WO2006125119A1 - Compositions and methods for treatment of eye disorders - Google Patents

Compositions and methods for treatment of eye disorders Download PDF

Info

Publication number
WO2006125119A1
WO2006125119A1 PCT/US2006/019327 US2006019327W WO2006125119A1 WO 2006125119 A1 WO2006125119 A1 WO 2006125119A1 US 2006019327 W US2006019327 W US 2006019327W WO 2006125119 A1 WO2006125119 A1 WO 2006125119A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
aryl
het
substituted
amino
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2006/019327
Other languages
English (en)
French (fr)
Inventor
Thomas Gadek
John Burnier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sarcode Bioscience Inc
Original Assignee
Sarcode Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=37431594&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2006125119(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to PL06770607T priority Critical patent/PL1881823T3/pl
Priority to EP06770607.7A priority patent/EP1881823B1/en
Priority to HK08112183.4A priority patent/HK1117083B/xx
Priority to DK06770607.7T priority patent/DK1881823T3/en
Priority to SI200631898T priority patent/SI1881823T1/sl
Application filed by Sarcode Corp filed Critical Sarcode Corp
Priority to CA2609053A priority patent/CA2609053C/en
Priority to CN2006800171884A priority patent/CN101175488B/zh
Priority to JP2008512519A priority patent/JP5794721B2/ja
Priority to ES06770607T priority patent/ES2530780T3/es
Priority to AU2006247136A priority patent/AU2006247136C1/en
Publication of WO2006125119A1 publication Critical patent/WO2006125119A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/472Non-condensed isoquinolines, e.g. papaverine
    • A61K31/4725Non-condensed isoquinolines, e.g. papaverine containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B3/00Apparatus for testing the eyes; Instruments for examining the eyes
    • A61B3/10Objective types, i.e. instruments for examining the eyes independent of the patients' perceptions or reactions
    • A61B3/101Objective types, i.e. instruments for examining the eyes independent of the patients' perceptions or reactions for examining the tear film
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B3/00Apparatus for testing the eyes; Instruments for examining the eyes
    • A61B3/10Objective types, i.e. instruments for examining the eyes independent of the patients' perceptions or reactions
    • A61B3/14Arrangements specially adapted for eye photography
    • A61B3/145Arrangements specially adapted for eye photography by video means
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/275Nitriles; Isonitriles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/341Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide not condensed with another ring, e.g. ranitidine, furosemide, bufetolol, muscarine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/38Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • A61K31/405Indole-alkanecarboxylic acids; Derivatives thereof, e.g. tryptophan, indomethacin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4151,2-Diazoles
    • A61K31/41621,2-Diazoles condensed with heterocyclic ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41841,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41921,2,3-Triazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4709Non-condensed quinolines and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/472Non-condensed isoquinolines, e.g. papaverine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4738Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4745Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/53751,4-Oxazines, e.g. morpholine
    • A61K31/53771,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/541Non-condensed thiazines containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/06Aluminium, calcium or magnesium; Compounds thereof, e.g. clay
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/07Tetrapeptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08Peptides having 5 to 11 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0014Skin, i.e. galenical aspects of topical compositions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0043Nose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0048Eye, e.g. artificial tears
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0048Eye, e.g. artificial tears
    • A61K9/0051Ocular inserts or implants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0053Mouth and digestive tract, i.e. intraoral and peroral administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/04Artificial tears; Irrigation solutions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C279/00Derivatives of guanidine, i.e. compounds containing the group, the singly-bound nitrogen atoms not being part of nitro or nitroso groups
    • C07C279/28Derivatives of guanidine, i.e. compounds containing the group, the singly-bound nitrogen atoms not being part of nitro or nitroso groups having nitrogen atoms of guanidine groups bound to cyano groups, e.g. cyanoguanidines, dicyandiamides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C317/00Sulfones; Sulfoxides
    • C07C317/44Sulfones; Sulfoxides having sulfone or sulfoxide groups and carboxyl groups bound to the same carbon skeleton
    • C07C317/48Sulfones; Sulfoxides having sulfone or sulfoxide groups and carboxyl groups bound to the same carbon skeleton the carbon skeleton being further substituted by singly-bound nitrogen atoms, not being part of nitro or nitroso groups
    • C07C317/50Sulfones; Sulfoxides having sulfone or sulfoxide groups and carboxyl groups bound to the same carbon skeleton the carbon skeleton being further substituted by singly-bound nitrogen atoms, not being part of nitro or nitroso groups at least one of the nitrogen atoms being part of any of the groups, X being a hetero atom, Y being any atom
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D207/00Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/04Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D207/06Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with radicals, containing only hydrogen and carbon atoms, attached to ring carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/02Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/02Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines
    • C07D217/06Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines with the ring nitrogen atom acylated by carboxylic or carbonic acids, or with sulfur or nitrogen analogues thereof, e.g. carbamates
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/12Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with radicals, substituted by hetero atoms, attached to carbon atoms of the nitrogen-containing ring
    • C07D217/18Aralkyl radicals
    • C07D217/20Aralkyl radicals with oxygen atoms directly attached to the aromatic ring of said aralkyl radical, e.g. papaverine
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/22Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the nitrogen-containing ring
    • C07D217/26Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D307/00Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
    • C07D307/02Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings
    • C07D307/34Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D307/38Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D307/52Radicals substituted by nitrogen atoms not forming part of a nitro radical
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D333/00Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/26Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D333/38Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/06Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/06Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D409/00Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04Ortho-condensed systems
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5032Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on intercellular interactions
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047Cells of the immune system
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70503Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
    • G01N2333/70525ICAM molecules, e.g. CD50, CD54, CD102
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70546Integrin superfamily, e.g. VLAs, leuCAM, GPIIb/GPIIIa, LPAM
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/02Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/20Screening for compounds of potential therapeutic value cell-free systems
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/16Ophthalmology

