WO2015060647A1 - O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법 - Google Patents

O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법 Download PDF

Info

Publication number
WO2015060647A1
WO2015060647A1 PCT/KR2014/009967 KR2014009967W WO2015060647A1 WO 2015060647 A1 WO2015060647 A1 WO 2015060647A1 KR 2014009967 W KR2014009967 W KR 2014009967W WO 2015060647 A1 WO2015060647 A1 WO 2015060647A1
Authority
WO
WIPO (PCT)
Prior art keywords
homoserine
succinyl
microorganism
strain
seq
Prior art date
Application number
PCT/KR2014/009967
Other languages
English (en)
French (fr)
Inventor
최수진
김소영
서창일
신용욱
양영렬
엄혜원
박혜민
전성후
정병훈
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to MYPI2016701394A priority Critical patent/MY190539A/en
Priority to US15/031,706 priority patent/US10316339B2/en
Priority to EP14854918.1A priority patent/EP3061812B1/en
Priority to PL14854918T priority patent/PL3061812T3/pl
Priority to CN201480058107.XA priority patent/CN105705636B/zh
Priority to CN201910776927.7A priority patent/CN110468168B/zh
Priority to BR112016008952-9A priority patent/BR112016008952B1/pt
Priority to JP2016526088A priority patent/JP6386552B2/ja
Priority to RU2016116166A priority patent/RU2651519C2/ru
Priority to ES14854918T priority patent/ES2908323T3/es
Publication of WO2015060647A1 publication Critical patent/WO2015060647A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01046—Homoserine O-succinyltransferase (2.3.1.46)

