WO2013041844A2 - Antibodies, variable domains & chains tailored for human use - Google Patents

Antibodies, variable domains & chains tailored for human use Download PDF

Info

Publication number
WO2013041844A2
WO2013041844A2 PCT/GB2012/052296 GB2012052296W WO2013041844A2 WO 2013041844 A2 WO2013041844 A2 WO 2013041844A2 GB 2012052296 W GB2012052296 W GB 2012052296W WO 2013041844 A2 WO2013041844 A2 WO 2013041844A2
Authority
WO
WIPO (PCT)
Prior art keywords
human
gene segments
gene
vertebrate
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2012/052296
Other languages
English (en)
French (fr)
Other versions
WO2013041844A3 (en
WO2013041844A9 (en
Inventor
Allan Bradley
Glenn Friedrich
E-Chiang Lee
Mark STRIVENS
Nicholas ENGLAND
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kymab Ltd
Original Assignee
Kymab Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=46889370&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2013041844(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from GB201116120A external-priority patent/GB201116120D0/en
Priority claimed from GB201116122A external-priority patent/GB201116122D0/en
Priority claimed from GBGB1203257.9A external-priority patent/GB201203257D0/en
Priority claimed from GBGB1204592.8A external-priority patent/GB201204592D0/en
Priority claimed from GBGB1205702.2A external-priority patent/GB201205702D0/en
Priority claimed from GBGB1208749.0A external-priority patent/GB201208749D0/en
Priority claimed from GB201211692A external-priority patent/GB201211692D0/en
Priority to JP2014531302A priority Critical patent/JP5813880B2/ja
Priority to BR112014006390A priority patent/BR112014006390A2/pt
Priority to EP16189625.3A priority patent/EP3128009B1/en
Priority to CN201280056727.0A priority patent/CN104080916A/zh
Priority to ES12772122.3T priority patent/ES2612935T3/es
Priority to AU2012311286A priority patent/AU2012311286B2/en
Priority to EP20188009.3A priority patent/EP3839049A3/en
Priority to HK14108036.3A priority patent/HK1194757B/en
Priority to NZ623756A priority patent/NZ623756B2/en
Priority to CA2846319A priority patent/CA2846319A1/en
Priority to EP12772122.3A priority patent/EP2758535B1/en
Application filed by Kymab Ltd filed Critical Kymab Ltd
Publication of WO2013041844A2 publication Critical patent/WO2013041844A2/en
Publication of WO2013041844A3 publication Critical patent/WO2013041844A3/en
Priority to US14/052,259 priority patent/US20140041067A1/en
Anticipated expiration legal-status Critical
Publication of WO2013041844A9 publication Critical patent/WO2013041844A9/en
Priority to US15/786,281 priority patent/US20180030121A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278Knock-in vertebrates, e.g. humanised vertebrates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/16Antivirals for RNA viruses for influenza or rhinoviruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • A61P33/02Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06Antimalarials
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/081Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
    • C07K16/085Herpetoviridae, e.g. pseudorabies virus, Epstein-Barr virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/081Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
    • C07K16/085Herpetoviridae, e.g. pseudorabies virus, Epstein-Barr virus
    • C07K16/088Varicella-zoster virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/081Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
    • C07K16/085Herpetoviridae, e.g. pseudorabies virus, Epstein-Barr virus
    • C07K16/089Cytomegalovirus
    • C07K16/108
    • C07K16/114
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1217Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Neisseriaceae (F)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1228Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K16/1232Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia from Escherichia (G)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1242Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Pasteurellaceae (F), e.g. Haemophilus influenza
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/461Igs containing Ig-regions, -domains or -residues form different species
    • C07K16/462Igs containing a variable region (Fv) from one specie and a constant region (Fc) from another
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/072Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/15Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/01Animal expressing industrially exogenous proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1018Orthomyxoviridae, e.g. influenza virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1036Retroviridae, e.g. leukemia viruses
    • C07K16/1045Lentiviridae, e.g. HIV, FIV, SIV
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/20Pseudochromosomes, minichrosomosomes
    • C12N2800/204Pseudochromosomes, minichrosomosomes of bacterial origin, e.g. BAC