Definitions

  • An ophthalmological disorder, dry eye is a common complaint of ophthalmic patients. Unaddressed conditions of dry eye can lead to erosion and abrasion of the epithelial cell surface of the cornea, raising susceptibility to infection. Progression of the disease can lead to ulceration of the cornea, even loss of sight.
  • LASIK can have a secondary effect of eye injury as nerves often can be severed or ablated during laser refractive surgery, which can lead to at least temporary dry eye syndrome of several months duration.
  • the present invention provides methods for treatment of inflammatory disorders mediated by LFA-I by administering an effective amount of an antagonist of LFA-I by itself or in combination with other therapeutic agents to a subject.
  • diseases in which the anti- LFA-I antibody, Raptiva has shown therapeutic effect or effect on inflammatory cells in the diseased tissue are diseasse that are treated by the LFA-I compounds of the present invention.
  • Patients with immune mediated allergic diseases including rhinitis may be treated with the compounds of the invention to reduce the inflammation associated with LFA-I mediated immune and/or allergic responses.
  • a local administration of the compounds of the invention, delivered via the mouth or nose as a misted solution or dispersed powder is useful in the treatment of asthma or other LFA-I mediated pulmonary inflammatory dieseases.
  • a cream formulation of the compounds of the invention is useful in the local delivery of a LFA-I antagonist to the skin in dermatologic diseases mediated by LFA-I such as eczema, and psoriasis.
  • an oral formulation of a LFA-I antagonist which is known to be poorly absorbed at the systemic level is administered by the oral route in animal studies is useful for local topical deliver of LFA-I antagonists in the treatment of inflammatory diseases of the gastrointestinal (GI) tract, including Crohn's disease and irritable bowel syndrome, or other GI disease mediated by LFA-I or other leucocyte integrins including VLA4 and Mac-1.
  • GI gastrointestinal
  • the disorder that is mediated by LFA-I is an eye disorder.
  • the inflammatory disorder that is mediated by LFA-I is dry eye.
  • the methods of the present invention are useful for treatment of dry eye syndrome.
  • This syndrome encompasses symptoms caused by: keratoconjunctivitis sicca, Sjorgen's syndrome, corneal injury, age-related dry eye, Stevens-Johnson syndrome, congenital alachrima, pharmacological side effects, infection, Riley-Day syndrome, conjunctival fibrosis, eye stress, glandular and tissue destruction, ocular cicatrical pemphogoid, blepharitis, autoimmune and other immunodeficient disorders, allergies, diabetes, lacrimal gland deficiency, lupus, Parkinson's disease, Sjogren's syndrome, rheumatoid arthritis, rosacea, environmental exposure to excessively dry air, airborne particulates, smoke, and smog and inability to blink, amongst others.
  • Another aspect of the present invention provides pharmaceutical compositions which comprise a LFA-I antagonist for administration in the methods of treatment of inflammatory disorders mediated by LFA-I.
  • the inflammatory disorder mediated by LFA-I is an eye disorder for which pharmaceutical compositions which comprise a LFA- 1 antagonist are provided.
  • the inflammatory disorder mediated by LFA-I is dry eye, for which pharmaceutical compositions which comprise a LFA-I antagonist have been provided. It is further provided that the compositions may further comprise another therapeutic agent to be co-administered either in the same formulation or separately.
  • the pharmaceutical compositions are administered orally, via injection, intranasally, via inhalation, rectally, topically, via instillation to the ocular surface, or transdermally.
  • the present invention provides formulations for the compositions which are adminstered in the methods of treatment of inflammatory disorders mediated by LFA-I.
  • gastro-retentive formulations of compositions are provided for administration to treat inflammatory disorders mediated by LFA-I.
  • gastro-retentive fo ⁇ nulations of compositions are provided for administration to treat eye disorders which are inflammatory disorders mediated by LFA-I .
  • ocular formulations of compositions are provided for administration to treat dry eye which is the inflammatory disorder mediated by LFA-I.
  • ocular formulations of compositions are provided for administration to treat inflammatory disorders mediated by LFA-I.
  • formulations of compositions are provided for administration to treat inflammatory disorders mediated by LFA-I, which are solutions, creams, powders, suspensions, mists, gels, solids, and the like. Controlled release formulations are also provided for in some embodiments of the invention.
  • the compounds of the invention are formulated as prodrugs.
  • compounds are provided for use in the methods of the invention.
  • Compounds that are useful in the methods of the invention include antibodies, fragments of antibodies, polypeptides, peptides, polymers, and organic small molecules.
  • Raptiva is used in an ocular formulation to treat dry eye.
  • One aspect of the invention combines a diagnostic with a method of treatment with an LFA-I antagonist.
  • a diagnostic test for Sjorgren's is performed.and after a diagnosis of the disease is made, the patient is administered an LFA-I antagonist as described herein.
  • a diagnostic test for dry eye is performed and after a diagnosis of dry eye is made, the patient is administered an LFA-I antagonist as described herein.
  • Tthe compounds provided herein are administered to increase tear or mucin production to a subject suffering from an inflammatory disorder mediated by LFA-I.
  • the inflammatory disorder treated is an eye disorder. Even more preferably, the inflammatory disorder is dry eye.
  • a method for identifying inhibitors of the LFA-I: ICAM-I interaction is provided.
  • the inhibitors are identified as being directly competitive with ICAM-I binding to LFA-I at the ⁇ L subunit of
  • the method utilizes cognitive binding experiments to identify antagonists of the LFA-I:
  • labeled probe molecules which are known to bind at metal ion dependent adhesion site of the LFA-1:ICAM-1 interaction on the ⁇ L subunit of LFA-I are employed.
  • a method of identifying useful pharmaceutical agents for human disease is described using the pattern of the inhibition of cell growth by siRNA (small interfering RNA sequences) directed against a cellular target involved in cell growth and human disease to identify compounds with a similar pattern of cell growth inhibition in a group of cultured cell lines.
  • the methods of this invention can also be used to identify useful inhibitors of LFA-I, the B-cell receptor BR3, Grb2 (a protein downstream of growth factor receptors in signaling cascades) and other protein targets inside and outside of cells.
  • the identification of compounds which fit an activity pattern opposite of the inhibition of cell growth by siRNA can be stimulants of cell growth useful in diseases and conditions of slow cell growth.
  • this method uses siRNA cellular activity data for target or selection of targets by searching public and/or proprietary databases of compound cellular activity for a pattern of similar cellular activity in response to a compound or collection of compounds as a method to identify compounds useful in the identification of a human pharmaceutical
  • Figure 1 depicts rolling, adhesion of leukocytes and transendothelial migration resulting from LFA-1:ICAM-1 interaction.
  • Figure 2 depicts antigen activation of the LFA-I: ICAM-I interaction.
  • Figure 3 depicts co-stimulatory function of the LFA-I .-ICAM-I interaction.
  • Figure 4 depicts small molecule antagonists useful in the methods of identification.
  • Figure 5 depicts Table 1 showing cation dependence of small molecule antagonists for LFA-I.
  • Figure 6 depicts SDS-PAGE analysis of compound 5 crosslinked LFA-I .
  • Figure 7 depicts binding of compound 2B and ICAM-I-Ig to 293 cells expressing wild type LFA-I or LFA-I lacking the I domain.
  • Figure 8 depicts antagonist competition by compounds 2A, 3, A-286982 and sICAM-1 in the LFA-l/ICAM-1 and
  • Figure 9 depicts correlation of IC50 values from antagonist competition in the LFA-l/ICAM-1 and LFA-1/small molecule ELISAs.
  • Figure 10 depicts effect of antagonists on ligand binding in the LFA-l/ICAM-1 and LFA-1/small molecule ELISAs.
  • Figure 11 depicts Schild regressions of sICAM-1 and compound 3 antagonism.
  • Figure 12 depicts flow diagram of the discovery of potent inhibitors of cell growth for the treatment of human cancer and inflammation.
  • a first aspect of the present invention is methods for the treatment of the inflammatory component of immune and other disorders.
  • the methods described herein are useful for the treatment of leukocyte mediated inflammation.
  • This component plays a role in initiating and advancing inflammation in selected diseases, such as psoriasis, eczema, asthma, dermatitis, rheumatoid arthritis, systemic lupus erythematosis (SLE), multiple sclerosis, responses associated with inflammatory bowel disease, Raynaud's syndrome, Sjorgen's disease, juvenile onset diabetes, diabetes mellitus, granulomatosis, CNS inflammatory disorder, multiple organ injury disease, all types of transplantations, including graft versus host or host versus graft disease, HIV and rhinovirus infections, and atherosclerosis amongst other diseases.
  • diseases such as psoriasis, eczema, asthma, dermatitis, rheumatoid arthritis, systemic lupus
  • a preferred embodiment of this invention is for the treatment of eye disorders.
  • the methods of the present invention are useful for treatment of dry eye syndrome.
  • This syndrome encompasses symptoms caused by: keratoconjunctivitis sicca, Sjorgen's syndrome, corneal injury, age-related dry eye, Stevens- Johnson syndrome, congenital alachrima, pharmacological side effects, infection, Riley-Day syndrome, conjunctival fibrosis, eye stress, glandular and tissue destruction, ocular cicatrical pemphogoid, blepharitis, autoimmune and other immunodeficient disorders, allergies, diabetes, lacrimal gland deficiency, lupus, Parkinson's disease, Sjogren's syndrome, rheumatoid arthritis, rosacea, environmental exposure to excessively dry air, airborne particulates, smoke, and smog and inability to blink, amongst others.
  • the methods of the present invention involve the inhibition of initiation and progression of inflammation related disease by inhibiting the interaction between LFA-I and ICAM-I.
  • LFA-I and ICAM-I are molecules with extracellular receptor domains which are involved in the process of lymphocyte/leukocyte migration and proliferation, leading to a cascade of inflammatory responses.
  • such methods provide anti-inflammatory effects in-vitro and in-vivo, e.g., as described in more detail below, and are useful in the treatment of inflammation mediated diseases, and in ' particular, dry eye disease.
  • Human blood contains white blood cells (leukocytes) which are further classified as neutrophils, lymphocytes (with B- and T- subtypes), monocytes, eosinophils, and basophils.
  • leukocytes white blood cells
  • lymphocytes with B- and T- subtypes
  • monocytes monocytes
  • eosinophils neutrophils
  • basophils basophils
  • lymphocytes Several of these classes of leukocytes, neutrophils, eosinophils, basophils and lymphocytes, are involved in inflammatory disorders.
  • LFA-I is one of a group of leucointegrins which are expressed on most leucocytes, and is considered to be the lymphoid integrin which interacts with a number of ICAMs as ligands. Disrupting these interactions, and thus the immune/inflammatory response provides for reduction of inflammation, in particular, inflammation of the eye.
  • ICAM- 1 (CD54) is a member of the ICAM family of adhesion receptors (ICAM- 1 , ICAM-2, ICAM-3 , ICAM-4) in the immunoglobulin protein super family, and is expressed on activated leucocytes, dermal fibroblasts, and endothelial cells.
  • ICAM- 1 adhesion receptors
  • ICAM-2 ICAM-2
  • ICAM-3 ICAM-4
  • ICAM-4 adhesion receptors
  • ICAM-I and LFA-I also referred to as 0 ⁇ 2 and CDl la/CD 18
  • LFA-I also referred to as 0 ⁇ 2 and CDl la/CD 18
  • FIG 1 For example, it is presently believed that prior to leukocyte transendothelial migration, a component of the inflammatory response, the presence of cytokines/chemokines activate integrins constir ⁇ tively expressed on leukocytes. Blood vessel endothelial cells also upregulate ICAM-I in response to the presence of the same cytokines/chemokines.
  • LFA-I plays a role in creating and maintaining the immunological synapse, which may be defined as the physical structure of the interacting surfaces of T cells and Antigen Presenting Cells (APCs), as shown in Figure 2.
  • APCs Antigen Presenting Cells
  • LFA-I stabilizes T-cell engagement with the APC, and thus leads to activation of T cells.
  • the interaction of LFA-I and ICAM-I also appears to provide co-stimulatory signals to resting T cells, as shown in Figure 3.
  • CD4+ T-cell proliferation and cytokine synthesis are mediated by this interaction as part of the inflammatory response.
  • ICAM-I and LFA-I Given the role that the interaction of ICAM-I and LFA-I plays in immune/inflammatory response, it is desirable to modulate these interactions to achieve a desired therapeutic result (e. g., inhibition of the interaction in the event of an overactive inflammatory response). Also, since LFA-I has several ligand partners within the ICAM family (ICAM-I, ICAM-2 and ICAM-3), involving a number of signaling pathways, in some embodiments of the invention, it is desirable to modulate these interactions selectively. It has been demonstrated that the antagonism of the interaction between ICAMs and leukointegrins can be realized by agents directed against either component.
  • the methods and compositions described herein can modulate one or more components of the pathways described herein.
  • the methods and compositions of the present invention may also intervene in either earlier or later portions of the inflammatory process as well.
  • upregulation of ICAM-I or LFA-I (activation) on endothelial cells or leukocytes, prior to tethering and transendothelial migration may be modulated by the methods and compositions described herein.
  • the present invention may be useful in modulating the expression of cytokines or chemokines that activate ICAM-I and LFA-I in the course of leukocyte trafficking, in modulating the transport of the cytokines or chemokines, in preventing transvasation of the arrested leukocyte, in modulating signalling via other mechanisms that are involved in leukocyte proliferation at the site of injury or inflammation, and the like.
  • Methods of Treatment are useful in modulating the expression of cytokines or chemokines that activate ICAM-I and LFA-I in the course of leukocyte trafficking, in modulating the transport of the cytokines or chemokines, in preventing transvasation of the arrested leukocyte, in modulating signalling via other mechanisms that are involved in leukocyte proliferation at the site of injury or inflammation, and the like.
  • subject includes animals, in particular humans as well as other mammals.
  • the methods generally involve the administration of one or more drugs for the treatment of one or more diseases.
  • Combinations of agents can be used to treat one disease or multiple diseases or to modulate the side-effects of one or more agents in the combination.
  • the compounds described herein can be used in combination with other dry eye treatment agents. Also, the compounds of the invention can be used with drugs that cause dry eye as a side effect.
  • treating includes achieving a therapeutic benefit and/or a prophylactic benefit.
  • therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated.
  • compositions may be administered to a subject at risk of developing a particular ' disease, or to a subject reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.
  • the compositions may be administered to a subject to prevent progression of physiological symptoms or of the underlying disorder.
  • the therapeutic agent is present in an amount sufficient to exert a therapeutic effect by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate the disease or at least one of its underlying symptoms.
  • the therapeutic effect is an effect on inflammation.
  • the therapeutic agent is present in an amount sufficient to exert a therapeutic effect to reduce symptoms of dry eye by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate symptoms of dry eye.
  • an effective amount of the therapeutic agent is a daily dose of about Ix 10 " ", Ix 10 "10 , Ix 10 '
  • Administration of the therapeutic agent may be by any suitable means.
  • the therapeutic agent is administered by oral administration.
  • the therapeutic agent is administered by transdermal administration.
  • the therapeutic agent is administered by injection.
  • the therapeutic agent is administered topically. If combinations of agents are administered as separate compositions, they may be administered by the same route or by different routes. If combinations of agents are administered in a single composition, they may be administered by any suitable route. In some embodiments, combinations of agents are administered as a single composition by oral administration. In some embodiments, combinations of agents are administered as a single composition by transdermal administration. In some embodiments, the combinations of agent are administered as a single composition by injection.
  • the combinations of agent are administered as a single composition topically.
  • the method of the invention described herein is a method of administering an antagonist of LFA- 1 to a subj ect to treat dry eye.
  • the LFA-I antagonist can modulate inflammation mediated by leukocytes.
  • a preferred embodiment of the invention treats a subject by administering an antagonist of LFA-I to modulate inflammation associated with ocular inflammation.
  • Another preferred embodiment of the method is to treat a subject with inflammation associated with dry eye syndrome by administering an antagonist of LFA-I.
  • An embodiment of the invention treats a subject with symptoms of dry eye due to allergies.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to diabetes.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to lacrimal gland deficiency.
  • An embodiment of the invention treats a , subject with symptoms of dry eye disorder due to lupus.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to Parkinson's disease.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to Sjogren's disease.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to rheumatoid arthritis.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to rosacea.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to complications arising from LASIK therapy for vision correction.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to use of contact lenses.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to exposure to arid climates.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to exposure to air pollution.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to windy climates.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to exposure due to cigarette smoke.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to keratoconjunctivitis sicca.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to corneal injury.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to conjunctival fibrosis.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to age- related dry eye.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to Stevens- Johnson syndrome.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to congenital alachrima.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to pharmacological side effects of other drugs being taken by the patient.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to infection.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to Riley-Day syndrome.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to eye stress, including that due to computer use.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to glandular and tissue destruction.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to ocular cicatrical pemphogoid.
  • An embodiment of the' invention treats a subj ect with symptoms of dry eye disorder due to blepharitis.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to automimmune and other immunodeficient disorders.
  • An embodiment of the invention treats a subject with symptoms of dry eye disorder due to an inability to blink.
  • An embodiment of the invention treats a subject with symptoms of psoriasis with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of eczema with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of lupus with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of Reynaud's syndrome with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subj ect with symptoms of granulomatosis with a LFA- 1 antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of CNS inflammatory disorder with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of multiple organ disease with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of allergic rhinitis with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of granulomatosis with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of atherosclerosis with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of graft versus host disease with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of host versus graft disease with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of inflammatory response associated with transplantation with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of inflammatory bowel disease with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of juvenile onset diabetes with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of diabetes mellitus with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of multiple sclerosis with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of asthma with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of dermatitis with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of systemic lupus erythematosis with a LFA-I antagonist of the method.
  • An embodiment of the invention treats a subject with symptoms of HIV and rhinovirus infections with a LFA-I antagonist of the method.
  • diagnostic procedures will be employed to identify a subject in need of treatment by the method of the invention.
  • Fluorescein staining of the cornea is used to diagnose symptoms of dry eye disorder.
  • Rose Bengal staining of the cornea is used to diagnose symptoms of dry eye disorder.
  • Corneal sensitivity is used to diagnose symptoms of dry eye disorder.
  • Tear breakup time (BUT) is used to diagnose symptoms of dry eye disorder.
  • Schirmer test with anesthesia is used to diagnose symptoms of dry eye disorder.
  • Schirmer test analyis is used to diagnose symptoms of dry eye disorder.
  • Impression cytology is used to diagnose symptoms of dry eye disorder.
  • Subjective dry eye symptoms are used to diagnose symptoms of dry eye disorder.
  • Tear flow analysis is used to diagnose symptoms of dry eye disorder.
  • Immunohistochemical methods including but not limited to human leukocyte antigen II (HLA-DR), are used to diagnose symptoms of dry eye disorder.
  • Antinuclear antibody test (ANA) or fluorescent antinuclear antibody test (FANA) is used to diagnose symptoms of dry eye disorder.
  • Ocular evaporation is used to diagnose symptoms of dry eye disorder.
  • Infrared meibography is used to diagnose symptoms of dry eye disorder.
  • Tandem scanning confocal microscopy (TSCM) is used to diagnose symptoms of dry eye disorder. This is an examplary list of procedures that may be used to diagnose symptoms of dry eye and is in no way limiting.
  • the antagonist of the method of the invention may be an antibody, fragment of an antibody, peptide or small molecule.
  • the LFA-I antagonist used is a peptide which is not an anitbody.
  • the antagonist of the method is a therapeutic agent.
  • a further preferred embodiment is a method of treating dry eye disease using therapeutic agents which are suitable for formulation and administration as ocular therapeutics.
  • Another aspect of the present invention is described herein and below, a method of comparison of the binding of ICAM-I and antagonists which can be utilized to identify antibodies, antibody fragments, peptides, and small molecules as antagonists of the LFA-I : ICAM-I interaction. See Gadek et al. 2002. The method is described in terms of identifying small molecule antagonists. However, it should not be interpreted as limiting the method in any manner to exclude its use in identifying larger molecule types of inhibitors of LFA-I, such as antibodies, fragments of antibodies or peptides.
  • This method comprises choosing one or more of the following steps as part of the process of identifying an antagonist as a directly competitive inhibitor of LFA-I: (a) competition experiments utilizing full length wild type LFA-I comparing the binding of potential antagonistic agents to that of sICAM-1 (the extracellular domains of LFA-I 's native ligand and a competitive LFA-l/ICAM-1 inhibitor) and A-286982 (an allosteric LFA-l/ICAM-1 inhibitor known to bind to the I (inserted) domain allosteric site (IDAS)).
  • sICAM-1 the extracellular domains of LFA-I 's native ligand and a competitive LFA-l/ICAM-1 inhibitor
  • A-286982 an allosteric LFA-l/ICAM-1 inhibitor known to bind to the I (inserted) domain allosteric site (IDAS)
  • the ICAM-I binding site targeted herein has previously been localized to include the metal ion dependent adhesion site (MIDAS) motif within the I domain of the LFA-I ⁇ s ⁇ bunit.
  • MIDAS metal ion dependent adhesion site
  • CAM-I Blocking of the CAMs, such as for example ICAM-I, or the leukointegrins, such as for example, LFA-I, by antibodies directed against either or both of these molecules can inhibit inflammatory response.
  • Previous studies have investigated the effects of anti-CD 11a M Abs on many T-cell-dependent immune functions in vitro and a number of immune responses in vivo.
  • anti-CD 1 Ia MAbs inhibit T-cell activation (See Kuypers T.W., Roos D. 1989 "Leukocyte membrane adhesion proteins LFA-I, CR3 and pl50,95: a review of functional and regulatory aspects" Res.
  • Peptides have been investigated for use in reducing the interaction of LFA-I with ICAM-I .
  • Polypeptides that do not contain an Fc region of an IgG are described in U. S. Patent No. 5,747,035, which can be used to treat LFA-I mediated disorders, in particular dry eye.
  • Use of dual peptides, the first a modulator of ICAM-I and the second a blocking peptide with a sequence obtained from LFA-I is described in U.S. Patent No. 5,843,885 to reduce the interactions between LFA-I and ICAM-I.
  • Cyclic peptides have been described in U.S. Patent No. 6,630,447 as inhibitors of the LFA-I: ICAM-I interaction.
  • Small molecule antagonists include statins whichbind to the CDl Ia domain of LFA-I. See Kallen, J., Welzenbach,
  • a family of hydantoin-based inhibitors can also be used as antagonists. See Kelly, T. A., Jeanfavre, D. D., McNeil,
  • a family of novel p-arylthio cinnamides can act as antagonists of LFA-I. See Liu, G.; Link, J.T.; Pei, Z.; Reilly,
  • the compounds described herein are used in combination with restasis (Cyclosporine A).
  • the compounds of the invention can also be used to increase mucin production and/or tear production.
  • the compounds of the present invention can offer additional relief beyond decreasing inflammation and by also increasing the mucin production that makes up a portion of tear film.
  • LFA-I and ICAMs are known to be involved in various autoimmune and inflammatory diseases, particularly those with involvement of lymphocytic (T-or B-cell), dendritic, monocytic cells expressing LFA-I on their surface as part of the inflammatory component of disease.
  • LFA-I antagonists can be particularly useful in treatment of these diseases because the therapeutic target's expression in diseased tissue is limited to infiltrating cells of the immune system.
  • LFA-I can block the adhesion, migration, proliferation, and release of inflammatory signals to surrounding tissue by immune system cells.
  • the anti- LFA-I antibody, Raptiva which has an effect on inflammatory cells in diseased tissue may be used to treat dry eye.
  • a lozenge incorporating the compounds of the invention in a solid or waxy material may stimulate salivary secretion while releasing the compound of the invention under sustained release.
  • a LFA-I antagonist may be delivered locally to the nose, nasal passages, and/or nasal cavity to reduce the inflammation associated immune and/or allergic responses.
  • a local administration of the compounds of the invention, delivered via the mouth or nose as a misted solution or dispersed powder may be useful in the treatment of Asthma or other LFA-I mediated pulmonary inflammatory dieseases.
  • a cream formulation of the compounds of the invention could be useful in the local delivery of a LFA-I antagonist to the skin in dermatologic diseases mediated by LFA-I such as eczema and psoriasis.
  • LFA-I antagonists and their pro-drugs which are transformed into the active drug in inflamed skin.
  • a skin cream applied to the outer surfaceof the eyelids thus delivering a LFA-I antagonist across the eyelid to the inner lining of the eyelid and the intervening conjunctival tissue and accessory lacrimal glands may be desirable in treating LFA-I mediated inflammation of the eyelid and eye, particularly in the treatment of dry eye.
  • An oral formulation of a LFA-I antagonist which is known to be poorly absorbed at the systemic level by the oral route in animal studies may be useful for local topical deliver of LFA- 1 antagonists in the treatment of inflammatory diseases of the gastrointestinal (GI) tract, including Crohn's disease and Irritable Bowel Syndrome, or other GI disease mediated by LFA-I or other leucocyte integrins including VLA4 and Mac-1.
