EP0093619B2 - Human tissue plasminogen activator, pharmaceutical compositions containing it, processes for making it, and DNA and transformed cell intermediates therefor - Google Patents

Human tissue plasminogen activator, pharmaceutical compositions containing it, processes for making it, and DNA and transformed cell intermediates therefor Download PDF

Info

Publication number
EP0093619B2
EP0093619B2 EP83302501A EP83302501A EP0093619B2 EP 0093619 B2 EP0093619 B2 EP 0093619B2 EP 83302501 A EP83302501 A EP 83302501A EP 83302501 A EP83302501 A EP 83302501A EP 0093619 B2 EP0093619 B2 EP 0093619B2
Authority
EP
European Patent Office
Prior art keywords
protein
plasminogen activator
tissue plasminogen
dna
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP83302501A
Other languages
German (de)
English (en)
French (fr)
Other versions
EP0093619B1 (en
EP0093619A1 (en
Inventor
David Vannorman Goeddel
William Jack Kohr
Diane Pennica
Gordon Allen Vehar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27409206&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP0093619(B2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from US06/483,052 external-priority patent/US4766075A/en
Application filed by Genentech Inc filed Critical Genentech Inc
Priority to AT83302501T priority Critical patent/ATE46360T1/de
Publication of EP0093619A1 publication Critical patent/EP0093619A1/en
Publication of EP0093619B1 publication Critical patent/EP0093619B1/en
Application granted granted Critical
Publication of EP0093619B2 publication Critical patent/EP0093619B2/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0026—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5)
    • C12N9/0028—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5) with NAD or NADP as acceptor (1.5.1)
    • C12N9/003—Dihydrofolate reductase [DHFR] (1.5.1.3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C12N15/71—Expression systems using regulatory sequences derived from the trp-operon
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • C12N9/6456—Plasminogen activators
    • C12N9/6459—Plasminogen activators t-plasminogen activator (3.4.21.68), i.e. tPA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21069—Protein C activated (3.4.21.69)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to human plasminogen activator, corresponding to that found in human serum and/ or tissues, and to novel forms and compositions thereof and particularly to the means and methods for its production to homogeneity in therapeutically significant quantities.
  • the present invention arises in part from the discovery of the DNA sequence and deduced amino acid sequence of human plasminogen activator.
  • This discovery enables the production of human plasminogen activator via the application of recombinant DNA technology, in turn, enabling the production of sufficient quality and quantity of material to initiate and conduct animal and clinical testing as prerequisites to market approval, unimpeded by the restrictions necessarily inherent in the isolation methods hitherto employed involving production and extraction from existing cell culture.
  • This invention is directed to these associated embodiments in all respects.
  • the fibrinolytic system is in a dynamic equilibrium with the coagulation system, maintaining an intact, patent vascular bed.
  • the coagulation system deposits fibrin as a matrix serving to restore a hemostatic condition.
  • the fibrinolytic system removes the fibrin network after the hemostatic condition is achieved.
  • the fibrinolytic process is brought about by the proteolytic enzyme plasmin that is generated from a plasma protein precursor plasminogen. Plasminogen is converted to plasmin through activation by an activator.
  • Urokinase has been the subject of numerous investigations-See, for example, references 1-6.
  • plasminogen activators have been isolated from various human tissue, e.g., uterine tissue, blood, serum-see generally references 7-11 and from cell culture (reference 94). Compositions thereof have also been described-see references 12, 13. See also references 14-18.
  • the plasminogen activators derived from these sources have been classified into two major groups: urokinase-type plasminogen activators (u-PA) and tissue-type plasminogen activators (t-PA) based on differences in their immunological properties.
  • u-PA urokinase-type plasminogen activators
  • t-PA tissue-type plasminogen activators
  • the product was isolated in relatively pure form, characterized and found to be a highly active fibrinolytic agent (20).
  • human tissue-type plasminogen activator essentially free of other human protein.
  • Such materials would probably exhibit bioactivity admitting of their use clinically in the treatment of various cardiovascular conditions or diseases.
  • DNA recombination of the essential elements i.e., an origin of replication, one or more phenotypic selection characteristics, an expression promoter, heterologous gene insert and remaining vector, generally is performed outside the host cell.
  • the resulting recombinant replicable expression vehicle, or plasmid is introduced into cells by transformation and large quantities of the recombinant vehicle obtained by growing the transformant.
  • the resulting expression vehicle is useful to actually produce the polypeptide sequence for which the inserted gene codes, a process referred to as expression.
  • the resulting product may be obtained by lysing, if necessary, the host cell, in microbial systems, and recovering the product by appropriate purification from other proteins.
  • heterologous polypeptides in practice, can express entirely heterologous polypeptides-so-called direct expression-or alternatively may express a heterologous polypeptides fused to a portion of the amino acid sequence of a homogolous polypeptide.
  • the intended bioactive product is sometimes rendered bioinactive within the fused, homologous/heterologous polypeptide until it is cleaved in an extracellular environment. See references (21 ) and (22).
  • protein biochemistry is a useful, indeed necessary, adjunct in biotechnology.
  • Cells producing the desired protein also produce hundreds of other proteins, endogenous products of the cell's metabolism. These contaminating proteins, as well as other compounds, if not removed from the desired protein, could prove toxic if administered to an animal or human in the course of therapeutic treatment with desired protein.
  • the techniques of protein biochemistry come to bear, allowing the design of separation procedures suitable for the particular system under consideration and providing a homogeneous product safe for intended use. Protein biochemistry also proves the identity of the desired product, characterizing it and ensuring that the cells have produced it faithfully with no alterations or mutations. This branch of science is also involved in the design of bioassays, stability studies and other procedures necessary to apply before successful clinical studies and marketing can take place.
  • the present invention is based upon the discovery that recombinant DNA technology can be used successfully to produce human tissue plasminogen activator (t-PA), preferably in direct form, and in amounts sufficient to initiate and conduct animal and clinical testing as prerequisites to market approval.
  • t-PA tissue plasminogen activator
  • the product human t-PA is suitable for use, in all of its forms, in the prophylactic or therapeutic treatment of human beings for various cardiovascular conditions or diseases.
  • the present invention in one important aspect, is directed to methods of treating vascular disorders in human subjects using t-PA and to suitable pharmaceutical compositions thereof.
  • the present invention discloses for the first time a polypeptide of specified amino-acid sequence which has human tissue plasminogen activator function, and which can be expressed in a recombinant host cell from DNA encoding the polypeptide. Such a coding sequence is also disclosed for the first time. Variations or modifications in the polypeptide, as natural alleles or other derivatives, are possible while retaining the plasminogen activator function.
  • the present invention in enabling the production of such polypeptides by genetically engineered microorganisms or cell culture systems provides an opportunity to produce human tissue plasminogen activator in a much more efficient manner than has been possible, enabling hitherto elusive commercial exploitation.
  • the human tissue plasminogen activator hereof may contain associated glycosylation to a greater or lesser extent compared with native material.
  • the t-PA will be free of the contaminants normally associated with it in its non-recombinant cellular environment.
  • the present invention is also directed to recombinant DNA expression vectors hardening DNA sequences encoding such polypeptides in expressible form, and to recombinant microorganisms or cell cultures capable of expressing such polypeptides.
  • the invention is directed to processes for preparing such recombinant microorganisms and cell cultures, and to processes for preparing such polypeptides by expression in a recombinant host cell of DNA encoding the polypeptide.
  • human tissue plasminogen activator or "human t-PA” or “t-PA” denotes human extrinsic (tissue-type) plasminogen activator, produced by microbial or cell culture systems, in bioactive forms comprising a protease portion and corresponding to those tissue plasminogen activators otherwise native to human tissue.
  • the human tissue plasminogen activator protein produced herein has been defined by means of determined DNA gene and deductive amino acid sequencing. It will be understood that natural allelic variations exist and occur from individual to individual. These variations may be demonstrated by (an) amino acid difference(s) in the overall sequence or by deletions, substitutions, insertions, inversions or additions of (an) amino acid(s) in said sequence. In addition, the location of and degree of glycosylation will depend on the nature of the host cellular environment.
  • tissue plasminogen activator All such allelic variations and modifications resulting in derivatives of human tissue plasminogen activator are included within the scope of this invention, as well as other related human extrinsic (tissue-type) plasminogen activators, similar physically and biologically, so long as the essential, characteristic human tissue plasminogen activator activity remains unaffected in kind.
  • Human tissue plasminogen activator is prepared 1 ) having methionine as its first amino acid (present by virtue of the ATG start signal codon insertion in front of the structural gene) or 2) where the methionine is intra- or extracellularly cleaved, having its normally first amino acid, or 3) together with either its signal polypeptide or a conjugated protein other than the conventional signal polypeptide, the signal polypeptide or conjugate being specifically cleavable in an intra- or extracellular environment (See reference 21), or 4) by direct expression in mature form without the necessity of cleaving away any extraneous, superflous polypeptide.
  • the expression vehicle is designed to express the tissue plasminogen activator together with its signal peptide.
  • the thus produced human t-PA in its various forms, is recovered and purified to a level fitting it for use in the treatment of various vascular conditions or diseases.
  • t-PA has forms which include both the single chain (1-chain) protein and the 2-chain protein.
  • the latter is proteolytically derived from the 1-chain compound. It is theorized that the 2-chain protein is associated with produced fibrin and that proteolytic conversion from 1- or 2- chain material occurs at the locus of the conversion of plasminogen to plasmin.
  • the present invention provides for the administration of the 1-chain protein for in vivo conversion as just described or for the administration of 2-chain protein, which has also been shown to be active.
  • the 2-chain protein can be prepared by in vitro proteolytic conversion after the 1-chain material is produced.
  • tissue plasminogen activator hereof is produced containing the enzymatically active portion corresponding to native material and the term human tissue plasminogen activator defines products comprising such portion alone or together with additional amino acid sequences up to the full length molecule.
  • human t-PA thus has a functional definition; it is capable of catalyzing the conversion of plasminogen to plasmin, binds to fibrin, and is classified as a t-PA based on immunological properties as set forth hereinabove.
  • Essentially pure form when used to describe the state of human t-PA produced by the invention means free of protein or other materials normally associated with human t-PA when produced by non-recombinant cells, i.e. in its "native" environment.
  • DHFR protein refers to a protein which is capable of the activity associated with dihydrofolate reductase (DHFR) and which, therefore, is required to be produced by cells which are capable of sunrival on medium deficient in hypoxanthine, glycine, and thymidine (-HGT medium). In general, cells lacking DHFR protein are incapable of growing on this medium, cells which contain DHFR protein are successful in doing so.
  • DHFR protein refers to a protein which is capable of the activity associated with dihydrofolate reductase (DHFR) and which, therefore, is required to be produced by cells which are capable of sunrival on medium deficient in hypoxanthine, glycine, and thymidine (-HGT medium). In general, cells lacking DHFR protein are incapable of growing on this medium, cells which contain DHFR protein are successful in doing so.
  • Cells sensitive to MTX refers to cells which are incapable of growing on media which contain the DHFR inhibitor methotrexate (MTX).
  • MTX methotrexate
  • cells sensitive to MTX are cells which, unless genetically altered or otherwise supplemented, will fail to grow under ambient and medium conditions suitable for the cell type when the MTX concentration is 0.2 pg/ml or more. Some cells, such as bacteria, fail to exhibit MTX sensitivity due to their failure to permit MTX inside their cell boundaries, even though they contain DHFR which would otherwise be sensitive tothis drug.
  • cells which contain, as their DHFR protein, wild type DHFR will be sensitive to methotrexate if they are permeable or capable of uptake with respect to MTX.
  • Wild type DHFR refers to dihydrofolate reductase as is ordinarily found in the particular organism in question. Wild type DHFR is generally sensitive in vitro to low concentrations of methotrexate.
  • DHFR protein with low binding affinity for MTX has a functional definition. This is a DHFR protein which, when generated within cells, will permit the growth of MTX sensitive cells in a medium containing 0.2 pg/ml or more of MTX. It is recognized that such a functional definition depends on the facility with which the organism produces the "DHFR protein with low binding affinity for MTX" as well as upon the protein itself. However, as used in the context of this invention, such a balance between these two mechanisms should not be troublesome. The invention operates with respect to conferring the capability of surviving these levels of MTX, and it is not consequential whether the ability to do so is impacted by increased expression in addition to the innate nature of the DHFR produced. A convenient DHFR protein which fits this definition is disclosed in U.S. Appl Serial No. 459, 151, filed January 19, 1983, incorporated herein by reference.
  • “Expression vector” includes vectors which are capable of expressing DNA sequences contained therein, where such sequences are operably linked to other sequences capable of effecting their expression. It is implied, although not always explicitly stated, that these expression vectors must be replicable in the host organisms either as episomes or as an integral part of the chromosomal DNA. Clearly a lack of replicability would render them effectively inoperable.
  • “expression vector” is given a functional definition, and any DNA sequence which is capable of effecting expression of a specified DNA code disposed therein is included in this term as it is applied to the specified sequence.
  • expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA loops which, in their vector form are not bound to the chromosome.
  • plasmid and “vector” are used interchangeably as the plasmid is the most commonly used form of vector.
  • vector is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • Recombinant host cells refers to cells which have been transformed with vectors constructed using recombinant DNA techniques. As defined herein, t-PA is produced in the amounts achieved by virtue of this transformation, rather than in such lesser amounts, or, more commonly, in such less than detectable amounts, as might be produced by the untransformed host. t-PA produced by such cells can be referred to as "recombinant t-PA”.
  • vectors and methods disclosed herein are suitable for use in host cells over a wide range of prokaryotic and eukaryotic organisms.
  • E. coli K12 strain 294 (ATCC No. 31446) is particularly useful.
  • Other microbial strains which may be used include E. coli strains such as E. coli B, and E. coli X1776 (ATTC No. 31537). These examples are, of course, intended to be illustrative rather than limiting.
  • Prokaryotes may also be used for expression.
  • the aforementioned strains, as well as E. coli W3110(F-, ⁇ - , pro-totrophic, ATCC No. 27325), bacilli such as Bacillus subtilus, and other enterobacteriaceae such as Salmonella typh-imurium or Serratia marcescens, and various pseudomonas species may be used.
  • plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts.
  • the vector ordinarily carries a replication site, as well as marking sequences which are capable of providing phenotypic selection in transformed cells.
  • E. coli is typically transformed using pBR 322, a plasmid derived from an E. coli species (Bolivar, et al., Gene, 2:95 (1977)).
  • pBR 322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.
  • the pBR 322 plasmid, or other microbial plasmid must also contain, or be modified to contain, promoters which can be used by the microbial organism for expression of its own proteins.
  • promoters most commonly used in recombinant DNA construction include the ⁇ -lactamase (penicillinase) and lactose promoter systems (Chang et al., Nature, 275: 617 (1978); Itakura, et al, Science, 198: 1056 (1977); (Goeddel, et al Nature 281: 544 (1979) and a tryptophan (trp) promoter system (Goeddel, et al, Nucleic Acids Res., 8: 4057 (1980); EPO Appl Publ No.
  • eukaryotic microbes such as yeast cultures may also be used.
  • Saccharomyces cere-visiae, or common baker's yeast is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available.
  • the plasmid YRp7 for example, (Stinchcomb, et al, Nature, 282:39 (1979); Kingsman et al, Gene, 7: 141(1979); Tschemper, et al, Gene, 10: 157 (1980)) is commonly used.
  • This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85: 12 (1977)).
  • the presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
  • Suitable promoting sequences in yeast vectors include the promoters for 3-phosphoglycerate kinase (Hitzeman, et al., J. Biol. Chem., 255:12073 (1980)) or other glycolytic enzymes (Hess, et al, J. Adv.
  • the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.
  • Other promoters which have the additional advantage of transcription controlled by growth conditions are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde -3- phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization (Holland, ibid.). Any plasmid vector containing yeast-compatible promoter, origin of replication and termination sequences is suitable.