Definitions

  • the present invention relates to the provision of antibody therapeutics and prophylactics that are tailored specifically for human use.
  • the present invention provides libraries, vertebrates and cells, such as transgenic mice or rats or transgenic mouse or rat cells. Furthermore, the invention relates to methods of using the vertebrates to isolate antibodies or nucleotide sequences encoding antibodies. Antibodies, heavy chains, polypeptides, nucleotide sequences, pharmaceutical compositions and uses are also provided by the invention.
  • non-human vertebrates eg, mice and rats
  • cells comprising transgenic immunoglobulin loci, such loci comprising human variable (V), diversity (D) and/or joining (J) segments, and optionally human constant regions.
  • endogenous constant regions of the host vertebrate eg, mouse or rat constant regions
  • the transgenic loci are provided in the transgenic loci.
  • transgenic loci in the art include varying amounts of the human V(D) J repertoire.
  • Existing transgenic immunoglobulin loci are based on a single human DNA source. The potential diversity of human antibody variable regions in non-human vertebrates bearing such transgenic loci is thus confined.
  • the present invention has been developed from extensive bioinformatics analysis of natural antibody gene segment distributions across a myriad of different human populations and across more than two thousand samples from human individuals.
  • the inventors have undertaken this huge task to more thoroughly understand and design non-human vertebrate systems and resultant antibodies to better address human medical therapeutics as a whole, as well as to enable rational design to address specific ethnic populations of humans.
  • the inventors have constructed transgenic non-human vertebrates and isolated antibodies, antibody chains and cells expressing these in a way that yields products that utilise gene segments that have been purposely included on the basis of the human bioinformatics analysis.
  • the examples illustrate worked experiments where the inventors isolated many cells and antibodies to this effect.
  • the invention also relates to synthetically-extended & ethnically-diverse superhuman
  • the present invention thus provides for novel and potentially expanded synthetic immunoglobulin diversities, thus providing a pool of diversity from which human antibody therapeutic leads can be selected.
  • This expanded pool is useful when seeking to find antibodies with desirable characteristics, such as relatively high affinity to target antigen without the need for further affinity maturation (eg, using laborious in vitro techniques such as phage or ribosome display), or improved biophysical characteristics, or to address targets and new epitopes that have previously been difficult to address with antibodies are not reached by prior antibody binding sites.
  • the invention also provides for diversity that is potentially biased towards variable gene usage common to members of a specific human population, which is useful for generating antibodies for treating and/or preventing diseases or conditions within such population. This ability to bias the antibody repertoire allows one to tailor antibody therapeutics with the aim of more effectively treating and/or preventing disease or medical conditions in specific human populations.
  • the present inventors realised the possibility of providing immunoglobulin gene segments from disparate sources in transgenic loci, in order to provide for novel and potentially-expanded antibody diversities from which antibody therapeutics (and antibody tool reagents) could be generated. This- opens up the potential of transgenic human-mouse/rat technologies to the possibility of interrogating different and possibly larger antibody sequence-spaces than has hitherto been possible.
  • HCDR3 length at least 20 amino acids
  • naturally-occurring antibodies have been isolated from humans infected with infectious disease pathogens, such antibodies having a long HCDR3 length.
  • Neutralising antibodies have been found in this respect.
  • a long HCDR3 length would be desirable to address other antigens (eg, receptor clefts or enzyme active sites), not just limited to infectious disease pathogens, and thus the inventors realised the general desirability of the possibility of engineering transgenic loci to be able to produce long HCDR3 antibodies and heavy chains.
  • the inventors through laborious execution of bioinformatics on in excess of 2000 human DNA samples via the 1000 Genomes project together with rational sequence choices, identified that the inclusion of the specific human gene segment variant JH6*02 is desirable for producing long HCDR3 antibodies and chains.
  • antibodies are humanised with an arbitrary choice of human constant region (presumably derived from one (often unknown) ethnic population or non-naturally occurring) that does not function as well in patients of a different human ethnic population. This is important, since the constant region has the major role in providing antibody effector functions, eg, for antibody recycling, cellular and complement recruitment and for cell killing.
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) comprising a genome having a superhuman immunoglobulin heavy chain human VH and/or D and/or J gene repertoire.
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) comprising a genome having a superhuman immunoglobulin light chain human VL gene repertoire; optionally wherein the vertebrate or cell is according to the first configuration.
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) whose genome comprises a transgenic immunoglobulin locus (eg, a heavy chain locus or a light chain locus), said locus comprising immunoglobulin gene segments according to the first and second human immunoglobulin gene segments (optionally V segments) as mentioned below operably connected upstream of an immunoglobulin constant region; optionally wherein the genome is homozygous for said transgenic immunoglobulin locus;
  • a transgenic immunoglobulin locus eg, a heavy chain locus or a light chain locus
  • said locus comprising immunoglobulin gene segments according to the first and second human immunoglobulin gene segments (optionally V segments) as mentioned below operably connected upstream of an immunoglobulin constant region; optionally wherein the genome is homozygous for said transgenic immunoglobulin locus;
  • immunoglobulin locus comprises more than the natural human complement of functional V gene segments;
  • immunoglobulin locus comprises more than the natural human complement of functional D gene segments;
  • the immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
  • a transgenic non-human vertebrate eg, a mouse or rat
  • vertebrate cell optionally an ES cell or antibody-producing cell
  • the transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments, a first (optionally a V segment) of said gene segments and a second (optionally a V segment) of said gene segments being different and derived from the genomes of first and second human individuals respectively, wherein the individuals are different; and optionally not related;
  • immunoglobulin locus comprises more than the natural human complement of functional V gene segments;
  • immunoglobulin locus comprises more than the natural human complement of functional D gene segments;
  • immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
  • a transgenic non-human vertebrate eg, a mouse or rat
  • vertebrate cell eg. an ES cell or antibody-producing cell
  • each locus comprising a plurality of human immunoglobulin gene segments operably connected upstream of a non-human vertebrate constant region for the production of a repertoire of chimaeric antibodies, or chimaeric light or heavy chains, having a non-human vertebrate constant region and a human variable region
  • the first transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments
  • the second transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments
  • each immunoglobulin locus comprises more than the natural human
  • each immunoglobulin locus comprises more than the natural human
  • a method of constructing a cell eg, an ES cell according to the invention, the method comprising
  • the gene segment(s) in step (b) are identified from an immunoglobulin gene database selected from the 1000 Genomes, Ensembl, Genbank and IMGT databases.
  • Genbank is a reference to Genbank release number 185.0 or 191.0; the 1000 Genomes database is Phase 1, release v3, 16 th March 2012; the Ensembl database is assembly GRCh37.p8 (10/04/2012); the IMGT database is available at www.imgt.org .
  • the first and second human individuals are members of first and second ethnic populations respectively, wherein the populations are different, optionally wherein the human immunoglobulin gene segment derived from the genome sequence of the second individual is low- frequency (optionally rare) within the second ethnic population.
  • This configuration of the invention also provides a method of making a transgenic non-human vertebrate (eg, a mouse or rat), the method comprising
  • an ES cell eg, a mouse C57BL/6N, C57BL/6J, 129S5 or 129Sv strain ES cell
  • a donor non-human vertebrate blastocyst eg, a mouse C57BL/6N, C57BL/6J, 129S5 or 129Sv strain blastocyst
  • the invention provides a method of isolating an antibody that binds a predetermined antigen (eg, a bacterial or viral pathogen antigen), the method comprising immunising a non-human vertebrate according to the invention.
  • a predetermined antigen eg, a bacterial or viral pathogen antigen
  • a first transgenic cell expresses a first antibody having a chain encoded by a first immunoglobulin gene, the gene comprising a first variable domain nucleotide sequence produced following recombination of a first human unrearranged immunoglobulin gene segment;
  • a second transgenic cell expresses a second antibody having a chain encoded by a second immunoglobulin gene, the second gene comprising a second variable domain nucleotide sequence produced following recombination of a second human unrearranged immunoglobulin gene segment, the first and second antibodies being non-identical;
  • the first and second gene segments are different and derived from the genome sequences of first and second human individuals respectively, wherein the individuals are different; and optionally not related; (d) wherein the cells are non-human vertebrate (eg, mouse or rat) cells.
  • non-human vertebrate eg, mouse or rat
  • the first and second human individuals are members of first and second ethnic populations respectively, wherein the populations are different; optionally wherein the ethnic populations are selected from those identified in the 1000 Genomes database.
  • the second human immunoglobulin gene segment is a polymorphic variant of the first human immunoglobulin gene segment; optionally wherein the second gene segment is selected from the group consisting of a gene segment in any of Tables 1 to 7 and 9 to 14 below (eg, selected from Table 13 or Table 14), eg, the second gene segment is a polymorphic variant of VH1- 69.
  • the heavy chain constant regions are gamma-type constant regions.
  • the invention also provides an isolated nucleotide sequence encoding the antibody, optionally wherein the sequence is provided in an antibody expression vector, optionally in a host cell.
  • the invention also provides a method of producing a human antibody, the method comprising replacing the non-human vertebrate constant regions of the antibody of the third configuration with human antibody constant regions.
  • the invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising an antibody according to the third configuration, or an antibody produced according to the method above and a diluent, excipient or carrier; optionally wherein the composition is provided in a container connected to an IV needle or syringe or in an IV bag.
  • the invention also provides an antibody-producing cell that expresses the second antibody recited in any one of the configurations.
  • the invention contemplates the combination of nucleotide sequences of first and second immunoglobulin gene segments (eg, two or more polymorphic variants of a particular human germline VH or VL gene segment) to provide a synthetic gene segment.
  • synthetic gene segment is used, in one embodiment, to build a transgenic immunoglobulin locus, wherein the synthetic gene segment is provided in combination with one or more human variable and J regions (and optionally one or more human D regions) operably connected upstream of a constant region.
  • the invention provides for superhuman gene segment diversity.
  • sequences to be combined can be selected from gene segments that have been observed to be commonly used in human antibodies raised against a particular antigen (eg, a flu antigen, such as haemaglutinin).
  • a flu antigen such as haemaglutinin
  • the synthetic gene segment may recombine in vivo to produce an antibody that is well suited to the treatment and/or prevention of a disease or condition (eg, influenza) mediated by said antigen.
  • a disease or condition eg, influenza
  • a non-human vertebrate (optionally a mouse or a rat) or vertebrate cell whose genome comprises an immunoglobulin heavy chain locus comprising human gene segment JH6*02, one or more VH gene segments and one or more D gene segments upstream of a constant region; wherein the gene segments in the heavy chain locus are operably linked to the constant region thereof so that the mouse is capable of producing an antibody heavy chain produced by recombination of the human JH6*02 with a D segment and a VH segment.
  • a non-human vertebrate cell (optionally a mouse cell or a rat cell) whose genome comprises an immunoglobulin heavy chain locus comprising human gene segment JH6*02, one or more VH gene segments and one or more D gene segments upstream of a constant region; wherein the gene segments in the heavy chain locus are operably linked to the constant region thereof for producing (eg, in a subsequent progeny cell) an antibody heavy chain produced by recombination of the human JH6*02 with a D segment and a VH segment.
  • a heavy chain (eg, comprised by an antibody) isolated from a vertebrate of the invention wherein the heavy chain comprises a HCD 3 of at least 20 amino acids.
  • a method for producing a heavy chain, VH domain or an antibody specific to a target antigen comprising immunizing a non-human vertebrate according to the invention with the antigen and isolating the heavy chain, VH domain or an antibody specific to a target antigen or a cell producing the heavy chain, VH domain or an antibody, wherein the heavy chain, VH domain or an antibody comprises a HCDR3 that is derived from the recombination of human JH6*02 with a VH gene segment and a D gene segment.
  • a heavy chain, VH domain or an antibody produced by the method comprising immunizing a non-human vertebrate according to the invention with the antigen and isolating the heavy chain, VH domain or an antibody specific to a target antigen or a cell producing the heavy chain, VH domain or an antibody, wherein the heavy chain, VH domain or an antibody comprises a HCDR3 that is derived from the recombination of human JH6*02 with a VH gene segment and a
  • a vector (eg, a CHO cell or HEK293 cell vector) comprising the nucleic acid; optionally wherein the vector is in a host cell (eg, a CHO cell or HEK293 cell).
  • a pharmaceutical composition comprising the antibody, heavy chain or VH domain (eg, comprised by an antibody), together with a pharmaceutically-acceptable excipient, diluent or a medicament (eg, a further antigen-specific variable domain, heavy chain or antibody).
  • the antibody, heavy chain or VH domain (eg, comprised by an antibody) as above for use in medicine.
  • an antibody, heavy chain or VH domain eg, comprised by an antibody
  • a method of producing an antibody heavy chain comprising
  • variable domain (b) combining the variable domain with a human heavy chain constant region to produce an antibody heavy chain comprising (in N- to C-terminal direction) the variable domain and the constant region;
  • human heavy chain constant region is an IGHGlref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region.
  • an antibody comprising a human heavy chain, the heavy chain comprising a variable domain that is specific for an antigen and a constant region that is an IGHGlref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region .
  • the variable domain comprises mouse-pattern AID somatic mutations.
  • a polypeptide comprising (in N- to C- terminal direction) a leader sequence, a human variable domain that is specific for an antigen and a human constant region that is an IGHGlref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region wherein (i) the leader sequence is not the native human variable domain leader sequence; and/or (ii) the variable domain comprises mouse AID-pattern somatic mutations and/or mouse Terminal deoxynucleotidyl transferase (TdT)- pattern junctional mutations.
  • TdT Terminal deoxynucleotidyl transferase
  • a vector (eg, a CHO cell or HEK293 cell vector) comprising a IGHGlref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region nucleotide sequence that is 3' of a cloning site for the insertion of a human antibody heavy chain variable domain nucleotide sequence, such that upon insertion of such a variable domain sequence the vector comprises (in 5' to 3' direction) a promoter, a leader sequence, the variable domain sequence and the constant region sequence so that the vector is capable of expressing a human antibody heavy chain when present in a host cell.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising at least 3 human variable region gene segments of the same type (eg, at least 3 human VH6-1 gene segments, at least 3 human JH6 gene segments, at least 3 human VK1-39 gene segments, at least 3 human D2-2 gene segments or at least 3 human JKI gene segments), wherein at least two of the human gene segments are variants that are not identical to each other.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 3 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments) cis at the same Ig locus.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising at least 2 different human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments) trans at the same Ig locus; and optionally a third human gene segment of the same type, wherein the third gene segment is cis with one of said 2 different gene segments.
  • a population of non-human vertebrates comprising a repertoire of human variable region gene segments, wherein the plurality comprises at least 2 human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), a first of said different gene segments is provided in the genome of a first vertebrate of the population, and a second of said different gene segments being provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second gene segment.
  • the plurality comprises at least 2 human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments)
  • a first of said different gene segments is provided in the genome of a first vertebrate
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 3 human variable region gene segments of the same type (eg, at least 3 human VH6-1 gene segments, at least 3 human J H6 gene segments, at least 3 human VK1-39 gene segments, at least 3 human D2-2 gene segments or at least 3 human JKI gene segments), wherein at least two of the human gene segments are variants that are not identical to each other.
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments) cis at the same Ig locus.
  • a non-human vertebrate eg, a mouse or rat
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments) trans at the same Ig locus; and optionally a third human gene segment of the same type, wherein the third gene segment is cis with one of said 2 different gene segments.
  • a non-human vertebrate eg, a mouse or rat
  • a method of providing an enhanced human immunoglobulin variable region gene segment repertoire comprising providing a population of non-human vertebrates (eg, a mouse or rat) comprising a repertoire of human variable region gene segments, wherein the method comprises providing at least 2 different human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VKI- 39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), wherein a first of said different gene segments is provided in the genome of a first vertebrate of the population, and a second of said different gene segments is provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second gene segment.
  • a population of non-human vertebrates eg, a mouse or rat
  • the method comprises providing at least 2 different human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations; optionally wherein at least 2 or 3 of said different gene segments are provided at the same Ig locus in said genome.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising first and second human Ig locus gene segments of the same type (eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments)
  • the first gene segment is a gene segment selected from any one of Tables 1 and 9 to 14 (eg, selected from Table 13 or Table 14) (eg, IGHJ6-a)
  • the second gene segment is the corresponding reference sequence.
  • a population of non-human vertebrates comprising first and second human Ig locus gene segments of the same type (eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments), wherein the first gene segment is a gene segment selected from any one of Tables 1 and 9 to 14 (eg, selected from Table 13 or Table 14) (eg, IGHJ6-a) and the second gene segment is the corresponding reference sequence, wherein the first gene segment is provided in the genome of a first vertebrate of the population, and the second gene segment is provided in the genome of a second vertebrate of the population.
  • first and second human Ig locus gene segments of the same type eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments
  • the first gene segment is a gene segment selected from any one of Tables 1 and 9 to 14 (eg, selected from Table 13 or Table 14) (eg,
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising first and second human Ig locus gene segments of the same type (eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments), wherein the first gene segment is a gene segment selected from any one of Tables 1 and 9 to 14 (eg, selected from Table 13 or Table 14) (eg, IGHJ6-a) and the second gene segment is the corresponding reference sequence.
  • first and second human Ig locus gene segments of the same type eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments
  • the first gene segment is a gene segment selected from any one of Tables 1 and 9 to 14 (eg, selected from Table 13 or Table 14) (eg, IGHJ6-a) and the second gene segment is the corresponding reference sequence.
  • the invention relates to human D gene segment variants as described further below.
  • the invention relates to human V gene segment variants as described further below. In one aspect of this configuration, the invention relates to human J gene segment variants as described further below.
  • Figures 1 to 3 Schematic illustrating a protocol for producing recombineered BAC vectors to add V gene segments into a mouse genome
  • FIG. 4 Schematic illustrating a protocol for adding V gene segments to a mouse genome using sequential recombinase mediated cassette exchange (s MCE).
  • Figure 5 Alignment of 13 IGHVl-69 variants showing the variable (V) coding region only. Nucleotides that differ from VH1-69 variant *01 are indicated at the appropriate position whereas identical nucleotides are marked with a dash. Where nucleotide changes result in amino acid differences, the encoded amino acid is shown above the corresponding triplet. Boxed regions correspond to CDR1, CDR2 and CDR3 as indicated.
  • Figure 6 is a schematic illustrating gene segment diversity and the effect of including variant variants in cis according to the invention:-
  • V4-4 can only be recombined within variant 1 to form for instance for instance V4-4-D-J6 or V4-4-D-J2 A .
  • the variant V4-4 A can't be recombined with either J6 or J2 A from variant 1 and can only be joined with J-genes from variant 2 to form V4-4 A -D-J6 A and V4-4 A -D-J2.
  • V4-4-J2/J6 complexity 4.
  • (c) Supra mouse of the invention The variants are added in cis and thus can be recombined in every combination, expanding the repertoire.
  • V4-4 can be combined with J6A, J6, J2A or J2 and similarly V4-4A can be recombined with these same J-genes.
  • the V4-4-J6/J2 complexity 8 which in this simple example is double that of a person and 4X that of a mouse with a single variant.
  • Figure 7 Alignment of human JH6*02 variants. Nucleotides that differ from JH6 *01 are indicated at the appropriate position whereas identical nucleotides are marked with a dash. Where nucleotide changes result in amino acid differences, the encoded amino acid is shown above. Accession numbers (eg, J00256) are shown to the left of the IMGT variant name.
  • Figure 8 Alignment of JH sequences from various species.
  • Table 13 Variant Frequency Analyses & Human Population Distributions
  • Table 14 Frequent Human Variant Distributions
  • a suitable source of JH6*02 and other human DNA sequences for use in the invention will be readily apparent to the skilled person.
  • a DNA sample from a consenting human donor (eg, a cheek swab sample as per the Example herein) from which can be obtained suitable DNA sequences for use in constructing a locus of the invention.
  • Other sources of human DNA are commercially available, as will be known to the skilled person.
  • the skilled person is able to construct gene segment sequence by referring to one or more databases of human Ig gene segment sequences disclosed herein.
  • An example source for human V, D and J gene segments according to the invention are Bacterial Artificial Chromosomes (RPCI-11 BACs) obtained from Roswell Park Cancer Institute
  • Male blood was obtained via a double-blind selection protocol. Male blood DNA was isolated from one randomly chosen donor (out of 10 male donors)".
  • the invention relates to synthetically-extended & ethnically-diverse superhuman immunoglobulin gene repertoires.
  • the human immunoglobulin repertoires are beyond those found in nature (ie, "Superhuman"), for example, they are more diverse than a natural human repertoire or they comprise combinations of human immunoglobulin gene segments from disparate sources in a way that is non-natural.
  • the repertoires of the invention are "superhuman” immunoglobulin repertoires, and the invention relates to the application of these in transgenic cells and non-human vertebrates for utility in producing chimaeric antibodies (with the possibility of converting these into fully-human, isolated antibodies using recombinant DNA technology).
  • the present invention thus provides for novel and potentially expanded synthetic immunoglobulin diversities, which provides for a pool of diversity from which antibody therapeutic leads (antibody therapeutics and antibody tool reagents) can be selected.
  • This opens up the potential of transgenic human-mouse/rat technologies to the possibility of interrogating different and possibly larger antibody sequence- spaces than has hitherto been possible.
  • the invention provides a SUPERHUMAN MOUSETM (aka SUPRA-MOUSETM) and a SUPERHUMAN RATTM (aka SUPRA-RATTM)
  • SUPRA-RATTM aka SUPRA-RATTM
  • the present inventors have realised the possibility of mining the huge genetics resources now available to the skilled person thanks to efforts such as the HapMap Project, 1000 Genomes Project and sundry other immunoglobulin gene databases (see below for more details).
  • the inventors realised the application of these genome sequencing developments in the present invention to generate synthetically-produced and ethnically-diverse artificial immunoglobulin gene repertoires.
  • the inventors realised that such repertoires are useful for the production of antibodies having improved affinity and/or biophysical characteristics, and/or wherein the range of epitope specificities produced by means of such repertoire is novel, provides for antibodies to epitopes that have hitherto been intractable by prior transgenic immunoglobulin loci or difficult to address.
  • the present invention provides libraries, vertebrates and cells, such as transgenic mice or rats or transgenic mouse or rat cells. Furthermore, the invention relates to methods of using the vertebrates to isolate antibodies or nucleotide sequences encoding antibodies. Antibodies, nucleotide sequences, pharmaceutical compositions and uses are also provided by the invention.
  • the present inventors have realized methods and antibody loci designs that harness the power of genetic variation analysis.
  • the reference human genome provides a foundation for experimental work and genetic analysis of human samples.
  • the reference human is a compilation of the genomes from a small number of individuals and for any one segment of the genome a high quality single reference genome for one of the two chromosomes is available. Because the reference genome was assembled from a series of very large insert clones, the identity of these clones is known.
  • the 1000-Genomes Project has the objective of identifying the most frequent variations in the human genome.
  • This public domain project involved sequencing the genomes of more than 1000 individuals from diverse ethnic groups, comparing these sequences to the reference and assembling a catalogue of variants. This has enabled the annotation of variants in coding regions, but because this sequence wasn't derived from large clones of DNA, the analysis of the sequence from diploid individuals can't discriminate the distribution of the variation between the maternal and paternally inherited chromosomes. Where more than one variant is identified in a protein coding gene, it is not possible to illuminate the distribution of the pattern of variants in each version of the protein.
  • the 1000-Genome Project has sequenced mother-father-child trios. This allows one to "phase" the sequence variants, in other words identify blocks of sequence that are inherited from one or other parent and deconvolute the variants.
  • the inventors' analysis of the 1000-genome data for the individual human coding segments of the C, V D and J genes from the heavy and light chains reveals that there is significant variation in these segments. Individuals will usually have two different heavy chain alleles and also different light chain alleles at both kappa and lambda loci. The repertoire of antibodies that can be generated from each allele will be different. This variation will contribute to a better or differing immune response to certain antigens.
  • mice that have hitherto been generated with immunoglobulin heavy and light chain loci contain just one type of immunoglobulin locus. Even if these mice contain a full human heavy chain locus, the variation will be less than contained in a typical human because only one set of C, V, D and J genes are available, while a typical human would have two sets.
  • the inventors have devised ways to improve on this limitation when constructing transgenic non- human vertebrates and cells for human antibody and variable region production in vivo.
  • mice can be generated with two different loci, each engineered to have a different repertoire of V, D and J segments. This could be in a single mouse or two or more separate mouse strains and would be analogous to or beyond the repertoire found in a normal human. The engineering of such a mouse would go beyond the repertoire described in humanized mice to date which only have one set of alleles.
  • JH gene segments eg, see the examples
  • this addresses compatibility with human patients since the inventor's analysis has drawn out candidate variants that are naturally conserved and sometimes very prevalent amongst human ethnic populations. Additionally this enables one to tailor the configurations of the invention to provide for antibody-based drugs that better address specific human ethnic populations.
  • loci and cells and vertebrates comprising these
  • gene segments are provided in which gene segments from different human populations are used. This is desirable to increase antibody gene diversity to better address more diverse human patients.
  • the gene segments are from first and second different human populations respectively, and thus the second gene segment is found in the second human population, but not so (or rarely) in the first human population. Rarely means, for example, that the gene segment is found in 5, 4, 3, 2, or 1 or zero individuals in the first population in the 1000 Genomes database.
  • the first gene segment may be shown as present in a first population by reference to Table 13 or 14 herein
  • the second gene segment may be shown as present in the second population by reference to Table 13 and not in the first population.
  • the first gene segment may also be shown as being present in the second population by reference to Table 13 or 14.
  • V gene segment In any configuration or aspect of the invention, where a V gene segment is used, this may be used optionally with the native leader sequence.
  • genomic DNA eg, from BACs as in the examples
  • the native leader will be used for each V gene segment incorporated into the locus and genomes of the invention.
  • the skilled person may wish to inert a non-native leader sequence together with one or more of the V gene segments.
  • this may be used optionally with the native 5' UTR sequence.
  • genomic DNA eg, from BACs as in the examples
  • native 5' UTR sequence will be used for each V gene segment incorporated into the locus and genomes of the invention.
  • skilled person may wish to exclude the native 5' UTR sequence.
  • the present invention provides, in a first configuration (a) Superhuman heavy chain gene repertoires
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) comprising a genome having a superhuman immunoglobulin heavy chain human VH and/or D and/or J gene repertoire.
  • the cell of the invention is an embryonic stem cell.
  • the ES cell is derived from the mouse C57BL/6N, C57BL/6J, 129S5 or 129Sv strain.
  • the non-human vertebrate is a rodent, suitably a mouse, and cells of the invention, are rodent cells or ES cells, suitably mouse ES cells.
  • the ES cells of the present invention can be used to generate animals using techniques well known in the art, which comprise injection of the ES cell into a blastocyst followed by implantation of chimaeric blastocystys into females to produce offspring which can be bred and selected for homozygous recombinants having the required insertion.
  • the invention relates to a transgenic animal comprised of ES cell-derived tissue and host embryo derived tissue. In one aspect the invention relates to genetically-altered subsequent generation animals, which include animals having a homozygous recombinants for the VDJ and/or VJ regions.
  • the natural human immunoglobulin gene segment repertoire consists of (see eg, www.imgt.org 3 ⁇ 4:-
  • V lambda total-75; functional-31 J lambda: total-7; functional-5
  • the vertebrate or cell genome comprises a transgenic immunoglobulin heavy chain locus comprising a plurality of human immunoglobulin VH gene segments, one or more human D gene segments and one or more human J gene segments, wherein the plurality of VH gene segments consists of more than the natural human repertoire of functional VH gene segments; optionally wherein the genome is homozygous for said transgenic heavy chain locus.
  • the VH gene repertoire consists of a plurality of VH gene segments derived from the genome sequence of a first human individual, supplemented with one or more different VH gene segments derived from the genome sequence of a second, different human individual.
  • the D and J segments are derived from the genome sequence of the first human individual.
  • the VH gene segments from the genome sequence of the second individual are selected from the VH gene segments listed in Table 1, 13 or 14. In this way, the locus provides a superhuman repertoire of D gene segments.
  • the individuals are not related.
  • Individuals are "not related" in the context of any configuration or aspect of the invention, for example, if one of the individuals does not appear in a family tree of the other individual in the same generation or going back one, two, three or four generations.
  • are not related for example, if they do not share a common ancestor in the present generation or going back one, two, three or four generations.
  • the transgenic locus comprises more than 41 functional human VH gene segment species, and thus more than the natural human functional repertoire.
  • the locus comprises at least 42, 43, 44, 45, 46, 47, 48, 49 or 50 functional human VH gene segment species (eg, wherein the locus comprises the full functional VH repertoire of said first individual supplemented with one or more VH gene segments derived from the genome sequence of the second human individual and optionally with one or more VH gene segments derived from the genome sequence of a third human individual).
  • the locus provides a superhuman repertoire of VH gene segments that is useful for generating a novel gene and antibody diversity for use in therapeutic and tool antibody selection.
  • the transgenic locus comprises a first VH gene segment derived from the genome sequence of the first individual and a second VH gene segment derived from the genome sequence of the second individual, wherein the second VH gene segment is a polymorphic variant of the first VH gene segment.
  • the VH gene segments are polymorphic variants of VHl-69 as illustrated in the examples below.
  • the locus comprises a further polymorphic variant of the first VH gene segment (eg, a variant derived from the genome sequence of a third human individual). In this way, the locus provides a superhuman repertoire of VH gene segments.
  • the genome (alternatively or additionally to the superhuman VH diversity) comprises a transgenic immunoglobulin heavy chain locus comprising a plurality of human immunoglobulin VH gene segments, a plurality of human D gene segments and one or more human J gene segments, wherein the plurality of D gene segments consists of more than the natural human repertoire of functional D gene segments.
  • the genome is homozygous for said transgenic heavy chain locus.
  • the D gene repertoire consists of a plurality of D gene segments derived from the genome sequence of a (or said) first human individual, supplemented with one or more different D gene segments derived from the genome sequence of a (or said) second, different human individual.
  • the individuals are not related.
  • the J segments are derived from the genome sequence of the first human individual.
  • the D gene segments from the genome sequence of the second individual are selected from the D gene segments listed in Table 2, 13 or 14. In this way, the locus provides a superhuman repertoire of D gene segments.
  • the transgenic locus comprises more than 23 functional human D gene segment species; optionally wherein the locus comprises at least 24, 25, 26, 27, 28, 29, 30 or 31 functional human D gene segment species (eg, wherein the locus comprises the full functional D repertoire of said first individual supplemented with one or more D gene segments derived from the genome sequence of the second human individual and optionally with one or more D gene segments derived from the genome sequence of a third human individual).
  • the locus provides a superhuman repertoire of D gene segments.
  • the transgenic locus comprises a first D gene segment derived from the genome sequence of the first individual and a second D gene segment derived from the genome sequence of the second individual, wherein the second D gene segment is a polymorphic variant of the first D gene segment.
  • the locus comprises a further polymorphic variant of the first D gene segment (eg, a variant derived from the genome sequence of a third human individual). In this way, the locus provides a superhuman repertoire of D gene segments.
  • the genome comprises a (or said) transgenic immunoglobulin heavy chain locus comprising a plurality of human immunoglobulin VH gene segments, one or more human D gene segments and a plurality of human JH gene segments, wherein the plurality of J gene segments consists of more than the natural human repertoire of functional J gene segments; optionally wherein the genome is homozygous for said transgenic heavy chain locus.
  • the JH gene repertoire consists of a plurality of J gene segments derived from the genome sequence of a (or said) first human individual, supplemented with one or more different J gene segments derived from the genome sequence of a (or said) second, different human individual.
  • the individuals are not related.
  • D segments are derived from the genome sequence of the first human individual.
  • the J gene segments from the genome sequence of the second individual are selected from the J gene segments listed in Table 3 13 or 14. In this way, the locus provides a superhuman repertoire of JH gene segments.
  • the transgenic locus comprises more than 6 functional human JH gene segment segments.
  • the locus comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 functional human JH gene segments (eg, wherein the locus comprises the full functional JH repertoire of said first individual supplemented with one or more J H gene segments derived from the genome sequence of the second human individual and optionally with one or more J H gene segments derived from the genome sequence of a third human individual).
  • the locus provides a superhuman repertoire of JH gene segments.
  • the transgenic locus comprises a first J H gene segment derived from the genome sequence of the first individual and a second JH gene segment derived from the genome sequence of the second individual, wherein the second J H gene segment is a polymorphic variant of the first JH gene segment.
  • the locus comprises a further polymorphic variant of the first JH gene segment (eg, a variant derived from the genome sequence of a third human individual). In this way, the locus provides a superhuman repertoire of JH gene segments.
  • the first configuration of the invention also provides:-
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) comprising a genome having a superhuman immunoglobulin light chain human VL gene repertoire.
  • the vertebrate or cell comprises a heavy chain transgene according to aspect (a) of the first configuration.
  • superhuman diversity is provided in both the heavy and light chain immunoglobulin gene segments in the cell and vertebrate.
  • the genome of the cell or vertebrate is homozygous for the heavy and light chain transgenes and endogenous antibody expression is inactivated.
  • Such a vertebrate is useful for immunisation with a predetermined antigen to produce one or more selected antibodies that bind the antigen and have human variable regions resulting from recombination within the superhuman gene segment repertoire. This provides potentially for a novel antibody and gene sequence space from which to select therapeutic, prophylactic and tool antibodies.
  • the vertebrate or cell genome comprises a transgenic immunoglobulin kappa light chain locus comprising a plurality of human immunoglobulin VK gene segments and one or more human J gene segments, wherein the plurality of VK gene segments consists of more than the natural human repertoire of functional VK gene segments; optionally wherein the genome is homozygous for said transgenic kappa light chain locus; and/or
  • transgenic immunoglobulin lambda light chain locus comprising a plurality of human immunoglobulin V ⁇ gene segments and one or more human J gene segments, wherein the plurality of V ⁇ gene segments consists of more than the natural human repertoire of functional V ⁇ gene segments; optionally wherein the genome is homozygous for said transgenic lambda light chain locus.
  • the locus provides a superhuman repertoire of VL gene segments.
  • the VK gene repertoire consists of a plurality of VK gene segments derived from the genome sequence of a first human individual, supplemented with one or more VK gene segments derived from the genome sequence of a second, different human individual; optionally wherein the individuals are not related; optionally wherein the J segments are derived from the genome sequence of the first human individual; and optionally wherein the VK gene segments from the genome sequence of the second individual are selected from the VK gene segments listed in Table 4, 13 or 14; and
  • the V ⁇ gene repertoire consists of a plurality of V ⁇ gene segments derived from the genome sequence of a first human individual, supplemented with one or more V ⁇ gene segments derived from the genome sequence of a second, different human individual; optionally wherein the individuals are not related; optionally wherein the J segments are derived from the genome sequence of the first human individual; and optionally wherein the V ⁇ gene segments from the genome sequence of the second individual are selected from the V ⁇ gene segments listed in Table 5, 13 or 14.
  • the locus provides a superhuman repertoire of VL gene segments.
  • the vertebrate or cell In one embodiment of the vertebrate or cell,
  • the kappa light transgenic locus comprises more than 38 functional human VK gene segment species; optionally wherein the locus comprises at least 39, 40, 41, 42, 43, 44, 45, 46, 47 or 48 functional human VK gene segment species (eg, wherein the locus comprises the full functional VK repertoire of said first individual supplemented with one or more VK gene segments derived from the genome sequence of the second human individual and optionally with one or more VK gene segments derived from the genome sequence of a third human individual); and
  • the lambda light transgenic locus comprises more than 31 functional human V ⁇ gene segment species; optionally wherein the locus comprises at least 32, 33, 34, 35, 36, 37, 38, 39, 40 or 41 functional human V ⁇ gene segment species (eg, wherein the locus comprises the full functional V ⁇ repertoire of said first individual supplemented with one or more V ⁇ gene segments derived from the genome sequence of the second human individual and optionally with one or more V ⁇ gene segments derived from the genome sequence of a third human individual).
  • the locus provides a superhuman repertoire of VL gene segments.
  • the kappa light transgenic locus comprises a first VK gene segment derived from the genome sequence of the first individual and a second VK gene segment derived from the genome sequence of the second individual, wherein the second VK gene segment is a polymorphic variant of the first VK gene segment; optionally wherein the locus comprises a further polymorphic variant of the first VK gene segment (eg, a variant derived from the genome sequence of a third human individual); and
  • the lambda light transgenic locus comprises a first V ⁇ gene segment derived from the genome sequence of the first individual and a second V ⁇ gene segment derived from the genome sequence of the second individual, wherein the second V ⁇ gene segment is a polymorphic variant of the first V ⁇ gene segment; optionally wherein the locus comprises a further polymorphic variant of the first VX gene segment (eg, a variant derived from the genome sequence of a third human individual).
  • the locus provides a superhuman repertoire of VL gene segments.
  • the genome comprises a (or said) transgenic immunoglobulin light chain locus comprising a plurality of human immunoglobulin VL gene segments and a plurality of human JL gene segments, wherein the plurality of J gene segments consists of more than the natural human repertoire of functional J gene segments; optionally wherein the genome is homozygous for said transgenic heavy chain locus.
  • the JK gene repertoire consists of a plurality of JK gene segments derived from the genome sequence of a (or said) first human individual, supplemented with one or more J K gene segments derived from the genome sequence of a (or said) second, different human individual; optionally wherein the individuals are not related; optionally wherein the VK segments are derived from the genome sequence of the first human individual; optionally wherein the J K gene segments from the genome sequence of the second individual are selected from the J K gene segments listed in Table 6, 13 or 14; and
  • the JK gene repertoire consists of a plurality of iX gene segments derived from the genome sequence of a (or said) first human individual, supplemented with one or more iX gene segments derived from the genome sequence of a (or said) second, different human individual; optionally wherein the individuals are not related; optionally wherein the V ⁇ segments are derived from the genome sequence of the first human individual; optionally wherein the iX gene segments from the genome sequence of the second individual are selected from the iX gene segments listed in Table 7, 13 or 14.
  • the locus provides a superhuman repertoire of J L gene segments.
  • the transgenic light chain locus comprises more than 5 functional human J K gene segment species; optionally wherein the locus comprises at least 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 functional human JK gene segment species (eg, wherein the locus comprises the full functional J K repertoire of said first individual supplemented with one or more JK gene segments derived from the genome sequence of the second human individual and optionally with one or more J K gene segments derived from the genome sequence of a third human individual); and/or
  • the transgenic light chain locus comprises more than 5 functional human iX gene segment species; optionally wherein the locus comprises at least 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 functional human iX gene segment species (eg, wherein the locus comprises the full functional iX repertoire of said first individual supplemented with one or more iX gene segments derived from the genome sequence of the second human individual and optionally with one or more iX gene segments derived from the genome sequence of a third human individual).
  • the locus provides a superhuman repertoire of J L gene segments.
  • the kappa light transgenic locus comprises a first JK gene segment derived from the genome sequence of the first individual and a second JK gene segment derived from the genome sequence of the second individual, wherein the second JK gene segment is a polymorphic variant of the first J K gene segment; optionally wherein the locus comprises a further polymorphic variant of the first J ⁇ gene segment (eg, a variant derived from the genome sequence of a third human individual); and
  • the lambda light transgenic locus comprises a first iX gene segment derived from the genome sequence of the first individual and a second iX gene segment derived from the genome sequence of the second individual, wherein the second JK gene segment is a polymorphic variant of the first iX gene segment; optionally wherein the locus comprises a further polymorphic variant of the first iX gene segment (eg, a variant derived from the genome sequence of a third human individual).
  • the locus provides a superhuman repertoire of J L gene segments.
  • the present invention provides, in a second configuration
  • a library of antibody-producing transgenic cells whose genomes collectively encode a repertoire of antibodies, wherein (a) a first transgenic cell expresses a first antibody having a chain (eg, heavy chain) encoded by a first immunoglobulin gene, the gene comprising a first variable domain nucleotide sequence produced following recombination of a first human unrearranged immunoglobulin gene segment (eg, a VH);
  • a first transgenic cell expresses a first antibody having a chain (eg, heavy chain) encoded by a first immunoglobulin gene, the gene comprising a first variable domain nucleotide sequence produced following recombination of a first human unrearranged immunoglobulin gene segment (eg, a VH);
  • a second transgenic cell expresses a second antibody having a chain (eg, a heavy chain) encoded by a second immunoglobulin gene, the second gene comprising a second variable domain nucleotide sequence produced following recombination of a second human unrearranged immunoglobulin gene segment (eg, a VH), the first and second antibodies being non-identical;
  • the first and second gene segments are different and derived from the genome sequences of first and second human individuals respectively, wherein the individuals are different; and optionally not related;
  • cells are non-human vertebrate (eg, mouse or rat) cells (eg, B-cells or hybridomas).
  • the library is provided in vitro.
  • the library is provided in vivo by one or a plurality of transgenic non-human vertebrates.
  • the or each vertebrate is according to any aspect of the first configuration of the invention.
  • the library encodes an antibody repertoire of from 10 to 10 9 antibodies, for example, 10, 20, 30, 40, 50, 100 or 1000 to 10 s ; or 10, 20, 30, 40, 50, 100 or 1000 to 10 7 ; or 10, 20, 30, 40, 50, 100 or 1000 to 10 s ; or 10, 20, 30, 40, 50, 100 or 1000 to 10 s ; or 10, 20, 30, 40, 50, 100 or 1000 to 10 4 antibodies.
  • library encodes an antibody repertoire of at least 10 3 , 10 4 , 10 s , 10 s , 10 7 , 10 s , 10 9 ' or 10 10 antibodies.
  • the first variable domain nucleotide sequence is produced following recombination of the first human unrearranged immunoglobulin gene segment with one or more other immunoglobulin gene segments (for example, human immunoglobulin gene segments).
  • the first gene segment is a VH
  • the first variable domain nucleotide sequence (a VH domain) is produced following recombination of the VH with a human D and JH segments in vivo, optionally with somatic hypermutation, in the first transgenic cell or an ancestor thereof.
  • the first variable domain nucleotide sequence (a VL domain) is produced following recombination of the VL with a human JL segment in vivo, optionally with somatic hypermutation, in e first transgenic cell or an ancestor thereof.
  • the second variable domain nucleotide sequence is produced following recombination of the second human unrearranged immunoglobulin gene segment with one or more other immunoglobulin gene segments (for example, human immunoglobulin gene segments).
  • the second gene segment is a VH
  • the second variable domain nucleotide sequence (a VH domain) is produced following recombination of the VH with a human D and JH segments in vivo, optionally with somatic hypermutation, in the second transgenic cell or an ancestor thereof.
  • the second variable domain nucleotide sequence (a VL domain) is produced following recombination of the VL with a human JL segment in vivo, optionally with somatic hypermutation, in the second transgenic cell or an ancestor thereof.
  • the first and second gene segments are respectively derived from genome sequences of first and second human individuals.
  • a gene segment is isolated or cloned from a sample cell taken from said individual using standard molecular biology techniques as know to the skilled person.