  • GI gastrointestinal
  • aliphatic includes both saturated and unsaturated, straight chain (unbranched) or branched aliphatic hydrocarbons, which are optionally substituted with one or moi ⁇ functional groups.
  • aliphatic is intended herein to include, but is not limited to, alkyl, alkenyl, alkynyl moieties.
  • alkyl includes straight and branched alkyl groups.
  • alkyl encompass both substituted and unsubstituted groups.
  • lower alkyl is used to indicate those alkyl groups (substituted, unsubstituted, branched or unbranched) having about 1-6 carbon atoms.
  • the alkyl, alkenyl and alkynyl groups employed in the invention contain about 1-20 aliphatic carbon atoms. In certain other embodiments, the alkyl, alkenyl, and alkynyl groups employed in the invention contain about 1-10 aliphatic carbon atoms. In yet other embodiments, the alkyl, alkenyl, and alkynyl groups employed in the invention contain about 1-8 aliphatic carbon atoms. In still other embodiments, the alkyl, alkenyl, and alkynyl groups employed in the invention contain about 1-6 aliphatic carbon atoms.
  • the alkyl, alkenyl, and alkynyl groups employed in the invention contain about 1-4 carbon atoms.
  • Illustrative aliphatic groups thus include, but are not limited to, for example, methyl, ethyl, n-propyl, isopropyl, allyl, n-butyl, sec- butyl, isobutyl, tert-butyl, n-pentyl, sec-pentyl, isopentyl, tert-pentyl, n-hexyl, sec- hexyl, moieties and the like, which again, may bear one or more substituents.
  • Alkenyl groups include, but are not limited to, for example, ethenyl, propenyl, butenyl, and the like.
  • Representative alkynyl groups include, but are not limited to, ethynyl, 2-propynyl and the like.
  • lower alkylene refers to a hydrocarbon chain which links together two other groups, i.e. is bonded to another group at either end, for example methylene, ethylene, butylene and the like.
  • a substituent is preferably from 1 to 10 carbons and more preferably from 1 to 5 carbons.
  • groups may be substituted, preferably with an amino, acetylamino (a lower alkylcarbonyl group bonded via a nitrogen atom), or cyclo lower alkyl group.
  • a saturated hydrocarbon ring preferably with a total of 3 to 10 methylenes (inclusive of the attachment carbons), more preferably 3 to 6.
  • alicyclic refers to compounds which combine the properties of aliphatic and cyclic compounds and include but are not limited to monocyclic, or polycyclic aliphatic hydrocarbons and bridged cycloalkyl compounds, which are optionally substituted with, one or more functional groups.
  • alicyclic is intended herein to include, but is not limited to, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties, which are optionally substituted with one or more functional groups.
  • Illustrative alicyclic groups thus include, but are not limited to, for example, cyclopropyl,-CH 2 -cyclopropyl, cyclobutyl, -CH ⁇ -cyclobutyl, cyclopentyl,-CH 2 - cyclopentyl, cyclohexyl,-CH 2 -cyclohexyl, cyclohexenylethyl, cyclohexanylethyl, norbornyl moieties and the like, which again, may bear one or more substituents.
  • alkoxy refers to a saturated or unsaturated parent molecular moiety through an oxygen atom.
  • the alkyl group contains about 1-20 aliphatic carbon atoms. In certain other embodiments, the alkyl group contains about 1-10 aliphatic carbon atoms. In yet other embodiments, the alkyl group employed in the invention contains about 1-8 aliphatic carbon atoms. In still other embodiments, the alkyl group contains about 1-6 aliphatic carbon atoms. In yet other embodiments, the alkyl group contains about 1-4 aliphatic carbon atoms.
  • alkoxy examples include but are not limited to, methoxy, ethoxy, isopropoxy, n-butoxy, i-butoxy, sec-butoxy, tert-butoxy, neopentoxy, n- hexloxy and the like.
  • lower alkoxy refers to a lower alkyl as defined above which may be branched or unbranched as also defined above and which is bonded by an oxygen to another group (i.e. alkyl ethers).
  • thioaUcyl refers to a saturated or unsaturated (i.
  • the alkyl group contains about 1-20 aliphatic carbon atoms. In certain other embodiments, the alkyl group contains about 1-10 aliphatic carbon atoms. In yet other embodiments, the alkyl group employed in the invention contains about 1-8 aliphatic carbon atoms. In still other embodiments, the alkyl group contains about 1-6 aliphatic carbon atoms. In yet other embodiments, the alkyl group contains about 1-4 aliphatic carbon atoms. Examples of thioalkyl include, but are not limited to, methylthio, ethylthio, propylthio, isopropylthio, n-butylthio, and the like.
  • lower alkylthio refers to a lower alkyl group bonded through a divalent sulfur atom, for example, a methylmercapto or an isopropylmercapto group.
  • lower alkylenethio is meant such a group which is bonded at each end.
  • alkylamino refers to a group having the structure- NHR' wherein R' is alkyl, as defined herein.
  • aminoalkyl refers to a group having the structure NH 2 R'-, wherein as defined herein.
  • the alkyl group contains about 1-20 aliphatic carbon atoms.
  • the alkyl group contains about 1-10 aliphatic carbon atoms.
  • the alkyl group employed in the invention contains about aliphatic carbon atoms.
  • the alkyl group contains about 1-6 aliphatic carbon atoms.
  • the alkyl group contains about 1-4 aliphatic carbon atoms.
  • alkylamino include, but are not limited to, methylamin ⁇ , and the like.
  • substituents of the above-described aliphatic (and other) moieties of compounds of the invention include, but are not limited to aliphatic; alicyclic; heteroaliphatic; heterocyclic; aromatic; heteroaromatic; aryl ; heteroaryl; alkylaryl; heteroalkylaryl ; alkylheteroaryl; heteroalkylheteroaryl; alkoxy ; aryloxy; heteroalkoxy ; heteroaryloxy; alkylthio; arylthio; heteroalkylthio ; R x independently includes, but is not limited to, aliphatic, alicyclic, heteroaliphatic, heterocyclic, aryl, heteroaryl, alkylaryl, alkylheteroaryl, heteroalkylaryl or heteroalkylheteroaryl, wherein any of the aliphatic, alicyclic, heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl substituent
  • aromatic moiety refers to a stable mono-or polycyclic, unsaturated moiety having preferably 3-14 carbon atoms, each of which may be substituted or unsubstituted.
  • aromatic moiety refers to a planar ring having p-orbitals perpendicular to the plane of the ring at each ring atom and satisfying the Huckel rule where the number of pi electrons in the ring is (4n+2) wherein n is an integer.
  • a mono-or polycyclic, unsaturated moiety that does not satisfy one or all of these criteria for aromaticity is defined herein as "non- aromatic", and is encompassed by the term “alicyclic”.
  • heteromatic moiety refers to a stable mono-or polycyclic, unsaturated moiety having preferably 3-14 carbon atoms, each of which may be substituted or unsubstituted; and comprising at least one heteroatom selected from O, S, and N within the ring in place of a ring carbon atom).
  • heteromatic moiety refers to a planar ring comprising at least one heteroatom, having p-orbitals perpendicular to the plane of the ring at each ring atom, and satisfying the Huckel rule where the number of pi electrons in the ring is (4n+2) wherein n is an integer.
  • aromatic and heteroaromatic moieties may be attached via an alkyl or heteroalkyl moiety and thus also include- (alkyl) aromatic,- (heteroalkyl) aromatic,- (heteroalkyl) heteroaromatic, and - (heteroalkyl) heteroaromatic moieties.
  • aromatic or heteroaromatic moieties and "aromatic, (heteroalkyl) aromatic,- (heteroalkyl) heteroaromatic, and (heteroalkyl) heteroaromatic" are interchangeable.
  • Substituents include, but are not limited to, any of the previously mentioned substituents, e. , the substituents recited for aliphatic moieties, or for other moieties as disclosed herein, resulting in the formation of a stable compound.
  • aryl does not differ significantly from the common meaning of the term in the art, and refers to an unsaturated cyclic moiety comprising at least one aromatic ring.
  • aryl refers to a mono- or bicyclic carbocyclic ring system having one or two aromatic rings including, but not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl and the like.
  • heteroaryl does not differ significantly from the common meaning of the term in the art, and refers to a cyclic aromatic radical having from five to ten ring atoms of which one ring atom is selected from S, and N; zero, one or two ring atoms are additional heteroatoms independently selected from S, and N; and the remaining ring atoms are carbon, the radical being joined to the rest of the molecule via any of the ring atoms, such as, for example, pyridyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, and the like.
  • aryl and heteroaryl groups can be unsubstituted or substituted, wherein substitution includes replacement of one or more of the hydrogen atoms thereon independently with any one or more of the following moieties including, but not limited to: aliphatic; alicyclic ; heteroaliphatic; heterocyclic; aromatic; heteroaromatic; aryl; heteroaryl; alkylaryl; heteroalkylaryl; alkylheteroaryl; heteroalkylheteroaryl; alkoxy; aryloxy ; heteroalkoxy; heteroaryloxy; alkylthio; arylthio; heteroalkylthio; heteroarylthio; F; Cl ; Br; I; -OH; -NO 2 ; -CN; -CF 3 ; - CH 2 CF 3 ; -CHCl 2 ; -CH 2 OH; -CH 2 CH 2 OH; -CH 2 NH 2
  • aryl, heteroaryl,- (alkyl) aryl or- (alkyl) heteroaryl substituents described above and herein may be substituted or unsubstituted. Additionally, it will be appreciated, that any two adjacent groups taken together may represent a 4, 5, 6, or 7-membered substituted or unsubstituted alicyclic-or heterocyclic moiety. Additional examples of generally applicable substituents are illustrated by the specific embodiments shown in the Examples that are described herein.
  • cycloalkyl refers specifically to groups having three to seven, preferably three to ten carbon atoms. Suitable cycloalkyls include, but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and the like, which, as in the case of aliphatic, alicyclic, heteroaliphatic or heterocyclic moieties, may optionally be substituted with substituents including, but not limited to aliphatic; alicyclic; heteroaliphatic; heterocyclic; aromatic ; heteroaromatic; aryl; heteroaryl; alkylaryl; heteroalkylaryl; alkylheteroaryl ; heteroalkylheteroaryl; alkoxy; aryloxy ; heteroalkoxy; heteroaryloxy ; alkylthio; heteroarylthio; F; Cl ; Br; I; -OH; -NO
  • heteroaliphatic refers to aliphatic moieties in which one or more carbon atoms in the main chain have been substituted with a heteroatom.
  • a heteroaliphatic group refers to an aliphatic chain which contains one or more oxygen, sulfur, nitrogen, phosphorus or silicon atoms, e. place of carbon atoms.
  • Heteroaliphatic moieties may be linear or branched, and saturated or unsaturated.
  • heterocycloalkyl refers to compounds which combine the properties of heteroaliphatic and cyclic compounds and include, but are not limited to, saturated and unsaturated mono-or polycyclic cyclic ring systems having 5-16 atoms wherein at least one ring atom is a heteroatom selected from S and N (wherein the nitrogen and sulfur heteroatoms may be optionally be oxidized), wherein the ring systems are optionally substituted with one or more functional groups, as defined herein.
  • heterocycloalkyl refers to a non-aromatic 5-, 6-or 7-membered ring or a polycyclic group wherein at least one ring atom heteroatom selected from S and N (wherein the nitrogen and sulfur heteroatoms may be optionally be oxidized), including, but not limited to, a bi-or tri-cyclic group, comprising fused six-membered rings having between one and three heteroatoms independently selected from oxygen, sulfur and nitrogen, wherein (i) each 5-membered ring has 0 to 2 double bonds, each 6-membered ring has 0 to 2 double bonds and each 7-membered ring has 0 to 3 double bonds, (ii) the nitrogen and sulfur heteroatoms may be optionally be oxidized, (iii) the nitrogen heteroatom may optionally be quaternized, and (iv) any of the above heterocyclic rings may be fused to an aryl or heteroaryl
  • heterocycles include, but are not limited to, heterocycles such as furanyl, pyranyl, pyrrolyl, thienyl, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolyl, oxazolidinyl, isooxazolyl, isoxazolidinyl, dioxazolyl, thiadiazolyl, oxadiazolyl, tetrazolyl, triazolyl, tliiatriazolyl, thiadiazolyl, oxadiazolyl, morpholinyl, thiazolyl, thiazolidinyl, isothiazolyl, isothiazolidinyl, dithiazolyl, dithiazolidinyl, tetrahydrofuryl, and benzofused derivatives thereof.
  • a "substituted heterocycle, or heterocycloalkyl or heterocyclic "group refers to a heterocycle, or heterocycloalkyl or heterocyclic group, as defined above, substituted by the independent replacement of one, two or three of the hydrogen atoms thereon with but are not limited to aliphatic; alicyclic ; heteroaliphatic; heterocyclic; aromatic; heteroaromatic; aryl; heteroaryl; alkylaryl ; heteroalkylaryl; alkylheteroaryl ; heteroalkylheteroaryl; alkoxy; aryloxy; heteroalkoxy; heteroaryloxy; alkylthio; arylthio ; heteroalkylthio; heteroarylthio; F; Cl ; Br; I; -OH; -NO 2 ; -CN; -CF 3 ; - CH 2 CF 3 ; -CHCl 2 ; -CH 2 OH; -
  • halo and halogen used herein refer to an atom selected from fluorine, chlorine, bromine and iodine.
  • haloalkyl denotes an alkyl group, as defined above, having one, two, or three halogen atoms attached thereto and is exemplified by such groups as chloromethyl, bromoethyl, trifluoromethyl, and the like.
  • amino refers to a primary (-NH 2 ), secondary (-NHR x ), tertiary (-NR x R y ), or quaternary amine (-N + R x R y R 2 ), where R y and R z are independently an aliphatic, alicyclic, heteroaliphatic, heterocyclic, aromatic or heteroaromatic moiety, as defined herein.
  • amino groups include, but are not limited to, methylamino, dimethylamino, ethylamino, diethylamino, diethylaminocarbonyl, iso-propylamino, piperidino, trimethylamino, and propylamino.
  • sulfonamido refers to a group of the general formula -SO2NRxRy where Rx and Ry are independently hydrogen, or an aliphatic, alicyclic, heteroaliphatic, heterocyclic, aromatic, heteroaromatic or acyl moiety, as defined herein.
  • benzamido refers to a group of the general formula PhNRx, where Rx is hydrogen, or an aliphatic, alicyclic, heteroaliphatic, heterocyclic, aromatic, heteroaromatic or acyl moiety, as defined herein.
  • C 1-6 alkylidene refers to a substituted or unsubstituted, linear or branched saturated divalent radical consisting solely of carbon and hydrogen atoms, having from one to six carbon atoms, having a free valence
  • C 2-6 alkylidene refers to a substituted or unsubstituted, linear or branched unsaturated divalent radical consisting solely of carbon and hydrogen atoms, having from two to six carbon atoms, having a free valence
  • heteroalkynyl encompass substituted and unsubstituted, saturated and unsaturated, and linear and branched groups.
  • alicyclic “heterocyclic”
  • heterocycloalkyl “heterocycle” and the like, encompass substituted and unsubstituted, and saturated and unsaturated groups.
  • cycloalkyl cycloalkenyl
  • cycloalkynyl cycloalkynyl
  • heterocycloalkyl "heterocycloalkenyr i ,”heterocycloalkynyl'','arornatic",''heteroaromatic”,"aryr', “heteroaryl” and the like encompass both substituted and unsubstituted groups.
  • natural amino acid refers to any one of the common, naturally occurring L-amino acids found in naturally occurring proteins : glycine (GIy), alanine (Ala), valine (VaI), leucine (Leu), isoleucine (He), lysine (Lys), arginine (Arg), histidine (His), proline (Pro), serine (Ser), threonine (Thr), phenylalanine (Phe), tyrosine (Tyr), tryptophan
  • side chain R is other than the amino acid side chains occurring in nature.
  • amino acid encompasses natural amino acids and unnatural amino acids.
  • bioisosteres generally refers to two or more compounds or moieties that possess similar molecular shapes and/or volumes. In certain embodiments, bioisosteres have approximately the same distribution of electrons. In certain other embodiments, bioisosteres exhibit similar biological properties. In preferred embodiments, bioisosteres possess similar molecular shapes and volumes; have approximately the same distribution of electrons; and exhibit similar biological properties.
  • pharmaceutically acceptable derivative denotes any pharmaceutically acceptable salt, ester, or salt of such ester, of such compound, or any other adduct or derivative which, upon administration to a patient, is capable of providing (directly or indirectly) a compound as otherwise described herein, or a metabolite or residue thereof.
  • Pharmaceutically acceptable derivatives thus include among others pro-drugs.
  • a pro-drug is a derivative of a compound, usually with significantly reduced pharmacological activity, which contains an additional moiety, which is susceptible to removal in vivo yielding the parent molecule as the pharmacologically active species.
  • pro-drug is an ester, which is cleaved in vivo to yield a compound of interest.
  • Pro-drugs of a variety of compounds, and materials and methods for derivatizing the parent compounds to create the pro-drugs, are known and may be adapted to the present invention. Certain exemplary pharmaceutical compositions and pharmaceutically acceptable derivatives will be discussed in more detail herein below.
  • the term pharmaceutically acceptable salt refers to those salts which are suitable for pharmaceutical use , preferably for use in the tissues of humans and lower animals without undue irritation, allergic response and the like.
  • Pharmaceutically acceptable salts of amines, carboxylic acids, and other types of compounds are well known in the art. For example, S. M. Berge, et ⁇ /.,describe pharmaceutically acceptable salts in detail in J Pharmaceutical Sciences, 66: 1-19 (1977), incorporated herein by reference.
  • the salts can be prepared in situ during the final isolation and purification of the compounds of the invention, or separately by reacting a free base or free acid function with a suitable reagent, as described generally below.
  • a free base function can be reacted with a suitable acid.
  • suitable pharmaceutically acceptable salts thereof may, include metal salts such as alkali metal salts, e. g. sodium or potassium salts; and alkaline earth metal salts, e. g. calcium or magnesium salts.
  • Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid
  • organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • salts include adipate, alginate, ascorbate, aspartate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hernisulfate, heptanoate, hexanoate, hydroiodide, 2- hydroxy-ethanesulfonate, lactobionate, lactate, laurate, Iauryl sulfate, malate, maleate, malonate, methanesulfonate, nicotinate, nitrate, oleate, oxalate, pahnitate, pectinate, persulfate, 3- ⁇ henylpropionate, phosphate, picjate, pivalate, propionate, stea
  • alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
  • Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, sulfonate and aryl sulfonate.
  • ester refers to esters that hydrolyze in vivo and include those that break down readily in the human body to leave the parent compound or a salt thereof.
  • Suitable ester groups include, for example, those derived from pharmaceutically acceptable aliphatic alcohol compounds, particularly alkanes, alkenes, ehtylene glycol, cycloalkanes, and the like in which each alkyl or alkenyl moiety advantageously has not more than 6 carbon atoms. These are exemplary only and in no way limit the possibilities of esters known in the art.
  • the term "pharmaceutically acceptable prodrugs” refers to those prodrugs of the compounds of the present invention which are suitable for pharmaceutical use, preferably for use with the tissues of humans and lower animals with undue toxicity, irritation, allergic response, and the like, and effective for their intended use, as well as the zwitterionic forms, where possible, of the compounds of the invention.
  • the terra "prodrug” refers to compounds that are rapidly transformed in vivo to yield the parent compound of the above formula, for example by hydrolysis in blood. A thorough discussion is provided in T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems, Vol. 14 of the A. C. S. Symposium Series, and in Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987, both of which are incorporated herein by reference.
  • compounds useful in the methods of the present invention include compounds of Formula I:
  • R 1E is hydrogen, an aliphatic, alicyclic, heteroaliphatic, heterocyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl moiety, -
  • R 3A is independently hydrogen, a protecting group, an aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl, alkylheteroaryl, heteroalkylaryl, heteroalkylheteroaryl moiety, or a pharmaceutically acceptable salt or ester, or R 3A , taken together with R 1 and R 2 , forms a heterocyclic moiety; wherein X 0 is a halogen selected from F, Br or I;
  • R 4 for each occurrence is independently hydrogen, halogen, -CN, -NO 2 , an aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl moiety, or is GR G! wherein G is -O-, -S-, NR G2 -, -CO-, -SO-, -
  • R G1 and R 02 are independently hydrogen, an aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl moiety; n is an integer from 0-4;
  • AR 1 is a monocyclic or polycyclic aryl, heteroaryl, alkylaryl, alkylheteroaryl, alicyclic or heterocyclic moiety;
  • SO 2 NR 132 -, and R G1 and R 02 are independently hydrogen, an aliphatic, alicyclic, heteroaliphatic,. heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl moiety, or any two adjacent occurrences of taken together, represent an alicyclic, heteroalicyclic, aryl, or heteroaryl moiety;
  • R is one of the following groups:
  • R is one of the following groups:
  • Formula II and R 29 is hydrogen, a pharmaceutically acceptable salt or ester.
  • Some preferred embodiments of the invention are compounds of the Formula II'
  • Some particularly preferred embodiments of compounds of the method of the present invention are compounds of Formulas IIA, HB and HC:
  • Formula HA where R 17 respectively can be each be chosen from the group of hydrogen, pharmaceutically acceptable salts and esters.
  • R 17 respectively can be each be chosen from the group of hydrogen, pharmaceutically acceptable salts and esters.
  • Cy is a 3-5 member ring.
  • Cy is a 5-member non-aromatic heterocycle optionally substituted with hydroxyl, oxo, thio, Cl, Ci -4 alkyl (preferably methyl), or C 1-4 alkanoyl (preferably acetyl, propanoyl or butanoyl).
  • the non- aromatic heterocycle comprises one or heteroatoms (N, O or S) and is optionally substituted with hydroxyl, oxo, mercapto, thio, methyl, acetyl, propanoyl or butyl.
  • the non-aromatic heterocycle comprises at least one nitrogen atom tnat is optionally substituted witii methyl or acetyl.
  • the non-aromatic heterocycle is selected from the group consisting of piperidine, piperazine, morpholine, tetrahydrofuran, tetrahydrothiophene, oxazolidine, thiazolidine optionally substituted with hydroxy, oxo, mercapto, thio, alkyl or alkanoyl.
  • Cy is a non-aromatic heterocycle selected from the group consisting of tetrahydrofuran-2-yl, thiazolidin-5-yl, thiazolidin-2-one-5-yl, and thiazolidin-2-thione-5-yl and cyclopropapyrrolidine.
  • Cy is a 5-member aromatic carbocycle or heterocycle optionally substituted with hydroxyl, oxo, thio, Cl, C 1 . 4 alkyl (preferably methyl), or Ci ⁇ alkanoyl (preferably acetyl, propanoyl or butanoyl).
  • the aromatic or heterocycle comprises one or heteroatoms (N, O or S) and is optionally substituted with hydroxyl, oxo, mercapto, thio, methyl, acetyl, propanoyl or butyl.
  • Cy is a 3-6 member carbocycle optionally substituted with hydroxyl, mercapto, halogen, oxo, thio, amino, amidine, guanidine, alkyl, alkoxy or acyl.
  • the carbocycle is saturated or partially unsaturated.
  • Cy is a carbocycle selected from the group consisting of cyclopropyl, cyclopropenyl, cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl and cyclohexenyl.
  • X 2 is a C 1-5 divalent hydrocarbon linker optionally having one or more carbon atoms replaced with N, O, S, SO or SO 2 and optionally being substituted with hydroxyl, mercapto, halogen, amino, aminoalkyl, nitro, oxo or thio. In a preferred embodiment X 2 will have at least one carbon atom.
  • Other moieties include sulfonamide ( — NRSO 2 — or — SO 2 NR), acyl, ether, thioether and amine.
  • X 2 is the group — CH 2 — NR 10 — C(O) — wherein the carbonyl — C(O) — portion thereof is adjacent (i.e. covalently bound) to Cy and R 10 is alkyl i.e. methyl and more preferably H.
  • K is a carbocycle or heterocycle optionally substituted with hydroxyl, mercapto, halogen, oxo, thio, a hydrocarbon, a halo- substituted hydrocarbon, amino, amidine, guanidine, cyano, nitro, alkoxy or acyl.
  • K is aryl or heteroaryl optionally substituted with halogen or hydroxyl.
  • K is phenyl, furan-2-yl, thiophene-2-yl, phenyl substituted with a halogen (preferably Cl) or hydroxyl, preferably at the meta position.
  • L 2 is a divalent hydrocarbon optionally having one or more carbon atoms replaced with N, O, S, SO or SO 2 and optionally being substituted with hydroxyl, halogen oxo, or thio; or three carbon atoms of the hydrocarbon are replaced with an amino acid residue.
  • L 2 is less than 10 atoms in length and more preferably 5 or less and most preferably 5 or 3 atoms in length.
  • Preferred amino acid side chains include non-naturally occurring side chains such as phenyl or naturally occurring side chains. Preferred side chains are those from Phe, Tyr, Ala, GIn and Asn.
  • L 2 is — CH 2 — NR 10 — C(O) — wherein the methylene moiety ( — CH 2 — ) thereof is adjacent to K.
  • R s is H, OH, amino, O-carbocycle or alkoxy optionally substituted with ammo, a carbocycle,a heterocycle, or a pharmaceutically acceptable salt or ester.
  • R 5 is H, phenyl or C M alkoxy optionally substituted with a carbocycle such as phenyl.
  • R 5 is H.
  • R 5 is methoxy, ethoxy, propyloxy, butyloxy, isobutyloxy, s-butyloxy, t-butyloxy, phenoxy or benzyloxy.
  • R 5 is NH 2 .
  • R 5 is ethoxy.
  • R 5 is isobutyloxy.
  • R 5 is alkoxy substituted with amino, for example 2- aminoethoxy, N-morpholinoethoxy, N,N-dialkyaminoethoxy, quaternary ammonium hydroxy alkoxy (e.g. trimethylammoniumhydroxyethoxy).
  • R 6'9 are independently H, hydroxyl, mercapto, halogen, cyano, amino, amidine, guanidine, nitro or alkoxy; or R 7 and R 8 together form a fused carbocycle or heterocycle optionally substituted with hydroxyl, halogen, oxo, thio, amino, amidine, guanidine or alkoxy.
  • R 6 and R 7 are independently H, F, Cl, Br or I.
  • R 8 and R 9 are both H.
  • one of R 6 and R 7 is a halogen while the other is hydrogen or a halogen.
  • R 7 is Cl while R 6 , R 8 and R 9 are each H.
  • R 6 and R 7 are both Cl while R 8 and R 9 are both H.
  • R 10 is H or a hydrocarbon chain optionally substituted with a carbocycle or a heterocycle.
  • R 10 is H or alkyl i.e. methyl, ethyl, propyl, butyl, i-butyl, s-butyl or t-butyl.
  • R 10 is H.
  • Further preferred embodiments of the method of the present invention are compounds of the Formula IV:
  • R 11 is a group of the formula
  • A is hydrogen, hydroxy, amino, or halogen and B is amino, carboxy, hydrogen, hydroxy, cyano, trifluoromethyl, halogen, lower alkyl, or lower alkoxy;
  • R 12 is a group of the formula:
  • R 13 is hydrogen, carboxy, or lower alkyl; n is 0 or 1; U 2 , V 2 , and W 2 are independently hydrogen, halogen, or lower alkyl provided U 2 and V 2 are not both hydrogen; X 3 is carbonyl, phenyl-substituted lower alkylene, imino, substituted irnino, or sulfonyl; Y 2 is lower alkylene which may be substituted by one or more of amino, substituted amino, lower alkyl, or cyclo lower alkyl, or Y 2 is lower alkenylene or lower alkylenethio; k is O or 1 ; when k is 1, Z 2 is hydrogen, lower alkylthio, — COOH, — CONH 2 , amino; and when k is O or 1, Z 2 is 1- adamantyl, diphenylmethyl, 3-[[(5-chloropyridin-2-yl) amino] carbonyl] pyrazin-2-yl,
  • R 15 is hydrogen, carboxy, or lower alkyl
  • U 3 , V 3 , and W 3 are independently hydrogen, halogen; or U 3 , V 3 , and W 3 are lower alkyl provided that U 3 and V 3 are not both hydrogen
  • X 4 is carbonyl, phenyl-substituted lower alkylene, imino, substituted imino which includes cyano, or sulfonyl
  • Y 3 is lower alkenylene, lower alkylenethio, or is lower alkylene which may be substituted by amino, acetylamino, or cyclo-lower alkyl
  • k 2 is 0 or 1 ; when k 2 is 1, Z is hydrogen, lower alkylthio, — COOH, -T-CONH 2 — , or amino; when k 2 is O or 1, Z 3 is 1- adamantyl, diphenylmethyl, 3-[[(5-chloropyridin-2-yl)amino
  • D 4 is a mono-, bi-, or tricyclic saturated, unsaturated, or aromatic ring, each ring having 5-, 6- or 7 atoms in the ring where the atoms in the ring are carbon or from one to four heteroatoms selected from the group nitrogen, oxygen, and sulfur, where any carbon or sulfur ring atom may optionally be oxidized, each ring substituted with 0-3 R 31 ;
  • L 3 is a bivalent linking group selected from the group
  • R 32 , R 32 ', R 34 , R 34 ', R 35 , R 35 ', R 36 , R 36 ', R 37 and R 37 ' each are independently selected from R 38 , R 39 and
  • R 24 and R 34 ' separately or together may form a saturated, unsaturated or aromatic fused ring with B 3 through a substituent RP on B, the fused ring containing 5, 6 or 7 atoms in the ring and optionally containing 1-3 heteroatoms selected from the group O, S and N, where any S or N may optionally be oxidized; optionally, R 35 and R 35 separately or together and R 36 and R 36 ' separately or together may form a saturated, unsaturated or aromatic fused ring with D 3 through a substituent R 3!
  • each R 32 -R 37 , NR 30 or N in L'-L 5 together with any other R 32 -R 37 , NR 30 or N in L'-L 5 may form a 5, 6 or 7 member homo- or heterocycle either saturated, unsaturated or aromatic optionally containing 1-3 additional heteroatoms selected from N, O and S, where any carbon or sulfur ring atom may optionally be oxidized, each cycle substituted with 0-3