  • cultures of cells derived from multicellular organisms may also be used as hosts.
  • any such cell culture is workable, whether from vertebrate or invertebrate culture.
  • interest has been greatest in vertebrate cells, and propogation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years [Tissue Culture, Academic Press, Kruse and Patterson, editors (1973)].
  • useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, BHK, COS-7 and MDCK cell lines.
  • Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences.
  • control functions on the expression vectors are often provided by viral material.
  • promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40).
  • the early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers, et al., Nature, 273: 113 (1978). Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hind I site toward the Bgl I site located in the viral origin of replication.
  • promoter or control sequences normally associated with the desired gene sequence provided such control sequences are compatible with the host cell systems.
  • An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g. Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
  • an exogenous origin such as may be derived from SV40 or other viral (e.g. Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
  • a preferred host cell for transfection by the vectors of the invention which comprise DNA sequences encoding both t-PA and DHFR protein it is appropriate to select the host according to the type of DHFR protein employed. If wild type DHFR protein is employed, it is preferable to select a host cell which is deficient in DHFR, thus permitting the use of the DHFR coding sequence as a marker for successful transfection in selective medium which lacks hypoxanthine, glycine, and thymidine.
  • An appropriate host cell in this case is the Chinese hamster ovary (CHO) cell line deficient in DHFR activity, prepared and propagated as described by Urlaub and Chasin, Proc. Natl. Acad. Sci. (USA) 77: 4216 (1980).
  • DHFR protein with low binding affinity for MTX is used as the controlling sequence, it is not necessary to use DHFR deficient cells. Because the mutant DHFR is resistant to methotrexate, MTX containing media can be used as a means of selection provided that the host cells are themselves methotrexate sensitive. Most eukaryotic cells which are capable of absorbing MTX appear to be methotrexate sensitive.
  • One such useful cell line is a CHO line, CHO-K1 ATCC No. CCL 61.
  • E. coli using the lac and trp promoter system and use of CHO cells as host cells, and expression vectors which include the SV40 origin of replication as a promoter.
  • expression vectors which include the SV40 origin of replication as a promoter.
  • analogous techniques to construct expression vectors for expression of desired protein sequences in alternative prokaryotic or eukaryotic host cell cultures.
  • DHFR dihydrofolate reductase
  • methotrexate methotrexate
  • transfection is carried out by the calcium phosphate precipitation method as described by Graham and Van der Eb, Virology, 52: 456 (1973).
  • other methods for introducing DNA into cells such as by nuclear injection or by protoplast fusion may also be used.
  • the preferred method of transfection is calcium treatment using calcium chloride as described by Cohen, F N. et al Proc. Natl. Acad. Sci. (USA), 69: 2110 (1972).
  • Plasmids containing the desired coding and control sequences employ standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to from the plasmids required.
  • Cleavage is performed by treating with restriction enzyme (or enzymes) in suitable buffer.
  • restriction enzyme or enzymes
  • suitable buffer In general, about 1 pg plasmid or DNA fragments is used with about 1 unit of enzyme in about 20 J.l1 of buffer solution. (Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer.) Incubation time of about 1 hour at 37°C are workable. After incubations, protein is removed by extraction with phenol and chloroform, and the nucleic acid is recovered from the aqueous fraction by precipitation with ethanol.
  • the preparation is treated for 15 minutes at 15°C with 10 units of Polymerase I (Klenow), phenolchloroform extracted, and ethanol precipitated.
  • Size separation of the cleaved fragments is performed using 6 percent polyacrylamide gel described by Goeddel, D., et al, Nucleic Acids Res., 8: 4057 (1980) incorporated herein by reference.
  • ligation For ligation approximately equimolar amounts of the desired components, suitably end tailored to provide correct matching are treated with about 10 units T4 DNA ligase per 0.5 pg DNA. (When cleaved vectors are used as components, it may be useful to prevent religation of the cleaved vector by pretreatment with bacterial alkaline phosphatase.)
  • the ligation mixtures are used to transform E. coli K12 strain 294 (ATCC 31446), and successful transformants selected by ampicillin or tetracycline resistance where appropriate. Plasmids from the transformants are prepared, analyzed by restriction and/or sequenced by the method of Messing, et al, Nucleic Acids Res., 9:309 (1981) or by the method of Maxam, et al, Methods in Enzymology, 65:499 (1980).
  • Amplification of DHFR protein coding sequences is effected by growing host cell cultures in the presence of approximately 20-500,000 nM concentrations of methotrexate, a competitive inhibitor of DHFR activity.
  • concentrations of methotrexate a competitive inhibitor of DHFR activity.
  • the effective range of concentration is highly dependent, of course, upon the nature of the DH FR gene, protein and the characteristics of the host. Clearly, generally defined upper and lower limits cannot be ascertained. Suitable concentrations of other folic acid analogs or other compounds which inhibit DHFR could also be used.
  • MTX itself is, however, convenient, readily available and effective.
  • Human tissue plasminogen activator was obtained according to the following protocol:
  • methotrexate as a drug which, while normally fatal to cells capable of its uptake, permits cells to grow in the presence of controlled levels of MTX by amplification of the gene coding for the DHFR coding sequence (Schimke, Robert T. et al, Science, 202: 1051 (1978); Biedler, J. L. et al. Cancer Res. 32:153 (1972); Chang, S. E., et al, Cell, 7: 391 (1976)).
  • amplification of the gene for DHFR may cause amplification of associated sequences which code for other proteins.
  • the associated protein is hepatitis B surface antigen (HBsAg) (Christman, J. et al. Proc. NatL Acad. Sci. 79: 1815 (1982)); the E. coli p rotein XGPRT (Ringold, Gordon, et al, J. Molec. and Appl. Gen., 1: 165 (1981 )); and an endogenous sequence from a DHFR/SV40 plasmid combination (Kaufman, R. F. et al, J. Molec. Biol., 159: 601 (1982)).
  • methotrexate resistance Other mechanisms for conferring methotrexate resistance include diminution of the binding affinity of the DHFR protein, so that it is less susceptible to methotrexate (Flintoff, W. F., et al, Somat. Cell Genet., 2 : 245 (1976)) but in this instance, amplification appears to occurs as well.
  • this aspect of the invention herein concerns using the impact of DHFR sequence amplification on associated protein coding sequences to provide a control mechanism which permits enhanced expression levels of t-PA sequences in the presence of MTX, or by virtue of prior treatment of transformed cells with MTX.
  • E. coli host culture and a CHO cell line suitable for the type of DHFR protein coding sequence to be introduced were employed as host cell cultures.
  • other eukaryotic and prokaryotic cells are suitable forthe method of the invention as well.
  • oligonucleotide ⁇ 100 pmole of oligonucleotide ⁇ was phosphorylated in a 30 ⁇ l reaction mixture containing 60 mM Tris (pH 8), 10 mM MgCl 2 , 15 mM [ ⁇ -mercaptoethanol and 50 4 Ci [ ⁇ 32 P] ATP (Amersham 5,000 Cimmol -1 ) 12 units of T4 polynucleotide kinase were added and the reaction allowed to proceed at 37°C for 15 min. One ⁇ l of 10 mM ATP and 12 units of T4 kinase were then added and the reaction allowed to proceed for an additional 30 min.
  • the phosphorylated oligomer ⁇ and the 5' hydroxyl oligomer I were combined with 0.5 ⁇ g of the eluted 55 bp Sau3A
  • the mixture was digested for 1 hour with 48 units of Narl, i20 units of EcoRl and 40 units of Bgl ⁇ (to eliminate polymerization through ligation of cohesive Sau3AI termini) and electrophoresed on a 6 percent gel.
  • the 338 bp product (approximately 0.1 ⁇ g) was recovered by electroelution.
  • the remainder of the t-PA coding sequences (amino acids 111-528) were isolated on a 1645 bp fragment by digesting plasmid pPA25E10 with Narl and Bg/ ⁇ .
  • the plasmid pLeIFAtrp103 is a derivative of the plasmid pLelFA25 (52) in which the EcoRl site distal to the LelF A gene has been removed (53). Three ⁇ g of pLeIFAtrp103 were digested with 20 units of EcoRl and 20 units of Bglll for 90 min. at 37°C, electrophoresed on 6 percent polyacrylamide gel and the large ( ⁇ 4,200 bp) vector fragment was recovered by electroelution.
  • Figure 10 shows the result of a fibrin plate assay for fibrinolytic activity of a tissue plasminogen activator expression product hereof.
  • An overnight culture of E. coli W31101/pt-PAtrpl2 in Luria broth containing 5 ⁇ g ml- 1 tetracycline was diluted 1:100 in M9 medium containing 0.2 percent glucose, 0.5 percent casamino acids and 5 p g ml- 1 tetracyline.
  • the cell pellets were suspended in 6M guanidine hydrochloride at 5 ⁇ 10 8 cells/ml, sonicated for 10 sec, incubated at 24°C for 30 min and then dialyzed for 4 hrs against 25 mM Tris-HCI pH 8.0,250 mM NaCl, 0.25 mM EDTA and 0.01 percent Tween 80 * After dialysis the samples were centrifuged at 13,000 Xg for 2 min and 10 p l of the supernatants analyzed for tissue plasminogen activator activity. Following the procedure of Granelli-Piperno and Reich (87), the plate was incubated for 3.5 hours at 37°C and lysis zones measured. Quantification was obtained by comparison to dilutions of a purified melanoma tissue plasminogen activator solution.
  • Human melanoma cells (Bowes) were used. The melanoma cells were cultured to confluent monolayers in 100 ml Earles Minimal Essential Media supplemented with sodium bicarbonate (0.12 percent final concentration), 2 mM glutamine and 10 percent heat-inactivated fetal calf serum. To confirm that the melanoma cells were actively producing human tissue plasminogen activator, human melanoma cells were cultured to confluency in a 24 well microtiter dish. Either in the presence or absence of 0.33 ⁇ M the protease inhibitor aprotinin, the cells were washed once with phosphate buffered saline and 0.3 ml of serum free methionine free medium was added.
  • RNA from melanoma cell cultures was extracted essentially as reported by Ward et al. (55). Cells were pelleted by centrifugation and then resuspended in 10 mM NaCl, 10 mM Tris-HCI pH 7.5, 1.5 mM MgCl 2 . Cells were lysed by the addition of NP-40 (1 percent final concentration), and nuclei were pelleted by centrifugation. The supernatant contained the total RNA which was further purified by multiple phenol and chloroform extractions. The aqueous phase was made 0.2 M in NaCI and then total RNA was precipitated by the addition of two volumes of ethanol.
  • Oligo-dT cellulose chromatography was utilized to purify mRNA from the total RNA preparations (54). Typical yields from 10 grams of cultured melanoma cells were 5 to 10 milligrams of total RNA and 50-200 micrograms of Poly(A) plus mRNA.
  • Fractionation of PolyA+ mRNA (200 pg) (56) was performed by electrophoresis through urea-agarose gels.
  • the slab agarose gel (57, 58) was composed of 1.75 percent agarose, 0.025 M sodium citrate, pH 3.8 and 6 M urea. Electrophoresis was performed for 7 hours at 25 milliamps and 4°C. The gel was then fractionated with a razor blade. The individual slices were melted at 70°C and extracted twice with phenol and once with chloroform. Fractions were then ethanol precipitated and subsequently assayed by in vitrotranslation in a rabbit reticulocyte lysate system, Bethes-da Research Lab.
  • the resulting translation products from each gel fraction were immunoprecipitated with rabbit anti-human tissue plasminogen activator specific IgG.
  • One major immunoprecipitated polypeptide band was observed in the translation of RNA fraction numbers 7 and 8 (migration of 21 to 24S) having molecular weight of approximately 63,000 daltons. This band was not observed when preimmune IgG was used for immunoprecipitation which suggested these polypeptides were tissue plasminogen activator specific.
  • E.1.D Preparation of a colony library containing tissue plasminogen activator sequences
  • Five ⁇ g of gelfractionated mRNA (gel slice 7 mRNA) was used for the preparation of double stranded cDNA by standard procedures (52, 65, 66).
  • the cDNA was size fractionated on a 6 percent polyacrylamide gel.
  • the cDNA greater than 350 base pairs in length (125 ng) was electroeluted.
  • the molecule was scanned in order to locate regions best suited for making synthetic probes, as follows:
  • the resulting lyophilized carboxymethylated protein was redissolved in 3 ml of 0.1 M sodium phosphate buffer (pH 7.5). Trypsin (TPCK) was added (1 to 50 ratio) and digested at 37°C. Aliquots (0.1 ml) were taken at 3 hours, 6 hours, and 12 hr. A second addition of trypsin was made at 12 hr. The reaction was stopped for 24 hr by freezing the sample until it could be injected on the HPLC. The progress of the digestion was determined by SDS gels on the aliquots. All gels were blank except for a faint band on the 3 hour aliquot. This indicated that the 24 hour digestion was complete and no large peptides remained.
  • TPCK Trypsin
  • a sample (ca. 0.5 ml) was injected into a high resolution Altex C-8 ultrasphere 5 ⁇ column with two runs. A gradient of acetonitrile was made gradual (1 percent to 5 percent in 5 min, 5 percent to 35 percent in 100 min, 35-50 percent in 30 min). In one of the two preparative runs, the eluant was monitored at two wavelengths (210 nm and 280 nm). The ratio of the two wavelength absorptions was used to indicate the tryptophan containing peptides.
  • the colonies were individually inoculated into wells of microtiter plates containing LB (93)+5 ⁇ g/ml tetracycline and stored at -20°C after addition of DMSO to 7 percent. Two copies of the colony library were grown up on nitrocellulose filters and the DNA from each colony fixed to the filter by the Grunstein Hogness procedure (69).
  • the 32 P-labelled-TC( A G)CA( A G)TA(G)TCCCA probe was prepared (from the synthetic oligomer) (W-E-Y-C-D) 14-mer pool as described above. Filters containing 4,600 transformants were prehybridized for 2 hours at room temperature in 50 mm sodium phosphate DH 6.8. 5X SSC (80), 150 ug/ml sonicated salmon sperm DNA, 5XDenhardt's solution (85) 10 percent formamide and then hybridized with 50 ⁇ 10 6 counts per minute of the labelled probe in the same solution.
  • the filters were washed 3 times at room temperature in 6xSCC, 0.1 percent SDS for 30 minutes, once in 2xSSC and then exposed to Kodak XR-5 x-ray film with Dupont Lightning Plus intensifying screens for 16 hours.
  • Plasmid DNA was isolated by a rapid method (71) from all colonies showing a positive hybridization reaction.
  • the cDNA inserts from these clones were then sequenced after subcloning fragments into the M13 vector mp7 (73) and by the Maxam Gilbert chemical procedure (74).
  • Figure 3 displays filter number 25 showing in the hybridization pattern a positive tissue plasminogen activator clone.
  • the cDNA insert in clone 25E 10 was demonstrated to be the DNA coding for tissue plasminogen activator by comparing its amino acid sequence with peptide sequence (See Supra) obtained from purified tissue plasminogen activator and by its expression product produced in E. colias described in more detail infra.
  • the cDNA insert of clone 25E1 (plasmid pPA25E10) was 2304 base pairs in length with the longest open reading frame encoding a protein of 508 amino acids (MW of 56,756) and containing a 772 bp 3' untranslated region. This cDNA clone lacked the N-terminal coding sequences.
  • E.1.G Direct expression of a human tissue plasminogen activator clone in E. coli
  • pPA25E10 50 pg of pPA25E10 (supra) were digested with Pst I and the 376 bp fragment isolated by electrophoresis on a 6 percent polyacrylamide gel. Approximately 3 ⁇ g of this fragment was isolated from the gel by electroeluting, digested with 30 units of Dde I for 1 hr at 37°C phenol and chloroform extracted, and ethanol precipitated. The resulting Dde I sticky ends were extended to blunt ends by adding 5 units of DNA polymerase I (Klenow fragment) and 0.1 mM each of dATP, dCTP, dGTP, dTTP to the reaction mixture and incubating at 4°C for 8 hours.
  • DNA polymerase I Klenow fragment
  • the DNA was digested with 15 units of Nar I for 2 hours and the reaction mixture electrophoresed on a 6 percent polyacrylamide gel. Approximately 0.5 ⁇ g of the desired 125 bp blunt end Nar I fragment was recovered. This fragment codes for amino acids number 69 through 110 of the mature full length tissue plasminogen activator protein.
  • the plasmid pAR1 exSRC is a derivative of the plasmid pSRCe ⁇ 16 (79) in which the EcoRl sites proximal to the * Trade mark trp promoter and distal to the SRC gene have been removed by repair with DNA polymerase 1(28), and the self-complementary oligodeoxynucleotide AATTATGAATTCAT (synthesized by the phosphotriester method (75) was inserted into the remaining Eco RI site immediately adjacent to the Xba I site. 20 ⁇ g of pAR1 exSRC were digested to completion with Eco Rl , phenol and chloroform extracted, and ethanol precipitated.
  • the plasmid was then digested with 100 units of nuclease S1 at 16°C for 30 minutes in 25 mM sodium acetate (pH 4.6), 1 mM ZnCl 2 and 0.3 M NaCl to create a blunt end with the sequence ATG. After phenol and chloroform extraction and ethanol precipitation, the DNA was digested with Bam HI, electrophoresed on a 6 percent polyacrylamide gel, and the large (4,300 bp) vector fragment recovered by electroelution.
  • the expression plasmid was assembled by ligating together 0.2 pg of vector, 0.06 pg of the 125 bp blunt end-Nar I fragment and 0.6 ⁇ g of the 1645 bp Nar lbgl fragment with 10 units of T 4 DNA ligase for 7 hours at room temperature and used to transform E. coli strain 294 (ATCC No. 31446) to ampicillin resistance. Plasmid DNA was prepared from 26 of the colonies and digested with Xba I and Eco RI. Twelve of these plasmids contained the desired 415 bp Xba IEco RI and 472 bp Eco RI-fragments.
  • 5 ng cDNA was extended with deoxy(C) residues using terminal deoxycytidyl transferase (67) and annealed with 50 ng of the plasmid pBR322 (68) which had been similarly tailed with deoxy(G) residues at the Pst I site (67).
  • the annealed mixture was then transformed into E. coli K12 strain 294. Approximately 1,500 transformants were obtained.
  • the strategy used to identify ⁇ phage recombinants carrying tissue plasminogen activator genes consisted in detecting nucleotide homology with a radioactive probe prepared from the tissue plasminogen activator cDNA of pPA25E10.
  • a radioactive probe prepared from the tissue plasminogen activator cDNA of pPA25E10.
  • One million recombinant ⁇ phage were plated out on DP 50 Sup F at a density of 10,000 pfu/15 cm plate, and nitrocellulose filter replicas were prepared for each plate by the method of Benton and Davis (78).
  • a 32 P-labelled DNA probe was prepared by standard procedures (83) from a 230 base pair Hpa II-Rsa I fragment located 34 base pairs from the 5' end of the plasmid pPA25E10.
