WO2022004953A1 - 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법 - Google Patents

아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법 Download PDF

Info

Publication number
WO2022004953A1
WO2022004953A1 PCT/KR2020/014539 KR2020014539W WO2022004953A1 WO 2022004953 A1 WO2022004953 A1 WO 2022004953A1 KR 2020014539 W KR2020014539 W KR 2020014539W WO 2022004953 A1 WO2022004953 A1 WO 2022004953A1
Authority
WO
WIPO (PCT)
Prior art keywords
acetoin
yeast
gene
dehydrogenase
gene encoding
Prior art date
Application number
PCT/KR2020/014539
Other languages
English (en)
French (fr)
Inventor
한지숙
배상정
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Publication of WO2022004953A1 publication Critical patent/WO2022004953A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26—Ketones

Definitions

  • the present invention relates to a genetically engineered yeast having acetoin-producing ability and a method for producing acetoin using the same.
  • Acetoin is a perfume with a buttery scent and is widely used in food, cosmetics, cigarettes, detergents, etc., as well as acts as an attractant of pests and can be used as an insect repellent. This acetoin is included in 30 platform chemicals that can be produced from biomass determined by the U.S. Department of Energy due to the advantages of being able to use it in a variety of ways and mass production.
  • Patent Document 1 Korean Patent Application No. 10-2016-0006582
  • Patent Document 2 Korean Patent Application No. 10-2015-0081821
  • the present inventors studied to develop a genetically engineered yeast that produces acetoin from glucose in high yield, and as a result, i) alcohol dehydrogenase, glycerol-3-phosphate dehydrogenase) and 2,3-butanediol dehydrogenase (2,3-butanediol dehydrogenase) activity is reduced, ii) acetolactate synthase, acetolactate decarboxylase and NADH
  • the present invention was completed by confirming that the activity of NADH oxidase is increased, and iii) EMP46, PEP7, SUR1 and/or HXK2 mutated yeast produces acetoin in high yield.
  • one aspect of the present invention compared to the parent strain, i) alcohol dehydrogenase (alcohol dehydrogenase), glycerol-3-phosphate dehydrogenase (glycerol-3-phosphate dehydrogenase) and 2,3-butane Diol dehydrogenase (2,3-butanediol dehydrogenase) activity is reduced, ii) acetolactate synthase, acetolactate decarboxylase (acetolactate decarboxylase) and NADH oxidase (NADH oxidase) activity is increased, and iii) any one selected from the group consisting of EMP46, PEP7, SUR1, HXK2 and combinations thereof is mutated, to provide a genetically engineered yeast.
  • alcohol dehydrogenase alcohol dehydrogenase
  • glycerol-3-phosphate dehydrogenase glycerol-3-phosphate dehydrogen
  • Another aspect of the present invention comprises the steps of: i) culturing the genetically engineered yeast; And ii) provides a method for producing acetoin comprising the step of obtaining acetoin produced from the yeast.
  • a gene encoding an alcohol dehydrogenase of wild-type yeast a gene encoding a glycerol-3-phosphate dehydrogenase, a gene encoding 2,3-butanediol dehydrogenase, and combinations thereof
  • a gene encoding an alcohol dehydrogenase of wild-type yeast a gene encoding a glycerol-3-phosphate dehydrogenase, a gene encoding 2,3-butanediol dehydrogenase, and combinations thereof
  • Deleting any one selected from the group consisting of ii) any one exogenous gene selected from the group consisting of a gene encoding acetolactate synthase, a gene encoding acetolactate decarboxylase, a gene encoding NADH oxidase, and combinations thereof; introducing; And iii) it provides a method for producing a yeast excellent in acetoin-producing ability, comprising the
  • Another aspect of the present invention provides a yeast excellent in acetoin-producing ability prepared by the above method.
  • Another aspect of the present invention i) culturing the yeast excellent in the acetoin-producing ability; And ii) provides a method for producing acetoin comprising the step of obtaining acetoin produced from the yeast.
  • the genetically engineered yeast having acetoin-producing ability and yeast having excellent acetoin-producing ability according to the present invention are i) ADH (alcohol dehydrogenase) gene, GPD (glycerol-3-phosphate dehydrogenase) gene, and BDH (2,3-butanediol) dehydrogenase) gene is deleted, ii) alsS gene, alsD gene and noxE gene are introduced, iii) EMP46, PEP7, SUR1 and HXK2 are mutated. Able to produce positive amounts of acetoin. Therefore, the genetically engineered yeast and evolved yeast having acetoin-producing ability according to the present invention can be usefully used to produce acetoin in high yield.
  • FIG. 1 is a diagram schematically showing an acetoin production pathway and a competitive pathway according to an embodiment.
  • FIG. 2 is a photograph taken of culturing the JHY902D strain and the JHY903 strain according to an embodiment in YPD medium or YPD medium containing acetoin at a concentration of 18 g/L.
  • Figure 3a is a graph showing the growth rate of the strain JHY902A, D1 to D3 strain, JHY902D strain and JHY903 strain according to an embodiment.
  • Figure 3b is a graph showing the glucose concentration in the culture of JHY902A strain, D1 to D3 strain, JHY902D strain and JHY903 strain according to an embodiment.
  • Figure 4 is a graph showing the production of acetoin and 2,3-butanediol of JHY902A strain, D1 to D3 strain, JHY902D strain and JHY903 strain according to an embodiment.
  • Figure 5a is a graph showing the growth rate of strains JHY903 and JHY903-1 to JHY903-9 according to an embodiment.
  • Figure 5b is a graph showing the glucose concentration in the culture solution of the strain JHY903 and JHY903-1 to JHY903-9 according to an embodiment.
  • FIG. 6 is a graph showing the production of acetoin and 2,3-butanediol of JHY903 strains and JHY903-1 to JHY903-9 strains according to an embodiment.
  • Figure 8a is a graph showing the growth rate of JHY903 strain, JHY903 [ARA1] strain and JHY903 [YPR1] strain according to an embodiment.
  • Figure 8b is a graph showing the glucose concentration in the culture of JHY903 strain, JHY903 [ARA1] strain and JHY903 [YPR1] strain in one embodiment.
  • Figure 9a is a graph showing the production of 2,3-butanediol of JHY903 strain, JHY903 [ARA1] strain and JHY903 [YPR1] strain according to an embodiment.
  • Figure 9b is a graph showing the production of acetoin in JHY903 strain, JHY903 [ARA1] strain and JHY903 [YPR1] strain according to an embodiment.
  • Figure 10a is a graph showing the growth rate of strain JHY903, strain JHY903-4, strain JHY903-45 and strain JHY903-459 according to an embodiment.
  • Figure 10b is a graph showing the glucose concentration in the culture of JHY903 strain, JHY903-4 strain, JHY903-45 strain and JHY903-459 strain according to an embodiment.
  • 11 is a graph showing the production of acetoin and 2,3-butanediol of JHY903 strain, JHY903-4 strain, JHY903-45 strain and JHY903-459 strain according to an embodiment.
  • One aspect of the present invention compared to the parent strain i) alcohol dehydrogenase (alcohol dehydrogenase), glycerol-3-phosphate dehydrogenase (glycerol-3-phosphate dehydrogenase) and 2,3-butanediol dehydrogenase (2,3) -butanediol dehydrogenase) activity is decreased, ii) acetolactate synthase, acetolactate decarboxylase and NADH oxidase activity are increased, iii) EMP46, Provided is a genetically engineered yeast in which any one selected from the group consisting of PEP7, SUR1, HXK2 and combinations thereof is mutated.
  • acetoin used in the present invention is used interchangeably with 3-hydroxybutanone or acetyl methyl carbinol, and the molecular formula of C 4 H 8 O 2 It may mean a compound having a.
  • the acetoin may include (R)-acetoin.
  • alcohol dehydrogenase may refer to an enzyme that promotes interconversion between alcohol and aldehyde or ketone by oxidation of NADH.
  • the alcohol dehydrogenase may include an enzyme having a similar activity, for example, ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7 or SFA1.
  • the alcohol dehydrogenase may be any one selected from the group consisting of ADH1, ADH2, ADH3, ADH4, ADH5, and combinations thereof.
  • the alcohol dehydrogenase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more of the amino acid sequence represented by SEQ ID NO: 99, 101, 103, 105, or 107 , at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% sequence homology.
  • glycerol-3-phosphate dehydrogenase used in the present invention may refer to an enzyme that promotes conversion to glycerol-3-phosphate (G3P).
  • G3P glycerol-3-phosphate
  • the glycerol-3-phosphate dehydrogenase may include an enzyme having a similar activity, even if the name of the enzyme is different, and may be any one selected from the group consisting of GPD1, GPD2, and combinations thereof.
  • the glycerol-3-phosphate dehydrogenase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% of the amino acid sequence represented by SEQ ID NO: 109 or 111 at least about 95%, at least about 97%, at least about 98%, or at least about 99% sequence homology.
  • homologous sequence having the same or similar activity to the given polynucleotide sequence is expressed as "% homology". For example, using standard software that calculates parameters such as score, identity and similarity, specifically BLAST 2.0, or by Southern hybridization experiments under defined stringent conditions. It can be confirmed by comparing, and the defined appropriate hybridization conditions can be determined by a method well known to those skilled in the art.
  • 2,3-butanediol dehydrogenase used in the present invention may refer to an enzyme that uses acetoin, NADH, and H + as substrates to produce 2,3-butanediol and NAD +, It belongs to the oxidoreductase family.
  • the 2,3-butanediol dehydrogenase may include an enzyme having a similar activity (eg, isoenzyme or homolog) even if the name of the enzyme is different, for example, BDH1, BDH2 from Saccharomyces cerevisiae, BDH99::67 from Paenibacillus polymyxa, Bacillus subtilis, Enterococcus faecium Enterococcus durans Mycobacteria It may be a 2,3-butanediol dehydrogenase derived from Mycobacterium sp. Lactobacillus lactis.
  • an enzyme having a similar activity eg, isoenzyme or homolog
  • the 2,3-butanediol dehydrogenase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% of the amino acid sequence represented by SEQ ID NO: 113. at least about 95%, at least about 97%, at least about 98%, or at least about 99% sequence homology.
  • the term "decrease in activity” means expressing a lower amount of an enzyme or polypeptide compared to the parent strain (eg, a non-genetically engineered strain or cell), or the activity of the enzyme or polypeptide is reduced. It may mean inactivated or inactivated (inactivation).
  • the strain with reduced activity may have a genetic modification that reduces the activity of one or more enzymes or polypeptides compared to a strain without the genetic modification.
  • Genetic modifications that reduce the activity of the enzyme or polypeptide include 1) deletion of a part or all of a gene encoding the enzyme or polypeptide, 2) modification of an expression control sequence to decrease expression of the gene, 3) the enzyme or Modification of the above gene sequence on the chromosome or 4) a combination thereof so that the activity of the polypeptide is weakened.
  • the method of deleting part or all of the gene encoding the enzyme or polypeptide may be performed by, for example, transforming a cassette for gene deletion into a parent strain using a Cre/loxP recombination system, and chromosomal insertion in yeast. It can be carried out by replacing a gene encoding an endogenous target protein in a chromosome with a gene or a marker gene in which some nucleic acid sequences are deleted through the vector.
  • the method of modifying the expression control sequence is performed by inducing mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of a nucleic acid sequence to further weaken the activity of the expression control sequence, or It can be carried out by replacing it with a nucleic acid sequence having activity.
  • the expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation.
  • the method of modifying the nucleotide sequence on the chromosome encoding the enzyme or polypeptide induces sequence mutation by deletion, insertion, non-conservative or conservative substitution of the nucleotide sequence to further weaken the activity of the protein, or a combination thereof. It can be carried out by changing the nucleotide sequence to have a weaker activity or by replacing it with a nucleotide sequence improved to have weaker activity.
  • a gene encoding alcohol dehydrogenase, a gene encoding glycerol-3-phosphate dehydrogenase, and a gene encoding 2,3-butanediol dehydrogenase may be deleted.
  • the gene encoding the alcohol dehydrogenase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% of the nucleotide sequence represented by SEQ ID NO: 100, 102, 104, 106, or 108 It may have at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% sequence homology.
  • the gene encoding the glycerol-3-phosphate dehydrogenase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about the nucleotide sequence represented by SEQ ID NO: 110 or 112. It may have 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more sequence homology.
  • the gene encoding the 2,3-butanediol dehydrogenase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about the nucleotide sequence represented by SEQ ID NO: 114. It may have 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more sequence homology.
  • the genes encoding the alcohol dehydrogenase include adh1 gene (SEQ ID NO: 100), adh2 gene (SEQ ID NO: 102), adh3 gene (SEQ ID NO: 104), adh4 gene (SEQ ID NO: 106), adh5 gene (SEQ ID NO: 108) And it may be any one selected from the group consisting of combinations thereof.
  • the gene encoding the glycerol-3-phosphate dehydrogenase may be any one selected from the group consisting of a gpd1 gene (SEQ ID NO: 110), a gpd2 gene (SEQ ID NO: 112), and combinations thereof.
  • the gene encoding the 2,3-butanediol dehydrogenase may be a bdh1 gene (SEQ ID NO: 114).
  • the yeast is selected from the group consisting of a gene encoding acetolactate synthase, a gene encoding acetolactate decarboxylase, a gene encoding NADH oxidase, and combinations thereof. gene) may be included.
  • acetolactate synthase used in the present invention is used interchangeably with acetohydroxy acid synthase (AHAS), and regulates the biosynthesis pathway of branched chain amino acids such as leucine, valine and isoleucine.
  • the enzyme it may be an enzyme that synthesizes one molecule of carbon dioxide and acetolactate from two molecules of pyruvic acid, respectively.
  • the acetolactate synthase may include an enzyme having a similar activity (eg, isoenzyme or homologue) even if the name of the enzyme is different, for example, by the alsS gene derived from Bacillus subtilis.
  • acetolactate synthase encoded by acetolactate synthase acetolactate synthase
  • acetolactate synthase I encoded by the ilvB gene or ilvN gene from E. coli acetolactate synthase II encoded by the ilvGMEDA gene from E. coli, or ilvI or ilvH from E. coli acetolactate synthase III encoded by the gene.
  • Saccharomyces cerevisiae In addition, in addition to Escherichia coli, Saccharomyces cerevisiae, anthrax (Bacillus anthracis), Haemophilus influenzae (Haemophilusinfluenzae), Salmonella typhimurium (Salmonella Typhimurium), Thermotaga maritima (Thermotogamaritima), Corynebacterium glue It may be an acetolactate synthase from Corynebacterium glutamicum, Mycobacterium tuberculosis, or Streptomyces cinnamonensis. Additionally, the plant-derived acetolactate synthase may be derived from Arabidopsisthhaliana, Gossypium hirsutum, Helianthus annuus, or Brassicanapus.
  • the acetolactate synthase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more of the amino acid sequence represented by SEQ ID NO: 32. % or greater, about 97% or greater, about 98% or greater, or about 99% or greater sequence homology.
  • acetolactate decarboxylase may refer to an enzyme that produces acetoin by removing carbon dioxide from acetolactate.
  • the acetolactate decarboxylase may include an enzyme having a similar activity (eg, isoenzyme or homologue) even if the name of the enzyme is different, for example, alsD from Bacillus subtilis, lacto aldB from Bacillus delbrueckii subsp. lactis, Brevibacillus brevis, Enterobacter aerogenes, Leuconostoc lactis, Saccharomyces cerevisiae It may be acetolactate decarboxylase from Staphylococcus aureus.
  • the acetolactate decarboxylase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about It may be a polypeptide having at least 95%, at least about 97%, at least about 98%, or at least about 99% sequence homology.
  • FIG. 1 is a diagram schematically showing an acetoin production pathway and a competitive pathway according to one embodiment.
  • the yeast has increased activities of acetolactate synthase and acetolactate decarboxylase compared to the parent strain, and thus can effectively produce acetoin.
  • the yeast in order to suppress the production of byproducts and further enhance the production of acetoin, the yeast may be one in which the competitive metabolic pathway of the acetoin production pathway is additionally blocked.
  • the competitive metabolic pathway may be an ethanol and glycerol synthesis metabolic pathway, as shown in FIG. 1 , and the competitive metabolic pathway may be achieved by reducing the activity of alcohol dehydrogenase or glycerol-3-phosphate dehydrogenase.
  • yeast generates 2 molecules of NADH by consuming 2 molecules of NAD+ while generating 2 molecules of pyruvic acid from glucose through glycolysis. Accordingly, NADH (excess) and NAD+ (shortage) phenomena may occur in the acetoin synthesis pathway.
  • the yeast may include an exogenous gene encoding NADH oxidase.
  • NADH oxidase used in the present invention may refer to an enzyme mediating a reaction for producing water and NAD+ using oxygen and NADH as substrates.