Definitions

  • the present invention provides an isolated polypeptide having resistance to feedback inhibition by methionine and homoserine O-succinyltransferase activity, an O-succinyl homoserine producing microorganism expressing the polypeptide and O-succinyl homo using the same. It is about how to produce serine.
  • O-succinyl homoserine or O-acetyl homoserine are known to use as an intermediate to biosynthesize methionine.
  • O-succinyl homoserine is bound to homoserine (homoserine O-succinyltransferase (MetA) which binds the succinyl group of Succinyl-coA to Homoserine.
  • MetA homoserine O-acetyltransferase
  • METX homoserine O-acetyltransferase
  • metA is one of the very important genes for the production of production strains.
  • MetX is not known to have feedback inhibition and is known to have high enzyme stability.
  • O-succinyl homoserine is blocked by the accumulation of cystathionine gamma synthase of the methionine biosynthetic pathway, so that O-succinyl homoserine producing strains exhibit L-methionine requirement. Accordingly, methionine is added to the medium.
  • homoserine O-succinyltransferase is inhibited by feedback inhibition by the added methionine, and finally, high concentration of O-succinyl is suppressed. Homoserine cannot be obtained.
  • the present invention also aims to provide a polynucleotide encoding the polypeptide.
  • the present invention also aims to provide a method for producing O-succinyl homoserine using the microorganism.
  • O-succinylhomoserine producing microorganisms that are resistant to feedback inhibition to the novel isolated methionine of the present invention and that have a polypeptide having homoserine O-succinyltransferase activity are resistant to feedback inhibition to methionine. Since O-succinyl homoserine can be produced in high yield, it can be usefully used to produce L-methionine having a high yield as a precursor thereof.
  • the present invention provides a novel isolated polypeptide that is resistant to feedback inhibition by methionine and has homoserine O-succinyltransferase activity.
  • the term “activity of homoserine O-succinyltransferase” used in the present invention refers to the activity of converting homoserine to O-succinyl homoserine. Means.
  • feedback inhibition refers to the inhibition of the enzymatic activity of homoserine O-succinyltransferase by methionine.
  • the polypeptide of the present invention has an amino acid sequence of SEQ ID NO: 1 having homoserine O-succinyltransferase activity, and is characterized by being resistant to methionine feedback inhibition.
  • the amino acid sequence of the polypeptide is 80% or more, specifically 90% or more, more specifically 95
  • Polypeptides having a homology of at least%, in particular at least 97% are also included in the present invention. Homology to the amino acid sequence is described, for example, in the algorithm BLAST by Karlin and Altschul, Pro. Natl. Acad. Sci.
  • Another aspect of the invention provides an isolated polynucleotide encoding said polypeptide.
  • the polypeptide may be encoded by the polynucleotide sequence of SEQ ID NO: 2 or 3, and due to the degeneracy of the codon, at least 80%, in particular at least 90%, more specifically at least 95%, in particular 97 Polynucleotides having at least% homology are also included in the present invention. However, the present invention is not limited thereto.
  • Still another aspect of the present invention provides a vector operably comprising the polynucleotide.
  • the term "vector” refers to a DNA preparation containing a nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable regulatory sequence to allow expression of the target protein in a suitable host.
  • the regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation.
  • the vector used in the present invention is not particularly limited as long as it can be replicated in the host, and any vector known in the art may be used.
  • O-succinylhomoserine which expresses a polypeptide having a homoserine O-succinyltransferase activity that is feedback resistant to methionine (O-succinyl L-homoserine) provides a microorganism.
  • microorganism that produces O-succinyl L-homoserine may be a microorganism that can accumulate inside and outside cells by producing O-succinyl homoserine.
  • Microorganisms producing the O-succinyl homoserine include prokaryotic and eukaryotic microbial strains.
  • Microorganism strains belonging to the genus and Brevibacterium genus may be included, but are not limited thereto.
  • microbial strains belonging to the genus Escherichia for example Escherichia coli may be used.
  • the microorganism producing the O-succinyl homoserine may be prepared using L-lysine, L-threonine or L-isoleucine producing strain. Specifically, it can be prepared using L-threonine producing strain. Since L-threonine producing strains are already well-synthesized to homoserine, precursors of L-threonine and O-succinyl homoserine, a large amount of methionine precursor, that is, O-succinyl Homoserine can be synthesized.
  • expression of the polypeptide may be achieved by transforming with a recombinant vector operably comprising a gene encoding the polypeptide, or by inserting a polynucleotide encoding the polypeptide into a chromosome, but is not particularly limited thereto. .
  • the term "transformation" means to introduce a vector comprising a polynucleotide encoding the target protein into the host cell to be able to express the protein encoded by the polynucleotide in the host cell.
  • the introduced polynucleotide can be located in the chromosome of the host cell or located outside the chromosome as long as it can be expressed in the host cell.
  • the polynucleotide may be introduced in any form as long as it can be introduced into and expressed in a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a polynucleotide construct containing all the elements necessary for self expression.
  • the expression cassette typically includes a promoter, transcription termination signal, ribosomal binding site, and translation termination signal operably linked to an open reading frame of the gene (abbreviated as "ORF").
  • the promoter used in the present invention is not particularly limited as long as it initiates a high frequency of transcription of a polynucleotide encoding a protein of interest in a host cell, and any promoter known in the art may be used. Specifically, T7 promoter, trc promoter, tac promoter, cysK promoter (Korean Patent Registration No. 10-0966324) may be used, but is not limited thereto.
  • the microorganism may be further deleted or attenuated the metB gene encoding cystathionine gamma synthase.
  • the microorganism further deletes the thrB gene encoding a homoserine kinase and the metA gene encoding a homoserine O-succinyltransferase. Or weakened.
  • sequence of the genes can be obtained from a database such as the American Biotechnology Information Center (NCBI).
  • NCBI American Biotechnology Information Center
  • deletion used in the present invention means a form in which the nucleotide sequence from the nucleotide sequence corresponding to the start codon of the target gene to the stop codon or a part or all of the regulatory region nucleotide sequences is removed from the chromosome. do.
  • the term "weakening” refers to the removal or reduction of intracellular activity of one or more enzymes encoded by corresponding DNA in a microbial strain, for example, a promoter of a gene. By altering the nucleotide sequence of the site and the 5'-UTR site, the expression of the protein can be attenuated or a mutation can be introduced into the ORF site of the gene, thereby weakening the activity of the protein.
  • Another aspect of the present invention comprises culturing the microorganism in a medium to produce O-succinyl homoserine and obtaining O-succinyl homoserine from the microorganism or medium, O-succinyl homoserine It provides a production method of
  • Cultivation process of the prepared O-succinyl homoserine production strain may be made according to suitable media and culture conditions known in the art. This culture process can be easily adjusted and used by those skilled in the art according to the strain selected. Examples of the culture method include, but are not limited to, batch, continuous and fed-batch cultures. Such various culture methods are disclosed, for example, in "Biochemical Engineering” by James M. Lee, Prentice-Hall International Editions, pp 138-176.
  • the medium used for culturing must adequately meet the requirements of the particular strain.
  • Media of various microorganisms are disclosed, for example, in "Manual of Methods for General Bacteriology" by the American Society for Bacteriology, Washington D.C., United States, 1981.
  • the medium contains various carbon sources, nitrogen sources and trace element components.
  • carbon sources that can be used include glucose, sucrose, lactose, fructose, maltose, starch, carbohydrates such as cellulose, soybean oil, sunflower oil, castor oil, fats such as coconut oil, palmitic acid, stearic acid, linoleic acid Fatty acids such as, alcohols such as glycelol and ethanol, and organic acids such as acetic acid.
  • nitrogen sources examples include organic nitrogen sources and urea such as peptone, yeast extract, gravy, malt extract, corn steep liquor (CSL) and soybean wheat, inorganic such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate Nitrogen sources are included. These nitrogen sources may be used alone or in combination.