  • Each nitrocellulose filter was prehybridized at 42°C for 2 hours in 50 mM sodium phosphate (pH 6.5), 5X SSC (77), .05 mg/ml sonicated salmon sperm DNA, 5X Denhardt's solution (84), 50 percent formamide and then hybridized with 50 ⁇ 10 6 counts per minute of the labelled probe in the same solution containing 10 percent sodium dextran sulfate (85). After an overnight incubation at 42°C, the filters were washed 4 times at 50° in 0.2X SSC, 0.1 percent SDA for 30 minutes, once in 2x SSC at room temperature and then exposed to Kodak XR-5 X-ray film with Dupont Cronex intensifying screens overnight.
  • the colonies were transferred from plates and grown on nitrocellulose filters and the DNA from each colony fixed to the filter by the Grunstein-Hogness procedure (69).
  • a 32 P-labelled probe was made by calf-thymus priming (83) a 4.2 kilobase pair Pvu 11 fragment from an isolated tissue plasminogen activator ⁇ genomic clone. Filters containing the 1,500 transformants were hybridized with 112X106 cpm of 32 P-genomic Pvu II fragment. Hybridization was for 16 hours using conditions described by Fritsch et. al (82). Filters were extensively washed and then exposed to Kodak XR-5 X-ray film with Dupont Lightning-Plus intensifying screens for 16-48 hours.
  • the native tissue plasminogen activator molecule has the potential to be stabilized by 17 disulfide bridges based on homology with other serine proteases. There are four potential N-glycosylation sites, three located in the "kringle" regions at asn 117' asn 184 , asn 218 and one potential site in the light chain region, at asn 448 . Variations in the structure of the oligosaccharide ligands may be responsible for the different molecular forms (65,000 and 63,000 mol. wt. species).
  • E.1.1 Direct expression of full length tissue plasminogen activator cDNA clone in E. coli
  • a reconstruction of the entire coding sequence was possible employing the common Hhal restriction endonuclease site shared by both partial clones pPA17 and pPA25E10.
  • a 55 pb Sau3Al-Hhal restriction fragment corresponding to amino acids 5-23 was isolated from the plasmid pPAl7.
  • the Sau3AI restriction site was located at codon four of the presumed mature coding sequence and was used to remove the signal peptide coding region.
  • a 263 bp Hhal -Narl fragment (coding for amino acids 24-110) was also isolated from plasmid pPA25E10.
  • Two synthetic deoxyoligonucleotides were designed which restore the codons for amino acids 1-4, incorporate an ATG translational initiation codon and create an EcoRl cohesive terminus. These free fragments were then ligated together to from a 338 bp fragment coding for amino acids 1-110.
  • This fragment and a 1645 bp Narl-Bg/l fragment from pPA25 E10 were then ligated between the EcoRl and Bg/ II sites of the plasmid pLetFAtrp1 03 (53) to give the expression plasmid pt-PAtrp12.
  • the cloned t-PA gene is transcribed under the control of a 300 bp fragment of the E. coli trp operon which contains the trp promoter, operator, and the Shine-Dalgarno sequence of the trp leader peptide but lacks the leader peptide ATG initiation codon (52).
  • E. coliK12 strain W3110 (ATCC No. 27325) containing the plasmid pt-PAtrp12 was grown, and extracts prepared for assay of fibrinolytic activity.
  • One method used for measuring tissue plasminogen activator activity is the fibrin plate assay (87). This measures the amount of plasmin formation by measuring the extent of plasmin digestion of fibrin in an agarose plate containing plasminogen and fibrin. Plasmin produces a clear lysis zone in the fibrin plate and the area of this zone can be correlated to the amount of tissue plasminogen activator in the sample.
  • Sequence analysis was based on the Edman degradation (83b).
  • the sample was introduced into the cup of the Beckman * 8908 or 890C spinning cup sequencer.
  • Polybrene * poly N,N,NlN l -tetramethyl - N-trimethylenehexameth-ylene diammonium diacetate
  • the sequencer was modified with a cold trap and some program changes to reduce background peaks.
  • the reagents were Beckman's sequence grade 0.1 molar Quadrol * buffer, phenylisothiocyanate, and heptafluorabutyric acid.
  • a sensitive assay for tissue plasminogen activator can be obtained by monitoring the tissue plasminogen activator catalyzed conversion of plasminogen to plasmin.
  • Plasmin is an enzyme for which there are chromogenic substrate assays. These assays are based on the proteolytic cleavage of a tripeptide from a chromophoric group. The rate of cleavage is directly related to both the specificity and the concentration of the protease being tested. The basis of the assay is the determination of the amount of plasmin formed following incubation of the tissue plasminogen activator containing solution with a solution of plasminogen. The greater the amount of activator, the greater the amount of plasmin formed. Plasmin is measured by monitoring its cleavage of the chromogenic substrate S2251 (purchased from Kabi Group, Inc., Greenwicht, CT).
  • the assay conditions for detection of the full length tissue plasminogen activator were modified by the addition of fibrinogen (0.2 mg) to the solution. Fibrinogen results in a stimulation of the activity of tissue plasminogen activator observed therefore resulting in somewhat elevated level of activity. Activity was recorded in Plough units, wherein 90,000 Plough units is equal to the activity exhibited by 1 mg of purified tissue plasminogen activator.
  • a sensitive assay for tissue plasminogen activator activity has been developed (87).
  • the assay is based on determination of plasmin formation by measuring the extent of plasmin digestion of fibrin in an agar plate containing fibrin and plasminogen. Plasmin produces a clear lysis zone in the fibrin plate. The area of this lysis zone can be correlated to the amount of tissue plasminogen activator in the sample.
  • a colony of E. colicontaining the plasmid (p ⁇ RIPA°) was inoculated into a test tube containing 5 mL of LB growth media containing 20 pg/ml ampicillin. The cells were grown overnight at 37°C. An aliquot of this culture was diluted 1: 100 into 300 ml of M9 media containing 20 pg/ml ampicillin. The cells were grown in a shaker flask at 37°C for four hours, with a resulting absorbance at 550 nm of 0.419. The tryptophan analog indole acrylic acid was added to a concentrated of 30 pg/ml. The cells were incubated 90 minutes, with a resulting absorbance at 550 nm of 0.628.
  • the cells were harvested by centrifugation and resuspended in 0.8 ml of 0.01 M Tris, pH 8.0, containing 0.01 M EDTA. The resulting suspension was stirred rapidly at room temperature for 18 hours. The sample was centrifuged and the supernatant assayed for tissue plasminogen activator activity.
  • Tables 1 and 2 show the results of the activation of plasminogen by respective E. coli extracts when assayed. An activity is generated which is dependent on the presence of plasminogen (Table 1). This activity is not affected by pre-immune serum of a rabbit but is markedly inhibited by antiserum which was raised against purified melanoma cell derived tissue plasminogen activator (88) (Tables 1 and 2). This demonstrates that the E. coli extracts are producing a plasminogen activating activity which is inhibited by antibodies against the tissue plasminogen activator.
  • Figure 7 shows the result of a fibrin plate assay for fibrinolytic activity.
  • a standard amount of urokinase was added to the center row in concentrations, from left to right, of 0.24, 0.14 ; 0.10, 0.05 and 0.02 Plough Units.
  • the bottom row is samples of natural tissue plasminogen activator, with the same amount of enzyme in each well.
  • the wells contain, from left to right, tissue plasminogen activator, anti-plasminogen activator plus preimmune serum, and tissue plasminogen activator plus tissue plasminogen activator antibodies.
  • the wells in the top row each contain 8 ⁇ l of the recombinant tissue plasminogen activator E. coli extracts.
  • the first well is the extract alone, the second well has pre-immune serum added, and the third well has the tissue plasminogen activator antibodies added. It is obvious that the preimmune serum does not affect natural or recombinant tissue plasminogen activator, and that tissue plasminogen activator antibodies inhibit the activity of natural as well as the E. coli extracts. Based on the urokinase standards, the extracts contain slightly less than 2.5 Plough units per ml. This compares favorably with the value obtained in Table 1 of 1.3 Plough units per ml.
  • Tables 1 and 2 set forth the results of assays performed as described above in E.1.K.1 b.:
  • Figure 10 represents the results of a fibrin plate assay performed with extracts from 10 L fermentation cultures of E. coli containing a tissue plasminogen activator expressing plasmid.
  • the fibrinolytic activity of the tissue plasminogen activator containing extract is represented in Figure 10 by Well A. This fibrinolytic activity is inhibited by anti t-PA IgG (Well C) but not by preimmune IgG (Well B) or anti urokinase IgG (Well D) and no activity is seen from an extract prepared from cells containing as a control the leukocyte interferon plasmid pLeIFAtrp103 (Well H).
  • t-PA human tissue plasminogen activator
  • Plasmid pPA17 was digested with Dde I, filled in using Klenow DNA polymerase 1, and subcut with Pst I; the approximately 200 bp fragment containing 5' terminal t-PA sequence thus generated was isolated.
  • the second t-PA fragment was obtained by digesting pt-PAtrp12 with Pst I and Nar I and isolating the approximately 310 bp fragment.
  • the third t-PA fragment was obtained by digesting pPA25E10 with Nar I and Bgl 11 and isolating the approximately 1645 bp fragment which contains, in addition to much of the t-PA coding region, some 3' non-translated sequences.
  • Plasmid pE342 which expresses HBV surface antigen (also referred to as pHBs348-E) has been described by Levinson et al, in EP 73656. Briefly, the origin of the Simian virus SV40 was isolated by digesting SV40 DNA with Hindlll, and converting the Hindll ends to EcoRl ends by the addition of a converter (AGCTGAATTC). This DNA was cut with Pvull, and RI linkers added. Following digestion with EcoRl, the 348 base-pair fragment spanning the origin was isolated by polyacrylamide gel electrophoresis and electroelution, and cloned in pBR322.
  • Expression plasmid pHBs348-E was constructed by cloning the 1986 base-pair fragment resulting from EcoRl and Bglll digestion of HBV (Animal virus Genetics, (Ch. 5) Acad. Press, N.Y (1980)) (which spans the gene encoding HBsAg) into the plasmid pML (Lusky et al., Nature, 293: 79 (1981) at the EcoRl and BamHl sites.
  • pML is a derivative of pBR322 which has a deletion eliminating sequences which are inhibitory to plasmid replication in monkey cells).
  • the resulting plasmid (pRl-Bgl) was then linearized with EcoRl, and the 348 base-pair fragment representing the SV40 origin region was introduced into the EcoRl site of pRl-Bgl.
  • the origin fragment can insert in either orientation. Since this fragment encodes both the early and late SV40 promoters in addition to the origin of replication, HBV genes could be expressed under the control of either promoter depending on this orientation (pHBS348-E representing HBs expressed under control of the early promoter).
  • pE342 is modified by partially digesting with Eco RI, filling in the cleaved site using Klenow DNA ploymerase I, and ligating the plasmid back together, thus removing the Eco RI site preceding the SV40 origin in pE342.
  • the resulting plasmid designated pE342AR1
  • pE342AR1 is digested with Eco RI, filled in using Klenow DNA polymerase I, and subcut with Bam HI. After electrophoresing on acrylamide gel, the approximately 3500 bp fragment is electroeluted, phenolchloroform extracted, and ethanol precipitated as above.
  • p342E 3500 bp vector and above described t-PA fragments comprising approximately 2160 bp were ligated together using standard techniques.
  • a plasmid containing the three t-PA encoding fragments in the proper orientation was isolated, characterized, and designated pE342-t-PA.
  • This plasmid was digested with Sac II and treated with bacterial alkaline phosphatase (BRL).
  • BBL bacterial alkaline phosphatase
  • This fragment was ligated into the pE342-t-PA plasmid to create pETPAER400, a plasmid which is analogous to pEHER except that the HBsAg coding region has been replaced by the cDNA sequences from t-PA
  • pETPAER400 (pETPER) was transfected into both dhfr CHO-DUX B11 cells and DHFR+ CHO-K1 (ATCC CCL61 ) cells by method of Graham and Van der Eb (supra). Transformed dhfr cells were selected by growth in glycine, hypoxanthine and thymidine deficient medium. Transformed DHFR + cells were selected by growth in ⁇ 100 nM MTX. Colonies which arose on the appropriate selection medium were isolated using cloning rings and propagated in the same medium to several generations.
  • cells from the colonies are split into media containing 5 X 10 4 , 105 , 2.5 X 10 5 , 5 X 10 5 , and 106 nM MTX and passaged several times.
  • Cells are plated at very low (102 - 103 cells/plate) cell densities in 10 cm dishes and the resulting colonies are isolated.
  • t-PA expression of t-PA in the transfected amplified colonies may conveniently be assay by the methods similar to those set forth in E.1.K.1.b (supra).
  • Coamplification of DHFR and t-PA sequences is assayed by isolating DNA from confluent monolayers of amplified colonies as follows: Confluent monolayers in 150 mm plates are washed with 50 ml sterile PBS and lysed by the addition of 5 ml of 0.1 percent SDS, 0.4 M CaCl 2 , 0.1 M EDTA, pH 8. After 5-10 minutes, the mixture is removed, phenol extracted, chloroform extracted, and ethanol precipitated.
  • the DNA is resuspended in 1 ml (per 100 mm plate) 10 mM Tris-HCI pH 8, 1 mM EDTA (TE), RNase added to 0.1 mg/ml, and the solution incubated 30 minutes at 37°C. SDS is then added to 0.1 percent and pronase (Sigma) is added to 0.5 mg/ml. After 3-16 hours incubation at 37°C, the solution is again phenol extracted, chloroform extracted, and ethanol precipitated. The DNA pellet is resuspended in 0.5 ml water and digested with restriction enzymes.
  • digested DNA is electrophoresed in an agarose gel [1 percent agarose in Tris-acetate buffer (40 mM Tris, 1 mM EDTA, made to pH 8.2 with acetic acid)] ; Crouse, et al, J. Biol. Chem., 257: 7887 (1982)). After bromphenol blue dye had migrated 2/3 of the way down the gel, the gel is removed and stained with ethidium bromide. After visualizing the DNA with ultraviolet light, the DNA is transferred from the gel to nitrocellulose filters according to the procedure of Southern (J. Mol. BioL 98: 503 (1975)). The filters are then hybridized with a nick translated probe made from the 1700 bp Sacl I fragment of pEHER (prepared and hybridized as described above), or from the approximately 1970 bp Bgl II fragment of pETPER.
  • agarose gel 1 percent agarose in Tris-acetate buffer (40 mM Tris, 1 mM EDTA, made
  • plasmid pETPFR was conducted containing the DNA sequence encoding wild type DHFR.
  • the construction was as described in Example E.2.A except that in place of plasmid pEHER as a source for the DHFR protein gene sequence, the plasmid pE342 . HBV ⁇ E400 . D22 was substituted.
  • the plasmid pE342 . HBV . E400 . D22 is the same as pEHER except for a single base pair difference between wild type and mutant DHFR.
  • the resulting plasmid pETPFR is analogous in every way to pETPER except that the DNA sequence encoding for wild type DHFR is substituted for that of the mutant.
  • pETPFR was used to transfect DHFR deficient CHO cells (Urlaub and Chasin (supra)) using the calcium phosphate precipitation method of Graham and Van der Eb. Twenty-one colonies which arose on the selective medium (-HGT) were assayed by detection of plasmin formation as assessed by the digestion of fibrin in an agar plate containing fibrin and plasminogen, described by Granelli-Piperno, et al, J. Exp. Med., 148: 223 (1978).
  • Subclone 1-15 was further amplified by seeding 2X10 5 cells in 100 mm plates containing 500 nM MTX. Assay of the cells thus amplified yielded a further increase (of about 3 fold) in t-PA production; when assayed quantitatively by the method of C.1.C, levels were in the range of 7 X 10-4 units/cell/day. A portion of these amplified cells was then transferred and maintained in the presence of 10,000 nM MTX. Subclones of 1-15, and 18B-9 were further tested after being maintained for approximately 1-2 months at the conditions specified in Table 3.
  • Cell line “1” is an unamplified clone from the original set of four.
  • “1-15 500” is an amplified subclone of cell line "1 " which was amplified initially in 50 nM MTX to give 1-15 and then transferred for further amplification into 500 nM MTX.
  • 1-15 10,000 is subclone of 1-15 50o which has been further amplified in the presence of 10 ; 000 nM MTX.
  • Cell line 18B-9 is a subclone of one of the original four detected which had been amplified on 50 nM MTX.
  • All of the amplified cells show increased levels of t-PA production over that exhibited by the unamplified cell culture. Even the unamplified culture produces amounts of t-Pa greater than 0.5 pg/cell/day, amplification results in levels approaching 50 pg/cell/day.
  • the compounds of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the human tissue plasminogen activator product hereof is combined in admixture with a pharmaceutically acceptable carrier vehicle.
  • a pharmaceutically acceptable carrier vehicle e.g. water, ethanol, styrene, styrene, styrene, styrene, styrene, styrene, styl, g. human serum albumin, are described for example in Remington's Pharmaceutical Sciences by E. W. Martin, which is hereby incorporated by reference.
  • Such compositions will contain an effective amount of the protein hereof together with a suitable amount of vehicle in order to prepare pharmaceutically acceptable compositions suitable for effective administration to the host.
  • the human tissue plasminogen activator hereof may be parenterally administered to subjects suffering from cardiovascular diseases or conditions. Dosage and dose rate may parallel that currently in use in clinical investigations of other cardiovascular, thrombolytic agents, e.g., about 440 IU/kg. body weight as an intravenous priming dose followed by a continuous intravenous infusion at about 440 IU/kg./hr. for 12 hours, in patients suffering from pulmonary embolism.
  • thrombolytic agents e.g., about 440 IU/kg. body weight as an intravenous priming dose followed by a continuous intravenous infusion at about 440 IU/kg./hr. for 12 hours, in patients suffering from pulmonary embolism.
  • a vial containing 25000 IU tissue plasminogen activator activity, 25 mg. mannitol and 45 mg. NaCl may be reconstituted with 5 ml. sterile water for injection and mixed with a suitable volume of 0.9 percent Sodium Chloride Injection or 5 percent Dextrose Injection for intravenous administration.
  • the catalytic site of the light chain of human t-PA is most likely formed by the histidine 322 , aspartic 371 and serine 478 residues. Furthermore, the amino acid sequences surrounding these residues are very homologous to corresponding parts of other serine proteases such as trypsin, prothrombin and plasminogen.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP83302501A 1982-05-05 1983-05-04 Human tissue plasminogen activator, pharmaceutical compositions containing it, processes for making it, and DNA and transformed cell intermediates therefor Expired - Lifetime EP0093619B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AT83302501T ATE46360T1 (de) 1982-05-05 1983-05-04 Plasminogenaktivator fuer menschliches gewebe, diesen aktivator enthaltende pharmazeutische zusammensetzungen, verfahren zur herstellung des aktivators sowie dna und transformierte zellzwischenprodukte hierfuer.