  • the NADH oxidase may include an enzyme having a similar activity (eg, isoenzyme or homologue) even if the name of the enzyme is different, for example, nox1, nox3, nox4, Lactococcus lactis-derived enzyme It may include noxE, and, in addition, Enterococcus genus, Lactobacillus genus, Disulfovibriosp. , Clostridium sp. It may be an NADH oxidase derived from Streptococcus genus.
  • NADH oxidase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more of the amino acid sequence represented by SEQ ID NO: 46. , at least about 97%, at least about 98%, or at least about 99% sequence homology.
  • the term “increase in activity” refers to the activity of a polypeptide or enzyme of the same type as compared to a polypeptide or enzyme not or possessed by the parent strain (eg, a non-genetically engineered strain or cell). It may mean to have a higher activity than this, or to express a higher amount of a polypeptide or enzyme of the same type.
  • the strain with increased activity may have a genetic modification that increases the activity of one or more enzymes or polypeptides compared to a strain without the genetic modification.
  • the genetic modification to increase the activity of the enzyme or polypeptide is 1) modification of the expression control sequence to increase the expression of the gene, 2) modification of the gene sequence on the chromosome to increase the activity of the enzyme or polypeptide, 3) the above It can be carried out using additionally introducing a gene encoding an enzyme or a polypeptide or 4) a combination thereof.
  • the acetolactate synthase may be encoded by the alsS gene, the alsS gene may be one comprising a nucleotide sequence shown in SEQ ID NO: 31.
  • the acetolactate dicarboxylate raised may be encoded by the gene alsD, alsD the gene may be one comprising a nucleotide sequence shown in SEQ ID NO: 33.
  • the NADH oxidase may be encoded by the gene noxE, noxE the gene may be the one that includes the nucleotide sequence shown in SEQ ID NO: 45.
  • the term “exogenous” may mean that a referenced molecule or referenced activity is introduced into a host cell.
  • the molecule may be introduced, for example, as non-chromosomal genetic material such as a plasmid or introduction of an encoding nucleic acid into host genetic material, such as by insertion into a host chromosome.
  • the term “exogenous” indicates that the encoding nucleic acid has been introduced into an organism in an expressible form.
  • the term “exogenous” refers to an activity introduced into a host parent cell.
  • the exogenous gene may be expressed in an amount sufficient to increase the activity of the mentioned enzyme compared to the parent strain in the yeast.
  • Homologs of the exogenous gene encoding acetolactate synthase, the exogenous gene encoding acetolactate decarboxylase, and the exogenous gene encoding NADH oxidase are derived from different microorganisms, but the proteins they encode It may refer to a gene encoding a protein exhibiting an activity similar to
  • the exogenous gene encoding the acetolactate synthase has about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more of the amino acid sequence represented by SEQ ID NO: 32. , which encodes an amino acid sequence having sequence homology of about 95% or more, about 97% or more, about 98% or more, or about 99% or more.
  • the exogenous gene encoding the acetolactate synthase has about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% of the base sequence represented by SEQ ID NO: 31, respectively. It may have sequence homology of at least about 95%, at least about 97%, at least about 98%, or at least about 99%.
  • the exogenous gene encoding the exogenous gene encoding the acetolactate decarboxylase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% of the amino acid sequence represented by SEQ ID NO: 34, respectively. % or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more of sequence homology.
  • the exogenous gene encoding the exogenous gene encoding the acetolactate decarboxylase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% of the nucleotide sequence represented by SEQ ID NO: 33, respectively. % or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more sequence homology.
  • the exogenous gene encoding the NADH oxidase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about It may encode an amino acid sequence having at least 95%, at least about 97%, at least about 98%, or at least about 99% sequence homology.
  • the exogenous gene encoding the NADH oxidase is about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, It may have about 95% or more, about 97% or more, about 98% or more, or about 99% or more sequence homology.
  • exogenous genes may be changed to sequences having codons that are suitable for expression in microorganisms, or sequences having optimized codons. This codon change may be appropriately made within a range in which the amino acid sequence of the protein does not change.
  • the exogenous gene may be introduced into the parent strain through an expression vector.
  • the exogenous gene may be introduced into the parent strain in the form of a linear polynucleotide.
  • the exogenous gene may be expressed from an expression vector (eg, a plasmid) in a strain.
  • the exogenous gene may be expressed by being inserted into a genetic material (eg, a chromosome) in a strain for stable expression.
  • the vector may include an origin of replication, a promoter, a gene encoding the enzyme, and a terminator.
  • the replication initiation point may include a yeast autonomous replication sequence (ARS).
  • the yeast self-replicating sequence may be stabilized by a yeast centromeric sequence (CEN).
  • the promoter may be selected from the group consisting of a TDH3 promoter, a TEF promoter, and a FBA1 promoter.
  • the terminator may be selected from the group consisting of CYC1, GPM1, and FBA1.
  • the vector may further include a selection marker.
  • the yeast may include a single gene, a plurality of genes, for example, 2 to 10 copy numbers.
  • the yeast is, for example, 1 to 10, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 to 10, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, or 2 to 3 copies of the gene encoding the enzyme.
  • each gene may be a copy of the same gene or may include copies of two or more different genes.
  • the plurality of copies of the exogenous gene may be comprised at the same locus, or at multiple loci, within the genome of the host cell.
  • EMP46 is a protein involved in glycoprotein secretion, nuclear structure, and gene silencing, and may have a sequence disclosed in NCBI Reference Sequence: NC_001144.5.
  • the EMP46 may have an amino acid sequence represented by SEQ ID NO: 115.
  • the EMP46 may be encoded by the nucleotide sequence represented by SEQ ID NO: 116.
  • the EMP46 mutation may be one in which leucine, which is the 160th amino acid in the amino acid sequence shown in SEQ ID NO: 115, is substituted with phenylalanine.
  • the EMP46 mutation may be one in which guanine, which is the 480th base, of the nucleotide sequence shown in SEQ ID NO: 116 is substituted with thymine.
  • the term "PEP7” refers to a protein involved in vacuole separation and liquid protein secretion, and may have a sequence disclosed in NCBI Reference Sequence: NC_001136.10.
  • the PEP7 may have an amino acid sequence represented by SEQ ID NO: 117.
  • the PEP7 may be encoded by the nucleotide sequence shown in SEQ ID NO: 118.
  • the PEP7 mutation may be one in which glutamine, which is the 169th amino acid in the amino acid sequence shown in SEQ ID NO: 117, is substituted with lysine.
  • the PEP7 mutation may be one in which cytosine (cytosine), which is the 505th base in the nucleotide sequence shown in SEQ ID NO: 118, is substituted with adenine.
  • the term "SUR1" used in the present invention is a protein involved in the synthesis of mannosyl phosphoryl inositol ceramide, and catalyzes the reaction of adding mannosyl to phosphoryl inositol ceramide.
  • the SUR1 may have a sequence disclosed in NCBI Reference Sequence: NC_001148.4.
  • the SUR1 may have an amino acid sequence represented by SEQ ID NO: 119.
  • the SUR1 may be encoded by the nucleotide sequence shown in SEQ ID NO: 120.
  • the SUR1 mutation may be one in which histidine, which is the 176th amino acid in the amino acid sequence shown in SEQ ID NO: 119, is substituted with tyrosine.
  • the SUR1 mutation may be one in which cytosine, which is the 526th base in the nucleotide sequence shown in SEQ ID NO: 120, is substituted with thymine.
  • HXK2 refers to a reaction in which phosphorylation of hexoses such as D-glucose and D-fructose is phosphorylated into hexose 6-phosphate (D-glucose 6-phosphate and D-fructose 6-phosphate, respectively).
  • the protein involved it may be one having the sequence disclosed in NCBI Reference Sequence: NC_001139.9.
  • the HXK2 may have an amino acid sequence represented by SEQ ID NO: 121.
  • the HXK2 may be encoded by the nucleotide sequence shown in SEQ ID NO: 122.
  • the HXK2 mutation may be one in which guanine, which is the 754th base among the base sequence shown in SEQ ID NO: 122, is substituted with thymine.
  • the yeast is Saccharomyces ( Saccharomyces ), Kluyveromyces ( Kluyveromyces ), Pichia ( Pichia ), Hansenula ( Hansenula ), Zygosaccharomyces ( Zygosaccharomyce s ) or Candida ( Candida ) It may be a genus strain . In addition, the yeast may be a Saccharomyces genus strain.
  • the Saccharomyces sp. strain is Saccharomyces cerevisiae ( S. scerevisiae ), Saccharomyces bayanus ( S. bayanus ), Saccharomyces paradoxus ( S.
  • Saccharomyces It may be a non-catheter (S. mikatae), and a saccharide as MY-ku laundry process Havre swallow any one selected from the group consisting of (S. kudriavzevii).
  • the yeast is arabinose dehydrogenase (ARA1), NADP-dependent aldo-keto reductase (NADPH-dependent aldo-keto reductase, YPR1), NADP-dependent 3-hydroxy acid dehydrogenase (NADP-dependent 3-
  • ARA1 arabinose dehydrogenase
  • NADPH-dependent aldo-keto reductase NADP-dependent aldo-keto reductase
  • YPR1 NADP-dependent 3-hydroxy acid dehydrogenase
  • NADP-dependent 3- NADP-dependent 3-hydroxy acid dehydrogenase
  • the yeast is selected from the group consisting of a gene encoding arabinose dehydrogenase, a gene encoding NADP-dependent aldo-kedo reductase, a gene encoding NADP-dependent 3-hydroxy acid dehydrogenase, and combinations thereof. Any one selected may be deleted.
  • arabinose dehydrogenase used in the present invention may mean an enzyme involved in the oxidation catalyst of D-arabinose, L-xylose, L-fucose and L-galactose in the presence of NADP+, for example, it may be ARA1.
  • the arabinose dehydrogenase may have a sequence described in NCBI Reference Sequence: NC_001134.8.
  • the arabinose dehydrogenase is It may be one encoded by the ara1 gene including the nucleotide sequence represented by SEQ ID NO: 124.
  • NADP-dependent aldo-kedo reductase is an enzyme capable of reducing various substrates including 2-methylbutylaldehyde, and can be rapidly induced by osmotic and oxidative stress.
  • the NADP-dependent aldo-kedo reductase may be GTR3, YJR096W or YPR1.
  • the NADP-dependent aldo-kedo reductase may have the sequence described in NCBI Reference Sequence: NC_001136.10.
  • the NADP-dependent aldo-kedo reductase is It may be one encoded by the ypr1 gene including the nucleotide sequence represented by SEQ ID NO: 126.
  • NADP-dependent 3-hydroxy acid dehydrogenase used in the present invention may be a NADP-dependent dehydrogenase having a broad substrate specificity acting on 3-hydroxy acids, for example, NRE1, IRC24, It may be ENV9 or YMR226C.
  • the NADP-dependent 3-hydroxy acid dehydrogenase may have a sequence described in NCBI Reference Sequence: NC_001145.3.
  • the NADP-dependent 3-hydroxy acid dehydrogenase may be encoded by the ymr226c gene including the nucleotide sequence shown in SEQ ID NO: 128.
  • Another aspect of the present invention comprises the steps of: i) culturing the genetically engineered yeast; And ii) provides a method for producing acetoin comprising the step of obtaining acetoin produced from the yeast.
  • the term "cultivation" used in the present invention may mean a series of actions of growing the yeast in an appropriately artificially controlled environmental condition in order to produce acetoin from the yeast.
  • the method of culturing the cells in the present invention can be performed using a method widely known in the art. Specifically, the culture may be continuously cultured in a batch process or injection batch or repeated fed batch process.
  • the medium used for culture may include one or more substrates that can be metabolized to acetoin, for example, in a conventional medium containing a suitable carbon source, nitrogen source, amino acid, vitamin, etc. under aerobic conditions at temperature, pH It is necessary to meet the requirements of a particular strain in an appropriate way while adjusting the etc.
  • glucose is used as the main carbon source
  • sugars and carbohydrates such as xylose, sucrose, lactose, fructose, maltose, starch, cellulose, soybean oil, sunflower oil, castor oil, coconut oil, etc.
  • Oils and fats, fatty acids such as palmitic acid, stearic acid and linoleic acid, alcohols such as glycerol, ethanol, and organic acids such as acetic acid may be included.
  • the culture may be characterized by culturing yeast in the presence of glucose.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation products, defatted soybean cake or its degradation products, etc. can These nitrogen sources may be used alone or in combination.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydroly
  • the medium may contain monopotassium phosphate, dipotassium phosphate and the corresponding sodium-containing salt as phosphorus.
  • the phosphorus that may be used includes potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salt.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used as the inorganic compound.
  • essential growth substances such as amino acids and vitamins can be used.
  • yeast can be grown in a suitable medium at a temperature ranging from about 20°C to about 37°C.
  • the growth medium is, for example, a broth containing yeast nitrogen base, ammonium sulfate, and dextrose as a carbon/energy source, or most strains of Saccharomyces cerevisiae. It may be a commercially prepared conventional medium such as YPD medium in which peptone, yeast extract and dextrose are blended in an optimal ratio for growth.
  • Other defined or synthetic growth media may be used, and media suitable for the growth of specific microorganisms are known to those skilled in the art of microbiology or fermentation science.
  • Acetoin produced by the yeast can be isolated from the culture medium using a method known in the art. This separation method may be centrifugation, filtration, ion exchange chromatography or crystallization. For example, the culture may be centrifuged at low speed to remove biomass, and the obtained supernatant may be separated through ion exchange chromatography.
  • a gene encoding an alcohol dehydrogenase of wild-type yeast a gene encoding a glycerol-3-phosphate dehydrogenase, a gene encoding 2,3-butanediol dehydrogenase, and combinations thereof Deleting any one selected from the group consisting of; ii) introducing any one exogenous gene selected from the group consisting of a gene encoding acetolactate synthase, a gene encoding acetolactate decarboxylase, a gene encoding NADH oxidase, and combinations thereof; And iii) it provides a method for producing a yeast excellent in acetoin-producing ability comprising the step of culturing the yeast at least 15 times in an acetoin-added medium.
  • step i) the gene encoding the wild-type yeast alcohol dehydrogenase, the gene encoding the glycerol-3-phosphate dehydrogenase and the gene encoding the 2,3-butanediol dehydrogenase are deleted. and a gene encoding acetolactate synthase, a gene encoding acetolactate decarboxylase, and a gene encoding NADH oxidase may be introduced in step ii).
  • the gene encoding the alcohol dehydrogenase, the gene encoding the glycerol-3-phosphate dehydrogenase and the gene encoding the 2,3-butanediol dehydrogenase and the method for deleting them are the same as described above in the genetically engineered yeast. do.
  • the medium to which acetoin is added may be characterized in that at least 4 g/L of acetoin is added.
  • the acetoin-added medium may be gradually increased from a concentration of 4 g/L to a concentration of 16.5 g/L.
  • exogenous gene encoding acetolactate synthase, the exogenous gene encoding acetolactate decarboxylase and the exogenous gene encoding NADH oxidase and the method for introducing them are the same as described above in the genetically engineered yeast.
  • the number of passages in step ii) may be at least 15 times or more, preferably, the number of passages in step ii) is 15 times, 17 times, 19 times, 21 times, 23 times, 25 times, 27 times, or 29 or more.
  • the gene encoding alcohol dehydrogenase, the gene encoding glycerol-3-phosphate dehydrogenase and the gene encoding 2,3-butanediol dehydrogenase are deleted in yeast (JHY605) After introducing an exogenous gene encoding acetolactate synthase, an exogenous gene encoding acetolactate decarboxylase and an exogenous gene encoding NADH oxidase, it was transferred to a medium supplemented with acetoin at a concentration of 4 g/L. When the OD value becomes about 1.0 at a wavelength of 600 nm by culturing at 37 ° C.
  • the step of subculturing the yeast strain can be repeated 19 times or more.
  • the acetoin-added medium may be gradually increased from a concentration of 4 g/L to a concentration of 16.5 g/L.
  • the yeast consists of a gene encoding arabinose dehydrogenase, a gene encoding NADP-dependent aldo-kedo reductase, a gene encoding NADP-dependent 3-hydroxy acid dehydrogenase, and combinations thereof. It may further comprise the step of deleting any one selected from the group.