  • the medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate and the corresponding sodium-containing salts as a person. It may also include metal salts such as magnesium sulfate or iron sulfate.
  • amino acids, vitamins, and appropriate precursors may be included. These media or precursors may be added batchwise or continuously to the culture.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture.
  • anti-foaming agents such as fatty acid polyglycol esters can be used during the culture to suppress bubble generation.
  • oxygen or oxygen-containing gas eg, air
  • the temperature of the culture is usually 20 ° C to 45 ° C, specifically 25 ° C to 40 ° C. The incubation period can continue until the desired amount of O-succinylhomoserine is obtained, specifically 10 to 160 hours.
  • O-succinylhomoserine produced by the method of the present invention can be converted to methionine by cystathionine gamma synthase or O-succinylhomoserine sulfhydrylase.
  • succinic acid in addition to L-methionine can be obtained as a by-product in addition to L-methionine through the reaction of O-succinyl-L-homoserine produced by the method of the present invention with CH 3 SH.
  • Another aspect of the invention is an O-succinyl of a polypeptide having an amino acid sequence represented by SEQ ID NO: 1 and having feedback resistance by methionine and homoserine O-succinyltransferase activity It relates to the use of homoserine production.
  • the newly isolated polypeptide is resistant to feedback inhibition to methionine and can produce O-succinyl homoserine in high yield, and the polypeptide can be used for O-succinyl homoserine production. Can be.
  • the metX gene (Homoserine O-acetyltransferase) has a structure similar to that of the metA gene but does not receive feedback inhibition to L-methonine.
  • metX from Chromobacterium violaceum has been developed.
  • methionine feedback inhibition resistance having the amino acid sequence of SEQ ID NO: 1 is finally obtained.
  • the polypeptide released was selected from the group, and the selected polypeptide was metX derived from Sideroxydans lithotrophicus ES-1, but the present inventors newly identified a new activity that has not been reported before.
  • the metX gene derived from the selected cyderoxydanthose rottrophycus ES-1 (sli) is expressed in Escherichia coli based on the metX gene sequence (SEQ ID NO: 2) of the reference sequence YP_003522665.1 of the NCBI database. It was synthesized through a codon optimization process (SEQ ID NO: 3).
  • PCR was performed using primers of SEQ ID NOs: 4 and 5 to amplify the metX gene.
  • the primer of SEQ ID NO: 5 has a restriction enzyme HindIII site.
  • PCR conditions were repeated 30 times for denaturation (95 °C 30 seconds, annealing 55 °C 30 seconds, extension 72 °C 1 minute).
  • the PCR product was purified by electrophoresis on a 1.0% agarose gel, eluting a 1.14 kb size band, followed by treatment with the HindIII restriction enzyme, and the pCL1920 vector containing the cysK promoter after treatment with EcoRV and HindIII restriction enzyme. The fragment was cloned.
  • the metX gene expression plasmid resulting from cloning was named pCL-PcysK-metX (sli).
  • the metB gene encoding cystathionine gamma synthase was deleted in wild type E. coli (K12) W3110 strain. FRT-one-step-PCR deletion was performed for metB gene deletion (PNAS (2000) vol97 P6640-6645).
  • a deletion cassette was prepared by PCR using pKD3 vector (PNAS (2000) vol97 P6640-6645) as a template using primers of SEQ ID NOs: 6 and 7.
  • PCR conditions were repeated 30 times in denaturation 95 °C 30 seconds, annealing 55 °C 30 seconds, elongation 72 °C 1 min.
  • the PCR product was purified by electrophoresis on 1.0% agarose gel and eluting a band of 1.1 kb in size.
  • the selected strains were PCR-strained under the above conditions using primers of SEQ ID NOs: 8 and 9 as strains, followed by confirming that a gene size of 1.5 kb was observed on a 1.0% agarose gel to confirm the deficiency of the metB gene. It was.
  • the identified strains were transformed with pCP20 vector (PNAS (2000) vol97 P6640-6645) and cultured in LB medium containing 100 ⁇ g / L ampicillin, and again the final metB gene reduced on 1.0% agarose gel by PCR under the same conditions. Defective strains were made and confirmed that the chloramphenicol marker was removed. The produced methionine requirement strain was named CC03-0131.
  • PCR conditions were repeated 30 times in denaturation 95 °C 30 seconds, annealing 55 °C 30 seconds, elongation 72 °C 1 min.
  • the PCR product was purified by electrophoresis on 1.0% agarose gel and eluting a band of 1.1 kb in size.
  • the recovered DNA fragments were electroporated to the CC03-0131 strain which was previously transformed with the pKD46 vector.
  • CC03-0131 strain transformed with pKD46 for electroporation was incubated to 30 ° C.
  • OD 600 0.5 using LB medium containing 200 ⁇ g / L ampicillin and 5 mM arabinose and washed three times with 10% glycerol. Was used. Electroporation was applied at 2500V.
  • the recovered strains were plated in LB plate medium containing 30 ⁇ g / L chloramphenicol and cultured at 37 ° C. for 1-2 days to select strains showing resistance.
  • Selected strains were PCR- scheduled under the above conditions using primers of SEQ ID NOs: 12 and 13, using the strain as a template, and confirmed the deletion of the thrB gene by confirming that the gene size was observed at 1.5 kb on 1.0% agarose gel. It was.
  • the identified strain was transformed with pCP20 vector and cultured in LB medium containing 100 ⁇ g / L ampicillin, and again, the final thrB gene deletion strain was reduced on 1.0% agarose gel by PCR under the same conditions, and the chloramphenicol marker was removed. It was confirmed.
  • the produced strain was named CC03-0131-2.
  • a hydroxy side thiooxidans ritonavir trophy kusu ES-1-derived substrate specificity and E. coli (K12) strain was based on the CC03-0131-2 the metB deficient and thrB genes on the W3110 strain to verify activity of the metX gene from E. coli strain
  • the original metA gene on the chromosome was deleted.
  • FRT-one-step-PCR deletion method was performed for metA gene deletion.
  • a deletion cassette was prepared by PCR using pKD3 vector as a template using primers of SEQ ID NOs: 14 and 15.
  • PCR conditions were repeated 30 times in denaturation 95 °C 30 seconds, annealing 55 °C 30 seconds, elongation 72 °C 1 min.
  • the PCR product was purified by electrophoresis on 1.0% agarose gel and eluting a band of 1.1 kb in size.
  • the recovered DNA fragments were electroporated to the strain CC03-0131-2 previously transformed with the pKD46 vector.
  • CC03-0131-2 strain transformed with pKD46 for electroporation was cultured to 30 ° C.
  • OD 600 0.5 using LB medium containing 200 ⁇ g / L ampicillin and 5 mM arabinose, followed by 10% glycerol It was used to wash three times. Electroporation was applied at 2500V.
  • the recovered strains were plated in LB plate medium containing 30 ⁇ g / L chloramphenicol and cultured at 37 ° C. for 1-2 days to select strains showing resistance.
  • the selected strains were PCR-strained under the above conditions using the primers of SEQ ID NOs: 16 and 17 using the strain as a template, and the defects of the metA gene were confirmed by confirming that the gene size was observed to be 1.5 kb on 1.0% agarose gel. It was.
  • the identified strain was transformed with pCP20 vector and cultured in LB medium containing 100 ⁇ g / L ampicillin, and again, the final metA gene deletion strain was made on 1.0% agarose gel by PCR under the same conditions, and the chloramphenicol marker was removed. It was confirmed.
  • the produced strain was named CC03-0132.
  • Example 2 to strain CC03-0132 strain that lacks metB, thrB and metA genes based on wild-type strain E. coli (K12) W3110 for confirming substrate specificity and activity of registerxin littotrophicus ES-1 metX gene
  • the plasmid pCL-PcysK-metX (sli) produced by was introduced.
  • the CC03-0132 strain which introduced the plasmid pCL-PcysK-metX (sli), was named CC03-0136, and the International Deposit under the Treaty of Budapest, 361-221, Hongje 1-dong, Seodaemun-gu, Seoul, Korea, dated June 10, 2013. It was deposited with the accession number KCCM 11424P at the Korea Microbial Conservation Center, an affiliated organization of the Korean spawn association.
  • a strain was prepared by introducing plasmid pCL-PcysK-metA prepared in the same manner as in Example 2 except for using wild type metA in the CC03-0132 strain.
  • the prepared strain was named CC03-0132 / pCL-PcysK-metA.
  • CCA-0132 strain and CJM-BTA strain were inoculated into plate LB medium as a control group, and metA prepared using CC03-0136 strain and the same vector transformed into a plate LB medium containing antibiotic spectinomycin and metX expression vector.
  • the metX gene derived from cedoxydanthose rottropycus ES-1 produces O-succinyl homoserine using succinyl CoA (succinyl-CoA) as a substrate, similar to the metA gene of E. coli . Acetyl homoserine did not produce.
  • the metX gene derived from the Cederidodans rottropycus ES-1 was introduced, the wild type itself did not show feedback inhibition by the methionine added to the medium without introducing a mutation.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 발명은 메치오닌에 의한 피드백 저해에 대한 내성 및 호모세린 O-숙시닐트랜스퍼라아제 활성을 가지는 폴리펩티드, 상기 폴리펩티드를 발현하는 O-숙시닐호모세린 생산 미생물 및 이를 이용하여 O-숙시닐호모세린을 생산하는 방법에 관한 것이다.