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US37486082A 1982-05-05 1982-05-05
US374860 1982-05-05
US39800382A 1982-07-14 1982-07-14
US06/483,052 US4766075A (en) 1982-07-14 1983-04-07 Human tissue plasminogen activator
US483052 1983-04-07
US398003 1989-08-24

Publications (3)

Publication Number Publication Date
EP0093619A1 EP0093619A1 (en) 1983-11-09
EP0093619B1 EP0093619B1 (en) 1989-09-13
EP0093619B2 true EP0093619B2 (en) 1996-09-18

Family

ID=27409206

Family Applications (1)

Application Number Title Priority Date Filing Date
EP83302501A Expired - Lifetime EP0093619B2 (en) 1982-05-05 1983-05-04 Human tissue plasminogen activator, pharmaceutical compositions containing it, processes for making it, and DNA and transformed cell intermediates therefor

Country Status (26)

Country Link
EP (1) EP0093619B2 (enrdf_load_stackoverflow)
JP (2) JPH0216981A (enrdf_load_stackoverflow)
AR (1) AR241654A1 (enrdf_load_stackoverflow)
BG (1) BG60253B1 (enrdf_load_stackoverflow)
BR (1) BR8302318A (enrdf_load_stackoverflow)
CA (1) CA1293211C (enrdf_load_stackoverflow)
CS (1) CS248705B2 (enrdf_load_stackoverflow)
CY (1) CY1341A (enrdf_load_stackoverflow)
DD (1) DD210303A5 (enrdf_load_stackoverflow)
DE (3) DE3380567D1 (enrdf_load_stackoverflow)
DK (1) DK174236B1 (enrdf_load_stackoverflow)
ES (1) ES522085A0 (enrdf_load_stackoverflow)
FR (1) FR2526443B1 (enrdf_load_stackoverflow)
GB (1) GB2119804B (enrdf_load_stackoverflow)
GR (1) GR79202B (enrdf_load_stackoverflow)
HK (1) HK88586A (enrdf_load_stackoverflow)
IE (1) IE54975B1 (enrdf_load_stackoverflow)
IL (1) IL68561A (enrdf_load_stackoverflow)
KE (1) KE3647A (enrdf_load_stackoverflow)
MY (1) MY8700119A (enrdf_load_stackoverflow)
NO (2) NO831575L (enrdf_load_stackoverflow)
OA (1) OA07419A (enrdf_load_stackoverflow)
PL (1) PL152438B1 (enrdf_load_stackoverflow)
PT (1) PT76636B (enrdf_load_stackoverflow)
RO (1) RO90639B (enrdf_load_stackoverflow)
ZW (1) ZW10483A1 (enrdf_load_stackoverflow)