  • a gene encoding an arabinose dehydrogenase, a gene encoding a NADP-dependent aldo-kedo reductase, a gene encoding a NADP-dependent 3-hydroxy acid dehydrogenase, and a method for deleting them are described above in genetically engineered yeast. same as bar
  • Another aspect of the present invention provides a yeast excellent in acetoin-producing ability prepared by the above method.
  • Another aspect of the present invention i) culturing the yeast excellent in the acetoin-producing ability; And ii) provides a method for producing acetoin comprising the step of obtaining acetoin produced from the yeast.
  • the culture method and the method for obtaining acetoin are the same as those described above in the method for producing acetoin using genetically engineered yeast.
  • S. cerevisiae produces ethanol as a major metabolite, and the genes involved in this are six alcohol dehydrogenases (ADH1, ADH2, ADH3, ADH4, ADH5, SFA1) using NADH as a cofactor and alcohol dehydrogenase using NADPH. (ADH6, ADH7) has been reported to exist.
  • ADH6, ADH7 has been reported to exist.
  • adh1, adh2, adh3, adh4 and adh5 genes are removed to reduce the production of ethanol, a major metabolite, a cofactor imbalance occurs. It is produced as a major metabolite.
  • acetoin is converted to 2,3-butanediol by 2,3-butanediol dehydrogenase (BDH1).
  • strains prepared through adaptive evolution and transformation using strains deficient in the dehydrogenase, glycerol-3-phosphate dehydrogenase, and 2,3-butanediol dehydrogenase are summarized in Table 1 below.
  • Example 1 Construction of S. cerevisiae strain (JHY605) in which adh genes (adh1, adh2, adh3, adh4, adh5) and gpd genes (gpd1, gpd2) are deleted
  • S. cerevisiae strains lacking adh genes ( adh1, adh2, adh3, adh4, adh5 ) and gpd genes ( gpd1, gpd2 ) were prepared using the Cre/loxP recombination system.
  • the cassette for gene deletion was PCR using pUG27 (plasmid containing loxP-his5+-loxP deletion cassette, Euroscarf, Germany) or pUG72 (plasmid containing loxP-URA3-loxP deletion cassette, Euroscarf, Germany) plasmid as a template obtained through amplification.
  • SEQ ID NOs: 1 and 2 adh1
  • SEQ ID NOs: 3 and 4 adh2
  • SEQ ID NOs: 5 and 6 adh3
  • SEQ ID NOs: 7 and 8 adh 4
  • SEQ ID NO: Combinations of 9 and 10 (adh5)
  • SEQ ID NOs: 11 and 12 gpd1
  • SEQ ID NOs: 13 and 14 gpd2
  • S. cerevisiae strain CEN Deleting adh genes ( adh1, adh2, adh3, adh4, adh5 ) and gpd genes ( gpd1, gpd2 ) in PK2-1C ( MATaura3-52trp1-289 leu2-3,112 his3 ⁇ 1 MAL2-8C SUC2 ) (Euroscarf, Germany)
  • the cassette for the gene deletion was introduced using a chemical transformation method using lithium acetate.
  • the transformed S. cerevisiae strain was cultured in SC medium (20 g/L glucose, 6.7 g/L YNB, appropriate amino acid addition), and S. cerevisiae strains lacking each gene were selected.
  • SEQ ID NOs: 15 and 16 ( adh1 ), SEQ ID NOs: 17 and 18 ( adh2 ), SEQ ID NOs: 19 and 20 ( adh3 ), SEQ ID NOs: 21 and 22 ( adh4 ), SEQ ID NOs: 23 and 24 ( adh5 ), SEQ ID NOs: 25 and 26 ( gpd1 ), and SEQ ID NOs: 27 and 28 ( gpd2 ) were used to confirm the deletion of the gene.
  • pSH63 TRP1, Cre recombinase
  • Cre recombinase expressing Cre recombinase to remove the selectable markers carried by the S. cerevisiae strain lacking the adh genes ( adh1, adh2, adh3, adh4, adh5 ) and gpd genes ( gpd1, gpd2) Under the control of GAL1 promoter, Euroscarf, Germany), adh gene ( adh1, adh2, adh3, adh4, adh5 ) and gpd gene ( gpd1, gpd2 ) from which the selectable marker gene was removed S.
  • the strain was named "JHY605" strain (CEN.PK2-1C adh1 ⁇ ::loxP adh2 ⁇ ::loxP adh3 ⁇ ::loxP adh4 ⁇ ::loxP adh5 ⁇ ::loxP gpd1 ⁇ ::loxP gpd2 ⁇ ::loxP ) did
  • Example 2 S. cerevisiae strain (JHY901) in which adh genes (adh1, adh2, adh3, adh4, adh5), gpd genes (gpd1, gpd2) and BDH gene (bdh1) are deleted
  • a JHY901 strain in which the bdh1 gene was deleted was prepared.
  • the JHY901 strain was produced using the Cre/loxp recombination system and was performed in the same manner as in Example 1.
  • the cassette for the bdh1 gene deletion was obtained through PCR amplification using the pUG27 plasmid as a template, and a combination of SEQ ID NOs: 29 and 30 was used as a primer set for the production of the bdh1 gene deletion cassette.
  • Example 3 S. cerevisiae strain (JHY902A) in which adh genes (adh1, adh2, adh3, adh4, adh5), gpd genes (gpd1, gpd2) and bdh gene (bdh1) are deleted and alsD, alsD and noxE genes are introduced / JHY902D) production
  • alsS base sequence of SEQ ID NO: 31, amino acid sequence of SEQ ID NO: 32
  • acetolactate decarboxylase derived from Bacillus subtilis alsD
  • the nucleotide sequence of SEQ ID NO: 33 and the amino acid sequence of SEQ ID NO: 34 were used, respectively.
  • the alsS gene and the alsD gene were obtained through PCR (alsS gene: primer sets of SEQ ID NOs: 35 and 36, alsD gene: primer sets of SEQ ID NOs: 37 and 38) using Bacillus subtilis genomic DNA as a template.
  • Lactococcus lactis-derived noxE gene (base sequence of SEQ ID NO: 45, amino acid sequence of SEQ ID NO: 46) was used.
  • the noxE gene was obtained through PCR (primer sets of SEQ ID NOs: 47 and 48) using the genomic DNA of Lactococcus lactis as a template.
  • ADH2-1 upper 301 bp, SEQ ID NO: 129
  • ADH2-2 lower 302 bp, SEQ ID NO: 130
  • YARCdelta4 of the ADH2 gene YARCdelta4-1 (167 bp, sequence No.
  • YARCdelta4-2 (170 bp, SEQ ID NO: 132) using S. cerevisiae genomic DNA as a template, PCR (upper 302 bp: primer set of SEQ ID NOs: 133 and 134, lower 301 bp: SEQ ID NO: 135 and 136 primer set)
  • YARCdelta4-1 primer set of SEQ ID NOs: 137 and 138
  • YARCdelta4-2 primer set of SEQ ID NO: 139 and 140.
  • TDH3 promoter SEQ ID NO: 39
  • TEF1 promoter SEQ ID NO: 40
  • CYC1 terminator SEQ ID NO: 41
  • GPM1 terminator SEQ ID NO: 42
  • TDH3 promoter and TEF1 promoter were obtained by treating p414GPD and p414TEF vectors (Mumberg et al., 1995) with SacI and SpeI restriction enzymes, respectively.
  • the GPM1 terminator was obtained through PCR (GPM1 terminator: primer sets of SEQ ID NOs: 43 and 44) using S. cerevisiae genomic DNA as a template.
  • the obtained promoter fragment was cloned using SacI and SpeI restriction enzymes, and the terminator fragment was cloned using XhoI and KpnI restriction enzymes.
  • the FBA1 promoter SEQ ID NO: 49
  • the FBA1 terminator SEQ ID NO: 50
  • the FBA1 promoter and terminator were obtained through PCR (promoter: primer sets of SEQ ID NOs: 51 and 52, terminator: primer sets of SEQ ID NOs: 53 and 54) using S. cerevisiae genomic DNA as a template.
  • the alsS gene and the noxE and alsD genes were cloned using BamHI and XhoI restriction enzymes, and the resulting vectors were respectively p414_P TDH3 - alsS -T CYC1 , p414 _P TEF1 - alsD -T GPM1 and p414_P FBA1 - noxE -T It was designated as FBA1.
  • PCR product having a 'promoter-gene-terminator' using the primer sets of SEQ ID NOs: 55 and 56 using the three types of vectors cloned above as templates, respectively got This PCR product has an MluI restriction enzyme sequence at the 5' end and an AscI-NotI-MluI sequence at the 3' end.
  • the p413G plasmid vector ( HIS3 , P TDH3, T CYC1 ) (Mumberg et al., 1995) was treated with BssHII restriction enzyme, and the PCR product P TEF1 - alsD- T GPM1 was treated with MluI restriction enzyme and cloned into p413-D vector. was obtained.
  • PCR products including the ampicillin resistance gene (Amp R) and bacterial replication origin (pUG ori) from 413GPD and ADH2-1 (or YARCdelta4-1), ADH2-2 (or YARCdelta4-2) was ligated through overlap PCR (a total of three fragments) and inserted into p413-D vector treated with SacI and NotI restriction enzymes.
  • the vector AscI and NotI restriction enzyme sites and the MluI and NotI restriction enzyme sites of the PCR product were used.
  • the acetoin-related gene insertion cassette I consisting of the alsS gene, the alsD gene and the noxE gene in the defective adh2 locus of the JHY901 strain prepared in Example 2 was obtained from the ADH2-SDN plasmid by treatment with SwaI restriction enzyme and then transformed and the HIS3 selection marker was removed using pSH63 expressing Cre recombinase to prepare JHY902A strain.
  • the JHY902A strain cell growth and glucose uptake inhibition were observed, which was caused by the accumulation of acetaldehyde in cells due to the lack of expression of acetolactate decarboxylase (alsS), which competes with pyruvate decarboxylase. was observed to be
  • the alsS gene, alsD gene and noxE with delta sequences added to both ends of the cassette Acetoin-related gene insertion cassette II containing the gene was obtained from Delta-SDN plasmid by treatment with SwaI restriction enzyme, and then transformed into JHY901 strain. After randomly selecting four transformants (D1-D4), the HIS3 selection marker was removed using pSH63 expressing Cre recombinase. As a result, it was confirmed that cell growth and glucose uptake inhibition were recovered in the D4 strain, and this strain was named "JHY902D”.
  • the JHY902D strain prepared in Example 3 was subcultured 19 consecutive times in YPD medium in which the acetoin concentration was gradually increased from the 4 g/L concentration to the 16.5 g/L concentration, and the resistance to acetoin and the acetoin-producing ability were The enhanced JHY903 strain was selected. Thereafter, the JHY902D strain and the JHY903 strain were cultured in YPD medium and YPD medium supplemented with 18 g/L of acetoin, respectively, to confirm the growth level.
  • the resistance to acetoin and the acetoin-producing ability of the JHY903 strain and the JHY902A strain, D1 to D3 strain and JHY902D strain prepared in Example 3 were compared.
  • the acetoin production medium is YPD5 (50 g/L glucose, 10 g/L yeast extract, 20 g/L bacto-peptone) or YPD10 (100 g/L glucose, 10 g/L yeast extract, 20 g/L bacto). -peptone) was used.
  • Cell culture was performed at 30° C. at 170 rpm using a shaker incubator.
  • the resistance to the acetoin was confirmed by measuring the cell concentration in the acetoin production medium in which the acetoin concentration was increased over time, and the production of metabolites including the acetoin was confirmed through the following method.
  • 800 ⁇ l of the culture solution of each strain was centrifuged to obtain a supernatant, which was filtered through a 0.22 ⁇ m filter to perform HPLC analysis.
  • UltiMate 3000 HPLC system Thermo fishers scientific
  • a BioRad Aminex HPX-87H column and a refractive index detector (RI detector) were used.
  • As the mobile phase 5 mM sulfuric acid was used, the flow rate was 0.6 ml/min, and the temperature was set to 60°C.
  • the cell concentration and glucose consumption of the JHY902D strain and the JHY903 strain were significantly increased than that of the JHY902A strain and the D1 to D3 strains.
  • the cell concentration of the JHY903 strain was increased more than 2 times than that of the JHY902A strain and the D1 to D3 strains.
  • the genome of the adapted-evolved JHY903 strain selected in Example 4 was requested to Macrogen and the nucleotide sequence was analyzed. As a result, it was confirmed that a total of four genes in the genome were mutated, and information on the mutated genes is shown in Table 3 below.
  • JHY903 strain produced R-acetoin type as a major acetoin stereoisomer by two enzymes (AlsS, AlsD) reaction.
  • AlsS, AlsD two enzymes
  • BDH1 2,3-butanediol dehydrogenase
  • ARA1 arabinose dehydrogenase
  • S red alcohol reductase activity
  • the bdh2 gene, the gre3 gene , the yjr096w gene, the ara1 gene, the ypr1 gene , the nre1 gene, the irc24 gene, the env9 gene or the ymr226c gene were further deleted in the JHY903 strain.
  • a Coex413-Cas9-target gene gRNA plasmid was used as the CRISPR/Cas9 system.
  • the Coex413-Cas9-target gene gRNA plasmid was performed in the same manner as in Example 3 for preparing the p413-SDN plasmid, and in this case, the primer sets described in Table 4 below were used for each defective gene.
  • ARA1 target gRNA F TACGAATGGCTCTGTCTCGT GTTTTAGAGCTAGAAATAGC 57
  • ARA1 target gRNA R ACGAGACAGAGCCATTCGTA GATCATTTATTCTTTCACTGC 58
  • BDH2 target gRNA F AAGGTAGTTGTCGAGCCCAC GTTTTAGAGCTAGAAATAGC 59
  • BDH2 target gRNA R GTGGGCTCGACAACTACCTT GATCATTTATTCTTTCACTGC 60
  • YPR1 target gRNA R GTCTTTGGCAACTCTTGCAT GATCATTTATTCTTTCACTGC 62
  • GRE3 target gRNA R CGGGCTTGATTCTACAACCA GATCATTTATTCTTTCACTGCG 64 Y
  • the used Coex413-Cas9-target gene gRNA plasmid was removed by culturing in YPD medium for about 18 hours.
  • the further deficient JHY903-1 to JHY903-9 strains were cultured in YPD (50 g/L glucose, 10 g/L yeast extract, 20 g/L bacto-peptone).
  • YPD 50 g/L glucose, 10 g/L yeast extract, 20 g/L bacto-peptone.
  • SC-HWU medium with amino acids added except for 20 g/L glucose, 6.7 g/L YNB, histidine, tryptophan, and uracil.
  • Cell concentration, acetoin production and 2,3-butanediol production were measured in the same manner as in Example 4.
  • the JHY903-1 to JHY903-9 strains the cell concentrations of the JHY903-2 strain and the JHY903-6 strain were reduced compared to the JHY903 strain, and there was no significant difference in glucose uptake ( FIGS. 5A and 5B ).
  • each protein tagged with His 6 at the C-terminus was purified through Ni-NTA system, followed by race Mixed acetoin (3R/S-acetoin) and cofactors (NADH or NADPH) were added and reacted, and then the reactants were analyzed.
  • YPR1 with His 6 attached to the C-terminus or pET-YPR1-His and pET-YMR226C-His plasmids loaded with genes encoding YMR226C enzymes were prepared, and PscI and NotI
  • a pET-ARA1-His plasmid was prepared by binding the ARA1 gene treated with a restriction enzyme of
  • E. coli transformed with each of the pET-ARA1-His, pET-YPR1-His and pET-YMR226C-His plasmids were inoculated into LB medium containing 30 ⁇ g/ml kanamycin and 20 ⁇ g/ml chloramphenicol and then OD at 37°C. Incubate until 600 values reached 0.8-1.0. Protein expression was induced by incubation at 30° C. for 5 hours after addition of 1 mM IPTG.
  • a binding buffer containing 0.1% protease inhibitor cocktail and 1 mM PMSF (phenylmethylsulfonyl fluoride) 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 5 mM imidazole, 0.1 mM EDTA
  • PMSF phenylmethylsulfonyl fluoride
  • Ni-NTA resin was washed with a wash buffer (40 mM Tris-HCl (pH 8.0), 500 mM NaCl, 50 mM imidazole, 0.1 mM EDTA) and loaded onto an Econo-Pac® chromatography column. After each enzyme was eluted using an elution buffer (50 mM Tris-HCl (pH 8.0), 50 mM NaCl, 300 mM imidazole, 0.1 mM EDTA), protein purity was confirmed using 1.2% SDS-PAGE. After confirming the purity, only parts with high purity were collected and buffer exchange was performed with the reaction buffer using a Microcon-30kDa Centrifugal Filter Unit.
  • a wash buffer 40 mM Tris-HCl (pH 8.0), 500 mM NaCl, 50 mM imidazole, 0.1 mM EDTA
  • an elution buffer 50 mM Tris-HCl (pH 8.0), 50 m
  • FID 275° C.
  • 450-GC Bruker
  • helium carrier gases
  • ARA1, YPR1, and YMR226C enzymes convert acetoin to 2,3-butanediol (FIG. 7).
  • S,S-2,3-butanediol and meso-2,3-butanediol were produced from racemic acetoin, which It means that it has (S)-stereospecific alcohol-forming reductase activity for acetoin.
  • the YPR1 enzyme had high stereoselectivity for 3R-acetoin.
  • the YMR226C enzyme had (S)-alcohol-forming reductase activity as well as (R)-alcohol-forming reductase activity and high stereoselectivity for 3S-acetoin.
  • ARA1 enzyme and YPR1 enzyme used both NADH and NADPH as coenzymes, but YMR226C enzyme reduced acetoin to 2,3-butanediol by selectively using only NADPH.
  • Example 8 Metabolite-producing ability of strains overexpressed with arabinose dehydrogenase (ARA1) or NADP-dependent aldo-kedo reductase (YPR1)
  • Example 7 when the ARA1 enzyme and the YPR1 enzyme, each of which confirmed the reduction effect of 2,3-butanediol, were overexpressed in the JHY903 strain, to determine whether the production of meso-2,3-butanediol was increased, ARA1 After the enzyme and YPR1 enzyme were overexpressed in the JHY903 strain, respectively, the cell concentration, acetoin production and 2,3-butanediol production of the strain were measured in the same manner as in Example 4.
  • each gene was secured using the primers shown in Table 7 below. Thereafter, the ARA1 gene treated with NheI and BamHI restriction enzymes was ligated to the p416G vector treated with SpeI and BamHI restriction enzymes to construct p416G-ARA1. In addition, the YPR1 gene treated with the same restriction enzyme was ligated to the p416G vector treated with SpeI and XhoI to construct p416G-YPR1.
  • JHY903 [ARA1] JHY903 [ARA1]
  • JHY903 [YPR1] JHY903 [ARA1]
  • JHY903 strain containing the p413G, p414G, and p416G-ARA1 plasmids to overexpress the ARA1 enzyme
  • JHY903 strain containing the p413G, p414G, and p416G-YPR1 plasmids to overexpress the YPR1 enzyme hereinafter referred to as the JHY903 strain.
  • JHY903 [YPR1] JHY903 [YPR1]
  • the Meso-2,3-butanediol production pathway was blocked to produce a strain with increased acetoin-producing ability.
  • a strain (JHY903-45) in which the ara1 gene and the ypr1 gene were further deleted was prepared, and furthermore, the ara1 gene, the ypr1 gene and the ymr226c gene were further deleted.
  • a strain (JHY903-459) was prepared.
  • the JHY903 strain, the JHY903-4 strain, the JHY903-45 strain and the JHY903-459 strain were further deleted genes in the same manner as in Example 6, and the cell concentration and acetoin and meso- in the same manner as in Example 4
  • the production of 2,3-butanediol was confirmed.
  • the production of metabolites of the strains is summarized in Table 8 below.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인의 생산방법에 관한 것이다. 본 발명에 따른 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 아세토인 생산능이 우수한 효모는 i) ADH(alcohol dehydrogenase) 유전자, GPD(glycerol-3-phosphate dehydrogenase) 유전자 및 BDH(2,3-butanediol dehydrogenase) 유전자가 결실되고, ii) alsS 유전자, alsD 유전자 및 noxE 유전자가 도입되며, iii) EMP46, PEP7, SUR1 및 HXK2가 돌연변이된 것으로서, 이를 이용하여 아세토인을 생산할 경우, 같은 양의 글루코스로부터 많은 양의 아세토인을 생산할 수 있다. 따라서, 본 발명에 따른 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 진화된 효모는 아세토인을 고수율로 생산하는데 유용하게 사용될 수 있다.

