) 신규 ｏ-포스포세린 배출 단백질 및 이를 이용한 ｏ-포스포세린의 생산방법
WO2019190193A1 (ko) 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법
WO2015186990A1 (ko) O-아세틸-호모세린을 생산하는 미생물 및 이를 이용하여 o-아세틸-호모세린을 생산하는 방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021112469A1 (ko) 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
WO2017007159A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2014182119A1 (en) Novel rhtb protein variants and the method of producing o-phosphoserine using the same
WO2015156583A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022158646A1 (ko) 신규한 쿠퍼익스포팅 p-type 에이티피에이즈 a 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2016195439A1 (ko) O-아세틸-호모세린을 생산하는 미생물 및 이를 이용하여 o-아세틸-호모세린을 생산하는 방법
WO2015186958A1 (ko) O-숙시닐호모세린 또는 숙신산의 생산능을 갖는 미생물 및 이를 이용한 숙신산 또는 o-숙시닐호모세린의 생산 방법
WO2015060647A1 (ko) O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15832358

Country of ref document: EP

Kind code of ref document: A1

REEP Request for entry into the european phase

Ref document number: 2015832358

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 15329921

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2017507849

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017105865

Country of ref document: RU

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: A201700326

Country of ref document: UA