Description

O-숙시닐호모세린 생산 미생물 및 이를 이용한 O-숙시닐호모세린의 생산방법
본 발명은 메치오닌에 의한 피드백 저해에 대한 내성 및 호모세린 O-숙시닐트랜스퍼라아제 활성을 가지는 분리된 폴리펩티드, 상기 폴리펩티드를 발현하는 O-숙시닐호모세린 생산 미생물 및 이를 이용하여 O-숙시닐호모세린을 생산하는 방법에 관한 것이다.
자연계에 존재하는 대부분의 미생물은 메치오닌을 생합성하기 위해서 O-숙시닐호모세린(O-succinyl homoserine) 또는 O-아세틸호모세린(O-acetyl homoserine)을 중간체로 이용하는 것으로 알려져 있다. 일반적으로 O-숙시닐호모세린은 호모세린(Homoserine)에 숙시닐코에이(Succinyl-coA)의 숙시닐 부위(Succinyl group)를 결합시키는 O-숙시닐트랜스퍼라아제(homoserine O-succinyltransferase, MetA)에 의해 생산되고, O-아세틸호모세린은 호모세린(Homoserine)에 아세틸코에이(acetyl-coA)의 아세틸 부위(Succinyl group)를 결합시키는 호모세린 O-아세틸트랜스퍼라아제(homoserine O-acetyltransferase, MetX)에 의해 생산된다. 즉, 중간체중 O-숙시닐호모세린을 생산하는 데에 있어서, metA는 생산균주 개발에 아주 중요한 유전자중 하나이다. 한편, MetX는 MetA와는 달리 피드백저해를 받지 않으며 효소 안정성도 높은 것으로 알려져 있다.
O-숙시닐호모세린은 메치오닌 생합성 경로의 시스타치오닌 감마 신타아제(cystathionine gamma synthase)가 차단되어 축적되는 데, 이에, O-숙시닐호모세린 생산 균주는 L-메치오닌 요구성을 나타낸다. 이에 따라 배지에 메치오닌을 첨가하게 되는데, 반면에 이렇게 첨가된 메치오닌에 의해서 호모세린 O-숙시닐트랜스퍼라아제가 피드백저해(feedback inhibition)를 받아 활성이 억제되고, 최종적으로는 고농도의 O-숙시닐호모세린을 얻을 수 없게 된다.
따라서, 종래의 많은 특허들은 피드백 조절 체계로부터 metA의 피드백 저해를 해제하는 연구에 집중되었다. 하지만 metA에 의해서 코딩되는 호모세린 O-숙시닐트랜스퍼라아제는 야생형 단백질 자체로도 안정성이 낮고, 피드백해제를 위해서 변이가 도입되면 불안정성이 더 커지는 문제점을 안고 있다. 높은 생산능을 가지는 O-숙시닐호모세린 생산 균주의 개발을 위해서는 metA 유전자의 피드백 저해가 제거되고 효소 안정성이 확보될 필요가 있다.
앞에서 언급된 metA의 피드백 저해현상과 불안정성 문제를 해결하기 위하여, 본 발명자들은 메치오닌에 의한 피드백 저해를 받지 않으며 효소 안정성이 확보된 호모세린 O-숙시닐트랜스퍼라아제를 찾기 위하여 예의 노력한 결과, 이의 활성을 갖는 신규한 효소 를 탐색하였다. 이렇게 탐색된 후보 유전자를 선별하고, 이를 에스케리키아 속 미생물에 도입하여 플라스크 배양한 결과, O-숙시닐호모세린이 생성됨을 확인하였다. 이렇게 선별된 유전자는 호모세린 O-숙시닐트랜스퍼라아제 활성을 가지며 메치오닌에 대한 피드백 저해에 내성을 가짐을 확인하여 본 발명을 완성하였다.
본 발명은 메치오닌에 의한 피드백 저해에 대한 내성 및 호모세린 O-숙시닐트랜스퍼라아제 활성을 갖는 신규 분리한 폴리펩티드를 제공하는 것을 목적으로 한다.
본 발명은 또한 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드를 제공하는 것을 목적으로 한다.
본 발명은 또한 상기 신규 분리한 폴리펩티드를 발현하는 O-숙시닐호모세린 생산 미생물을 제공하는 것을 목적으로 한다.
본 발명은 또한 상기 미생물을 이용하여 O-숙시닐호모세린을 생산하는 방법을 제공하는 것을 목적으로 한다.
본 발명의 신규 분리한 메치오닌에 대한 피드백 저해에 내성을 가지며, 호모세린 O-숙시닐트랜스퍼라아제 활성을 갖는 폴리펩티드를 포함하는 O-숙시닐호모세린 생산 미생물은 메치오닌에 대한 피드백 저해에 내성을 가지며 고수율로 O-숙시닐호모세린을 생산할 수 있으므로, 이를 전구체로 하는 L-메치오닌을 고수율로 생산하는데 유용하게 사용할 수 있다.
상기 목적을 달성하기 위한 하나의 양태로서 본 발명은 메치오닌에 의한 피드백 저해에 내성을 가지며 호모세린 O-숙시닐트랜스퍼라아제 활성을 갖는 신규 분리한 폴리펩티드를 제공한다.
본 발명에서 사용된 상기 용어 “호모세린 O-숙시닐트랜스퍼라아제 활성(activity of homoserine O-succinyltransferase)”은 호모세린(Homoserine)을 O-숙시닐호모세린(O-succinyl homoserine)으로 전환하는 활성을 의미한다.
본 발명에서 사용된 상기 용어 “피드백 저해(feedback inhibition)”는 메치오닌에 의한 호모세린 O-숙시닐트랜스퍼라아제의 효소 활성의 억제를 나타낸다.
본 발명의 폴리펩티드는 호모세린 O-숙시닐트랜스퍼라아제 활성을 가지는 서열번호 1의 아미노산 서열을 가지며, 메치오닌 피드백 저해에 내성을 갖는 것을 특징으로 한다. 본 발명에서 제시한 호모세린 O-숙시닐트랜스퍼라아제 활성 및 메치오닌에 대한 피드백 저해에 내성을 가지는 한, 상기 폴리펩티드의 아미노산 서열에 대해서 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 특히 구체적으로는 97% 이상의 상동성을 가지는 폴리펩티드 또한 본 발명에 포함된다. 상기 아미노산 서열에 대한 상동성은 예를 들면 문헌에 의한 알고리즘 BLAST [참조: Karlin 및 Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)]나 Pearson에 의한 FASTA [참조: Methods Enzymol., 183, 63(1990)]을 사용하여 결정할 수 있다. 이러한 알고리즘 BLAST에 기초하여, BLASTN이나 BLASTX라고 불리는 프로그램이 개발되어 있다[참조: www.ncbi.nlm.nih.gov].
본 발명의 또 다른 양태는 상기 폴리펩티드를 코딩하는 분리된 폴리뉴클레오티드를 제공한다.
상기 폴리펩티드는 서열번호 2 또는 3의 폴리뉴클레오티드 서열에 의해 코딩될 수 있으며, 코돈의 축퇴성으로 인하여 이와 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 특히 구체적으로는 97% 이상의 상동성을 가지는 폴리뉴클레오티드 또한 본 발명에 포함된다. 그러나, 본 발명이 이에 제한되는 것은 아니다.
또한 본 발명의 또 다른 양태는 상기 폴리뉴클레오티드를 작동 가능하게 포함하는 벡터를 제공한다.
본 발명에서, 상기 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 암호화하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 벡터는 적당한 숙주 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 발명에서 사용되는 벡터는 숙주 중에서 복제 가능한 것이면 특별히 한정되지 않으며 당업계에 알려진 임의의 벡터를 이용할 수 있다.
본 발명의 또 다른 양태는 메치오닌에 대한 피드백 저해에 대한 내성을 가지는(feedback resistant) 호모세린 O-숙시닐트랜스퍼라아제(Homoserine O-succinyltransferase) 활성을 갖는 폴리펩티드를 발현하는, O-숙시닐호모세린(O-succinyl L-homoserine)을 생산하는 미생물을 제공한다.
본 발명에서 사용된 상기 용어 “O-숙시닐호모세린(O-succinyl L-homoserine)을 생산하는 미생물”이란 O-숙시닐호모세린을 생산하여 세포 내외에서 축적할 수 있는 미생물일 수 있다.
상기 O-숙시닐호모세린을 생산하는 미생물은, 원핵 및 진핵 미생물 균주를 포함한다. 예를 들어, O-숙시닐호모세린을 생산하는 에스케리키아(Escherichia) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속, 코리네박테리움(Corynebacterium) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 균주가 포함될 수 있으나 이에 제한되지 않는다. 구체적으로는, 에스케리키아(Escherichia) 속에 속하는 미생물 균주, 그 예로 에스케리키아 콜라이(Escherichia coli)가 사용될 수 있다.
상기 O-숙시닐호모세린을 생산하는 미생물은 L-라이신, L-쓰레오닌 또는 L-이소류신 생산 균주를 이용하여 제조할 수 있다. 구체적으로는, L-쓰레오닌 생산 균주를 이용하여 제조할 수 있다. L-쓰레오닌 생산 균주는 L-쓰레오닌 및 O-숙시닐호모세린의 전구체인 호모세린까지의 합성이 이미 원활하게 이루어지는 균주이므로, 이를 활용하여 많은 양의 메치오닌 전구체, 즉 O-숙시닐호모세린을 합성할 수 있다.
본 발명에서, 상기 폴리펩티드의 발현은 상기 폴리펩티드를 코딩하는 유전자를 작동 가능하게 포함하는 재조합 벡터로 형질전환되거나, 상기 폴리펩티드를 암호화하는 폴리뉴클레오티드가 염색체 내에 삽입되어 달성될 수 있으나, 이로 특별히 제한되지 않는다.
본 발명에서, 상기 용어 "형질전환"은 목적 단백질을 암호화하는 폴리 뉴클레오티드를 포함하는 벡터를 숙주 세포 내에 도입하여 숙주 세포 내에서 상기 폴리뉴클레오티드가 암호화하는 단백질을 발현할 수 있도록 하는 것을 의미한다. 도입된 폴리뉴클레오티드는 숙주 세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치할 수 있다. 상기 폴리뉴클레오티드는 숙주 세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 폴리뉴클레오티드 구조체인 발현카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현카세트는 통상 상기 유전자의 오픈 리딩 프레임(open reading frame, 이하 "ORF"라 약칭함)에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결 신호, 리보좀 결합부위 및 번역 종결신호를 포함한다.
본 발명에서 사용되는 프로모터는 숙주세포 내에서 목적 단백질을 암호화하는 폴리뉴클레오티드의 전사를 높은 빈도로 개시하는 것이라면 특별히 한정되지 않으며, 당업계에 알려진 임의의 프로모터를 이용할 수 있다. 구체적으로는, T7 프로모터, trc 프로모터, tac 프로모터, cysK 프로모터(대한민국 특허등록번호 제10-0966324호)를 사용할 수 있으며, 이에 한정되는 것은 아니다.