Description

아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법
본 발명은 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인의 생산방법에 관한 것이다.
아세토인(acetoin)은 버터향이 나는 향료로 식품, 화장품, 담배, 세제 등에 널리 사용될 뿐만 아니라, 해충의 유인제로 작용하여 방충제로서의 활용이 가능하다. 이러한 아세토인은 다양한 활용 가능성과 대량생산이 가능하다는 장점으로 인해, 미국 에너지국이 정한 바이오 매스로부터 생산 가능한 30개 플랫폼 화학물질에 포함되어 있다.
현재 대부분의 아세토인은 화학적 합성법으로 생산되고 있으나, 화장품 분야 및 식품 분야에서는 천연향료에 대한 선호도가 증가하고 있어, 생물공정을 통한 아세토인 생산방법이 주목 받고 있다. 최근 미생물을 이용하여 아세토인을 생산하는 방법에 관한 연구가 활발히 진행되고 있다. 예컨대, 재조합 엔테로박터 에어로게네스균(Enterobactera erogenes) 및 재조합 고초균(Bacillus subtilis)을 이용한 아세토인 생산방법이 개발된 바 있다(대한민국 특허출원 제10-2016-0006582호 및 대한민국 특허출원 제2015-0081821호). 그러나, 주로 박테리아 균주를 기반으로 진행되고 있으며, 이들 중 대부분은 병원성을 가지거나 산성 조건, 삼투압, 고농도의 글루코스 또는 고농도의 아세토인에 대한 내성이 부족하여 생산 수율이 낮다는 문제점이 있다.
이에, 미국 FDA에서 GRAS(Generally Recognized As Safe)로 인정되는 미생물을 사용하여 고수율로 아세토인을 생산하는 방법이 요구되고 있다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 대한민국 특허출원 제10-2016-0006582호
(특허문헌 2) 대한민국 특허출원 제10-2015-0081821호
이에 본 발명자들은 글루코스로부터 아세토인을 고수율로 생산하는 유전적으로 조작된 효모를 개발하기 위해 연구한 결과, i) 알코올 탈수소효소(alcohol dehydrogenase), 글리세롤-3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 2,3-부탄다이올 탈수소효소(2,3-butanediol dehydrogenase)의 활성이 감소되고, ii) 아세토락테이트 신타아제(acetolactate synthase), 아세토락테이트 디카복실레이즈(acetolactate decarboxylase) 및 NADH 산화효소(NADH oxidase)의 활성이 증가되며, iii) EMP46, PEP7, SUR1 및/또는 HXK2가 돌연변이된 효모가 고수율로 아세토인을 생산하는 것을 확인함으로써 본 발명을 완성하였다.
상기 목적을 달성하기 위하여, 본 발명의 일 측면은, 모균주에 비해, i) 알코올 탈수소효소(alcohol dehydrogenase), 글리세롤-3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 2,3-부탄다이올 탈수소효소(2,3-butanediol dehydrogenase)의 활성이 감소되고, ii) 아세토락테이트 신타아제(acetolactate synthase), 아세토락테이트 디카복실레이즈(acetolactate decarboxylase) 및 NADH 산화효소(NADH oxidase)의 활성이 증가되며, iii) EMP46, PEP7, SUR1, HXK2 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나가 돌연변이된, 유전적으로 조작된 효모를 제공한다.
본 발명의 다른 측면은, i) 상기 유전적으로 조작된 효모를 배양하는 단계; 및 ii) 상기 효모로부터 생산되는 아세토인을 수득하는 단계를 포함하는 아세토인을 생산하는 방법을 제공한다.
본 발명의 또 다른 측면은, i) 야생형 효모의 알코올 탈수소효소를 코딩하는 유전자, 글리세롤-3-인산 탈수소효소를 코딩하는 유전자, 2,3-부탄다이올 탈수소효소를 코딩하는 유전자 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나를 결실시키는 단계; ii) 아세토락테이트 신타아제를 코딩하는 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 유전자, NADH 산화효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 외인성 유전자(exogenous gene)를 도입시키는 단계; 및 iii) 상기 효모를 아세토인이 첨가된 배지에서 적어도 15회 계대배양하는 단계를 포함하는, 아세토인 생산능이 우수한 효모를 제조하는 방법을 제공한다.
본 발명의 또 다른 측면은, 상기 방법으로 제조된 아세토인 생산능이 우수한 효모를 제공한다.
본 발명의 또 다른 측면은, i) 상기 아세토인 생산능이 우수한 효모를 배양하는 단계; 및 ii) 상기 효모로부터 생산되는 아세토인을 수득하는 단계를 포함하는 아세토인을 생산하는 방법을 제공한다.
본 발명에 따른 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 아세토인 생산능이 우수한 효모는 i) ADH(alcohol dehydrogenase) 유전자, GPD(glycerol-3-phosphate dehydrogenase) 유전자 및 BDH(2,3-butanediol dehydrogenase) 유전자가 결실되고, ii) alsS 유전자, alsD 유전자 및 noxE 유전자가 도입되며, iii) EMP46, PEP7, SUR1 및 HXK2가 돌연변이된 것으로서, 이를 이용하여 아세토인을 생산할 경우, 같은 양의 글루코스로부터 많은 양의 아세토인을 생산할 수 있다. 따라서, 본 발명에 따른 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 진화된 효모는 아세토인을 고수율로 생산하는데 유용하게 사용될 수 있다.
도 1은 일 실시예에 따른 아세토인 생산 경로 및 경쟁 경로를 도식화하여 나타낸 도면이다.
도 2는 일 실시예에 따른 JHY902D 균주 및 JHY903 균주를 YPD 배지 또는 18 g/L 농도의 아세토인이 첨가된 YPD 배지에서 배양한 것을 촬영한 사진이다.
도 3a는 일 실시예에 따른 JHY902A 균주, D1 내지 D3 균주, JHY902D 균주 및 JHY903 균주의 성장율을 나타낸 그래프이다.
도 3b는 일 실시예에 따른 JHY902A 균주, D1 내지 D3 균주, JHY902D 균주 및 JHY903 균주의 배양액 내 글루코스 농도를 나타낸 그래프이다.
도 4는 일 실시예에 따른 JHY902A 균주, D1 내지 D3 균주, JHY902D 균주 및 JHY903 균주의 아세토인 및 2,3-부탄다이올의 생산량을 나타낸 그래프이다.
도 5a는 일 실시예에 따른 JHY903 균주 및 JHY903-1 내지 JHY903-9 균주의 성장율을 나타낸 그래프이다.
도 5b는 일 실시예에 따른 JHY903 균주 및 JHY903-1 내지 JHY903-9 균주의 배양액 내 글루코스 농도를 나타낸 그래프이다.
도 6은 일 실시예에 따른 JHY903 균주 및 JHY903-1 내지 JHY903-9 균주의 아세토인 및 2,3-부탄다이올의 생산량을 나타낸 그래프이다.
도 7은 ARA1, YPR1 및 YMR226C 효소의 라세믹 아세토인(3R/S-아세토인)에 대한 입체선택성 및 입체특이성을 가스 크로마토그래피(gas chromatography, GC)로 분석한 결과이다.
도 8a는 일 실시예에 따른 JHY903 균주, JHY903 [ARA1] 균주 및 JHY903 [YPR1] 균주의 성장율을 나타낸 그래프이다.
도 8b는 일 실시예에 JHY903 균주, JHY903 [ARA1] 균주 및 JHY903 [YPR1] 균주의 배양액 내 글루코스 농도를 나타낸 그래프이다.
도 9a는 일 실시예에 따른 JHY903 균주, JHY903 [ARA1] 균주 및 JHY903 [YPR1] 균주의 2,3-부탄다이올의 생산량을 나타낸 그래프이다.
도 9b는 일 실시예에 따른 JHY903 균주, JHY903 [ARA1] 균주 및 JHY903 [YPR1] 균주의 아세토인의 생산량을 나타낸 그래프이다.
도 10a는 일 실시예에 따른 JHY903 균주, JHY903-4 균주, JHY903-45 균주 및 JHY903-459 균주의 성장율을 나타낸 그래프이다.
도 10b는 일 실시예에 따른 JHY903 균주, JHY903-4 균주, JHY903-45 균주 및 JHY903-459 균주의 배양액 내 글루코스 농도를 나타낸 그래프이다.
도 11은 일 실시예에 따른 JHY903 균주, JHY903-4 균주, JHY903-45 균주 및 JHY903-459 균주의 아세토인 및 2,3-부탄다이올의 생산량을 나타낸 그래프이다.
본 발명의 일 측면은, 모균주에 비해 i) 알코올 탈수소효소(alcohol dehydrogenase), 글리세롤-3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 2,3-부탄다이올 탈수소효소(2,3-butanediol dehydrogenase)의 활성이 감소되고, ii) 아세토락테이트 신타아제(acetolactate synthase), 아세토락테이트 디카복실레이즈(acetolactate decarboxylase) 및 NADH 산화효소(NADH oxidase)의 활성이 증가되며, iii) EMP46, PEP7, SUR1, HXK2 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나가 돌연변이된, 유전적으로 조작된 효모를 제공한다.
본 발명에서 사용하는 용어 "아세토인(acetoin)"이란, 3-히드록시부타논(3-hydroxybutanone) 또는 아세틸 메틸 카르비놀(acetyl methyl carbinol)과 호환적으로 사용되고, C4H8O2의 분자식을 갖는 화합물을 의미할 수 있다. 상기 아세토인은(R)-아세토인을 포함할 수 있다.
본 발명에서 사용하는 용어 "알코올 탈수소효소"란, NADH의 산화로 알코올 및 알데하이드 또는 케톤 사이의 상호전환을 촉진하는 효소를 의미할 수 있다. 상기 알코올 탈수소효소는 효소의 이름이 상이하더라도, 그와 유사한 활성을 갖는 효소를 포함할 수 있으며, 예를 들면, ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7 또는 SFA1를 포함할 수 있다. 바람직하게는, 상기 알코올 탈수소효소는 ADH1, ADH2, ADH3, ADH4, ADH5 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
구체적으로, 상기 알코올 탈수소효소는 서열번호 99, 101, 103, 105, 또는 107로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 폴리펩티드일 수 있다.
본 발명에서 사용하는 용어 "글리세롤-3-인산 탈수소효소"란, 글리세롤-3-인산(G3P)으로의 전환을 촉진하는 효소를 의미할 수 있다. 상기 글리세롤-3-인산 탈수소효소는 효소의 이름이 상이하더라도, 그와 유사한 활성을 갖는 효소를 포함할 수 있으며, GPD1, GPD2 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
또한, 상기 글리세롤-3-인산 탈수소효소는 서열번호 109 또는 111로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 폴리펩티드일 수 있다.
본 발명에서 사용하는 용어 "상동성"란, 주어진 폴리염기서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 이때, 주어진 폴리염기서열과 동일하거나 유사한 활성을 갖는 그의 상동성 서열이 "% 상동성"으로 표시된다. 예를 들면, 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)들을 계산하는 표준 소프트웨어, 구체적으로 BLAST 2.0를 이용하거나, 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은, 당업자에게 잘 알려진 방법으로 결정될 수 있다.
본 발명에서 사용하는 용어 "2,3-부탄다이올 탈수소효소"란, 아세토인, NADH, 및 H+를 기질로 하여, 2,3-부탄다이올 및 NAD+를 생산하는 효소를 의미할 수 있으며, 옥시도리덕타아제(oxidoreductase) 과(family)에 속한다. 상기 2,3-부탄다이올 탈수소효소는 효소의 이름이 상이하더라도 그와 유사한 활성을 갖는 효소(예를 들면, 동질효소(isoenzyme) 또는 동족체(homolog))를 포함할 수 있으며, 예를 들면, 사카로마이세스 세레비지애 유래의 BDH1, BDH2, 패니바실러스 폴리믹사(Paenibacillus polymyxa) 유래의 BDH99::67, 바실러스 서브틸리스, 엔테로코커스 패시움(Enterococcusfaecium) 엔테로코커스 듀란스(Enterococcusdurans) 마이코박테리움 속(Mycobacterium sp.) 락토바실러스 락티스 유래의 2,3-부탄다이올 탈수소효소일 수 있다.
또한, 상기 2,3-부탄다이올 탈수소효소는 서열번호 113으로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 폴리펩티드일 수 있다.
본 발명에서 사용하는 용어 "활성 감소(decrease in activity)" 란, 모균주(예, 유전적으로 조작되지 않은 균주 또는 세포)에 비해 더 적은 양의 효소 또는 폴리펩티드를 발현하거나, 효소 또는 폴리펩티드의 활성이 비활성화 또는 불활성화(inactivation)된 것을 의미할 수 있다. 또한, 상기 활성이 감소된 균주는, 유전적 변형을 갖지 않은 균주에 비해 하나 이상의 효소 또는 폴리펩티드의 활성을 감소시키는 유전적 변형(genetic modification)을 갖는 것일 수 있다.
상기 효소 또는 폴리펩티드의 활성을 감소시키는 유전적 변형은 1) 상기 효소 또는 폴리펩티드를 암호화하는 유전자의 일부 또는 전체의 결실, 2) 상기 유전자의 발현이 감소하도록 발현조절 서열의 변형, 3) 상기 효소 또는 폴리펩티드의 활성이 약화되도록 염색체 상의 상기 유전자 서열의 변형 또는 4) 이의 조합 등을 사용하여 수행될 수 있다.
상기 효소 또는 폴리펩티드를 암호화하는 유전자의 일부 또는 전체를 결실하는 방법은 예를 들면, Cre/loxP 재조합 시스템을 사용하여 유전자 결손을 위한 카세트를 모균주에 형질전환함으로써 수행될 수 있고, 효모 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 유전자를 일부 핵산 서열이 결실된 유전자 또는 마커 유전자로 교체함으로써 수행될 수 있다. 상기 발현조절 서열을 변형하는 방법은 상기 발현조절 서열의 활성을 더욱 약화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 핵산 서열로 교체함으로써 수행할 수 있다. 상기 발현조절 서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함한다. 아울러, 상기 효소 또는 폴리펩티드를 암호화하는, 염색체 상의 염기서열을 변형하는 방법은 상기 단백질의 활성을 더욱 약화하도록 염기서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 염기서열로 교체함으로써 수행할 수 있다.
상기 효모는 알코올 탈수소효소를 코딩하는 유전자, 글리세롤-3-인산 탈수소효소를 코딩하는 유전자 및 2,3-부탄다이올 탈수소효소를 코딩하는 유전자가 결실된 것일 수 있다.
상기 알코올 탈수소효소를 코딩하는 유전자는 서열번호 100, 102, 104, 106, 또는 108로 표시되는 염기서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 것일 수 있다.
상기 글리세롤-3-인산 탈수소효소를 코딩하는 유전자는 서열번호 110 또는 112로 표시되는 염기서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 것일 수 있다.
상기 2,3-부탄다이올 탈수소효소를 코딩하는 유전자는 서열번호 114로 표시되는 염기서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 것일 수 있다.
상기 알코올 탈수소효소를 코딩하는 유전자는 adh1 유전자(서열번호 100), adh2 유전자(서열번호 102), adh3 유전자(서열번호 104), adh4 유전자(서열번호 106), adh5 유전자(서열번호 108) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나일 수 있다. 상기 글리세롤-3-인산 탈수소효소를 코딩하는 유전자는 gpd1 유전자(서열번호 110), gpd2 유전자(서열번호 112) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나일 수 있다. 상기 2,3-부탄다이올 탈수소효소를 코딩하는 유전자는 bdh1 유전자(서열번호 114)일 수 있다.
또한, 상기 효모는 아세토락테이트 신타아제를 코딩하는 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 유전자, NADH 산화효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 외인성 유전자(exogenous gene)를 포함할 수 있다.
본 발명에서 사용하는 용어 "아세토락테이트 신타아제"란, 아세토하이드록시산 신타아제(acetohydroxy acid synthase, AHAS)와 호환적으로 사용되며, 류신, 발린 및 이소류신 등의 분지쇄 아미노산 생합성 경로에 대한 조절효소로서, 두 분자의 피루브산으로부터 각각 한 분자의 이산화탄소와 아세토락테이트를 합성하는 효소일 수 있다. 상기 아세토락테이트 신타아제는 효소의 이름이 상이하더라도 그와 유사한 활성을 갖는 효소(예를 들면, 동질효소 또는 동족체)를 포함할 수 있으며, 예를 들면, 바실러스 서브틸리스 유래의 alsS 유전자에 의해 암호화되는 아세토락테이트 신타아제, 대장균 유래의 ilvB 유전자 또는 ilvN 유전자에 의해 암호화되는 아세토락테이트 신타아제 I, 대장균 유래의 ilvGMEDA 유전자에 의해 암호화되는 아세토락테이트 신타아제 II, 또는 대장균 유래의 ilvI 또는 ilvH 유전자에 의해 암호화되는 아세토락테이트 신타아제 III를 포함할 수 있다. 또한, 이외에, 대장균, 사카로마이세스 세레비지애, 탄저균(Bacillus anthracis), 해모필러스 인플루엔자(Haemophilusinfluenzae), 살모넬라 티피무리움(Salmonella Typhimurium), 써모타가 마리티마(Thermotogamaritima), 코리네박테리움 글루타미쿰(Corynebacteriumglutamicum), 결핵균(Mycobacterium tuberculosis), 또는 스트렙토마이세스 신나모네시스(Streptomycescinnamonensis) 유래의 아세토락테이트 신타아제일 수 있다. 추가적으로 식물 유래로는 애기 장대(Arabidopsisthaliana), 고시피움 히르수툼(Gossypiumhirsutum), 헬리안투스 안누우스(Helianthus annuus), 또는 브라시카 나푸스(Brassicanapus) 유래의 아세토락테이트 신타아제일 수 있다.
또한, 상기 아세토락테이트 신타아제는 서열번호 32로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 폴리펩티드 일 수 있다.
본 발명에서 사용하는 용어 "아세토락테이트 디카복실레이즈"란, 아세토락테이트로부터 이산화탄소를 제거하여 아세토인을 생산하는 효소를 의미할 수 있다. 상기 아세토락테이트 디카복실레이즈는 효소의 이름이 상이하더라도 그와 유사한 활성을 갖는 효소(예를 들면, 동질효소 또는 동족체)를 포함할 수 있으며, 예를 들면, 바실러스 서브틸리스 유래의 alsD, 락토바실러스 델브루키(Lactobacillus delbrueckii subsp. lactis) 유래의 aldB, 브레비바실러스 브레비스(Brevibacillusbrevis), 엔테로박터 에어로게네스(Enterobacteraerogenes), 류코노스톡 락티스(Leuconostoc lactis), 사카로마이세스 세레비지애. 스타필로코커스 아우레우스(Staphylococcus aureus) 유래의 아세토락테이트 디카복실레이즈일 수 있다.
또한, 상기 아세토락테이트 디카복실레이즈는 서열번호 34로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 폴리펩티드 일 수 있다.
아세토인을 효과적으로 생산할 수 있는 유전적으로 조작된 효모의 아세토인 생산 경로에 대해 도 1을 참조하여 설명한다. 도 1은 일구체예에 따른 아세토인 생산 경로 및 경쟁 경로를 도식화하여 나타낸 도면이다.