  • the sequence of the gene segment may be mutated (eg, by the introduction of up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotide changes) prior to use in the present invention.
  • a gene segment is derived by identifying a candidate human immunoglobulin gene segment in a database (see guidance below) and a nucleotide sequence encoding a gene segment for use in the present invention is made by reference (eg, to be identical or a mutant with up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotide changes to the reference sequence) to the database sequence.
  • a nucleotide sequence encoding a gene segment for use in the present invention is made by reference (eg, to be identical or a mutant with up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotide changes to the reference sequence) to the database sequence.
  • the skilled person will be aware of methods of obtaining nucleotide sequences by reference to databases or by obtaining from cellular samples.
  • the first and second human individuals are members of first and second ethnic populations respectively, wherein the populations are different. This, therefore, provides for superhuman gene diversity in transgenic loci, cells and vertebrates as per the invention.
  • the ethnic populations are selected from those identified in the 1000 Genomes Project of database.
  • Table 8 which provides details of the ethnic populations on which the 1000 Genomes database is based.
  • the International HapMap Project discloses that goal of the HapMap Project: to determine the common patterns of DNA sequence variation in the human genome by determining the genotypes of one million or more sequence variants, their frequencies and the degree of association between them in DNA samples from populations with ancestry from parts of Africa, Asia and Europe.
  • the relevant human populations of differing geographical ancestry include Yoruba, Japanese, Chinese, Northern European and Western European populations. More specifically:- Utah population with Northern or Western European ancestry (samples collected in 1980 by the
  • a suitable sample of human populations from which the populations used in the present invention are selected is as follows:-
  • each human population is selected from a population marked "(a)" above.
  • each human population is selected from a population marked "(b)" above.
  • each human population is selected from a population marked "(c)" above.
  • the first and second ethnic populations are selected from the group consisting of an ethnic population with European ancestry, an ethnic population with East Asian, an ethnic population with West African ancestry, an ethnic population with Americas ancestry and an ethnic population with South Asian ancestry.
  • the first and second ethnic populations are selected from the group consisting of an ethnic population with Northern European ancestry; or an ethnic population with Western European ancestry; or an ethnic population with Toscani ancestry; or an ethnic population with British ancestry; or an ethnic population with Icelandic ancestry; or an ethnic population with Finnish ancestry; or an ethnic population with Iberian ancestry; or an ethnic population with Japanese ancestry; or an ethnic population with Chinese ancestry; or an ethnic population Vietnamese ancestry; or an ethnic population with Yoruba ancestry; or an ethnic population with Luhya ancestry; or an ethnic population with Gambian ancestry; or an ethnic population with Malawian ancestry; or an ethnic population with Native American ancestry; or an ethnic population with Afro-Caribbean ancestry; or an ethnic population with Mexican ancestry; or an ethnic population with Puerto ican ancestry;
  • the human immunoglobulin gene segment derived from the genome sequence of the second individual is low-frequency (optionally rare) within the second ethnic population.
  • human immunoglobulin gene segment has a Minor Allele Frequency (MAF) (cumulative frequency) of between 0.5% - 5%, optionally less than 0.5%, in the second human population, eg, as in the 1000 Genomes database.
  • MAF Minor Allele Frequency
  • the first variable region nucleotide sequence is produced by recombination of the first human
  • immunoglobulin gene segment with a first J gene segment and optionally a first D gene segment, wherein the first human immunoglobulin gene segment is a V gene segment and the V, D and J segments are derived from the first human population, optionally from the genome of one individual the first human populati
  • the second variable region nucleotide sequence is produced by recombination of the second human immunoglobulin gene segment with a second J gene segment and optionally a second D gene segment, wherein the second human immunoglobulin gene segment is a V gene segment derived from the second population and the D and/or J segments are derived from the first human population, optionally the D and J gene segments being from the genome of one individual of the first human population.
  • all of the D and J segments that have been recombined with the first and second V gene segments are D and J segments derived from the first human population, optionally the D and J gene segments being from the genome of one individual of the first human population.
  • the second human immunoglobulin gene segment is a polymorphic variant of the first human immunoglobulin gene segment; optionally wherein the second gene segment is selected from the group consisting of a gene segment in any of Tables 1 to 7 and 9 to 14 (eg, selected from Table 13 or 14).
  • the first and second human immunoglobulin gene segments are both (i) V H gene segments; (ii) D segments; (iii) J segments (optionally both J H segments, both J K segments or both ⁇ ⁇ segments); (iv) constant regions (optionally both a gamma constant region, optionally both a C gamma-1 constant region); (v) CHI regions; (vi) CH2 regions; or (vii) CH3 regions.
  • the library is, for example, a naive and optionally has a library size of from 10 or 10 2 to 10 9 cells.
  • the library has, for example, been selected against a predetermined antigen and optionally has a library size of from 10 or 10 2 to 10 9 cells.
  • said first and second cells are progeny of first and second ancestor non-human vertebrate cells respectively, wherein the first ancestor cell comprises a genome comprising said first human immunoglobulin gene segment; and the second ancestor cell comprises a genome comprising said second human immunoglobulin gene segment.
  • the invention further provides a library of antibody-producing transgenic cells whose genomes collectively encode a repertoire of antibodies, wherein the library comprises the first and second ancestor cells described above.
  • the invention further provides a library of hybridoma cells produced by fusion of the library of the invention (eg, a B-cell library) with fusion partner cells and optionally has a library size of from 10 or 10 2 to 10 9 cells.
  • a library size of from 10 or 10 2 to 10 9 cells.
  • 10 or 10 2 to 10 9 cells For example, from 10, 20, 30, 40, 50, 100 or 1000 to 10 s ; or 10, 20, 30, 40, 50, 100 or 1000 to 10 7 ; or 10, 20, 30, 40, 50, 100 or 1000 to 10 s ; or 10, 20, 30, 40, 50, 100 or 1000 to 10 s ; or 10, 20, 30, 40, 50, 100 or 1000 to 10 4 cells.
  • Production of hybridomas is well known to the skilled person.
  • fusion partners are SP2/0-gl4 (obtainable from ECACC), P3X63-Ag8.653 (obtainable from LGC Standards; C L-1580), NS1 and NS0 cells.
  • PEG fusion or electrofusion can be carried out, as is conventional.
  • the invention provides, in a third confieuration:- An isolated antibody having
  • each variable domain of the antibody is a human variable domain.
  • heavy chain constant regions are mu- or gamma-type constant regions.
  • the invention also provides an isolated nucleotide sequence encoding the antibody of the third configuration, optionally wherein the sequence is provided in an antibody expression vector, optionally in a host cell.
  • Suitable vectors are mammalian expression vectors (eg, CHO cell vectors or HEK293 cell vectors), yeast vectors (eg, a vector for expression in Picchia pastoris, or a bacterial expression vector, eg, a vector for E. coli expression.
  • the invention also provides a method of producing a human antibody, the method comprising replacing the non-human vertebrate constant regions of the antibody of the third configuration with human antibody constant regions (eg, a C variant disclosed in table 13 or 18).
  • human antibody constant regions eg, a C variant disclosed in table 13 or 18.
  • the skilled person will be aware of standard molecular biology techniques to do this. For example, see Harlow, E. & Lane, D. 1998, 5 th edition, Antibodies: A Laboratory Manual, Cold Spring Harbor Lab. Press, Plainview, NY; and Pasqualini and Arap, Proceedings of the National Academy of Sciences (2004) 101:257-259 for standard immunisation.
  • Joining of the variable regions of an antibody to a human constant region can be effected by techniques readily available in the art, such as using conventional recombinant DNA and NA technology as will be apparent to the skilled person. See e.g. Sambrook, J and Russell, D. (2001, 3'd edition) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, NY).
  • the method comprises further making a mutant or derivative of the antibody.
  • the invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising an antibody according to the third configuration, or a human antibody of the invention and a diluent, excipient or carrier;
  • composition is provided in a container connected to an IV needle or syringe or in an IV bag.
  • the invention also provides an antibody-producing cell (eg, a mammalian cell, eg, CHO or HEK293; a yeast cell, eg, P pastoris; a bacterial cell, eg, E coli; a B-cell; or a hybridoma) that expresses the second antibody of the third configuration or the isolated antibody of the invention.
  • an antibody-producing cell eg, a mammalian cell, eg, CHO or HEK293; a yeast cell, eg, P pastoris; a bacterial cell, eg, E coli; a B-cell; or a hybridoma
  • the first configuration of the invention also provides:-
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) whose genome comprises a transgenic immunoglobulin locus (eg, a heavy chain locus or a light chain locus), said locus comprising immunoglobulin gene segments according to the first and second human immunoglobulin gene segments (optionally V segments) described above in connection with the third configuration.
  • the gene segments are operably connected upstream of an immunoglobulin constant region; optionally wherein the genome is homozygous for said transgenic immunoglobulin locus.
  • the immunoglobulin locus comprises more than the natural human complement of functional V gene segments; and/or
  • immunoglobulin locus comprises more than the natural human complement of functional D gene segments;
  • immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
  • the first configuration also provides:-
  • a transgenic non-human vertebrate eg, a mouse or rat
  • vertebrate cell eg. an ES cell or antibody-producing cell
  • a transgenic immunoglobulin locus comprising a plurality of human immunoglobulin gene segments operably connected upstream of a non-human vertebrate constant region for the production of a repertoire of chimaeric antibodies, or chimaeric light or heavy chains, having a non-human vertebrate constant region and a human variable region
  • the transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments, a first (optionally a V segment) of said gene segments and a second (optionally a V segment) of said gene segments being different and derived from the genomes of first and second human individuals respectively, wherein the individuals are different; and optionally not related; optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional V gene segments; and/or optionally where
  • a superhuman immunoglobulin gene repertoire is provided in a transgenic non-human vertebrate or vertebrate cell according to the invention.
  • the first configuration also provides:-
  • a transgenic non-human vertebrate eg, a mouse or rat
  • vertebrate cell eg. an ES cell or antibody-producing cell
  • each locus comprising a plurality of human immunoglobulin gene segments operably connected upstream of a non-human vertebrate constant region for the production of a repertoire of chimaeric antibodies, or chimaeric light or heavy chains, having a non-human vertebrate constant region and a human variable region
  • the first transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments
  • the second transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments
  • each immunoglobulin locus comprises more than the natural human
  • each immunoglobulin locus comprises more than the natural human
  • a superhuman immunoglobulin gene repertoire is provided in a transgenic non-human vertebrate or vertebrate cell according to the invention.
  • the immunoglobulin gene segments are optionally as described for the third configuration.
  • the genome optionally comprises a third immunoglobulin gene segment (optionally a V segment), the third gene segment being derived from a human individual that is different from the individual from which the first (and optionally also the second) gene segment is derived; optionally wherein the first, second and third gene segments are polymorphic variants of a human immunoglobulin gene segment (eg, VH1-69 - see the examples for further description).
  • a human immunoglobulin gene segment eg, VH1-69 - see the examples for further description.
  • the genome of the vertebrate or cell is optionally homozygous for the first, second and optional third gene segment, wherein a copy of the first, second and optional third gene segments are provided together on the same chromosome operably connected upstream of a common non-human vertebrate constant region.
  • each first, second and optional third gene segment is a V gene segment.
  • the library of the invention is provided by a collection of non-human vertebrates (optionally a collection of rodents, mice or rats); optionally, wherein a first member of said collection produces said first antibody but not said second antibody, and a second member of the collection produces said second antibody (but optionally not said first antibody). It is therefore contemplated to make non-human vertebrates where different human genomes have been used as a source for building the transgenic loci in the vertebrates.
  • a first vertebrate comprises a transgenic heavy chain locus having gene segments only from a first (and optionally a second) human population or individual;
  • a second vertebrate comprises a transgenic heavy chain locus having gene segments only from a third (and optionally a fourth) human population or individual; and optionally third and more vertebrates can be built similarly based on unique or overlapping human population genomes.
  • the mixed population provides a collective pool of human immunoglobulin genes that is greater than found in a natural human repertoire. This is useful to extend the antibody and gene sequence space beyond those possible with prior transgenic mice and rats bearing human immunoglobulin loci. As explained above, these have been based on a single human genome.
  • the collection of non-human vertebrates bear human immunoglobulin genes confined to human populations that are together grouped under the same population genus "(a)" mentioned above.
  • This provides for a gene repertoire that is biased to producing human antibody variable regions prevalent in the population genus (a) and thus useful for generating antibody therapeutics/prophylactics for members of said population.
  • gene segments from different human populations are provided in a single transgene according to the invention (not necessarily in a collection of vertebrates)
  • the different human populations are for example together grouped under the same population genus "(a)" mentioned above.
  • the invention also provides a repertoire of antibodies expressed from a library of cells according to the invention.
  • the constant region of the transgenic locus is, in one example, an endogenous constant region of said vertebrate (eg, endogenous mouse or rat constant region, eg, from the same strain of mouse or rat as the non- human vertebrate itself).
  • an endogenous constant region of said vertebrate eg, endogenous mouse or rat constant region, eg, from the same strain of mouse or rat as the non- human vertebrate itself.
  • the invention also provides a method of constructing a cell (eg, an ES cell) according to the invention, the method comprising
  • the cell comprises a heavy chain locus constructed according to steps (a) to (c) and/or a light chain locus (kappa and/or lambda loci) constructed according to steps (a) to (c).
  • the cell is homozygous for the or each transgenic locus; optionally wherein antibody expression from loci endogenous to said cell has been inactivated. This is useful for confining the functional antibody gene repertoire, and thus antibody production, to antibodies bearing human variable regions.
  • the gene segment(s) in step (b) are identified from an immunoglobulin gene database selected from the 1000 Genomes, Ensembl, Genbank and IMGT databases.
  • the first and second human individuals are members of first and second ethnic populations respectively, wherein the populations are different, optionally wherein the human immunoglobulin gene segment derived from the genome sequence of the second individual is low- frequency (optionally rare) within the second ethnic population.
  • the invention also provides a method of making a transgenic non-human vertebrate (eg, a mouse or rat), the method comprising
  • an ES cell eg, a mouse C57BL/6N, C57BL/6J, 129S5 or 129Sv strain ES cell
  • a donor non-human vertebrate blastocyst eg, a mouse C57BL/6N, C57BL/6J, 129S5 or 129Sv strain blastocyst
  • the invention provides a transgenic non-human vertebrate (eg, a mouse or rat) made by the method or a progeny thereof.
  • the invention also provides a population of such non-human vertebrates.
  • the invention also provides a method of isolating an antibody that binds a predetermined antigen (eg, a bacterial or viral pathogen antigen), the method comprising
  • This method optionally further comprises after step (e) the step of isolating from said B lymphocytes nucleic acid encoding said antibody that binds said antigen; optionally exchanging the heavy chain constant region nucleotide sequence of the antibody with a nucleotide sequence encoding a human or humanised heavy chain constant region and optionally affinity maturing the variable region of said antibody; and optionally inserting said nucleic acid into an expression vector and optionally a host.
  • GenBank www.ncbi.nlm.nih.gov/genbank
  • Bioinformatics tools for database manipulation are also readily available and known to the skilled person, eg, as publicly available from the 1000 Genomes Project/EBI (www.100Qgenomes.org)
  • IMGT International ImMunoGeneTics Information System 9 ; M.-P. Lefranc, 2002;
  • IMGT is an integrated information system that specializes in antibodies, T cell receptors, and MHC molecules of all vertebrate species. It provides a common portal to standardized data that include nucleotide and protein sequences, oligonucleotide primers, gene maps, genetic polymorphisms, specificities, and two-dimensional (2D) and three-dimensional (3D) structures.
  • IMGT includes three sequence databases (IMGT/LIGM-DB, IMGT/MHC-DB, IMGT/PRIMERDB), one genome database (IMGT/GENE-DB), one 3D structure database (IMGT/3Dstructure-DB), and a range of web resources ("/MGf Marie-Paule page”) and interactive tools.
  • V-BASE (I. M. Tomlinson, 2002;http://www.mrc-cpe.cam. ac.uk/vbase).
  • V-BASE is a comprehensive directory of all human antibody germline variable region sequences compiled from more than one thousand published sequences. It includes a version of the alignment software DNAPLOT (developed by Hans-Helmar Althaus and Werner Muller) that allows the assignment of rearranged antibody V genes to their closest germline gene segments.
  • Antibodies Structure and Sequence(A. C. R. Martin, 2002; htto://www. bioinf.ora.uk/abs). This page summarizes useful information on antibody structure and sequence. It provides a query interface to the Kabat antibody sequence data, general information on antibodies, crystal structures, and links to other antibody-related information. It also distributes an automated summary of all antibody structures deposited in the Protein Databank (PDB). Of particular interest is a thorough description and comparison of the various numbering schemes for antibody variable regions.
  • PDB Protein Databank
  • AAAAA AHo's Amazing Atlas of Antibody Anatomy (A. Honegger, 2001;
  • This resource includes tools for structural analysis, modeling, and engineering. It adopts a unifying scheme for comprehensive structural alignment of antibody and T- cell-receptor sequences, and includes Excel macros for antibody analysis and graphical representation.
  • Therapeutic Antibody Human Homology Project which aims to correlate clinical efficacy and antiimmunoglobulin responses with variable region sequences of therapeutic antibodies.
  • the Antibody Resource Page (The Antibody Resource Page, 2000;
  • HapMap The International HapMap Consortium. 2003;
  • the HapMap Project is an international project that aims to compare the genetic sequences of different individuals to identify chromosomal regions containing shared genetic variants.
  • the HapMap www site provides tools to identify chromosomal regions and the variant therein, with options to drill down to population level frequency data.
  • This resource provides complete genomic sequence for 2500 unidentified individuals from one of 25 distinct population groups, with the aim of identifying genomic variants of >1%.
  • the site provides the ability to interrogate data utilizing online tools (e.g. 'Variation Pattern Finder') and to download variant data for individual population groups.
  • a low- frequency immunoglobulin gene segment is classed as one with 'Minor Allele Frequency' (MAF) (cumulative frequency) of between 0.5% - 5%, rare variants are those classed as having a MAF of less than 0.5% in a particular human population.
  • MAF 'Minor Allele Frequency'
  • germline refers to the canonical germline gene segment sequence.
  • the inventors have devised a collection of candidate polymorphic antibody gene segment variants, eg, human variant JH gene segments (eg, see Example 4), that can be built into the design of transgenic heavy chain loci in mice for expressing increasingly diverse and new, synthetic repertoires of human variable regions.
  • candidate polymorphic antibody gene segment variants eg, human variant JH gene segments (eg, see Example 4)
  • the invention provides the following embodiments.
  • the present invention provides in a fourth configuration-
  • Antibodies with long HCDR3 have been shown to neutralise a variety of pathogens effectively including HIV, Influenza virus, malaria and Africa trypanosomes. Reference is also made to naturally-occurring Camelid (eg, llama or camel) heavy chain-only antibodies which bear long HCDR3s for reaching relatively inaccessible epitopes (see, eg, EP0937140). Long HCDR3s can form unique stable subdomains with extended loop structure that towers above the antibody surface to confer fine specificity. In some cases, the long HCD 3 itself is sufficient for epitope binding and neutralization (Liu, L et al; Journal of Virology. 2011.
  • the unique structure of the long HCDR3 allows it to bind to cognate epitopes within inaccessible structure or extensive glycosylation on a pathogen surface.
  • human peripheral blood there is around 3.5% of naive B antibodies or 1.9% of memory B IgG antibodies containing the HCDR3s with lengths of more than 24 amino acids (PLoS One. 2012;7(5):e36750. Epub 2012 May 9; "Human peripheral blood antibodies with long HCDR3s are established primarily at original recombination using a limited subset of germline genes"; Briney BS e al, incorporated herein by reference) (Fig. 1).
  • the inventors chose in this configuration of the invention to include a human JH6 gene segment as a mandatory human gene segment in their IgH locus design.
  • a human JH6 gene segment as a mandatory human gene segment in their IgH locus design.
  • Several different naturally- occurring human JH6 variants are known (eg, JH6*01 to *04 as well as others; I MGT nomenclature). The inventors considered this when deciding upon which human JH6 variant should be included in the transgenic IgH locus design.
  • FIG. 7 An alignment of some human JH6 variants is shown in Figure 7 (from www.imgt.org: dashes indicate identical nucleotides; nucleotide changes versus the *01 variant are shown by underlined nucleotides and corresponding amino acid changes are shown by underlined amino acids; Genbank accession numbers (release 185.0) are shown prefixed by J, X, M or A).
  • the inventors used sequencing of human genomic DNA samples, inspection of public IgH DNA databases as well as informed choices on the basis of variant sequences as means to arrive at a rational choice of which JH6 variant to use.
  • the 1000 Genomes database uses human JH6*03 as the reference sequence, which would be a possible choice for the skilled person wishing to construct a transgenic IgH locus.
  • position 6 in JH6*03 is a tyrosine (Y) encoded by a TAC codon
  • Y tyrosine
  • G glycine
  • GGT codon the glycine being present as a YYG motif, forming part of a larger YYGXDX motif.
  • YYG and YYGXDX motifs are conserved across many vertebrate species (see Figures 7 & 8). This suggested to the inventors, therefore, that preservation of this motif might be desirable, which could guide the choice of JH6 variant for use in the present invention.
  • AID mutation hotspots the cytidine being the substrate of AID
  • these hotspots being the underlined motifs in the previous sentence.
  • the inventors considered the impact of this and in doing so they considered possible mutants created by AID activity at the cytidine.
  • JH6*02 decided specifically to use human JH6*02 as the mandatory human JH6 for their IgH locus design.
  • JH6*01 was rejected as the mandatory JH6 gene segment since the nucleotide sequence GGG CAA (encoding G and Q) contains a GGCA motif which is an AID recognition hotspot.
  • the inventors realised that JH6*04 also contains such a motif due to the presence of the sequence GGC AAA encoding G and K (positions 11 and 12 respectively).
  • the *02 variant has a C instead of a G that is in the *01 variant, the C desirably being a synonymous change (ie, not changing the encoded amino acid sequence around the CDR3/FW4 junction) and also this does not provide a GGCA AID hotspot motif.
  • the inventors therefore, decided that the mandatory JH6 should have this C base and this too pointed them to using the human JH6*02 variant.
  • the only JH6 species included in the locus or genome is human JH6*02.
  • the inventors obtained 9 anonymised DNA samples from cheek swabs of 9 consenting human adults. Sequencing was performed on IgH locus DNA to confirm natural JH6 variant usage. It was found that the genome of all 9 humans contained a JH6*02 variant gene segment. In 7 out of the 9 humans, the genome was homozygous for JH6*02 (ie, each chromosome 14 had JH6*02 as its JH6 gene segment in the IgH locus). The inventors also inspected the publicly-available sequence information from the genomes of well-known scientists Craig Venter and Jim Watson. Both of these genomes contain JH6*02 too. This indicated to the inventors that this variant is common in humans.
  • the inventors constructed transgenic JH6*02-containing IgH loci in ES cells, generated transgenic non-human vertebrates from the ES cells (both naive and immunised with a range of different target antigen types), isolated antibodies and heavy chain sequences based on JH6*02 as well as B-cells expressing these and made hybridomas expressing antigen-specific antibodies that are based on the chosen JH6*02 variant.
  • the chosen variant was preferably used over other JH gene segments in all settings (naive, immunised and antigen-specific) for the production of HCD 3 of at least 20 amino acids.
  • the present invention provides an IgH locus including human JH6*02 (IMGT nomenclature) as a mandatory JH gene segment.
  • the locus comprises non-human vertebrate (eg, mouse or rat) constant region gene segments downstream (ie, 3' of) the human JH6*02; and one or more VH gene segments (eg, a plurality of human VH gene segments) and one or more D gene segments (eg, a plurality of human D gene segments) upstream of (ie, 5' of) the human JH6*02.
  • the locus is comprised by a vector (eg, a DNA vector, eg, a yeast artificial chromosome (YAC), BAC or PAC).
  • Such a vector eg, YAC
  • a non-human vertebrate eg, mouse or rat
  • standard techniques eg, pronuclear injection
  • IgH chains comprising at least one chain whose variable domain is a product of the recombination of human JH6*02 with a VH and a D gene segment.
  • the locus (eg, with a completely human, rat or mouse constant region, or a human/mouse chimaeric constant region) can be provided in the genome of a non-human vertebrate (eg, mouse or rat) cell.
  • the cell is an ES cell or an antibody-producing cell (eg, an isolated B-cell, an iPS cell or a hybridoma).
  • the invention provides a non-human vertebrate (eg, a mouse or a rat) comprising an IgH locus of the invention which comprises a human JH6*02 gene segment, wherein the locus can express an IgH chain whose variable domain is a product of the recombination of human JH6*02 with a VH and a D gene segment.
  • a non-human vertebrate eg, a mouse or a rat
  • the locus can express an IgH chain whose variable domain is a product of the recombination of human JH6*02 with a VH and a D gene segment.
  • the inventors have successfully produced such mice which produce such IgH chains with VH domains based on human JH6*02.
  • the inventors isolated and sequenced IgH chains from the mice before (naive) and after (immunised) exposure to a range of target antigens and confirmed by comparison to IMGT IgH gene segment sequences that the isolated chains (and antibodies containing these) were produced based on JH6*02. Such chains were found in naive mice, as well as in antigen-specific antibodies from immunised mice.
  • B-cells were isolated from immunised mice, wherein the B-cells express antibodies based on JH6*02 and hybridomas were generated from the B-cells, the hybridomas expressing antigen-specific antibodies based on JH6*02.
  • the inventors therefore, provided the locus, vertebrate, cell and hybridoma of the invention based on the use of human JH6*02 and showed that antibodies based on JH6*02 and B-cells expressing these can be successfully produced and isolated following immunisation of the vertebrates, corresponding hybridomas being a good source of antibodies whose VH domains are based on JH6*02, eg for administration to a patient, eg, for human medicine. Furthermore, it was found possible to produce and isolated antigen-specific antibodies whose VH domains are based on JH6*02 and which had a relatively long HCDR3 (eg, 20 amino acids).
  • a non-human vertebrate (optionally a mouse or a rat) or vertebrate cell whose genome comprises an immunoglobulin heavy chain locus comprising human gene segment JH6*02, one or more VH gene segments and one or more D gene segments upstream of a constant region; wherein the gene segments in the heavy chain locus are operably linked to the constant region thereof so that the mouse is capable of producing an antibody heavy chain produced by recombination of the human JH6*02 with a D segment and a VH segment.
  • the invention provides
  • the locus comprises a human JH6, eg, JH6*02.
  • the invention also provides a HCDR3, VH domain, antibody heavy chain or antibody having a HCDR3 size of at least 20 amino acids.
  • the HCDR3 or VH domain (or VH domain of the heavy chain or antibody) comprises mouse AID-pattern somatic hypermutations and/or mouse dTd-pattern mutations. This can be provided, for example, wherein VH domain is produced in a mouse comprising mouse AID and/or mouse TdT (eg, endogenous AID or TdT). See also Annu. Rev. Biochem. 2007. 76:1-22; Javier M. Di noisya and Michael S.
  • the vertebrate is naive. In another embodiment, the vertebrate instead is immunised with a target antigen.
  • the vertebrate or cell mentioned below is capable of so producing an antibody heavy chain upon immunisation with a target antigen.
  • the vertebrate is an immunised vertebrate that produces antibody heavy chains specific for a target antigen and wherein the variable domains of the heavy chains are the product of recombination between a VH, D and JH6*02.
  • the D is selected from human D3-3, D2-15, D3-9; D4-17; D3-10; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; Dl-26; Dl-20; D5-18; D3-16; D2-21; Dl-14; D7-27; Dili D6-25; D2-14 and D4-23 (eg, selected from D3-9*01; D4-17*01; D3-10*01; D2-2*02; D5- 24*01; D6-19*01; D3-22*01; D6-13*01; D5-12*01; Dl-26*01; Dl-20*01; D5-18*01; D3-16*02; D2-21*02; Dl-14*01; D7-27*02; Dl-l*01; D6-25*01; D2-15*01; and D4-23*01).
  • the D is human D3-9 or D3-10.
  • the HCD 3 length is at least
  • the genome comprises additional human JH gene segments (eg, JH2, 3, 4 and 5 gene segments).
  • the genome comprises an immunoglobulin light chain locus comprising one or more human V gene segments and one or more human J gene segments upstream of a constant region (eg, a human or a mouse lambda or kappa constant region).
  • a constant region eg, a human or a mouse lambda or kappa constant region
  • the locus comprises control elements, such as an ⁇ and 5 ⁇ between the J gene segment(s) and the constant region as is known by the skilled person.
  • control elements such as an ⁇ and 5 ⁇ between the J gene segment(s) and the constant region as is known by the skilled person.
  • a mouse ⁇ and 5 ⁇ is included in the heavy chain locus between the JH6*02 and the constant region (ie, in 5' to 3' order the locus comprises the JH6*02, ⁇ and 5 ⁇ and constant region).
  • the ⁇ and 5 ⁇ are ⁇ and 5 ⁇ of a mouse 129-derived genome (eg, a 129Sv-derived genome, eg, 129Sv/EV (such as 129S7Sv/Ev (such as from AB2.1 or AB2.2 cells obtainable from Baylor College of Medicine, Texas, USA) or 129S6Sv/Ev))); in another example, the ⁇ and 5 ⁇ are ⁇ and 5 ⁇ of a mouse C57BL/6 -derived genome.
  • the locus can be constructed in the IgH locus of the genome of a cell selected from AB2.1, AB2.2, VGF1, CJ7 and FH14.
  • VGF1 cells were established and described in Auerbach W, Dunmore JH, Fairchild-Huntress V, et al; Establishment and chimera analysis of 129/SvEv- and C57BL/6-derived mouse embryonic stem cell lines. Biotechniques 2000; 29:1024-8, 30, 32, incorporated herein by reference.
  • the constant region (or at least a C ⁇ ; or C ⁇ and gamma constant regions thereof) is a constant region (or C ⁇ ; or C ⁇ and gamma constant regions thereof) is of a genome described in the paragraph immediately above.
  • JH6*02 and other human DNA sequences will be readily apparent to the skilled person.
  • a DNA sample from a consenting human donor (eg, a cheek swab sample as per the Example herein) from which can be obtained suitable DNA sequences for use in constructing a locus of the invention.
  • Other sources of human DNA are commercially available, as will be known to the skilled person.
  • the skilled person is able to construct gene segment sequence by referring to one or more databases of human Ig gene segment sequences disclosed herein.
  • the immunised vertebrate produces an antibody heavy chain specific for a target antigen and wherein the variable domain of the heavy chain is the product of recombination between a VH, D and JH6*02 and wherein the HCDR3 length is at least 20 amino acids (eg, 20, 21, 23 or 24).
  • a non-human vertebrate cell (optionally a mouse cell or a rat cell) whose genome comprises an immunoglobulin heavy chain locus comprising human gene segment JH6*02, one or more VH gene segments and one or more D gene segments upstream of a constant region; wherein the gene segments in the heavy chain locus are operably linked to the constant region thereof for producing (eg, in a subsequent progeny cell) an antibody heavy chain produced by recombination of the human JH6*02 with a D segment and a VH segment.
  • the cell of clause 3 which is an ES cell capable of differentiation into a progeny antibody- producing cell that expresses said heavy chain.
  • the heavy chain locus comprises a human JH6*02 recombination signal sequence (RSS) operably connected 5' to the JH6*02 gene segment.
  • RSS recombination signal sequence
  • the native RSS-JH6*02 sequence can be used to advantageously maintain the natural pairing between RSS and theis JH gene segment.
  • the following sequence is used:- ggtttttgtggggteaggatggacattctgccattgtgattactactactactacggtatggacgtctggggccaagggaccacgg ⁇ tctcctcag (SEQ ID NO: 238)
  • RSSs have a common architecture: 9mer (eg, first underlined sequence above) followed by a 22bp spacer and then a 7mer (eg, second underlined sequence above). Spacers are 23bp +/- 1 normally, while the 9 and 7mer are more conserved.
  • JH6*02 is the only JH6-type gene segment in the genome.
  • the locus comprises one, more or all human D gene segments D3-9; D4-17; D3-10; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; Dl-26; Dl-20; D5-18; D3-16; D2-21; Dl-14; D7-27; Dl-1; D6-25; D2-14; and D4-23.
  • the locus comprises one, more or all of human D gene segments D3-9*01; D4- 17*01; D3-10*01; D2-2*02; D5-24*01; D6-19*01; D3-22*01; D6-13*01; D5-12*01; Dl-26*01; Dl-20*01; D5-18*01; D3-16*02; D2-21*02; Dl-14*01; D7-27*02; Dl-l*01; D6-25*01; D2-15*01; and D4-23*01.
  • the vertebrate or cell of clause 10, wherein the locus comprises one, more or all human D gene segments D3-9, D3-10, D6-19, D4-17, D6-13, D3-22, D2-2, D2-25 and D3-3.
  • the locus comprises one, more or all human D gene segments D3-9, D3-10, D6- 19, D4-17, D6-13 and D3-22 (for example one, more or all of D3-9*01, D3-10*01, D6-19*01, D4- 17*01, D6-13*01 and D3-22*01).
  • D segments were found in naive repertoires to be productive in recombination with human JH6*02 to produce HCDR3s of at least 20 amino acids in length.
  • the locus comprises one, more or all human D gene segments D3-10, D6-19 and Dl-26 (for example, one, more or all of D3-10*01, D6-19*01 and Dl-26*01). These D segments were found in immunised repertoires to be productive in recombination with human JH6*02 to produce HCDR3s of at least 20 amino acids in length.
  • the locus comprises one, more or all human D gene segments D3-9 and D3-10 (for example, one, more or all of D3-9*01 and D3-10*01). These D segments were found in antigen-specific repertoires to be productive in recombination with human JH6*02 to produce HCDR3s of at least 20 amino acids in length.
  • the 3'-most D gene segment is D7-27.
  • the locus comprises all of human D gene segments from Dl-1 to D7-27 as present in a germline human IgH locus (eg, as shown in the IMGT database).
  • the JH6*02 is in human germline configuration with respect to one, more or all of the ⁇ , 5 ⁇ and constant region (eg, C ⁇ ).
  • the locus comprises one, more or all of IGHV gene segments selected from V3-21, V3-13, V3-7, V6-1, Vl-8, Vl-2, V7-4-1, Vl-3, Vl-18, V4-4, V3-9, V3-23, V3-11 and V3-20.
  • the locus comprises one, more or all human IGHV gene segments V3-21, V3-13, V3-7, V6-1, Vl-8, Vl-2, V7-4-1, Vl-3, Vl-18, V4-4, V3-9, V3-23 (for example, one, more or all of V3-21*03, V3-13*01, V3-7*01, V6-l*01, Vl-8*01, Vl-2*02, V7-4-l*01, Vl-3*01, Vl-18*01, V4- 4*01, V3-9*01 and V3-23*04).
  • These segments were found in naive repertoires to be productive in recombination with human JH6*02 to produce HCD 3s of at least 20 amino acids in length.
  • the locus comprises one, more or all human IGHV gene segments V3-7, V3-11 and V4-4 (for example, one, more or all of V3-7*01, V3-ll*01 and V4-4*02). These segments were found in immunised repertoires to be productive in recombination with human JH6*02 to produce HCDR3s of at least 20 amino acids in length.
  • the locus comprises one, more or all human IGHV gene segments V4-4, Vl-8, V3- 9, V3-11 and V3-20 (for example, one, more or all of V4-4*02, Vl-8*01, V3-9*01, V3-ll*01 and V3-20 (eg, *d01). These segments were found in antigen-specific repertoires to be productive in recombination with human JH6*02 to produce HCDR3s of at least 20 amino acids in length.
  • the locus comprises one, more or all of human D3-9*01, D3-10*01, D6-19*01, D6-13*01, Dl-26*01, IGHV1-8*01, IGHV4-61*01, IGHV6- 1*01, IGHV4-4*02, IGHV1-3*01, IGHV3-66*03, IGHV3-7*01 and IGHV3-9*01.
  • locus comprises one, more or all of human IGHV1-8*01, D3-9*01 and D3- 10*01. These gene segments were productive with JH6*02 to produce HCDR3s of at least 20 amino acids in more than 10 antibodies.
  • An antibody-producing cell (eg, a B-cell) that is a progeny of the cell of any one of clauses 3 to 14, wherein the antibody-producing cell comprises a heavy chain locus comprising a rearranged variable region produced by recombination of human JH6*02 with a D segment and a VH segment (eg, JH6*02 with human VH3-11 (eg, VH3-11*01) and D3-9; VH3-20 (eg, VH3-20*01) and D3-10; VH4-4 (eg, VH4-4*02) and D3-10; VH3-9 (eg, VH3-9*01) and D3-10; or VH1-8 (eg, VH1-8*01) and D310).
  • a heavy chain locus comprising a rearranged variable region produced by recombination of human JH6*02 with a D segment and a VH segment
  • VH3-11 eg, VH3-11*01
  • variable region would be the product of in vivo somatic hypermutation in a non-hman vertebrate or cell of the invention.
  • a target antigen-specific antibody comprising a heavy chain that comprises a rearranged variable region produced by recombination of human JH6*02 with
  • variable region would be the product of in vivo somatic hypermutation in a non-hman vertebrate or cell of the invention
  • the HCDR3 length is at least 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acids. Additionally, in one example the length is no more than 35, 34, 33, 32 or 31 amino acids. For example, the HCDR3 length is 20, 21, 22, 23 or 24 amino acids.
  • a heavy chain (eg, comprised by an antibody) isolated from a vertebrate of any one of clauses 1, 2, 5 to 14 and 17 to 21 wherein the heavy chain comprises a HCD 3 of at least 20 amino acids.
  • the heavy chain is chimaeric where the C region is non-human.
  • the heavy chain is human where the C region is human.
  • a heavy chain eg, comprised by an antibody whose VH variable domain is identical to the VH variable domain of the heavy chain of clause 22 or 23, and which comprises a human constant region or a human-mouse chimaeric constant region (eg, CHI is human and the other constant domains are mouse).
  • a method for producing a heavy chain, VH domain or an antibody specific to a target antigen comprising immunizing a non-human vertebrate according to any one of clauses 1, 2, 5 to 14 and 17 to 21 with the antigen and isolating the heavy chain, VH domain or an antibody specific to a target antigen or a cell producing the heavy chain, VH domain or an antibody, wherein the heavy chain, VH domain or an antibody comprises a HCDR3 that is derived from the recombination of human JH6*02 with a VH gene segment and a D gene segment. 7.
  • a method for producing a human heavy chain or antibody comprising carrying out the method of clause 26, wherein the constant region of the locus is a non-human vertebrate (eg, mouse or rat) constant region, and then replacing the non-human constant region of the isolated heavy chain or antibody with a human constant region (eg, by engineering of the nucleic acid encoding the antibody).
  • the constant region of the locus is a non-human vertebrate (eg, mouse or rat) constant region, and then replacing the non-human constant region of the isolated heavy chain or antibody with a human constant region (eg, by engineering of the nucleic acid encoding the antibody).
  • the HCD 3 length is at least 20 amino acids as herein described.
  • a vector eg, a CHO cell or HEK293 cell vector comprising the nucleic acid of clause 30;
  • a host cell eg, a CHO cell or HEK293 cell.
  • a pharmaceutical composition comprising the antibody, heavy chain or VH domain (eg, comprised by an antibody) of any one of clauses 22 to 25 and 28, together with a
  • pharmaceutically-acceptable excipient eg, a further antigen-specific variable domain, heavy chain or antibody.
  • a medicament eg, a further antigen-specific variable domain, heavy chain or antibody.
  • the antibody, heavy chain or VH domain eg, comprised by an antibody of any one of clauses 22 to 25 and 28 for use in medicine (eg, human medicine).
  • the locus comprises the following human VH gene segments
  • the locus comprises the following human VH gene segment
  • the locus comprises the following human JH gene segment variants
  • the locus comprises the following human D gene segments
  • the present invention provides in a fifth confieuration:-
  • Constant Regions Tailored to Human Use & Antibody Humanisation Additional rational design and bioinformatics has led the inventors to realise that specific human constant region variants are conserved across many diverse human populations. The inventors realised that this opens up the possibility of making a choice to humanise antibodies, chains and variable domains by using such specific constant regions in products, rather than arbitrarily choosing the human constant region (or a synthetic version of a human constant region). This aspect of the invention also enables one to tailor antibody-based drugs to specific human ethnic populations, thereby more closely matching drug to patient (and thus disease setting) than has hitherto been performed.
  • antibodies are humanised with an arbitrary choice of human constant region (presumably derived from one (often unknown) ethnic population or non-naturally occurring) that does not function as well in patients of a different human ethnic population. This is important, since the constant region has the major role in providing antibody effector functions, eg, for antibody recycling, cellular and complement recruitment and for cell killing.
  • human IgG sub-types IgGl, lgG2, gG3 and lgG4 exhibit differential capacity to recruit immune functions, such as antibody-dependent cellular cytotoxicity (ADCC, e.g., IgGl and lgG3), antibody-dependent cellular phagocytosis (ADCP, e.g., IgGl, lgG2, lgG3 and lgG4), and complement dependent cytotoxicity (CDC, e.g., IgGl, lgG3).
  • ADCC antibody-dependent cellular cytotoxicity
  • ADCP antibody-dependent cellular phagocytosis
  • CDC complement dependent cytotoxicity
  • Sub-type-specific engagement of such immune functions is based on selectivity for Fc receptors on distinct immune cells and the ability to bind Clq and activate the assembly of a membrane attack complex (MAC).
  • MAC membrane attack complex
  • FcYRI FcYRI
  • FcYRIIa/b/c FcYRIIIa/b
  • IgGl IgGl
  • lgG2 restricted to the FcYRIIa 131H polymorphism
  • lgG4 only has measurable affinity for FcYRI.
  • the key contact residues for receptor binding have been mapped to the amino acid residues spanning the lower hinge and CH2 region.
  • standard protein engineering techniques some success in enhancing or reducing the affinity of an antibody preparation for Fc receptors and the Clq component of complement has been achieved.
  • lgG2 is least capable of binding the family of Fc receptors.
  • lgG2 as the starting point, efforts have been made to find a mutant with diminished effector functions but which retains FcRn binding, prolonged stability, and low immunogenicity.
  • Improved mutants of this nature may provide improved antibody therapeutics with retained safety.
  • Human IgGl therapeutic antibodies that bind to cell surface targets are able to engage effector cells that may mediate cell lysis of the target cell by antibody-dependent cellular cytotoxicity (ADCC) or complement dependent cytotoxicity (CDC). These mechanisms occur through interaction of the CH2 region of the antibody Fc domain to Fcy receptors on immune effector cells or with Clq, the first component of the complement cascade.
  • ADCC antibody-dependent cellular cytotoxicity
  • CDC complement dependent cytotoxicity
  • Table 19 shows the activities of different human gamma sub-types.
  • the skilled person may choose accordingly to promote or dampen-down activity depending upon the disease setting in humans of interest.
  • use of a human gamma-1 constant region is desirable when one wishes to isolated totally human heavy chains and antibodies that have relatively high complement activation activity by the classical pathway and FcYRl recognition in human patients. See also Mol Immunol. 2003 Dec;40(9):585-93; "Differential binding to human Fcgamma Rl la and Fcgamma Rllb receptors by human IgG wild type and mutant antibodies"; Armour KL et al, which is incorporated herein by reference.
  • lgG2 constant regions are well suited to producing antibodies and heavy chains according to the invention for binding to cytokines or soluble targets in humans, since lgG2 is essentially FcYRl, Ill- silent, FcYRl la-active and has little Complement activity.
  • IgGl constant regions have wide utility for human therapeutics, since IgGl antibodies and heavy chains are FcYRl, II, III- active and have complement activity. This can be enhanced by using a human gamma-1 constant region that has been activated by engineering as is known in the art.
  • the work of the inventors has therefore identified a collection of human constant region of different isotypes from which an informed choice can be made when humanising chimaeric antibody chains (or conjugating V domains, such as dAbs or Camelid VHH, to constant regions).
  • the collection was identified on the basis of bioinformatics analysis of the 1000 Genomes database, the inventors selecting constant region variants that are frequently occurring across several human ethnic populations, as well as those that appear with relatively high frequency within individual populations (as assessed by the number of individuals whose genomes comprise the variant).
  • the inventors have provided a collection of human constant region variants that are naturally-occuring and which can be used when rationally designing antibodies, heavy chains and other antibody-based formats that bear a human constant region.
  • this is useful when humanising chimaeric heavy chains to produce totally human chains in which both the variable and constant regions are human. This is useful for compatibility with human patients receiving antibody-based drugs.
  • a method of producing an antibody heavy chain comprising
  • an antigen-specific heavy chain variable domain eg, VH (such as a human VH or dAb) or VHH or a humanised heavy chain variable domain
  • variable domain (b) combining the variable domain with a human heavy chain constant region to produce an antibody heavy chain comprising (in N- to C-terminal direction) the variable domain and the constant region;
  • the human heavy chain constant region is an IGHAref, IGHAla, IGHA2a, IGHA2b, IGHGlref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref, IGHG4a, IGHDref, IGHEref, IGHMref, IGHMa or IGHMb constant region.
  • Step (b) can be carried out, eg, using recombinant DNA technology using the corresponding nucleotide sequences.
  • genomic DNA or equivalent ie, having introns and exons and optionally also 5' UT sequences, eg, with native or a non-native leader sequence
  • genomic DNA or equivalent ie, having introns and exons and optionally also 5' UT sequences, eg, with native or a non-native leader sequence
  • an intronless sequence can be used, for example any of the "CDS" sequences disclosed as SEQ ID NO: 365 onwards herein (eg, with native or a non-native leader sequence).
  • the human heavy chain constant region is an IGHAref constant region.
  • the human heavy chain constant region is an IGHAla constant region.
  • the human heavy chain constant region is an IGHA2a constant region.
  • the human heavy chain constant region is an IGHA2b constant region.
  • the human heavy chain constant region is IGHGlref constant region.
  • the human heavy chain constant region is an IGHG2ref constant region.
  • the human heavy chain constant region is an IGHG2a constant region.
  • the human heavy chain constant region is an IGHG3ref constant region.
  • the human heavy chain constant region is an IGHG3a constant region.
  • the human heavy chain constant region is an IGHG3b constant region.
  • the human heavy chain constant region is an IGHG4ref constant region.
  • the human heavy chain constant region is an IGHG4a constant region.
  • the human heavy chain constant region is an IGHDref constant region.
  • the human heavy chain constant region is an IGHEref constant region.
  • the human heavy chain constant region is an IGHMref constant region.
  • the human heavy chain constant region is an IGHMa constant region.
  • the human heavy chain constant region is an IGHMb constant region.
  • a derivative eg, a mutant or conjugate
  • a toxic payload can be conjugated (eg, for oncology applications).
  • one or more mutations can be introduced, as is known in the art, to inactivate or enhance Fc effector function.
  • variable domain is a human variable domain.
  • a human variable domain is, for example, the product of recombination in a transgenic non- human vertebrate of human VH, D and JH gene segments.
  • the variable domain is identified using in vitro display technology from a human VH library, eg, using phage display, ribosome display or yeast display, as is known in the art.
  • the variable domain is a humanised variable domain, eg, comprising human frameworks with non-human (eg, mouse or rat) CD s). Humanisation technology is conventional in the art, and will be readily known to the skilled person.
  • variable domain has previously been selected from a non-human vertebrate that has been immunised with the antigen.
  • the vertebrate (such as a mouse or rat) genome comprises a chimaeric heavy chain locus comprising a human variable region (human V, D and JH gene segments) operably connected upstream of a non-human vertebrate constant region so that the locus is able to rearrange for the expression of heavy chains comprising human variable domains and non- human vertebrate constant regions.
  • a human variable region human V, D and JH gene segments
  • variable domain is selected using an in vitro technology such as phage display, ribosome display or yeast display.
  • the variable domain may be displayed with or without an constant region, provided that it is later combined with a human constant region as per the invention.
  • an expression vector (Eg, a mammalian expression vector, such as a CHO or HEK293 vector) comprising a nucleotide sequence encoding the constant region; inserting a nucleotide sequence encoding the variable domain into the vector 5' of the constant region sequence; inserting the vector into a host cell and expressing the heavy chain by the host cell; the method further comprising isolating a heavy chain (eg, as part of an antibody) comprising the variable domain and the human constant region.
  • an expression vector Eg, a mammalian expression vector, such as a CHO or HEK293 vector
  • the vector comprises regulatory elements sufficient to effect expression of the heavy chain when the vector is harboured by a host cell, eg, a CHO or HEK293 cell.