본 발명의 구체적인 실시 양태에서, 상기 미생물은 시스타치오닌 감마 신타아제(cystathionine gamma synthase)를 코딩하는 metB 유전자가 추가로 결손 또는 약화될 수 있다.
또한 본 발명의 구체적인 실시 양태에서, 상기 미생물은 호모세린 키나아제(homoserine kinase)를 코딩하는 thrB 유전자 및 호모세린 O-숙시닐트랜스퍼라아제(homoserine O-succinyltransferase)를 코딩하는 metA 유전자를 추가로 더 결손 또는 약화시킬 수 있다.
본 발명에서, 상기 유전자들의 서열은 미국생물공학정보센터(NCBI)와 같은 데이터베이스로부터 얻을 수 있다.
본 발명에서 사용되는 상기 용어 “결손(deletion)”은 목적 유전자의 개시코돈에 해당하는 염기서열로부터 종결코돈까지의 염기서열 영역 혹은 그 조절부위 염기서열 중 일부 혹은 전부를 염색체 내부에서 제거한 형태를 의미한다.
본원에서 사용되는 상기 용어“약화(weakening)”는 미생물 균주에서 상응하는 DNA에 의해 코딩되는 하나 이상의 효소에 대한 세포 내 활성을 제거하거나 감소시키는 것을 의미하는데, 예를 들어, 유전자의 프로모터(promoter) 부위 및 5'-UTR 부위의 염기서열을 변형시킴으로써 단백질의 발현을 약화시키거나 해당 유전자의 ORF 부위에 돌연변이를 도입함으로써 단백질의 활성을 약화시킬 수 있다.
본 발명의 또 다른 양태는 상기 미생물을 배지에서 배양하여 O-숙시닐호모세린을 생산하는 단계 및 상기 미생물 또는 배지로부터 O-숙시닐호모세린을 수득하는 단계를 포함하는, O-숙시닐호모세린의 생산방법을 제공한다.
상기 제조된 O-숙시닐호모세린 생산 균주의 배양 과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 당업자라면 선택되는 균주에 따라 용이하게 조정하여 사용할 수 있다. 상기 배양 방법의 예에는, 회분식, 연속식 및 유가식 배양이 포함되나, 여기에 한정되는 것은 아니다. 이러한 다양한 배양 방법은 예를 들어 문헌("Biochemical Engineering" by James M. Lee, Prentice-Hall International Editions, pp 138-176)에 개시되어 있다.
배양에 사용되는 배지는 특정한 균주의 요구조건을 적절하게 만족시켜야 한다. 다양한 미생물의 배지는 예를 들어 문헌("Manual of Methods for General Bacteriology" by the American Society for Bacteriology, Washington D.C., 미국, 1981)에 개시되어 있다. 상기 배지는 다양한 탄소원, 질소원 및 미량원소 성분을 포함한다. 사용될 수 있는 탄소원의 예에는, 포도당, 자당, 유당, 과당(fructose), 말토즈, 전분, 셀룰로즈와 같은 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유와 같은 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리셀롤 및 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 탄소원은 단독 또는 조합되어 사용될 수 있다. 사용될 수 있는 질소원의 예에는, 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액(CSL) 및 대두밀과 같은 유기 질소원 및 요소, 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄과 같은 무기 질소원이 포함된다. 이들 질소원은 단독 또는 조합되어 사용될 수 있다. 상기 배지에는 인원으로서, 인산이수소칼륨, 인산수소이칼륨 및 대응되는 소듐-함유 염이 포함될 수 있다. 또한, 황산마그네슘 또는 황산철과 같은 금속염을 포함할 수 있다. 이 외에, 아미노산, 비타민, 및 적절한 전구체 등이 포함될 수 있다. 이들 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있다.
또한, 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 배양물에 적절한 방식으로 첨가하여 배양물의 pH를 조정할 수 있다. 또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배양물의 호기상태를 유지하기 위하여, 배양물 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입한다. 배양물의 온도는 통상 20℃ 내지 45℃, 구체적으로는 25℃ 내지 40℃이다. 배양 기간은 원하는 O-숙시닐호모세린 의 생성량이 얻어질 때까지 계속할 수 있으며, 구체적으로는 10 내지 160 시간이다.
본 발명의 방법으로 생산한 O-숙시닐호모세린은 시스타치오닌 감마 신타아제 (cystathionine gamma synthase) 또는 O-숙시닐호모세린 설피드릴라아제 (O-succinylhomoserine sulfhydrylase)에 의하여 메치오닌으로 전환될 수 있다. 또한, 본 발명의 방법으로 생산한O-숙시닐-L-호모세린과 CH3SH와의 반응을 통하여 L-메치오닌 이외에도 숙신산을 별도의 생산공정 없이 부산물로 얻을 수 있다.
본 발명의 또 다른 양태는 서열번호 1로 표시되는 아미노산 서열을 가지고, 메치오닌에 의한 피드백 내성(feedback resistant) 및 호모세린 O-숙시닐트랜스퍼라아제(Homoserine Succinyltransferase) 활성을 갖는 폴리펩티드의 O-숙시닐호모세린 생산 용도에 관한 것이다. 본 발명에서 신규하게 분리한 상기 폴리펩티드가 메치오닌에 대한 피드백 저해에 내성을 가지며 고수율로 O-숙시닐호모세린을 생산할 수 있음을 규명하였는바, 상기 폴리펩티드는 O-숙시닐호모세린 생산 용도로 사용될 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
실시예 1: 신규한 O-숙시닐트랜스퍼라아제 활성을 갖는 폴리펩티드의 선별
metA 유전자의 피드백 조절의 해제 및 안정성 확보를 위한 방법의 일환으로서, metX 유전자(Homoserine O-acetyltransferase)가 metA 유전자와 비슷한 구조를 가지면서도 L-메치오닌(L-methonine)에 대한 피드백 저해를 받지 않는 것에 착안하여, 크로모박테리움 비오라시움(Chromobacterium violaceum) 유래의 metX가 개발된 바 있다.
이에 신규 호모세린 O-숙시닐트랜스퍼라아제 개발을 위해 기 개발된 크로모박테리움 비오라시움 유래의 metX의 아미노산 서열 상동성 분석을 통해 최종적으로 서열번호 1의 아미노산 서열을 가지는 메치오닌 피드백 저해 내성에 해제된 폴리펩티드를 선별하였으며, 선별된 폴리펩티드는 시데록시단스 리토트로피쿠스 ES-1(Sideroxydans lithotrophicus ES-1)으로부터 유래된 metX 이나, 기 보고된 바 없는 새로운 활성을 본 발명자들이 새롭게 확인하였다.
실시예 2: 플라스미드의 제작
2-1. 시데록시단스 리토트로피쿠스 ES-1 유래 metX 유전자의 합성
선별한 시데록시단스 리토트로피쿠스 ES-1 (sli) 유래 metX 유전자는 NCBI 데이터베이스의 참조 서열(reference sequence) YP_003522665.1의 metX 유전자 서열(서열번호 2)을 기반으로 대장균(Escherichia coli)에서 발현되도록 코돈 최적화(codon optimization) 과정을 거쳐 합성하였다(서열번호 3).
2-2. 시데록시단스 리토트로피쿠스 ES-1 유래 metX 유전자를 발현하는 플라스미드의 제작
합성한 서열번호 3의 염기서열을 근간으로 서열번호 4, 5의 프라이머를 이용하여 PCR을 수행하여 metX 유전자를 증폭하였다. 서열번호 5의 프라이머는 제한효소 HindIII 부위를 가지고 있다.
서열번호 4) 5’- ATC TTGAGTATTTCGGTTGGTATTG-3’
서열번호 5) 5’-CCC AAGCTT ttaagcagctgattcccaagc-3’
PCR 조건은 변성(denaturation) 95℃ 30초, 어닐링(annealing) 55℃ 30초, 신장(extension) 72℃ 1분을 30회 반복 수행하였다. 이 PCR 결과물은 1.0% 아가로스 겔에서 전기 영동한 후 1.14kb 크기의 밴드를 용리하여 정제한 뒤, HindIII 제한효소를 처리하고, cysK 프로모터가 포함된 pCL1920 벡터는EcoRV 및 HindIII 제한효소 처리 후, 두 단편을 클로닝하였다. 클로닝 결과로 얻은 metX 유전자 발현 플라스미드를 pCL-PcysK-metX(sli)라 명명하였다.
실시예 3: 실험균주의 제작
3-1. metB 유전자 결손
야생형 E. coli(K12) W3110 균주에서 시스타치오닌 감마 신타아제를 코딩하는 metB 유전자를 결손시켰다. metB 유전자 결손을 위해 FRT-one-step-PCR deletion 방법을 수행하였다(PNAS (2000) vol97 P6640-6645). metB 유전자 결손을 위해서 서열번호 6, 7의 프라이머를 이용하여 pKD3 벡터(PNAS (2000) vol97 P6640-6645)를 주형으로 하여 PCR 반응으로 결손 카세트(deletion cassette)를 제작하였다.
서열번호 6)
5’-
TTACTCTGGTGCCTGACATTTCACCGACAAAGCCCAGGGAACTTCATCACGTGTAGGCTGGAGCTGCTTC-3’
서열번호 7)
5’-CGCTGCGCCAGCTCCATACGCGGCACCAGCGTTCGCAACCCACGTAGCAGCATATGAATATCCTCCTTAG-3’
PCR 조건은 변성 95℃ 30초, 어닐링 55℃ 30초, 신장 72℃ 1분을 30회 반복 수행하였다. 이 PCR 결과물은 1.0% 아가로스 겔에서 전기 영동한 후 1.1kb 크기의 밴드를 용리하여 정제하였다. 회수된 DNA 절편은 pKD46 벡터(PNAS (2000) vol97 P6640-6645)를 미리 형질 전환 시킨 E. coli(K12) W3110 균주에 일렉트로포레이션하였다. 일렉트로포레이션(electroporation)을 위하여 pKD46으로 형질전환된 W3110 균주는 200μg/L 암피실린(ampicillin)과 5 mM 아라비노스(L-arabinose)가 포함된 LB배지를 이용하여 30℃ OD600=0.5까지 배양시킨 후, 10% 글리세롤로 3회 세척하여 사용하였다. 일렉트로포레이션은 2500V로 가하였다. 회수된 균주를 30μg/L 클로람페니콜(chloramphenicol)을 포함한 LB 평판배지에 도말하여 37℃에서 1~2일 배양한 후 내성을 보이는 균주를 선별하였다.