도 1에 나타낸 바와 같이, 일구체예에 따른 효모는 모균주에 비하여 아세토락테이트 신타아제, 및 아세토락테이트 디카복실레이즈의 활성이 증가되어 있어 아세토인을 효과적으로 생산할 수 있다. 또한, 아세토인의 생산에 있어서, 부산물 생성을 억제하고, 아세토인의 생산을 더욱 증진시키고자, 상기 효모는 아세토인의 생산 경로의 경쟁적 대사 경로가 추가적으로 차단된 것일 수 있다. 상기 경쟁적 대사 경로는 도 1에 나타낸 바와 같이, 에탄올 및 글리세롤 합성 대사 경로일 수 있으며, 상기 경쟁적 대사 경로는 알코올 탈수소효소 또는 글리세롤-3-인산 탈수소효소의 활성을 감소시켜 달성될 수 있다. 또한, 아세토인을 2,3-부탄다이올로 전환하는 대사 경로를 제거하여 아세토인의 생산을 더 증가시킬 수 있다. 그에 더하여, 보조인자 불균형을 감소시키기 위한 과정을 추가적으로 수행할 수 있다. 하기 반응에서와 같이 효모는 해당작용을 통해 포도당으로부터 2분자의 피루브산을 생성하면서 2분자의 NAD+를 소모하여 2분자의 NADH를 생성한다. 이에 따라, 아세토인 합성 경로에서 NADH(과잉)와 NAD+(부족) 현상이 발생할 수도 있다.
Figure PCTKR2020014539-appb-I000001
NADH 산화 효소의 활성을 증가시켜 NADH를 산화시킴으로써 보조인자(cofactor, NAD+/NADH)의 불균형을 해소할 수 있다. 상기 효모는 NADH 산화효소를 코딩하는 외인성 유전자(exogenous gene)를 포함할 수 있다.
본 발명에서 사용하는 용어 "NADH 산화효소"란, 산소와 NADH를 기질로 하여 물과 NAD+를 생산하는 반응을 매개하는 효소를 의미할 수 있다. 상기 NADH 산화효소는 효소의 이름이 상이하더라도 그와 유사한 활성을 갖는 효소(예를 들면, 동질효소 또는 동족체)를 포함할 수 있으며, 예를 들면, nox1, nox3, nox4, 락토코커스 락티스 유래의 noxE를 포함할 수 있고, 이외에, 엔테로코커스 속, 락토바실러스 속, 디설포비브리오 속(Desulfovibriosp.), 클로스트리디움 속(Clostridium sp.) 스트렙토코커스 속 유래의 NADH 산화효소일 수 있다.
또한, 상기 NADH 산화효소는 서열번호 46으로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 폴리펩티드 일 수 있다.
본 발명에서 사용하는 용어 "활성 증가(increase in activity)"란, 모균주(예, 유전적으로 조작되지 않은 균주 또는 세포)가 갖지 않는 또는 갖는 폴리펩티드 또는 효소에 비해, 동일한 타입의 폴리펩티드 또는 효소의 활성이 보다 더 높은 활성을 갖거나, 더 많은 양의 동일한 타입의 폴리펩티드 또는 효소를 발현하는 것을 의미할 수 있다. 또한, 상기 활성이 증가된 균주는, 유전적 변형을 갖지 않은 균주에 비해 하나 이상의 효소 또는 폴리펩티드의 활성을 증가시키는 유전적 변형을 갖는 것일 수 있다.
상기 효소 또는 폴리펩티드의 활성을 증가시키는 유전적 변형은 1) 상기 유전자의 발현이 증가하도록 발현조절 서열의 변형, 2) 상기 효소 또는 폴리펩티드의 활성이 증가되도록 염색체 상의 상기 유전자 서열의 변형, 3) 상기 효소 또는 폴리펩티드를 코딩하는 유전자를 추가적으로 도입 또는 4) 이의 조합 등을 사용하여 수행될 수 있다.
상기 아세토락테이트 신타아제는 alsS 유전자에 의해 코딩되는 것일 수 있으며, 상기 alsS 유전자는 서열번호 31로 표시되는 염기서열을 포함하는 것일 수 있다. 상기 아세토락테이트 디카복실레이즈는 alsD 유전자에 의해 코딩되는 것일 수 있으며, 상기 alsD 유전자는 서열번호 33으로 표시되는 염기서열을 포함하는 것일 수 있다. 상기 NADH 산화효소는 noxE 유전자에 의해 코딩되는 것일 수 있으며, 상기 noxE 유전자는 서열번호 45로 표시되는 염기서열을 포함하는 것인일 수 있다.
본 발명에서 사용하는 용어 "외인성(exogenous)"이란, 언급된 분자(referenced molecule)또는 언급된 활성(referenced activity)이 숙주 세포로 도입된 것을 의미할 수 있다. 분자는 예를 들면, 숙주 염색체 내로의 삽입에 의하는 것과 같은 코딩 핵산(encoding nucleic acid)의 숙주 유전 물질 내로의 도입 또는 플라스미드와 같은 비염색체 유전물질로서 도입될 수 있다. 코딩 핵산의 발현과 관련하여, 상기 용어 "외인성"은 상기 코딩 핵산이 개체 내로 발현 가능한 형태로 도입된 것을 나타낸다. 생합성 활성과 관련하여, 상기 용어 "외인성"은 숙주 모세포에 도입된 활성을 나타낸다.
상기 외인성 유전자는, 상기 효모에서 그 모균주에 비하여 언급된 효소의 활성이 증가되기에 충분한 양으로 발현된 것일 수 있다. 상기 아세토락테이트 신타아제를 코딩하는 외인성 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 외인성 유전자, 및 NADH 산화효소를 코딩하는 외인성 유전자의 상동 유전자(homolog)는 서로 다른 미생물로부터 유래하였으나 그들이 코딩하는 단백질과 유사한 활성을 나타내는 단백질을 암호화하는 유전자를 의미할 수 있다.
상기 아세토락테이트 신타아제를 코딩하는 외인성 유전자는 서열번호 32로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 아미노산 서열을 코딩하는 것일 수 있다. 상기 아세토락테이트 신타아제를 코딩하는 외인성 유전자는 각각 서열번호 31로 표시되는 염기서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 것일 수 있다.
상기 아세토락테이트 디카복실레이즈를 코딩하는 외인성 유전자를 코딩하는 외인성 유전자는 각각 서열번호 34로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 아미노산 서열을 코딩하는 것일 수 있다. 상기 아세토락테이트 디카복실레이즈를 코딩하는 외인성 유전자를 코딩하는 외인성 유전자는 각각 서열번호 33으로 표시되는 염기서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 것일 수 있다.
상기 NADH 산화효소를 코딩하는 외인성 유전자는 서열번호 46으로 표시되는 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 아미노산 서열을 코딩하는 것일 수 있다. 상기 NADH 산화효소를 코딩하는 외인성 유전자는 각각 서열번호 45로 표시되는 염기서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 것일 수 있다.
이러한 외인성 유전자는 미생물에서 발현되기에 적합한 코돈으로 변경된 서열, 최적화된 코돈을 갖는 서열로 변경될 수 있다. 이 코돈 변경은 단백질의 아미노산 서열이 바뀌지 않는 범위 내에서 적절히 이루어질 수 있다.
상기 외인성 유전자는 발현 벡터를 통하여 모균주 내로 도입된 것일 수 있다. 또한, 상기 외인성 유전자는 선형 폴리뉴클레오티드 형태로 모균주 내로 도입된 것일 수 있다. 또한, 상기 외인성 유전자는 균주 내에서 발현 벡터(예, 플라스미드)로부터 발현되는 것일 수 있다. 또한, 상기 외인성 유전자는 안정적인 발현을 위하여 균주 내의 유전물질(예, 염색체)에 삽입되어 발현되는 것일 수 있다. 상기 벡터는 복제개시점, 프로모터, 상기 효소를 코딩하는 유전자, 및 터미네이터를 포함할 수 있다. 상기 복제 개시점은 효모 자가복제 서열(autonomous replication sequence, ARS)을 포함할 수 있다. 상기 효모 자가복제서열은 효모 동원체 서열(centromeric sequence, CEN)에 의해 안정화될 수 있다. 상기 프로모터는 TDH3 프로모터, TEF 프로모터, 및 FBA1 프로모터로 이루어진 군으로부터 선택된 것일 수 있다. 상기 터미네이터는 CYC1, GPM1, 및 FBA1로 이루어진 군으로부터 선택되는 것일 수 있다. 상기 벡터는 선별 마커를 더 포함할 수 있다.
상기 효모는 단일 유전자, 복수의 유전자 예를 들면, 2 내지 10 카피 수를 포함할 수 있다. 상기 효모는, 예를 들면, 1 내지 10, 1 내지 8, 1 내지 7, 1 내지 6, 1 내지 5, 1 내지 4, 1 내지 3, 2 내지 10, 2 내지 8, 2 내지 7, 2 내지 6, 2 내지 5, 2 내지 4, 또는 2 내지 3 카피의 상기 효소를 코딩하는 유전자를 포함할 수 있다. 상기 효모가 복수의 유전자를 포함하는 경우, 각각의 유전자는 동일한 유전자의 카피이거나 둘 이상의 상이한 유전자의 카피를 포함할 수 있다. 외인성 유전자의 복수의 카피는 숙주 세포의 게놈 내에 동일한 유전자 좌(locus), 또는 여러 유전자 좌에 포함될 수 있다.
본 발명에서 사용하는 용어 "EMP46"란, 당단백질의 분비와 핵 구조 및 유전자 침묵에 관여하는 단백질로, NCBI Reference Sequence: NC_001144.5에 개시된 서열을 갖는 것일 수 있다. 상기 EMP46은 서열번호 115로 표시되는 아미노산 서열을 갖는 것일 수 있다. 또한, 상기 EMP46은 서열번호 116으로 표시되는 염기서열에 의해 코딩되는 것일 수 있다. 상기 EMP46 돌연변이는 서열번호 115로 표시되는 아미노산 서열 중 160번째 아미노산인 류신(Leucine)이 페닐알라닌(Phenylalanine)으로 치환된 것일 수 있다. 또한, 상기 EMP46 돌연변이는 서열번호 116으로 표시되는 염기서열 중 480번째 염기인 구아닌(guanin)이 티민(thymine)으로 치환된 것일 수 있다.
본 발명에서 사용하는 용어 "PEP7"이란, 액포 분리 및 액상 단백질 분비에 관여하는 단백질로, NCBI Reference Sequence: NC_001136.10에 개시된 서열을 갖는 것일 수 있다. 상기 PEP7은 서열번호 117로 표시되는 아미노산 서열을 갖는 것일 수 있다. 또한, 상기 PEP7은 서열번호 118로 표시되는 염기서열에 의해 코딩되는 것일 수 있다. 상기 PEP7 돌연변이는 서열번호 117로 표시되는 아미노산 서열 중 169번째 아미노산인 글루타민(Glutamine)이 리신(Lysine)으로 치환된 것일 수 있다. 또한, 상기 PEP7 돌연변이는 서열번호 118로 표시되는 염기서열 중 505번째 염기인 사이토신(cytosine)이 아데닌(adenine)으로 치환된 것일 수 있다.
본 발명에서 사용하는 용어 "SUR1"이란, 만노실 포스포릴이노시톨 세라마이드의 합성에 관여하는 단백질로, 포스포릴 이노시톨 세라마이드에 만노실을 첨가하는 반응을 촉매한다. 상기 SUR1은 NCBI Reference Sequence: NC_001148.4에 개시된 서열을 갖는 것일 수 있다. 상기 SUR1은 서열번호 119로 표시되는 아미노산 서열을 갖는 것일 수 있다. 또한, 상기 SUR1은 서열번호 120으로 표시되는 염기서열에 의해 코딩되는 것일 수 있다. 상기 SUR1 돌연변이는 서열번호 119로 표시되는 아미노산 서열 중 176번째 아미노산인 히스티딘(Histidine)이 티로신(Tyrosine)으로 치환된 것일 수 있다. 상기 SUR1 돌연변이는 서열번호 120으로 표시되는 염기서열 중 526번째 염기인 사이토신이 티민으로 치환된 것일 수 있다.
본 발명에서 사용하는 용어 "HXK2"이란, D-글루코스 및 D-과당과 같은 육탄당의 인산화를 육탄당 6-인산(각각 D-글루코스 6-포스페이트 및 D-과당 6- 인산)으로 인산화하는 반응에 관여하는 단백질로, NCBI Reference Sequence: NC_001139.9에 개시된 서열을 갖는 것일 수 있다. 상기 HXK2은 서열번호 121로 표시되는 아미노산 서열을 갖는 것일 수 있다. 또한, 상기 HXK2은 서열번호 122로 표시되는 염기서열에 의해 코딩되는 것일 수 있다. 상기 HXK2 돌연변이는 서열번호 122로 표시되는 염기서열 중 754번째 염기인 구아닌이 티민으로 치환된 것일 수 있다.
상기 효모는 사카로마이세스(Saccharomyces), 클루베로마이세스(Kluyveromyces), 피키아(Pichia), 한세눌라(Hansenula), 자이고사카로마이세스(Zygosaccharomyces) 또는 캔디다(Candida) 속 균주일 수 있다. 또한, 상기 효모는 사카로마이세스(Saccharomyces) 속 균주일 수 있다. 상기 사카로마이세스 속 균주는 사카로마이세스 세레비지애(S. scerevisiae), 사카로마이세스 바야누스(S. bayanus), 사카로마이세스 파라독서스 (S. paradoxus), 사카로마이세스 미카테(S. mikatae), 및 사카로마이세스 쿠드리아브제비(S. kudriavzevii)로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
상기 효모는 아라비노스 탈수소효소(arabinose dehydrogenase, ARA1), NADP-의존적 알도-케도 환원 효소(NADPH-dependent aldo-keto reductase, YPR1), NADP-의존적 3-히드록시산 탈수소효소(NADP-dependent 3-hydroxy acid dehydrogenase, YMR226C) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 활성이 감소된 것일 수 있다. 구체적으로, 상기 효모는 아라비노스 탈수소효소를 코딩하는 유전자, NADP-의존적 알도-케도 환원 효소를 코딩하는 유전자, NADP-의존적 3-히드록시산 탈수소효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나가 결실된 것일 수 있다.
본 발명에서 사용하는 용어 "아라비노스 탈수소효소"란, NADP+의 존재 하에서 D-아라비노스, L-크실로스, L-푸코스 및 L-갈락토스의 산화 촉매에 관여하는 효소를 의미할 수 있고, 예를 들어, ARA1일 수 있다. 상기 아라비노스 탈수소효소는 NCBI Reference Sequence: NC_001134.8에 기재된 서열을 갖는 것일 수 있다. 상기 아라비노스 탈수소효소는 서열번호 124로 표시되는 염기서열을 포함하는 ara1 유전자에 의해 코딩되는 것일 수 있다.
본 발명에서 사용하는 용어 "NADP-의존적 알도-케도 환원 효소"란, 2-메틸부틸알데히드를 포함하는 여러 기질을 감소시킬 수 있는 효소로, 삼투 및 산화 스트레스에 의해 빠르게 유도될 수 있다. 예를 들어, 상기 NADP-의존적 알도-케도 환원 효소는 GTR3, YJR096W 또는 YPR1일 수 있다. 상기 NADP-의존적 알도-케도 환원 효소는 NCBI Reference Sequence: NC_001136.10에 기재된 서열을 갖는 것일 수 있다. 상기 NADP-의존적 알도-케도 환원 효소는 서열번호 126으로 표시되는 염기서열을 포함하는 ypr1 유전자에 의해 코딩되는 것일 수 있다.
본 발명에서 사용하는 용어 "NADP-의존적 3-히드록시산 탈수소효소"란, 3-히드록시산에 작용하는 광범위한 기질 특이성을 갖는 NADP-의존적 탈수소효소일 수 있고, 예를 들어, NRE1, IRC24, ENV9 또는 YMR226C일 수 있다. 상기 NADP-의존적 3-히드록시산 탈수소효소는 NCBI Reference Sequence: NC_001145.3에 기재된 서열을 갖는 것일 수 있다. 상기 NADP-의존적 3-히드록시산 탈수소효소는 서열번호 128로 표시되는 염기서열을 포함하는 ymr226c 유전자에 의해 코딩되는 것일 수 있다.
본 발명의 다른 측면은, i) 상기 유전적으로 조작된 효모를 배양하는 단계; 및 ii) 상기 효모로부터 생산되는 아세토인을 수득하는 단계를 포함하는 아세토인을 생산하는 방법을 제공한다.
상기 아세토인을 생산하는 방법에 있어서, 상기 효모에 대해서는 전술한 유전적으로 조작된 효모에 대한 설명을 참조한다.
본 발명에서 사용하는 용어 "배양"이란, 상기 효모로부터 아세토인을 생산하기 위하여, 상기 효모를 적당히 인공적으로 조절한 환경조건에서 생육시키는 일련의 행위를 의미할 수 있다. 본 발명에서 상기 세포를 배양하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로 상기 배양은 배치 공정 또는 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있다. 배양에 사용되는 배지는 아세토인으로 대사될 수 있는 하나 이상의 기질을 포함하는 것일 수 있으며, 예를 들면, 적당한 탄소원, 질소원, 아미노산, 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 적절한 방식으로 특정 균주의 요건을 충족해야 한다.
사용될 수 있는 탄소원으로는 글루코스를 주탄소원으로 사용하며, 이외에 자일로스, 수크로스, 락토스, 프락토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함될 수 있다.
상기 배양은 글루코스 존재 하에 효모를 배양하는 것을 특징으로 할 수 있다.
이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다. 사용될 수 있는 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 및 질산암모늄과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민과 같은 아미노산 및 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해생성물 등 유기질소원이 사용될 수 있다. 이들 질소원은 단독 또는 조합되어 사용될 수 있다. 상기 배지에는 인원으로서 인산 제1칼륨, 인산 제2칼륨 및 대응되는 소듐-함유 염이 포함될 수 있다. 사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함된다. 또한, 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간 및 탄산칼슘 등이 사용될 수 있다. 마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다.
통상적으로, 효모는 약 20℃ 내지 약 37℃ 범위의 온도에서 적절한 배지 내에 성장시킬 수 있다. 본 발명에서 성장 배지는, 예를 들면, 효모 질소 베이스(yeast nitrogen base), 암모늄 설페이트, 및 탄소/에너지 공급원으로서의 덱스트로스를 포함하는 브로스(broth) 또는 대부분의 사카로마이세스 세레비지애 균주의 성장을 위한 최적 비율로 펩톤, 효모 추출물 및 덱스트로스를 블렌딩한 YPD 배지와 같이 상업적으로 제조된 통상적인 배지일 수 있다. 그밖에 정의되거나 합성된 성장 배지도 사용할 수 있으며, 특정 미생물의 성장에 적절한 배지는 미생물학 또는 발효과학 분야의 당업자에게 공지되어 있다.
상기 효모를 통해 생산된 아세토인은 당업계에 공지된 방법을 사용하여 배양 배지로부터 분리할 수 있다. 이러한 분리 방법은 원심분리, 여과, 이온교환크로마토그래피 또는 결정화일 수 있다. 예를 들면, 배양물을 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을, 이온교환크로마토그래피를 통하여 분리할 수 있다.
본 발명의 또 다른 측면은, i) 야생형 효모의 알코올 탈수소효소를 코딩하는 유전자, 글리세롤-3-인산 탈수소효소를 코딩하는 유전자, 2,3-부탄다이올 탈수소효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나를 결실시키는 단계; ii) 아세토락테이트 신타아제를 코딩하는 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 유전자, NADH 산화효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 외인성 유전자를 도입시키는 단계; 및 iii) 상기 효모를 아세토인이 첨가된 배지에서 적어도 15회 계대배양하는 단계를 포함하는 아세토인 생산능이 우수한 효모를 제조하는 방법을 제공한다.
구체적으로, 상기 방법은, i) 단계에서 야생형 효모의 알코올 탈수소효소를 코딩하는 유전자, 글리세롤-3-인산 탈수소효소를 코딩하는 유전자 및 2,3-부탄다이올 탈수소효소를 코딩하는 유전자를 결실시킬 수 있고, ii) 단계에서 아세토락테이트 신타아제를 코딩하는 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 유전자 및 NADH 산화효소를 코딩하는 유전자를 도입시킬 수 있다.
상기 알코올 탈수소효소를 코딩하는 유전자, 글리세롤-3-인산 탈수소효소를 코딩하는 유전자 및 2,3-부탄다이올 탈수소효소를 코딩하는 유전자 및 이들을 결실시키는 방법은 유전적으로 조작된 효모에서 상술한 바와 동일하다.
상기 아세토인이 첨가된 배지는 적어도 4 g/L 농도의 아세토인이 첨가된 것을 특징으로 하는 것일 수 있다. 상기 아세토인이 첨가된 배지는 4 g/L 농도에서 점진적으로 16.5 g/L 농도까지 증가시킬 수 있다.
상기 아세토락테이트 신타아제를 코딩하는 외인성 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 외인성 유전자 및 NADH 산화효소를 코딩하는 외인성 유전자 및 이들을 도입시키는 방법은 유전적으로 조작된 효모에서 상술한 바와 동일하다.
상기 ii) 단계에서 계대배양 횟수는 적어도 15회 이상일 수 있으며, 바람직하게는, 상기 ii) 단계에서 계대배양 횟수는 15회, 17회, 19회, 21회, 23회, 25회, 27회 또는 29회 이상일 수 있다.