  • An antibody comprising a human heavy chain, the heavy chain comprising a variable domain that is specific for an antigen and a constant region that is an IGHAref, IGHAla, IGHA2a, IGHA2b, IGHGlref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref, IGHG4a, IGHDref, IGHEref, IGHMref, IGHMa or IGHMb constant region.
  • a polypeptide comprising (in N- to C- terminal direction) a leader sequence, a human variable domain that is specific for an antigen and a human constant region that is an IGHAref, IGHAla, IGHA2a, IGHA2b, IGHGlref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref, IGHG4a, IGHDref, IGHEref, IGHMref, IGHMa or IGHMb constant region; wherein (i) the leader sequence is not the native human variable domain leader sequence (eg, the leader sequence is another human leader sequence or a non-human leader sequence); and/or (ii) the variable domain comprises mouse AID-pattern somatic mutations or mouse terminal deoxynucleotidyl transferase (TdT)- pattern junctional mutations.
  • TdT mouse terminal deoxynucleotidyl
  • the promoter sequence is a human IGK 3-15 promoter.
  • variable domain comprises mouse AID-pattern somatic mutations and/or mouse terminal deoxynucleotidyl transferase (TdT)- pattern junctional mutations.
  • one way, in any aspect of this configuration of the invention, to provide mouse AID-pattern somatic mutations and/or mouse terminal deoxynucleotidyl transferase (TdT)- pattern junctional mutations is to select a variable domain from a non-human vertebrate or cell.
  • a vertebrate or cell as disclosed herein.
  • a vector eg, a CHO cell or HEK293 cell vector
  • comprising the nucleic acid of aspect 8, 9 or 10; optionally wherein the vector is in a host cell eg, a CHO cell or HEK293 cell.
  • a pharmaceutical composition comprising the antibody or polypeptide of any one of aspects 6, 7 and 10, together with a pharmaceutically-acceptable excipient, diluent or a medicament (eg, a further antigen-specific variable domain, antibody chain or antibody).
  • a pharmaceutically-acceptable excipient e.g, a further antigen-specific variable domain, antibody chain or antibody.
  • the antibody or polypeptide of any one of aspects 6, 7 and 10 for use in treating and/or preventing a medical condition in a human patient.
  • IGHAla constant region and the human population is selected from any population number 1-14;
  • IGHA2a constant region and the human population is selected from any population number 1-14;
  • (iV) IGHG2a constant region and the human population is selected from any population number 1-9 and 11-13;
  • IGHG3b constant region and the human population is selected from any population number 1-8 and 11-13;
  • IGHG4a constant region and the human population is selected from any population number 1-9 and 11-13;
  • IGHMa constant region and the human population is selected from any population number 1-14; or
  • IGHMb constant region and the human population is selected from any population number 1-14; Wherein the populations are numbered as follows (population labels being according to 1000
  • a vector (eg, a CHO cell or HEK293 cell vector) comprising a IGHGlref, IGHG2ref, IGHG2a,
  • IGHG3ref IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region nucleotide sequence that is 3' of a cloning site for the insertion of a human antibody heavy chain variable domain nucleotide sequence, such that upon insertion of such a variable domain sequence the vector comprises (in 5' to 3' direction) a promoter, a leader sequence, the variable domain sequence and the constant region sequence so that the vector is capable of expressing a human antibody heavy chain when present in a host cell.
  • the present invention provides in a Sixth confieuration:-
  • the inventors' analysis has revealed groupings of naturally-occurring human antibody gene segment variants as set out in Table 13 and Table 14. This revealed the possibility of producing transgenic genomes in non-human vertebrates and cells wherein the genomes contain more than the natural human complement of specific human gene segments. In one example, this can be achieved by providing more than the natural human complement of a specific gene segment type on one or both of the respective Ig locus (eg, one or both chromosomes harbouring IgH in a mouse genome or mouse cell genome).
  • this configuration of the invention provides the following (as set out in numbered paragraphs):-
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 3 human variable region gene segments of the same type (eg, at least 3 human VH6-1 gene segments, at least 3 human J H6 gene segments, at least 3 human VK1-39 gene segments, at least 3 human D2-2 gene segments or at least 3 human JKI gene segments), wherein at least two of the human gene segments are variants that are not identical to each other.
  • the genome comprises a variable region that comprises V, D and J gene segments (for the variable region of a heavy chain locus) or V and J gene segments (for the variable region of a light chain locus) upstream of a constant region for expression of heavy or light chains respectively.
  • the skilled person can choose to provide more than the wild type human complement of a specific gene segment type by providing several copies of one variant type of the human gene segment.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 3 human variable region gene segments of the same type (eg, at least 3 human VH6-1 gene segments, at least 3 human J H6 gene segments, at least 3 human VK1-39 gene segments, at least 3 human D2-2 gene segments or at least 3 human JKI gene segments), wherein the human gene segments are identical variants.
  • the genome comprises a variable region that comprises V, D and J gene segments (for the variable region of a heavy chain locus) or V and J gene segments (for the variable region of a light chain locus) upstream of a constant region for expression of heavy or light chains respectively.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 3 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments) cis at the same Ig locus.
  • the skilled person can choose to provide more than the wild type human complement of a specific gene segment type by providing several copies of one variant type of the human gene segment.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 non-endogenous variable region gene segments of the same variant type (eg, at least 2 human JH6*02 gene segments) cis at the same Ig locus.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments) trans at the same Ig locus; and optionally a third human gene segment of the same type, wherein the third gene segment is cis with one of said 2 different gene segments.
  • the skilled person can choose to provide more than the wild type human complement of a specific gene segment type by providing several copies of one variant type of the human gene segment.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different human variable region gene segments of the same variant type (eg, at least 2 human JH6*02 gene segments) trans at the same Ig locus; and optionally a third human gene segment of the same variant type, wherein the third gene segment is cis with one of said 2 different gene segments.
  • a population of non-human vertebrates comprising a repertoire of human variable region gene segments, wherein the plurality comprises at least 2 human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), a first of said different gene segments is provided in the genome of a first vertebrate of the population, and a second of said different gene segments being provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second gene segment.
  • the plurality comprises at least 2 human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments)
  • a first of said different gene segments is provided in the genome of a first vertebrate
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 3 human variable region gene segments of the same type (eg, at least 3 human VH6-1 gene segments, at least 3 human J H6 gene segments, at least 3 human VK1-39 gene segments, at least 3 human D2-2 gene segments or at least 3 human JKI gene segments), wherein at least two of the human gene segments are variants that are not identical to each other.
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments) cis at the same Ig locus.
  • a non-human vertebrate eg, a mouse or rat
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments) trans at the same Ig locus; and optionally a third human gene segment of the same type, wherein the third gene segment is cis with one of said 2 different gene segments.
  • a non-human vertebrate eg, a mouse or rat
  • a method of providing an enhanced human immunoglobulin variable region gene segment repertoire comprising providing a population of non-human vertebrates (eg, a mouse or rat) comprising a repertoire of human variable region gene segments, wherein the method comprises providing at least 2 different human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), wherein a first of said different gene segments is provided in the genome of a first vertebrate of the population, and a second of said different gene segments is provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second gene segment.
  • a population of non-human vertebrates eg, a mouse or rat
  • the method comprises providing at least 2 different human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human J H6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JKI gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • the gene segments are derived from the genome sequence of two or more different human individuals; optionally wherein the different human individuals are from different human populations.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 human variable region gene segments of the same type (eg, at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human J KI gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations; optionally wherein at least 2 or 3 of said different gene segments are provided at the same Ig locus in said genome.
  • a non-human vertebrate eg, a mouse or rat
  • each of said gene segments occurs in 10 or more different human populations.
  • each of said gene segments has a human frequency of 5% or greater (eg, 10, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% or greater).
  • Frequency can, for example, be cumulative frequency in the 1000 Genomes database.
  • each of said gene segments occurs in 10 or more different human populations.
  • each of said gene segments occurs in the 1000 Genomes database in more than 50 individuals.
  • each of said gene segments has a human frequency of 5% or greater (eg, 10, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% or greater); and (ii) occurs in 10 or more different human populations.
  • Frequency can, for example, be cumulative frequency in the 1000 Genomes database.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising first and second human Ig locus gene segments of the same type (eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments), wherein the first gene segment is a gene segment selected from Table 14 (eg, IGHJ6-a) and the second gene segment is the corresponding reference sequence (eg, IGHJ6 ref; SEQ ID NO: 244).
  • Table 14 lists commonly-occurring natural human variants. It can be seen that these occur across many human populations and thus usefully have wide applicability for human antibody- based drugs.
  • the gene segments are provided as targeted insertions into an endogenous non- human vertebrate Ig locus.
  • random integration eg, using YACs
  • YACs YACs
  • the genome comprises a variable region that comprises V, D and J gene segments (for the variable region of a heavy chain locus) or V and J gene segments (for the variable region of a light chain locus) upstream of a constant region for expression of heavy or light chains respectively.
  • the invention enables the skilled person to select two or more different naturally-occurring human gene segment variants for combination into the genome of a non- human vertebrate or cell.
  • a reference sequence need not be included. It may be desirable to use one or more rare gene segments to increase diversity of the repertoire. Additionally or alternatively, it may be desirable to include a mixture of frequent and rare variants of the same type to provide repertoire diversity. The variants may be chosen additionally or alternatively to tailor the gene segment inclusion to one or more specific human populations as indicated by the information provided in Table 13 or Table 14.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising first and second human Ig locus gene segments of the same type (eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments), wherein the gene segments are gene segments selected from Table 13 or Table 14; and optionally wherein one or more of the gene segments appears in Table 14 (eg, IGHJ6-a) or is a reference sequence (eg, IGHJ6 ref; SEQ. ID NO: 244).
  • the gene segments are heavy chain gene segments and the non-human locus is an IgH locus.
  • the gene segments are light chain (kappa or lambda) gene segments and the non-human locus is an IgL locus.
  • the chromosomes are the same type (eg, both mouse chromosome 6 or rat chromosome 4).
  • first gene segment is a gene segment selected from any one of Tables 1 to 7 and 9 to 14 (eg, selected from Table 13 or 14) and the second gene segment is the corresponding reference sequence.
  • a population of non-human vertebrates comprising first and second human Ig locus gene segments of the same type (eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments), wherein the first gene segment is a gene segment selected from any one of Tables 1 to 7 and 9 to 14 (eg, Table 13 or 14) (eg, IGHJ6-a) and the second gene segment is the corresponding reference sequence (eg, SEQ. ID NO: 7), wherein the first gene segment is provided in the genome of a first vertebrate of the population, and the second gene segment is provided in the genome of a second vertebrate of the population.
  • the gene segments are heavy chain gene segments and the non-human locus is an IgH locus.
  • the gene segments are light chain (kappa or lambda) gene segments and the non-human locus is an IgL locus.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising first and second human Ig locus gene segments of the same type (eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments), wherein the first gene segment is a gene segment selected from any one of Tables 1 to 7 and 9 to 14 (eg, Table 13 or 14) (eg, IGHJ6-a) and the second gene segment is the corresponding reference sequence (eg, SEQ. ID NO: 7).
  • first and second human Ig locus gene segments of the same type eg, first and second human JH6 gene segments; or first and second lgG2 gene segments; or first and second human J ⁇ 7 gene segments
  • the first gene segment is a gene segment selected from any one of Tables 1 to 7 and 9 to 14 (eg, Table 13 or 14) (eg, IGHJ6-a) and the second
  • a method of providing an enhanced human immunogolobulin gene segment repertoire comprising providing a population according to any one of paragraphs 30 to 33.
  • the inventors identified gene segment variants from their analysis that are relatively prevalent in a small number of human populations, and not across many populations.
  • the inventors realized that inclusion of one or more of such gene segments in the configurations of the invention (eg, in transgenic Ig loci, vertebrates and cells) would be useful for producing antibodies, Ig chains and variable domains that can address antigens (eg, disease- causing antigens or pathogens) to which the small number of human populations may become exposed.
  • antigens eg, disease- causing antigens or pathogens
  • Such products would be useful for treating and/or preventing disease or medical conditions in members of such a population.
  • This aspect could also be useful for addressing infectious disease pathogens that may have been common in the small number of populations, but which in the future or relatively recently in evolution has become a more prevalent disease-causing pathogen in other human populations (ie, those not listed in Table 13 against the gene segment variant(s) in question).
  • the inventors From the 1000 Genomes database the inventors have identified the gene segment variants listed in Table 20.
  • one, more or all of the gene segments used in the present invention can be a gene segment listed in Table 20A, 20B, 20C or 20D.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising at least 3 human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein at least two of the human JH gene segments are variants that are not identical to each other.
  • any cell of the invention is an isolated cell.
  • An "isolated" cell is one that has been identified, separated and/or recovered from a component of its production environment (eg, naturally or recombinantly).
  • the isolated cell is free of association with all other components from its production environment, eg, so that the cell can produce an antibody to an FDA-approvable or approved standard.
  • Contaminant components of its production environment such as that resulting from recombinant transfected cells, are materials that would typically interfere with research, diagnostic or therapeutic uses for the resultant antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.
  • the polypeptide will be purified: (1) to greater than 95% by weight of antibody as determined by, for example, the Lowry method, and in some embodiments, to greater than 99% by weight; (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under non- reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Ordinarily, however, an isolated cell will be prepared by at least one purification step.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising at least 2 different non-endogenous JH gene segments (eg, human gene segments) of the same type (JH1, JH2, JH3, JH4, JH5 or JH6) cis at the same Ig (eg, IgH, eg, endogenous IgH, eg, mouse or rat IgH) locus.
  • the genome comprises a human VH, D and JH repertoire comprising said different JH gene segments.
  • the non-endogenous JH gene segments are non-mouse or non-rat, eg, human JH gene segments.
  • one or more or all of the non-endogenous gene segments are synthetic.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6) trans at the same Ig (eg, IgH, eg, endogenous IgH, eg, mouse or rat IgH) locus; and optionally a third human JH gene segments of the same type, wherein the third JH is cis with one of said 2 different JH gene segments.
  • a population of non-human vertebrates comprising a repertoire of human JH gene segments, wherein the plurality comprises at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), a first of said different JH gene segments is provided in the genome of a first vertebrate of the population, and a second of said different JH gene segments being provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second JH gene segment.
  • non-human vertebrates eg, mice or rats
  • the plurality comprises at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6)
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B- cell
  • having a genome comprising at least 2 different non-endogenous (eg, human) JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (eg, 3, 4, 5 or 6 generations).
  • the non-endogenous JH gene segments are human JH gene segments.
  • one or more or all of the non-endogenous gene segments are synthetic.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 3 human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein at least two of the human JH gene segments are variants that are not identical to each other.
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous (eg, human) JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6) cis at the same Ig (eg, IgH, eg, endogenous IgH, eg, mouse or rat IgH) locus).
  • the non-endogenous JH gene segments are non-mouse or non-rat, eg, human JH gene segments.
  • one or more or all of the non-endogenous gene segments are synthetic.
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6) trans at the same Ig (eg, IgH, eg, endogenous IgH, eg, mouse or rat IgH) locus; and optionally a third human JH gene segments of the same type, wherein the third JH is cis with one of said 2 different JH gene segments.
  • JH1, JH2, JH3, JH4, JH5 or JH6 trans at the same Ig (eg, IgH, eg, endogenous IgH, eg, mouse or rat IgH) locus
  • a third human JH gene segments of the same type wherein the third JH is cis with one of said 2 different JH gene segments.
  • a method of providing an enhanced human immunoglobulin JH gene segment repertoire comprising providing a population of non-human vertebrates (eg, a mouse or rat) comprising a repertoire of human JH gene segments, wherein the method comprises providing at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein a first of said different J H gene segments is provided in the genome of a first vertebrate of the population, and a second of said different JH gene segments is provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second JH gene segment.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous (eg, human) JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (eg, 3, 4, 5, or 6 generations).
  • the non-endogenous JH gene segments are human JH gene segments.
  • one or more or all of the non-endogenous gene segments are synthetic.
  • At least 2 or 3 of said different gene segments are provided cis at the same Ig locus in said genome.
  • the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (eg, 3, 4, 5, or 6 generations).
  • the JH gene segments are derived from the genome sequence of two or more different human individuals; optionally wherein the different human individuals are from different human populations.
  • the individuals are not genetically related (eg, going back 3, 4, 5, or 6 generations).
  • At least one of the different JH segments is a synthetic mutant of a human germline JH gene segment.
  • the invention also provides a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate (eg, a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 human JH gene segments of the same type (JH1, JH2, J H3, JH4, JH5 or JH6), wherein the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (eg, 3, 4, 5, or 6 generations); optionally wherein at least 2 or 3 of said different gene segments are provided at the same IgH locus in said genome.
  • a non-human vertebrate eg, a mouse or rat
  • the genome comprises a substantially complete functional repertoire of human JH gene segment types supplemented with one, two or more human JH gene segments, wherein said substantially complete functional repertoire and the supplementary JH gene segments are not found together in the germline genome of a human individual.
  • the population comprises a substantially complete functional repertoire of human JH gene segment types supplemented with one, two or more human JH gene segments, wherein said substantially complete functional repertoire and the supplementary JH gene segments are not found together in the germline genome of a human individual.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human cell eg, an ES cell or a B-cell
  • a population of non-human vertebrates comprising a substantially complete functional repertoire of human JH gene segment types supplemented with one, two or more human JH gene segments, wherein said substantially complete functional repertoire and the supplementary JH gene segments are not found together in the germline genome of a human individual.
  • a population of non-human vertebrates eg, mice or rats
  • comprising a substantially complete functional repertoire of human JH gene segment types supplemented with one, two or more human JH gene segments wherein said substantially complete functional repertoire and the supplementary JH gene segments are not found together in the germline genome of a human individual.
  • At least one of said JH gene segments is SEQ ID NO: 1, 2, 3 or 4.
  • at least one of said JH gene segments is SEQ ID NO: 1 and at least one, two or more of said supplementary JH gene segments is a variant according to any example above.
  • at least one of said JH gene segments is SEQ ID NO: 2 and at least one, two or more of said supplementary JH gene segments is a variant according to any one of the examples above.
  • at least one of said JH gene segments is SEQ ID NO: 2 and at least one, two or more of said supplementary JH gene segments is a variant according to any one of the examples above.
  • the non-human vertebrate or vertebrate cell of the invention comprises a genome that comprises VH, D and JH gene repertoires comprising human gene segments, the JH gene repertoire (eg, a human JH gene segment repertoire) comprising a plurality of JH1 gene segments provided by at least 2 different JH1 gene segments in cis at the same Ig locus in said genome;
  • the JH gene repertoire eg, a human JH gene segment repertoire
  • JH gene segments are derived from the genome sequence of two or more different human individuals.
  • said at least 2 different JH gene segments are human gene segments or synthetic gene segments derived from human gene segments.
  • the Ig locus is a IgH locus, eg, an endogenous locus, eg, a mouse or rat IgH locus.
  • the non-human vertebrate or vertebrate cell of the invention comprises a genome that comprises VH, D and JH gene repertoires comprising human gene segments, the JH gene repertoire (eg, a human JH gene segment repertoire) comprising
  • JH gene segments are derived from the genome sequence of two or three different human individuals;
  • said at least 3 different JH gene segments are human gene segments or synthetic gene segments derived from human gene segments.
  • the Ig locus is a IgH locus, eg, an endogenous locus, eg, a mouse or rat IgH locus.
  • the different human individuals are from different human populations.
  • the individuals are not genetically related (eg, Going back 3, 4, 5 or 6generations).
  • at least one of the different JH segments is a synthetic mutant of a human germline JH gene segment.
  • the vertebrate or cell genome comprises human VH, D and JH gene repertoires, the JH gene repertoire (eg, a human JH gene repertoire) comprising
  • JH1 gene segments provided by at least 2 different human JH1 gene segments, optionally in cis at the same Ig locus in said genome;
  • JH2 gene segments provided by at least 2 different human JH2 gene segments, optionally in cis at the same Ig locus in said genome;
  • JH3 gene segments provided by at least 2 different human JH3 gene segments, optionally in cis at the same Ig locus in said genome;
  • JH4 gene segments provided by at least 2 different human JH4 gene segments, optionally in cis at the same Ig locus in said genome;
  • JH5 gene segments provided by at least 2 different human JH5 gene segments, optionally in cis at the same Ig locus in said genome;
  • JH6 gene segments provided by at least 2 different human JH6 gene segments, optionally in cis at the same Ig locus in said genome;
  • JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (eg, 3, 4, 5 or 6 generations).
  • said at least 2 different JH gene segments are human gene segments or synthetic gene segments derived from human gene segments.
  • the Ig locus is a IgH locus, eg, an endogenous locus, eg, a mouse or rat IgH locus.
  • the human individuals are from different human populations.
  • An embodiment provides a vertebrate, cell or population of the invention whose genome comprises a plurality of JH5 gene segments, wherein the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a nucleotide mutation at one or more positions corresponding to positions
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a guanine at a position corresponding to position 106,330,067 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the variant comprises additionally a mutation at a position corresponding to (i) position 106,330,071 on human chromosome 14 (optionally the additional mutation being a guanine); (ii) position 106,330,066 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (iii) position 106,330,068 on human chromosome 14 (optionally the additional mutation being a thymine).
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a guanine at a position corresponding to position 106,330,071 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the variant comprises additionally a mutation at a position corresponding to (i) position 106,330,063 on human chromosome 14 (optionally the additional mutation being an adenine); and/or (ii) position 106,330,067 on human chromosome 14 (optionally the additional mutation being a guanine).
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a cytosine at a position corresponding to position 106,330,045 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises an adenine at a position corresponding to position 106,330,044 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the variant comprises additionally a mutation at a position corresponding to (i) position
  • 106.330.066 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (ii) position 106,330,068 on human chromosome 14 (optionally the additional mutation being a thymine).
  • the plurality comprises a human JH5 gene variant of SEQ I D NO: 1, wherein the variant comprises a guanine at a position corresponding to position 106,330,066 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the variant comprises additionally a mutation at a position corresponding to (i) position
  • 106.330.067 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (ii) position 106,330,068 on human chromosome 14 (optionally the additional mutation being a thymine).
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a thymine at a position corresponding to position 106,330,068 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the variant comprises additionally a mutation at a position corresponding to (i) position 106,330,067 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (ii) position 106,330,066 on human chromosome 14 (optionally the additional mutation being a guanine).
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a cytosine at a position corresponding to position 106,330,027 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises an adenine at a position corresponding to position 106,330,024 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a thymine at a position corresponding to position 106,330,032 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a thymine at a position corresponding to position 106,330,041 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises an adenine or thymine at a position corresponding to position 106,330,063 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the variant comprises additionally a mutation at a position corresponding to position 106,330,071 on human chromosome 14 (optionally the additional mutation being a guanine).
  • the plurality comprises a human JH5 gene variant of SEQ ID NO: l,wherein the variant comprises a cytosine at a position corresponding to position 106,330,062 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
  • the genome comprises SEQ ID NO:l; optionally in cis at the same Ig locus as one, two or more of the variants.
  • An embodiment provides a vertebrate, cell or population of the invention whose genome comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a nucleotide mutation at one or more positions corresponding to positions
  • the genome of the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a guanine at a position corresponding to position 106,329,435 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
  • the variant comprises additionally a mutation at a position corresponding to (i) position 106,329,468 on human chromosome 14 (optionally the additional mutation being a guanine); (ii) position 106,329,419 on human chromosome 14 (optionally the additional mutation being an adenine); (iii) position 106,329,434 on human chromosome 14 (optionally the additional mutation being a cytosine) and/or position 106,329,414 on human chromosome 14 (optionally the additional mutation being a guanine); (iv) position 106,329,426 on human chromosome 14 (optionally the additional mutation being an adenine); (v) position 106,329,413 on human chromosome 14 (optionally the additional mutation being an adenine); (vi) position 106,329,417 on human chromosome 14 (optionally the additional mutation being a thymine); (vii) position 106,
  • the variant comprises additionally mutations at positions corresponding to position
  • the vertebrate, cell or population optionally comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a guanine at a position corresponding to position 106,329,468 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
  • the variant comprises additionally a mutation at a position corresponding to position 106,329,435 on human chromosome 14 (optionally the additional mutation being a guanine).
  • the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a thymine at a position corresponding to position 106,329,417 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
  • the variant comprises additionally a mutation at a position corresponding to position 106,329,435 on human chromosome 14 (optionally the additional mutation being a guanine).
  • the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a cytosine at a position corresponding to position 106,329,434 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
  • the variant comprises additionally a mutation at a position corresponding to (i) position 106,329,414 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (ii) position 106,329,435 on human chromosome 14 (optionally the additional mutation being a guanine).
  • the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a thymine at a position corresponding to position 106,329,411 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
  • the variant comprises additionally a mutation at a position corresponding to position 106,329,435 on human chromosome 14 (optionally the additional mutation being a guanine).
  • the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant that is an antisense sequence of a variant described above.
  • the genome comprises SEQ ID NO:2; optionally cis at the same Ig locus as one, two or more of the JH6 variants.
  • An embodiment provides a vertebrate, cell or population of the invention whose genome comprises a plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant of SEQ ID NO: 3, wherein the variant comprises a nucleotide mutation at one or more positions
  • the vertebrate, cell or population comprises said plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant of SEQ ID NO: 3, wherein the variant comprises a guanine at a position corresponding to position 106,331,455 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 3.
  • the variant comprises additionally a mutation at a position corresponding to (i) position 106,331,453 on human chromosome 14 (optionally the additional mutation being an adenine); and/or (ii) position 106,331,409 on human chromosome 14 (optionally the additional mutation being an adenine); (iii) position 106,329,434 on human chromosome 14 (optionally the additional mutation being an adenine).
  • the vertebrate, cell or population comprises a plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant of SEQ ID NO: 3, wherein the variant comprises an adenine at a position corresponding to position 106,331,453 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 3.
  • the variant comprises additionally a mutation at a position corresponding to position 106,331,409 on human chromosome 14 (optionally the additional mutation being an adenine).
  • the vertebrate, cell or population comprises a plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant of SEQ ID NO: 3, wherein the variant comprises an adenine at a position corresponding to position 106,331,409 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 3.
  • the vertebrate, cell or population comprises a plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant that is an antisense sequence of a variant described above.
  • the genome comprises SEQ ID NO:3; optionally cis at the same Ig locus as one, two or more of the JH2 variants.
  • the vertebrate, cell or population genome comprises two or more different JH gene segments selected from SEQ ID NOs: 1 to 3 and variants described above; optionally wherein said JH gene segments are cis at the same immunoglobulin Ig locus.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 3 human D gene segments of the same type (eg, D2-2 gene segments), wherein at least two of the human D gene segments are variants that are not identical to each other (eg, D2-2ref and D2-2a).
  • one or more or all of the variants are naturally-occurring human gene segments.
  • one or more of the variants may be a synthetic variant of a human gene segment.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different non-endogenous D gene segments of the same type type (eg, D2-2ref and D2-2a) cis at the same Ig locus.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different human D gene segments of the same type (eg, D2-2ref and D2-2a) trans at the same Ig locus; and optionally a third human D gene segment (eg, (eg, D2-2ref, D2-2a or D2-2b) of the same type, wherein the third D is cis with one of said 2 different D gene segments.
  • a population of non-human vertebrates comprising a repertoire of human D gene segments, wherein the plurality comprises at least 2 different human D gene segments of the same type (eg, D2-2 gene segments), a first of said different D gene segments (eg, D2-2ref) is provided in the genome of a first vertebrate of the population, and a second of said different D gene segment (eg, D2-2a) being provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second D gene segment.
  • non-human vertebrates eg, mice or rats
  • the plurality comprises at least 2 different human D gene segments of the same type (eg, D2-2 gene segments)
  • a first of said different D gene segments eg, D2-2ref
  • a second of said different D gene segment eg, D2-2a
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different non-endogenous D gene segments of the same type (eg, human D2-2 gene segments), wherein the D gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • vertebrate eg, a mouse or rat
  • the method comprising providing the vertebrate with a genome comprising at least 3 human D gene segments of the same type (eg, D2-2 gene segments), wherein at least two of the human D gene segments are variants that are not identical to each other (eg, D2-2ref and D2-2a).
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous D gene segments of the same type (eg, human D2-2 gene segments) cis at the same Ig locus.
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different human D gene segments of the same type (eg, D2-2ref and D2-2a) trans at the same Ig locus; and optionally a third human D gene segment (eg, D2-2ref, D2-2a or D2-2b) of the same type, wherein the third D is cis with one of said 2 different D gene segments.
  • a method of providing an enhanced human immunoglobulin D gene segment repertoire comprising providing a population of non-human vertebrates (eg, a mouse or rat) comprising a repertoire of human D gene segments, wherein the method comprises providing at least 2 different human D gene segments of the same type (eg, D2-2ref and D2-2a), wherein a first of said different D gene segments is provided in the genome of a first vertebrate of the population, and a second of said different D gene segments is provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second D gene segment.
  • non-human vertebrates eg, a mouse or rat
  • the method comprises providing at least 2 different human D gene segments of the same type (eg, D2-2ref and D2-2a), wherein a first of said different D gene segments is provided in the genome of a first vertebrate of the population, and a second of said different D gene segments is provided in the genome of a second vertebrate of the population
  • vertebrate eg, a mouse or rat
  • the method comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous D gene segments of the same type (eg, D2-2ref and D2-2a), wherein the D gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • vertebrate eg, a mouse or rat
  • the method comprising providing the vertebrate with a genome comprising at least 2 human D gene segments of the same type (eg, D2-2ref and D2-2a), wherein the D gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations; optionally wherein at least 2 or 3 of said different gene segments are provided at the same IgH locus in said genome. 170.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human cell eg, an ES cell or a B-cell
  • having a genome comprising a substantially complete functional repertoire of human D gene segment types supplemented with one, two or more variant human D gene segments, wherein said substantially complete functional repertoire and the supplementary D gene segments are not found together in the germline genome of a human individual.
  • a population of non-human vertebrates comprising a substantially
  • D6-13ref and D6-13a or D3-9ref and D3-9a; or
  • first and/or second D gene segment is present in two or more copies.
  • the vertebrate, cell or population comprises one or more D segments selected from human D3-3, D2-15, D3-9; D4-17; D3-10; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; Dl-26; Dl-20; D5-18; D3-16; D2-21; Dl-14; D7-27; Dl-1; D6-25; D2-14 and D4-23 (eg, selected from D3- 9*01; D4-17*01; D3-10*01; D2-2*02; D5-24*01; D6-19*01; D3-22*01; D6-13*01; D5-12*01; Dl- 26*01; Dl-20*01; D5-18*01; D3-16*02; D2-21*02; Dl-14*01; D7-27*02; Dl-l*01; D6-25*01; D2-15*01; and D4-23*01), together with the reference sequence(s) of said selected segment(s) of said
  • a non-human vertebrate or vertebrate cell according to clause 155 comprising a genome that comprises VH, D and JH gene repertoires comprising human gene segments, the D gene repertoire comprising one or more of a plurality of D2-2 gene segments provided by at least 2 different D2-2 gene segments in cis at the same Ig locus in said genome;
  • a non-human vertebrate or vertebrate cell according to clause 155 comprising a genome that comprises VH, D and JH gene repertoires comprising human gene segments, the D gene repertoire comprising one or more of a plurality of D2-2 gene segments provided by at least 2 different D2-2 gene segments in trans in said genome;
  • D7-27 gene segments provided by at least 2 different D7-27 gene segments in trans in said genome; optionally wherein the D gene segments are derived from the genome sequence of two or more different human individuals.
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or B-cell), according to clause 154, comprising a genome that comprises VH, D and JH gene repertoires comprising human gene segments, the D gene repertoire comprising one or more of a plurality of D2-2 gene segments provided by at least 3 different D2-2 gene segments;
  • D4-4 gene segments provided by at least 3 different D4-4 gene segments
  • D7-27 gene segments provided by at least 3 different D7-27 gene segments
  • the D gene segments are derived from the genome sequence of two or three different human individuals; optionally wherein at least 2 or 3 of said different gene segments are provided in cis at the same Ig locus in said genome.
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or B-cell) according to clause 158, comprising a genome comprising human VH, D and JH gene repertoires, the D gene repertoire comprising of one or more of a plurality of D2-2 gene segments provided by at least 2 different D2-2 gene ; optionally in cis in said genome;
  • D3-16 gene segments provided by at least 2 different D3-16 gene ; optionally in cis in said genome;
  • D3-9 gene segments provided by at least 2 different D3-9 gene ; optionally in cis in said genome;
  • D7-27 gene segments provided by at least 2 different D7-27 gene ; optionally in cis in said genome; wherein the D gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • one or more of the D gene segments is a variant of a human germline D gene segment, wherein the variant gene segment encodes an amino acid sequence that differs by 1, 2 or 3 amino acids from the corresponding amino acid sequence encoded by the human germline D gene segment, provided in that said amino acid sequence encoded by the variant does not include a stop codon when said corresponding amino acid sequence does not include a stop codon.
  • variant and germline D gene segments encode the respective amino acid sequences in reading frame 2 (IMGT numbering). See Briney et al 2012.
  • D segments are usable in all three reading frames.
  • a variant of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or all of these human germline D gene segments is used.
  • a human D2-2 gene segment ((optionally two copies and/or in homozygous state) comprising a thymine at a position corresponding to position 106,382,687 on human chromosome 14; and optionally no further mutation from the sequence of D2-2ref.
  • a human D3-16 gene segment (optionally two copies and/or in homozygous state) comprising a cytosine at a position corresponding to position 106,361,515 on human chromosome 14; and optionally no further mutation from the sequence of D3-16a.
  • the vertebrate, cell or population of clause 205 wherein the plurality comprises a human D6-13 gene segment (optionally two copies and/or in homozygous state) comprising a thymine at a position corresponding to position 106,367,013 on human chromosome 14; and optionally no further mutation from the sequence of D6-13ref. 207.
  • a human D3-10 gene segment (optionally two copies and/or in homozygous state) comprising a thymine at a position corresponding to position 106,370,370 on human chromosome 14; and optionally no further mutation from the sequence of D3-10ref.
  • a human D3-10 gene segment (optionally two copies and/or in homozygous state) comprising a cytosine at a position corresponding to position 106,370,370 on human chromosome 14; and optionally no further mutation from the sequence of D3-10a.
  • a human D3-10 gene segment (optionally two copies and/or in homozygous state) comprising an adenine at a position corresponding to position 106,370,371 on human chromosome 14; and optionally no further mutation from the sequence of D3-10ref.
  • a human D3-9 gene segment (optionally two copies and/or in homozygous state) comprising an adenine at a position corresponding to position 106,370,567 on human chromosome 14; and optionally no further mutation from the sequence of D3-9ref.
  • a human D3-9 gene segment (optionally two copies and/or in homozygous state) comprising a thymine at a position corresponding to position 106,370,567 on human chromosome 14; and optionally no further mutation from the sequence of D3-9a.
  • a human D2-8 gene segment (optionally two copies and/or in homozygous state) comprising a thymine at a position corresponding to position 106,373,085 on human chromosome 14; and optionally no further mutation from the sequence of D2-8b.
  • a D4-4 gene segment (optionally two copies and/or in homozygous state) comprising a cytosine at a position corresponding to position 106,379,086 on human chromosome 14; and optionally no further mutation from the sequence of D4-4ref.
  • a human D4-4 gene segment (optionally two copies and/or in homozygous state) comprising a cytosine at a position corresponding to position 106,379,089 on human chromosome 14; and optionally no further mutation from the sequence of D4-4ref or a cytosine at a position corresponding to position 106,379,086 on human chromosome 14.
  • a D3-3 gene segment (optionally two copies and/or in homozygous state) comprising a thymine at a position corresponding to position 106,380,241 on human chromosome 14; and optionally no further mutation from the sequence of D3-3ref.
  • a human D3-3 gene segment (optionally two copies and/or in homozygous state) comprising a cytosine at a position corresponding to position 106,380,241 on human chromosome 14; and optionally no further mutation from the sequence of D3-3a.
  • a specific application of this configuration is the provision of multiple human JL gene segments ( and/or i ⁇ ) as follows (as set out in numbered paragraphs, starting at paragraph number 80).
  • 80. A non-human vertebrate (eg, a mouse or rat) or a non-human vertebrate cell (eg, an ES cell or a B-cell) having a genome comprising at least 3 human JL gene segments of the same type (eg, JKI), wherein at least two of the human J L gene segments are variants that are not identical to each other.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different non-endogenous JL gene segments of the same type (eg, JKI) cis at the same Ig locus.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different human JL gene segments of the same type (eg, JKI) trans at the same Ig locus; and optionally a third human JL gene segment of the same type, wherein the third JL is cis with one of said 2 different JL gene segments.
  • a population of non-human vertebrates comprising a repertoire of human JL gene segments, wherein the plurality comprises at least 2 different human JL gene segments of the same type (eg, JKI), a first of said different J L gene segments is provided in the genome of a first vertebrate of the population, and a second of said different JL gene segments being provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second JL gene segment.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human vertebrate cell eg, an ES cell or a B-cell
  • having a genome comprising at least 2 different non-endogenous JL gene segments of the same type (eg, JKI), wherein the JL gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 3 human JL gene segments of the same type (eg, JKI), wherein at least two of the human JL gene segments are variants that are not identical to each other.
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous JL gene segments of the same type (eg, JKI) cis at the same Ig locus.
  • a method of enhancing the immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different human JL gene segments of the same type(eg, JKI) trans at the same Ig locus; and optionally a third human JL gene segment of the same type, wherein the third JL is cis with one of said 2 different J L gene segments.
  • a method of providing an enhanced human immunoglobulin JL gene segment repertoire comprising providing a population of non-human vertebrates (eg, a mouse or rat) comprising a repertoire of human JL gene segments, wherein the method comprises providing at least 2 different human JL gene segments of the same type (eg, JKI), wherein a first of said different JL gene segments is provided in the genome of a first vertebrate of the population, and a second of said different J L gene segments is provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second JL gene segment.
  • non-human vertebrates eg, a mouse or rat
  • JKI human JL gene segments of the same type
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous JL gene segments of the same type (eg, JKI), wherein the JL gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • JL gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
  • JL gene segments are derived from the genome sequence of two or more different human individuals; optionally wherein the different human individuals are from different human populations.
  • a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate comprising providing the vertebrate with a genome comprising at least 2 human J L gene segments of the same type (eg, JKI), wherein the J L gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations; optionally wherein at least 2 or 3 of said different gene segments are provided at the same IgL locus in said genome.
  • the population of paragraph 83 wherein the population comprises a substantially complete functional repertoire of human J L gene segment types supplemented with one, two or more human JK and/or iX gene segments respectively, wherein said substantially complete functional repertoire and the supplementary gene segments are not found together in the germline genome of a human individual.
  • a non-human vertebrate eg, a mouse or rat
  • a non-human cell eg, an ES cell or a B-cell
  • having a genome comprising a substantially complete functional repertoire of human JK and/or iX gene segment types supplemented with one, two or more human JK and/or iX gene segments respectively, wherein said substantially complete functional repertoire and the supplementary gene segments are not found together in the germline genome of a human individual.
  • a population of non-human vertebrates comprising a substantially complete functional repertoire of human JK and/or iX gene segment types supplemented with one, two or more human JK and/or iX gene segments respectively, wherein said substantially complete functional repertoire and the supplementary gene segments are not found together in the germline genome of a human individual.
  • a non-human vertebrate or vertebrate cell according to paragraph 81 comprising a genome that comprises VL and J L gene repertoires comprising human gene segments, the J L gene repertoire comprising a plurality of human JKI gene segments provided by at least 2 different human JKI gene segments in cis at the same Ig locus in said genome;
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or B-cell), according to paragraph 80, comprising a genome that comprises VL and J L gene repertoires comprising human gene segments, the J L gene repertoire comprising a plurality of human JKI gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human JKI gene segments;
  • a plurality of human JK2 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human JKI gene segments;
  • a plurality of human JK3 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human JKI gene segments;
  • a plurality of human JK4 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human JKI gene segments;
  • a plurality of human JK5 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human JKI gene segments;
  • a plurality of human J ⁇ l gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human J ⁇ l gene segments;
  • a plurality of human J ⁇ 2 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human J ⁇ 2 gene segments;
  • a plurality of human J ⁇ 3 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human J ⁇ 3 gene segments;
  • a plurality of human J ⁇ 4 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human J ⁇ 4 gene segments;
  • a plurality of human J ⁇ 5 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human J ⁇ 5 gene segments;
  • a plurality of human J ⁇ 6 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human J ⁇ 6 gene segments; or
  • J ⁇ 7 gene segments provided by at least 3 (eg, 3, 4, 5, 6, or 7) different human J ⁇ 7 gene segments; optionally wherein the J L gene segments are derived from the genome sequence of two or three different human individuals; optionally wherein at least 2 or 3 of said different gene segments are provided in cis at the same Ig locus in said genome.
  • a non-human vertebrate or vertebrate cell (optionally an ES cell or B-cell) according to paragraph 84, comprising a genome comprising human VL and J L gene repertoires, the J L gene repertoire comprising a plurality of human JKI gene segments provided by at least 2 different human JKI gene segments, optionally in cis at the same Ig locus in said genome;