Families Citing this family (105)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4558010A (en) * 1980-04-03 1985-12-10 Abbott Laboratories Recombinant deoxyribonucleic acid which codes for plasminogen activator and method of making plasminogen activator protein therefrom
GR79202B (enrdf_load_stackoverflow) * 1982-05-05 1984-10-22 Genentech Inc
US4713339A (en) * 1983-01-19 1987-12-15 Genentech, Inc. Polycistronic expression vector construction
US5011795A (en) * 1983-01-19 1991-04-30 Genentech, Inc. Human tPA production using vectors coding for DHFR protein
AU2353384A (en) * 1983-01-19 1984-07-26 Genentech Inc. Amplification in eukaryotic host cells
IE56716B1 (en) * 1983-01-19 1991-11-20 Genentech Inc Method for producing human tpa and expression vectors therefor
US5010002A (en) * 1983-01-19 1991-04-23 Genentech, Inc. Human t-PA production using vectors coding DHFR protein
US5169762A (en) * 1983-03-03 1992-12-08 Genentech, Inc. Human nerve growth factor by recombinant technology
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
JPS59196824A (ja) * 1983-04-21 1984-11-08 Kowa Co 吸着防止剤
US5639639A (en) * 1983-11-02 1997-06-17 Genzyme Corporation Recombinant heterodimeric human fertility hormones, and methods, cells, vectors and DNA for the production thereof
PT79518B (pt) * 1983-11-21 1986-12-12 Ciba Geigy Ag 54). 5 ^ig do plasmídeo pBR 322 /PHO5 Bam Rsa 637 são digeridos com a endonuclease de restrição Xbal. Apos digestão completa o DNA ê extraído com fenol/clorofórmio e precipitado com etanol. 0 DNA ê redissolvido em Tris.HCl 50mM pH8,0 numa concentração de 50 p-g/nd. e ê digerido com 11 unidades de fosfatase alcalina do intestino de vitela (Boehringer), durante 1 hora a 379C. - 97 fORHjf y| A enzima ê inativada a 65 9C durante 1 hora. 0 DNA ê purificado por cromatografia de troca iõnica em DE 52 ( Whatman) e precipitação com etanol como descrito no Exemplo 9Aa. Dois oligodeoxinucleotídeos sintéticos com a formula 5’-CTAGAAGGGGTATCTTTGGATAAGA - 3' 3’- TTCCCCATAGAAACCTATTCTCTAG -5' são fosforilados individualmente nas suas extremidades 5' como descrito no Exemplo 9Ab. Os oligodeoxinacleotídeos fosforilados são misturados em quantidades equimolares . A mistura ê aquecida durante 10 min. a 759C, depois deixada arrefecer lentamente atê à temperatura ambiente e guardada a -209C. Este adaptador ê designado por adaptador C. 1 ^ig (120 pmoles) do adaptador C emparelhado e fosforilado e 5 pg (1,5 pmoles) de pBR322/ /PH05 Bam-Rsa 637 desfosforilado e cortado com Xba I são ligados em 40^1 de Tris.HCl 60mM pH 7,5, MgCl2 lOmM, DTT 5mM, ATP lmM, 1600 unidades da ligase de DNA do T4 a 159C durante 20 horas. A ligase de DNA ê inactivada durante 10 min. a 859C e o excesso de adaptadores ê removido por precipitação com isopropanol. 0 DNA ê redissolvido em H20 numa concentração de 0,25 mg/ml. Os múltiplos de adaptadores são removidos por digestão com a endonuclease de restrição BglII. 0 DNA ê precipitado com etanol, redissolvido e depois digerido com Bam HI. Os fragmentos de restrição são separados num gel de 0,6¾ de agarose de baixo ponto de fusão em Tris-borato-EDTA pH8,3. 0 fragmento Bam HI-BglII de 662 pb (derivado de fragmento Bam HI-Rsa I de 637 pb) ê localizado e removido do gel. c) Isolamento de um fragmento de vector contendo a sequência codificadora do TPA maduro ( fig. 23) 5 yig do plasmídeo p31R/SS-TPA /\ 2, são digeridos com as endonucleases de restrição Bam HI e BglII. Após digestão completo de DNA e precipitado com etanol e ressuspenso em Tris.HCl 50mM pH 8,0 numa concentração de 75 jxg /ml. Os fragmentos de DNA sao desforilados nas suas extremidades 5' por digestão com 1 unidade de fosfatase alcalina de intestino de vitela ( Boehringer) em 60 de Tris.HCl 50mM pH 8,0 durante 1 hora a 379 C. A fosfatase ê inactivada por incubação a 659C durante 1,5 horas. 0 DNA é purificado por cromatografia de troca iónica em DE-52 (Whatman) como descrito no Exemplo 9Aa. 0 DNA ê precipitado com etanol, redissolvido em Tris-HCl lOmM, pH8,0 e aplicada num gel de 0,6 °'o de agarose de ponto de fusão baixo. 0 fragmento maior Bam HI -BglII de 5,2 kb ê removido do gel. d) Ligação dos fragmentos de DNA isolados e transformação de E.coli HB 101 (cf. figs 23 e 24 ). Dois blocos de gel de agarose de ponto de fusão baixo contendo 0,1 pmoles do fragmento Bam HIBglII de 5,2 kb de p31R/SS-TPA/\ 2 e 0,2 pmoles do fragmen to BamHI -BglII de 662 pb de pBR322/PHO5 Bam-Rsa 637, respectivamente, são misturados, liquefeitos a 659C e diluídos para baixar a concentração de agarose para 0,3¾. A ligação ê feita em 150^1 de Tris.HCl 60mM, pH 7,5; MgCl^ lOmM, 99 jr £ DTT 5mM, ATP ImM e 800 unidades de ligase de DNA do T4 (Biolabs) a 159C durante 16 horas. Amostras de 10 ^il e 30 yjl são misturadas com 100 p.1 de células E.coliHB 101 competentes para a transformação como descrito no Exemplo 4a. - R 6 colonias transformadas amp são crescidas individualmente em meio LB contendo 100 ^g/ml de ampicilina. 0 DNA de plasmídeo ê analisado quanto ao tamanho e orientação da invenção por corte com a endonuclease de restrição Bam Hl. Um único clone com a orientação correcta da inserção é designado por p31/PHO5 637-TPA (cf. fig. 23). 0 plasmídeo pBR 322/PHO5 Bam-Rsa 637 pode também ser substituído por pBR 322/PHO5 Bam-Rsa 595, pBR 322/PHO5 Bam-Rsa 811 e pBR 322/PHO5 Bam-Rsa 1312 . Seguindo o processo descrito atras são isolados clones únicos com inserções do tamanho e orientação esperados e designados por p31/PHO5 595C-TPA, p51/PHO5 811C-TPA e p31/PHO5 1312 C-TPA. 0 adaptador C pode também ser substituído pelo adaptador B com a seguinte férmula 5' -CTAGATAAGAGATCTGC -3’ 3’ TATTCTCTAGACG -5' o qual codifica Lis -Arg na construção final (fig. 24). A fosforilação dos oligodeoxinucleotídeos sintéticos e emparelhamento são como descrito para o adaptador C. Para a adição do adaptador 5 de pBR 322/PHO5 Bam-Rsa 637 cortado com Xba I são digeridos com 2 unidades de nuclease (Sigma) em 50 yjl de acetato de sédio 30mM pH 4,6, NaCI 200mM e ZnSO^ ImM durante 40 min. a 379C para criar extremidades cerses (ver fig.23). Apos extração com fenol clorofórmio o DNA ê precipitado com etanol e redissolvido em H^O numa concentração de 0,25 mg/ml. 0,4 ^g (120 pmoles) de adaptador A fosforilado e emparelhado e 5 ^ig (1,5 pmoles) de pBR 322/PHO5 Bam -Rsa 637 cortado com Xba I /S^ são ligados através das extremidades cerses como descrito para o adaptador C exceptuando a utilização de ATP 3,5 mM. As outras construções são como descrito atras. Os clones resultantes são identificado pela letra A e referidos como p31/PHO5 595A-TPA, p31/PHO5 637A-TPA, p31/PHO5 811A-TPA e p31/PHO5 1312 A-TPA. Exemplo 16: Subclonagem de construção genética no vector de levedura de elevado numero de copias pJDB2O7 e transformação de S. cerevisiae GRF18 As construções descritas nos Exemplos 13-19 contêm o promotor de PH05 com ou sem extensões para a região codificadora do gene de PH05 . A região codificadora do TPA com ou sem prepo-sequência e os sinais de terminação da transcrição de PH05 num arranjo tendem, tudo inserido num vector derivado do pBR 322. Os fragmentos Bam HI-HIND III contendo todo o arranjo são ligados ao fragmento Bam Hl -Hind III de 6,4 kb do pJDB 207 como descrito para uma reacção analoga no Exemplo 10. Células E.coli HB101 competentes são transformadas e vãrias colonias amp^ de cada experiência são crescidas individualmente em meio LB com 100 ^ig/ml de ampicilina. 0 DNA de plasmídio é analisado por corte com as endonucleases de restrição Hind III, Bam Hl e Pst I. Partindo dos plasmídeos p31/PHO5-TPA 18, ρ31 /PHO5-TPA 42, p31R/SS-TPA /\ 2, p31R/SS-TPA/\ 3, Ρ31/ΡΗΟ5 595C-TPA, p31/PHO5 637C-TPA,’ p31/PHO5 811C-TPA, P31/PHO5 1312C-TPA, p31/PHO5 595B-TPA, p31/PHO5 637-TPA, P31/PHO5 811 B-TPA, p31/PHO5 1312 B-TPA, p31/PHO5 595 A-TPA P31/PHO5 637-TPA, p31/PHO5 811-A-TPA e p31/PHO5 1312A-TPA obtem-se os clones que se seguem com as inserções correctas PJDB2O7/PHO5-TPA18 PJDB2O7/PHO5-TPA42 PJDB2O7R/PHO5-SS-TPA Λ 2 PJDB2O7R/PHO5-SS-TPA Λ 3 PJDB2O7/PHO5 595C-TPA PJDB2O7/PHO5 637C-TPA PJDB2O7/PHO5 811C-TPA PJDB2O7/PHO5 1312C-TPA PJDB2O7/PHO5 595B-TPA PJDB207/PH05 637B-TPA pJDB2O7/PHO5 811B-TPA PJDB2O7/PHO5 1312B-TPA pJDB2O7/PHO5 595A-TPA PJDB2O7/PHO5 637A-TPA PJDB2O7/PHO5 811A-TPA PJDB2O7/PHO5 1312A-TPA . Estes plasmídeos são introduzidos individualmente em Saccharomyces cerevisiae estirpe GRF 18 como descrito no Exemplo 11. Uma única colónia de levedura de cada uma das transformações de levedura ê picked. Os clones obtidos são designados por . Saccharomyces cerevisíae GRF18/pJDB2Ò7/PHO5-TPA18 Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5-TPA42 Saccharomyces cerevisíae GRF18/pJDB2O7R/PHO5-SS-TPA/\ 2 Sacchãtúiuycea cerevisíae GRFi8/pJD32O7R/?HO5~SS-TPA /\ 3 Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5 595C-TPA Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5 637C-TPA Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5 811C-TPA Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5 1312C-TPA Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5 595B-TPA Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5 637B-TPA Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5 811B-TPA Saccharomyces cerevisíae GRF18/pJDB2O7/PHO5 1312B-TPA As células de levedura são crescidas colhidas e extraídas como descrito nos Exemplos 11 e 12. A actividade de TPA nos extractos celulares é testado como descrito no Exemplo 12. Os resultados estão apresen tados na tabela 3. Tabela 3: Actividade de TPA da estirpe de levedura Saccharomyces cerevisiae GRF18 transformada com diferentes plasmídeos e testada em condições de desrepressão (Pi baixo) : plasmídeo Actividade de TPA(unidades/l de cultura de células de levedura/ OD^qq) PJDB2O7/PHO5-TPA18 750 PJDB2O7/PHO5-TPA42 700 PJDB2O7R/PHO5-SS-TPA_A 2 600 PJDB2O7R/PHO5-SS-TPA 3 650 PJDB2O7/PHO5 595C-TPA 900 Exemplo 17: Substituição cromossómica do gene de PHO5 pelo gene do TPA (ver fig.25) A região codificadora da proteína TPA ê colocada no cromossoma II de levedura na posição da região codificadora da proteína PH05 . Experimentálmente isto ê con seguido por cotransformação. Saccharomyces cerevisiae estirpe GRF 18 ê cotransformada com 25 ^ig do plasmídeo p31/PHO5 -TPA 18, linearizado com BnmHI e Hind III, e 3 ^xg do plasmídeo de levedura Yepl3 (51). De 24 colónias Leu obtidas, uma ê Pho5 e ao mesmo tempo produz aproximadamente 35 unidades de TPA/1 de cultura de células de levedura /0D600. Por crescimento deste transformante num meio contendo leucina (YPD, 10g/l de Bacto Yeast Extract, 20g/l de Bacto Peptone, 20 g/l de glucose) durante 10 gerações, segregantes Leu~são obtidos com uma frequência de 10-20¾ os quais provavelmente perderam o plasmideo Yep31. Por análise ou Southern do DNA total de levedura isolado dos segregantes Leu (52) verifica-se que no nível de DNA que as sequências codificadoras da proteína TPA substituem as sequências codificadores da proteína PH05 deixando inal. teradas as sequências ladeantes do cromossoma II. Seleccionou-se uma estirpe que se designou por Saccharomyces cerevisiae GRF 18 (pho-5-ΤΡΑ)♦ Exemplo 18: Melhoramento de estirpe por mutação A estirpe Saccharomyces cerevisiae GRF18 /pJDB2O7/PHO5-TPA (IA) é ainda desenvolvida para produção de TPA por mutação e selecção de baixa actividade de fosfatase ácida. Saccharomyces cerevisiae H2 4 3/pJDB 20 7/ /PH05 -TPA (IA) um mutante termo-sensível de Saccharomyces cerevisiae GRF18/pJDB2O7/PHO5 TPA (IA) ê obtido por irra_2 diação com UV (0,08 yiWcm , 15 segundos, 99,2¾ de morte). As colónias são crescidas em meio YPD osmc ticamente estabilizado contendo sorbitol 1,2M (10 g/l de Bacto Yeast Extract, 20 g/l de Bacto Peptone, 20g/l de glucose, 20 g/l de agar Bacto) e transferidas para meio YPD sem sorbitol. Saccharomyces cerevisiae H243 ê isolada como colónia de crescimento lento. Cerca de 10$ células de Saccharomyces cerevisiae H243/pJDB2O7/PHO5 -TPA (IA) são semeadas em agar YNB (6,8 1 de yeast Nitrogen Base sem aminoãcidos ; 20 g/1 de glucose, 20 g/1 de agar Bacto, suplementado com 20 mg/1 de histidina) e são irradiadas directamente com UV (0,08 -2 uWcm durante 12 segundos). A morte e de 98¾. As colonias obtidas a partir das células sobreviventes são transferidas para meio de Pi baixo e dois dias depois coradas para a actividade de fosfatase acida por um teste de sobrecamada de agar mole (48). Os mutantes negativos para a fosfatase _4 acida são obtidos com uma frequência de mutaçao de 3,2x10 . A estirpe com o título de TPA mais elevado é seleccionado e referido como Saccharomyces cerevisiae H423/pJDB2O7/PHO5-TPA (IA). As actividades de TPA de tres estirpes diferentes de levedura transformadas com pJDB2O7/PHO5-TPA (IA) estão apresentadas na Tabela 4. Tabela 4: Actividade de TPA de diferentes estirpes de Saccharomyces cerevisiae transformadas em condi ções de desrepressão (Pi baixo) Actividade de TPA (unidades/1 de cultura de células de levedura /OD^qq) GRF18/pJDB2O7/PHO5-TPA(lA) 625 H243/pJDB2O7/PHO5 -TPA(IA) 1560 H423/pJDB2O7/PHO5 -TPA(IA) 7200 • 1 Exemplo 19 : Produção de TPA por uma estirpe recombinante da levedura Saccharomyces cerevisiae numa escala de 30 1. Saccharomyces cerevisiae estirpe GRF 18/pJDB2O7/PHO5-TPA(lA) possui um plasmídeo que inclui uma marca para leucina permitindo manutenção selectiva do plasmídeo no organismo hospedeiro, um gene estrutural para o TPA humano e o promotor da fosfatase acida PH05 que permite a expressão do gene do TPA em meios com quantidades limitativas de fosfato inorgânico (condições de desrepressão). A estirpe ê mantida em culturas de agar inclinado preparadas com um meio definido sem o aminoãcido leucina para assegurar a retenção do plasmídeo. Agar recentemente inoculado e incubado durante 24 horas a 30?C. A cultura â superfície de um dos agares inclinados ê ressuspensa em 3ml de meio de pre-cultura o qual ê então transferido para o primeiro balão de pre-cultura com agitação. 0 balão de 500 ml tem uma unica saída e contem 100 ml de meio I de pre-cultura tendo o seguinte composição ( valoreq em g/1). L-asparagina, 2,0; L-histidina, 0,02 glucose, 10 ; Kt^PO^, 1,0 ; MgSO4· 7H2O, 0,5 ; NaCl 0,1 ; CaCl2~2H2O, 0,1 ; solução de vitaminas 5 jil/1 e solução de micronutriantes 5 ml/1. 0 meio e ajustado a pH7,2 usando NaOH antes da esterilização . A glucose, vitaminas e micronutrientes são esterilizados à parte e adicionados ao meio. As soluções "stock” de vitaminas e micronutrientes têm as seguintes composições (em g/1): Vitaminas - biotina, 0,0002; D-pantotenato de cãlcio , 0,04 ; acido fõlico, 0,0002; acido micotínico, 0,04 ; acido p-aminobenzõico, 0,02 ; hidrocloreto de piridoxina, 0,04; riboflãvina, 0,02 ; hidrocloreto de tiamina, 0,04; e inositol 0,2 em 1 1 de agua desionizada ; micronutrientes - acido bórico 0,05 ; CuSO "^H 0, 0,004 ; Kl, 0,01; FeCl^.óH^O, 0,02 ; MnSO^, 0,04 ; NaMoO^. 2^0, 0,02 e ZnSO^.71^0, 0,04 em 1 1 de agua desionizada. 0 meio ê preparado usando agua desionizada. A primeira pré-cultura é incubada durante 24 horas a 309C num agitador orbitol com 5cm de excentricidade a uma velocidade de 250 rev/min. Os balões com a primeira pré-cultura constituem o inoculo para os balões da segunda pré-cultura. Estes balões recebem um inoculo de 1¾ (v/v). Eles contem 100 ml de meio II de pré-cultura tendo a seguinte composição (mg/1): Extracto de levedura (Difco), 10,0 ; L-asparagina, 6,6; Κ^ΡΟ^ 1.0 ; MgSO^.7H2O, 1,0 ; L-histidina, 0,02 e D-glucose (mono-hidrato) , 33,0. 0 meio que ê preparado usando agua desionizada tem um pH de aproximadamente 6,0. A glucose é esterilizada separadamente. As condições de incubação são idênticas âs da primeira pré-cultura. 0 caldo de cultura de 3 balões ê combinado para dar um inoculo a 1¾ v/v para o fermentador principal de produção. 0 fermentador de produção tem um volume total de aproximadamente 45 1, contem 4 saliências e um agitador de turbina de disco de seis lâminas com um diâmetro de 115 mm. A velocidade de agitação é de 600 rev/min, a sobrepressão de 0,3 bar e uma velocidade de arejamento de 0,5 vol/vol/min. * ,· Η Ο fermentador contem 30 1 de um meio com as composições seguintes: (valores em g/1): L-asparagina, 2,0 ; L-histidina, 0,02 ; Kí^PO^, 0,03; MgSO^. 71^0, 0,5; NaCl, 0,1, CaCl2.2H2O, 0,1 ; KC1, ip ; D-glucose (mono -hidrato) , 20,0 ; solução de vitaminas 5 ml/1 e solução micronutrientes, 5ml/l. 0 meio ê ajustado pH 7,2 usando NaOH antes da esterilização. A glucose, vitaminas e micronutrientes são esterilizados separadamente e adicionados ao meio. As soluções "stock" de vitaminas e micronutrientes têm composição idêntica às descritas para o meio I de prê-cultura. A temperatura de fermentação ê de 309C. 0 pH desce para 5,0 onde ê controlado usando NaOH. Apos fermentação durante cerca de 20 horas atinge-se a produção máxima de TPA. A densidade óptica que atinge 2-3 unidades e a actividade de fosfatase ácida dão indicações uteis àcer ca do progresso da fermentação. 0 calor de fermentação ê arrefecido para 109C antes da colheita das células de levedura. Exemplo 20: Recuperação e purificação do TPA e pro-TPA por cromatografia com anticorpos monoclonais anti-TPA a) Preparação de extractos celulares 0 líquido de cultura (pH4) dos 30 1 de fermentação (cf.Exemplo 19) é arrefecido atê 109C e centrifugado usando uma centrífuga Alfa-Laval BRPX-207. As células separadas são ressuspensas em 21 de tampão de lise A ( NaH2P04 20mM, f^HPO^ 80mM, NaCl 150 mM, 0,01¾ de Tween, Benzamidina lOmM e EDTA lOmM). • 1 ί »» A solução é arrefecida atê 59C e passa da através de um moinho Dyno (tipo KDL-Pilot) com uma velocidade de alimentação de 101/h. 0 moinho estã equipado com 500 ml de pérolas de vidro de 0,5 -0,75 m de diâmetro e ê ligado a 3000 rev/min. Antes da adição das pérolas de vidro às células em suspensão aquelas são lavadas com 300 ml de tampão de lise A contendo 30 mg de BSA. A suspensão de células ê centrifugada ( rotor Sorvall 653, 40 min. 9000 rpm) e o sedimento rejeitado. b) Digestão do DNA^e fraccionamento com sulfato de amonio Adiciona-se 5 mg de DNAse a 2 1 da suspensão clarificada e a mistura ê agitada durante 30 min. a 49C. Subsequentemente a solução é levada a 35¾ de saturação com (NH^^SO^ (p/v) e ê agitada durante 1 hora a 49C. A solução ê centrifugada como descrito atrãs e o sedimento contendo toda a actividade de TPA ê ressuspensa em 1 1 de tampão H contendo 1¾ de Tween e 0,1¾ de SDS. A suspensão ê agitada durante pelo menos 1 hora a 49C. c) Cromatografia de imunoafinidade I) Purificação do anticorpo anti-TPA 5 ml de soro de coelho, anti -TPA (oferecido pelo Dr. E. Reich, Friedrich -Miescher-Institut Basel) são passados por uma coluna de sefarose com lisina para renovar o plasminogenio de soro. A coluna ê lavada com 1-2 volumes de PB5 pH 7,4 contendo NaCl 100 mM, KCI 2,7 mM, Na2HP04 8,lmM e KH2PO4 1,5 mM. $ rf* « « Ο líquido da coluna e de lavagens são juntos. 0 anti-soro sem plasminogênio é precipitado pela adição de (NH^)2SO^ sólido para uma concentração final de 50¾ (p/v). A solução ê mantida durante a noite a 4?C e em seguida centrifugada ( rotor Sorvall GSA,1200 rpm, 20 min.) . 