선별된 균주는 균주를 주형으로 하여 서열번호 8, 9의 프라이머를 이용하여 위 조건으로 PCR 한 후, 1.0% 아가로스 겔 상에서 유전자의 크기가 1.5kb로 관찰되는 것을 확인함으로서 metB 유전자의 결손을 확인하였다.
서열번호 8) 5’-TATTCGCCGCTCCATTCAGC-3’
서열번호 9) 5’-TACCCCTTGTTTGCAGCCCG-3’
확인된 균주는 pCP20 벡터(PNAS (2000) vol97 P6640-6645)로 형질전환시켜 100μg/L 암피실린을 포함한 LB 배지에서 배양하였으며, 다시 동일한 조건의 PCR을 통해 1.0% 아가로스 겔 상에서 작아진 최종 metB 유전자 결손 균주를 제작하였고, 클로람페니콜 마커가 제거되었음을 확인하였다. 제작된 메치오닌 요구성 균주를 CC03-0131 로 명명하였다.
3-2. thrB 유전자 결손
호모세린 키나아제를 코딩하는 유전자인 thrB 유전자를 결손시킴으로써 호모세린으로부터 O-숙시닐 호모세린의 합성량을 증가시키고자 하였다. 특히 쓰레오닌 생산균주를 이용할 경우 호모세린의 이용 활성이 매우 크기 때문에 이 유전자의 결손이 꼭 필요하다. 상기 제작된 CC03-0131 균주에서 thrB 유전자 결손을 위해 FRT-one-step-PCR deletion 방법을 수행하였다. thrB 유전자 결손을 위해서는 서열번호 10, 11의 프라이머를 이용하여 pKD3 벡터를 주형으로 하여 PCR 반응으로 결손 카세트를 제작하였다.
서열번호 10)
5’-
CATGGTTAAAGTTTATGCCCCGGCTTCCAGTGCCAATATGAGCGTCGGGTGTGTAGGCTGGAGCTGCTTC-3’
서열번호 11)
5’-
GGAGATACCGCTCGCTACCGCGCCGATTTCCGCGACCGCCTGCCGCGCCTCATATGAATATCCTCCTTAG-3’
PCR 조건은 변성 95℃ 30초, 어닐링 55℃ 30초, 신장 72℃ 1분을 30회 반복 수행하였다. 이 PCR 결과물은 1.0% 아가로스 겔에서 전기 영동한 후 1.1 kb 크기의 밴드를 용리하여 정제하였다. 회수된 DNA 절편은 pKD46 벡터를 미리 형질 전환 시킨 CC03-0131 균주에 일렉트로포레이션하였다. 일렉트로포레이션을 위하여 pKD46으로 형질전환된 CC03-0131 균주는 200μg/L 암피실린과 5 mM 아라비노스가 포함된 LB배지를 이용하여 30℃ OD600=0.5까지 배양시킨 후, 10% 글리세롤로 3회 세척하여 사용하였다. 일렉트로포레이션은 2500V로 가하였다. 회수된 균주를 30μg/L 클로람페니콜을 포함한 LB 평판배지에 도말하여 37℃에서 1~2일 배양한 후 내성을 보이는 균주를 선별하였다.
선별된 균주는 균주를 주형으로 하여 서열번호 12, 13의 프라이머를 이용하여 위 조건으로 PCR 한 후, 1.0% 아가로스 겔 상에서 유전자의 크기가 1.5 kb로 관찰되는 것을 확인함으로써 thrB 유전자의 결손을 확인하였다.
서열번호 12) 5’-ACTCGACGATCTCTTTGCC-3’
서열번호 13) 5’-ACGCCGAGAGGATCTTCGCAG-3’
확인된 균주는 pCP20 벡터로 형질전환시켜 100μg/L 암피실린을 포함한 LB 배지에서 배양하였으며, 다시 동일한 조건의 PCR을 통해 1.0% 아가로스 겔 상에서 작아진 최종 thrB 유전자 결손 균주를 제작하였고, 클로람페니콜 마커가 제거되었음을 확인하였다. 제작된 균주를 CC03-0131-2 로 명명하였다.
3-3. metA 유전자 결손
E. coli 균주에서 시데록시단스 리토트로피쿠스 ES-1 유래 metX 유전자의 기질 특이성 및 활성 확인을 위해 E. coli(K12) W3110 균주에 metB 및 thrB 유전자를 결손시킨 CC03-0131-2 균주를 기반으로 염색체 상의 본래 metA 유전자를 결손시켰다. metA 유전자 결손을 위해 FRT-one-step-PCR deletion 방법을 수행하였다. metA 유전자 결손을 위해서 서열번호 14, 15의 프라이머를 이용하여 pKD3 벡터를 주형으로 하여 PCR 반응으로 결손 카세트를 제작하였다.
서열번호 14)
5’-
TCAGCTGTTGCGCATCGATTCCCGTGAATCGCGCAACACGCCCGCAGAGCGTGTAGGCTGGAGCTGCTTC-3’
서열번호 15)
5’-
CCGTCACAAAGGCAATGCGCTTATCTTTACTGGCAAACAGATATGCATCCCATATGAATATCCTCCTTAG-3’
PCR 조건은 변성 95℃ 30초, 어닐링 55℃ 30초, 신장 72℃ 1분을 30회 반복 수행하였다. 이 PCR 결과물은 1.0% 아가로스 겔에서 전기 영동한 후 1.1kb 크기의 밴드를 용리하여 정제하였다. 회수된 DNA 절편은 pKD46 벡터를 미리 형질 전환 시킨 CC03-0131-2 균주에 일렉트로포레이션하였다. 일렉트로포레이션(electroporation)을 위하여 pKD46으로 형질전환된 CC03-0131-2 균주는 200μg/L 암피실린과 5mM 아라비노스 가 포함된 LB배지를 이용하여 30℃ OD600=0.5까지 배양시킨 후, 10% 글리세롤로 3회 세척하여 사용하였다. 일렉트로포레이션은 2500V로 가하였다. 회수된 균주를 30μg/L 클로람페니콜을 포함한 LB 평판배지에 도말하여 37℃에서 1~2일 배양한 후 내성을 보이는 균주를 선별하였다.
선별된 균주는 균주를 주형으로 하여 서열번호 16, 17의 프라이머를 이용하여 위 조건으로 PCR 한 후, 1.0% 아가로스 겔 상에서 유전자의 크기가 1.5kb로 관찰되는 것을 확인함으로서 metA 유전자의 결손을 확인하였다.
서열번호 16) 5’-CTCATTAACGTTGGTTGTCA-3’
서열번호 17) 5’-TATCTTGCTGCTGCTGAATG-3’
확인된 균주는 pCP20 벡터로 형질전환시켜 100μg/L 암피실린을 포함한 LB 배지에서 배양하였으며, 다시 동일한 조건의 PCR을 통해 1.0% 아가로스 겔 상에서 작아진 최종 metA 유전자 결손 균주를 제작하였고, 클로람페니콜 마커가 제거되었음을 확인하였다. 제작된 균주를 CC03-0132 로 명명하였다.
3-4. 시데록시단스 리토트로피쿠스 ES-1 유래 metX 유전자 발현 플라스미드가 도입된 균주의 제작
시데록시단스 리토트로피쿠스 ES-1 유래 metX 유전자의 기질 특이성 및 활성 확인을 위해 야생형 균주 E. coli(K12) W3110 기반으로 metB, thrB 및 metA 유전자를 결손시킨 균주 CC03-0132 균주에 상기 실시예 2에서 제작한 플라스미드 pCL-PcysK-metX(sli)를 도입하였다.
플라스미드 pCL-PcysK-metX(sli)를 도입한 CC03-0132 균주를 CC03-0136으로 명명하고, 2013년 O6월 10일자로 대한민국 서울 특별시 서대문구 홍제 1동 361-221 번지에 소재하는 부다페스트 조약 하의 국제기탁기관인 한국종균협회 부설 한국미생물 보존센터에 수탁번호 KCCM 11424P로 기탁하였다.
대조군으로 CC03-0132 균주에, 야생형 metA를 이용한 것 외에는 실시예 2와 같은 방법으로 제작된 플라스미드 pCL-PcysK-metA를 도입하여 균주를 제작하였다. 상기 제작된 균주를 CC03-0132/pCL-PcysK-metA로 명명하였다.
뿐만 아니라, 대한민국 특허등록번호 제10-0905381호에 개시된 균주로서, 메치오닌 요구성 균주인 L-쓰레오닌(L-threonine) 생산 균주 TF4076(수탁번호: KFCC-10718)를 기반으로 NTG를 이용한 인공적인 돌연변이법을 사용하여 메치오닌 요구성이 해제된 쓰레오닌 생산균주 CJM002(수탁번호: KCCM-10568)를 이용하여, 상기 3-1 내지 3-3과 동일한 방법으로 균주를 제작하였고, 제작된 균주를 CJM-BTA 로 명명하였다.
CJM-BTA 균주를 기반으로 상기와 동일한 플라스미드 pCL-PcysK-metX(sli), pCL-PcysK-metA를 도입하였으며, 제작된 균주를 각각 CJM-BTA/pCL-PcysK- metX(sli) 및 CJM-BTA/pCL-PcysK-metA로 명명하였다.
실시예 4: 균주를 이용한 O-숙시닐호모세린의 생산
4-1. 플라스크 배양 실험
상기 실시예 3에서 제작된 균주에 도입된 시데록시단스 리토트로피쿠스 ES-1 유래 metX 유전자의 기질 특이성 및 활성을 확인하기 위해 삼각플라스크 배양을 실시하였다. 플라스크 배지 조성을 하기 표 1에 나타내었다.
표 1
Figure PCTKR2014009967-appb-T000001
평판 LB배지에 대조군으로서 CC03-0132 균주 및 CJM-BTA 균주를 접종하고, 항생제 스펙티노마이신이 함유된 평판 LB배지에 metX 발현 벡터를 형질 전환 시킨 CC03-0136 균주 및 동일 벡터를 이용하여 제작된 metA 발현 벡터를 형질 전환 시킨 균주(CC03-0132/pCL-PcysK- metA), 그리고 CJM-BTA 균주 기반으로 metX 또는 metA 발현 벡터를 각각 형질 전환시킨 두 균주(CJM-BTA/pCL-PcysK- metX(sli) 및 CJM-BTA/pCL-PcysK- metA)를 접종하여 33℃에서 하루 밤 배양한 후, 단일 콜로니를 스펙티노마이신이 포함된 2ml LB 배지에 접종한 후 33℃에서 2시간 배양하고, 다시 25ml 플라스크 배지를 포함한 250 ml 삼각플라스크에 OD600=0.07 로 접종하여 33℃ 200rpm 에서 48시간 배양하여 HPLC 분석을 통해 O-숙시닐 호모세린 생산량을 비교하였다. 그 결과를 하기 표 2에 나타내었다.
표 2
Figure PCTKR2014009967-appb-T000002
그 결과, 시데록시단스 리토트로피쿠스 ES-1 유래 metX 유전자는 E. coli의 metA 유전자와 마찬가지로, 숙시닐 CoA(succinyl-CoA)를 기질로 이용하여 O-숙시닐 호모세린을 생산하며, O-아세틸 호모세린은 생산하지 않았다. 시데록시단스 리토트로피쿠스 ES-1 유래 metX 유전자가 도입된 경우는 변이의 도입 없이 야생형 그 자체로도 배지에 첨가된 메치오닌에 의한 피드백 저해 현상이 나타나지 않음을 알 수 있었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2014009967-appb-I000001