본 발명의 일 실시예에 있어서, 알코올 탈수소효소를 코딩하는 유전자, 글리세롤-3-인산 탈수소효소를 코딩하는 유전자 및 2,3-부탄다이올 탈수소효소를 코딩하는 유전자가 결실된 효모(JHY605)에 아세토락테이트 신타아제를 코딩하는 외인성 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 외인성 유전자 및 NADH 산화효소를 코딩하는 외인성 유전자를 도입시킨 후, 4 g/L 농도에서 아세토인이 첨가된 배지로 옮겨서 37℃ 온도 및 200 rpm 조건에서 배양하여 600nm 파장에서 O.D 값이 약 1.0이 되었을 때, 효모 균주를 계대배양하는 단계를 19회 이상 반복할 수 있다. 이때, 상기 아세토인이 첨가된 배지는 4 g/L 농도에서 점진적으로 16.5 g/L 농도까지 증가시킬 수 있다.
ii) 단계 후, 상기 효모에 아라비노스 탈수소효소를 코딩하는 유전자, NADP-의존적 알도-케도 환원 효소를 코딩하는 유전자, NADP-의존적 3-히드록시산 탈수소효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나를 결실시키는 단계를 추가적으로 포함할 수 있다.
아라비노스 탈수소효소를 코딩하는 유전자, NADP-의존적 알도-케도 환원 효소를 코딩하는 유전자, NADP-의존적 3-히드록시산 탈수소효소를 코딩하는 유전자 및 이들을 결실시키는 방법은 유전적으로 조작된 효모에서 상술한 바와 동일하다.
본 발명의 또 다른 측면은, 상기 방법으로 제조된 아세토인 생산능이 우수한 효모를 제공한다.
본 발명의 또 다른 측면은, i) 상기 아세토인 생산능이 우수한 효모를 배양하는 단계; 및 ii) 상기 효모로부터 생산되는 아세토인을 수득하는 단계를 포함하는 아세토인을 생산하는 방법을 제공한다. 배양 방법 및 아세토인 수득 방법은 유전적으로 조작된 효모를 이용한 아세토인을 생산하는 방법에서 상술한 바와 동일하다.
이하, 본 발명을 하기 실시예에 의하여 더욱 상세하게 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들만으로 한정되는 것은 아니다.
제조예 1. 아세토인(acetoin) 생산능을 갖는 유전적으로 조작된 사카로마이세스 세레비지애(S. cerevisiae) 균주 제작
S. cerevisiae는 에탄올을 주요 대사산물로 생산하며 이에 관여하는 유전자는 보조인자로 NADH를 사용하는 6종의 알코올 탈수소효소(ADH1, ADH2, ADH3, ADH4, ADH5, SFA1)와 NADPH를 사용하는 알코올 탈수소효소(ADH6, ADH7)가 존재한다고 보고되고 있다. 주요 대사산물인 에탄올의 생산을 줄이기 위해 adh1, adh2, adh3, adh4 및 adh5 유전자를 제거할 경우 보조인자 불균형이 발생하는데 이에 상보적으로 NADH를 사용하는 글리세롤 탈수소효소(GPD1, GPD2)에 의해 글리세롤이 주요 대사산물로 생산된다. 또한, 아세토인은 2,3-부탄다이올 탈수소효소(BDH1)에 의하여 2,3-부탄다이올로 전환된다. 따라서, 에탄올과 글리세롤, 2,3-부탄다이올의 합성경로를 모두 차단한 탈수소효소, 글리세롤-3-인산 탈수소효소, 및 2,3-부탄다이올 탈수소효소가 결손된 균주(adh1-5β gpd1,2β, bdh1β)를 이용하여 아세토인을 생산하고자 한다(도 1).
상기 탈수소효소, 글리세롤-3-인산 탈수소효소, 및 2,3-부탄다이올 탈수소효소가 결손된 균주를 이용하여, 적응진화 및 형질전환을 통해 제작한 균주를 하기 표 1에 정리하였다.
균주명 유전자형
JHY605 CEN.PK2-1c adh1β::loxP adh2β::loxP adh3β::loxP adh4β::loxP adh5β::loxP gpd1β::loxP gpd2β::loxP
JHY901 CEN.PK2-1c adh1β::loxP adh2β::loxP adh3β::loxP adh4β::loxP adh5β::loxP gpd1β::loxP gpd2β::loxP bdh1::loxP
JHY902A JHY901 adh2β::PTDH3 -alsS-TCYC1, PTEF -alsD-TGPM1, PFBA1-noxE-TFBA1
JHY902D JHY901 delta::PTDH3 -alsS-TCYC1, PTEF-alsD-TGPM1, PFBA1-noxE-TFBA1
JHY903 Evolved strain from JHY902D
JHY903-1 JHY903 bdh2△
JHY903-2 JHY903 gre3△
JHY903-3 JHY903 yjr096w△
JHY903-4 JHY903 ara1△
JHY903-5 JHY903 ypr1△
JHY903-6 JHY903 nre1△
JHY903-7 JHY903 irc24△
JHY903-8 JHY903 env9△
JHY903-9 JHY903 ymr226c△
JHY903-45 JHY903 ara1△ ypr1△
JHY903-49 JHY903 ara1△ ymr226c△
JHY903-459 JHY903 ara1△ ypr1△ ymr226c△
아울러, 상기 표 1에 기재된 균주들을 제작하는데 사용한 플라스미드를 하기 표 2에 나타내었다.
플라스미드 특징
p413G CEN/ARS plasmid, HIS3, PTDH3, TCYC1
p414G CEN/ARS plasmid, TRP1, PTDH3, TCYC1
p416G CEN/ARS plasmid, URA3, PTDH3, TCYC1
pUG27 Plasmid containing loxP-URA3-loxP deletion cassette
pSH63 Plasmid containing the Cre-recombinase under the control of GAL1 promoter; TRP1
ADH2-SDN Plasmid containing PTDH3-alsS-TCYC1, PTEF-alsD-TGPM1, PFBA1-noxE-TFBA1, and loxp-HIS-loxp flanked by 300 bp of up- and downstream of ADH2
Delta-SDN Plasmid containing PTDH3-alsS-TCYC1, PTEF-alsD-TGPM1, PFBA1-noxE-TFBA1, and loxp-HIS-loxp flanked by YARCdelta4-1 and 2
p413G-alsS p413G containing PTDH3-alsS-TCYC1
p414G-alsD p414G containing PTDH3-alsD-TCYC1
p416F-noxE p416F containing PFBA1-noxE-TCYC1
p416G-ARA1 p416G containing PTDH3-ARA1-TCYC1
p416G-YPR1 p416G containing PTDH3-YPR1-TCYC1
p416G-YMR226C p416G containing PTDH3-YMR226C-TCYC1
pET-28b(+) Km R, His6-tagged protein expression vector
pET-ARA1-His Ara1-His6 expression plasmid
pET-YPR1-His Ypr1-His6 expression plasmid
pET-YMR226C-His Ymr226c-His6 expression plasmid
pET-alsS-His AlsS-His6 expression plasmid
p413-Cas9-ARA1 target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-ARA1 gRNA-TSUP4
p413-Cas9-BDH2 target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-BDH2 gRNA-TSUP4
p413-Cas9-YPR1 target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-YPR1 gRNA-TSUP4
p413-Cas9-GRE3 target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-GRE3 gRNA-TSUP4
p413-Cas9-YJR096W target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-YJR096W gRNA-TSUP4
p413-Cas9-YMR226C target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-YMR226C gRNA-TSUP4
p413-Cas9-NRE1 target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-NRE1 gRNA-TSUP4
p413-Cas9-IRC24 target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-IRC24 gRNA-TSUP4
p413-Cas9-ENV9 target gRNA CEN/ARS plasmid, HIS3, PTDH3-CAS9- TTPI1, PSNR52-ENV9 gRNA-TSUP4
실시예 1. adh 유전자(adh1, adh2, adh3, adh4, adh5) 및 gpd 유전자(gpd1, gpd2)가 결손된 S. cerevisiae 균주(JHY605) 제작
adh 유전자(adh1, adh2, adh3, adh4, adh5) 및 gpd 유전자(gpd1, gpd2)가 결손된 S. cerevisiae 균주는 Cre/loxP 재조합 시스템을 이용하여 제작하였다. 유전자 결손을 위한 카세트는 pUG27(loxP-his5+-loxP 결손 카세트를 포함하는 플라스미드, Euroscarf, 독일) 또는 pUG72(loxP-URA3-loxP 결손 카세트를 포함하는 플라스미드, Euroscarf, 독일) 플라스미드를 주형으로 사용하여 PCR 증폭을 통해 획득하였다. 유전자 결손 카세트 제작을 위한 프라이머 세트로는, 서열번호 1 및 2(adh1), 서열번호 3 및 4(adh2), 서열번호 5 및 6(adh3), 서열번호 7 및 8(adh4), 서열번호 9 및 10(adh5), 서열번호 11 및 12(gpd1), 및 서열번호 13 및 14(gpd2)의 조합을 각각 해당 유전자를 결손시키기 위해 사용하였다.
S. cerevisiae 균주 CEN. PK2-1C(MATaura3-52trp1-289 leu2-3,112 his3β1 MAL2-8C SUC2)(Euroscarf, 독일)에 adh 유전자(adh1, adh2, adh3, adh4, adh5) 및 gpd 유전자(gpd1, gpd2)를 결손시키기 위해, 상기 유전자 결손용 카세트를 리튬 아세테이트를 이용한 화학적 형질전환 방법을 이용하여 도입시켰다. 이후, 상기 형질전환시킨 S. cerevisiae 균주를 SC 배지(20 g/L 포도당, 6.7 g/L YNB, 적당한 아미노산 첨가물)에서 배양하였으며, 각각의 유전자가 결손된 S. cerevisiae 균주를 선별하였다.
이때, 확인용 프라이머로서, 각각 서열번호 15 및 16(adh1), 서열번호 17 및 18(adh2), 서열번호 19 및 20(adh3), 서열번호 21 및 22(adh4), 서열번호 23 및 24(adh5), 서열번호 25 및 26(gpd1), 및 서열번호 27 및 28(gpd2) 조합을 이용하여 해당 유전자의 결손을 확인하였다.
adh 유전자(adh1, adh2, adh3, adh4, adh5) 및 gpd 유전자(gpd1, gpd2)가 결손된 S. cerevisiae 균주가 지니고 있는 선별마커를 제거하기 위해, Cre 재조합효소를 발현시키는 pSH63(TRP1, Cre recombinase under the control of GAL1 promoter, Euroscarf, 독일)로 형질전환시켰으며, 선별마커 유전자가 제거된 adh 유전자(adh1, adh2, adh3, adh4, adh5) 및 gpd 유전자(gpd1, gpd2)가 결손된 S. cerevisiae 균주를"JHY605"균주(CEN.PK2-1C adh1β::loxP adh2β::loxP adh3β::loxP adh4β::loxP adh5β::loxP gpd1β::loxP gpd2β::loxP)로 명명하였다.
실시예 2. adh 유전자(adh1, adh2, adh3, adh4, adh5), gpd 유전자(gpd1, gpd2) 및 BDH 유전자(bdh1)가 결손된 S. cerevisiae 균주(JHY901) 제작
실시예 1에서 제작한 JHY605 균주에 추가적으로 bdh1 유전자를 결손시킨 JHY901 균주를 제작하였다. JHY901 균주는 Cre/loxp 재조합 시스템을 이용하여 제작하였으며 실시예 1과 동일한 방법으로 수행하였다. 이때, bdh1 유전자 결손을 위한 카세트는 pUG27 플라스미드를 주형으로 사용하여, PCR 증폭을 통해 획득하였으며, bdh1 유전자 결손 카세트 제작을 위한 프라이머 세트로는 서열번호 29 및 30 조합을 이용하였다.
실시예 3. adh 유전자(adh1, adh2, adh3, adh4, adh5), gpd 유전자(gpd1, gpd2) 및 bdh 유전자(bdh1)가 결손되고, alsD, alsD 및 noxE 유전자가 도입된 S. cerevisiae 균주(JHY902A/ JHY902D) 제작
아세토락테이트 신타아제로는 바실러스 서브틸리스(Bacilus subtilis) 유래의 alsS(서열번호 31의 염기서열, 서열번호 32의 아미노산 서열), 아세토락테이트 디카복실레이즈로는 바실러스 서브틸리스 유래의 alsD(서열번호 33의 염기서열, 서열번호 34의 아미노산 서열)을 각각 사용하였다. 구체적으로, alsS 유전자 및 alsD 유전자는 바실러스 서브틸리스 유전체 DNA를 주형으로 PCR(alsS 유전자: 서열번호 35 및 36의 프라이머 세트, alsD 유전자: 서열번호 37 및 38의 프라이머 세트)을 통해 확보하였다. NADH 산화 효소로는 락토코커스 락티스(Lactococcus lactis) 유래의 noxE 유전자(서열번호 45의 염기서열, 서열번호 46의 아미노산 서열)를 사용하였다. noxE 유전자는 락토코커스 락티스의 유전체 DNA를 주형으로 PCR(서열번호 47 및 48의 프라이머 세트)을 통해 확보하였다. 상동재조합을 통해 유전자 카세트를 삽입하고자 ADH2 유전자의 ADH2-1(상위 301 bp, 서열번호 129)와 ADH2-2(하위 302 bp, 서열 번호 130) 및 YARCdelta4을 절반인 YARCdelta4-1(167 bp, 서열 번호 131)와 YARCdelta4-2(170 bp, 서열 번호 132)를 S. cerevisiae의 유전체 DNA를 주형으로 사용하여 PCR(상위 302 bp: 서열번호 133 및 134의 프라이머 세트, 하위 301 bp: 서열번호 135 및 136의 프라이머 세트) (YARCdelta4-1: 서열번호 137 및 138의 프라이머 세트, YARCdelta4-2: 서열번호 139 및 140의 프라이머 세트)을 통해 확보하였다.
alsS 유전자 및 alsD 유전자를 과발현시키기 위해, 각각 TDH3 프로모터(서열번호 39) 및 TEF1 프로모터(서열번호 40)와 CYC1 터미네이터(서열번호 41) 및 GPM1 터미네이터(서열번호 42)를 사용하였다. TDH3 프로모터 및 TEF1 프로모터는 각각 p414GPD, p414TEF 벡터(Mumberg et al., 1995)를 SacI, SpeI 제한효소로 처리하여 얻었다. GPM1 터미네이터는 S. cerevisiae의 유전체 DNA를 주형으로 사용하여 PCR(GPM1 터미네이터: 서열번호 43 및 44의 프라이머 세트)을 통해 얻었다. 얻어진 프로모터 절편은 SacI, SpeI 제한효소를 이용하여 클로닝하였고, 터미네이터 절편은 XhoI, KpnI 제한효소를 이용하여 클로닝하였다. 또한, noxE 유전자를 과발현하기 위해, FBA1 프로모터(서열번호 49)와 FBA1 터미네이터(서열번호 50)를 사용하였다. FBA1 프로모터 및 터미네이터는 S. cerevisiae의 유전체 DNA를 주형으로 사용하여 PCR(프로모터: 서열번호 51 및 52의 프라이머 세트, 터미네이터: 서열번호 53 및 54의 프라이머 세트)을 통해 얻었다. 이후, alsS 유전자와 noxE 및 alsD 유전자는 BamHI, XhoI 제한효소를 사용하여 클로닝하였고, 그에 따라 얻어진 벡터를 각각 p414_PTDH3-alsS-TCYC1, p414_PTEF1-alsD-TGPM1및 p414_PFBA1-noxE-TFBA1로 명명하였다.
최종적으로는 하나의 벡터를 사용하여 필요한 유전자를 모두 발현시키기 위하여, 앞서 클로닝 된 3종류의 벡터를 각각 주형으로 서열번호 55 및 56의 프라이머 세트를 사용하여 '프로모터-유전자-터미네이터'를 지니는 PCR 산물을 얻었다. 이 PCR 산물은 5' 말단에 MluI 제한효소 서열, 3' 말단에 AscI-NotI-MluI 서열을 갖는다. p413G 플라스미드 벡터(HIS3, PTDH3, TCYC1)(Mumberg et al., 1995)를 BssHII 제한효소로 처리하고 PCR 산물인 PTEF1-alsD-TGPM1을 MluI 제한효소로 처리하여 클로닝하여 p413-D 벡터를 획득하였다. 해당 벡터에 상동재조합에 필요한 서열을 유전자 카세트 양 말단에 추가로 삽입하고자 413GPD로부터 암피실린 저항성 유전자(Amp R)와 박테리아 복제시작점(pUG ori)을 포함한 PCR 산물과 ADH2-1 (또는 YARCdelta4-1), ADH2-2 (또는 YARCdelta4-2)을 오버랩 PCR (총 3가지 절편)을 통해 연결하였고 이를 SacI 및 NotI 제한효소로 처리한 p413-D 벡터에 삽입하였다. 또한 추가적인 클로닝은 벡터의 AscI, NotI 제한효소 자리와 PCR 산물의 MluI, NotI 제한효소 자리를 이용하였다. AscI과 MluI은 동일한 접착말단(sticky end)을 형성하므로 서로 접착이 가능하고, 접착된 후에는 각 효소에 의해 더 이상 인지되지 않기 때문에 PCR 산물에 포함되어 클로닝된 새로운 AscI 제한효소 자리를 이용하여 추가적인 클로닝이 가능하다. 이러한 방법을 통하여 PTDH3-alsS-TCYC1 및 PFBA1-noxE-TFBA1를 순차적으로 클로닝 하였고 최종적으로 ADH2-SDN 벡터 또는 delta-SDN 벡터가 제작되었다.
이후, 실시예 2에서 제조한 JHY901 균주의 결손된 adh2 유전자 자리에 alsS 유전자, alsD 유전자 및 noxE 유전자로 이루어진 아세토인 관련 유전자 삽입 카세트 I를 ADH2-SDN 플라스미드로부터 SwaI 제한효소를 처리하여 얻은 후 형질전환하였고 HIS3 선별마커는 Cre 재조합효소를 발현시키는 pSH63를 이용하여 제거하여 JHY902A 균주를 제작하였다. JHY902A 균주의 경우, 세포 성장 및 포도당 섭취 저해 현상이 나타났는데, 이는 피루브산 탈탄산효소(pyruvate decarboxylase)와 경쟁하는 아세토락테이트 탈탄산효소(alsS)의 발현 부족으로 인하여 세포 내 아세트알데히드의 축적되어 발생한 것으로 관찰되었다.
이에 S. cerevisiae 균주 내 수백여 개 존재하는 델타 서열을 타겟하는 다중 삽입 시스템(multi-copy integration)을 통해 alsS의 발현양을 조절하고자, 카세트 양 끝에 델타 서열이 추가된 alsS 유전자, alsD 유전자 및 noxE 유전자를 포함하는 아세토인 관련 유전자 삽입 카세트 II를 Delta-SDN 플라스미드로부터 SwaI 제한효소를 처리하여 얻은 후 JHY901 균주에 형질전환하였다. 무작위로 4개의 형질전환체(D1-D4)를 선택한 후 HIS3 선별마커는 Cre 재조합효소를 발현시키는 pSH63를 이용하여 제거하였다. 그 결과, D4 균주에서 세포 성장 및 포도당 섭취 저해 현상이 회복되었음을 확인하였으며, 이를 "JHY902D" 균주로 명명하였다.
실시예 4. 적응진화를 통해 아세토인 생산능이 향상된 S. cerevisiae 균주(JHY903) 선별
상기 실시예 3에서 제작한 JHY902D 균주를 아세토인 농도가 4 g/L 농도에서 점진적으로 16.5 g/L 농도까지 증가된 YPD 배지에 19회 연속적으로 계대배양하여 아세토인에 대한 저항성 및 아세토인 생산능이 증대된 JHY903 균주를 선별하였다. 그 후, JHY902D 균주와 JHY903 균주를 YPD 배지 및 18 g/L의 아세토인이 첨가된 YPD 배지에서 각각 배양하여 성장 정도를 확인하였다.
그 결과, JHY903 균주의 경우 아세토인이 첨가된 배지에서도 콜로니를 형성하는 반면, JHY902D 균주는 콜로니를 잘 형성하지 못하는 것을 확인하였다(도 2).
JHY903 균주와 상기 실시예 3에서 제작한 JHY902A 균주, D1 내지 D3 균주 및 JHY902D 균주의 아세토인에 대한 저항성 및 아세토인 생산능을 비교하였다. 아세토인 생산 배지로는 YPD5(50 g/L 포도당, 10 g/L yeast extract, 20 g/L bacto-peptone) 또는 YPD10(100 g/L 포도당, 10 g/L yeast extract, 20 g/L bacto-peptone)이 사용되었다. 세포 배양은 진탕배양기를 이용하여 30℃에서 170 rpm으로 진행하였다. 아세토인을 생산하기 위한 배양조건은 YPD5 배지를 사용하는 실험의 경우 초기접종 세포농도는 OD600=0.5로 고정하였고, 100 ㎖ 삼각플라스크에서 10 ㎖ 배지로 진행하였다. 또한, YPD10 배지를 사용한 실험의 경우 초기접종 세포농도는 OD600=5이며 100 ㎖ 삼각플라스크에서 10 ㎖ 배지로 진행하였다.