0 precipitado e dissolvido num peque no volume de PB5 e dializado contra PBS contendo 0,1 ¾ de NaNj. A IgG desta solução dializada e purificada numa coluna de proteína A -sefarose (55). II) Preparação de uma coluna com anticorpo anti-TPA 13 mg de anticorpo anti-TPA purificado são dializados contra MOPS 0,1 M pH7,0. 0 anticorpo e ligado a 5 ml de Affigel 10 activado ( Biorad ) segundo as instruções do fabricante. A matrix do gel ó equilibrada com PBS contendo 1¾ de Tween 80, 0,1¾ de SDS, NaCl 0,2M, Benzamidin lOmM e 0,1¾ de NaN^. A matrix e aplicada numa coluna de 5 ml. III) Purificação de TPA por cromatografia de imunoafinidade. 0 sedimento redissolvido do fraccionamento com sulfato de amónio ê centrifugado para remover o material insolúvel ( rotor Sorvall GSA, 30 min. 12000rpm) e subsequentemente aplicado â coluna de afinidade a uma ve locidade de fluxo de cerca de lOml/hr a 49C. Depois de todo o volume ter passado através da coluna esta ê lavada com 10 volumes da coluna de PBS contendo 0,05¾. de Tween 80. A coluna ê eluída usando glicina-ΗΟΙΟ,ΙΜ pH2,5 contendo 0,1 ¾ de Tween. São colhidas fracções de 2 ml e testados para a actividade de TPA segundo o método de Rânby (49). Como substracto usa-se D-Val-Leu-Lis -pNA (Kabi -S-2251). As fracções com actividades mais elevadas são reunidas, neutralizadas usando Tris IM e concentradas por ultrafiltração usando uma membrana Amicon YM10. 0 TPA assim obtido apresenta cerca de 90¾ de pureza e estã predominantemente em forma de cadeia unica ( pro-TPA) como evidenciado por SDS-PAGE em condições de redução. 0 peso molecular aparente em condições não redutoras ê de cerca de 60 000 por SDS -PAGE (ver figura A). Figuras A e B : electroforese em gel de poliacrilamida-SDS do produto do gene TPA em levedura (Figura A) e a sua actividade enzimãtica num gel de actividade (placas com caseína) ( figura B). B:gel de actividade A:gel com SDS ad figura A (SDS-PAGE): Faixas 1 e 4 : proteínas padrão (marcadores de peso molecular) Faixas 2 e 5 : TPA de melanoma Faixas 3 e 6 : TPA de levedura Faixas 1 - 3 : em condições de redução Faixas 4 - 6 : em condições de não-redução As amostras correram num gel de 12,5¾ que se corou para proteínas usando azul Coomassie brilhante. ad. figura B (gel de actividade, cf. Exemplo 23): Faixa 1 : TPA de melanoma Faixa 2 : TPA de levedura Sobre-camada para plasminogénio de agar com caseira (referência 56) . Exemplo 21: Recuperação e purificação de TPA e pro-TPA por cromatografia de afinidade com DE-3 a. Preparação de uma coluna de DE-3 Sepharosé 26 mg do inibidor DE-3 purificado a partir de Erythrina latíssima (16) são acoplados a 5 ml de Sepharose 4b ® activada com brometo de cianogênio (Pharmacia) segundo as instruções do fabricante. A matrix ê equilibrada com tampão fosfato salino ("PBS") pH 7,4 contendo NaCl 0,4M, 0,1¾ de Triton X-100R e 0,02¾ de azida de sódio. A matrix ê então acamada numa coluna de 5 ml. b. Purificação de TPA e pro-TPA por cromatografia em DE-3 R Sepharose 4b Os extractos celulares (cf. Exemplo 20a) são tornados 0,4 M relativamente a NaCl e 0,1¾ para Triton X-lOCr^ e filtrados através de uma membrana de 0,45 ^im (Millipore). A solução ê então aplicada à coluna de DE-3 Sepharose (ver atras) a uma velocidade de fluxo de 45ml/hr â temperatura ambiente e o efluente ê rejeitado. Depois do volume total do extracto ter passado através da coluna esta ê lavada com cerca de 50 ml de PB5 contendo NaCl 0,4 M e 0,1 ¾ de Triton X-lOO*' sendo colhidos fracções de 2 ml a 49C. 0 conteúdo protêico de cada fracção ê determinado por medição da absorvância de UV a 280nm. A proteína adsorvida verificou-se ser eluída como um pico bem definido. As fracções contendo os valores mais elevados de absorvância de UV e de activida125 de fibrinolítica determinada pelo teste da I fibrina (47) são reunidas dando 8 ml de solução que se guardou a -209 C. Isto representa aproximadamente 70-80¾ da actividade total aplicada à coluna. As fracções com as actividades »· mais baixas são reunidas separadamente. A recuperação total de actividade em ambos os conjuntos de fracções monta os 90-100¾. c). Purificação de pro-TPA por cromatografia em DE-3 Sepharose 4b® na presença de um inibidor de proteíases. A cromatografia dos extractos de células de levedura ê feita de modo semelhante ao descrito no Exemplo 21b exceptuando a inclusão neste caso do inibidor de tripsina pancreãtica bãsica (BPTI) a 0,1 KlU/ml usando o teste fluorimétrico como Cbz-Gly-Gly-Arg-AMC como substracto (37) determinou-se o conteúdo em TPA e pro-TPA da solução purificada. 90¾ do TPA estã na forma de pro-enzima e 10¾ na forma activa. Assim, a conversão de pro-TPA em TPA durante o processo de purificação é inibido pelo BPTI. Exemplo 22: Separação de pro-TPA do TPA A solução de TPA e pro-TPA obtida como descrito no Exemplo 21c e ajustada a pH8,0 com Tris.HCl O,1M contendo 0,1¾ de Triton X-lOcP e tornado lmM relativamente ao diisopropilfluorofosfato. Apos incubação a 37?C durante 4 horas, a mistura ê passada através de uma coluna de 5 ml de DE-3 Sepharose® (cf. Exemplo 21a). 0 efluente contendo o TPA irreversivelmente inibido é rejeitado. A coluna e lavada com 6 volumes de coluna de PBS contendo NaCl 0,4 M e 0,1¾ de Triton X-IOC^ e subsequentemente eluída com PB5 contendo K SCN 1,6M, NaCl 0,4M e 0,1¾ de Triton X-10C^ como descrito no Exemplo 21b . As fracções apresentando as absorvân. 1 s· P0RWI « ? » ... Ή , - - - , __. «τ'. cias de UV mais elevadas são reunidas. 0 conjunto de fracções contem pro-TPA numa forma substancialmente pura uma vez que não se detecta actividade amidolítica no teste fluorimêtrico usando Cbz-Gli-Gli-Arg-AMC (37) como substrato. A actividade amidolítica assim como a fibrinolítica pode ser restabelecida por tratamento com plasmina a qual converte pro-TPA em enzima activa. Exemplo 23: Propriedades do produto do gene TPA em levedura a. Propriedades enzimãticas 0 produto do gene TPA em levedura obtido segundo o Exemplo 19 e purificado por eromatografia de afinidade em DE-3 (cf. Exemplo 21b) ê enzimãticamente activo como se mostra por clivagem de plasminogênio zimogênio em plasmina na ausência e na presença de fibrina. A actividade enzimãtica pode ser verificada pelos testes colorimêtricos descritos por Ranby (49) (cf. Exemplo 12) e por Verheijen et al. (60) , em placas de caseína e de fibrina (56) e num teste de fase solida com 12 9 I - fibrinogenio ( 47). A actividade enzimãtica em placas de caseína ê mostrada na figura B ( cf. Exemplo 20 c III). A actividade enzimãtica do TPA obtido ê grandemente estimulada pela fibrina. 0 TPA parcialmente purificado por eromatografia de afinidade em DE-3 ê testado num teste de velocidade parabólica (cf. Ranby (49)). Tomando a velocidade reacção Δ E versus Δ t^ entre e 5 minutos como uma medida da actividade enzimãtica a estimulação por concentração óptimas de fibrina ê de 10-20 vezes ( ca. 100 yig /ml) . 0 efeito pode ser observado com fragmentos de fibrina obtidos por digestão com CnBr
US4703008A (en) * 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
KR850004274A (ko) * 1983-12-13 1985-07-11 원본미기재 에리트로포이에틴의 제조방법
NZ210501A (en) * 1983-12-13 1991-08-27 Kirin Amgen Inc Erythropoietin produced by procaryotic or eucaryotic expression of an exogenous dna sequence
JP2648301B2 (ja) * 1983-12-27 1997-08-27 ジエネテイツクス・インスチチユ−ト・インコ−ポレ−テツド 真核細胞の形質転換のための補助ｄｎａを含むベクター
EP0154272B1 (en) * 1984-02-27 1992-01-08 Green Cross Corporation Production of human urokinase
EP0156169B1 (en) * 1984-02-29 1991-12-18 Asahi Kasei Kogyo Kabushiki Kaisha An aqueous solution of a tissue plasminogen activator dissolved therein at an increased concentration and a method
US4758512A (en) * 1984-03-06 1988-07-19 President And Fellows Of Harvard College Hosts and methods for producing recombinant products in high yields
EP0173552B1 (en) * 1984-08-24 1991-10-09 The Upjohn Company Recombinant dna compounds and the expression of polypeptides such as tpa
US4753879A (en) * 1984-08-27 1988-06-28 Biogen N.V. Modified tissue plasminogen activators
EP0174835A1 (en) * 1984-09-11 1986-03-19 The Upjohn Company Human tissue plasminogen activator and recombinant DNA compounds
UA54363C2 (uk) 1984-09-28 2003-03-17 Кірін-Амген, Інк Виділена молекула днк, яка кодує людський еритропоетин (варіанти), біологічно функціональний кільцевий плазмідний або вірусний днк-вектор, штам еукаріотичних клітин-хазяїв (варіанти), спосіб одержання поліпептиду, фармацевтична композиція
IE81135B1 (en) * 1984-10-01 2000-03-22 Genzyme Corp Recombinant DNA techniques and the products thereof
FI90990C (fi) * 1984-12-18 1994-04-25 Boehringer Ingelheim Int Rekombinantti-DNA-molekyyli, transformoitu isäntäorganismi ja menetelmä interferonin valmistamiseksi
DE3500961A1 (de) * 1985-01-14 1986-07-17 Gesellschaft für Biotechnologische Forschung mbH (GBF), 3300 Braunschweig Escherichia-coli-staemme, dna-teilsequenzen dieser staemme und herstellungsverfahren
DE3689598T2 (de) 1985-01-28 1994-06-30 Xoma Corp Arab-promoter und verfahren zur herstellung von polypeptiden einschliesslich cecropinen mittels mikrobiologischer verfahren.
EP0201153A3 (en) * 1985-02-09 1987-10-07 Beecham Group Plc Modified enzyme and process for its preparation
EP0207589A1 (en) * 1985-04-03 1987-01-07 Beecham Group Plc Fibrinolytic enzyme
GB8508717D0 (en) * 1985-04-03 1985-05-09 Beecham Group Plc Composition
US5756093A (en) * 1985-04-22 1998-05-26 Genentech, Inc. Tissue plasminogen activator variants
US5736134A (en) * 1985-04-22 1998-04-07 Genentech, In.C Tissue plasminogen activator variants
DE3682104D1 (de) * 1985-04-22 1991-11-28 Genentech Inc Plasminogenaktivator-mutante des menschlichen gewebes, verfahren und zwischenprodukte dafuer und diese mutante verwendende zusammensetzungen.
FR2593393B1 (fr) * 1985-05-28 1989-06-02 Wellcome Found Solution aqueuse a usage parenteral d'activateur tissulaire du plasminogene, procede pour la preparer et recipient obture la contenant
AU593264B2 (en) * 1985-07-10 1990-02-08 Kanegafuchi Kagaku Kogyo Kabushiki Kaisha Chromosomal DNA sequence, expression vector for human tissue plasminogen activating factor, cultured cells transfected with same and method of producing said activating factor
US4916071A (en) 1985-08-14 1990-04-10 American Home Products Corporation Poly-kringle plasminogen activator
US5244806A (en) * 1985-08-26 1993-09-14 Eli Lilly And Company DNA encoding novel tissue plasminogen activator derivatives having kringles 1 and 2 deleted, vectors and host cells
USH2055H1 (en) 1985-09-20 2002-12-03 Zymogenetics, Inc. Expression of tissue-type plasminogen activator in bacteria
DE3537708A1 (de) 1985-10-23 1987-04-23 Boehringer Mannheim Gmbh Verfahren zur aktivierung von t-pa nach expression in prokaryonten
GB8528321D0 (en) * 1985-11-18 1985-12-24 Ciba Geigy Ag Modified fibrinolytic agents
JP2581668B2 (ja) * 1985-11-27 1997-02-12 三井東圧化学株式会社 ヒト正常細胞由来のヒト組織プラスミノ−ゲン活性化因子をコ−ドする新しいｄｎａ配列とそれを含むベクタ−及び細胞
AU586306B2 (en) * 1985-12-16 1989-07-06 Ethicon Inc. Method for inhibiting post-surgical adhesion formation by the topical administration of tissue plasminogen activator
WO1987003906A1 (en) 1985-12-20 1987-07-02 The Upjohn Company Tissue plasminogen activator (tpa) analogs
US5106741A (en) * 1985-12-20 1992-04-21 The Upjohn Company Tissue plasminogen activator (TPA) analogs
ES2031826T3 (es) * 1985-12-23 1993-01-01 Chiron Corporation Procedimiento para producir nuevos peptidos activadores del plasminogeno.
JPS62149625A (ja) * 1985-12-25 1987-07-03 Green Cross Corp:The 生理活性物質の製造方法
DK43387A (da) * 1986-01-29 1987-07-30 Beecham Group Plc Fibrinolytisk enzym
EP0231883B1 (en) * 1986-01-31 1992-09-02 Sagami Chemical Research Center Hybrid plasminogen activator-like polypeptide
US5204255A (en) * 1986-01-31 1993-04-20 Sagami Chemical Research Center Hybrid tissue plasminogen activator/urokinase polypeptides
US5837518A (en) * 1986-01-31 1998-11-17 Genetics Institute, Inc. Thrombolytic proteins
US5258298A (en) * 1986-01-31 1993-11-02 Genetics Institute, Inc. Deletion and glycosylation mutant of human tissue plasminogen activator
US5002887A (en) * 1986-01-31 1991-03-26 Genetics Institute, Inc. Truncated thrombolytic proteins
DE3682891D1 (de) * 1986-02-17 1992-01-23 Stichting Centraal Lab Gewebeplasminogen-aktivator-mutant, dafuer kodierende rekombinante genetische information und verfahren zur herstellung dieser mutanten, deren verwendung und pharmazeutische zusammensetzungen.
FR2594845B1 (fr) * 1986-02-21 1989-12-01 Genetica Preparation par voie microbiologique de l'activateur tissulaire humain du plasminogene (t-pa) et conversion de l'enzyme ainsi obtenue en sa forme active
US4851517A (en) * 1986-02-26 1989-07-25 Monsanto Company Tissue plasminogen activator oligosaccharide from normal human colon cells
US5132214A (en) * 1986-04-09 1992-07-21 Monsanto Company Large scale production of plasminogen activator from normal human colon cells
US4927630A (en) * 1986-02-26 1990-05-22 Monsanto Company Tissue plasminogen activator from normal human colon cells
US4751084A (en) * 1986-02-26 1988-06-14 Monsanto Company Tissue plasminogen activator from normal human colon cells
US5589361A (en) * 1986-03-18 1996-12-31 Genentech, Inc. Human tissue-type plasminogen activator variant
JPH01500322A (ja) * 1986-03-28 1989-02-09 クリエイティブ　バイオモレクレス，インコーポレーテッド 組織プラスミノーゲンアクテイベーター類縁蛋白質
ATE90967T1 (de) * 1986-03-28 1993-07-15 Creative Biomolecules Inc Proteinanaloge des gewebs-plasminogenaktivators.
GB8608020D0 (en) * 1986-04-02 1986-05-08 Beecham Group Plc Compounds
NZ219829A (en) * 1986-04-02 1990-05-28 Beecham Group Plc Tissue-type plasminogen activator modified in the region of amino acids 67-69 and pharmaceutical compositions thereof
PT84589B (en) * 1986-04-02 1989-05-09 Beecham Group Plc Process for preparing a fibrinolytic enzyme
PT84588B (en) * 1986-04-02 1989-05-09 Beecham Group Plc Process for preparing a fibrinolytic enzyme
DE3643158A1 (de) * 1986-04-21 1987-11-19 Boehringer Mannheim Gmbh Gewebs-plasminogen-aktivator(tpa) - derivat und seine herstellung
DE3613401A1 (de) * 1986-04-21 1987-12-17 Boehringer Mannheim Gmbh Verfahren zur herstellung von plasminogen-aktivatoren in prokaryonten
JP2585532B2 (ja) * 1986-05-10 1997-02-26 三井東圧化学株式会社 動物細胞の形質転換体及びそれを得る方法並びにその形質転換体を用いてｔ−ＰＡを生産する方法
PT84991B (pt) * 1986-06-06 1990-03-08 Genentech Inc Processo para a producao de actividador do plasminogenio biologicamente activo
DK345087A (da) * 1986-07-11 1988-01-12 Novo Industri As Modificeret vaevsplasminogenaktivator
PT86162B (pt) * 1986-11-21 1990-11-20 Smithkline Beecham Corp Expressao de proteina recombinante
GB8628398D0 (en) * 1986-11-27 1986-12-31 Central Blood Lab Authority Pharmaceutically-active conjugates
ZA879286B (en) 1986-12-16 1988-10-26 Smith Kline Rit New plasminogen activators
NL8700013A (nl) * 1987-01-06 1988-08-01 Leuven Res & Dev Vzw Hybride plasminogeenactivatoren met verbeterde trombolytische eigenschappen en geneesmiddelen die deze plasminogeenactivatoren bevatten.
MY103358A (en) * 1987-04-15 1993-06-30 Novartis Ag Process for the production of protiens.
CA1341345C (en) * 1987-05-08 2002-03-05 Hanne Ranch Johansen Expression of foreign genes in drosophila cells
US5681713A (en) * 1987-05-08 1997-10-28 Smithkline Beecham Corporation Expression of heterologous proteins in Drosophila cells
DE3853100T2 (de) * 1987-06-04 1995-08-03 Eisai Co Ltd Gewebs-Plasminogen-Aktivator-Analoge mit modifizierten Wachstumsfaktordomänen.
US5266474A (en) * 1987-06-24 1993-11-30 Genentech, Inc. Balanced inducible transcription system
ATE120491T1 (de) * 1987-06-24 1995-04-15 Genentech Inc Ausgeglichenes, konstitutives, induzierbares transkriptionssystem.
US4935237A (en) * 1988-03-21 1990-06-19 Genentech, Inc. Processes for the preparation of t-PA mutants
JPH03500002A (ja) * 1987-07-06 1991-01-10 ジェネティックス・インスチチュート・インコーポレーテッド 新規な血栓崩壊蛋白
IL87276A (en) * 1987-08-03 1995-07-31 Fujisawa Pharmaceutical Co Analog of tissue plasminogen activator comprising only the kringle 2 and protease domain dna encoding the same processes for the preparation thereof and pharmaceutical compositions containing the same
US5504001A (en) * 1987-11-25 1996-04-02 Zymogenetics, Inc. Hybrid plasminogen activator
US5364622A (en) * 1987-12-04 1994-11-15 Dr. Karl Thomae Gmbh Methods for preventing adhesions to organs and parts of organs by application of tissue plasminogen activator and hydroxyethylcellulose hydrogel
DE3741149A1 (de) * 1987-12-04 1989-06-15 Thomae Gmbh Dr K Zubereitungsformen zur verhinderung von adhaesionen von organen und organteilen
US4929560A (en) * 1988-02-03 1990-05-29 Damon Biotech, Inc. Recovery of tissue plasminogen activator
JP2576200B2 (ja) * 1988-03-09 1997-01-29 味の素株式会社 生理活性タンパク質の製造法
WO1989009257A1 (en) * 1988-03-22 1989-10-05 Invitron Corporation METHOD TO ENHANCE tPA PRODUCTION
US5210037A (en) * 1988-03-22 1993-05-11 Centocor Incorporated Method to enhance TPA production
US5037646A (en) * 1988-04-29 1991-08-06 Genentech, Inc. Processes for the treatment of vascular disease
US5270198A (en) * 1988-05-20 1993-12-14 Genentech, Inc. DNA molecules encoding variants of tissue plasminogen activators, vectors, and host cells
US5346824A (en) * 1988-05-20 1994-09-13 Genentech, Inc. DNA encoding variants of tissue plasminogen activators and expression vectors and hosts thereof
US5023078A (en) * 1988-08-10 1991-06-11 Albert P. Halluin Plasminogen activator-heparin conjugates
US5714145A (en) * 1988-09-02 1998-02-03 Genentech, Inc. Tissue plasminogen activator having zymogenic or fibrin specific properties
US5262170A (en) * 1988-09-02 1993-11-16 Genentech, Inc. Tissue plasminogen activator having zymogenic or fibrin specific properties and substituted at amino acid positions 296-299, DNA molecules encoding them, vectors, and host cells
DE3831714A1 (de) * 1988-09-17 1990-03-22 Basf Ag Tpa-aehnliche polypeptide, ihre herstellung und verwendung
US5252713A (en) * 1988-09-23 1993-10-12 Neorx Corporation Polymeric carriers for non-covalent drug conjugation
US5550042A (en) * 1989-03-06 1996-08-27 The Board Of Regents Of The University Of Texas System Serine protease mutants of the chymotrypsin superfamily resistant to inhibition by their cognate inhibitors and genes encoding the same and serine protease inhibitor mutants and genes encoding the same
US5866413A (en) * 1989-03-06 1999-02-02 Board Of Regents Of The University Of Texas System Pai-1 mutants
DE69033699T2 (de) * 1989-03-06 2001-05-23 The Board Of Regents Of The University Of Texas System, Austin Gegenüber eigenen inhibitoren resistente t-pa mutanten
AU667462B2 (en) * 1990-11-30 1996-03-28 Monoclonetics International Incorporated Methods for the diagnosis of chronic lower back and cervical pain
EP0786257B1 (en) * 1992-06-03 2003-07-30 Genentech, Inc. Tissue plasminogen activator glycosylation variants with improved therapeutic properties
DE10153601A1 (de) 2001-11-02 2003-05-22 Paion Gmbh DSPA zur Behandlung von Schlaganfall
JP4595968B2 (ja) * 2007-07-12 2010-12-08 パナソニック電工株式会社 往復式電気かみそりの内刃