Claims (7)

  1. 서열번호 1로 표시되는 아미노산 서열을 가지고, 메치오닌에 의한 피드백 저해에 대한 내성(feedback resistant) 및 호모세린 O-숙시닐트랜스퍼라아제(Homoserine Succinyltransferase) 활성을 갖는 분리된 폴리펩티드.
  2. 제1항의 폴리펩티드를 코딩하는 서열번호 2 또는 3의 염기서열을 갖는 분리된 폴리뉴클레오티드.
  3. 서열번호 1로 표시되는 아미노산 서열을 가지고, 메치오닌에 의한 피드백 내성(feedback resistant) 및 호모세린 O-숙시닐트랜스퍼라아제(Homoserine Succinyltransferase) 활성을 갖는 폴리펩티드를 발현하는, O-숙시닐호모세린을 생산하는 에스케리키아속 미생물.
  4. 제3항에 있어서,
    상기 에스케리키아속 미생물은 대장균(Escherichia coli)인 것을 특징으로 하는 O-숙시닐호모세린을 생산하는 에스케리키아속 미생물.
  5. 제3항에 있어서,
    시스타치오닌 감마 신타아제(cystathionine gamma synthase)를 코딩하는 metB 유전자가 추가로 결손 또는 약화된 것을 특징으로 하는 에스케리키아속 미생물.
  6. 제3항에 있어서,
    호모세린 키나아제(homoserine kinase)를 코딩하는 thrB 유전자 또는 호모세린 O-숙시닐트랜스퍼라아제(homoserine O-succinyltransferase)를 코딩하는 metA 유전자가 추가로 결손 또는 약화된 것을 특징으로 하는 에스케리키아속 미생물.
  7. (a) 제3항 내지 제6항 중 어느 한 항의 미생물을 배지에서 배양하는 단계; 및
    (b) 상기 미생물 또는 배지로부터 O-숙시닐호모세린을 수득하는 단계를 포함하는, O-숙시닐호모세린의 생산방법.
PCT/KR2014/009967 2013-10-23 2014-10-22 O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법 WO2015060647A1 (ko)

Priority Applications (10)

Application Number Priority Date Filing Date Title
MYPI2016701394A MY190539A (en) 2013-10-23 2014-10-22 Microorganisms for production of o-succinylhomoserine and method for production of o-succinylhomoserine using the same
US15/031,706 US10316339B2 (en) 2013-10-23 2014-10-22 Microorganisms for production of O-succinylhomoserine and method for production of O-succinylhomoserine using the same
EP14854918.1A EP3061812B1 (en) 2013-10-23 2014-10-22 Microorganism for production o-succinylhomoserine and method for production of o-succinylhomoserine using the same
PL14854918T PL3061812T3 (pl) 2013-10-23 2014-10-22 Drobnoustrój wytwarzający o-sukcynylohomoserynę i sposób wytwarzania przy jego użyciu o-sukcynylohomoseryny
CN201480058107.XA CN105705636B (zh) 2013-10-23 2014-10-22 生产o-琥珀酰高丝氨酸的微生物和使用其生产o-琥珀酰高丝氨酸的方法
CN201910776927.7A CN110468168B (zh) 2013-10-23 2014-10-22 生产o-琥珀酰高丝氨酸的微生物和使用其生产o-琥珀酰高丝氨酸的方法
BR112016008952-9A BR112016008952B1 (pt) 2013-10-23 2014-10-22 Microrganismos para a produção de o-succinil homoserina e método para produção de o-succinil homoserina usando os mesmos
JP2016526088A JP6386552B2 (ja) 2013-10-23 2014-10-22 Ｏ−スクシニルホモセリンの生産のため微生物及びこれを用いたｏ−スクシニルホモセリンの生産方法
RU2016116166A RU2651519C2 (ru) 2013-10-23 2014-10-22 Микроорганизмы для получения о-сукцинилгомосерина и способ получения о-сукцинилгомосерина с использованием указанных микроорганизмов
ES14854918T ES2908323T3 (es) 2013-10-23 2014-10-22 Microorganismo para la producción de o-succinilhomoserina y un método para la producción de o-succinilhomoserina mediante el uso del mismo