  • R 31 R 31 ; and where s is 0-2; B is selected from the group
  • Y 3 is selected from CH and NR 30 ; n is 0-3:
  • G 3 is selected from hydrogen and Ci-C ⁇ alkyl, optionally G taken together with T may form a C 3 -C 6 cycloalkyl optionally substituted with -V-W;
  • T 3 is selected from the group a naturally occurring ⁇ -amino-acid side chain, and U 4 -Q 4 -V 4 -W 4 ;
  • U 4 is an optionally substituted bivalent radical selected from the group
  • Q 4 is absent or is selected from the group
  • V 4 is absent or is an optionally substituted bivalent group selected from Ci-Cgalkyl, Q-Cscycloalkyl, Co-C ⁇ alkyl-C ⁇ -Cioaryl, and Co-C 6 alky-het; where the substituents on any alkyl are 1-3 R 38 and the substituents on any aryl or het are 1-3 R 31 ;
  • R 3S is R 38' or R 38" substituted with 1-3 R 38 ';
  • R 38 ' is selected from the group hydrogen, halo(F. Cl, Br, I), cyano, isocyanate, carboxy, carboxy-C r Ci l alkyl, amino, amino-C r C 8 alkyl, aminocarbonyl, carboxamido, carbamoyl, carbamoyloxy, formyl, formyloxy, azido, nitro, imidazoyl, ureido, thioureido, thiocyanato, hydroxy, CpQalkoxy, mercapto, sulfonamido, het, phenoxy, phenyl, benzamido, tosyl, morpholino, morpholinyl, piperazinyl, piperidinyl, pyrrolinyl, imidazolyl, and indolyl;
  • R 38 " is selected from the group
  • R 43 is selected from hydrogen and substituted or unsubstituted Ci-C I0 alkyl,. C 2 -Ci 0 alkenyl, C 2 -C I0 alkynyl, Q-C ⁇ cycloalkyl,
  • R 31 is selected from R 40 and R 41 ;
  • R 41 is selected from the group
  • C 6 cycloalkyl C 3 -C 6 cycloalkenyl, C r C 6 alkyl-phenyl, phenyl-C r C 6 alkyl, CpC ⁇ alkyloxycarbonyl, phenyl-C 0 -C 6 alkyloxy, C r
  • R 30 ' is selected from hydrogen, hydroxy and substituted or unsubstituted Q-Ci jalkyl, Cj-Ci i alkoxy, C 2 -Cioalkenyl, C 2 -
  • R 30 and R 30 ' taken together with the common nitrogen to which they are attached may from an optionally substituted heterocycle selected from morpholinyl, piperazinyl, thiamorpholinyl, pyrrolidinyl, imidazolidinyl,indolinyl, isoindolinyl,
  • R 33 is selected from hydrogen and substituted or unsubstituted Ci-C 6 alkyl, C r C 6 alkylcarbonyl, C 2 -C 6 alkenyl, Qj-C ⁇ alkynyl,
  • R 40 is selected from the group OH, halo(F, Cl. Br, I), CN, isocyanate, OR 43 , SR 42 , SOR 43 , NO 2 , CF 3 , R 43 , NR 30 R 30 ',
  • R 46 is a substituted or unsubstituted group selected from
  • C r C 8 alkyl C 2 -C 8 alkenyl, C 2 -C 8 alkynyl, C 3 -C 8 cycloalkyl, C 3 -C 6 cycloalkenyl, C 0 -C 6 alkyl-phenyl, phenyl-C 0 -C 6 alkyl, C 0 -
  • R 45 is a substituted or unsubstituted group selected from hydroxy, Ci-C ⁇ alkoxy, C 3 -C 12 cycloalkoxy, C 8 -Ci 2 aralkoxy, C 8 -
  • Ciocycloalkoxycarbonylalkyloxy C 8 -
  • Compounds of Formulas I- VI also include pharmaceutically acceptable salts, and esters including pro-drug compounds of
  • R 3A ,R 5 R 10 , R 17 , R 18 , R 19 , R 20 , R 21 , R 29 , and a carboxylic ester at R 44 may be lower alkyl or -CH 2 CH 2 - R 22 where R 22 is one of the following: where R 23 is hydrogen or methyl and R 24 is lower alkyl or lower cycloalkyl.
  • a preferred embodiment of compounds of Formula VI has the stereochemistry indicated in Formula VI'.
  • Some of the compounds described herein may comprise one or more asymmetric centers, and thus may comprise individual stereoisomers, individual diastereomers and any mixtures therein. Further, compounds of the invention may contain geometric isomers of double bonds, comprising Z and E isomers, and may be present as pure geometric isomers or mixtures thereof.
  • the methods of the present invention are performed with the following compounds or a pharmaceutically acceptable salt or ester thereof:
  • Compounds of the present invention include the following compounds or a pharmaceutically acceptable salt or ester thereof:
  • the compounds of the invention may be prepared by methods well known to those skilled in the art and may be purified in a number of ways, including by crystallization or precipitation under varied conditions to yield one or more polymorphs.
  • the present invention encompasses the above described inventive compounds, their polymorphs, their pharmaceuticially acceptable salts, their pharmaceutically acceptable solvates, and pharmaceutcially acceptable compositions containing them.
  • LFA-I antagonistic properties of peptides or small molecules and developing the compounds for treatment of LFA-I mediated diseases, preferably by topical delivery.
  • the compounds are not administered systemically, the systemic pharmacokinetic profiles of these drugs are typically not determined and hence the candidate pool of drugs available for development is larger.
  • the LFA-I antagonists are developed into ocular formulations and then promoted and sold for treatment of eye disorders, such as dry eye.
  • the Hut78 assay is typically used to determine LFA-I antagonistic.properties.
  • leukocyte antagonistic properties can be determined.
  • the method of the present invention may draw upon many suitable modes of administration to deliver the LFA-I antagonist of the methods described herein. Such delivery to affected regions of the body may be achieved either via local or systemic administration. Suitable formulations and additional carriers are described in Remington "The Science and Practice of Pharmacy” (20 th Ed., Lippincott Williams & Wilkins, Baltimore MD), the teachings of which are incorporated by reference in their entirety herein.
  • the invention provides a pharmaceutical composition for administration to a subject containing: (i) an effective amount of a therapeutic agent; and (ii) a pharmaceutical excipient suitable for oral administration.
  • the composition further contains: (iii) an effective amount of a second therapeutic agent.
  • the pharmaceutical composition of the invention is preferably delivered to the ocular surface, interconnecting innervation, conjuncitva, lacrimal glands, or meibomian glands.
  • effective treatment can encompass administering therapeutic agents of the present invention via oral administration, topical administration, via injection, intranasally, rectally, transdermally, via an impregnated or coated device such as an ocular insert or implant, or iontophoretically, amongst other routes of administration.
  • the pharmaceutical composition can be injected intramuscularly, intra-arterially, subcutaneously, or intravenously.
  • a pump mechanism may be employed to administer the pharmaceutical composition over a preselected period.
  • injections may be made periocularly, intraocularly, subconjunctively, retrobulbarly, or intercamerally.
  • systemic delivery is preferred.
  • the compounds of the invention can be formulated for and administered orally.
  • the composition of the' invention may be administered intranasally, transdermally, or via some forms of oral administration, e. g. with use of a mouthwash or lozenge incorporating a compound of the invention that is poorly absorbed from the G.I.
  • iontophoretic or topical administration may be used.
  • the pharmaceutical compositions of the present invention may be administered to the ocular surface via a pump-catheter system, or released from within a continuous or selective release device such as, e.g., membranes such as, but not limited to, those employed in the OcusertTM System (Alza Corp, Palo Alto, CA).
  • a continuous or selective release device such as, e.g., membranes such as, but not limited to, those employed in the OcusertTM System (Alza Corp, Palo Alto, CA).
  • the pharmaceutical compositions can be incorporated within, carried by or attached to contact lenses which are then worn by the subject.
  • the pharmaceutical compositions can be sprayed onto ocular surface.
  • compositions of the invention may be administered in combination with other therapies for the treatment of the disorder or underlying disease.
  • the LFA-I antagonist of the invention is administered at the same time, or separately during the treatment period for which a subject receives immunosuppressive therapies, such as azathioprine, cyclophosphoramide, methotrextate, antimalarial drugs, mycophenolan mofetile, daclizumab, intravenous immunoglobin therapy, and the like.
  • immunosuppressive therapies such as azathioprine, cyclophosphoramide, methotrextate, antimalarial drugs, mycophenolan mofetile, daclizumab, intravenous immunoglobin therapy, and the like.
  • the LFA-I antagonist of the invention is administered at the same time or separately during the treament period for which a subject receives other anti-inflammatory treatments, such as cyclosporin A, corticosteroids, NSAIDS 1 asprin, doxycycline, and the like.
  • the LFA-I antagonist of the invention is administered at the same time or separately during the treatment period for which a subject receives hormone therapy, and the like.
  • the LFA-I antagonist of the invention is administered at the same time or separately during the treatment period for which a subject receives anti-allergy therapy, palliative care for dry eye including artificial tears or artificial saliva, muscarinic M3 receptor agonists to increase aqueous secretions, autologous serum, sodium hyaluronate drops, and the like.
  • anti-allergy therapy palliative care for dry eye including artificial tears or artificial saliva, muscarinic M3 receptor agonists to increase aqueous secretions, autologous serum, sodium hyaluronate drops, and the like.
  • the LFA-I antagonist is administered in a single dose.
  • a single dose of a LFA-I antagonist may also be used when it is co-administered with another substance (e.g., an analgesic) for treatment of an acute condition.
  • the LFA-I antagonist (by itself or in combination with other drugs) is administered in multiple doses. Dosing may be about once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times or more than ten times per day. Dosing may be about once a month, once every two weeks, once a week, or once every other day. In one embodiment the drug is an analgesic. In another embodiment the LFA-I antagonist and another therapeutic substance are administered together about once per day to about 10 times per day. In another embodiment the administration of the LFA-I antagonist and another therapeutic substance continues for less than about 7 days. In yet another embodiment the co-administration continues for more.than about 6, 10, 14, 28 days, two months, six months, or one year.
  • co-administered dosing is maintained as long as necessary, e.g., dosing for chronic inflammation.
  • Administration of the compositions of the invention may continue as long as necessary.
  • a composition of the invention is administered for more than 1, 2, 3, 4, 5, 6, 7, 14, or 28 days.
  • a composition of the invention is administered for less than 28, 14, 7, 6, 5, 4, 3, 2, or 1 day.
  • a composition of the invention is administered chronically on an ongoing basis, e.g., for the treatment of chronic pain.
  • Dosing for the LFA-I antagonist in the method of the invention may be found by routine experimentation. The daily dose can range from about Ix 10 "7 g to 5000mg.
  • Daily dose range may depend on the form of LFA-I antagonist e.g., the esters or salts used, and/or route of administration, as described herein.
  • typical daily dose ranges are, e.g. about 1-5000 mg, or about 1-3000 mg, or about 1-2000 mg, or about 1-1000 mg, or about 1-500 mg, or about 1-100 mg, or about 10-5000 mg, or about 10-3000 mg, or about 10-2000 mg, or about 10-1000 mg, or about 10- 500 mg, or about 10-200 mg, or about 10-100 mg, or about 20-2000 mg or about 20-1500 mg or about 20-1000 mg or about 20-500 mg, or about 20-100 mg, or about 50-5000 mg, or about 50-4000 mg, or about 50-3000 mg, or about 50-2000 mg, or about 50-1000 mg, or about 50-500 mg, or about 50-100 mg, about 100-5000 mg, or about 100-4000 mg, or about 100-3000 mg, or about 100-2000 mg, or about 100-1000 mg, or about
  • the daily dose of LFA-I antagonist is about 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 mg. In some embodiments, the daily dose of the LFA-I antagonist is 10 mg. In some embodiments, the daily dose of the LFA-I antagonist is 100 mg. In some embodiments, the daily dose of LFA-I antagonist is 500 mg. In some embodiments, the daily dose of LFA-I antagonist is 1000 mg. [00134] For topical delivery to the ocular surface, the typical daily dose ranges are, e.g.
  • the daily dose of LFA-I antagonist is about Ix 10 "7 , Ix 10 '6 , Ix 10 "5 , Ix 10 "4 , Ix 10 "3 g, Ix 10 "2 g, Ix lO'g.or Ig.
  • the daily dose of the LFA-I antagonist is Ix 10 "7 g.
  • the daily dose of the LFA-I antagonist is Ix 10 "5 g.
  • the daily dose of LFA-I antagonist is Ix 10 "3 g.
  • the daily dose of LFA-I antagonist is Ix 10 "2 g.
  • the individual dose ranges from about lxl ⁇ '7 g to 5.0g, or about lxl ⁇ '7 g to 2.5g, or about lxl ⁇ '7 g to l.OOg, or about lxl ⁇ "7 g to 0.5g, or about lxl ⁇ "7 g to 0.25g, or about lxl ⁇ "7 g to O.lg, or about lxl ⁇ "7 g to 0.05g, or about lxl ⁇ "7 g to 0.025g, or about lxl ⁇ "7 g to Ix 10 "2 g, or about lxl ⁇ '7 g to 5x 10 "3 g, or about lxl ⁇ "7 g to 2.5x 10 '3 g, or about lxl ⁇ "7 g to Ix 10 ' 3 g, or about lxl ⁇ "7 g to 5x 10 ⁇ g, or about lxl ⁇ ' ⁇ g, or
  • the daily dosages may range about the range described for systemic administration or may range about the range described for topical administration.
  • the compounds of the invention may be formulated as a sterile solution or suspension, in suitable vehicles, well known in the art. Suitable formulations and additional carriers are described in Remington "The Science and Practice of
  • the vehicle may be chosen from those known in art to be suitable, including aqueous solutions or oil suspensions, or emulsions, with sesame oil, corn oil, cottonseed oil, or peanut oil, as well as elixirs, mannitol, dextrose, or a sterile aqueous solution, and similar pharmaceutical vehicles.
  • the concentration of drug may be adjusted, the pH of the solution buffered and the isotonicity adjusted to be compatible with intravenous injection, as is well known in the art.
  • Oral formulations can be tablets, capsules, troches, pills, wafers, chewing gums, lozenges, aqueous solutions or suspensions, oily suspensions, syrups, elixirs, or dispersible powders or granules, and the like and may be made in any way known in the art. Oral formulations may also contain sweetening, flavoring, coloring and preservative agents.
  • compositions for tablet forms may comprise nontoxic ingredients such as inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate, or sodium phosphate, and the like.
  • inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate, or sodium phosphate, and the like.
  • carriers which are commonly used include lactose and corn starch, and lubricating agents such as magnesium stearate are commonly added.
  • useful carriers include lactose and corn starch.
  • carriers and excipients include milk, sugar, certain types of clay, gelatin, stearic acid or salts thereof, calcium stearate, talc, vegetable fats or oils, gums and glycols.
  • Surfactant which can be used to form pharmaceutical compositions and dosage forms of the invention include, but are not limited to, hydrophilic surfactants, lipophilic surfactants, and mixtures thereof. That is, a mixture of hydrophilic surfactants may be employed, a mixture of lipophilic surfactants may be employed, or a mixture of at least one hydrophilic surfactant and at least one lipophilic surfactant may be employed.
  • a suitable hydrophilic surfactant may generally have an HLB value of at least 10, while suitable lipophilic surfactants may generally have an HLB value of or less than about 10.
  • HLB hydrophilic-lipophilic balance
  • Surfactants with lower HLB values are more lipophilic or hydrophobic, and have greater solubility in oils, while surfactants with higher HLB values are more hydrophilic, and have greater solubility in aqueous solutions.
  • Hydrophilic surfactants are generally considered to be those compounds having an HLB value greater than about 10, as well as anionic, cationic, or zwitterionic compounds for which the HLB scale is not generally applicable.
  • lipophilic (i.e., hydrophobic) surfactants are compounds having an HLB value equal to or less than about 10.
  • Hydrophilic surfactants may be either ionic or non-ionic. Suitable ionic surfactants include, but are not limited to, alkylammonium salts; fusidic acid salts; fatty acid derivatives of amino acids, oligopeptides, and polypeptides; glyceride derivatives of amino acids, oligopeptides, and polypeptides; lecithins and hydrogenated lecithins; lysolecithins and hydrogenated lysolecithins; phospholipids and derivatives thereof; lysophospholipids and derivatives thereof; carnitine fatty acid ester salts; salts of alkylsulfates; fatty acid salts; sodium docusate; acyl lactylates; mono- and di-acetylated tartaric acid esters of mono- and di-
  • preferred ionic surfactants include, by way of example: lecithins, lysolecithin, phospholipids, lysophospholipids and derivatives thereof; carnitine fatty acid ester salts; salts of alkylsulfates; fatty acid salts; sodium docusate; acyl lactylates; mono- and di-acetylated tartaric acid esters of mono- and di-glycerides; succinylated mono- and di-glycerides; citric acid esters of mono- and di-glycerides; and mixtures thereof.
  • Ionic surfactants maybe the ionized forms of lecithin, lysolecithin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatide acid, phosphatidylserine, lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysophosphatidic acid, lysophosphatidylserine, PEG-phosphatidylethanolamine, PVP- phosphatidylethanolamine, lactylic esters of fatty acids, stearoyl-2-lactylate, stearoyl lactylate, succinylated monoglycerides, mono/diacetylated tartaric acid esters of mono/diglycerides, citric acid esters of mono/diglycerides, cholylsarcosine, caproate, caprylate, cap
  • Hydrophilic non-ionic surfactants may include, but not limited to, alkylglucosides; alkylmaltosides; alkylthioglucosides; lauryl macrogolglycerides; poly ⁇ xyalkylene alkyl ethers such as polyethylene glycol alkyl ethers; polyoxyalkylene alkylphenols such as polyethylene glycol alkyl phenols; polyoxyalkylene alkyl phenol fatty acid esters such as polyethylene glycol fatty acids monoesters and polyethylene glycol fatty acids diesters; polyethylene glycol glycerol fatty acid esters; polyglycerol fatty acid esters; polyoxyalkylene sorbitan fatty acid esters such as polyethylene glycol sorbitan fatty acid esters; hydrophilic transesterification products of a polyol with at least one member of the group consisting of glycerides, vegetable oils, hydrogenated vegetable oils, fatty acids, and sterols; polyoxyethylene glycol sorb
  • the polyol may be glycerol, ethylene glycol, polyethylene glycol, sorbitol, propylene glycol, pentaerythritol, or a saccharide.
  • Other hydrophilic-non-ionic surfactants include, without limitation, PEG-IO laurate, PEG-12 laurate, PEG-20 Iaurate, PEG-32 laurate, PEG-32 dilaurate, PEG-12 oleate, PEG-15 oleate, PEG-20 oleate, PEG-20 dioleate, PEG-32 oleate, PEG-200 oleate, PEG-400 oleate, PEG-15 stearate, PEG-32 distearate, PEG-40 stearate, PEG-100 stearate, PEG-20 dilaurate, PEG-25 glyceryl trioleate, PEG-32 dioleate, PEG-20 glyceryl laurate, PEG-30 glyce
  • Suitable lipophilic surfactants include, by way of example only: fatty alcohols; glycerol fatty acid esters; acetylated glycerol fatty acid esters; lower alcohol fatty acids esters; propylene glycol fatty acid esters; sorbitan fatty acid esters; polyethylene glycol sorbitan fatty acid esters; sterols and sterol derivatives; polyoxyethylated sterols and sterol derivatives; polyethylene glycol alkyl ethers; sugar esters; sugar ethers; lactic acid derivatives of mono- and di-glycerides; hydrophobic transesterification products of a polyol with at least one member of the group consisting of glycerides, vegetable oils, hydrogenated vegetable oils, fatty acids and sterols; oil-soluble vitamins/vitamin derivatives; and mixtures thereof.
  • preferred lipophilic surfactants include glycerol fatty acid esters, propylene glycol fatty acid esters, and mixtures thereof, or are hydrophobic transesterification products of a polyol with at least one member of the group consisting of vegetable oils, hydrogenated vegetable oils, and triglycerides.
  • Surfactants may be used in any formulation of the invention where its use is not otherwise contradicted. In some embodiments of the invention, the use of no surfactants or limited classes of surfactants are preferred.
  • gastroretentive formulations to enhance absorption from the gastrointestinal (GI) tract. A formulation which is retained in the stomach for several hours may release compounds of the invention slowly and provide a sustained release that may be preferred in some embodiments of the invention. Disclosure of such gastro-retentive formulations are found in Klausner, E.A.; Lavy, E.; Barta, M.; Cserepes, E.; Friedman, M.; Hoffman, A.
  • Intranasal administration may utilize an aerosol suspension of respirable particles comprised of the compounds of the invention, which the subject inhales.
  • the compound of the invention are absorbed into the bloodstream via pulmonary absorption or contact the lacrimal tissues via nasolacrimal ducts, and subsequently be delivered to the lacrimal tissues in a pharmaceutically effective amount.
  • the respirable particles may be solid or liquid, with suitably sized particles, as is known in the art to be effective for absorption.
  • Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders.
  • the liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described supra.
  • the compositions are administered by the oral or nasal respiratory route for local or systemic effect.
  • compositions in preferably pharmaceutically acceptable solvents may be nebulized by use of inert gases. Nebulized solutions may be inhaled directly from the nebulizing device or the nebulizing device may be attached to a face mask tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions may be administered, preferably orally or nasally, from devices that deliver the formulation in an appropriate manner.
  • any suitable formulation known in the art may be utilized, either as a solution, suspension, gel, powder, cream, oil, solids, dimethylsulfoxide (DMSO)-based solutions or liposomal formulation for use in a patch or other delivery system known in the art.
  • the pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients, which are compounds that allow increased penetration of, or assist in the delivery of, therapeutic molecules across the stratum corneum permeability barrier of the skin. There are many of these penetration-enhancing molecules known to those trained in the art of topical formulation.
  • humectants e.g., urea
  • glycols e.g., propylene glycol
  • alcohols e.g., ethanol
  • fatty acids e.g., oleic acid
  • surfactants e.g., isopropyl myristate and sodium lauryl sulfate
  • pyrrolidones e.g., isopropyl myristate and sodium lauryl sulfate
  • pyrrolidones e.glycerol monolaurate, sulfoxides, terpenes (e.g., menthol)
  • amines amides, alkanes, alkanols, water, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
  • transdermal patches for the delivery of pharmaceutical agents is well known in the art. See, e.g.,- U.S. Pat. Nos. 5,023,252, 4,992,445 and 5,001,139. Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
  • compositions of the present invention may be a liposomal formulation for topical or oral administration, any of which are known in the art to be suitable for the purpose of this invention.
  • Lubricants which can be used to form pharmaceutical compositions and dosage forms of the invention include, but are not limited to, calcium stearate, magnesium stearate, mineral oil, light mineral oil, glycerin, sorbitol, mannitol, polyethylene glycol, other glycols, stearic acid, sodium lauryl sulfate, talc, hydrogenated vegetable oil (e.g., peanut oil, cottonseed oil, sunflower oil, ' sesame oil, olive oil, corn oil, and soybean oil), zinc stearate, ethyl oleate, ethyl laureate, agar, or mixtures thereof.
  • Additional lubricants include, for example, a syloid silica gel, a coagulated aerosol of synthetic silica, or mixtures thereof.
  • a lubricant can optionally be added, in an amount of less than about 1 weight percent of the pharmaceutical composition.
  • the compounds of the invention may be attached releasably to biocompatible polymers for use in sustained release formulations on, in or attached to inserts for topical or systemic administration.
  • the controlled release from a biocompatible polymer may be utilized with a water soluble polymer to form a instillable formulation, as well.
  • Eye drops may be prepared by dissolving the active ingredient in a sterile aqueous solution such as physiological saline, buffering solution, etc., or by combining powder compositions to be dissolved before use.
  • Other vehicles may be chosen, as is known in the art, including but not limited to: balance salt solution, saline solution, water soluble polyethers such as polyethyene glycol, polyvinyls, such as polyvinyl alcohol and povidone, cellulose derivatives such as methylcellulose and hydroxypropyl methylcellulose, petroleum derivatives such as mineral oil and white petrolatum, animal fats such as lanolin, polymers of.acrylic acid such as carboxypolymethylene gel, vegetable fats such as peanut oil and polysaccharides such as dextrans, and glycosaminoglycans such as sodium hyaluronate.
  • additives ordinarily used in the eye drops can be added.
  • Such additives include isotonizing agents (e.g., sodium chloride, etc.), buffer agent (e.g., boric acid, sodium monohydrogen phosphate, sodium dihydrogen phosphate, etc.), preservatives (e.g., benzalkonium chloride, benzethonium chloride, chlorobutanol, etc.), thickeners (e.g., saccharide such as lactose, mannitol, maltose, etc.; e.g., hyaluronic acid or its salt such as sodium hyaluronate, potassium hyaluronate, etc.; e.g., mucopolysaccharide such as chondroitin sulfate, etc.; e.g., sodium polyacrylate, carboxyvinyl polymer, crosslinked polyacrylate, polyvinyl alcohol, polyvinyl pyrrolidone, methyl cellulose
  • compositions of the present compositions may be enhanced by a surfactant or other appropriate co-solvent in the composition.
  • cosolvents include polysorbate 20, 60, and 80, Pluronic F68, F-84 and P-103, cyclodextrin, or other agents known to those skilled in the art.
  • co-solvents may be employed at a level of from about 0.01% to 2% by weight.
  • the composition of the invention can be formulated as a sterile unit dose type containing no preservatives.
  • the compositions of the invention may be packaged in multidose form. Preservatives may be preferred to prevent microbial contamination during use.
  • Suitable preservatives include: benzalkonium chloride, thimerosal, chlorobutanol, methyl paraben, propyl paraben, phenylethyl alcohol, edetate disodium, sorbic acid, Onamer M, or other agents known to those skilled in the art. In the prior art ophthalmic products, such preservatives may be employed at a level of from 0.004% to 0.02%. In the compositions of the present application the preservative, preferably benzalkonium chloride, may be employed at a level of from 0.001 % to less than 0.01%, e.g. from 0.001 % to 0.008%, preferably about 0.005% by weight. It has been found that a concentration of benzalkonium chloride of 0.005% may be sufficient to preserve the compositions of the present invention from microbial attack.
  • the amount of administration and the number of administrations of the active ingredient used in the present invention vary according to sex, age and body weight of patient, symptoms to be treated, desirable therapeutic effects, administration routes and period of treatment.
  • the formulations containing the compounds of the invention may range in concentration from about 0.0001 to 10.0 W/V %, about 0.005 to 10.0 W/V %, about 0.01 to 10.0 W/V %, about 0.05 to 10.0 W/V %, about 0.1 to 10.0 W/V %, about 0.5 to 10.0 W/V %, about 1.0 to 10.0 W/V %, about 20 to 10.0 W/V %, about 3.0 to 10.0 W/V %, about 4.0 to 10.0 W/V %, or about ' 5.0 to 10.0 W/V %.
  • One embodiment of the invention has a formulation of about 1.0 to 10.0 W/V % of the compounds of the invention.
  • One embodiment of the invention has a formulation of about 0.01 to 10.0 W/V % of the compounds of the invention.
  • One embodiment of the invention has a formulation of about 5.0 to 10.0 W/V % of the compounds of the invention.
  • the administration maybe administered several times a day per eye, preferably one to ten times, more preferably one to four times, most preferably once a day.
  • the size of the drop administered may be in the range of about 10-100 ⁇ l, about 10-90 ⁇ l, about 10-80 ⁇ l, about 10- 70 ⁇ l, about 10-60 ⁇ l, about 10-50 ⁇ l, about 10-40 ⁇ l, about 10-30 ⁇ l, about 20- lOO ⁇ l, about 20-90 ⁇ l, about 20-80 ⁇ l, about 20- 70 ⁇ l, about 20-60 ⁇ l, about 20-50 ⁇ l, about 20-40 ⁇ l, or about 20-30 ⁇ l,
  • One embodiment of the invention administers a drop in the range of 10-30 ⁇ l.
  • One embodiment of the invention administers a drop in the range of 10-100 ⁇ l.
  • One embodiment of the invention administers a drop in the range of 20-5 O ⁇ l.
  • One embodiment of the invention administers a drop in the range of 10-60 ⁇ l.
  • the formulations of the invention may be administered several drops per time, one to four drops, preferably one to three drops, more preferably one to two drops, and most preferably one drop per day.
  • the concentration of the compounds of the invention in the formulations may range about 0.0001 10.0 W/V %, about 0.005 to 10.0 W/V %, about 0.01 to 10.0 W/V %, about 0.05 to ⁇ 10.0 W/V %, about 0.1 to 10.0 W/V %, about 0.5 to 10.0 W/V %, about 1.0 to 10.0 W/V %, about 20 to 10.0 W/V %, about 3.0 to 10.0 W/V %, about 4.0 to 10.0 W/V %, or about 5.0 to 10.0 W/V %.
  • One embodiment of the invention has a formulation of about 1.0 to 10.0 W/V % of the compounds of the invention.
  • One embodiment of the invention has a formulation of about 0.01 to 10.0 W/V % of the compounds of the invention.