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Communicable Diseases (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Environmental Sciences (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Pulmonology (AREA)
  • AIDS & HIV (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/GB2012/052296 2011-09-19 2012-09-18 Antibodies, variable domains & chains tailored for human use Ceased WO2013041844A2 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
ES12772122.3T ES2612935T3 (es) 2011-09-19 2012-09-18 Anticuerpos, dominios variables y cadenas adaptados para su uso en seres humanos
AU2012311286A AU2012311286B2 (en) 2011-09-19 2012-09-18 Antibodies, variable domains and chains tailored for human use
EP20188009.3A EP3839049A3 (en) 2011-09-19 2012-09-18 Antibodies, variable domains & chains tailored for human use
BR112014006390A BR112014006390A2 (pt) 2011-09-19 2012-09-18 anticorpos, domínios variáveis e cadeias feitos especialmente para uso humano
NZ623756A NZ623756B2 (en) 2011-09-19 2012-09-18 Antibodies, variable domains & chains tailored for human use
JP2014531302A JP5813880B2 (ja) 2011-09-19 2012-09-18 ヒトへの使用に合わせて作製された抗体、可変ドメインおよび鎖
EP12772122.3A EP2758535B1 (en) 2011-09-19 2012-09-18 Antibodies, variable domains&chains tailored for human use
CA2846319A CA2846319A1 (en) 2011-09-19 2012-09-18 Antibodies, variable domains & chains tailored for human use
HK14108036.3A HK1194757B (en) 2011-09-19 2012-09-18 Antibodies, variable domains & chains tailored for human use
EP16189625.3A EP3128009B1 (en) 2011-09-19 2012-09-18 Antibodies, variable domains & chains tailored for human use
CN201280056727.0A CN104080916A (zh) 2011-09-19 2012-09-18 定制供人类使用的抗体、可变结构域和链
US14/052,259 US20140041067A1 (en) 2011-09-19 2013-10-11 Antibodies, variable domains & chains tailored for human use
US15/786,281 US20180030121A1 (en) 2011-09-19 2017-10-17 Antibodies, variable domains & chains tailored for human use