상기 아세토인에 대한 저항성은 시간이 경과함에 따라 아세토인 농도가 증가된 아세토인 생산 배지에서 세포농도를 측정하여 확인하였으며, 상기 아세토인을 비롯한 대사산물의 생산량은 아래와 같은 방법을 통해 확인하였다. 대사산물을 분석하기 위해, 각 균주의 배양액 800 ㎕를 원심분리하여 상등액을 얻고, 이를 0.22 ㎛ 필터로 여과하여 HPLC 분석을 진행하였다. 이때, UltiMate 3000 HPLC system(Thermo fishers scientific)을 이용하였고, BioRad Aminex HPX-87H 컬럼과 굴절률검출기(RI detector)를 사용하였다. 이동상은 5 mM 황산을 사용하였고, 유속은 0.6 ㎖/분, 온도는 60℃로 설정하였다.
그 결과, 도 3a 및 도 3b에 나타난 바와 같이, JHY902D 균주 및 JHY903 균주의 세포농도 및 글루코스 소모량이 JHY902A 균주 및 D1 내지 D3 균주보다 유의미하게 증가하였다. 특히, JHY903 균주의 세포농도는 JHY902A 균주 및 D1 내지 D3 균주보다 2배 이상 증가하였다.
또한, 도 4에 나타난 바와 같이, JHY902D 균주 및 JHY903 균주의 아세토인 생산량이 유의미하게 증가한 것을 확인하였다. 특히, JHY902D 균주의 경우 아세토인뿐만 아니라 2,3-부탄다이올의 생산량이 증가한 반면, JHY903 균주의 경우 아세토인 생산량이 약 24.5% 증가하였지만, 2,3-부탄다이올과 같은 부산물의 생산량 감소하였다.
실시예 5. 적응진화된 S. cerevisiae 균주(JHY903)의 유전자 돌연변이 분석
상기 실시예 4에서 선별한 적응진화된 JHY903 균주의 게놈을 마크로젠에 의뢰하여 염기서열을 분석하였다. 그 결과, 유전체 내 총 4개의 유전자가 돌연변이 되었음이 확인되었으며, 돌연변이된 유전자에 대한 정보를 하기 표 3에 나타내었다.
유전자 돌연변이 종류 아미노산 변화
EMP46 Missense(TTG->TTT) 160Leu->Phe
PEP7 Missense(CAA->AAA) 169Gln->Lys
SUR1 Missense(CAT->TAT) 176His->Tyr
HXK2 Nonsense(GGA->TGA) 252Gly->Stop
실시예 6. 아라비노스 탈수소효소(ARA1) 유전자 또는 2,3-부탄다이올 생산과 관련된 유전자 추가 결손 균주(JHY903-X) 제작
JHY903 균주는 두가지 효소(AlsS, AlsD) 반응에 의하여 R-아세토인 타입을 주요 아세토인 입체이성질체로서 생산하였다. 한편, 2,3-부탄다이올 탈수소효소(BDH1)은 아세토인에 대해(R)-입체 특이적 알코올 환원효소 활성을 가지며 아라비노스 탈수소효소(ARA1)는 아세토인에 대해(S)-입체 특이적 알코올 환원효소 활성을 가진다는 것이 알려져 있다. 이에, 2,3-부탄다이올의 생산을 줄이기 위해, JHY903 균주에서 bdh2 유전자, gre3 유전자, yjr096w 유전자, ara1 유전자, ypr1 유전자, nre1 유전자, irc24 유전자, env9 유전자 또는 ymr226c 유전자를 추가 결손시켰다.
유전자를 결손시키는 방법으로 CRISPR/Cas9 시스템으로서, Coex413-Cas9-target gene gRNA 플라스미드를 이용하였다. 이때, Coex413-Cas9-target gene gRNA 플라스미드는 실시예 3의 p413-SDN 플라스미드 제조방법과 동일하게 수행하였으며, 이때, 각각의 결손 유전자는 하기 표 4에 기재된 프라이머 세트를 이용하였다.
서열정보 서열번호
ARA1 target gRNA F TACGAATGGCTCTGTCTCGTGTTTTAGAGCTAGAAATAGC 57
ARA1 target gRNA R ACGAGACAGAGCCATTCGTAGATCATTTATCTTTCACTGC 58
BDH2 target gRNA F AAGGTAGTTGTCGAGCCCACGTTTTAGAGCTAGAAATAGC 59
BDH2 target gRNA R GTGGGCTCGACAACTACCTTGATCATTTATCTTTCACTGC 60
YPR1 target gRNA F ATGCAAGAGTTGCCAAAGACGTTTTAGAGCTAGAAATAGC 61
YPR1 target gRNA R GTCTTTGGCAACTCTTGCATGATCATTTATCTTTCACTGC 62
GRE3 target gRNA F TGGTTGTAGAATCAAGCCCGGTTTTAGAGCTAGAAATAGC 63
GRE3 target gRNA R CGGGCTTGATTCTACAACCAGATCATTTATCTTTCACTGCG 64
YJR096W target gRNA F AGAAGCGGTTGATGAAGGATGTTTTAGAGCTAGAAATAGC 65
YJR096W target gRNA R ATCCTTCATCAACCGCTTCTGATCATTTATCTTTCACTGC 66
YMR226C target gRNA F AGTTAGATACAGAGGTAACGGTTTTAGAGCTAGAAATAGC 67
YMR226C target gRNA R CGTTACCTCTGTATCTAACTGATCATTTATCTTTCACTGC 68
NRE1 target gRNA F AGGTATCGGTAAGTCCATCGGTTTTAGAGCTAGAAATAGC 69
NRE1 target gRNA R CGATGGACTTACCGATACCTGATCATTTATCTTTCACTGCG 70
IRC24 target gRNA F CGTCTACGGCGTAGCAAGAAGTTTTAGAGCTAGAAATAGC 71
IRC24 target gRNA R TTCTTGCTACGCCGTAGACGGATCATTTATCTTTCACTGCG 72
ENV9 target gRNA F AGGAAGATTGCTGTAGTAACGTTTTAGAGCTAGAAATAGC 73
ENV9 target gRNA R GTTACTACAGCAATCTTCCTGATCATTTATCTTTCACTGCG 74
이후, 하기 표 5의 프라이머 및 PCR을 이용해 각각의 해당 유전자 결손을 확인하였다.
서열정보 서열번호
ARA1 upstream F GCCTCCACCTTAACATCTTA 75
ARA1 downstream R ACGTACGGCGAATGATTATA 76
BDH2 upstream F GCATTGGTTAGCTCAGATAT 77
BDH2 downstream R CTGCCCCACTTTTAT ATGTC 78
YPR1 upstream F AGCCTATTTGGAAAAGACTG 79
YPR1 downstream R CAGTAGAAGCGCAACTAGTA 80
GRE3 upstream F TGTTTCCCAATTGTTGCTGG 81
GRE3 downstream R TTGGGACCGCTTTGCTCTCT 82
YJR096W upstream F TTGTCCTTATTTGAGGCTCC 83
YJR096W downstream R ATTGCGCTTATCTTTTGGCA 84
YMR226C upstream F AACACTCGACCAGAACGATC 85
YMR226C downstream R CAGCCTAGTTTAGCCAAATC 86
NRE1 upstream F TCAATATCTCCGCTACAACG 87
NRE1 downstream R GATGTAATGTGACGGCAGCC 88
IRC24 upstream F TTCTTGTCAACAGGTGCTAG 89
IRC24 downstream R TTACCGATACCTCTGGAAAC 90
ENV9 upstream F ATTGAGCCACAGGTCTTTCG 91
ENV9 downstream R AGATCCAAGCCTGATAGACC 92
사용한 Coex413-Cas9-target gene gRNA 플라스미드는 YPD 배지에 약 18시간 배양하여 제거하였다. 상기 추가 결손시킨 JHY903-1 내지 JHY903-9 균주는 YPD(50 g/L 포도당, 10 g/L yeast extract, 20 g/L bacto-peptone)에서 배양하였다. Coex413-Cas9-target gene gRNA 플라스미드를 포함하는 균주의 경우 SC-HWU배지(20 g/L 포도당, 6.7 g/L YNB, 히스티딘, 트립토판, 우라실을 제외한 아미노산 첨가물)에서 배양하였다. 아세토인을 생산하기 위한 배양조건은 YPD5 또는 SC-HWU 배지를 사용하는 실험의 경우 초기접종 세포농도는 OD600=0.5으로 고정하였고, 100 ㎖ 삼각플라스크에서 10 ㎖ 배지로 진행하였다. 실시예 4와 동일한 방법으로 세포농도, 아세토인 생산량 및 2,3-부탄다이올 생산량을 측정하였다. 그 결과, 상기 JHY903-1 내지 JHY903-9 균주 중에서 JHY903-2 균주 및 JHY903-6 균주의 세포농도가 JHY903 균주에 비해 감소하였으며, 글루코스 흡수율에서는 유의미한 차이가 나타나지 않았다(도 5a 및 도 5b). 또한, 대사산물 생산량과 관련하여, JHY903-4 균주의 경우, 2,3-부탄다이올 생산량이 약 36.1% 감소하였으나, 아세토인의 생산량은 JHY903 균주에 비해 유의미하게 증가하지 않았다. 또한, JHY903-4 균주의 경우 ara1 유전자를 제거하였음에도 불구하고 여전히 2,3-부탄다이올이 생산되었고, 이를 통해, 2,3-부탄다이올 생산에 관여하는 효소가 여전히 세포 내 존재하는 것을 알 수 있었다. 또한, JHY903-2, JHY903-5 및 JHY 903-7 균주에서 2,3-부탄다이올 생산량이 감소됨을 확인하였다. 이들 균주들 중에서 JHY903-5 균주의 경우, 아세토인의 생산량이 JHY903 균주에 비해 유의미하게 증가하였다(도 6).
실시예 7. In vitro 분석을 통한 ARA1, YPR1 및 YMR226C 효소들의 아세토인에 대한 반응성 확인
ARA1, YPR1 또는 YMR226C 효소가 아세토인을 2,3-부탄다이올로 환원시키는지 여부를 직접적으로 확인하고자, C-말단에 His6를 태그한 각 단백질을 Ni-NTA 시스템을 통해 정제한 후 라세믹 아세토인(3R/S-아세토인)과 보조인자(NADH 혹은 NADPH)를 첨가하여 반응시킨 후 반응물질을 분석하였다.
이때, C-말단에 His6가 결합된 ARA1, YPR1 또는 YMR226C 효소를 정제하기 위해, 대장균 Rogetta gami2(DE3)를 사용하였다. 각각의 효소 및 His6를 코딩하는 유전자가 적재된 플라스미드를 제작하기 위해, 하기 표 6에 기재된 프라이머를 이용하여 각각의 유전자를 확보한 후, NcoI 및 NotI의 제한효소가 처리된 pET-28b 벡터에 동일한 제한효소가 처리된 각각의 유전자를 결합시켜 C-말단에 His6를 붙인 YPR1, 또는 YMR226C 효소를 코딩하는 유전자가 적재된 pET-YPR1-His 및 pET-YMR226C-His 플라스미드를 제작하였고 PscI과 NotI의 제한효소가 처리된 ARA1 유전자를 결합시켜 pET-ARA1-His 플라스미드를 제작하였다.
서열정보 서열번호
ARA1 for pET PscI F TCGAACATGTCCTCTTCTTCAGTAGCCTCAAC 93
ARA1 for pET NotI R TCGAGCGGCCGCATACTTTAAATTGTCCAAGTTTGG 94
YPR1 for pET NcoI F TCGACCATGGGTCCTGCTACGTTAAAGAATTC 95
YPR1 for pET NotI R TCGAGCGGCCG CTTGGAAAATTGGGAAGGATC 96
YMR226C for pET NcoI F TCGACCATGGGTTCCCAAGGTAGAAAAGCTGC 97
YMR226C for pET NotI R TCGAGCGGCCGCTCCACGGAAGATATGATGAG 98
각각의 pET-ARA1-His, pET-YPR1-His 및 pET-YMR226C-His 플라스미드로 형질전환된 대장균은 30 ㎍/㎖ 카나마이신과 20 ㎍/㎖ 클로람페니콜이 포함된 LB 배지에 접종한 후 37℃에서 O.D600 값이 0.8 내지 1.0에 도달할 때까지 배양하였다. 1 mM IPTG를 첨가한 후 30℃에서 5시간 배양하여 단백질 발현을 유도하였다. 원심 분리를 통해 세포를 모은 후, 0.1% protease inhibitor cocktail과 1 mM PMSF(phenylmethylsulfonyl fluoride)가 포함된 결합버퍼(50 mM Tris-HCl(pH8.0) 100 mM NaCl, 5 mM imidazole, 0.1 mM EDTA)에 현탁한 후 초음파 파쇄기를 이용하여 세포를 용해(20초-on, 10초-off 주기로 30분 동안 수행)하였다. 원심분리를 통해 상등액을 얻은 후 HisPur Ni-NTA 레진과 4℃에서 1시간 30분 동안 반응시켰다. 그 후 Ni-NTA 레진을 워시 버퍼(40 mM Tris-HCl(pH 8.0), 500 mM NaCl, 50 mM imidazole, 0.1 mM EDTA)를 이용하여 세척한 후, Econo-Pac® 크로마토그래피 컬럼에 로딩하였다. 용출 버퍼(50 mM Tris-HCl(pH 8.0), 50 mM NaCl, 300 mM imidazole, 0.1 mM EDTA)를 이용하여 각각의 효소를 용리한 후, 1.2% SDS-PAGE를 이용하여 단백질 순도를 확인하였다. 순도 확인 후, 높은 순도를 가진 부분만 모아 Microcon-30kDa Centrifugal Filter Unit을 이용하여 반응 버퍼로 버퍼 교환을 수행하였다.
상기 수득한 ARA1, YPR1과 YMR226C 효소의 입체특이성과 선택성을 확인하기 위해, 125 μM의 각 효소와 5 mM(R/S)-아세토인, 5 mM NADH 또는 NADPH가 포함된 50 mM Tris-HCl(pH 7.0) 버퍼에 약 24시간 동안 반응시켰다.
대사산물을 분석하기 위하여 배양액 800 ㎕를 원심분리하여 상등액을 얻고, 이를 0.22 μm 필터로 여과하여 HPLC 분석을 진행하였다. UltiMate 3000 HPLC system(Thermo fishers scientific)을 이용하였고, BioRad Aminex HPX-87H 컬럼과 굴절률검출기(RI detector)를 사용하였다. 그 후, 아세토인과 2,3-부탄다이올 입체이성질체를 분석하기 위해, HPLC 분석 샘플을 에틸 아세테이트를 1:1로 혼합한 후 추출하였고, GC(gas chromatography) 분석을 진행하였다. 상기 GC 분석은 β-DEXTM 120 컬럼이 장착된 450-GC(Bruker)의 FID(275℃)와 헬륨을 운반기체(25 ㎖/min)로 사용하였다. 컬럼의 온도는 75℃에서 8분 동안 유지하였고, 분당 2℃씩 증가시켜 85℃에 도달한 후 14분 동안 유지시켰다.
그 결과, ARA1, YPR1, 및 YMR226C 효소가 아세토인을 2,3-부탄다이올로 전환하는 것을 확인하였다(도 7). 구체적으로, ARA1 효소 및 YPR1 효소의 반응물을 각각 분석한 결과, 라세믹 아세토인으로부터 S,S-2,3-부탄다이올 및 meso-2,3-부탄다이올이 생산되었고, 이는 해당 효소들이 아세토인에 대한(S)-입체특이적 알코올 형성 환원효소 활성을 가진다는 것을 의미한다. 또한, YPR1 효소의 경우 3R-아세토인에 대한 입체 선택성이 높다는 것을 확인하였다. 반면, YMR226C 효소의 경우(S)-알코올 형성 환원효소 활성뿐만 아니라(R)-알코올 형성 환원효소 활성을 가지며 3S-아세토인에 대한 입체 선택성이 높았다. ARA1 효소와 YPR1 효소는 NADH와 NADPH를 모두 조효소로 사용하지만 YMR226C 효소의 경우 NADPH만을 선택적으로 사용하여 아세토인을 2,3-부탄다이올로 환원시켰다.
실시예 8. 아라비노스 탈수소 효소(ARA1) 또는 NADP-의존적 알도-케도 환원 효소 (YPR1)가 과발현된 균주의 대사산물 생산능 확인
상기 실시예 7에서 2,3-부탄다이올로의 환원 효과를 확인한 ARA1 효소 및YPR1 효소를 각각 JHY903 균주에 과발현시키는 경우 meso-2,3-부탄다이올의 생산량이 증가하는지 확인하기 위해, ARA1 효소 및 YPR1 효소를 각각 JHY903 균주에 과발현 시킨 후, 실시예 4와 동일한 방법으로 균주의 세포농도, 아세토인 생산량 및 2,3-부탄다이올 생산량을 측정하였다.
먼저, 효모 세포 내 ARA1 및 YPR1 효소를 과발현하는 플라스미드를 제조하기 위해, 하기 표 7에 기재된 프라이머를 이용하여 각각의 유전자를 확보하였다. 이 후, SpeI 및 BamHI의 제한효소가 처리된 p416G 벡터에 NheI 및 BamHI의 제한효소가 처리된 ARA1 유전자를 결합시켜 p416G-ARA1을 제작하였다. 또한, SpeI 및 XhoI이 처리된 p416G 벡터에 동일한 제한효소가 처리된 YPR1 유전자를 결합시켜 p416G-YPR1을 제작하였다.
서열정보 서열번호
ARA1 for pRS NheI F TCGAGCTAGCATGTCTTCTTCAGTAGCCTC 99
ARA1 for pRS BamH1 R TCGAGGATCCTTAATACTTTAAATTGTCCAAGTTTG 100
YPR1 for pRS SpeI F TCGAACTAGTATGCCTGCTACGTTAAAGAA 101
YPR1 for pRS XhoI R TCGACTCGAGTCATTGGAAAATTGGGAAGGA 102
리튬 아세테이트를 이용한 화학적 형질전환 방법을 이용하여 JHY903 균주에 p413G (HIS3, PTDH3, TCYC1)(Mumberg et al., 1995), p414G (TRP1, PTDH3, TCYC1)(Mumberg et al., 1995), 및 p416G (URA3, PTDH3, TCYC1)(Mumberg et al., 1995) 플라스미드를 넣어 JHY903 [EV] 균주를 제조하였다. 또한, p413G, p414G, 및 p416G-ARA1 플라스미드를 넣어 ARA1 효소를 과발현하는 JHY903 균주 (이하, JHY903 [ARA1]) 및 p413G, p414G, 및 p416G-YPR1 플라스미드를 넣어 YPR1 효소를 과발현하는 JHY903 균주 (이하, JHY903 [YPR1])을 제조하였다.
그 결과, JHY903 균주와 비교하여 JHY903 [ARA1] 및 JHY903 [YPR1]의 세포농도 및 글루코스 소모량에서는 유의미한 차이가 나타나지 않았다(도 8a 및 도 8b). 한편, JHY903 균주와 비교하여 JHY903 [ARA1] 균주 및 JHY903 [YPR1] 균주의 2,3-부탄다이올의 생산량이 유의미하게 증가하였다(도 9a). 또한, JHY903 균주뿐만 아니라, JHY903 [ARA1] 균주 및 JHY903 [YPR1] 균주 모두 아세토인 생산량이 높은 것을 확인하였다(도 9b).
실시예 9. Meso-2,3-부탄다이올 생산 경로가 차단된 최종 균주 및 이의 아세토인 생산능 확인
ypr1 유전자 및 ymr226c 유전자들의 제거를 통해 Meso-2,3-부탄다이올 생산 경로가 차단시켜 아세토인 생산능이 증가된 균주를 제작하고자 하였다. 먼저, Meso-2,3-부탄다이올 생산을 줄이기 위하여 ara1 유전자 및 ypr1 유전자가 추가로 결손된 균주(JHY903-45)를 제작하였으며, 나아가, ara1 유전자, ypr1 유전자 및 ymr226c 유전자가 추가로 결손된 균주(JHY903-459)를 제작하였다. 이때, JHY903 균주, JHY903-4 균주, JHY903-45 균주 및 JHY903-459 균주는 실시예 6과 동일한 방법으로 유전자를 추가로 결손시켰으며, 실시예 4와 동일한 방법으로 세포농도 및 아세토인 및 meso-2,3-부탄다이올의 생산량을 확인하였다. 상기 균주들의 대사산물 생산량을 하기 표 8에 정리하여 나타내었다.
Strain Description Fermentation time(h) Products(g/L) Productivity
of acetoin
(g/(L·h))		 Yield
of acetoin
(g/g glucose)
Glycerol Ethanol R,R/S,S-2,3-BDO Meso-2,3-BDO Acetoin
Batch flask fermentation
JHY903 Evolved strain of adh1-5β gpd1,2β bdh1β delta::alsS-alsD-noxE 28 0.26±0.00 0.06±0.00 0.07±0.02 0.51±0.06 22.70±0.05 0.811±0.002 0.447±0.000
JHY903-4 JHY903 ara1β 28 0.30±0.07 0.05±0.00 0.09±0.00 0.36±0.02 22.77±0.07 0.813±0.003 0.448±0.000
JHY903-45 JHY903 ara1β ypr1β 28 0.25±0.00 0.06±0.00 0.08±0.00 0.19±0.00 23.04±0.05 0.823±0.002 0.454±0.000
JHY903-459 JHY903 ara1β ypr1β ymr226cβ 28 0.34±0.08 0.05±0.00 0.11±0.00 0.19±0.01 24.76±0.13 0.884±0.005 0.488±0.001
그 결과, JHY903-45 균주의 경우, meso-2,3-부탄다이올의 생산량이 JHY903 균주에 비해 약 47.2% 감소되었다. JHY903-459 균주의 경우, 50.73 g/L의 포도당으로부터 약 24.76 g/L의 아세토인을 생산하였으며, 이는 이론 생산 수율의 약 99.78%에 미치는 효율인 것을 확인하였다(도 10a, 도 10b 및 도 11).