  • One embodiment of the invention has a formulation of about 5.0 to 10.0 W/V % of the compounds of the invention.
  • These formulations may be applied or sprayed several times a day, preferably one to six times, more preferably one to four times, and most preferably once a day.
  • the compounding ratio of each ingredient may be suitably increased or decreased based on the degree of inflammations or infections.
  • the formulations of the invention can further include other pharmacological active ingredients as far as they do not contradict the purpose of the present invention.
  • their respective contents may be suitably increased or decreased in consideration of their effects and safety.
  • kits include a compound of the invention in suitable packaging, and written material that can include instructions for use, discussion of clinical studies, listing of side effects, and the like.
  • the kit may further contain another therapeutic agent that is co-administered with the LFA-I antagonist of the invention.
  • the therapeutic agent and the LFA-I antagonist of the invention are provided as separate compositions in separate containers within the kit.
  • the therapeutic agent and the LFA-I antagonist of the invention are provided as a single composition within a container in the kit.
  • Suitable packaging and additional articles for use e.g., measuring cup for liquid preparations, foil wrapping to minimize exposure to air, dispensers, and the like) are known in the art and may be included in the kit.
  • Divalent cations play a critical role in integrin/ligand binding and their presence is essential in experimental investigations of these interactions. See Hynes, R. O. 1992. Integrins: Versatility, modulation, and signaling in cell adhesion, Cell, 69: 11-25; Humphries, M. J. 1996. Integrin activation: the link between ligand binding and signal transduction, Curr. Op. Cell Biol., 8: 632-640. The affinities of ICAM-I-Ig and compounds 1, 3, and 4 (structures shown in Figure 4) for LFA-I under two sets of commonly used divalent cation conditions were measured using fluorescence polarization.
  • the affinity of compound 1 for LFA-I was first measured in a direct binding assay, and then the affinities of ICAM-I-Ig and compounds 3 and 4 for LFA-I were measured in competition with compound 1 for LFA-I ( Figure 4, and Table 1 in Figure 5).
  • the affinity of the A-286982, which binds to the IDAS, was not measured as it does not compete with compound 1 for binding to LFA-I (see below).
  • Similar changes in the affinities of compounds 1, 3 and 4 for LFA-I were measured under the different cation conditions as for ICAM-I-Ig.
  • the small molecule affinities increase at least ten-fold in the presence OfMnCl 2 over those measured in CaCl 2 and MgCl 2 .
  • both ICAM-I-Ig and the class of LFA-I antagonists represented by compounds 1 - 4 share a divalent cation sensitivity for LFA-I binding (Table 1). Consequently, in order to identify antagonists of LFA-I /ICAM-I which bind in a similar manner to that of ICAM-I-Ig and compounds 1-4, all binding assays reported herein were performed under similar conditions, in the presence OfMnCl 2 , which is known to maximize the binding of both ICAM-I and these cation-sensitive antagonists.
  • the high affinity binding site necessary to crosslink after gel filtration is provided by the intact LFA-I heterodimer.
  • the absence of a high affinity site in the isolated ⁇ L subunit is consistent with a previous study demonstrating lack of interaction of XVA143 with the isolated I domain (Welzenbach et al. 2002).
  • the site of crosslinking was further defined by fragmenting the affinity-labeled ⁇ L subunit with hydroxylamine, electrophoretically separating the fragments, and then performing N-terminal sequencing on the radiolabeled fragments to determine their locations within the protein sequence.
  • Both peptides were approximately 500 amino acids long as judged by their sizes on SDS-PAGE (50 - 60 kDa); this fragment size is consistent with the next two predicted cleavage sites (N-G) for hydroxylamine, N507 and N530 (Larson et al. 1989, Bornstein, P. 1969. The nature of a hydroxylamine-sensitive bond in collagen, Biochem. Biophys. Res. Comm., 36: 957- 964). No label was incorporated into the C-terminal half of the s ⁇ bunit. Attempts to refine the crosslinking site further were not successful. No definable labeled peptides were recoverable after limited digestion of the labeled ⁇ L subunit with either cyanogen bromide or Lys-C.
  • the second site is a lower affinity binding site (e.g. K ⁇ > 1 ⁇ M) in the ⁇ subunit which is involved with stabilization of the LFA-I heterodimer under SDS-PAGE.
  • This site is more dynamic by nature (i.e. faster off rate) and does not survive the gel filtration/photolysis process.
  • the characteristics of this second low affinity site are consistent with those of the recently described ⁇ / ⁇ I-like allosteric antagonist binding site in the I-like domain of the ⁇ subunit (Welzenbach et al. 2002, Shimaoka et al. 2003b, Salas et al. 2004, Yang et al. 2004).
  • the low affinity binding of the ICAM-I mimetics described herein to the ⁇ subunit of LFA-I, presumably to the I-like domain, is likely due to the sequence homology between the I and I-like domains, particularly with regard to similarities in MIDAS motifs and their affinities for the carboxylic acid moiety common to this class of antagonists.
  • the affinity of compounds for the I-like domain in the ⁇ 2 subunit mustbe attenuated in order to select antagonists which are specific to LFA-I (Keating, S., Marsters, J., Beresini, M., Ladner, C, Zioncheck, K., Clark, K., Arellano, F., and Bodary, S. 2000. Putting the pieces together: Contribution of fluorescence polarization assays to small molecule lead optimization, SPIE Proceedings, 3913: 128-137).
  • the common trend in potencies between the two antagonist competition ELISAs with ICAM-I-Ig and compound 2B as ligands reveals that each compound disrupts the binding of both ICAM-I and small molecule ligands in a mechanistically similar fashion.
  • An antagonist which inhibits through direct competition with the ligand of interest, exhibits a non-saturable rightward shift of the ligand binding curves to higher apparent EC 50 values with increasing antagonist concentration and no reduction in the maximal binding of the ligand (Lutz, M., and Kenakin, T. 1999. Quantitative Molecular Pharmacology and Informatics in Drug Discovery, John Wiley & Sons, Ltd., New York, Pratt, W. B., and Taylor, P. 1990. Principles of Drug Action; The Basis of Pharmacology, Churchill Livingstone, New York Matthews, J. C. 1993. Fundamentals of Receptor, Enzyme, and Transport Kinetics, CRC Press, Boca Raton, Kenakin, T. 1997.
  • ICAM-I-Ig A, C, E
  • compound 2B B, D, F
  • the antagonists were added in two-fold dilutions starting at 2.4 (A) and 2.7 (B) ⁇ M sICAM-1, 0.040 (C) and 0.10 (D) ⁇ M compound 3 and 20 (E) and 50 (F) ⁇ M A-286982.
  • the order of antagonist concentrations was, -Q- (lowest added antagonist concentration), - ⁇ -, -O-, - ⁇ -, - ⁇ -, -A.- to -•- (highest antagonist concentration).
  • A-286982 is an insurmountable antagonist of ICAM-I-Ig binding.
  • the presence of A-286982 at micromolar concentrations shifted the compound 2B binding curves to lower EC 50 values and appeared to enhance the binding of compound 2B to LFA-I ( Figure 10F).
  • the contrasting effects of A-286982 on compound 2B and ICAM-I-Ig binding may be due to the known allosteric effect of the compound binding to the IDAS site on LFA-I.
  • the A-286982 binding data serve as an illustration for allosteric inhibiton for small molecule and protein ligand binding to LFA-I in the binding experiments demonstrated in this method.
  • Schild analysis can be also used to investigate whether a compound inhibits ligand binding through direct competition for a single binding site (Lutz and Kenakin 1999, Pratt and Taylor 1990, Matthews 1993, Kenakin 1997, Coultrap 1999). This model is based upon the assumptions that equiactive responses in an assay are the result of equivalent occupancy of receptor by ligand and that maximal binding is unchanged by the presence of antagonist.
  • the dose ratio is the ratio of the EC 50 values in the presence and absence of antagonist and is a measure of the ligand concentrations leading to equiactive responses. This dose ratio was determined for each concentration of antagonist and the Schild regressions were plotted as shown in Figure 11. A linear response with a slope of 1 in a Schild regression indicates that inhibition by an antagonist is directly competitive and reversible (Lutz andKenakin 1999, Kenaki ⁇ 1997). The Schild analysis would yield a nonlinear relationship and/or a slope that deviates significantly from 1 in the case of an allosteric inhibitor that does not result in a reduction of maximal binding (Lutz and Kenakin 1999, Kenakin 1997).
  • Schild regressions for both sICAM-1 and compound 3 are shown in Figure 11 with comparable slopes of 1.26 and 1.24, respectively.
  • Schild regressions of s-ICAM-1 (-A.-) and compound 3 (-•-) antagonism in the LFA-l/ICAM-1 ligand binding ELISA are plotted from the data in Figure 5 (A) and (C), respectively.
  • siRNA small interfering RNA sequences
  • siRNA data is desirable because siRNA silences the target' s gene and is directly linked to the inhibition of cell growth by that target. Therefore siRNA data is useful to correlate the inhibition of a target's function and the inhibition of cell growth. Compounds identified in this manner are useful in the treatment of human diseases.
  • Figure 12 is a flow chart for the identification of compounds for the treatment of human diseases using siRNA growth inhibition data.
  • the method includes choosing a cellular target (for example, a protein or other biopolymer whose formation is controlled by the transcription and/or translation of a gene) involved in the growth of cells containing said target whose inhibition would be useful in the control of cell growth is selected.
  • a cellular target for example, a protein or other biopolymer whose formation is controlled by the transcription and/or translation of a gene
  • This selection can be from lists of such targets in the public domain including the scientific literature and includes enzymes, receptors and proteins involved in protein-protein interactions.
  • One such useful target is the association of beta-catenin with proteins of the TCF family such as TCF-4. These proteins are in the Wnt pathway and are involved in the growth and proliferation of a number of human tumors including common cancer.
  • a compound which binds to beta-catenin and blocks its association with TCF-4 is useful in preventing selected gene transcription and the growth of tumors in human cancers, particularly colon cancer.
  • Small interfering RNA (siRNA) sequences unique to the target are purchased from commercial suppliers such as Dharmacon, Boulder CO.
  • Cell lines from the National Cancer Institute' s panel of 60 cell lines relevant to cancer (for example the Colon and Breast derived NCI cell lines) and/or inflammation (for example the NCI leukemia cell lines) can be grown in the presence of increasing amounts of the siRNA directed against the target until the growth of the cells is inhibited.
  • a single concentration of siRNA can be used against all of the cell lines and the relative inhibition of cell growth can be measured.
  • the NCI's existing data for dose titration effects of compounds on the growth of the same 60 cell lines can be searched using the NCI ' s COMPARE program or to identify compounds which have a similar pattern of activity (for example, the concentration of compound which inhibits the growth of cells by 50% compared to its uninhibited growth, the GI50 value for a compound).
  • the similarity can be quantified by statistical or other methods including the Pearson correlation used in the NCI COMPARE program.
  • Search algorithms other than NCI COMPARE can be used to define compound and siRNA similarities.
  • Data from the NCI can be analyzed online via the world wide web, or it can be downloaded to a computer or network of computers and analyzed offline. Additional databases including public and proprietary databases linking compound structure to their inhibition of cell growth are also useful for the purposes of this invention.
  • the structures of compounds whose cell growth activity pattern is similar to the pattern of growth inhibition produced by the siRNA experiment will contain common substructural features (for example phenyl groups, carboxylic acid groups, hydrogen bond donor group, etc.) which can define a structure activity relationship (SAR).
  • SAR relationships are commonly used by medicinal chemists skilled in the art of drug discovery to link the activity of compounds against a target to a common structural motif.
  • SAR structure activity relationship
  • SAR structure activity relationship
  • Useful compounds can be synthesized or identified in computer searches of the NCI database or other databases of commercially available compounds or computer generated libraries of compounds with interesting and diverse structural features and computed properties (such as 'druglikeness').
  • Compounds from commercial or synthetic sources can be tested in the cell growth assays for improved potency in the inhibition of cell growth and the data (both for improvements and declines in potency) can be used to refine the SAR for inhibition of cell growth mediated by a target. Iterative cycles of data acquisition, SAR refinement, compound procurement, compound testing/data acquisition can identify a compound with a potency below 10 micromolar in the inhibition of cell growth.
  • Such a compound can be useful in drug discovery because it is often possible to achieve circulating levels in excess of 10 micromolar in an animal used as a model of human disease (e.g., a mouse xenograft model of human cancer, as a non-limiting example). Further testing in animal models relevant to the target for improved potency, efficacy and duration of action can identify a candidate molecule for the clinical treatment of human diseases including cancer and inflammatory diseases of aberrant cell growth. Alternatively, the identification of compounds which fit an activity pattern opposite of the inhibition of cell growth by siRNA can be stimulants of cell growth useful in diseases and conditions of slow cell growth. Enhanced cell growth could be useful in wound healing and other clinical settings.
  • the method described herein may also utilize the transfection of a gene for a known protein regulator of the target to aid in identifying a pattern of inhibition sufficiently distinctive to be able to identify molecules with a similar pattern of activity.
  • This method is useful in the identification of potent compounds with significant potencies below 10 micromolar in the inhibition of cell growth. These compounds can be used in animal models of human cancer and inflammation. More preferred are compounds whose inhibition of cell growth (GI50) is below 1 micromolar. Even more preferred are compounds whose growth inhibition (GI50) is less than 100 nM. Most preferred are compounds with GI50 values below 10 nM.
  • the methods of this invention can also be used to identify useful inhibitors of LFA-I, the B-cell receptor BR3, Grb2 (a protein downstream of growth factor receptors in signaling cascades) and other protein targets inside and outside of cells. It is particularly useful against targets in the Wnt pathway including beta-catenin for the treatment of human colon cancer. It is also useful against additional disease related targets in lymphoma, leukemia, colon cancer, melanoma, breast cancer, brain cancer, lung cancer, kidney cancer and other human cancers. The method is useful in identifying compounds useful in the treatment of human inflammatory diseases mediated by the growth and proliferation of inflammatory cells.
  • siRNA cellular activity data for target or selection of targets by searching public and/or proprietary databases of compound cellular activity for a pattern of similar cellular activity in response to a compound or collection of compounds as a method to identify compounds useful in the identification of a human pharmaceutical.
  • sICAM- 1 a truncated form of native ICAM-I without the transmembrane and cytoplasmic domains for ease of use in in vitro assays, but with the intact LFA-I binding epitope
  • MEM-48 a truncated form of native ICAM-I without the transmembrane and cytoplasmic domains for ease of use in in vitro assays, but with the intact LFA-I binding epitope
  • MEM-48 were from R&D Systems (Minneapolis, MN).
  • Mouse monoclonal anti-human Wl integrin (clone PLM2) was generated using standard procedures (Fisher et al.
  • the affinity of compound 1 for LFA-I was first measured by addition of 2 nM compound 1 to serial dilutions of LFA-I starting from 1 ⁇ M in buffer containing either MnCl 2 or CaCl 2 and MgCl 2 .
  • Competition experiments were performed by addition of serial dilutions of antagonists to 2 nM compound 1 (using either 3 nM LFA-I (in MnCl 2 ) or 40 nM LFA-I (in CaCl 2 and MgCl 2 )).
  • the LFA-I concentrations were reduced to 2 and 20 nM LFA-I in the two divalent cation buffer conditions to maximize inhibition by ICAM-I-Ig.
  • the LFA-I binding and antagonist competition data were analyzed using a non linear least squares fit of a four-parameter equation with KaleidaGraph software (Synergy Software, Reading, PA) to obtain the EC 50 values for the LFA-I titration and the IC 50 values of the antagonists.
  • the data measured in both the homogeneous FP and heterogeneous ELISA formats described below contain relatively large signal to background ratios and the error estimates in the fits are typically less than 10% of the final value of the fitted parameter.
  • the equilibrium dissociation constants (K d ) of LFA-I for compound 1 with and without A-286982 were calculated using Klotz and Hill analyses (Panvera, 1995).
  • the affinities (Kj) of the antagonists for LFA-I were calculated using the IC 50 values, the K( J of compound 1 /LFA-I, and the concentrations of compound 1 and LFA-I in the competition experiments (Keating et al. 2000, Jacobs et al. 1975). .
  • Example 2 LFA-I /ICAM-I and LFA-1/Small Molecule Enzyme-Linked Immunosorbent Assays (ELISAs).
  • ELISAs LFA-I /ICAM-I and LFA-1/Small Molecule Enzyme-Linked Immunosorbent Assays.
  • Antagonist Competition Small molecules and sICAM-1 were assayed for the ability to disrupt binding of ICAM-I-Ig or a fluorescein-labeled small molecule antagonist, compound 2B, to LFA-I in a competitive format (Gadek et al.2002, Burdick 1999, Quan et al. 1998).
  • Compound 2B is similar to compound 1, but with a longer linker between the small molecule and fluorescein to maximize the binding of the anti-fluorescein detection antibody.
  • 96-well plates were coated with 5 ⁇ g/ml (33.3 nM) mouse anti-human B2 integrin (a non-function blocking antibody) in phosphate-buffered saline (PBS) overnight at 4 0 C.
  • the plates were blocked with assay buffer (20 mM Hepes, pH 7.2, 140 mM NaCl, 1 mM MnCl 2 , 0.5 % bovine serum albumin (BSA) and 0.05% Tween-20) for 1 hour at room temperature.
  • assay buffer (20 mM Hepes, pH 7.2, 140 mM NaCl, 1 mM MnCl 2 , 0.5 % bovine serum albumin (BSA) and 0.05% Tween-20
  • IC 50 values for each curve were determined by fitting to the four-parameter equation described above using KaleidaGraph software.
  • the format and results from this form of the LFA-l/ICAM-1 assay are similar to those previously reported (Gadek et al. 2002, Burdick 1999); however, this format is more robust due to antibody capture of the LFA-I rather than direct coating onto the ELISA plate.
  • the EC 50 values generated in the presence and absence of antagonist were analyzed by Schild regression (Arunlakshana and Schild 1959, Lutz and Kenakin 1999, Pratt and Taylor 1990, Matthews 1993, Kenakin, 1997).
  • Example 3 Crosslinking of a Radiolabeled, Photoactivatable Analogue of Compound 3 to LFA-I
  • LFA-I Full length human membrane-associated LFA-I or BSA (0.35 mg/mL [1.4 and 5.3 ⁇ M, respectively] in 20 inM Hepes, 150 mM NaCl, 5 mM CaCl 2 , 5 mM MgCl 2 , 1 mM MnCl 2 , and 1 % n-octylglucoside, pH 7.2) was incubated overnight at 37 0 C with 4.1 ⁇ M compound 5, a tritium-labeled photoactivatable analogue of compound 3 (Kauer et al.
  • Residual unlinked compound 5 was removed by gel filtration (G-25) as above.
  • the crosslinked complex was then denatured in 8 M guanidine hydrochloride (GuHCl) and reduced and alkylated.
  • the treated proteins were subjected to SDS-PAGE followed by Coomassie blue staining. Radiolabeled proteins were visualized by audioradiography.
  • the treated ⁇ L and B2 subunits were separated by size exclusion chromatography in the presence of 6 M GuHCl, 20 mM Hepes, 10 mM EDTA, pH 6.8 and then chemically cleaved with 2,6 M hydroxylamine in 10 % acetic acid with 7 M GuHCl for 4 h at 75 0 C.
  • CACTGTGGCGCCCTGGTTTTCAGGAAGGTAGTGGATCAGGCACAAGCAAACAGGACCTGACTTC 1 containing the sequence from the Narl site to the start of the I. domain, a sequence of DNA encoding GSGSG and the 23 bp of the ⁇ L sequence after the end of the I domain, and the reverse primer TCTGAGCCATGTGCTGGTATCGAGGGGC, which primes at the second PfIMl restriction site after the I domain.
  • PCR was performed using these primers and the pLFA.huID. ⁇ p linearized with BgI II, which cut at a site within the I domain.
  • a DNA fragment was amplified that contained the sequence from the Nar 1 site to the second PfIMl site and in which the entire I domain, from C125 through G311, was replaced with a DNA sequence encoding GSGSG.
  • This piece of DNA was purified, digested with Narl and PfIMl and inserted into the human ⁇ L plasmid (pRKLFA ⁇ m) at the corresponding Narl and PfIMl sites. Correct insertion of the DNA sequence encoding GSGSG was confirmed by sequence analysis.
  • 2 x 10 5 cells were added per well in a round bottom 96-well plate in adhesion buffer containing 0.5% BGG, 0.1 mM MnCl 2 , l ⁇ g/ml anti-B2 activating antibody MEM-48 and IuM compound 2B.
  • the cells were incubated for 1 hour at 37 0 C, washed with cold PBS and fixed with 1 % formaldehyde/PBS.
  • the cells were then incubated with a 1:500 dilution of sheep anti-fluorescein-HRP for 1 hour at room temperature, washed with PBS and incubated with TMB for 15 minutes.
  • the reaction was stopped with IM H 3 PO 4 and read at 450 nm.
  • transfectants were tested for the structural integrity of the surface-expressed ⁇ L/B2 complexes and for the presence or absence of the I domain by FACS analysis using a panel of antibodies with known binding epitopes (Edwards et al. 1998).
  • Example 6 Human T-CeIl Adhesion Assay (Cell Attachment Assay).
  • the T-cell adhesion assay is performed using a human T-lymphoid cell line HuT 78.
  • Goat anti-HuIgG Fc
  • Fc Goat anti-HuIgG
  • PBS 96-well plates
  • Plates are washed with PBS and blocked for 1 h at room temperature with 1% BSA in PBS.
  • 5 domain ICAM-Ig is diluted to 100 ng/ml in PBS and 50 ml/well was added to the plates O/N at 4 0 C.
  • HuT 78 cells are centrifuged at 100 g and the cell pellet is treated with 5 mM EDTA for about 5 minutes at 37°C in a 5% CO 2 incubator. Cells are washed in 0.14 M NaCl, 0.02 M Hepes, 0.2% glucose and 0.1 mM MnCl 2 (assay buffer) and centrifuged. The cells are resuspended in assay buffer to 3.0 x 10 6 c.ml. Inhibitors are diluted in assay buffer to a 2X final concentration and pre-incubated with HuT78 cells for 30 minutes at room temperature. 100 ⁇ l/well of cells and inhibitors are added to the plates and incubated at room temperature for I h.
  • This assay is an in vitro model of lymphocyte proliferation resulting from activation, induced by engagement of the T-cell receptor and LFA-I, upon interaction with antigen presenting cells.
  • Microliter plates (Nunc 96 well ELISA certified) are pre-coated overnight at 4°Cwith 50 ⁇ l of 2 ⁇ g/ml of goat anti-human Fc (Caltag H10700) and 50 ⁇ l of 0. 07 ⁇ g/rnl monoclonal antibody to CD3 (Immunotech 0178) in sterile PBS.
  • Monocytes are depleted using a myeloid cell depletion reagent method (Myeloclear, Labs, Hornby, Ontario, Canada). PBLs are resuspended in 90% heat-inactivated Fetal Bovine serum and 10% DMSO, aliquoted, and stored in liquid nitrogen.
  • cells are resuspended in RPMI 1640 medium (Gibco, Grand Island, NY) supplemented with 10% heat- inactivated Fetal Bovine serum (Intergen, Purchase, NY), ImM sodium pyruvate, 3 mM L-glutamine, ImM nonessential amino acids, 500 ⁇ g/ml penicillin, 50 ⁇ g/ml streptomycin, 50 ⁇ g/ml gentamycin (Gibco).
  • RPMI 1640 medium Gibco, Grand Island, NY
  • Fetal Bovine serum Intergen, Purchase, NY
  • ImM sodium pyruvate 3 mM L-glutamine
  • ImM nonessential amino acids 500 ⁇ g/ml penicillin, 50 ⁇ g/ml streptomycin, 50 ⁇ g/ml gentamycin (Gibco).
  • CD4+ T cells Purification of CD4+ T cells are obtained by negative selection method (Human CD4 Cell Recovery Column Kit # CLl 10-5 Accurate). 100,000 purified CD4+ T cells (90% purity) per microliter plate well are cultured for 72 hours at 37 0 C ' in 5% CO 2 in 100 ml of culture medium (RPMI 1640 (Gibco) supplemented with 10% heat inactivated FBS (Intergen), 0.1 mM non-essential amino acids, 1 nM Sodium Pyruvate, 100 units/ml Penicillin, 100 ⁇ g/ml Streptomycin, 50 ⁇ g/ml Gentamicin, 10 mM Hepes and 2 mM Glutarnine).
  • culture medium RPMI 1640 (Gibco) supplemented with 10% heat inactivated FBS (Intergen), 0.1 mM non-essential amino acids, 1 nM Sodium Pyruvate, 100 units/ml Penicillin, 100 ⁇ g/ml Streptomycin,
  • Inhibitors are added to the plate at the initiation of culture. Proliferative responses in these cultures are measured by addition of 1 ⁇ Ci/well titrated thymidine during the last 6 hours before harvesting of cells. Incorporation of radioactive label is measured by liquid scintillation counting (Packard 96 well harvester and counter). Results are expressed in counts per minute (cpm).
  • Example 8 In-Vitro Mixed Lymphocyte Culture Model.
  • the mixed lymphocyte culture model which is an in vitro model of transplantation (A. J. Cunningham, "Understanding Immunology, Transplantation Immunology” pages 157-159 (1978) examines the effects of various LFA-I antagonists in both the proliferative and effector arms of the human mixed lymphocyte response.
  • PBMC peripheral blood
  • PBMCs Mononuclear cells from peripheral blood (PBMC) are separated from heparanized whole blood drawn from healthy donors. Blood is diluted 1:1 with saline, layered, and centrifuged at x 250Og for 30 minutes on LSM (6.2 g Ficoll and 9.4 g sodium diztrizoate per 100 ml) (Organon Technica, NJ).
  • LSM 6.2 g Ficoll and 9.4 g sodium diztrizoate per 100 ml
  • An alternative method is to obtain whole blood from healthy donors through leukophoresis.
  • PBMCs are separated as above, resuspended in 90% heat inactivated Fetal Bovine serum and 10% DMSO, aliquoted and stored in liquid nitrogen.
  • cells are resuspended in RPMI 1640 medium (Gibco, Grand Island, NY) supplemented with 10% heat-inactivated Fetal Bovine serum (Intergen, Purchase, NY), 1 DiM sodium pyruvate, 3 mM L-glutamine, 1 mM nonessential amino acids, 500 ⁇ g/ml penicillin, 50 ⁇ g/ml streptomycin, 50 ⁇ g/ml gentamycin (Gibco).
  • MLR Mixed Lymphocyte Response
  • Dry eye is created in rabbits by surgically closing the lacrimal gland excretory duct, and allowing the rabbits to remain untreated for at least four weeks. See Gilbard, J.P, 1996 " Dry Eye: phramcological approaches, effects, and progress" CLAO J. 22, 141-145. After confirming dry eye by Schirmer test, and ocular surface staining, LFA-I antagonists of the invention is instilled as a solution at concentrations of 0,01, 0,1, and 1.0% in neutral, isotonic buffered aqueous solution. Administration is one 50 microliter drop to the ocular surface up to 5 times a day, every day for 4 weeks.
  • Example 10 Phase 1 Human Study
  • LFA-I antagonists Up to 56 healthy individuals are enrolled. A randomized, controlled, dose escalation trial of both single and multiple administrations of LFA-I antagonist is conducted. Cohorts of 7 subjects each ( 5 treatment, 2 placebo) are treated at each of 6-8 dose levels of LFA-I antagonists formulated as sterile, neutral, isotonic, buffered aqueous solutions. Subjects receive a single intra-ocular administration on Day 1. Samples are obtained for pharmacokinetic and pharmacodynamic assessments over the subsequent week. Starting Day 8, subjects receive the same dose of LFA-I antagonist daily for a total of 14 days. PK/PD assessments, safety laboratory studies, Schirmer testing, corneal staining and conjunctival biopsies are assessed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Ophthalmology & Optometry (AREA)
  • General Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Inorganic Chemistry (AREA)
  • Dermatology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Zoology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Biophysics (AREA)
PCT/US2006/019327 2005-05-17 2006-05-17 Compositions and methods for treatment of eye disorders Ceased WO2006125119A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
AU2006247136A AU2006247136C1 (en) 2005-05-17 2006-05-17 Compositions and methods for treatment of eye disorders
CN2006800171884A CN101175488B (zh) 2005-05-17 2006-05-17 治疗眼病的组合物和方法
HK08112183.4A HK1117083B (en) 2005-05-17 2006-05-17 Compositions and methods for treatment of eye disorders
DK06770607.7T DK1881823T3 (en) 2005-05-17 2006-05-17 COMPOSITION AND PROCEDURES FOR TREATMENT OF EYE DISORDERS
SI200631898T SI1881823T1 (sl) 2005-05-17 2006-05-17 Sestavki in postopki za zdravljenje bolezni oäśesa
PL06770607T PL1881823T3 (pl) 2005-05-17 2006-05-17 Kompozycje i sposoby leczenia chorób oczu
CA2609053A CA2609053C (en) 2005-05-17 2006-05-17 Compositions and methods for treatment of eye disorders
EP06770607.7A EP1881823B1 (en) 2005-05-17 2006-05-17 Compositions and methods for treatment of eye disorders
JP2008512519A JP5794721B2 (ja) 2005-05-17 2006-05-17 眼障害の治療のための組成物および方法
ES06770607T ES2530780T3 (es) 2005-05-17 2006-05-17 Composiciones y métodos para el tratamiento de trastornos oculares