Applications Claiming Priority (14)

Application Number Priority Date Filing Date Title
GB201116120A GB201116120D0 (en) 2011-09-19 2011-09-19 Manipulation of immunoglobulin gene diversity and multi antibody therapeutics, especially for infectious diseases
GB201116122A GB201116122D0 (en) 2011-09-19 2011-09-19 Synthetically-extended & ethnically diverse superhuman immunoglobulin gene repertoires
GB1116122.1 2011-09-19
GB1116120.5 2011-09-19
GB1203257.9 2012-02-24
GBGB1203257.9A GB201203257D0 (en) 2012-02-24 2012-02-24 Animals, repertoires & methods
GB1204592.8 2012-03-15
GBGB1204592.8A GB201204592D0 (en) 2012-03-15 2012-03-15 Animals, repertoires & methods
GBGB1205702.2A GB201205702D0 (en) 2012-03-29 2012-03-29 Animals,repertoires & methods
GB1205702.2 2012-03-29
GB1208749.0 2012-05-18
GBGB1208749.0A GB201208749D0 (en) 2012-05-18 2012-05-18 Synthetically-extended & ethnically-diverse superhuman immunoglobulin gene repertoires
GB201211692A GB201211692D0 (en) 2012-07-02 2012-07-02 Animals, repertories & methods
GB1211692.7 2012-07-02

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/052,259 Continuation US20140041067A1 (en) 2011-09-19 2013-10-11 Antibodies, variable domains & chains tailored for human use

Publications (3)

Publication Number Publication Date
WO2013041844A2 true WO2013041844A2 (en) 2013-03-28
WO2013041844A3 WO2013041844A3 (en) 2013-07-11
WO2013041844A9 WO2013041844A9 (en) 2014-11-27

Family

ID=46889370

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/GB2012/052296 Ceased WO2013041844A2 (en) 2011-09-19 2012-09-18 Antibodies, variable domains & chains tailored for human use
PCT/GB2012/052298 Ceased WO2013041846A2 (en) 2011-09-19 2012-09-18 Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/GB2012/052298 Ceased WO2013041846A2 (en) 2011-09-19 2012-09-18 Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics

Country Status (10)

Country Link
US (4) US20140041067A1 (cg-RX-API-DMAC7.html)
EP (6) EP3311661B1 (cg-RX-API-DMAC7.html)
JP (4) JP2014533930A (cg-RX-API-DMAC7.html)
CN (4) CN106995822B (cg-RX-API-DMAC7.html)
AU (3) AU2012311286B2 (cg-RX-API-DMAC7.html)
BR (2) BR112014006394A2 (cg-RX-API-DMAC7.html)
CA (2) CA2846319A1 (cg-RX-API-DMAC7.html)
DK (2) DK3311661T3 (cg-RX-API-DMAC7.html)
ES (1) ES2612935T3 (cg-RX-API-DMAC7.html)
WO (2) WO2013041844A2 (cg-RX-API-DMAC7.html)

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8945560B1 (en) 2014-07-15 2015-02-03 Kymab Limited Method of treating rheumatoid arthritis using antibody to IL6R
US8980273B1 (en) 2014-07-15 2015-03-17 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
US8986691B1 (en) 2014-07-15 2015-03-24 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
US8986694B1 (en) 2014-07-15 2015-03-24 Kymab Limited Targeting human nav1.7 variants for treatment of pain
US8992927B1 (en) 2014-07-15 2015-03-31 Kymab Limited Targeting human NAV1.7 variants for treatment of pain
FR3011249A1 (cg-RX-API-DMAC7.html) * 2013-10-01 2015-04-03 Kymab Ltd
US8999341B1 (en) 2014-07-15 2015-04-07 Kymab Limited Targeting rare human PCSK9 variants for cholesterol treatment
NL2013554A (en) * 2013-10-01 2015-04-07 Kymab Ltd Animal models and therapeutic molecules.
US9017678B1 (en) 2014-07-15 2015-04-28 Kymab Limited Method of treating rheumatoid arthritis using antibody to IL6R
US9034332B1 (en) 2014-07-15 2015-05-19 Kymab Limited Precision medicine by targeting rare human PCSK9 variants for cholesterol treatment
US9040052B1 (en) 2013-12-17 2015-05-26 Kymab Limited Precision Medicine by targeting rare human PCSK9 variants for cholesterol treatment
US9045545B1 (en) 2014-07-15 2015-06-02 Kymab Limited Precision medicine by targeting PD-L1 variants for treatment of cancer
US9045548B1 (en) 2014-07-15 2015-06-02 Kymab Limited Precision Medicine by targeting rare human PCSK9 variants for cholesterol treatment
US9051378B1 (en) 2014-07-15 2015-06-09 Kymab Limited Targeting rare human PCSK9 variants for cholesterol treatment
US9062105B1 (en) 2014-07-15 2015-06-23 Kymab Limited Precision Medicine by targeting VEGF-A variants for treatment of retinopathy
EP2886557A1 (en) * 2013-12-17 2015-06-24 Kymab Limited Antibodies for use in treating conditions related to specific PCSK9 variants in specific patient populations
WO2015092394A1 (en) * 2013-12-17 2015-06-25 Kymab Limited Antibodies for use in treating conditions related to specific pcsk9 variants in specific patients populations
US9067998B1 (en) 2014-07-15 2015-06-30 Kymab Limited Targeting PD-1 variants for treatment of cancer
US9139648B1 (en) 2014-07-15 2015-09-22 Kymab Limited Precision medicine by targeting human NAV1.9 variants for treatment of pain
US9150660B1 (en) 2014-07-15 2015-10-06 Kymab Limited Precision Medicine by targeting human NAV1.8 variants for treatment of pain
DE202014010499U1 (de) 2013-12-17 2015-10-20 Kymab Limited Targeting von humaner PCSK9 zur Cholesterinbehandlung
EP2975059A1 (en) 2014-07-15 2016-01-20 Kymab Limited Antibodies for use in treating conditions related to specific pcsk9 variants in specific patients populations
EP2975058A1 (en) * 2014-07-15 2016-01-20 Kymab Limited Antibodies for use in treating conditions related to specific PCSK9 variants in specific patient populations
WO2016008899A1 (en) 2014-07-15 2016-01-21 Kymab Limited Targeting human pcsk9 for cholesterol treatment
US9253965B2 (en) 2012-03-28 2016-02-09 Kymab Limited Animal models and therapeutic molecules
WO2016023916A1 (en) 2014-08-12 2016-02-18 Kymab Limited Treatment of disease using ligand binding to targets of interest
WO2016071701A1 (en) 2014-11-07 2016-05-12 Kymab Limited Treatment of disease using ligand binding to targets of interest
DE202015009002U1 (de) 2014-07-15 2016-08-18 Kymab Limited Targeting von humaner PCSK9 zur Cholesterinbehandlung
US9434782B2 (en) 2009-07-08 2016-09-06 Kymab Limited Animal models and therapeutic molecules
US9445581B2 (en) 2012-03-28 2016-09-20 Kymab Limited Animal models and therapeutic molecules
US9516868B2 (en) 2010-08-02 2016-12-13 Regeneron Pharmaceuticals, Inc. Mice that make VL binding proteins
JP2017502030A (ja) * 2013-12-17 2017-01-19 カイマブ・リミテッド 対象とするヒト標的に特異的に結合するリガンド
JP2017505127A (ja) * 2014-01-24 2017-02-16 チルドレンズ メディカル センター コーポレーション 抗体親和性の最適化のための高スループットマウスモデル
US9622459B2 (en) 2011-12-20 2017-04-18 Regeneron Pharmaceuticals, Inc. Humanized light chain mice
US9783593B2 (en) 2013-05-02 2017-10-10 Kymab Limited Antibodies, variable domains and chains tailored for human use
US9783618B2 (en) 2013-05-01 2017-10-10 Kymab Limited Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
US9788534B2 (en) 2013-03-18 2017-10-17 Kymab Limited Animal models and therapeutic molecules
US9932398B2 (en) 2011-10-17 2018-04-03 Regeneron Pharmaceuticals, Inc. Restricted immunoglobulin heavy chain mice
US9930871B2 (en) 2013-02-20 2018-04-03 Regeneron Pharmaceuticals, Inc. Non-human animals with modified immunoglobulin heavy chain sequences
US9963716B2 (en) 2011-09-26 2018-05-08 Kymab Limited Chimaeric surrogate light chains (SLC) comprising human VpreB
US10130081B2 (en) 2011-08-05 2018-11-20 Regeneron Pharmaceuticals, Inc. Humanized universal light chain mice
WO2019037099A1 (en) * 2017-08-25 2019-02-28 Wenning Qin Large scale modification of eukaryotic genome
US10238093B2 (en) 2012-06-12 2019-03-26 Regeneron Pharmaceuticals, Inc. Humanized non-human animals with restricted immunoglobulin heavy chain loci
US10251377B2 (en) 2012-03-28 2019-04-09 Kymab Limited Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies
US10667501B2 (en) 2012-05-17 2020-06-02 Kymab Limited Transgenic non-human vertebrate for the in vivo production of dual specificity immunoglobulins or hypermutated heavy chain only immunoglobulins
WO2020169022A1 (en) * 2019-02-18 2020-08-27 Beijing Biocytogen Co., Ltd Genetically modified non-human animals with humanized immunoglobulin locus
US10787522B2 (en) 2014-03-21 2020-09-29 Regeneron Pharmaceuticals, Inc. VL antigen binding proteins exhibiting distinct binding characteristics
US10881085B2 (en) 2014-03-21 2021-01-05 Regeneron Pharmaceuticals, Inc. Non-human animals that make single domain binding proteins
US11051497B2 (en) 2011-09-19 2021-07-06 Kymab Limited Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
US11111314B2 (en) 2015-03-19 2021-09-07 Regeneron Pharmaceuticals, Inc. Non-human animals that select for light chain variable regions that bind antigen
EP3476942B1 (en) * 2017-10-27 2022-01-26 Trianni, Inc. Long germline dh genes and long hcdr3 antibodies
WO2022056276A1 (en) 2020-09-11 2022-03-17 Regeneron Pharmaceuticals, Inc. Identification and production of antigen-specific antibodies
WO2022132943A1 (en) 2020-12-16 2022-06-23 Regeneron Pharmaceuticals, Inc. Mice expressing humanized fc alpha receptors
US20220324968A1 (en) * 2019-04-18 2022-10-13 Kymab Limited Antagonists anti-cd7 antibodies
CN115988960A (zh) * 2020-06-25 2023-04-18 株式会社湖美宝 杂合转基因动物
US11707056B2 (en) 2013-05-02 2023-07-25 Kymab Limited Animals, repertoires and methods
US11753479B2 (en) 2014-03-04 2023-09-12 Kymab Limited Nucleic acids encoding anti-OX40L antibodies
US11779604B2 (en) 2016-11-03 2023-10-10 Kymab Limited Antibodies, combinations comprising antibodies, biomarkers, uses and methods
EP4257599A3 (en) * 2016-01-13 2024-01-17 Regeneron Pharmaceuticals, Inc. Rodents having an engineered heavy chain diversity region
US11997994B2 (en) 2020-06-02 2024-06-04 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. Genetically modified non-human animals with common light chain immunoglobulin locus
US12209128B2 (en) 2016-06-20 2025-01-28 Kymab Limited Anti-PD-L1 antibodies
US12295354B2 (en) 2016-06-03 2025-05-13 Regeneron Pharmaceuticals, Inc. Non-human animals expressing exogenous terminal deoxynucleotidyltransferase
EP4610362A3 (en) * 2013-09-18 2025-12-17 Kymab Limited Methods, cells and organisms

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10513711B2 (en) * 2014-08-13 2019-12-24 Dupont Us Holding, Llc Genetic targeting in non-conventional yeast using an RNA-guided endonuclease
AU2017268458B2 (en) 2016-05-20 2022-07-21 Regeneron Pharmaceuticals, Inc. Methods for breaking immunological tolerance using multiple guide RNAS
CN107312863A (zh) * 2017-08-08 2017-11-03 深圳华大基因研究院 利用数字PCR鉴定B淋巴细胞的Ig基因分布的方法
CN107557367B (zh) * 2017-09-08 2020-11-03 北京大学人民医院 Ighg1基因突变体及其应用
CN108486126A (zh) * 2018-03-27 2018-09-04 重庆金迈博生物科技有限公司 一种核酸分子及其在人源化抗体中的应用
US11337409B2 (en) 2018-06-08 2022-05-24 Crystal Bioscience Inc. Transgenic animal for producing diversified antibodies that have the same light chain I
IL318469A (en) * 2018-06-14 2025-03-01 Regeneron Pharma Non-human animals capable of reorganizing transgenic DH-DH, and their uses
EP4559939A3 (en) 2020-12-23 2025-09-24 Regeneron Pharmaceuticals, Inc. Nucleic acids encoding anchor modified antibodies and uses therof
US20240392313A1 (en) * 2021-11-16 2024-11-28 National University Corporation Tottori University Mammalian artificial chromosome vector having human immunoglobulin heavy chain locus comprising modified d-region, and cell or non-human animal retaining the vector
JP7212982B1 (ja) 2022-10-05 2023-01-26 株式会社Logomix 細胞ライブラリおよびその製造方法
JP2025170455A (ja) * 2022-10-05 2025-11-19 株式会社Logomix 細胞ライブラリおよびその製造方法
TW202430558A (zh) * 2023-01-18 2024-08-01 美商基利科學股份有限公司 人類免疫球蛋白重鏈長cdr3轉殖基因構築體及其用途
CN119855835A (zh) * 2023-06-13 2025-04-18 南京维立志博生物科技股份有限公司 基于共同轻链产生双特异性抗体的方法
CN117736322B (zh) * 2024-02-21 2024-04-19 吉林大学 抗syce2单分子抗体t2d及其应用

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5859301A (en) 1993-12-23 1999-01-12 Dsm N.V. Process for preparing alkanones and alkanols
US5939598A (en) 1990-01-12 1999-08-17 Abgenix, Inc. Method of making transgenic mice lacking endogenous heavy chains
EP0937140A2 (en) 1996-06-27 1999-08-25 Vlaams Interuniversitair Instituut voor Biotechnologie vzw. Recognition molecules interacting specifically with the active site or cleft of a target molecule
EP1034260A2 (en) 1997-12-05 2000-09-13 Europäisches Laboratorium Für Molekularbiologie (Embl) Novel dna cloning method relying on the e. coli rece/rect recombination system
US6130364A (en) 1995-03-29 2000-10-10 Abgenix, Inc. Production of antibodies using Cre-mediated site-specific recombination
EP1204740A1 (en) 1999-07-09 2002-05-15 The European Molecular Biology Laboratory Methods and compositions for directed cloning and subcloning using homologous recombination
WO2002066630A1 (en) 2001-02-16 2002-08-29 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
US6586251B2 (en) 2000-10-31 2003-07-01 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
US6673986B1 (en) 1990-01-12 2004-01-06 Abgenix, Inc. Generation of xenogeneic antibodies
EP1399559A2 (en) 2001-06-21 2004-03-24 The Babraham Institute Mouse lambda light chain locus
US7501552B2 (en) 1991-08-28 2009-03-10 Medarex, Inc. Transgenic non-human animals for producing chimeric antibodies
WO2009076464A2 (en) 2007-12-10 2009-06-18 Aliva Biopharmaceuticals, Inc. Methods for sequential replacement of targeted region by homologous recombination
WO2009097006A2 (en) 2007-08-10 2009-08-06 Medarex, Inc. Hco32 and hco27 and related examples
WO2009143472A2 (en) 2008-05-23 2009-11-26 Aliva Biopharmaceuticals, Inc. Method of generating single vl domain antibodies in transgenic animals
WO2010039900A2 (en) 2008-09-30 2010-04-08 Aliva Biopharmaceuticals, Inc. Non-human mammals for the production of chimeric antibodies
WO2011004192A1 (en) 2009-07-08 2011-01-13 Genome Research Limited Animal models and therapeutic molecules
WO2011066501A1 (en) 2009-11-30 2011-06-03 Centocor Ortho Biotech Inc. Antibody fc mutants with ablated effector functions
WO2012141798A1 (en) 2011-02-25 2012-10-18 Regeneron Pharmaceuticals, Inc. Adam6 mice