Claims (22)

  1. 모균주에 비해,
    i) 알코올 탈수소효소(alcohol dehydrogenase), 글리세롤-3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 2,3-부탄다이올 탈수소효소(2,3-butanediol dehydrogenase)의 활성이 감소되고,
    ii) 아세토락테이트 신타아제(acetolactate synthase), 아세토락테이트 디카복실레이즈(acetolactate decarboxylase) 및 NADH 산화효소(NADH oxidase)의 활성이 증가되며,
    iii) EMP46, PEP7, SUR1, HXK2 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나가 돌연변이된, 유전적으로 조작된 효모.
  2. 제1항에 있어서,
    상기 알코올 탈수소효소는 ADH1, ADH2, ADH3, ADH4, ADH5 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나인 것인, 유전적으로 조작된 효모.
  3. 제1항에 있어서,
    상기 글리세롤-3-인산 탈수소효소는 GPD1, GPD2 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나인 것인, 유전적으로 조작된 효모.
  4. 제1항에 있어서,
    상기 효모는 아세토락테이트 신타아제를 코딩하는 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 유전자, NADH 산화효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 외인성 유전자(exogenous gene)를 포함하는 것인, 유전적으로 조작된 효모.
  5. 제1항에 있어서,
    상기 EMP46 돌연변이는 서열번호 116으로 표시되는 염기서열 중 480번째 염기인 구아닌(guanin)이 티민(thymine)으로 치환된 것인, 유전적으로 조작된 효모.
  6. 제1항에 있어서,
    상기 PEP7 돌연변이는 서열번호 118로 표시되는 염기서열 중 505번째 염기인 사이토신(cytosine)이 아데닌(adenine)으로 치환된 것인, 유전적으로 조작된 효모.
  7. 제1항에 있어서,
    상기 SUR1 돌연변이는 서열번호 120으로 표시되는 염기서열 중 526번째 염기인 사이토신이 티민으로 치환된 것인, 유전적으로 조작된 효모.
  8. 제1항에 있어서,
    상기 HXK2 돌연변이는 서열번호 122로 표시되는 염기서열 중 754번째 염기인 구아닌이 티민으로 치환된 것인, 유전적으로 조작된 효모.
  9. 제1항에 있어서,
    상기 효모는 아라비노스 탈수소효소(arabinose dehydrogenase), NADP-의존적 알도-케도 환원 효소(NADPH-dependent aldo-keto reductase), NADP-의존적 3-히드록시산 탈수소효소(NADP-dependent 3-hydroxy acid dehydrogenase) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 활성이 감소된 것인, 유전적으로 조작된 효모.
  10. 제9항에 있어서,
    상기 효모는 아라비노스 탈수소효소를 코딩하는 유전자, NADP-의존적 알도-케도 환원 효소를 코딩하는 유전자, NADP-의존적 3-히드록시산 탈수소효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나가 결실된 것인, 유전적으로 조작된 효모.
  11. 제10항에 있어서,
    상기 아라비노스 탈수소효소는 서열번호 124로 표시되는 염기서열을 포함하는 ara1 유전자에 의해 코딩되는 것인, 유전적으로 조작된 효모.
  12. 제10항에 있어서,
    상기 NADP-의존적 알도-케도 환원 효소는 서열번호 126으로 표시되는 염기서열을 포함하는 ypr1 유전자에 의해 코딩되는 것인, 유전적으로 조작된 효모.
  13. 제10항에 있어서,
    상기 NADP-의존적 3-히드록시산 탈수소효소는 서열번호 128로 표시되는 염기서열을 포함하는 ymr226c 유전자에 의해 코딩되는 것인, 유전적으로 조작된 효모.
  14. 제1항에 있어서,
    상기 효모 세포는 사카로마이세스(Saccharomyces) 속 균주인 것인, 유전적으로 조작된 효모.
  15. 제14항에 있어서,
    상기 사카로마이세스 속 균주는 사카로마이세스 세레비지애(S. scerevisiae), 사카로마이세스 바야누스(S. bayanus), 사카로마이세스 파라독서스 (S. paradoxus), 사카로마이세스 미카테(S. mikatae), 및 사카로마이세스 쿠드리아브제비(S. kudriavzevii)로 이루어진 군으로부터 선택되는 어느 하나인 것인, 유전적으로 조작된 효모.
  16. i) 제1항 내지 제15항 중 어느 한 항의 유전적으로 조작된 효모를 배양하는 단계; 및
    ii) 상기 효모로부터 생산되는 아세토인을 수득하는 단계를 포함하는, 아세토인의 생산방법.
  17. 제16항에 있어서,
    상기 배양은 글루코스 존재 하에 효모를 배양하는 것을 특징으로 하는 것인, 아세토인의 생산방법.
  18. i) 야생형 효모의 알코올 탈수소효소를 코딩하는 유전자, 글리세롤-3-인산 탈수소효소를 코딩하는 유전자, 2,3-부탄다이올 탈수소효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나를 결실시키는 단계;
    ii) 아세토락테이트 신타아제를 코딩하는 유전자, 아세토락테이트 디카복실레이즈를 코딩하는 유전자, NADH 산화효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 외인성 유전자를 도입시키는 단계; 및
    iii) 상기 효모를 아세토인이 첨가된 배지에서 적어도 15회 계대배양하는 단계를 포함하는,
    아세토인 생산능이 우수한 효모를 제조하는 방법.
  19. 제18항에 있어서,
    상기 아세토인이 첨가된 배지는 적어도 4 g/L 농도의 아세토인이 첨가된 것을 특징으로 하는 것인, 방법.
  20. 제18항에 있어서,
    ii) 단계 후, 상기 효모에 아라비노스 탈수소효소를 코딩하는 유전자, NADP-의존적 알도-케도 환원 효소를 코딩하는 유전자, NADP-의존적 3-히드록시산 탈수소효소를 코딩하는 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나를 결실시키는 단계를 추가적으로 포함하는 것인, 방법.
  21. 제18항 내지 제20항 중 어느 한 항의 방법으로 제조된, 아세토인 생산능이 우수한 효모.
  22. i) 제21항의 아세토인 생산능이 우수한 효모를 배양하는 단계; 및
    ii) 상기 효모로부터 생산되는 아세토인을 수득하는 단계를 포함하는, 아세토인의 생산방법.
PCT/KR2020/014539 2020-07-03 2020-10-22 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법 WO2022004953A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200082364A KR102306725B1 (ko) 2020-07-03 2020-07-03 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법
KR10-2020-0082364 2020-07-03

Publications (1)

Publication Number Publication Date
WO2022004953A1 true WO2022004953A1 (ko) 2022-01-06

Family

ID=77920405

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/014539 WO2022004953A1 (ko) 2020-07-03 2020-10-22 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법

Country Status (2)

Country Link
KR (1) KR102306725B1 (ko)
WO (1) WO2022004953A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120129953A (ko) * 2010-02-12 2012-11-28 캘리포니아 인스티튜트 오브 테크놀로지 연료, 화학물질, 그리고 아미노산의 향상된 생산을 위한 감소된 부산물 축적을 갖는 효모 미생물
JP2014039533A (ja) * 2012-03-15 2014-03-06 Toyota Central R&D Labs Inc 酵母における外来遺伝子の発現産物の生産方法、酵母における発現調節剤及びその利用
JP2017085918A (ja) * 2015-11-04 2017-05-25 Ｊｘエネルギー株式会社 キシロースからエタノールを生産する酵母
KR20170065242A (ko) * 2015-12-03 2017-06-13 서울대학교산학협력단 아세토인 생산능을 갖는 유전적으로 조작된 효모 세포 및 그를 사용하여 아세토인을 생산하는 방법
KR20190008805A (ko) * 2017-07-17 2019-01-25 서울대학교산학협력단 젖산 생산능 향상에 관여하는 재조합 sur1 유전자 및 이를 포함하는 형질전환 미생물

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150081821A (ko) 2014-01-07 2015-07-15 최종성 천년여왕
KR20160006582A (ko) 2014-07-09 2016-01-19 한국전자통신연구원 사용자의 위치가 삽입된 오디오 신호를 처리하는 장치 및 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120129953A (ko) * 2010-02-12 2012-11-28 캘리포니아 인스티튜트 오브 테크놀로지 연료, 화학물질, 그리고 아미노산의 향상된 생산을 위한 감소된 부산물 축적을 갖는 효모 미생물
JP2014039533A (ja) * 2012-03-15 2014-03-06 Toyota Central R&D Labs Inc 酵母における外来遺伝子の発現産物の生産方法、酵母における発現調節剤及びその利用
JP2017085918A (ja) * 2015-11-04 2017-05-25 Ｊｘエネルギー株式会社 キシロースからエタノールを生産する酵母
KR20170065242A (ko) * 2015-12-03 2017-06-13 서울대학교산학협력단 아세토인 생산능을 갖는 유전적으로 조작된 효모 세포 및 그를 사용하여 아세토인을 생산하는 방법
KR20190008805A (ko) * 2017-07-17 2019-01-25 서울대학교산학협력단 젖산 생산능 향상에 관여하는 재조합 sur1 유전자 및 이를 포함하는 형질전환 미생물

Also Published As

Publication number Publication date
KR102306725B1 (ko) 2021-09-30

Similar Documents

Publication Publication Date Title
CN106661540B (zh) 通过重组菌株从葡萄糖生产木糖醇
US7700319B2 (en) Production of 3-hydroxypropionic acid using beta-alanine/pyruvate aminotransferase
KR101946649B1 (ko) 산화환원효소 활성을 갖는 폴리펩티드 및 그의 용도
US7109010B2 (en) Methods and materials for the synthesis of organic products
EP2308959A1 (en) Novel microorganism and its use in lignocellulose detoxifixcation
CN110914435B (zh) 产依克多因酵母
US9328358B2 (en) Method of producing 2, 3-butanediol using recombinant yeast
WO2019203436A1 (ko) 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
KR101581504B1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
KR102109763B1 (ko) 2,3―부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3―부탄디올의 생산 방법
WO2022004953A1 (ko) 아세토인 생산능을 갖는 유전적으로 조작된 효모 및 이를 이용한 아세토인 생산방법
KR101819189B1 (ko) 아세토인 생산능을 갖는 유전적으로 조작된 효모 세포 및 그를 사용하여 아세토인을 생산하는 방법
WO2016122107A1 (ko) 2,3-부탄다이올 또는 아세토인 생산능을 갖는 유전적으로 조작된 효모 세포 및 그를 사용하여 2,3-부탄다이올 또는 아세토인을 생산하는 방법
KR101773123B1 (ko) 2,3-부탄다이올 생산능을 갖는 유전적으로 조작된 효모 세포 및 그를 사용하여 2,3-부탄다이올을 생산하는 방법
KR102303662B1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
JP2008283917A (ja) 乳酸の製造方法
US20120058563A1 (en) Production of 2-keto-l-gulonic acid
JP4162383B2 (ja) ホモグルタミン酸の生産に関与する遺伝子およびその使用
WO2024071491A1 (ko) 마이코스포린 유사 아미노산 생산능을 갖는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산 방법
KR102613937B1 (ko) 갈락토스 이용에 관여하는 모든 유전자가 결손된 효모 균주 및 이를 이용한 재조합 단백질 생산방법
KR20110097157A (ko) 포도당을 보조기질로 이용할 수 있는 자일리톨 생산 균주 및 고생산성 발효 방법
WO2024117834A1 (ko) 1,3-propanediol과 3-hydroxypropionic acid를 동시 생산하는 미생물 및 이의 용도
WO2014182054A1 (ko) 3,6-안하이드로-l-갈락토오스를 대사하는 재조합 미생물 및 이의 용도
WO2013085321A1 (ko) 3-하이드록시프로피온알데히드 및/또는 3-하이드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-하이드록시프로피온알데히드 및/또는 3-하이드록시프로피온산의 생산방법
JP2011097929A (ja) イソプロピルアルコール生産酵母及びイソプロピルアルコール生産方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20942666

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20942666

Country of ref document: EP

Kind code of ref document: A1