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US68172205P 2005-05-17 2005-05-17
US68177205P 2005-05-17 2005-05-17
US68168405P 2005-05-17 2005-05-17
US68172305P 2005-05-17 2005-05-17
US60/681,723 2005-05-17
US60/681,722 2005-05-17
US60/681,684 2005-05-17
US60/681,772 2005-05-17

Publications (1)

Publication Number Publication Date
WO2006125119A1 true WO2006125119A1 (en) 2006-11-23

Family

ID=37431594

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/019327 Ceased WO2006125119A1 (en) 2005-05-17 2006-05-17 Compositions and methods for treatment of eye disorders

Country Status (15)

Country Link
US (34) US8168655B2 (https=)
EP (3) EP3195861A1 (https=)
JP (7) JP5794721B2 (https=)
CN (2) CN101175488B (https=)
AU (1) AU2006247136C1 (https=)
CA (3) CA2609053C (https=)
CY (1) CY1118660T1 (https=)
DK (2) DK2444079T3 (https=)
ES (2) ES2614080T3 (https=)
HU (1) HUE031979T2 (https=)
LT (1) LT2444079T (https=)
PL (2) PL2444079T3 (https=)
PT (2) PT1881823E (https=)
SI (2) SI1881823T1 (https=)
WO (1) WO2006125119A1 (https=)

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009139817A3 (en) * 2008-04-15 2010-01-07 Sarcode Corporation Crystalline pharmaceutical and methods of preparation and use thereof
US7700625B2 (en) 2005-04-13 2010-04-20 Astex Therapeutics Ltd. Hydroxybenzamide derivatives and their use as inhibitors of Hsp90
JP2011500683A (ja) * 2007-10-19 2011-01-06 サーコード コーポレーション 糖尿病性網膜症の治療のための組成物及び方法
US7879873B2 (en) 2008-09-26 2011-02-01 Boehringer Ingelheim International Gmbh Azaindazole compounds as CCR1 receptor antagonists
WO2011050175A1 (en) * 2009-10-21 2011-04-28 Sarcode Corporation Crystalline pharmaceutical and methods of preparation and use thereof
JP2011516607A (ja) * 2008-04-15 2011-05-26 サーコード コーポレイション 胃腸系へのlfa−1アンタゴニストの送達
JP2011518155A (ja) * 2008-04-15 2011-06-23 サーコード コーポレイション 免疫関連障害の局所治療に使用するためのエアゾール化lfa−1アンタゴニスト
JP2011521896A (ja) * 2008-04-15 2011-07-28 サーコード コーポレイション 免疫関連障害に対する局部治療に使用するための局所lfa−1アンタゴニスト
US8008327B2 (en) 2008-04-29 2011-08-30 Boehringer Ingelheim International Gmbh Indazole compounds as CCR1 receptor antagonists
US8106057B2 (en) 2006-03-01 2012-01-31 Astex Therapeutics, Ltd. Dihydroxyphenyl isoindolylmethanones
US8293917B2 (en) 2008-05-06 2012-10-23 Boehringer Ingelheim International Gmbh Pyrazole compounds as CCR1 antagonists
WO2013110679A1 (en) * 2012-01-27 2013-08-01 F. Hoffmann-La Roche Ag Integrin antagonist conjugates for targeted delivery to cells expressing lfa-1
US8546442B2 (en) 2010-12-23 2013-10-01 Boehringer Ingelheim International Gmbh Pyrazolopiperidine compounds as CCR1 receptor antagonists
US8592450B2 (en) 2005-05-17 2013-11-26 Sarcode Bioscience Inc. Compositions and methods for treatment of eye disorders
US8648066B2 (en) 2009-05-22 2014-02-11 Exelixis, Inc. Benzoxazepines as inhibitors of PI3K/mTOR and methods of their use and manufacture
US8871786B2 (en) 2010-04-30 2014-10-28 Boehringer Ingelheim International Gmbh Azaindazole amide compounds as CCR1 receptor antagonists
US8883790B2 (en) 2006-10-12 2014-11-11 Astex Therapeutics Limited Pharmaceutical combinations
US8889730B2 (en) 2012-04-10 2014-11-18 Pfizer Inc. Indole and indazole compounds that activate AMPK
US8916552B2 (en) 2006-10-12 2014-12-23 Astex Therapeutics Limited Pharmaceutical combinations
US8927550B2 (en) 2009-10-27 2015-01-06 Boehringer Ingelheim International Gmbh Heterocyclic compounds as CCR1 receptor antagonists
US8952034B2 (en) 2009-07-27 2015-02-10 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US8962610B2 (en) 2011-07-01 2015-02-24 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9056858B2 (en) 2009-10-21 2015-06-16 Boehringer Ingelheim International Gmbh Indazole and pyrazolopyridine compounds as CCR1 receptor antagonists
US9079901B2 (en) 2010-07-02 2015-07-14 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9085553B2 (en) 2012-07-25 2015-07-21 SARcode Bioscience, Inc. LFA-1 inhibitor and methods of preparation and polymorph thereof
US9115096B2 (en) 2011-05-10 2015-08-25 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9193694B2 (en) 2011-07-01 2015-11-24 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9216174B2 (en) 2003-11-05 2015-12-22 Sarcode Bioscience Inc. Modulators of cellular adhesion
US9394285B2 (en) 2013-03-15 2016-07-19 Pfizer Inc. Indole and indazole compounds that activate AMPK
US9428439B2 (en) 2006-10-12 2016-08-30 Astex Therapeutics Ltd. Hydrobenzamide derivatives as inhibitors of Hsp90
WO2017006272A1 (en) 2015-07-08 2017-01-12 Glaxosmithkline Intellectual Property Limited Pharmaceutical compositions comprising an integrin alpha4 antagonist for use in treating ocular inflammatory conditions
US9730912B2 (en) 2006-10-12 2017-08-15 Astex Therapeutics Limited Pharmaceutical compounds
WO2019020580A1 (en) 2017-07-24 2019-01-31 Interquim, S.A. PROCESS FOR PREPARING AND PURIFYING LIFITEGRAST ANTAGONIST OF LFA-1
WO2019096996A1 (en) 2017-11-17 2019-05-23 Medichem, S.A. A process to obtain a tetrahydroisoquinoline derivative
US10689371B2 (en) 2018-04-18 2020-06-23 Constellation Pharmaceuticals, Inc. Modulators of methyl modifying enzymes, compositions and uses thereof
RU2778771C2 (ru) * 2012-07-25 2022-08-24 Новартис Аг Ингибитор ассоциированного с функцией лимфоцитов антигена-1 (lfa-1), способы его получения и его полиморф
US11459338B2 (en) 2017-11-24 2022-10-04 Jubilant Episcribe Llc Heterocyclic compounds as PRMT5 inhibitors
US11529341B2 (en) 2018-03-13 2022-12-20 Jubilant Prodel LLC Bicyclic compounds as inhibitors of PD1/PD-L1 interaction/activation
US11629135B2 (en) 2017-11-06 2023-04-18 Jubilant Prodell Llc Pyrimidine derivatives as inhibitors of PD1/PD-L1 activation
US11833156B2 (en) 2017-09-22 2023-12-05 Jubilant Epipad LLC Heterocyclic compounds as pad inhibitors
US11919912B2 (en) 2018-05-21 2024-03-05 Constellation Pharmaceuticals, Inc. Modulators of methyl modifying enzymes, compositions and uses thereof
US12516040B2 (en) 2019-07-24 2026-01-06 Constellation Pharmaceuticals, Inc. Crystalline forms of 7-chloro-2-(4-3-methoxyazetidin-1-yl)cyclohexyl)-2,4-dimethyl-N-((6-methyl-4-(methylthio)-2-oxo-1,2-dihydropyridin-3-yl)methyl)benzo[d][1,3]dioxole-5-carboxamide

Families Citing this family (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7202209B2 (en) * 2005-07-13 2007-04-10 Allergan, Inc. Cyclosporin compositions
KR100930467B1 (ko) * 2007-06-07 2009-12-08 동아제약주식회사 점액분비를 촉진시키는 3',4',5-트리메톡시 플라본 유도체화합물, 그의 제조방법 및 약학적 용도
CN105943534A (zh) * 2008-04-15 2016-09-21 萨可德生物科学公司 用于局部治疗免疫相关疾病的局部lfa-1拮抗剂
US8506944B2 (en) 2008-05-07 2013-08-13 The Regents Of The University Of California Replenishment and enrichment of ocular surface lubrication
HUE024146T2 (en) 2008-05-07 2016-02-29 Univ California Medical filling and enrichment of eye surface lubrication
WO2011071730A1 (en) * 2009-12-08 2011-06-16 Boehringer Ingelheim International Gmbh Process for synthesis of intermediates useful for making substituted indazole and azaindazole compounds
US11407713B2 (en) 2011-01-03 2022-08-09 The William M. Yarbrough Foundation Isothiocyanate functional surfactants, formulations incorporating the same, and associated methods of use
US10640464B2 (en) 2011-01-03 2020-05-05 The William M. Yarbrough Foundation Use of isothiocyanate functional surfactants as Nrf2 inducers to treat epidermolysis bullosa simplex and related diseases
US11279674B2 (en) 2011-01-03 2022-03-22 The William M. Yarbrough Foundation Isothiocyanate functional surfactant and associated method of use
US10647668B2 (en) 2011-01-03 2020-05-12 The William M. Yarbrough Foundation Isothiocyanate functional surfactant and associated method of use
US9962361B2 (en) 2011-01-03 2018-05-08 The William M. Yarbrough Foundation Isothiocyanate functional surfactants, formulations incorporating the same, and associated methods of use
US10308599B2 (en) 2011-01-03 2019-06-04 The William M. Yarbrough Foundation Isothiocyanate functional surfactants, formulations incorporating the same, and associated methods of use
US8933119B2 (en) 2011-01-03 2015-01-13 The William M. Yarbrough Foundation Method for treating phytophotodermatitis
US10273205B2 (en) 2011-01-03 2019-04-30 The William M. Yarbrough Foundation Isothiocyanate functional surfactants, formulations incorporating isothiocyanate functional surfactants and associated methods for treating biofilms
US8865765B2 (en) 2011-01-12 2014-10-21 The William M. Yarbrough Foundation Method for treating eczema
US9532969B2 (en) 2011-02-08 2017-01-03 The William M. Yarbrough Foundation Method for treating psoriasis
US9839621B2 (en) 2012-07-26 2017-12-12 The William M. Yarbrough Foundation Method for treating bladder cancer
US10434082B2 (en) 2012-07-26 2019-10-08 The William M. Yarbrough Foundation Isothiocyanate functional compounds augmented with secondary antineoplastic medicaments and associated methods for treating neoplasms
US9949943B2 (en) 2012-07-26 2018-04-24 The William M. Yarbrough Foundation Method for treating neurodegenerative diseases
US10434081B2 (en) 2012-07-26 2019-10-08 The William M. Yarbrough Foundation Inhibitors of macrophage migration inhibitory factor
US10080734B2 (en) 2012-07-26 2018-09-25 The William M. Yarbrough Foundation Method for treating autism and other neurodevelopmental disorders
US10441561B2 (en) 2012-07-26 2019-10-15 The William M. Yanbrough Foundation Method for treating benign prostatic hyperplasia (BPH), prostatitis, and prostate cancer
WO2014018874A1 (en) 2012-07-26 2014-01-30 The William M. Yarbrough Foundation Method for treating skin cancer
US10335387B2 (en) 2012-07-26 2019-07-02 The William M. Yarbrough Foundation Method for treating infectious diseases with isothiocyanate functional compounds
US20150367004A1 (en) * 2012-12-10 2015-12-24 Molecular Targeting Technologies, Inc. Compositions and methods of diagnosing ocular diseases
BR112015014367B1 (pt) * 2012-12-19 2022-11-22 Novartis Ag Composição inibidora de lfa-1, método para estabilizar a dita composição e uso da mesma para tratar uma doença ocular
CN113230021A (zh) 2015-01-12 2021-08-10 科达莱昂治疗公司 微滴递送设备和方法
CN106995439B (zh) * 2016-01-26 2019-09-20 镇江圣安医药有限公司 氘取代3-(甲磺酰基)-l-苯丙氨酸衍生物及其药物组合物、药物制剂和用途
WO2017152027A1 (en) 2016-03-04 2017-09-08 Rynerson James M Method of treating an eye disorder by inhibiting or disrupting bacterial biofilm formation
US11242367B2 (en) 2016-08-12 2022-02-08 Silk Technologies, Ltd. Silk-derived protein for treating inflammation
WO2018035469A1 (en) 2016-08-19 2018-02-22 Akrivista, LLC Methods of diagnosing and treating dry eye syndrome and compositions for treating a human eye
US9981041B2 (en) * 2016-08-23 2018-05-29 Ira Jason Salzman Ophthalmic lubricating spray
US10098895B2 (en) * 2016-09-07 2018-10-16 Glia, Llc Treatment of symptoms related to neurodegenerative disorders through pharmacological dermal activation of cranial nerves
CN109906120A (zh) 2017-01-20 2019-06-18 科达莱昂治疗公司 压电流体分配器
CN109134533B (zh) * 2017-06-27 2020-08-11 维眸生物科技(上海)有限公司 一种含磷化合物及其制备和应用
JP7311160B2 (ja) 2017-08-18 2023-07-19 アクリビスタ エルエルシー ドライアイ症候群を診断及び処置する方法及びヒトの眼を処置するための組成物
WO2019097547A1 (en) 2017-11-15 2019-05-23 Cipla Limited An improved process for the preparation of lifitegrast or salts thereof
WO2019113483A1 (en) 2017-12-08 2019-06-13 Kedalion Therapeutics, Inc. Fluid delivery alignment system
US12350194B1 (en) 2018-04-12 2025-07-08 Bausch + Lomb Ireland Limited Topical ocular delivery of fluids with controlled mass dosing and wireless communication
US20190314197A1 (en) 2018-04-12 2019-10-17 Kedalion Therapeutics, Inc. Topical Ocular Delivery Methods and Devices for Use in the Same
WO2020010116A1 (en) 2018-07-03 2020-01-09 Kedalion Therapeutics, Inc. Topical ocular delivery devices and methods for using the same
US11166910B2 (en) * 2019-01-25 2021-11-09 Nordiccan A/S Cannabinoid chewing gum with sugar alcohols
US12097145B2 (en) 2019-03-06 2024-09-24 Bausch + Lomb Ireland Limited Vented multi-dose ocular fluid delivery system
US11679028B2 (en) 2019-03-06 2023-06-20 Novartis Ag Multi-dose ocular fluid delivery system
JP7700045B2 (ja) 2019-04-18 2025-06-30 アズーラ オフサルミックス エルティーディー. 眼障害を処置するための化合物および方法
EP3958915A4 (en) * 2019-04-22 2023-01-11 Allegro Ophthalmics, LLC COMPOSITIONS AND METHODS USABLE FOR THE TREATMENT OF DRY EYE
EP4003363A4 (en) * 2019-07-25 2023-08-16 North Carolina State University INTERLINKING COMPOUNDS AND METHODS OF USE THEREOF
US12496218B1 (en) 2019-11-12 2025-12-16 Bausch + Lomb Ireland Limited Fractionated topical ocular drug delivery methods and devices for use in the same
AU2020419590A1 (en) 2019-11-15 2022-06-30 Silk Technologies, Ltd. Stable formulations of silk-derived protein
CN115768384A (zh) 2020-04-17 2023-03-07 科达隆治疗公司 流体动力致动的不含防腐剂分配系统
US12290472B2 (en) 2020-04-17 2025-05-06 Bausch + Lomb Ireland Limited Hydrodynamically actuated preservative free dispensing system
EP4120973A4 (en) 2020-04-17 2024-04-17 Bausch + Lomb Ireland Limited Hydrodynamically actuated preservative free dispensing system having a collapsible liquid reservoir
US11938057B2 (en) 2020-04-17 2024-03-26 Bausch + Lomb Ireland Limited Hydrodynamically actuated preservative free dispensing system
US11459351B1 (en) 2021-04-05 2022-10-04 Azura Ophthalmics Ltd. Compounds and methods for the treatment of ocular disorders
US11213551B1 (en) 2021-04-05 2022-01-04 Korb Research, Llc. Ocular treatment compositions and methods of use thereof
CN115707698A (zh) * 2021-08-18 2023-02-21 辽宁何氏医学院 5,7-二氯-1,2,3,4-四氢异喹啉-6-甲酰胺类化合物及其制备方法和应用
WO2023201283A2 (en) * 2022-04-13 2023-10-19 The Regents Of The University Of California Methods of producing plasma or serum and uses thereof
CN119895319A (zh) * 2022-09-15 2025-04-25 日油株式会社 用于接触镜片的溶液
WO2024215778A1 (en) * 2023-04-10 2024-10-17 Insitu Biologics, Inc. Sustained release stable emulsion pharmaceutical formulations
WO2025223511A1 (zh) * 2024-04-25 2025-10-30 上海翊石医药科技有限公司 一类苯甲酰基甘氨酸衍生物及其制备方法和应用

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4992445A (en) 1987-06-12 1991-02-12 American Cyanamid Co. Transdermal delivery of pharmaceuticals
US5001139A (en) 1987-06-12 1991-03-19 American Cyanamid Company Enchancers for the transdermal flux of nivadipine
US5023252A (en) 1985-12-04 1991-06-11 Conrex Pharmaceutical Corporation Transdermal and trans-membrane delivery of drugs
US5747035A (en) 1995-04-14 1998-05-05 Genentech, Inc. Polypeptides with increased half-life for use in treating disorders involving the LFA-1 receptor
US5843885A (en) 1994-04-19 1998-12-01 The University Of Kansas ICAM-1/LFA-1 short-chain peptides and method of using same
WO1999049856A2 (en) 1998-03-27 1999-10-07 Genentech, Inc. Antagonists for treatment of cd11/cd18 adhesion receptor mediated disorders
WO2000021920A1 (en) 1998-10-13 2000-04-20 F. Hoffmann-La Roche Ag Diaminopropionic acid derivatives
WO2001058853A1 (en) 2000-02-09 2001-08-16 F. Hoffmann-La Roche Ag Dehydroamino acids
WO2002059114A1 (en) 2000-11-28 2002-08-01 Genentech, Inc. Lfa-1 antagonist compounds
US6630447B2 (en) 2000-01-14 2003-10-07 University Of New Mexico Peptide inhibitors of LFA-1/ICAM-1 interaction
US6630492B1 (en) 1997-08-28 2003-10-07 Novartis Ag Lymphocyte function antigen-1 antagonists
WO2005044817A1 (en) 2003-11-05 2005-05-19 Sunesis Pharmaceuticals, Inc. Modulators of cellular adhesion