Family Cites Families (173)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1014946A (en) 1910-06-16 1912-01-16 Us Sherardizing Company Alloy for coating with metal.
US1006439A (en) 1911-03-11 1911-10-17 Clarence Cosby Can-shearing machine.
US5807715A (en) 1984-08-27 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin
US5169939A (en) 1985-05-21 1992-12-08 Massachusetts Institute Of Technology & Pres. & Fellows Of Harvard College Chimeric antibodies
US4720449A (en) 1985-06-03 1988-01-19 Polaroid Corporation Thermal imaging method
GB8823869D0 (en) 1988-10-12 1988-11-16 Medical Res Council Production of antibodies
WO1991000906A1 (en) 1989-07-12 1991-01-24 Genetics Institute, Inc. Chimeric and transgenic animals capable of producing human antibodies
US6657103B1 (en) 1990-01-12 2003-12-02 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6713610B1 (en) 1990-01-12 2004-03-30 Raju Kucherlapati Human antibodies derived from immunized xenomice
US7084260B1 (en) 1996-10-10 2006-08-01 Genpharm International, Inc. High affinity human antibodies and human antibodies against human antigens
US6255458B1 (en) 1990-08-29 2001-07-03 Genpharm International High affinity human antibodies and human antibodies against digoxin
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5633425A (en) * 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5770429A (en) * 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US6300129B1 (en) 1990-08-29 2001-10-09 Genpharm International Transgenic non-human animals for producing heterologous antibodies
AU8507191A (en) 1990-08-29 1992-03-30 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
AU2515992A (en) 1991-08-20 1993-03-16 Genpharm International, Inc. Gene targeting in animal cells using isogenic dna constructs
EP0746609A4 (en) * 1991-12-17 1997-12-17 Genpharm Int NON-HUMAN TRANSGENIC ANIMALS CAPABLE OF PRODUCING HETEROLOGOUS ANTIBODIES
ATE381614T1 (de) 1992-07-24 2008-01-15 Amgen Fremont Inc Bildung von xenogenen antikörpern
PT1589107E (pt) 1992-08-21 2010-03-29 Univ Bruxelles Imunoglobulinas desprovidas de cadeias leves
DE4228162C1 (de) 1992-08-25 1994-01-13 Rajewsky Klaus Dr Verfahren zum Ersetzen homologer Genabschnitte aus Säugern in der Keimbahn von nicht-menschlichen Säugern
US5565321A (en) 1993-01-22 1996-10-15 Immunex Corporation Detection of mutations in a CD40 ligand gene
CA2161351C (en) * 1993-04-26 2010-12-21 Nils Lonberg Transgenic non-human animals capable of producing heterologous antibodies
DE4331162A1 (de) 1993-09-14 1995-03-16 Bayer Ag Verfahren zur Herstellung von Cyaninfarbstoffen
US7119248B1 (en) 1994-04-12 2006-10-10 Miltenyi Biotec Gmbh Antibodies against epitopes with homology to self antigens, methods of preparation and applications thereof
WO1997049804A1 (en) 1996-06-26 1997-12-31 Baylor College Of Medicine Chromosomal rearrangement by insertion of two recombination substrates
EP2305027B1 (en) 1996-12-03 2014-07-02 Amgen Fremont Inc. Transgenic mammals having human Ig loci including plural VH and Vkappa regions and antibodies produced therefrom
US6319906B1 (en) 1996-12-31 2001-11-20 Isis Pharmaceuticals Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
IL132560A0 (en) 1997-05-02 2001-03-19 Genentech Inc A method for making multispecific antibodies having heteromultimeric and common components
US20020088019A1 (en) 1997-09-02 2002-07-04 Oron Yacoby-Zeevi Methods of and pharmaceutical compositions for improving implantation of embryos
ATE401410T1 (de) 1997-11-18 2008-08-15 Pioneer Hi Bred Int Zusammensetzungen und verfahren für die genetische modifizierung von pflanzen
EP0939120A1 (en) 1998-02-27 1999-09-01 Gesellschaft für biotechnologische Forschung mbH (GBF) Method for marker-free repetitive DNA expression cassette exchange in the genome of cells or parts of cells
GB9823930D0 (en) 1998-11-03 1998-12-30 Babraham Inst Murine expression of human ig\ locus
US6914128B1 (en) 1999-03-25 2005-07-05 Abbott Gmbh & Co. Kg Human antibodies that bind human IL-12 and methods for producing
JP2003503015A (ja) * 1999-05-03 2003-01-28 メダレツクス・インコーポレーテツド スタフィロコッカス・アウレウスに対するヒト抗体
US6833268B1 (en) 1999-06-10 2004-12-21 Abgenix, Inc. Transgenic animals for producing specific isotypes of human antibodies via non-cognate switch regions
US7605238B2 (en) 1999-08-24 2009-10-20 Medarex, Inc. Human CTLA-4 antibodies and their uses
CA2307503A1 (en) 2000-05-02 2001-11-02 Carlos F. Barbas Iii Peptides for use as a vaccine or treatment for hiv infection
EP1278851B1 (en) * 2000-05-19 2006-01-18 Scancell Limited Humanised antibodies to the epidermal growth factor receptor
AU2001277076A1 (en) 2000-07-21 2002-02-05 The United States Of America As Represented By The Secretary Of Agriculture Methods for the replacement, translocation and stacking of DNA in eukaryotic genomes
EP1311530A4 (en) * 2000-08-03 2004-10-06 Wim-Van Schooten PRODUCTION OF HUMANIZED ANTIBODIES IN TRANSGENIC ANIMALS
US8165246B1 (en) * 2000-08-28 2012-04-24 Alcatel Lucent Training sequence for low latency LMS implementation
US7105348B2 (en) 2000-10-31 2006-09-12 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
EP2042594B1 (en) 2000-11-17 2011-03-23 Kyowa Hakko Kirin Co., Ltd. Expression of xenogenous (human) immunoglobulins in cloned, transgenic ungulates
MXPA03004793A (es) * 2000-11-30 2004-12-03 Medarex Inc Roedores transgenicos transcromosomales para elaborar anticuerpos humnanos.
US20030093818A1 (en) 2000-12-19 2003-05-15 Belmont Heather J. Transgenic animals comprising a humanized immune system
GEP20084484B (en) * 2001-01-05 2008-09-25 Pfizer Antibodies to insulin-like growth factor i receptor
FR2827302B1 (fr) 2001-07-13 2003-10-10 Genoway Cellule et animal transgenique modelisant la presentation antigenique humaine et leurs utilisations
US20030108925A1 (en) 2001-10-05 2003-06-12 U.S. Epa Genetic testing for male factor infertility
US20060199204A1 (en) 2001-10-05 2006-09-07 U.S. Epa Genetic testing for male factor infertility
US7390885B2 (en) * 2001-11-26 2008-06-24 Cell Matrix, Inc. Humanized collagen antibodies and related methods
US7435871B2 (en) 2001-11-30 2008-10-14 Amgen Fremont Inc. Transgenic animals bearing human Igλ light chain genes
WO2003061363A2 (en) 2002-01-17 2003-07-31 Albert Einstein College Of Medicine Of Yeshiva University Mutations caused by activation-induced cytidine deaminase
US8877901B2 (en) 2002-12-13 2014-11-04 Immunomedics, Inc. Camptothecin-binding moiety conjugates
CN105884893A (zh) 2002-07-18 2016-08-24 莫鲁斯有限公司 抗体混合物的重组生产
EP1539946A4 (en) 2002-09-09 2006-03-15 California Inst Of Techn METHOD AND COMPOSITIONS FOR PRODUCING HUMANIZED MICE
CN103709250B (zh) * 2002-10-17 2016-08-10 根马布股份公司 抗cd20的人单克隆抗体
US7700356B2 (en) 2002-11-08 2010-04-20 The United States Of America As Represented By The Secretary Of Agriculture System for gene targeting and producing stable genomic transgene insertions
DE10251918A1 (de) 2002-11-08 2004-05-19 Horn, Carsten, Dipl.-Biochem. Dr. Systeme zur Erzeugung stabiler genomischer Transgen-Insertionen
CA2505326A1 (en) 2002-11-08 2004-05-21 Ablynx N.V. Camelidae antibodies against immunoglobulin e and use thereof for the treatment of allergic disorders
CL2003002461A1 (es) * 2002-11-27 2005-01-07 Dow Chemical Company Agroscien Inmunoglobulina que comprende al menos un glicano afucosilado, composicion que la contiene, secuencia nucleotidica y vector que la comprende, procedimiento para producir dicha inmunoglobulina en plantas.
GB2398784B (en) 2003-02-26 2005-07-27 Babraham Inst Removal and modification of the immunoglobulin constant region gene cluster of a non-human mammal
US20100069614A1 (en) 2008-06-27 2010-03-18 Merus B.V. Antibody producing non-human mammals
EP2395017A3 (en) 2003-05-30 2012-12-19 Merus B.V. Design and use of paired variable regions of specific binding molecules
WO2005001087A2 (en) 2003-06-11 2005-01-06 Regeneron Pharmaceuticals, Inc. Methods of modifying genes in eukaryotic cells
GB2403475B (en) 2003-07-01 2008-02-06 Oxitec Ltd Stable integrands
CN103205436B (zh) * 2003-07-15 2016-05-25 人类多克隆治疗公司 人源化免疫球蛋白基因座
US7663017B2 (en) 2003-07-30 2010-02-16 Institut Pasteur Transgenic mice having a human major histocompatability complex (MHC) phenotype, experimental uses and applications
US20050153392A1 (en) 2003-08-11 2005-07-14 Roland Buelow Transgenesis with humanized immunoglobulin loci
US7604994B2 (en) 2003-09-03 2009-10-20 Morphotek, Inc. Genetically altered antibody-producing cell lines with improved antibody characteristics
CA2445602C (en) 2003-10-20 2014-01-14 Campusgen Gmbh Nucleotide sequence for creatinine deiminase and method of use
PL1691837T3 (pl) 2003-12-10 2012-11-30 Squibb & Sons Llc IP-10 przeciwciała i ich zastosowanie
AU2005227313A1 (en) 2004-03-19 2005-10-06 Amgen Inc. Reducing the risk of human and anti-human antibodies through V gene manipulation
US7625549B2 (en) * 2004-03-19 2009-12-01 Amgen Fremont Inc. Determining the risk of human anti-human antibodies in transgenic mice
NZ550106A (en) * 2004-04-22 2009-06-26 Kyowa Hakko Kirin Co Ltd Transgenic animals and uses thereof
JP2006029459A (ja) 2004-07-16 2006-02-02 Kayaba Ind Co Ltd 緩衝装置
ES2440990T5 (es) 2004-07-22 2022-10-25 Univ Erasmus Med Ct Rotterdam Moléculas de unión
FR2875239B1 (fr) 2004-09-10 2007-07-20 Inst Necker Ass Loi De 1901 Procede pour l'acceleration des mutations somatiques et son application en proteomique
CN101076542A (zh) 2004-09-13 2007-11-21 伊沃詹尼克斯有限公司 特异性针对肝细胞癌和其他癌的抗体及其用途
WO2006044492A2 (en) 2004-10-14 2006-04-27 Ingenious Targeting Laboratory, Inc. Methods for generating rat embryo-derived cell lines and genetic modification of rat genome
PL1802193T3 (pl) 2004-10-19 2014-09-30 Regeneron Pharma Sposób wytwarzania myszy homozygotycznej pod względem modyfikacji genetycznej
WO2006055704A2 (en) 2004-11-17 2006-05-26 Curagen Corporation Antibodies directed to ten-m proteins and uses thereof
CN101128483B (zh) 2004-12-21 2015-06-03 阿斯利康公司 血管生成素-2的抗体及其应用
WO2006117699A2 (en) 2005-04-29 2006-11-09 Innate Pharma Transgenic animals and methods of making recombinant antibodies
BRPI0520212A2 (pt) 2005-05-14 2009-08-18 Univ Fudan métodos de geração de um vertebrado não humano transgênico, e de uma célula de vertebrado recombinante, célula de vertebrado em cultura, e, ácido nucleico
EP1780272A1 (en) 2005-10-27 2007-05-02 GSF-Forschungszentrum für Umwelt und Gesundheit GmbH Method for enhancing somatic hypermutation, gene conversion and class switch recombination
GB0601513D0 (en) 2006-01-25 2006-03-08 Univ Erasmus Medical Ct Binding molecules 3
JP5184374B2 (ja) 2006-01-25 2013-04-17 エラスムス・ユニヴァーシティ・メディカル・センター・ロッテルダム 対立遺伝子排除
US7462759B2 (en) 2006-02-03 2008-12-09 Pioneer Hi-Bred International, Inc. Brittle stalk 2 gene family and related methods and uses
EP2003960B1 (en) 2006-03-31 2015-06-10 E. R. Squibb & Sons, L.L.C. Transgenic animals expressing chimeric antibodies for use in preparing human antibodies
CN101454345B (zh) 2006-06-02 2012-08-08 瑞泽恩制药公司 人il-6受体的高亲和力抗体
EP2043695B8 (en) 2006-06-27 2012-02-29 Sanofi Pasteur VaxDesign Corporation Models for vaccine assessment
EP1878342A1 (en) 2006-07-13 2008-01-16 Institut Pasteur Immunodeficient mice transgenic for HLA class I and HLA class II molecules and their uses
JP2010501165A (ja) 2006-08-22 2010-01-21 ジーツー インフラメイション プロプライエタリー リミテッド 抗体の作製方法
DK2769992T3 (da) 2006-10-02 2021-03-22 Regeneron Pharma Humane antistoffer med høj affinitet for human IL-4-receptor
WO2008070367A2 (en) 2006-11-01 2008-06-12 Facet Biotech Corporation Mammalian cell-based immunoglobulin display libraries
NO347649B1 (no) 2006-12-14 2024-02-12 Regeneron Pharma Humant antistoff eller antistoff fragment som spesifikt binder human deltaliknende ligand 4 (hDII4), nukleinsyremolekyl som koder for slike og vektor og vert-vektorsystemer, samt fremgangsmåte for fremstilling, sammensetning og anvendelse.
GB0700194D0 (en) 2007-01-05 2007-02-14 Univ Edinburgh Humanisation of animals
WO2008103475A1 (en) 2007-02-20 2008-08-28 Anaptysbio, Inc. Somatic hypermutation systems
PT2125889E (pt) 2007-02-21 2014-04-15 Univ Massachusetts Anticorpos humanos contra vírus da hepatite c (hcv) e seus usos
BRPI0809435A2 (pt) 2007-03-27 2014-09-09 Sea Lane Biotechnologies, Llc Constructos e bibliotecas que compreendem sequências de cadeia leve substituida de anticorpos
GB0706628D0 (en) 2007-04-04 2007-05-16 Univ Erasmus Germ-line manipulation 1
SI2602323T1 (en) * 2007-06-01 2018-05-31 Open Monoclonal Technology, Inc. Compositions and procedures for inhibiting endogenous immunoglobin gene and the formation of transgenic human idiopathic antibodies
WO2009013620A2 (en) 2007-06-11 2009-01-29 Erasmus University Medical Center Rotterdam Homologous recombination
DK2178916T3 (en) 2007-07-31 2015-01-12 Regeneron Pharma Human antibodies to human cd20 and method thereof for use
MY153781A (en) 2007-08-10 2015-03-13 Regeneron Pharma High affinity human antibodies to human nerve growth factor
KR101280704B1 (ko) 2007-10-12 2013-07-01 에프. 호프만-라 로슈 아게 다수의 핵산으로부터의 단백질 발현
US8227577B2 (en) 2007-12-21 2012-07-24 Hoffman-La Roche Inc. Bivalent, bispecific antibodies
WO2009094178A2 (en) 2008-01-25 2009-07-30 Cabot Corporation Method of preparing modified colored pigments
US20110107445A1 (en) 2008-03-26 2011-05-05 Iti Scotland Limited Efficient Insertion of DNA Into Embryonic Stem Cells
CA2721231C (en) 2008-04-14 2015-10-06 Innovative Targeting Solutions Inc. Sequence diversity generation in immunoglobulins
DK2556747T3 (da) * 2008-06-27 2021-02-15 Merus Nv Antistofproducerende transgen mus
JO3672B1 (ar) * 2008-12-15 2020-08-27 Regeneron Pharma أجسام مضادة بشرية عالية التفاعل الكيماوي بالنسبة لإنزيم سبتيليسين كنفرتيز بروبروتين / كيكسين نوع 9 (pcsk9).
RU2011129459A (ru) 2008-12-18 2013-01-27 Эрасмус Юниверсити Медикал Сентр Роттердам Трансгенные животные (не человек), экспрессирующие гуманизированные антитела, и их применение
CA2750520C (en) 2009-02-04 2017-12-05 Molecular Innovations Methods for screening candidate agents for modulating prorenin and renin, assays for detecting prorenin, and antibodies used therein
EP2401298A1 (en) 2009-02-24 2012-01-04 Glaxo Group Limited Antigen-binding constructs
GB0905023D0 (en) 2009-03-24 2009-05-06 Univ Erasmus Medical Ct Binding molecules
EP2414507B1 (en) 2009-04-03 2014-07-02 Medical Research Council Mutants of activation-induced cytidine deaminase (aid) and methods of use
EP3205723A1 (en) 2009-06-26 2017-08-16 i2 Pharmaceuticals, Inc. Expression of surrogate light chains
US9445581B2 (en) 2012-03-28 2016-09-20 Kymab Limited Animal models and therapeutic molecules
JP5781508B2 (ja) 2009-07-15 2015-09-24 アイム・セラピューティクス・べー・フェー 高親和性抗体を産生させるための手段および方法
JO3182B1 (ar) 2009-07-29 2018-03-08 Regeneron Pharma مضادات حيوية بشرية عالية الالفة مع تولد الاوعية البشرية - 2
EP2464220A4 (en) 2009-08-13 2014-05-07 Crystal Bioscience Inc Transgenic animal for the production of antibodies with minimal complementarity-determining regions
CN102050877B (zh) * 2009-10-30 2014-05-07 上海抗体药物国家工程研究中心有限公司 抗人cd20人源化抗体、其制备方法及用途
WO2011056864A1 (en) 2009-11-05 2011-05-12 Anaptysbio, Inc. Methods of generating improved antigen-binding agents using chain shuffling and optionally somatic hypermutation
NZ600002A (en) 2009-11-17 2014-08-29 Sanford Applied Biosciences L L C Human artificial chromosome vector
EP2509997B1 (en) 2009-12-07 2017-08-30 i2 Pharmaceuticals, Inc. Conjugates comprising an antibody surrogate scaffold with improved pharmacokinetic properties
DK2509409T3 (en) * 2009-12-10 2016-11-14 Regeneron Pharma MICE, WHICH PRODUCES HEAVY CHAIN ANTIBODIES
JO3274B1 (ar) * 2009-12-24 2018-09-16 Regeneron Pharma أجسام مضادة بشرية للبروتين 4 المشابه لأجيوبيوتين البشري
US20120021409A1 (en) 2010-02-08 2012-01-26 Regeneron Pharmaceuticals, Inc. Common Light Chain Mouse
WO2011097603A1 (en) 2010-02-08 2011-08-11 Regeneron Pharmaceuticals, Inc. Common light chain mouse
WO2011146121A1 (en) 2010-05-17 2011-11-24 Sangamo Biosciences, Inc. Novel dna-binding proteins and uses thereof
SG186238A1 (en) 2010-06-17 2013-01-30 Kymab Ltd Animal models and therapeutic molecules
SMT201900241T1 (it) 2010-06-22 2019-05-10 Regeneron Pharma Topi esprimenti una catena leggera ibrida di immunoglobulina con una regione variabile umana
RS55495B1 (sr) 2010-08-02 2017-04-28 Regeneron Pharma Miševi koji stvaraju vezujuće proteine koji sadrže vl domene
EP2606064B1 (en) 2010-08-16 2015-02-25 NovImmune S.A. Methods for the generation of multispecific and multivalent antibodies
JO3375B1 (ar) 2010-11-08 2019-03-13 Regeneron Pharma أجسام مضادة بشرية للجين a1 الشبيه بعامل النخر الورمي (tl1a)
MX2013007168A (es) 2010-12-22 2013-11-04 Genentech Inc Anticuerpo anti-pcsk9 y metodos de uso.
SI3865581T1 (sl) 2011-08-05 2024-12-31 Regeneron Pharmaceuticals, Inc. Miši s humanizirano univerzalno lahko verigo
JP2014531452A (ja) 2011-09-19 2014-11-27 カイマブ・リミテッド 動物、レパートリーおよび方法
CA2846319A1 (en) 2011-09-19 2013-03-28 Kymab Limited Antibodies, variable domains & chains tailored for human use
EP2761008A1 (en) 2011-09-26 2014-08-06 Kymab Limited Chimaeric surrogate light chains (slc) comprising human vpreb
SG10202010120XA (en) 2011-10-17 2020-11-27 Regeneron Pharma Restricted immunoglobulin heavy chain mice
EP2769247B1 (en) 2011-10-20 2021-12-01 3M Innovative Properties Company Apodized broadband partial reflectors
US20130102031A1 (en) 2011-10-25 2013-04-25 Anaptysbio, Inc. Use of somatic hypermutation to create insertion and deletion mutations in vitro
GB2496375A (en) 2011-10-28 2013-05-15 Kymab Ltd A non-human assay vertebrate comprising human antibody loci and human epitope knock-in, and uses thereof
US20180295821A1 (en) 2011-12-02 2018-10-18 Kymab Limited Transgenic Animals
US9253965B2 (en) 2012-03-28 2016-02-09 Kymab Limited Animal models and therapeutic molecules
GB201122047D0 (en) 2011-12-21 2012-02-01 Kymab Ltd Transgenic animals
PL2793567T3 (pl) 2011-12-20 2019-09-30 Regeneron Pharmaceuticals, Inc. Myszy z humanizowanym łańcuchem lekkim
PL3597038T3 (pl) 2012-02-01 2021-11-08 Regeneron Pharmaceuticals, Inc. Humanizowane gryzonie wykazujące ekspresję łańcuchów ciężkich zawierających domeny vl
AR090219A1 (es) 2012-03-02 2014-10-29 Regeneron Pharma Anticuerpos humanos frente a toxinas de clostridium difficile
AU2013204140B2 (en) 2012-03-06 2016-01-28 Regeneron Pharmaceuticals, Inc. Common light chain mouse
AU2013204581B2 (en) 2012-03-16 2015-06-25 Regeneron Pharmaceuticals, Inc. Non-human animals expressing pH-sensitive immunoglobulin sequences
JP2015512635A (ja) 2012-03-28 2015-04-30 カイマブ・リミテッド クラススイッチした完全ヒト抗体の発現のためのトランスジェニック非−ヒト脊椎動物
GB2502127A (en) 2012-05-17 2013-11-20 Kymab Ltd Multivalent antibodies and in vivo methods for their production
US10251377B2 (en) 2012-03-28 2019-04-09 Kymab Limited Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies
JO3820B1 (ar) 2012-05-03 2021-01-31 Regeneron Pharma أجسام مضادة بشرية لـ fel d1وطرق لاستخدامها
WO2013176772A1 (en) 2012-05-25 2013-11-28 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
CN104540383B (zh) 2012-06-12 2017-08-29 瑞泽恩制药公司 具有受限制的免疫球蛋白重链基因座的人源化非人动物
US8962913B2 (en) 2012-06-18 2015-02-24 Regeneron Pharmaceuticals, Inc. Humanized IL-7 rodents
SG10201707569YA (en) 2012-12-12 2017-10-30 Broad Inst Inc Delivery, Engineering and Optimization of Systems, Methods and Compositions for Sequence Manipulation and Therapeutic Applications
WO2014130690A1 (en) 2013-02-20 2014-08-28 Regeneron Pharmaceuticals, Inc. Non-human animals with modified immunoglobulin heavy chain sequences
US10993420B2 (en) 2013-03-15 2021-05-04 Erasmus University Medical Center Production of heavy chain only antibodies in transgenic mammals
US9788534B2 (en) 2013-03-18 2017-10-17 Kymab Limited Animal models and therapeutic molecules
US9783618B2 (en) 2013-05-01 2017-10-10 Kymab Limited Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
US20150033372A1 (en) 2013-05-01 2015-01-29 Kymab Limited Human VpreB & Chimaeric Surrogate Light Chains in Transgenic Non-Human Vertebrates
US11707056B2 (en) 2013-05-02 2023-07-25 Kymab Limited Animals, repertoires and methods
US9783593B2 (en) 2013-05-02 2017-10-10 Kymab Limited Antibodies, variable domains and chains tailored for human use
US20140331339A1 (en) 2013-05-03 2014-11-06 Kymab Limited Transgenic Non-Human Assay Vertebrates, Assays and Kits
US20140331344A1 (en) 2013-05-03 2014-11-06 Kymab Ltd. Transgenic Animals
ES2993142T3 (en) 2013-10-01 2024-12-23 Kymab Ltd Animal models and therapeutic molecules
GB201710984D0 (en) 2017-07-07 2017-08-23 Kymab Ltd Cells, vertebrates, populations & methods

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5939598A (en) 1990-01-12 1999-08-17 Abgenix, Inc. Method of making transgenic mice lacking endogenous heavy chains
US6673986B1 (en) 1990-01-12 2004-01-06 Abgenix, Inc. Generation of xenogeneic antibodies
US7501552B2 (en) 1991-08-28 2009-03-10 Medarex, Inc. Transgenic non-human animals for producing chimeric antibodies
US5859301A (en) 1993-12-23 1999-01-12 Dsm N.V. Process for preparing alkanones and alkanols
US6130364A (en) 1995-03-29 2000-10-10 Abgenix, Inc. Production of antibodies using Cre-mediated site-specific recombination
EP0937140A2 (en) 1996-06-27 1999-08-25 Vlaams Interuniversitair Instituut voor Biotechnologie vzw. Recognition molecules interacting specifically with the active site or cleft of a target molecule
EP1034260A2 (en) 1997-12-05 2000-09-13 Europäisches Laboratorium Für Molekularbiologie (Embl) Novel dna cloning method relying on the e. coli rece/rect recombination system
EP1204740A1 (en) 1999-07-09 2002-05-15 The European Molecular Biology Laboratory Methods and compositions for directed cloning and subcloning using homologous recombination
US6586251B2 (en) 2000-10-31 2003-07-01 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
WO2002066630A1 (en) 2001-02-16 2002-08-29 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
EP1399559A2 (en) 2001-06-21 2004-03-24 The Babraham Institute Mouse lambda light chain locus
WO2009097006A2 (en) 2007-08-10 2009-08-06 Medarex, Inc. Hco32 and hco27 and related examples
WO2009076464A2 (en) 2007-12-10 2009-06-18 Aliva Biopharmaceuticals, Inc. Methods for sequential replacement of targeted region by homologous recombination
WO2009143472A2 (en) 2008-05-23 2009-11-26 Aliva Biopharmaceuticals, Inc. Method of generating single vl domain antibodies in transgenic animals
WO2010039900A2 (en) 2008-09-30 2010-04-08 Aliva Biopharmaceuticals, Inc. Non-human mammals for the production of chimeric antibodies
WO2011004192A1 (en) 2009-07-08 2011-01-13 Genome Research Limited Animal models and therapeutic molecules
WO2011066501A1 (en) 2009-11-30 2011-06-03 Centocor Ortho Biotech Inc. Antibody fc mutants with ablated effector functions
WO2012141798A1 (en) 2011-02-25 2012-10-18 Regeneron Pharmaceuticals, Inc. Adam6 mice

Non-Patent Citations (30)

* Cited by examiner, † Cited by third party
Title
"HapMap", 2003, THE INTERNATIONAL HAPMAP CONSORTIUM
ANNU. REV. BIOCHEM., vol. 76, 2007, pages 1 - 22
AUERBACH W; DUNMORE JH; FAIRCHILD-HUNTRESS V ET AL.: "Establishment and chimera analysis of 129/SvEv- and C57BL/6-derived mouse embryonic stem cell lines", BIOTECHNIQUES, vol. 29, 2000, pages 1024 - 8
BENNY K C LO: "Methods in Molecular BiologyTM", HUMAN PRESS, article "Antibody Engineering Methods and Protocols"
CAMACHO C.; COULOURIS G.; AVAGYAN V.; MA N.; PAPADOPOULOS J.; BEALER K.; MADDEN T.L.: "BLAST+: architecture and applications.", BMC BIOINFORMATICS, vol. 10, 2008, pages 421, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/20003500>
CURR OPIN IMMUNOL., vol. 7, no. 2, April 1995 (1995-04-01), pages 248 - 54
GENOMES PROJECT CONSORTIUM, 2010, Retrieved from the Internet <URL:http://www.1000genomes.org>
H.HAGA ET AL., JAPANESE SNP DATABASE, 2002, Retrieved from the Internet <URL:http://snp.ims.u-tokyo.ac.ip/index.html>
HARLOW, E.; LANE, D.: "Antibodies: A Laboratory Manual, 5th edition,", 1998, COLD SPRING HARBOR LAB. PRESS
J MOL BIOL., vol. 270, no. 4, 25 July 1997 (1997-07-25), pages 587 - 97
J. SALDANHA, HUMANIZATION BYDESIGN, 2000
JAVIER M. DI NOIA; MICHAEL S. NEUBERGER, MOLECULAR MECHANISMS OF ANTIBODY SOMATIC HYPERMUTATION
KABAT, E. A.; WU, T. T.; PERRY, H.; GOTTESMAN, K.; FOELLER, C.: "Sequences of Proteins of Immunological Interest, 5th ed.,", 1991, NIH PUBLICATION NO. 91- 3242
LIU, L ET AL., JOURNAL OF VIROLOGY, vol. 85, 2011, pages 8467 - 8476
M. R. CLARK, MIKE'S IMMUNOGLOBULIN STRUCTURE/FUNCTION, 2001, Retrieved from the Internet <URL:http:llwww.path.cam.ac.uk/~mrc7/mikeimages.htm/>
MARIE-PAULE LEFRANC; GÉRARD LEFRANC: "The Immunoglobulin Facts Book", 2001, ACADEMIC PRESS, ISBN: 0-12-441351-X, pages: 3pp, 104, XP003035047
MOL IMMUNOL., vol. 40, no. 9, December 2003 (2003-12-01), pages 585 - 93
N A ROSENBERG ET AL., SCIENCE, vol. 298, no. 5602, 20 December 2002 (2002-12-20), pages 2342 - 2343
N. WHITELEGG; A. R. REES: "WAM?Web Antibody Modeling", 2001, CENTRE FOR PROTEIN ANALYSIS AND DESIGN AT THE UNIVERSITY OF BATH
NAT REV GENET., vol. 2, no. 10, October 2001 (2001-10-01), pages 769 - 79
NATURE, vol. 426, no. 6968, 18 December 2003 (2003-12-18), pages 789 - 96
OSOEGAWA K; MAMMOSER AG; WU C; FRENGEN E; ZENG C; CATANESE JJ; DE JONG PJ: "A bacterial artificial chromosome library for sequencing the complete human genome", GENOME RES., vol. 11, no. 3, March 2001 (2001-03-01), pages 483 - 96, XP002310986, DOI: doi:10.1101/gr.169601
OSOEGAWA, K.; WOON, P.Y.; ZHAO, B.; FRENGEN, E.; TATENO, M.; CATANESE, J.J; JONG, P.J.: "An Improved Approach for Construction of Bacterial Artificial Chromosome Libraries", GENOMICS, vol. 52, 1998, pages 1 - 8, XP004449066, DOI: doi:10.1006/geno.1998.5423
PASQUALINI; ARAP, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 101, 2004, pages 257 - 259
PLOS ONE, vol. 6, no. 3, 30 March 2011 (2011-03-30), pages EL6857
PLOS ONE., vol. 7, no. 5, 9 May 2012 (2012-05-09), pages E36750
ROGOZIN; DIAZ: "Cutting Edge: DGYW/WRCH Is a Better Predictor of Mutability at G:C Bases in lg Hypermutation Than the Widely Accepted RGYW/WRCY Motif and Probably Reflects a Two-Step Activation-Induced Cytidine Deaminase-Triggered Process", JOURNAL OF IMMUNOLOGY, vol. 172, no. 6, 15 March 2004 (2004-03-15), pages 3382 - 3384
SAMBROOK, J; RUSSELL, D.: "Molecular Cloning: A Laboratory Manual, 3'd edition", 2001, COLD SPRING HARBOR LAB. PRESS
See also references of EP2758535A2
THE ANTIBODY RESOURCE PAGE, 2000

Cited By (137)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11564380B2 (en) 2009-07-08 2023-01-31 Kymab Limited Animal models and therapeutic molecules
US9434782B2 (en) 2009-07-08 2016-09-06 Kymab Limited Animal models and therapeutic molecules
US9447177B2 (en) 2009-07-08 2016-09-20 Kymab Limited Transgenic mouse homozygous for chimeric IgH locus
US11812731B2 (en) 2009-07-08 2023-11-14 Kymab Ltd. Animal models and therapeutic molecules
US9505827B2 (en) 2009-07-08 2016-11-29 Kymab Limited Animal models and therapeutic molecules
US9504236B2 (en) 2009-07-08 2016-11-29 Kymab Limited Animal models and therapeutic molecules
US10165763B2 (en) 2009-07-08 2019-01-01 Kymab Limited Animal models and therapeutic molecules
US11606941B2 (en) 2009-07-08 2023-03-21 Kymab Limited Animal models and therapeutic molecules
US10064398B2 (en) 2009-07-08 2018-09-04 Kymab Limited Animal models and therapeutic molecules
US9686970B2 (en) 2010-08-02 2017-06-27 Regeneron Pharmaceuticals, Inc. Mice that make VL binding proteins
US12486335B2 (en) 2010-08-02 2025-12-02 Regeneron Pharmaceuticals, Inc. Mice that make VL binding proteins
US10954310B2 (en) 2010-08-02 2021-03-23 Regeneran Pharmaceuticals, Inc. Mice that make VL binding proteins
US9516868B2 (en) 2010-08-02 2016-12-13 Regeneron Pharmaceuticals, Inc. Mice that make VL binding proteins
US11357217B2 (en) 2011-08-05 2022-06-14 Regeneron Pharmaceuticals, Inc. Humanized universal light chain mice
US10130081B2 (en) 2011-08-05 2018-11-20 Regeneron Pharmaceuticals, Inc. Humanized universal light chain mice
US11051497B2 (en) 2011-09-19 2021-07-06 Kymab Limited Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
US9963716B2 (en) 2011-09-26 2018-05-08 Kymab Limited Chimaeric surrogate light chains (SLC) comprising human VpreB
US10246509B2 (en) 2011-10-17 2019-04-02 Regeneron Pharmaceuticals, Inc. Restricted immunoglobulin heavy chain mice
US9932398B2 (en) 2011-10-17 2018-04-03 Regeneron Pharmaceuticals, Inc. Restricted immunoglobulin heavy chain mice
US11261248B2 (en) 2011-10-17 2022-03-01 Regeneron Pharmaceuticals, Inc. Restricted immunoglobulin heavy chain mice
US12433266B2 (en) 2011-12-20 2025-10-07 Regeneron Pharmaceuticals, Inc. Humanized light chain mice
US10561124B2 (en) 2011-12-20 2020-02-18 Regeneron Pharmaceuticals, Inc. Humanized light chain mice
US11617357B2 (en) 2011-12-20 2023-04-04 Regeneron Pharmaceuticals, Inc. Humanized light chain mice
US11612151B2 (en) 2011-12-20 2023-03-28 Regeneron Pharmaceuticals, Inc. Humanized light chain mice
US9622459B2 (en) 2011-12-20 2017-04-18 Regeneron Pharmaceuticals, Inc. Humanized light chain mice
US9706759B2 (en) 2011-12-20 2017-07-18 Regeneron Pharmaceuticals, Inc. Humanized light chain mice
US10774155B2 (en) 2012-03-28 2020-09-15 Kymab Limited Animal models and therapeutic molecules
US11297811B2 (en) 2012-03-28 2022-04-12 Kymab Limited Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies
US9445581B2 (en) 2012-03-28 2016-09-20 Kymab Limited Animal models and therapeutic molecules
US9938357B2 (en) 2012-03-28 2018-04-10 Kymab Limited Animal models and therapeutic molecules
US9924705B2 (en) 2012-03-28 2018-03-27 Kymab Limited Animal models and therapeutic molecules
US9896516B2 (en) 2012-03-28 2018-02-20 Kymab Limited Animal models and therapeutic molecules
US9253965B2 (en) 2012-03-28 2016-02-09 Kymab Limited Animal models and therapeutic molecules
US9938358B2 (en) 2012-03-28 2018-04-10 Kymab Limited Animal models and therapeutic molecules
US10251377B2 (en) 2012-03-28 2019-04-09 Kymab Limited Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies
US10667501B2 (en) 2012-05-17 2020-06-02 Kymab Limited Transgenic non-human vertebrate for the in vivo production of dual specificity immunoglobulins or hypermutated heavy chain only immunoglobulins
US10542735B2 (en) 2012-06-12 2020-01-28 Regerneron Pharmaceuticals, Inc. Humanized non-human animals with restricted immunoglobulin heavy chain loci
US10238093B2 (en) 2012-06-12 2019-03-26 Regeneron Pharmaceuticals, Inc. Humanized non-human animals with restricted immunoglobulin heavy chain loci
US11666040B2 (en) 2012-06-12 2023-06-06 Regeneron Pharmaceuticals, Inc. Humanized non-human animals with restricted immunoglobulin heavy chain loci
US11559050B2 (en) 2012-06-12 2023-01-24 Regeneron Pharmaceuticals, Inc. Humanized non-human animals with restricted immunoglobulin heavy chain loci
US9930871B2 (en) 2013-02-20 2018-04-03 Regeneron Pharmaceuticals, Inc. Non-human animals with modified immunoglobulin heavy chain sequences
US11297810B2 (en) 2013-03-18 2022-04-12 Kymab Limited Animal models and therapeutic molecules
US10226033B2 (en) 2013-03-18 2019-03-12 Kymab Limited Animal models and therapeutic molecules
US9788534B2 (en) 2013-03-18 2017-10-17 Kymab Limited Animal models and therapeutic molecules
US9783618B2 (en) 2013-05-01 2017-10-10 Kymab Limited Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
US9783593B2 (en) 2013-05-02 2017-10-10 Kymab Limited Antibodies, variable domains and chains tailored for human use
US11820810B2 (en) 2013-05-02 2023-11-21 Kymab Limited Antibodies, variable domains and chains tailored for human use
US10730930B2 (en) 2013-05-02 2020-08-04 Kymab Limited Antibodies, variable domains and chains tailored for human use
US11707056B2 (en) 2013-05-02 2023-07-25 Kymab Limited Animals, repertoires and methods
EP4610362A3 (en) * 2013-09-18 2025-12-17 Kymab Limited Methods, cells and organisms
NL2013554A (en) * 2013-10-01 2015-04-07 Kymab Ltd Animal models and therapeutic molecules.
EP3794941A1 (en) 2013-10-01 2021-03-24 Kymab Limited Animal models and therapeutic molecules
CN105683365A (zh) * 2013-10-01 2016-06-15 科马布有限公司 动物模型及治疗分子
WO2015049517A3 (en) * 2013-10-01 2015-08-06 Kymab Limited Animal models and therapeutic molecules
US10149462B2 (en) 2013-10-01 2018-12-11 Kymab Limited Animal models and therapeutic molecules
JP7179106B2 (ja) 2013-10-01 2022-11-28 カイマブ・リミテッド 動物モデル及び治療用分子
JP7133902B2 (ja) 2013-10-01 2022-09-09 カイマブ・リミテッド 動物モデル及び治療用分子
US10966412B2 (en) 2013-10-01 2021-04-06 Kymab Limited Animal models and therapeutic molecules
FR3011249A1 (cg-RX-API-DMAC7.html) * 2013-10-01 2015-04-03 Kymab Ltd
NL2015773A (en) * 2013-10-01 2016-09-22 Kymab Ltd Animal models and therapeutic molecules.
JP2021087442A (ja) * 2013-10-01 2021-06-10 カイマブ・リミテッド 動物モデル及び治療用分子
US11399522B2 (en) 2013-10-01 2022-08-02 Kymab Limited Animal models and therapeutic molecules
US10618971B2 (en) 2013-12-17 2020-04-14 Kymab Limited Targeting rare human PCSK9 variants for cholesterol treatment
WO2015092393A3 (en) * 2013-12-17 2015-09-11 Kymab Limited Ligands specifically binding to human targets of interest
US11434305B2 (en) 2013-12-17 2022-09-06 Kymab Limited Precision medicine by targeting rare human PCSK9 variants for cholesterol treatment
EP2886558A1 (en) * 2013-12-17 2015-06-24 Kymab Limited Antibodies for use in treating conditions related to specific PCSK9 variants in specific patient populations
DE202014010421U1 (de) 2013-12-17 2015-11-12 Kymab Limited Menschliche Ziele
DE202014010499U1 (de) 2013-12-17 2015-10-20 Kymab Limited Targeting von humaner PCSK9 zur Cholesterinbehandlung
WO2015092394A1 (en) * 2013-12-17 2015-06-25 Kymab Limited Antibodies for use in treating conditions related to specific pcsk9 variants in specific patients populations
EP2886557A1 (en) * 2013-12-17 2015-06-24 Kymab Limited Antibodies for use in treating conditions related to specific PCSK9 variants in specific patient populations
US10611849B2 (en) 2013-12-17 2020-04-07 Kymab Limited Precision medicine by targeting rare human PCSK9 variants for cholesterol treatment
US9040052B1 (en) 2013-12-17 2015-05-26 Kymab Limited Precision Medicine by targeting rare human PCSK9 variants for cholesterol treatment
JP2017502030A (ja) * 2013-12-17 2017-01-19 カイマブ・リミテッド 対象とするヒト標的に特異的に結合するリガンド
JP2017505127A (ja) * 2014-01-24 2017-02-16 チルドレンズ メディカル センター コーポレーション 抗体親和性の最適化のための高スループットマウスモデル
US11974553B2 (en) 2014-01-24 2024-05-07 Children's Medical Center Corporation High-throughput mouse model for optimizing antibody affinities
US11773175B2 (en) 2014-03-04 2023-10-03 Kymab Limited Antibodies, uses and methods
US11753479B2 (en) 2014-03-04 2023-09-12 Kymab Limited Nucleic acids encoding anti-OX40L antibodies
US10787522B2 (en) 2014-03-21 2020-09-29 Regeneron Pharmaceuticals, Inc. VL antigen binding proteins exhibiting distinct binding characteristics
US10881085B2 (en) 2014-03-21 2021-01-05 Regeneron Pharmaceuticals, Inc. Non-human animals that make single domain binding proteins
US9051378B1 (en) 2014-07-15 2015-06-09 Kymab Limited Targeting rare human PCSK9 variants for cholesterol treatment
US8986694B1 (en) 2014-07-15 2015-03-24 Kymab Limited Targeting human nav1.7 variants for treatment of pain
US9067998B1 (en) 2014-07-15 2015-06-30 Kymab Limited Targeting PD-1 variants for treatment of cancer
US10618955B2 (en) 2014-07-15 2020-04-14 Kymab Limited Methods for treating neurodegenerative disease using anti-PD-1 antibodies
DE202015009006U1 (de) 2014-07-15 2016-08-19 Kymab Limited Targeting von humaner PCSK9 zur Cholesterinbehandlung
US9062105B1 (en) 2014-07-15 2015-06-23 Kymab Limited Precision Medicine by targeting VEGF-A variants for treatment of retinopathy
US10711059B2 (en) 2014-07-15 2020-07-14 Kymab Limited Methods for treating neurodegenerative diseases using anti-PD-L1 antibodies
US9139648B1 (en) 2014-07-15 2015-09-22 Kymab Limited Precision medicine by targeting human NAV1.9 variants for treatment of pain
US8980273B1 (en) 2014-07-15 2015-03-17 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
DE202015009007U1 (de) 2014-07-15 2016-08-19 Kymab Limited Targeting von humaner PCSK9 zur Cholesterinbehandlung
EP3332790A1 (en) 2014-07-15 2018-06-13 Kymab Limited Antibodies for use in treating conditions related to specific pcsk9 variants in specific patients populations
US9150660B1 (en) 2014-07-15 2015-10-06 Kymab Limited Precision Medicine by targeting human NAV1.8 variants for treatment of pain
US9045548B1 (en) 2014-07-15 2015-06-02 Kymab Limited Precision Medicine by targeting rare human PCSK9 variants for cholesterol treatment
US9187562B1 (en) 2014-07-15 2015-11-17 Kymab Limited Methods for treating anaemia
EP2975059A1 (en) 2014-07-15 2016-01-20 Kymab Limited Antibodies for use in treating conditions related to specific pcsk9 variants in specific patients populations
EP2975058A1 (en) * 2014-07-15 2016-01-20 Kymab Limited Antibodies for use in treating conditions related to specific PCSK9 variants in specific patient populations
US9045545B1 (en) 2014-07-15 2015-06-02 Kymab Limited Precision medicine by targeting PD-L1 variants for treatment of cancer
US8986691B1 (en) 2014-07-15 2015-03-24 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
US9428578B2 (en) 2014-07-15 2016-08-30 Kymab Limited Methods of treating anaemia
US9914769B2 (en) 2014-07-15 2018-03-13 Kymab Limited Precision medicine for cholesterol treatment
DE202015009002U1 (de) 2014-07-15 2016-08-18 Kymab Limited Targeting von humaner PCSK9 zur Cholesterinbehandlung
US9034331B1 (en) 2014-07-15 2015-05-19 Kymab Limited Targeting rare human PCSK9 variants for cholesterol treatment
US8945560B1 (en) 2014-07-15 2015-02-03 Kymab Limited Method of treating rheumatoid arthritis using antibody to IL6R
US9034332B1 (en) 2014-07-15 2015-05-19 Kymab Limited Precision medicine by targeting rare human PCSK9 variants for cholesterol treatment
US9068012B1 (en) 2014-07-15 2015-06-30 Kymab Limited Targeting rare human PCSK9 variants for cholesterol treatment
WO2016008899A1 (en) 2014-07-15 2016-01-21 Kymab Limited Targeting human pcsk9 for cholesterol treatment
US9439963B2 (en) 2014-07-15 2016-09-13 Kymab Limited Methods of treating anaemia
US9303089B2 (en) 2014-07-15 2016-04-05 Kymab Limited Methods of treating anaemia
US9416180B1 (en) 2014-07-15 2016-08-16 Kymab Limited Precision medicine by targeting VEGF-A variants for treatment of diabetic macular edema and branch retinal vein occlusion
US9394568B2 (en) 2014-07-15 2016-07-19 Kymab Limited Methods of treating anaemia
US8992927B1 (en) 2014-07-15 2015-03-31 Kymab Limited Targeting human NAV1.7 variants for treatment of pain
US11555066B2 (en) 2014-07-15 2023-01-17 Kymab Limited Precision medicine for cholesterol treatment
US9023359B1 (en) 2014-07-15 2015-05-05 Kymab Limited Targeting rare human PCSK9 variants for cholesterol treatment
US9017678B1 (en) 2014-07-15 2015-04-28 Kymab Limited Method of treating rheumatoid arthritis using antibody to IL6R
DE202015008988U1 (de) 2014-07-15 2016-06-30 Kymab Limited Targeting von humaner PCSK9 zur Cholesterinbehandlung
US8999341B1 (en) 2014-07-15 2015-04-07 Kymab Limited Targeting rare human PCSK9 variants for cholesterol treatment
DE202015008974U1 (de) 2014-07-15 2016-06-30 Kymab Limited Targeting von humaner PCSK9 zur Cholesterinbehandlung
WO2016023916A1 (en) 2014-08-12 2016-02-18 Kymab Limited Treatment of disease using ligand binding to targets of interest
WO2016071701A1 (en) 2014-11-07 2016-05-12 Kymab Limited Treatment of disease using ligand binding to targets of interest
US11111314B2 (en) 2015-03-19 2021-09-07 Regeneron Pharmaceuticals, Inc. Non-human animals that select for light chain variable regions that bind antigen
EP4257599A3 (en) * 2016-01-13 2024-01-17 Regeneron Pharmaceuticals, Inc. Rodents having an engineered heavy chain diversity region
US12295354B2 (en) 2016-06-03 2025-05-13 Regeneron Pharmaceuticals, Inc. Non-human animals expressing exogenous terminal deoxynucleotidyltransferase
US12209128B2 (en) 2016-06-20 2025-01-28 Kymab Limited Anti-PD-L1 antibodies
US11779604B2 (en) 2016-11-03 2023-10-10 Kymab Limited Antibodies, combinations comprising antibodies, biomarkers, uses and methods
WO2019037099A1 (en) * 2017-08-25 2019-02-28 Wenning Qin Large scale modification of eukaryotic genome
US11946063B2 (en) 2017-10-27 2024-04-02 Trianni, Inc. Long germline DH genes and long HCDR3 antibodies
EP3476942B1 (en) * 2017-10-27 2022-01-26 Trianni, Inc. Long germline dh genes and long hcdr3 antibodies
US12004495B2 (en) 2019-02-18 2024-06-11 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. Genetically modified non-human animals with humanized immunoglobulin locus
WO2020169022A1 (en) * 2019-02-18 2020-08-27 Beijing Biocytogen Co., Ltd Genetically modified non-human animals with humanized immunoglobulin locus
EP3927832A4 (en) * 2019-02-18 2022-11-30 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. GENETICALLY MODIFIED NON-HUMAN ANIMALS WITH HUMANIZED IMMUNOGLOBULIN LOCUS
US11730151B2 (en) 2019-02-18 2023-08-22 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. Genetically modified non-human animals with humanized immunoglobulin locus
US20220324968A1 (en) * 2019-04-18 2022-10-13 Kymab Limited Antagonists anti-cd7 antibodies
US12435134B2 (en) * 2019-04-18 2025-10-07 Kymab Limited Antagonists anti-CD7 antibodies
US11997994B2 (en) 2020-06-02 2024-06-04 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. Genetically modified non-human animals with common light chain immunoglobulin locus
CN115988960A (zh) * 2020-06-25 2023-04-18 株式会社湖美宝 杂合转基因动物
EP4173480A4 (en) * 2020-06-25 2024-04-17 Humab Co. Ltd. HETEROZYGOUS TRANSGENIC ANIMAL
WO2022056276A1 (en) 2020-09-11 2022-03-17 Regeneron Pharmaceuticals, Inc. Identification and production of antigen-specific antibodies
WO2022132943A1 (en) 2020-12-16 2022-06-23 Regeneron Pharmaceuticals, Inc. Mice expressing humanized fc alpha receptors

Also Published As

Publication number Publication date
EP3128009B1 (en) 2020-07-29
JP2016002084A (ja) 2016-01-12
BR112014006394A2 (pt) 2017-03-28
US20180030121A1 (en) 2018-02-01
EP3839049A2 (en) 2021-06-23
CN103945689A (zh) 2014-07-23
WO2013041844A3 (en) 2013-07-11
AU2012311286A1 (en) 2014-05-01
EP3311661B1 (en) 2022-04-20
AU2017254949A1 (en) 2017-11-23
EP3839049A3 (en) 2021-10-20
JP2014529998A (ja) 2014-11-17
WO2013041846A2 (en) 2013-03-28
HK1194757A1 (en) 2014-10-24
CN103945689B (zh) 2016-10-19
AU2012311286B2 (en) 2018-07-26
CA2846322A1 (en) 2013-03-28
EP2757875B1 (en) 2017-11-29
EP4091442A1 (en) 2022-11-23
JP2017079795A (ja) 2017-05-18
CN107056936B (zh) 2021-09-03
CN107056936A (zh) 2017-08-18
US20220000085A1 (en) 2022-01-06
JP6324355B2 (ja) 2018-05-16
CN106995822A (zh) 2017-08-01
JP7067868B2 (ja) 2022-05-16
WO2013041846A3 (en) 2013-08-01
CN104080916A (zh) 2014-10-01
BR112014006390A2 (pt) 2017-03-28
EP2758535B1 (en) 2016-11-09
EP2758535A2 (en) 2014-07-30
US11051497B2 (en) 2021-07-06
ES2612935T3 (es) 2017-05-19
DK3311661T3 (da) 2022-07-11
EP2757875A2 (en) 2014-07-30
JP5813880B2 (ja) 2015-11-17
CA2846319A1 (en) 2013-03-28
EP3311661A1 (en) 2018-04-25
NZ623745A (en) 2016-06-24
AU2012311288B2 (en) 2017-08-17
WO2013041844A9 (en) 2014-11-27
AU2012311288A1 (en) 2014-05-01
DK2757875T3 (en) 2018-01-08
EP2757875B2 (en) 2023-03-22
US20140041067A1 (en) 2014-02-06
EP3128009A1 (en) 2017-02-08
NZ623756A (en) 2016-06-24
US20140212416A1 (en) 2014-07-31
CN106995822B (zh) 2021-06-29
JP2014533930A (ja) 2014-12-18

Similar Documents

Publication Publication Date Title
US11820810B2 (en) Antibodies, variable domains and chains tailored for human use
US20180030121A1 (en) Antibodies, variable domains &amp; chains tailored for human use
US9783618B2 (en) Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
HK40083899A (en) Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
HK1194757B (en) Antibodies, variable domains &amp; chains tailored for human use
HK1195449B (en) Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
HK1195449A (en) Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
NZ623745B2 (en) Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12772122

Country of ref document: EP

Kind code of ref document: A2

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2846319

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2014531302

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2012772122

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2012772122

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2012311286

Country of ref document: AU

Date of ref document: 20120918

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014006390

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014006390

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20140318