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL43343A (en) * 1972-10-24 1976-03-31 Lilly Co Eli Production of plasminogen activator
FR2252842B1 (enrdf_load_stackoverflow) * 1973-12-03 1977-11-04 Fabre Sa Pierre
FR2310133A2 (fr) * 1975-05-05 1976-12-03 Fabre Sa Pierre Nouveau medicament comportant un activateur du plasminogene perfectionne
US4245051A (en) * 1978-03-30 1981-01-13 Rockefeller University Human serum plasminogen activator
DE3015699C2 (de) * 1979-04-26 1982-07-15 Asahi Kasei Kogyo K.K., Osaka Herstellung eines Plasminogen-Aktivators
US4314994A (en) * 1979-07-27 1982-02-09 Pierre Fabre S.A. Process for obtaining a plasminogen activator
US4370417A (en) * 1980-04-03 1983-01-25 Abbott Laboratories Recombinant deoxyribonucleic acid which codes for plasminogen activator
NL8003402A (nl) * 1980-06-11 1982-01-04 Leuven Res & Dev Vzw Nieuwe plasminogeen-activator en farmaceutisch preparaat met trombolytische werking.
JPS5852634B2 (ja) * 1980-12-05 1983-11-24 株式会社林原生物化学研究所 ウロキナ−ゼの製造法
MX197183A (es) * 1982-05-05 1994-02-28 Genentech Inc Activador de plasminogeno de tejido humano
GR79202B (enrdf_load_stackoverflow) * 1982-05-05 1984-10-22 Genentech Inc

Also Published As

Publication number Publication date
DE3316297C2 (enrdf_load_stackoverflow) 1989-09-21
IE54975B1 (en) 1990-04-11
EP0093619B1 (en) 1989-09-13
BG60253B2 (bg) 1994-03-24
ES8501629A1 (es) 1984-12-16
JPH0216981A (ja) 1990-01-19
OA07419A (fr) 1984-11-30
DK198883A (da) 1983-12-20
AU1414283A (en) 1983-11-10
EP0093619A1 (en) 1983-11-09
DD210303A5 (de) 1984-06-06
MY8700119A (en) 1987-12-31
ES522085A0 (es) 1984-12-16
JPH0448440B2 (enrdf_load_stackoverflow) 1992-08-06
PL241805A1 (en) 1984-07-30
CA1293211C (en) 1991-12-17
GB8312221D0 (en) 1983-06-08
GR79202B (enrdf_load_stackoverflow) 1984-10-22
RO90639A (ro) 1987-01-30
CY1341A (en) 1987-01-16
GB2119804B (en) 1986-02-26
JP2564444B2 (ja) 1996-12-18
AU563031B2 (en) 1987-06-25
BR8302318A (pt) 1984-01-10
CS248705B2 (en) 1987-02-12
HK88586A (en) 1986-11-28
BG60253B1 (bg) 1994-03-24
IL68561A (en) 1991-01-31
DK198883D0 (da) 1983-05-04
RO90639B (ro) 1987-01-31
JPH05137583A (ja) 1993-06-01
NO831575L (no) 1983-11-07
DE3316297A1 (de) 1983-11-17
DE3380567D1 (en) 1989-10-19
DE93619T1 (de) 1987-08-13
IL68561A0 (en) 1983-09-30
IE831024L (en) 1983-11-05
FR2526443A1 (fr) 1983-11-10
DK174236B1 (da) 2002-10-07
GB2119804A (en) 1983-11-23
ZW10483A1 (en) 1983-09-21
PT76636B (en) 1986-01-10
KE3647A (en) 1986-07-25
PL152438B1 (en) 1990-12-31
PT76636A (en) 1983-06-01
NO852065L (no) 1983-11-07
FR2526443B1 (fr) 1985-12-06
AR241654A1 (es) 1992-10-30

Similar Documents

Publication Publication Date Title
EP0093619B2 (en) Human tissue plasminogen activator, pharmaceutical compositions containing it, processes for making it, and DNA and transformed cell intermediates therefor
US4766075A (en) Human tissue plasminogen activator
US5763253A (en) Methods of preparing tissue plasiminogen activator derivative composition
US4853330A (en) Human tissue plasminogen activator
EP0117059B1 (en) Methods for producing human tpa and expression vectors therefor
US5147643A (en) DNA sequences encoding human t-PA substituted at position 275 or at positions 275 and 277 and pharmaceutical compositions
EP0620279B1 (en) Preparation of functional human urokinase proteins
US5587159A (en) Human tissue plasminogen activator
US5385732A (en) Variants of tissue plasminogen activator, compositions and methods of use for same
US5185259A (en) Truncated human tissue plasminogen activator
US5112755A (en) Preparation of functional human urokinase proteins
US5073494A (en) Human tissue plasminogen activator substituted at position 275 or at positions 275 and 277
EP0424405B1 (en) Variants of plasminogen activators and processes for their production
US5010002A (en) Human t-PA production using vectors coding DHFR protein
USH2181H1 (en) Human tPA production using vectors coding for DHFR protein
US5268291A (en) Human t-PA production using vectors coding for DHFR protein
BG60507B2 (bg) Човешки тъканен плазминогенен активатор
GB2121050A (en) Preparation of functional human urokinase proteins
HRP950158A2 (en) Human tissue plasminogen activator
SI8310997A (sl) Aktivator plazminogena človeškega tkiva
HK1007333B (en) Variants of plasminogen activators and processes for their production

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Designated state(s): AT BE CH DE FR GB IT LI LU NL SE

17P Request for examination filed

Effective date: 19840427

ITCL It: translation for ep claims filed

Representative=s name: JACOBACCI CASETTA & PERANI S.P.A.

TCNL Nl: translation of patent claims filed
EL Fr: translation of claims filed
TCAT At: translation of patent claims filed
DET De: translation of patent claims
GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

RBV Designated contracting states (corrected)

Designated state(s): AT BE CH DE FR IT LI LU NL SE

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE CH DE FR IT LI LU NL SE

REF Corresponds to:

Ref document number: 46360

Country of ref document: AT

Date of ref document: 19890915

Kind code of ref document: T

REF Corresponds to:

Ref document number: 3380567

Country of ref document: DE

Date of ref document: 19891019

ET Fr: translation filed
ITF It: translation for a ep patent filed
PLBI Opposition filed

Free format text: ORIGINAL CODE: 0009260

26 Opposition filed

Opponent name: BOEHRINGER MANNHEIM GMBH

Effective date: 19900611

Opponent name: BEHRINGWERKE AKTIENGESELLSCHAFT

Effective date: 19900612

Opponent name: ABBOTT LABORATORIES

Effective date: 19900613

Opponent name: TOYO BOSEKI KABUSHIKI KAISHA

Effective date: 19900612

Opponent name: CELLTECH LIMITED

Effective date: 19900612

Opponent name: THE WELLCOME FOUNDATION LIMITED

Effective date: 19900612

Opponent name: KABIVITRUM AB

Effective date: 19900612

NLR1 Nl: opposition has been filed with the epo

Opponent name: ABBOTT LABORATORIES

Opponent name: TOYO BOSEKI K.K.

Opponent name: CELLTECH LIMITED

Opponent name: THE WELLCOME FOUNDATION LIMITED

Opponent name: KABIVITRUM AB

Opponent name: BEHRINGWERKE AG.

Opponent name: BOEHRINGER MANNHEIM GMBH.

ITTA It: last paid annual fee
REG Reference to a national code

Ref country code: FR

Ref legal event code: CC

Free format text: FRCC 92C0406, 920605

REG Reference to a national code

Ref country code: FR

Ref legal event code: CB

Free format text: FRCB 92C0406, 830504

MEDD It: supplementary protection certificate for pharmaceutical products: granted

Free format text: CCP 282, 19920513; GENENTECH INC.

REG Reference to a national code

Ref country code: FR

Ref legal event code: CL

REG Reference to a national code

Ref country code: SE

Ref legal event code: SPCF

Free format text: 83302501

EPTA Lu: last paid annual fee
EAL Se: european patent in force in sweden

Ref document number: 83302501.8

PLAW Interlocutory decision in opposition

Free format text: ORIGINAL CODE: EPIDOS IDOP

REG Reference to a national code

Ref country code: CH

Ref legal event code: SPCF

Free format text: CHSPCFOICM 48313/880919, 960228

PUAH Patent maintained in amended form

Free format text: ORIGINAL CODE: 0009272

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: PATENT MAINTAINED AS AMENDED

27A Patent maintained in amended form

Effective date: 19960918

AK Designated contracting states

Kind code of ref document: B2

Designated state(s): AT BE CH DE FR IT LI LU NL SE

REG Reference to a national code

Ref country code: CH

Ref legal event code: AEN

Free format text: MAINTIEN DU BREVET DONT L'ETENDUE A ETE MODIFIEE

NLR2 Nl: decision of opposition
NLR3 Nl: receipt of modified translations in the netherlands language after an opposition procedure
ET3 Fr: translation filed ** decision concerning opposition
ITF It: translation for a ep patent filed
APAC Appeal dossier modified

Free format text: ORIGINAL CODE: EPIDOS NOAPO

APAC Appeal dossier modified

Free format text: ORIGINAL CODE: EPIDOS NOAPO

REG Reference to a national code

Ref country code: CH

Ref legal event code: SPCG

Free format text: OICM 48313/19880919, 19960228, EXPIRES:20030919

Ref country code: CH

Ref legal event code: SPCC

Free format text: OICM 48313/19880919, 19960228

REG Reference to a national code

Ref country code: SE

Ref legal event code: SPCG

Free format text: 9490099, 900504, EXPIRES: 20050503

REG Reference to a national code

Ref country code: FR

Ref legal event code: TP

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 20020508

Year of fee payment: 20

Ref country code: FR

Payment date: 20020508

Year of fee payment: 20

Ref country code: DE

Payment date: 20020508

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: AT

Payment date: 20020513

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: LU

Payment date: 20020515

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20020517

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20020529

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: BE

Payment date: 20020717

Year of fee payment: 20

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LI

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20030503

Ref country code: CH

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20030503

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NL

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20030504

Ref country code: LU

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20030504

Ref country code: AT

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20030504

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

BE20 Be: patent expired

Owner name: *GENENTECH INC.

Effective date: 20030504

EUG Se: european patent has lapsed
NLV7 Nl: ceased due to reaching the maximum lifetime of a patent

Effective date: 20030504

APAH Appeal reference modified

Free format text: ORIGINAL CODE: EPIDOSCREFNO

PLAB Opposition data, opponent's data or that of the opponent's representative modified

Free format text: ORIGINAL CODE: 0009299OPPO