Family Cites Families (108)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US744A (en) * 1838-05-17 Mode of cutting off steam in steam-engines
US423439A (en) * 1890-03-18 Stove-pipe guard and register
GB138135A (en) * 1918-08-13 1920-02-05 Hugh William Gabbett Fairfax Improvements in automatic firearms
US1680610A (en) * 1926-09-16 1928-08-14 Mary Y Harmon Batik-frame support
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
US3876444A (en) * 1970-04-24 1975-04-08 Gen Electric Method of treating high strength carbon fibers
IE52535B1 (en) 1981-02-16 1987-12-09 Ici Plc Continuous release pharmaceutical compositions
US4931279A (en) * 1985-08-16 1990-06-05 Bausch & Lomb Incorporated Sustained release formulation containing an ion-exchange resin
US4713244A (en) 1985-08-16 1987-12-15 Bausch & Lomb Incorporated Sustained-release formulation containing an amino acid polymer with a lower alkyl (C1 -C4) polar solvent
US4668506A (en) 1985-08-16 1987-05-26 Bausch & Lomb Incorporated Sustained-release formulation containing and amino acid polymer
GB2209937B (en) 1987-09-21 1991-07-03 Depiopharm S A Water insoluble polypeptides
DE3852374T2 (de) 1987-11-02 1995-05-04 Baylor College Medicine Verwendung von ICAM-1 oder ihre funktionelle Derivate zur Behandlung unspezifischer Entzündungen.
CA1338839C (en) 1988-01-29 1997-01-14 Yoshio Sasaki Controlled release formulation
DE3802996A1 (de) 1988-02-02 1989-08-10 Cassella Ag Verwendung von 2-oxo-pyrrolidin-1-acetamid zur bestimmung der glomerulaeren filtrationsrate beim menschen
US5424399A (en) 1988-06-28 1995-06-13 The Children's Medical Center Corporation Human CR3α/β heterodimers
DE68923048T2 (de) 1988-08-23 1995-11-16 Dana Farber Cancer Inst Inc Alpha-Subeinheit des LFA-1-Leukocyt-Adhäsions-Rezeptors.
ES2141076T3 (es) 1988-09-01 2000-03-16 Bayer Ag Proteina del receptor de rinovirus humano que inhibe la infectividad del virus.
AU4412889A (en) 1988-09-28 1990-04-18 Dana-Farber Cancer Institute Intercellular adhesion molecules, and their binding ligands
US5149780A (en) 1988-10-03 1992-09-22 The Scripps Research Institute Peptides and antibodies that inhibit integrin-ligand binding
JPH04505009A (ja) 1989-03-09 1992-09-03 ダナ・ファーバー・キャンサー・インスティチュート クローニングlfa―1
ZA903223B (en) 1989-04-28 1991-02-27 Baylor College Medicine Dissemination of hiv-1 infected cells
CH679207A5 (https=) * 1989-07-28 1992-01-15 Debiopharm Sa
WO1991019511A1 (en) 1990-06-18 1991-12-26 The General Hospital Corporation CONTROLLING CELLULAR IMMUNE/INFLAMMATORY RESPONSES WITH β2 INTEGRINS
CA2046830C (en) 1990-07-19 1999-12-14 Patrick P. Deluca Drug delivery system involving inter-action between protein or polypeptide and hydrophobic biodegradable polymer
US5318965A (en) 1990-08-24 1994-06-07 Abbott Laboratories Quinobenzoxazine, antineoplastic agents
WO1992003473A1 (en) 1990-08-27 1992-03-05 Cetus Corporation Cd18 peptide medicaments for the treatment of disease
JP2995860B2 (ja) 1990-11-27 1999-12-27 味の素株式会社 新規ペプチド
US5288854A (en) 1990-11-28 1994-02-22 Center For Blood Research, Inc. Functional derivatives of ICAM-1 which are substantially capable of binding to LFA-1 but are substantially incapable of binding to MAC-1
CH683149A5 (fr) 1991-07-22 1994-01-31 Debio Rech Pharma Sa Procédé pour la préparation de microsphères en matériau polymère biodégradable.
DE69229275T2 (de) * 1991-10-04 1999-12-30 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Rockville Herstellung eines arzneimittels zur behandlung von augenentzündung durch blockierung von zelladhäsionsmolekulen
GB9211268D0 (en) 1992-05-28 1992-07-15 Ici Plc Salts of basic peptides with carboxyterminated polyesters
US5298492A (en) 1992-08-04 1994-03-29 Schering Corporation Diamino acid derivatives as antihypertensives
AU687755B2 (en) 1992-08-21 1998-03-05 Genentech Inc. Method for treating an LFA-1-mediated disorder
WO1994011400A1 (en) 1992-11-18 1994-05-26 Helsinki University Licensing Ltd. Oy Peptides from human icam-2 and from human icam-1 and their analogs for use in therapy and diagnosis
DK0678018T3 (da) 1993-01-06 2003-04-28 Kinerton Ltd Ion molekylærkonjugater af bionedbrydelige polyestere og bioaktive polypeptider
US5672659A (en) 1993-01-06 1997-09-30 Kinerton Limited Ionic molecular conjugates of biodegradable polyesters and bioactive polypeptides
US5424289A (en) * 1993-07-30 1995-06-13 Alza Corporation Solid formulations of therapeutic proteins for gastrointestinal delivery
US5397791A (en) 1993-08-09 1995-03-14 Merck & Co., Inc. Fibrinogen receptor antagonists
PT656348E (pt) 1993-12-03 2000-10-31 Hoffmann La Roche Derivados do acido acetico como medicamentos
US5470953A (en) 1993-12-23 1995-11-28 Icos Corporation Human β2 integrin α subunit
US5849327A (en) 1994-07-29 1998-12-15 Advanced Polymer Systems, Inc. Delivery of drugs to the lower gastrointestinal tract
US5585359A (en) 1994-09-29 1996-12-17 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
DK0710657T3 (da) 1994-11-02 1999-05-25 Merck Patent Gmbh Adhæsionsreceptor-antagonister
US5612052A (en) 1995-04-13 1997-03-18 Poly-Med, Inc. Hydrogel-forming, self-solvating absorbable polyester copolymers, and methods for use thereof
FI974368A7 (fi) * 1995-05-29 1997-11-28 Pfizer Kasvuhormonin vapautumista edistäviä dipeptidejä
US5877224A (en) 1995-07-28 1999-03-02 Rutgers, The State University Of New Jersey Polymeric drug formulations
US5980945A (en) 1996-01-16 1999-11-09 Societe De Conseils De Recherches Et D'applications Scientifique S.A. Sustained release drug formulations
US5840332A (en) * 1996-01-18 1998-11-24 Perio Products Ltd. Gastrointestinal drug delivery system
WO1997040085A2 (en) 1996-04-23 1997-10-30 Kinerton Limited Acidic polylactic polymers
HRP970493A2 (en) 1996-09-23 1998-08-31 Wienman E. Phlips Oral delayed immediate release medical formulation and method for preparing the same
CA2217134A1 (en) * 1996-10-09 1998-04-09 Sumitomo Pharmaceuticals Co., Ltd. Sustained release formulation
IL129344A0 (en) 1996-11-27 2000-02-17 Du Pont Pharm Co Novel integrin receptor antagonists
US5968895A (en) * 1996-12-11 1999-10-19 Praecis Pharmaceuticals, Inc. Pharmaceutical formulations for sustained drug delivery
US5893985A (en) 1997-03-14 1999-04-13 The Lincoln Electric Company Plasma arc torch
AR012443A1 (es) 1997-04-16 2000-10-18 Uriach & Cia Sa J Nuevas carboxamidas como inhibidores de la agregacion plaquetaria, procedimiento para su preparacion, composiciones farmaceuticas que loscontienen y uso de los mismos en la manufactura de medicamentos
DE69900207T2 (de) * 1998-07-14 2001-11-22 Alcon Laboratories, Inc. Verwendung von 11-(3-dimethylaminopropyliden)-6,11-dihydrodibenz[b,e]oxepin-2-essigsäure und deren pharmazeutisch annehmbaren salzen zur herstellung eines medikaments zur behandlung nicht-allergisch-bedingten augenentzündungen und zur prevention der okularen neovaskularisation
MXPA01005346A (es) 1998-11-27 2003-03-27 Kanji Takada Una formulacion oral para suministro de farmaco gastrointestinal.
IT1304152B1 (it) * 1998-12-10 2001-03-08 Mediolanum Farmaceutici Srl Composizioni comprendenti un peptide ed acido polilattico-glicolicoatte alla preparazione di impianti sottocutanei aventi un prolungato
US6670321B1 (en) 1998-12-30 2003-12-30 The Children's Medical Center Corporation Prevention and treatment for retinal ischemia and edema
WO2000040262A1 (en) 1999-01-05 2000-07-13 The Flinders University Of South Australia Novel agents and methods for treatment and diagnosis of ocular disorders
AU2847200A (en) 1999-01-27 2000-08-18 G.D. Searle & Co. Novel hydroxyamidino carboxylate derivatives useful as nitric oxide synthase inhibitors
EP1028114A1 (en) 1999-02-13 2000-08-16 Aventis Pharma Deutschland GmbH Novel guanidine derivatives as inhibitors of cell adhesion
EP1169024B1 (en) 1999-03-31 2005-12-21 Janssen Pharmaceutica N.V. Pregelatinized starch in a controlled release formulation
EP1194128A2 (en) 1999-06-23 2002-04-10 Sedum Laboratories Ionically formulated biomolecule microcarriers
AU767837B2 (en) 1999-08-18 2003-11-27 Ipsen Pharma S.A.S. Sustained release formulation of a peptide
ECSP003707A (es) 1999-10-13 2002-05-23 Novartis Ag Diazepanes
DE60037822D1 (de) * 1999-10-22 2008-03-06 Biogen Idec Inc Verwendung eines cd40:cd154 bindungs-unterbrechers zur behandlung immunologischer komplikationen des auges
US6294522B1 (en) 1999-12-03 2001-09-25 Cv Therapeutics, Inc. N6 heterocyclic 8-modified adenosine derivatives
US6605597B1 (en) 1999-12-03 2003-08-12 Cv Therapeutics, Inc. Partial or full A1agonists-N-6 heterocyclic 5′-thio substituted adenosine derivatives
PT1237575E (pt) * 1999-12-14 2008-11-17 Genentech Inc Antagonista de tnf-alfa e antagonista de lfa-1 para tratar a artrite reumatóide
CA2395892C (en) 1999-12-31 2014-06-03 Rutgers, The State University Pharmaceutical formulation composed of a polymer blend and an active compound for time-controlled release
US7521061B2 (en) * 1999-12-31 2009-04-21 Rutgers, The State University Of New Jersey Pharmaceutical formulation for regulating the timed release of biologically active compounds based on a polymer matrix
AU784226B2 (en) 1999-12-31 2006-02-23 Rutgers, The State University Pharmaceutical formulation for regulating the timed release of biologically active compounds based on a polymer matrix
US20030064105A1 (en) 2000-08-25 2003-04-03 Myung-Jin Kim Lipophilic-coated microparticle containing a protein drug and formulation comprising same
JP2003532703A (ja) 2000-05-05 2003-11-05 ソシエテ・ド・コンセイユ・ド・ルシエルシエ・エ・ダアツプリカーション・シヤンテイフイツク・(エス.セー.エール.アー.エス) 新規アミノ酸誘導体及びその医薬としての使用
GB0011817D0 (en) 2000-05-16 2000-07-05 Pharmacia & Upjohn Spa Antagonists of integrin receptors
EP1294704A1 (en) 2000-06-29 2003-03-26 Abbott Laboratories Aryl phenylheterocyclyl sulfide derivatives and their use as cell adhesion-inhibiting anti-inflammatory and immune-suppressive agents
PE20020420A1 (es) 2000-10-02 2002-06-27 Novartis Ag Derivados de diazacicloalcanodiona como antagonistas del antigeno asociado a la funcion del linfocito-1 (lfa-1)
GB0025208D0 (en) 2000-10-13 2000-11-29 Euro Celtique Sa Delayed release pharmaceutical formulations
US6653478B2 (en) 2000-10-27 2003-11-25 Ortho-Mcneil Pharmaceutical, Inc. Substituted benzimidazol-2-ones as vasopressin receptor antagonists and neuropeptide Y modulators
DE10055857A1 (de) 2000-11-10 2002-08-22 Creative Peptides Sweden Ab Dj Neue pharmazeutische Depotformulierung
GB0028367D0 (en) 2000-11-21 2001-01-03 Celltech Chiroscience Ltd Chemical compounds
WO2002050080A1 (en) 2000-12-19 2002-06-27 Boehringer Ingelheim Pharmaceuticals, Inc. Small molecules useful in the treatment of inflammatory disease
WO2002058672A2 (en) 2001-01-26 2002-08-01 Debio Recherche Pharmaceutique S.A. Microparticles of biodegradable polymer encapsulating a biologically active substance
ATE348829T1 (de) 2001-02-06 2007-01-15 Pfizer Prod Inc Pharmazeutische zusammensetzungen zur behandlung von störungen des zns oder anderen erkrankungen
AU2002250236A1 (en) 2001-03-02 2002-09-19 Medimmune, Inc. Cd2 antagonists for treatment of autoimmune or inflammatory disease
US20020176841A1 (en) 2001-03-19 2002-11-28 Praecis Pharmaceuticals Inc. Pharmaceutical formulations for sustained release
US6872382B1 (en) 2001-05-21 2005-03-29 Alcon, Inc. Use of selective PDE IV inhibitors to treat dry eye disorders
JP4583751B2 (ja) 2001-06-06 2010-11-17 アベンティス・フアーマ・リミテッド 炎症性疾患の治療に使用するための置換されたテトラヒドロイソキノリン
KR20040066177A (ko) 2001-12-19 2004-07-23 알자 코포레이션 친수성 거대분자의 경구 생체이용률을 증가시키기 위한제형 및 투여 형태
CN1638732A (zh) 2002-03-04 2005-07-13 研究及应用科学协会股份有限公司 含载体肽的缓释药物制剂
AU2003250482A1 (en) 2002-08-13 2004-02-25 Warner-Lambert Company Llc Phthalimide derivatives as matrix metalloproteinase inhibitors
EP1542768A1 (en) 2002-09-20 2005-06-22 Alcon, Inc. Use of cytokine synthesis inhibitors for the treatment of dry eye disorders
US7785578B2 (en) 2002-10-11 2010-08-31 Aciont, Inc. Non-invasive ocular drug delivery
US7544699B2 (en) 2003-08-08 2009-06-09 Transtech Pharma, Inc. Aryl and heteroaryl compounds, compositions, and methods of use
US7501538B2 (en) 2003-08-08 2009-03-10 Transtech Pharma, Inc. Aryl and heteroaryl compounds, compositions and methods of use
WO2005042710A1 (en) * 2003-10-28 2005-05-12 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Use of statin to kill ebv-transformed b cells
GT200500139A (es) 2004-06-08 2005-07-25 Metodo para la preparacion de acidos hidroxamicos
DK2444079T3 (en) 2005-05-17 2017-01-30 Sarcode Bioscience Inc Compositions and Methods for the Treatment of Eye Diseases
US7541420B2 (en) * 2006-06-30 2009-06-02 Sabic Innovative Plastics Ip B.V. Method for making molded polycarbonate articles with improved color
JP4193895B2 (ja) 2006-10-12 2008-12-10 横河電機株式会社 欠陥検査装置
ES2830024T3 (es) 2007-10-19 2021-06-02 Novartis Ag Composiciones y métodos para el tratamiento del edema macular
WO2009139817A2 (en) 2008-04-15 2009-11-19 Sarcode Corporation Crystalline pharmaceutical and methods of preparation and use thereof
WO2009128934A1 (en) 2008-04-15 2009-10-22 Sarcode Corporation Topical lfa-1 antagonists for use in localized treatment of immune related disorders
WO2009128932A1 (en) 2008-04-15 2009-10-22 Sarcode Corporation Delivery of lfa-1 antagonists to the gastrointestinal system
US8337942B2 (en) * 2009-08-28 2012-12-25 Minsek David W Light induced plating of metals on silicon photovoltaic cells
WO2011050175A1 (en) * 2009-10-21 2011-04-28 Sarcode Corporation Crystalline pharmaceutical and methods of preparation and use thereof
KR20200108932A (ko) * 2012-07-25 2020-09-21 에스에이알코드 바이오사이언스 인코포레이티드 Lfa-1 저해제 및 그의 다형체

Patent Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5023252A (en) 1985-12-04 1991-06-11 Conrex Pharmaceutical Corporation Transdermal and trans-membrane delivery of drugs
US5001139A (en) 1987-06-12 1991-03-19 American Cyanamid Company Enchancers for the transdermal flux of nivadipine
US4992445A (en) 1987-06-12 1991-02-12 American Cyanamid Co. Transdermal delivery of pharmaceuticals
US5843885A (en) 1994-04-19 1998-12-01 The University Of Kansas ICAM-1/LFA-1 short-chain peptides and method of using same
US5747035A (en) 1995-04-14 1998-05-05 Genentech, Inc. Polypeptides with increased half-life for use in treating disorders involving the LFA-1 receptor
US6630492B1 (en) 1997-08-28 2003-10-07 Novartis Ag Lymphocyte function antigen-1 antagonists
WO1999049856A2 (en) 1998-03-27 1999-10-07 Genentech, Inc. Antagonists for treatment of cd11/cd18 adhesion receptor mediated disorders
US20040006236A1 (en) 1998-10-13 2004-01-08 Nader Fotouhi Diaminopropionic acid derivatives
WO2000021920A1 (en) 1998-10-13 2000-04-20 F. Hoffmann-La Roche Ag Diaminopropionic acid derivatives
US20050080119A1 (en) 1998-10-13 2005-04-14 Nader Fotouhi Diaminopropionic acid derivatives
US6803384B2 (en) 1998-10-13 2004-10-12 Hoffmann-La Roche Inc. Diaminopropionic acid derivatives
US6331640B1 (en) 1998-10-13 2001-12-18 Hoffmann-La Roche Inc. Diaminopropionic acid derivatives
US6630447B2 (en) 2000-01-14 2003-10-07 University Of New Mexico Peptide inhibitors of LFA-1/ICAM-1 interaction
US6515124B2 (en) 2000-02-09 2003-02-04 Hoffman-La Roche Inc. Dehydroamino acids
WO2001058853A1 (en) 2000-02-09 2001-08-16 F. Hoffmann-La Roche Ag Dehydroamino acids
US6667318B2 (en) 2000-11-28 2003-12-23 Genentech, Inc. LFA-1 antagonist compounds
US20040058968A1 (en) 2000-11-28 2004-03-25 Genentech, Inc. LFA-1 antagonist compounds
US20020119994A1 (en) 2000-11-28 2002-08-29 Genentech, Inc LFA-1 Antagonist compounds
US6872735B2 (en) 2000-11-28 2005-03-29 Genentech, Inc. LFA-1 antagonist compounds
WO2002059114A1 (en) 2000-11-28 2002-08-01 Genentech, Inc. Lfa-1 antagonist compounds
WO2005044817A1 (en) 2003-11-05 2005-05-19 Sunesis Pharmaceuticals, Inc. Modulators of cellular adhesion

Non-Patent Citations (63)

* Cited by examiner, † Cited by third party
Title
A. J. CUNNINGHAM, UNDERSTANDING IMMUNOLOGY, TRANSPLANTATION IMMUNOLOGY, 1978, pages 157 - 159
BERLIN ET AL., TRANSPLANTATION, vol. 53, 1992, pages 840 - 849
BORNSTEIN, P.: "The nature of a hydroxylamine- sensitive bond in collagen", BIOCHEM. BIOPHYS. RES. COMM., vol. 36, 1969, pages 957 - 964, XP024832824, DOI: doi:10.1016/0006-291X(69)90297-6
CHAVANPATIL, M.D.; JAIN, P.; CHAUDHARI, S.; SHEAR, R.; VAVIA, P.R.: "Novel sustained release, swellable and bioadhesive gastroretentive drug delivery system for olfoxacin", INT. J. PHARM.
COSIMI ET AL., J. IMMUNOLOGY, vol. 144, 1990, pages 4604 - 4612
COSIMI ET AL.: "Leukocyte Adhesion Molecules", 1988, SPRINGER, article "Immunosuppression of Cynomolgus Recipients of Renal Allografts by R6.5, a Monoclonal Antibody to Intercellular Adhesion Molecule-1", pages: 274
COULTRAP, S. J.; SUN, H.; TENNER, T. E. JR.; MACHU, T. K.: "Competitive antagonism of the mouse 5- hydroxytryptamine3 receptor by bisindolylmaleimide I, a ''selective'' protein kinase C inhibitor", JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, vol. 290, 1999, pages 76 - 82
DIAMOND, M.; SPRINGER, T.A: "The dynamic regulation of integrin adhesiveness", CURRENT BIOLOGY, vol. 4, 1994, pages 506 - 532
EDWARD B. ROCHE,: "Bioreversible Carriers in Drug Design", 1987, AMERICAN PHARMACEUTICAL ASSOCIATION AND PERGAMON PRESS
FISCHER A; DURANDY A; STERKERS G; GRISCELLI C.: "Role of the LFA-1 molecule in cellular interactions required for antibody production in humans", J. IMMUNOL., vol. 136, 1986, pages 3198
FRENETTE, P. S.: "Locking a leukocyte integrin with statins", N. ENGL. J. MED., vol. 345, 2001, pages 1419 - 1421
GADDUM, J. H.; HAMEED, K. A.; HATHWAY, D. E.; STEPHENS, F. F.: "Quantitative studies of antagonists for 5-hydroxytryptamine", Q. J EXP. PHYSIOL., vol. 40, 1955, pages 49 - 74
GADEK, T, SCIENCE, vol. 295, no. 5557, 8 February 2002 (2002-02-08)
GADEK, T. R.; BURDICK, D. J.; MCDOWELL, R. S.; STANLEY, M. S.; MARSTERS, J. C. JR.; PARIS, K. J.; OARE, D. A.; REYNOLDS, M. E.; LA: "Generation of an LFA-1 antagonist by the transfer of the ICAM-1 immunoregulatory epitope to a small molecule", SCIENCE, vol. 295, 2002, pages 1086 - 1089, XP002522872, DOI: doi:10.1126/science.295.5557.1086
GENNARO: "The Science and Practice of Pharmacy 20th Ed.,", LIPPINCOTT WILLIAMS & WILKINS
GILBARD, J.P: "Dry Eye: phramcological approaches, effects, and progress", CLAO J., vol. 22, 1996, pages 141 - 145, XP000872479
HEAGY W; WALTERBANGH C; MARTZ E: "Potent ability of anti-LFA- monoclonal antibody to prolong allograft survival", TRANSPLANTATION, vol. 37, 1984, pages 520 - 523, XP009033662
HOFFMAN, A.; STEPENSKY, D.; LAVY, E.; EYAL, S.; KLAUSNER, E.; FRIEDMAN, M.: "Pharmacokinetic and pharmacodynamic aspects of gastroretentive dosage forms", INT. J. PHARM., vol. 11, 2004, pages 141 - 53
HUMPHRIES, M. J.: "Integrin activation: the link between ligand binding and signal transduction", CURR. OP. CELL BIOL., vol. 8, pages 632 - 640
HUTH, J. R.; OLEJNICZAK, E. T.; MENDOZA, R.; LIANG, H.; HARRIS, E. A. S.; LUPHER, M. L. JR.; WILSON, A. E.; FESIK, S. W.; STAUNTON: "NMR and mutagenesis evidence for an I domain allosteric site that regulates lymphocyte function-associated antigen 1 ligand binding", PROC. NATL. ACAD. SCI. U.S.A., vol. 97, 2000, pages 5231 - 5236, XP001106539, DOI: doi:10.1073/pnas.97.10.5231
HYNES, R. 0.: "Integrins: Versatility, modulation, and signaling in cell adhesion", CELL, vol. 69, 1992, pages 11 - 25, XP023884392, DOI: doi:10.1016/0092-8674(92)90115-S
JIANPING, GAO ET AL., EXPERIMENTAL EYE RESEARCH, vol. 78, no. 4, April 2004 (2004-04-01), pages 823 - 835
KALLEN, J.; WELZENBACH, K.; RAMAGE, P; GEYL, D; KRIWACKI, R.; LEGGE, G.; COTTENS, S.; WEITZ-SCHMIDT, G.; HOMMEL, U.: "Structural basis for LFA-1 inhibition upon lovastatin binding to the CD11 I-domain", J. MOL. BIOL., vol. 292, 1999, pages 1 - 9, XP004461886, DOI: doi:10.1006/jmbi.1999.3047
KEATING, S.; MARSTERS, J.; BERESINI, M.; LADNER, C.; ZIONCHECK, K.; CLARK, K., SPIE PROCEEDINGS, vol. 3913, pages 128 - 137
KEATING, SUSAN M. ET AL., PROC. SPIE, vol. 2913, no. 128, 2 July 2003 (2003-07-02), pages 137
KELLY, T. A.; JEANFAVRE, D. D.; MCNEIL, D. W.; WOSKA, J. R. JR.; REILLY, P. L.; MAINOLFI, E. A.; KISHIMOTO, K. M.; NABOZNY, G. H.;: "Cutting edge: a small molecule antagonist of LFA-1-mediated cell adhesion", J. IMMUNOL., vol. 163, 1999, pages 5173 - 5177
KENAKIN, T.: "Pharmacologic Analysis of Drug-Receptor Interaction", 1997, LIPPINCOTT-RAVEN
KISHIMOTO, T. K.; ROTHLEIN; R. R.: "Integrins, ICAMs, and selectins: role and regulation of adhesion molecules in neutrophil recruitment to inflammatory sites", ADV. PHARMACOL., vol. 25, 1994, pages 117 - 13 8
KLAUSNER, E.A.; LAVY, E.; BARTA, M.; CSEREPES, E.; FRIEDMAN, M.; HOFFMAN, A.: "Novel gastroretentive dosage forms: evaluation of gastroretentivity and its effect on levodopa in humans", PHARM. RES., vol. 20, 2003, pages 1466 - 73
KRENSKY, A.M.; MADRID, F.; ROBBINS, E.; NAGY, J.A.; SPRINGER, T.A.; BURAKOFF, S.J.: "The functional significance, distribution, and structure of LFA-1, LFA-2, and LFA-3: cell surface antigens associated with CTL-target interactions", J. IMMUNOL., vol. 131, 1983, pages 611 - 616
KUNERT KATHLEEN S ET AL., ARCHIVES OF OPHTHALMOLOGY, vol. 118, no. 11, November 2000 (2000-11-01), pages 1489 - 1496
KUYPERS T.W.; ROOS D: "Leukocyte membrane adhesion proteins LFA-1, CR3 and pl50,95: a review of functional and regulatory aspects", RES. IMMUNOL., vol. 140, 1989, pages 461 - 465
LANGEGREN, U., J. IMMUNOL. METHODS, vol. 57, 1984, pages 379 - 388
LARSON, R.S.; CORBI, A. L.; BERMAN, L.; SPRINGER, T.: "Primary structure of the leukocyte function-associated molecule- alpha subunit: an integrin with an embedded domain defining a protein superfamily", J. CELL BIOL, vol. 108, 1989, pages 703 - 712, XP000654994, DOI: doi:10.1083/jcb.108.2.703
LIU, G.; HUTH, J. R.; OLEJNICZAK, E. T.; MENDOZA, R.; DEVRIES, P.; LEITZA ,S.; REILLY, E. B.; OKASINSKI, G. F.; FESIK, S. W.; VON: "Novel p-arylthio cinnamides as antagonists of leukocyte function-associated antigen-1/intracellular adhesion molecule- interaction. 2. Mechanism of inhibition and structure-based improvement of pharmaceutical properties", J. MED. CHEM., vol. 44, 2001, pages 1202 - 1210
LIU, G.; HUTH, J. R.; OLEJNICZAK, E. T.; MENDOZA, R.; DEVRIES, P.; LEITZA ,S.; REILLY; E. B.; OKASINSKI; G. F.; FESIK, S. W.; VON: "Novel p-arylthio cinnamides as antagonists of leukocyte function-associated antigen-1/intracellular adhesion molecule- interaction. 2. Mechanism of inhibition and structure-based improvement of pharmaceutical properties", J. MED. CHEM., vol. 44, 2001, pages 1202 - 1210
LIU, G.; LINK, J.T.; PEI, Z.; REILLY, E.B.; NGUYEN, B.; MARSH, K.C.; OKASINSKI, G.F.; VON GELDERN, T.W.; ORMES, M.; FOWLER, K.: "Discovery of novel p-arylthio cinnamides as antagonists of leukocyte function-associated antigen- 1/intracellular adhesion molecule- interaction. 1. Identification of an additional binding pocket based on an anilino diaryl sulfide lead", J. MED. CHEM., vol. 43, 2000, pages 4015 - 4030
LIU, G: "Small molecule antagonists of the LF A-l/ICAM-l interaction as potential therapeutic agents", EXPERT OPIN. THER. PATENTS, vol. 11, 2001, pages 1383 - 1393, XP002321823, DOI: doi:10.1517/13543776.11.9.1383
LO SK; VAN SEVENTER GA; LEVIN SM; WRIGHT SD.: "Two leukocyte receptors (CD la/CD18 and CD1 lb/CD18) mediate transient adhesion to endothelium by binding to different ligands", J. IMMUNOL., vol. 143, 1989, pages 3325
LU, C; SHIMAOKA, M.; SALAS, A.; SPRINGER, T.A.: "The Binding Sites for Competitive Antagonistic, Allosteric Antagonistic, and Agonistic Antibodies to the I Domain of Integrin LFA-1", J. IMMUN., vol. 173, 2004, pages 3972 - 3978, XP002461643
LUTZ, M.; KENAKIN, T.: "Quantitative Molecular Pharmacology and Informatics in Drug Discovery", 1993, JOHN WILEY & SONS, LTD.
LUTZ, M.; KENAKIN, T.: "Quantitative Molecular Pharmacology and Informatics in Drug Discovery", 1999, JOHN WILEY & SONS, LTD.
MATTHEWS, J. C: "Fundamentals of Receptor, Enzyme, and Transport Kinetics", 1993, CRC PRESS
MENTZER SJ; GROMKOWSKI SH; KRENSKY AM; BURAKOFF SJ; MARTZ E.: "LFA-1 membrane molecule in the regulation of homotypic adhesions of human B lymphocytesn", J. IMMUNOL., vol. 135, 1985, pages 9
PRATT, W. B.; TAYLOR, P., PRINCIPLES OF DRUG ACTION: THE BASIS OF PHARMACOLOGY, 1990
S. M. BERGE ET AL., J PHARMACEUTICAL SCIENCES, vol. 66, 1977, pages 1 - 19
SALAS, A.; SHIMAOKA, M.; KOGAN, A. N.; HARWOOD, C.; VON ANDRIAN, U. H.; SPRINGER, T. A.: "Rolling adhesion through an extended conformation of integrin ?1?2 and relation to a I and ?I-like domain interaction", IMMUNITY, vol. 20, 2004, pages 393 - 406
SANDERS VM; SNYDER JM; UHR JW; VITETTA ES.: "Characterization of the physical interaction between antigen-specific B and T cells", J. IMMUNOL., vol. 137, 1986, pages 2395
SHIMAOKA, M ET AL., IMMUNITY, CELL PRESS, vol. 19, no. 3, 1 September 2003 (2003-09-01), pages 391 - 402
SHIMAOKA, M.; LU, C.; PALFRAMAN, R. T.; VON ANDRIAN, U. H.; MCCORMACK, A.; TAKAGI, J.; SPRINGER, T. A.: "Reversibly locking a protein fold in an active conformation with a disulfide bond: integrin alphaL I domains with high affinity and antagonist activity in vivo", PROC. NATL. ACAD. SCI, U.S.A., vol. 98, 2001, pages 6009 - 6014, XP002209620, DOI: doi:10.1073/pnas.101130498
SHIMAOKA, M.; SALAS, A.; YANG, W.; WEITZ-SCHMIDT, G.; SPRINGER, T.: "Small molecule integrin antagonists that bind to the P2 subunit I-like domain and activate signals in one direction and block them in another", IMMUNITY, vol. 19, 2003, pages 391 - 402, XP008091510, DOI: doi:10.1016/S1074-7613(03)00238-3
SHIMAOKA, M.; SPRINGER, T.A.: "Therapeutic antagonists and the conformational regulation of the fl2 integrins", CURR. TOPICS MED. CHEM., vol. 4, 2004, pages 1485 - 1495
SHIMAOKA, M.; XIAO, T.; LIU, J.-H.; YANG, Y.; DONG, Y.; JUN, C-D.; MCCORMACK, A.; ZHANG, R.; JOACHIMIAK, A.; TAKAGI, J.: "Structures of the alpha L I domain and its complex with ICAM-1 reveal a shape-shifting pathway for integrin regulation", CELL, vol. 112, 2003, pages 99 - 111
SHIMAOKA, M.; XIAO, T.; LIU, J.-H.; YANG, Y.; DONG, Y.; JUN, C-D.; MCCORMACK, A; ZHANG, R.; JOACHIMIAK, A.; TAKAGI, J.: "Structures of the alpha L I domain and its complex with ICAM-1 reveal a shape-shifting pathway for integrin regulation", CELL, vol. 112, 2003, pages 99 - 111
SHIMAOKA, M.; XIAO, T.; LIU, J.-H.; YANG, Y.; DONG, Y.; JUN, C-D.; MCCORMACK, A; ZHANG, R.; JOACHIMIAK, A.; TAKAGI, J.: "Structures of the alpha L I domain and its complex with ICAM-1 reveal a shape-shifting pathway for integrin regulation", CELL, vol. 2003, pages 99 - 111
SPRINGER, T.A.: "Adhesion receptors of the immune system", NATURE, vol. 346, 1990, pages 425 - 434, XP000141345, DOI: doi:10.1038/346425a0
STREUBEL, A.; SIEPMANN, J.; BODMEIER, R.: "Gastroretentive drug delivery systems", EXPERT OPIN. DRUG DELIVER., vol. 3, 2006, pages 217 - 3
T. HIGUCHI; V. STELLA: "A. C. S. Symposium Series", vol. 14, article "Pro-drugs as Novel Delivery Systems"
WEITZ-SCHMIDT, G.; WELZENBACH, K.; BRINKMANN, V.; KAMATA, T.; KALLEN, J.; BRUNS, C.; COTTENS, S.; TAKADA, Y.; HOMMEL, U.: "Statins selectively inhibit leukocyte function antigen- by binding to a novel regulatory integrin site", NATURE MED., vol. 7, 2001, pages 687 - 692
WELZENBACH, K.; HOMMEL, U.; WEITZ-SCHMIDT,G.: "Small molecule inhibitors induce conformational changes in the I domain and the I-like domain of Lymphocyte Function-Associated Antigen-1", J. BIOL. CHEM., vol. 277, 2002, pages 10590 - 10598
WONG, A.; HWANG, S. M.; JOHANSON, K.; SAMANEN, J.; BENNETT, D.; LANDVATTER, S. W.; CHEN, W.; HEYS, J. R.; ALI, F. E.; KU, T. W.: "Binding of [3H]-SK&F 107260 and [3H]-SB 214857 to purified integrin alphallbbeta3: evidence for a common binding site for cyclic arginyl-glycinyl-aspartic acid peptides and nonpeptides", J PHARMACOL. EXP. THERAPEUTICS, vol. 285, 1998, pages 228 - 235, XP008054065
YALAMANCHILI, P.; LU, C.; OXVIG, C.; SPRINGER T. A.: "Folding and function of I domain- deleted Mac-1 and lymphocyte function-associated antigen-1", J BIOL. CHEM., vol. 275, 2000, pages 21877 - 21882
YANG, W.; SHIMAOKA, M.; SALAS, A.; TAKAGI, J.; SPRINGER, T. A.: "Intersubunit signal transmission in integrins by a receptor-like interaction with a pull spring", PNAS, vol. 101, 2004, pages 2906 - 2911