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2013-0126612 2013-10-23
KR1020130126612A KR101555750B1 (ko) 2013-10-23 2013-10-23 O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법

Publications (1)

Publication Number Publication Date
WO2015060647A1 true WO2015060647A1 (ko) 2015-04-30

Family

ID=52993172

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/009967 WO2015060647A1 (ko) 2013-10-23 2014-10-22 O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법

Country Status (12)

Country Link
US (1) US10316339B2 (ko)
EP (1) EP3061812B1 (ko)
JP (1) JP6386552B2 (ko)
KR (1) KR101555750B1 (ko)
CN (2) CN105705636B (ko)
BR (1) BR112016008952B1 (ko)
ES (1) ES2908323T3 (ko)
HU (1) HUE057421T2 (ko)
MY (1) MY190539A (ko)
PL (1) PL3061812T3 (ko)
RU (2) RU2651519C2 (ko)
WO (1) WO2015060647A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108949661B (zh) * 2018-07-27 2021-06-08 浙江工业大学 一种产o-琥珀酰-l-高丝氨酸重组大肠杆菌及其应用
WO2024096123A1 (ja) * 2022-11-04 2024-05-10 株式会社バイオパレット 遺伝子が改変された微生物およびその生産方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100905381B1 (ko) 2006-07-28 2009-06-30 씨제이제일제당 (주) Ｌ-메치오닌 전구체 생산 균주 및 상기 ｌ-메치오닌전구체로부터의 ｌ-메치오닌 및 유기산의 생산방법
KR20090106365A (ko) * 2008-04-04 2009-10-08 씨제이제일제당 (주) Ｌ-메치오닌 전구체 생산 균주 및 이를 이용한 ｌ-메치오닌 전구체의 생산 방법
KR100966324B1 (ko) 2008-01-08 2010-06-28 씨제이제일제당 (주) 향상된 ｌ－쓰레오닌 생산능을 갖는 대장균 및 이를 이용한ｌ－쓰레오닌의 생산 방법

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10247437A1 (de) * 2002-10-11 2004-04-29 Consortium für elektrochemische Industrie GmbH Feedback-resistente Homoserin-Transsuccinylasen
DE10305774A1 (de) * 2003-02-06 2004-08-26 Consortium für elektrochemische Industrie GmbH Verfahren zur fermentativen Herstellung von L-Methionin
US7029893B2 (en) * 2003-02-28 2006-04-18 Ajinomoto Co., Inc. Polynucleotides encoding polypeptides involved in amino acid biosynthesis in methylophilus methylotrophus
WO2007011939A2 (en) * 2005-07-18 2007-01-25 Basf Ag Use of dimethyl disulfide for methionine production in microorganisms
ES2575906T3 (es) * 2007-04-11 2016-07-04 Cj Cheiljedang Corporation Composiciones y métodos de producir metionina
US7851180B2 (en) * 2008-04-04 2010-12-14 Cj Cheiljedang Corporation Microorganism producing L-methionine precursor and the method of producing L-methionine precursor using the microorganism
US8283152B2 (en) * 2009-08-28 2012-10-09 Cj Cheiljedang Corporation Microorganism producing O-acetyl-homoserine and the method of producing O-acetyl-homoserine using the microorganism

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100905381B1 (ko) 2006-07-28 2009-06-30 씨제이제일제당 (주) Ｌ-메치오닌 전구체 생산 균주 및 상기 ｌ-메치오닌전구체로부터의 ｌ-메치오닌 및 유기산의 생산방법
KR100966324B1 (ko) 2008-01-08 2010-06-28 씨제이제일제당 (주) 향상된 ｌ－쓰레오닌 생산능을 갖는 대장균 및 이를 이용한ｌ－쓰레오닌의 생산 방법
KR20090106365A (ko) * 2008-04-04 2009-10-08 씨제이제일제당 (주) Ｌ-메치오닌 전구체 생산 균주 및 이를 이용한 ｌ-메치오닌 전구체의 생산 방법

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
"Manual of Methods for General Bacteriology''", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
DATABASE PROTEIN [online] 18 May 2013 (2013-05-18), "homoserine O-acetyltransferase [Sideroxydans lithotrophicus", XP055334832, accession no. NCBI Database accession no. WP_013028177 *
JAMES M. LEE: "Biochemical Engineering", PRENTICE-HALL INTERNATIONAL EDITIONS, pages: 138 - 176
METHODS ENZYMOL., vol. 183, 1990, pages 63
PNAS, vol. 97, 2000, pages 6640 - 6645
See also references of EP3061812A4

Also Published As

Publication number Publication date
BR112016008952B1 (pt) 2023-11-14
MY190539A (en) 2022-04-27
HUE057421T2 (hu) 2022-05-28
ES2908323T3 (es) 2022-04-28
EP3061812B1 (en) 2022-01-19
EP3061812A1 (en) 2016-08-31
JP2016533731A (ja) 2016-11-04
CN105705636A (zh) 2016-06-22
US20160304919A1 (en) 2016-10-20
RU2016116166A (ru) 2017-12-01
EP3061812A4 (en) 2017-06-14
CN110468168B (zh) 2023-02-17
US10316339B2 (en) 2019-06-11
JP6386552B2 (ja) 2018-09-05
CN110468168A (zh) 2019-11-19
CN105705636B (zh) 2019-09-24
KR101555750B1 (ko) 2015-09-25
PL3061812T3 (pl) 2022-05-09
BR112016008952A2 (pt) 2017-09-19
KR20150046964A (ko) 2015-05-04
RU2757787C1 (ru) 2021-10-21
RU2651519C2 (ru) 2018-04-19

Similar Documents

Publication Publication Date Title
WO2016024771A1 (ko) O-포스포세린 생산 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인 생산 방법
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2014142463A1 (ko) L-발린 생산능이 향상된 균주 및 이를 이용한 l-발린 생산방법
WO2012099396A2 (en) A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same
WO2013105802A2 (ko) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2015186990A1 (ko) O-아세틸-호모세린을 생산하는 미생물 및 이를 이용하여 o-아세틸-호모세린을 생산하는 방법
WO2021112469A1 (ko) 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
WO2015064917A1 (ko) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신 생산방법
WO2017043915A1 (ko) 신규 ｏ-포스포세린 배출 단백질 변이체 및 이를 이용한 ｏ-포스포세린, 시스테인 및 이의 유도체의 생산방법
WO2013103246A2 (ko) 퀴놀린산을 생산하는 재조합 미생물 및 이를 이용한 퀴놀린산의 생산 방법
WO2014126384A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2014171747A1 (ko) L-트립토판 생산능을 갖는 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법
WO2015060647A1 (ko) O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법
WO2015060648A1 (ko) O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법
WO2015060649A1 (ko) O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법
WO2016195439A1 (ko) O-아세틸-호모세린을 생산하는 미생물 및 이를 이용하여 o-아세틸-호모세린을 생산하는 방법
WO2015186958A1 (ko) O-숙시닐호모세린 또는 숙신산의 생산능을 갖는 미생물 및 이를 이용한 숙신산 또는 o-숙시닐호모세린의 생산 방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2015156484A1 (ko) O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법
WO2016036209A1 (ko) L-쓰레오닌 생산능이 향상된 미생물 및 이를 이용한 l-쓰레오닌 생산방법
WO2016036191A1 (ko) L-라이신 생산능이 향상된 미생물 및 이를 이용한 l-라이신 생산방법
WO2016126006A1 (ko) 퀴놀린산 생산능을 가지는 미생물 및 이를 이용하여 퀴놀린산을 생산하는 방법
WO2022055192A1 (ko) 신규 o-포스포세린 배출 단백질 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14854918

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2016526088

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15031706

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016008952

Country of ref document: BR

REEP Request for entry into the european phase

Ref document number: 2014854918

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: IDP00201603222

Country of ref document: ID

Ref document number: 2014854918

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016116166

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112016008952

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160420