Cited By (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9248126B2 (en) 2003-11-05 2016-02-02 Sarcode Bioscience Inc. Modulators of cellular adhesion
US9216174B2 (en) 2003-11-05 2015-12-22 Sarcode Bioscience Inc. Modulators of cellular adhesion
US8101648B2 (en) 2005-04-13 2012-01-24 Astex Therapeutics, Ltd. Hydroxybenzamide derivatives and their use as inhibitors of HSP90
US7700625B2 (en) 2005-04-13 2010-04-20 Astex Therapeutics Ltd. Hydroxybenzamide derivatives and their use as inhibitors of Hsp90
US9914719B2 (en) 2005-04-13 2018-03-13 Astex Therapeutics Ltd. Hydroxybenzamide derivatives and their use as inhibitors of HSP90
US8816087B2 (en) 2005-04-13 2014-08-26 Astex Therapeutics Limited Hydroxybenzamide derivatives and their use as inhibitors of Hsp90
US8758776B2 (en) 2005-05-17 2014-06-24 Sarcode Bioscience Inc. Compositions and methods for treatment
US10188641B2 (en) 2005-05-17 2019-01-29 Sarcode Bioscience Inc. Compositions and methods for treatment
US12558350B2 (en) 2005-05-17 2026-02-24 Bausch + Lomb Ireland Limited Compositions and methods for treatment
US8592450B2 (en) 2005-05-17 2013-11-26 Sarcode Bioscience Inc. Compositions and methods for treatment of eye disorders
US9045458B2 (en) 2005-05-17 2015-06-02 Sarcode Bioscience Inc. Compositions and methods for treatment
US9045457B2 (en) 2005-05-17 2015-06-02 Sarcode Bioscience Inc. Compositions and methods for treatment
US9051297B2 (en) 2005-05-17 2015-06-09 Sarcode Bioscience Inc. Compositions and methods for treatment
US8771715B2 (en) 2005-05-17 2014-07-08 Sarcode Bioscience Inc. Compositions and methods for treatment
US8106057B2 (en) 2006-03-01 2012-01-31 Astex Therapeutics, Ltd. Dihydroxyphenyl isoindolylmethanones
US9428439B2 (en) 2006-10-12 2016-08-30 Astex Therapeutics Ltd. Hydrobenzamide derivatives as inhibitors of Hsp90
US8883790B2 (en) 2006-10-12 2014-11-11 Astex Therapeutics Limited Pharmaceutical combinations
US9730912B2 (en) 2006-10-12 2017-08-15 Astex Therapeutics Limited Pharmaceutical compounds
US8916552B2 (en) 2006-10-12 2014-12-23 Astex Therapeutics Limited Pharmaceutical combinations
US20160220702A1 (en) * 2007-10-19 2016-08-04 Sarcode Bioscience Inc. Compositions and methods for treatment of diabetic retinopathy
JP2011500683A (ja) * 2007-10-19 2011-01-06 サーコード コーポレーション 糖尿病性網膜症の治療のための組成物及び方法
US10960087B2 (en) 2007-10-19 2021-03-30 Novartis Ag Compositions and methods for treatment of diabetic retinopathy
US8871935B2 (en) 2008-04-15 2014-10-28 Sarcode Bioscience Inc. Crystalline pharmaceutical and methods of preparation and use thereof
JP2020023546A (ja) * 2008-04-15 2020-02-13 サーコード バイオサイエンス インコーポレイテッド 胃腸系へのlfa−1アンタゴニストの送達
JP2011518155A (ja) * 2008-04-15 2011-06-23 サーコード コーポレイション 免疫関連障害の局所治療に使用するためのエアゾール化lfa−1アンタゴニスト
JP2011516607A (ja) * 2008-04-15 2011-05-26 サーコード コーポレイション 胃腸系へのlfa−1アンタゴニストの送達
JP2017141310A (ja) * 2008-04-15 2017-08-17 サーコード バイオサイエンス インコーポレイテッド 免疫関連障害の局所治療に使用するためのエアゾール化lfa−1アンタゴニスト
JP2011521896A (ja) * 2008-04-15 2011-07-28 サーコード コーポレイション 免疫関連障害に対する局部治療に使用するための局所lfa−1アンタゴニスト
WO2009139817A3 (en) * 2008-04-15 2010-01-07 Sarcode Corporation Crystalline pharmaceutical and methods of preparation and use thereof
US11028077B2 (en) 2008-04-15 2021-06-08 Novartis Pharmaceuticals Corporation Crystalline pharmaceutical and methods of preparation and use thereof
US8367701B2 (en) 2008-04-15 2013-02-05 Sarcode Bioscience Inc. Crystalline pharmaceutical and methods of preparation and use thereof
US8080562B2 (en) 2008-04-15 2011-12-20 Sarcode Bioscience Inc. Crystalline pharmaceutical and methods of preparation and use thereof
JP2016128515A (ja) * 2008-04-15 2016-07-14 サーコード バイオサイエンス インコーポレイテッド 免疫関連障害の局所治療に使用するためのエアゾール化lfa−1アンタゴニスト
US8008327B2 (en) 2008-04-29 2011-08-30 Boehringer Ingelheim International Gmbh Indazole compounds as CCR1 receptor antagonists
US8263597B2 (en) 2008-04-29 2012-09-11 Boehringer Ingelheim International Gmbh Indazole compounds as CCR1 receptor antagonists
US8293917B2 (en) 2008-05-06 2012-10-23 Boehringer Ingelheim International Gmbh Pyrazole compounds as CCR1 antagonists
US8063065B2 (en) 2008-09-26 2011-11-22 Boehringer Ingelheim International Gmbh Azaindazole compounds as CCR1 receptor antagonists
US8163918B2 (en) 2008-09-26 2012-04-24 Boehringer Ingelheim International Gmbh Azaindazole compounds as CCR1 receptor antagonists
US8338610B2 (en) 2008-09-26 2012-12-25 Boehringer Ingelheim International Gmbh Pyridinyl compounds useful as intermediates
US7879873B2 (en) 2008-09-26 2011-02-01 Boehringer Ingelheim International Gmbh Azaindazole compounds as CCR1 receptor antagonists
US8648066B2 (en) 2009-05-22 2014-02-11 Exelixis, Inc. Benzoxazepines as inhibitors of PI3K/mTOR and methods of their use and manufacture
US8952034B2 (en) 2009-07-27 2015-02-10 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9371329B2 (en) 2009-07-27 2016-06-21 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9056858B2 (en) 2009-10-21 2015-06-16 Boehringer Ingelheim International Gmbh Indazole and pyrazolopyridine compounds as CCR1 receptor antagonists
WO2011050175A1 (en) * 2009-10-21 2011-04-28 Sarcode Corporation Crystalline pharmaceutical and methods of preparation and use thereof
US8378105B2 (en) 2009-10-21 2013-02-19 Sarcode Bioscience Inc. Crystalline pharmaceutical and methods of preparation and use thereof
US9890141B2 (en) 2009-10-21 2018-02-13 Sarcode Bioscience Inc. Crystalline pharmaceutical and methods of preparation and use thereof
US8927574B2 (en) 2009-10-21 2015-01-06 Sarcode Bioscience Inc. Crystalline pharmaceutical and methods of preparation and use thereof
US9353088B2 (en) 2009-10-21 2016-05-31 Sarcode Bioscience Inc. Crystalline pharmaceutical and methods of preparation and use thereof
US8927550B2 (en) 2009-10-27 2015-01-06 Boehringer Ingelheim International Gmbh Heterocyclic compounds as CCR1 receptor antagonists
US8871786B2 (en) 2010-04-30 2014-10-28 Boehringer Ingelheim International Gmbh Azaindazole amide compounds as CCR1 receptor antagonists
US9079901B2 (en) 2010-07-02 2015-07-14 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US8546442B2 (en) 2010-12-23 2013-10-01 Boehringer Ingelheim International Gmbh Pyrazolopiperidine compounds as CCR1 receptor antagonists
US9115096B2 (en) 2011-05-10 2015-08-25 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9403782B2 (en) 2011-05-10 2016-08-02 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9682998B2 (en) 2011-05-10 2017-06-20 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9676760B2 (en) 2011-07-01 2017-06-13 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9695192B2 (en) 2011-07-01 2017-07-04 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9598435B2 (en) 2011-07-01 2017-03-21 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9193694B2 (en) 2011-07-01 2015-11-24 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US8962610B2 (en) 2011-07-01 2015-02-24 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
WO2013110679A1 (en) * 2012-01-27 2013-08-01 F. Hoffmann-La Roche Ag Integrin antagonist conjugates for targeted delivery to cells expressing lfa-1
RU2624732C2 (ru) * 2012-01-27 2017-07-06 Ф.Хоффманн-Ля Рош Аг Конъюгаты антагонистов интегрина для нацеленной доставки к клеткам, экспрессирующим lfa-1
CN104185478B (zh) * 2012-01-27 2016-10-12 弗·哈夫曼-拉罗切有限公司 用于靶向递送至表达lfa-1的细胞的整联蛋白拮抗剂缀合物
CN104185478A (zh) * 2012-01-27 2014-12-03 弗·哈夫曼-拉罗切有限公司 用于靶向递送至表达lfa-1的细胞的整联蛋白拮抗剂缀合物
US8889730B2 (en) 2012-04-10 2014-11-18 Pfizer Inc. Indole and indazole compounds that activate AMPK
RU2778771C2 (ru) * 2012-07-25 2022-08-24 Новартис Аг Ингибитор ассоциированного с функцией лимфоцитов антигена-1 (lfa-1), способы его получения и его полиморф
US10214517B2 (en) 2012-07-25 2019-02-26 Sarcode Bioscience Inc. LFA-1 inhibitor and methods of preparation and polymorph thereof
US10906892B2 (en) 2012-07-25 2021-02-02 Novartis Pharmaceuticals Corporation LFA-1 inhibitor and methods of preparation and polymorph thereof
US9085553B2 (en) 2012-07-25 2015-07-21 SARcode Bioscience, Inc. LFA-1 inhibitor and methods of preparation and polymorph thereof
US9394285B2 (en) 2013-03-15 2016-07-19 Pfizer Inc. Indole and indazole compounds that activate AMPK
US10413535B2 (en) 2015-07-08 2019-09-17 Axerovision, Inc. Pharmaceutical compositions comprising an integrin ALPHA4 antagonist for use in treating ocular inflammatory conditions
WO2017006272A1 (en) 2015-07-08 2017-01-12 Glaxosmithkline Intellectual Property Limited Pharmaceutical compositions comprising an integrin alpha4 antagonist for use in treating ocular inflammatory conditions
US10751334B2 (en) 2015-07-08 2020-08-25 Axerovision, Inc. Pharmaceutical compositions comprising an integrin alpha4 antagonist for use in treating ocular inflammatory conditions
EP3868754A1 (en) 2017-07-24 2021-08-25 Interquim, S.A. Process for preparing and purifying the lfa-1 antagonist lifitegrast
WO2019020580A1 (en) 2017-07-24 2019-01-31 Interquim, S.A. PROCESS FOR PREPARING AND PURIFYING LIFITEGRAST ANTAGONIST OF LFA-1
US11833156B2 (en) 2017-09-22 2023-12-05 Jubilant Epipad LLC Heterocyclic compounds as pad inhibitors
US12357639B2 (en) 2017-09-22 2025-07-15 Jubilant Epipad LLC Heterocyclic compounds as pad inhibitors
US11629135B2 (en) 2017-11-06 2023-04-18 Jubilant Prodell Llc Pyrimidine derivatives as inhibitors of PD1/PD-L1 activation
US11001574B2 (en) 2017-11-17 2021-05-11 Medichem S.A. Process to obtain a tetrahydroisoquinoline derivative
WO2019096996A1 (en) 2017-11-17 2019-05-23 Medichem, S.A. A process to obtain a tetrahydroisoquinoline derivative
US11459338B2 (en) 2017-11-24 2022-10-04 Jubilant Episcribe Llc Heterocyclic compounds as PRMT5 inhibitors
US11529341B2 (en) 2018-03-13 2022-12-20 Jubilant Prodel LLC Bicyclic compounds as inhibitors of PD1/PD-L1 interaction/activation
US11274095B2 (en) 2018-04-18 2022-03-15 Constellation Pharmaceuticals, Inc. Modulators of methyl modifying enzymes, compositions and uses thereof
US10689371B2 (en) 2018-04-18 2020-06-23 Constellation Pharmaceuticals, Inc. Modulators of methyl modifying enzymes, compositions and uses thereof
US12612390B2 (en) 2018-04-18 2026-04-28 Constellation Pharmaceuticals, Inc. Modulators of methyl modifying enzymes, compositions and uses thereof
US11919912B2 (en) 2018-05-21 2024-03-05 Constellation Pharmaceuticals, Inc. Modulators of methyl modifying enzymes, compositions and uses thereof
US12516040B2 (en) 2019-07-24 2026-01-06 Constellation Pharmaceuticals, Inc. Crystalline forms of 7-chloro-2-(4-3-methoxyazetidin-1-yl)cyclohexyl)-2,4-dimethyl-N-((6-methyl-4-(methylthio)-2-oxo-1,2-dihydropyridin-3-yl)methyl)benzo[d][1,3]dioxole-5-carboxamide

Also Published As

Publication number Publication date
US9045457B2 (en) 2015-06-02
EP2444079B1 (en) 2016-11-30
PT1881823E (pt) 2015-03-02
JP2020079312A (ja) 2020-05-28
US8771715B2 (en) 2014-07-08
AU2006247136A2 (en) 2006-11-23
US8168655B2 (en) 2012-05-01
US20150174119A1 (en) 2015-06-25
JP2019081785A (ja) 2019-05-30
US20110165229A1 (en) 2011-07-07
US12558350B2 (en) 2026-02-24
US20150175581A1 (en) 2015-06-25
US20140378506A1 (en) 2014-12-25
PL2444079T3 (pl) 2017-07-31
US20060281739A1 (en) 2006-12-14
EP2444079A1 (en) 2012-04-25
EP1881823B1 (en) 2014-12-03
US20150216857A1 (en) 2015-08-06
US20150175578A1 (en) 2015-06-25
AU2006247136B2 (en) 2012-04-19
US9051297B2 (en) 2015-06-09
CA2609053C (en) 2017-04-25
LT2444079T (lt) 2017-03-27
PL1881823T3 (pl) 2015-05-29
JP2008545656A (ja) 2008-12-18
US20170143690A1 (en) 2017-05-25
US20140073666A1 (en) 2014-03-13
CA2960117C (en) 2018-01-30
EP1881823A4 (en) 2009-06-17
US20170143693A1 (en) 2017-05-25
US20150175577A1 (en) 2015-06-25
US20150175579A1 (en) 2015-06-25
US20140099387A1 (en) 2014-04-10
HUE031979T2 (en) 2017-08-28
US20170143691A1 (en) 2017-05-25
US20150152090A1 (en) 2015-06-04
ES2530780T3 (es) 2015-03-05
US20140141062A1 (en) 2014-05-22
SI2444079T1 (sl) 2017-05-31
SI1881823T1 (sl) 2015-04-30
US20150140078A1 (en) 2015-05-21
US20170143692A1 (en) 2017-05-25
JP2012107057A (ja) 2012-06-07
DK1881823T3 (en) 2015-03-02
JP2015187165A (ja) 2015-10-29
CN101175488B (zh) 2012-04-18
JP5794721B2 (ja) 2015-10-14
CA2985444C (en) 2019-03-12
US20230233551A1 (en) 2023-07-27
CA2960117A1 (en) 2006-11-23
JP2017141297A (ja) 2017-08-17
JP6816180B2 (ja) 2021-01-20
US8592450B2 (en) 2013-11-26
HK1117083A1 (en) 2009-01-09
ES2614080T3 (es) 2017-05-29
AU2006247136C1 (en) 2020-01-16
US20110165228A1 (en) 2011-07-07
US20140161872A1 (en) 2014-06-12
US20150140075A1 (en) 2015-05-21
JP6288907B2 (ja) 2018-03-07
PT2444079T (pt) 2017-03-03
US20150175580A1 (en) 2015-06-25
US20150140076A1 (en) 2015-05-21
CA2985444A1 (en) 2006-11-23
US20150140080A1 (en) 2015-05-21
EP1881823A1 (en) 2008-01-30
CY1118660T1 (el) 2017-07-12
US20140371265A1 (en) 2014-12-18
US20150140082A1 (en) 2015-05-21
CA2609053A1 (en) 2006-11-23
CN102617557A (zh) 2012-08-01
EP3195861A1 (en) 2017-07-26
US9045458B2 (en) 2015-06-02
US8758776B2 (en) 2014-06-24
US20100092541A1 (en) 2010-04-15
US20150140079A1 (en) 2015-05-21
US20150182520A1 (en) 2015-07-02
US8084047B2 (en) 2011-12-27
CN101175488A (zh) 2008-05-07
US20150140077A1 (en) 2015-05-21
AU2006247136A1 (en) 2006-11-23
US10188641B2 (en) 2019-01-29
US20120232019A1 (en) 2012-09-13
US20150140081A1 (en) 2015-05-21
DK2444079T3 (en) 2017-01-30
JP2013006880A (ja) 2013-01-10
US20100092542A1 (en) 2010-04-15

Similar Documents

Publication Publication Date Title
US12558350B2 (en) Compositions and methods for treatment
HK1241744A1 (en) Compositions and methods for treatment of dry eye disorders

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200680017188.4

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006770607

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2006247136

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 8114/DELNP/2007

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2609053

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2008512519

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU