WO2017201350A1 - Polynucleotides encoding interleukin-12 (il12) and uses thereof - Google Patents

Polynucleotides encoding interleukin-12 (il12) and uses thereof Download PDF

Info

Publication number
WO2017201350A1
WO2017201350A1 PCT/US2017/033422 US2017033422W WO2017201350A1 WO 2017201350 A1 WO2017201350 A1 WO 2017201350A1 US 2017033422 W US2017033422 W US 2017033422W WO 2017201350 A1 WO2017201350 A1 WO 2017201350A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
cancer
glycero
polynucleotide
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/033422
Other languages
English (en)
French (fr)
Inventor
Joshua Frederick
Susannah HEWITT
Ailin Bai
Stephen Hoge
Vladimir PRESNYAK
Iain Mcfadyen
Kerry BENENATO
Ellalahewage Sathyajith Kumarasinghe
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
ModernaTx Inc
Original Assignee
ModernaTx Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=58794205&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2017201350(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to RU2018144292A priority Critical patent/RU2769316C2/ru
Priority to CN201780030730.8A priority patent/CN109195621A/zh
Priority to LTEPPCT/US2017/033422T priority patent/LT3458083T/lt
Priority to CA3024470A priority patent/CA3024470A1/en
Priority to EP22204799.5A priority patent/EP4186518A1/en
Priority to SG11201809381XA priority patent/SG11201809381XA/en
Priority to HRP20230050TT priority patent/HRP20230050T1/hr
Priority to RS20230055A priority patent/RS63912B1/sr
Priority to FIEP17726458.7T priority patent/FI3458083T3/fi
Priority to JP2018560509A priority patent/JP7246930B2/ja
Priority to SI201731299T priority patent/SI3458083T1/sl
Priority to KR1020227040214A priority patent/KR20220159479A/ko
Priority to ES17726458T priority patent/ES2941411T3/es
Priority to DK17726458.7T priority patent/DK3458083T5/da
Priority to KR1020187036222A priority patent/KR102469450B1/ko
Priority to PL17726458.7T priority patent/PL3458083T3/pl
Priority to SM20230121T priority patent/SMT202300121T1/it
Application filed by ModernaTx Inc filed Critical ModernaTx Inc
Priority to MA45027A priority patent/MA45027B1/fr
Priority to MX2018013509A priority patent/MX393869B/es
Priority to AU2017268397A priority patent/AU2017268397B2/en
Priority to EP17726458.7A priority patent/EP3458083B1/en
Publication of WO2017201350A1 publication Critical patent/WO2017201350A1/en
Priority to IL262501A priority patent/IL262501A/en
Priority to US16/192,274 priority patent/US10646549B2/en
Anticipated expiration legal-status Critical
Priority to US16/842,300 priority patent/US11000573B2/en
Priority to US17/308,686 priority patent/US11311602B2/en
Priority to US17/721,583 priority patent/US11571463B2/en
Priority to US18/164,796 priority patent/US20240024422A1/en
Priority to JP2023040409A priority patent/JP2023072056A/ja
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/208IL-12
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7115Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • A61K9/5107Excipients; Inactive ingredients
    • A61K9/5123Organic compounds, e.g. fats, sugars
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5434IL-12
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • Interleukin-12 is a pro-inflammatory cytokine that plays an important role in innate and adaptive immunity. Gately, MK et al., Annu Rev Immunol. 16: 495-521 (1998). IL12 functions primarily as a 70 kDa heterodimeric protein consisting of two disulfide-linked p35 and p40 subunits. IL12 p40 homodimers do exist, but other than functioning as an antagonist that binds the IL12 receptor, they do not appear to mediate a biologic response. Id.
  • the precursor form of the IL12 p40 subunit (NM_002187; P29460; also referred to as IL12B, natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2) is 328 amino acids in length, while its mature form is 306 amino acids long.
  • the precursor form of the IL12 p35 subunit (NM_000882; P29459; also referred to as IL12A, natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1) is 219 amino acids in length and the mature form is 197 amino acids long. Id.
  • the genes for the IL12 p35 and p40 subunits reside on different chromosomes and are regulated independently of each other.
  • IFN- ⁇ interferon gamma
  • the present disclosure provides mRNA therapeutics for the treatment of cancer.
  • the mRNA therapeutics of the disclosure are particularly well-suited for the treatment of cancer as the technology provides for the intracellular delivery of mRNA encoding immune modulating polypeptides (for example, immune stimulating polypeptides, such as IL-12, and the like, useful in immuno-oncology ("IO")), followed by de novo synthesis of functional proteins within target cells, e.g., within target cells in tumors.
  • immune modulating polypeptides for example, immune stimulating polypeptides, such as IL-12, and the like, useful in immuno-oncology ("IO")
  • IO immuno-oncology
  • the disclosure features therapeutic mRNAs having modified nucleotides to (1) minimize unwanted immune activation (e.g., the innate immune response associated with in vivo introduction of foreign nucleic acids) and (2) optimize the translation efficiency of mRNA to protein.
  • Exemplary aspects of the disclosure feature therapeutic mRNAs having a combination of nucleotide modifications to reduce the innate immune response and sequence
  • immune modulating polypeptides e.g., immune stimulating polypeptides such as IL-12
  • the mRNA therapeutic technology of the disclosure features delivery of mRNA(s) encoding immune modulating (e.g., immune stimulating) polypeptides via a lipid nanoparticle (LNP) delivery system.
  • the mRNA therapeutic technology of the disclosure features delivery of mRNA(s) encoding immune modulating polypeptides into tumors via a lipid nanoparticle (LNP) delivery system.
  • the disclosure also features novel ionizable lipid-based LNPs which have improved properties when combined with mRNA(s) encoding immune modulating (e.g., immune stimulating) polypeptides and administered in vivo, for example, cellular uptake, intracellular transport and/or endosomal release or endosomal escape.
  • immune modulating e.g., immune stimulating
  • the LNP formulations of the disclosure also demonstrate reduced immunogenicity associated with the in vivo administration of LNPs.
  • Certain aspects of the present disclosure are directed to a method of reducing the size of a tumor or inhibiting growth of a tumor in a subject in need thereof comprising administering to the subject an effective amount of a composition comprising one or more polynucleotides encoding an IL-12 polypeptide, wherein the polynucleotide comprises an open reading frame (“ORF") encoding an interleukin 12 p40 subunit (“IL12B”) polypeptide and an interleukin 12 p35 subunit (“IL12A”) polypeptide.
  • ORF open reading frame
  • IL12B interleukin 12 p40 subunit
  • IL12A interleukin 12 p35 subunit
  • the method further comprises administering to the subject an effective amount of a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide or an effective amount of a composition comprising a checkpoint inhibitor polypeptide.
  • the checkpoint inhibitor polypeptide inhibits PD1, PD-L1, CTLA-4, or a combination thereof.
  • the checkpoint inhibitor polypeptide comprises an antibody.
  • administering the composition activates T cells in the subject.
  • Another aspect of the present disclosure is directed to a method of activating T cells in a subject in need thereof comprising administering to the subject an effective amount of a composition comprising one or more polynucleotides encoding an IL-12 polypeptide, wherein the polynucleotide comprises an ORF encoding an IL12B polypeptide and an IL12A polypeptide.
  • the T cell activation comprises inducing T cell proliferation.
  • the T cell activation comprises inducing T cell infiltration in the tumor or increasing the number of tumor- infiltrating T cells.
  • the T cell activation comprises inducing a memory T cell response.
  • the activated T cells comprise CD4 + T cells, CD8 + T cells, or both.
  • administering the composition alone or in combination with a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide or a composition comprising a checkpoint inhibitor polypeptide increases an effector to suppressor T cell ratio in the tumor.
  • administering the composition further increases the number of activated NK cells in the subject.
  • administering the composition increases cross-presenting dendritic cells in the tumor of the subject.
  • administering the composition reduces the size of a distal tumor or inhibits growth of a distal tumor in the subject.
  • Another aspect of the present disclosure is directed to a method of increasing an effector to suppressor T cell ratio in a tumor of a subject in need thereof comprising administering to the subject an effective amount of a composition comprising one or more polynucleotides encoding an IL-12 polypeptide, wherein the polynucleotide comprises an ORF encoding an IL12B polypeptide and an IL12A polypeptide.
  • the effector to suppressor T cell ratio is a CD8 + T cells: T regulatory (Treg) cells ratio.
  • Another aspect of the present disclosure is directed to a method of increasing the number of activated Natural Killer (NK) cells in a subject in need thereof comprising administering to the subject an effective amount of a composition comprising one or more polynucleotides encoding an IL-12 polypeptide, wherein the polynucleotide comprises an ORF encoding an IL12B polypeptide and an IL12A polypeptide.
  • NK Natural Killer
  • Another aspect of the present disclosure is directed to a method of increasing cross-presenting dendritic cells in a tumor of a subject in need thereof comprising administering to the subject an effective amount of a composition comprising one or more polynucleotides encoding an IL-12 polypeptide, wherein the polynucleotide comprises an ORF encoding an IL12B polypeptide and an IL12A polypeptide.
  • the cross-presenting dendritic cells are CD103 + cells.
  • Another aspect of the present disclosure is directed to a lipid nanoparticle
  • polynucleotide comprises an ORF encoding a human IL12B polypeptide operably linked to a human IL12A polypeptide.
  • the IL12B polypeptide and the IL12A polypeptide are fused directly or by a nucleic acid encoding a linker.
  • the IL12B polypeptide comprises an amino acid sequence at least 80%, at least 90%, at least 95%, or at least 98%> identical to amino acids 23 to 328 of SEQ ID NO: 48, wherein the amino acid sequence has IL12B activity.
  • the IL12A polypeptide comprises an amino acid sequence at least 80%>, at least 90%, at least 95%, or at least 98%) identical to amino acids 336 to 532 of SEQ ID NO: 48, wherein the amino acid sequence has IL12A activity.
  • the polynucleotide comprises a nucleotide sequence encoding a signal peptide.
  • the signal peptide is an IL12B signal peptide.
  • the composition comprises a polynucleotide comprising an
  • the composition comprises a polynucleotide comprising an ORF encoding an IL12B signal peptide, an IL12B polypeptide, a linker and an IL12A polypeptide.
  • the linker comprises a Gly/Ser linker.
  • the IL12 polypeptide comprises an amino acid sequence at least 80%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO: 48.
  • the polynucleotide comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 5 to 44, 236, and 237.
  • the polynucleotide comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 236 or 237.
  • the polynucleotide comprises an ORF comprising at least one chemically modified nucleoside.
  • the at least one chemically modified nucleoside is selected from the group consisting of pseudouridine, Nl- methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and a combination thereof.
  • the chemically modified nucleosides in the ORF are selected from the group consisting of uridine, adenine, cytosine, guanine, and any combination thereof.
  • the polynucleotide comprises a miRNA binding site.
  • the miRNA binding site is a miR-122 binding site.
  • the miRNA binding site is a miR-122-3p or miR-122-5p binding site.
  • the miRNA binding site comprises a nucleotide sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% identical to aacgccauua ucacacuaaa ua (SEQ ID NO: 51), wherein the miRNA binding site binds to miR-122.
  • the miRNA binding site comprises a nucleotide sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%), or about 100% identical to uggaguguga caaugguguu ug (SEQ ID NO: 53), wherein the miRNA binding site binds to miR-122.
  • the miRNA binding site comprises a nucleotide sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% identical to caaacaccau ugucacacuc ca (SEQ ID NO: 54), wherein the miRNA binding site binds to miR-122.
  • the polynucleotide comprises a 5' untranslated region
  • the 5' UTR comprises a nucleic acid sequence at least about 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence listed in Table 3.
  • the polynucleotide comprises a 3' untranslated region (UTR).
  • the 3' UTR comprises a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence listed in Table 4 A or 4B.
  • the polynucleotide comprises a miRNA binding site within the 3' UTR.
  • the polynucleotide comprises a nucleotide spacer sequence fused to the miRNA binding site.
  • the polynucleotide comprises a 5' terminal cap structure. In some embodiments, the polynucleotide comprises a 3' polyA tail. In some embodiments, the polynucleotide comprises a codon optimized ORF. In certain embodiments, the polynucleotide is in vitro transcribed (IVT) polynucleotide. In certain embodiments, the polynucleotide is circular.
  • the polynucleotide is formulated with a delivery agent.
  • the delivery agent comprises a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, or a conjugate.
  • the delivery agent is a lipid nanoparticle.
  • the delivery agent comprises a compound having formula (I)
  • Ri is selected from the group consisting of C5-20 alkyl, C5-20 alkenyl, -R*YR", -YR", and -R"M'R' ;
  • R 2 and R 3 are independently selected from the group consisting of H, Ci-14 alkyl, C 2 -i 4 alkenyl, -R*YR", -YR", and -R*OR", or R 2 and R 3 , together with the atom to which they are attached, form a heterocycle or carbocycle;
  • R4 is selected from the group consisting of a C 3-6 carbocycle, -(CH 2 ) n Q, -(CH 2 ) n CHQR, -CHQR, -CQ(R) 2 , and unsubstituted Ci -6 alkyl, where Q is selected from a carbocycle, heterocycle, -OR,
  • M and M' are independently selected from -C(0)0-, -OC(O)-, -C(0)N(R)-, -N(R)C(0)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(0)(OR)0-, -S(0) 2 - an aryl group, and a heteroaryl group;
  • R 7 is selected from the group consisting of Ci -3 alkyl, C 2 - 3 alkenyl, and H; each R is independently selected from the group consisting of Ci -3 alkyl, C 2-3 alkenyl, and H; each R is independently selected from the group consisting of C MS alkyl, C 2 - 18 alkenyl, -R*YR", -YR", and H; each R" is independently selected from the group consisting of C 3- i 4 alkyl and C 3- i 4 alkenyl; each R* is independently selected from the
  • the compound is of Formula (IA):
  • R4 is unsubstituted C 1-3 alkyl, or -(CH 2 ) n Q, in which n is 1, 2, 3, 4, or 5 and Q is OH, - HC(S)N(R) 2 , or - HC(0)N(R) 2 ;
  • M and M' are independently selected from -C(0)0-, -OC(O)-, -C(0)N(R)-, -P(0)(OR)0-, an aryl group, and a heteroaryl group; and
  • R 2 and R 3 are independently selected from the group consisting of H, C 1-14 alkyl, and C 2 . 14 alkenyl.
  • the compound is of Formula (II):
  • Mi is a bond or M';
  • R4 is unsubstituted C 1-3 alkyl, or -(CH 2 ) n Q, in which n is 2, 3, or 4 and Q is OH, - HC(S)N(R) 2 , or - HC(0)N(R) 2 ;
  • M and M' are independently selected from -C(0)0-, -OC(O)-, -C(0)N(R)-, -P(0)(OR)0-, an aryl group, and a heteroaryl group; and
  • R 2 and R 3 are independently selected from the group consisting of H, Ci-14 alkyl, and C 2 . 14 alkenyl.
  • the compound is selected from Compound 1 to Compound
  • the delivery agent comprises a compound havin the formula (I)
  • Ri is selected from the group consisting of C 53 o alkyl, C 520 alkenyl, -R*YR", -R", and R"M'R';
  • R 2 and R 3 are independently selected from the group consisting of H, Cn 4 alkyl, C 2 i 4 alkenyl, R*YR", YR", and R*OR", or R 2 and R 3 , together with the atom to which they are attached, form a heterocycle or carbocycle;
  • R4 is selected from the group consisting of a C 36 carbocycle, (CH 2 ) n Q, -(CH 2 ) n CHQR, CHQR, CQ(R) 2 , and unsubstituted Ci 6 alkyl, where Q is selected from a carbocycle, heterocycle, -OR, - (CH 2 ) n N(R) 2 , -(O)OR, -OC(0)R, -CX 3 , -C
  • the delivery agent further comprises a phospholipid.
  • the phospholipid is selected from the group consisting of 1,2 dilinoleoyl sn glycero 3 phosphocholine (DLPC), 1,2 dimyristoyl sn glycero
  • DMPC 1,2 dioleoyl sn glycero 3 phosphocholine
  • DOPC 1,2 dipalmitoyl sn glycero 3 phosphocholine
  • DPPC 1,2 distearoyl sn glycero 3
  • DSPC 1,2 diundecanoyl sn glycero phosphocholine
  • DUPC 1, palmitoyl 2 oleoyl sn glycero 3 phosphocholine
  • POPC palmitoyl 2 oleoyl sn glycero 3 phosphocholine
  • POPC palmitoyl 2 oleoyl sn glycero 3 phosphocholine
  • POPC palmitoyl 2 oleoyl sn glycero 3 phosphocholine
  • OChemsPC 1,2 hexadecyl sn glycero 3 phosphocholine
  • CI 6 Lyso PC 1,2 dilinolenoyl sn glycero 3 phosphocholine
  • phosphoethanolamine (ME 16:0 PE), 1,2 distearoyl sn glycero 3 phosphoethanolamine, 1,2 dilinoleoyl sn glycero 3 phosphoethanolamine, 1,2 dilinolenoyl sn glycero 3 phosphoethanolamine, 1,2 di arachidonoyl sn glycero 3 phosphoethanolamine, 1,2 didocosahexaenoyl sn glycero 3 phosphoethanolamine, 1,2 di oleoyl sn glycero 3 phospho rac (1 glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.
  • DOPG 1,2 distearoyl sn glycero 3 phosphoethanolamine
  • 1,2 dilinoleoyl sn glycero 3 phosphoethanolamine 1,2 dilinolenoyl sn glycero 3
  • the phospholipid is selected from the group consisting of 1 myristoyl 2 palmitoyl sn glycero 3 phosphocholine (14:0-16:0 PC, MPPC), 1 myristoyl 2 stearoyl sn glycero 3 phosphocholine (14:0-18:0 PC, MSPC), 1 palmitoyl 2 acetyl sn glycero 3 phosphocholine (16:0-02:0 PC), 1 palmitoyl 2 myristoyl sn glycero 3 phosphocholine (16:0-14:0 PC, PMPC), 1 palmitoyl 2 stearoyl sn glycero 3 phosphocholine (16:0-18:0 PC, PSPC), 1 palmitoyl 2 oleoyl sn glycero 3 phosphocholine (16:0-18: 1 PC, POPC), 1 palmitoyl 2 linoleoyl sn glycero 3 phosphocholine (16
  • docosahexaenoyl sn glycero 3 phosphocholine 14:0-22:6 PC
  • 1 stearoyl 2 myristoyl sn glycero 3 phosphocholine (18:0-14:0 PC, SMPC)
  • 1 stearoyl 2 palmitoyl sn glycero 3 phosphocholine (18:0-16:0 PC, SPPC)
  • 1 stearoyl 2 oleoyl sn glycero 3 phosphocholine (18:0-18: 1 PC, SOPC
  • 1 stearoyl 2 linoleoyl sn glycero 3 phosphocholine (18:0-18:2 PC)
  • 1 stearoyl 2 arachidonoyl sn glycero 3 phosphocholine (18:0-20:4 PC)
  • 1 stearoyl 2 docosahexaenoyl sn glycero 3 phosphocholine 18:
  • the delivery agent further comprises a structural lipid. In some embodiments, the delivery agent further comprises a PEG lipid. In some embodiments, the delivery agent further comprises an ionizable lipid selected from the group consisting of 3 (didodecylamino) N1,N1,4 tridodecyl 1 piperazineethanamine (KL10), Nl [2 (didodecylamino)ethyl] N1,N4,N4 tridodecyl 1,4 piperazinediethanamine (KL22), 14,25 ditridecyl 15, 18,21,24-tetraaza-octatriacontane (KL25), 1,2 dilinoleyloxy N,N dimethylaminopropane (DLin-DMA), 2,2 dilinoleyl 4 dimethylaminomethyl [1,3] dioxolane (DLin-K-DMA), heptatriaconta 6,9,28,31 t
  • the delivery agent further comprises a quaternary amine compound.
  • the quaternary amine compound is selected from the group consisting of l,2-dioleoyl-3 -trimethylammonium-propane (DOTAP), N-[l-(2,3- dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), l-[2- (oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTEVI), 2,3- dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(l ,2-dimyristyloxyprop-3 -
  • DOSPA N,N-diste
  • DLePC l,2-dilauroyl-sn-glycero-3-ethylphosphocholine
  • DSTAP l,2-distearoyl-3- trimethylammonium-propane
  • DPTAP l,2-dipalmitoyl-3 -trimethylammonium-propane
  • DLTAP l,2-dilinoleoyl-3 -trimethylammonium-propane
  • DMTAP 1,2-distearoyl -sn-glycero-3- ethylphosphocholine
  • DPePC 1,2-dimyristoyl -sn-glycero-3-ethylphosphocholine
  • DMePC 1,2-dioleoyl-sn- glycero-3-ethylphosphocholine
  • the composition is formulated for in vivo delivery. In some aspects, the composition is formulated for intramuscular, subcutaneous, intratumoral, or intradermal delivery.
  • the administration treats a cancer.
  • the cancer is selected from the group consisting of adrenal cortical cancer, advanced cancer, anal cancer, aplastic anemia, bileduct cancer, bladder cancer, bone cancer, bone metastasis, brain tumors, brain cancer, breast cancer, childhood cancer, cancer of unknown primary origin, Castleman disease, cervical cancer, colon/rectal cancer, endometrial cancer, esophagus cancer, Ewing family of tumors, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gestational trophoblastic disease, Hodgkin disease, Kaposi sarcoma, renal cell carcinoma, laryngeal and hypopharyngeal cancer, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myelomonocytic leukemia, liver cancer, hepatocellular carcinoma (HCC), non-small cell
  • composition is administered by a device comprising a
  • the effective amount is between about 0.10 mg/kg to about 1,000 mg/kg.
  • FIG. 1 shows (1) the wild-type IL12B amino acid sequence, (2) the wild-type nucleic acid encoding the wtIL12B, (3) the wild-type IL12A amino acid sequence, (4) the wild-type nucleic acid encoding the wtIL12A, (5) the wild-type IL12B signal peptide amino acid sequence, and (6) the wild-type nucleic acid encoding the wtIL12B signal peptide.
  • FIG. 2A is a graph depicting the higher AUC and C max for IL12 plasma levels observed following intravenous administration of IL12 mRNA in lipid nanoparticle (L P) compared to the corresponding IL12 recombinant protein.
  • FIG. 2B is a graph depicting the higher AUC and Cmax for IFNy plasma levels observed following intravenous administration of IL12 mRNA administered in lipid nanoparticle (LNP) compared to IL12 recombinant protein.
  • FIG. 3 is a graph depicting the robust efficacy of a single intravenous (IV) dose of
  • IL12 mRNA in lipid nanoparticle at doses of 0.1 mg/kg (Group 4) and 0.05 mg/kg (Group 5) (as indicated by lines with the inverted triangles), compared to Groups 1 (PBS), 2 (IL12 protein), 7 and 8 (controls NST-FIX, 0.1 mg/kg and 0.05 mg/kg, respectively).
  • FIGs. 4A-4F are graphs depicting the mean tumor volume and the number of complete responses (CR) seen following administration of a single intravenous (IV) dose of: IL12 mRNA in lipid nanoparticle (LNP), at doses of 0.1 mg/kg (Group 4) (FIG. 4F) and 0.05 mg/kg (Group 5) (Fig. 4E), PBS (Group 1) (FIG. 4A), IL12 protein (Group 2) (FIG. 4D), controls NST-FIX, 0.1 mg/kg and 0.05 mg/kg (Groups 7 and 8, respectively) (FIG. 4C and FIG. 4B, respectively).
  • Complete responses (CRs) are shown in FIGs. 4E and 4F only.
  • FIG. 4E shows that 6 of 8 CRs were seen in Group 5 (IL12 mRNA in lipid nanoparticle (LNP), at a dose of 0.05 mg/kg).
  • FIG. 4F shows that 5 of 9 CRs were seen in Group 4 (IL12 mRNA in lipid nanoparticle (LNP), at a dose of 0.1 mg/kg). Aside from the IL12 mRNA groups, all other groups did not observe any CRs. [0036] FIG.
  • FIG. 5 is a graph depicting the survival benefit at day 47 post tumor-implantation from a single intravenous (IV) dose of IL12 mRNA in lipid nanoparticle (LNP) at a dose of 0.05 mg/kg (Group 5) and a dose of 0.1 mg/kg (Group 4) compared to a single IV dose of IL12 protein at ⁇ g (-0.05 mg/kg) (Group 2), NST-FIX at 0.1 mg/kg (Group 7) or 0.05 mg/kg (Group 8), or PBS (Group 1).
  • IV intravenous
  • LNP lipid nanoparticle
  • FIGs. 6A-6B are graphs showing the in vivo anti-tumor efficacy of a single
  • FIG. 6A shows the tumor volume means (mm 3 ), up to day 24, starting at day 10 post implantation.
  • FIG. 6B shows the individual tumor volumes (mm 3 ) for each group of mice, up to day 47, starting at day 10 post implantation.
  • FIGs. 7A-7B are graphs showing the in vivo anti-tumor efficacy of an
  • IL12 (miRless) mRNA.
  • Complete responses (CR) were achieved in 5 of 12 animals that received IL12 mRNA.
  • FIG. 7C is a graph showing comparable in vivo anti-tumor efficacy of IL12
  • IL12 miR122 binding site (FIG. 7C) in a B-cell lymphoma tumor model (A20). Both IL12 mRNAs (with miR122 binding site and without ⁇ i.e., miRless)) were formulated in an MC3-based lipid nanoparticle (LNP). The IL12 mRNAs were administered to mice bearing A20 B-cell lymphoma tumors. Complete responses (CR) were achieved in 6 out of 12 mice in the IL12 miR122 group (FIG. 7C).
  • FIGs. 8A-8B are graphs showing in vivo anti-tumor efficacy of a single dose of
  • FIG. 8C is a graph showing enhanced in vivo anti-tumor efficacy in a B-cell
  • lymphoma tumor model (A20) by administering multiple doses of 0.5 ⁇ g IL12 mRNA in MC3-based lipid nanoparticle (LNP) to mice bearing A20 tumors.
  • Complete responses (CR) were achieved in 5 out of 12 mice administered weekly dosing of 0.5 ⁇ g IL12 miR122 for seven (7) days x 6.
  • FIG. 8D is a graph showing that the in vivo anti-tumor efficacy of weekly
  • FIG. 14 shows the individual tumor volumes for 12 mice administered 0.5 ⁇ g of IL12 mRNA in Compound 18-based LNP for 7 days x 6. Complete responses (CR) were also achieved in 5 out of 12 animals.
  • FIGs. 8E-8F are graphs showing tumor growth in mice bearing A20 tumors
  • NST non-translated negative control mRNA
  • LNP MC3-based lipid nanoparticle
  • NST 0.5 ⁇ g non-translated negative control mRNA
  • NST Compound 18-based LNP
  • FIGs. 9A-9B are graphs showing dose-dependent levels of IL12 in plasma (FIG.
  • FIGs. 9C-9D are graphs showing elevated levels of IL12 in plasma and tumor following administration of indicated doses of IL12 mRNA in Compound 18-based LNPs compared to IL12 mRNA in MC3-based LNPs.
  • FIG. 9C shows plasma IL12 levels at 6 hours and 24 hours;
  • FIG. 9D shows tumor IL12 levels at 6 hours and 24 hours.
  • FIGs. 9E-9F are graphs showing increased levels of IFNy at 6 hours and 24 hours in plasma (FIG.
  • mice were given (i) PBS, (ii) 0.5 ⁇ g NST in MC3, (iii) 2.5 ⁇ g NST in MC3, (iv) 5 ⁇ g NST in MC3, (v) 0.5 ⁇ g IL12 in MC3, (vi) 2.5 ⁇ g IL12 in MC3, (vii) 5 ⁇ g IL12 in MC3, (viii) 0.5 ⁇ g IL12 miR122 in MC3, (ix) 2.5 ⁇ g IL12 miR122 in MC3, (x) 5 ⁇ g IL12 miR122 in MC3, (xi) 0.5 ⁇ g NST in Compound 18, (xii) 2.5 ⁇ g NST in Compound 18, (xiii) 0.5 ⁇ g IL12 miR122 in Compound 18, and (xiv) 2.5 ⁇ g IL12 miR122 in Compound
  • FIGs. 9G-9H are graphs showing increased levels of IP 10 at 6 hours and 24 hours in plasma (FIG. 9G) and in tumor (FIG. 9H) following administration of IL12 mRNA to mice bearing A20 tumors. From left to right, the mice were given (i) PBS, (ii) 0.5 ⁇ g NST in MC3, (iii) 2.5 ⁇ g NST in MC3, (iv) 5 ⁇ g NST in MC3, (v) 0.5 ⁇ g IL12 in MC3, (vi) 2.5 ⁇ g IL12 in MC3, (vii) 5 ⁇ g IL12 in MC3, (viii) 0.5 ⁇ g IL12 miR122 in MC3, (ix) 2.5 ⁇ g IL12 miR122 in MC3, (x) 5 ⁇ g IL12 miR122 in MC3, (xi) 0.5 ⁇ g NST in Compound 18, (xii) 2.5 ⁇ g NST in Compound 18, (xiii) 0.5
  • FIGs. 91-9 J are graphs showing decreased levels of IL6 at 6 hours and 24 hours in plasma (FIG. 91) and in tumor (FIG. 9J) following administration of IL12 mRNA. From left to right, the mice were given (i) PBS, (ii) 0.5 ⁇ g NST in MC3, (iii) 2.5 ⁇ g NST in MC3, (iv) 5 ⁇ g NST in MC3, (v) 0.5 ⁇ g IL12 in MC3, (vi) 2.5 ⁇ g IL12 in MC3, (vii) 5 ⁇ g IL12 in MC3, (viii) 0.5 ⁇ g IL12 miR122 in MC3, (ix) 2.5 ⁇ g IL12 miR122 in MC3, (x) 5 ⁇ g IL12 miR122 in MC3, (xi) 0.5 ⁇ g NST in Compound 18, (xii) 2.5 ⁇ g NST in Compound 18, (xiii) 0.5 ⁇ g IL12
  • FIGs. 9K-9L are graphs showing decreased levels of G-CSF at 6 hours and 24 hours in plasma (FIG. 9K) and in tumor (FIG. 9L) following administration of IL12 mRNA.
  • the mice were given (i) PBS, (ii) 0.5 ⁇ g NST in MC3, (iii) 2.5 ⁇ g NST in MC3, (iv) 5 ⁇ g NST in MC3, (v) 0.5 ⁇ g IL12 in MC3, (vi) 2.5 ⁇ g IL12 in MC3, (vii) 5 ⁇ g IL12 in MC3, (viii) 0.5 ⁇ g IL12 miR122 in MC3, (ix) 2.5 ⁇ g IL12 miR122 in MC3, (x) 5 ⁇ g IL12 miR122 in MC3, (xi) 0.5 ⁇ g NST in Compound 18, (xii) 2.5 ⁇ g NST in Compound 18, (xiii) 0.5 ⁇ g IL
  • FIGs. 9M-9N are graphs showing decreased levels of GROa at 6 hours and at 24 hours in plasma (FIG. 9M) and tumor (FIG. 9N) following administration of IL12 mRNA.
  • the mice were given (i) PBS, (ii) 0.5 ⁇ g NST in MC3, (iii) 2.5 ⁇ g NST in MC3, (iv) 5 ⁇ g NST in MC3, (v) 0.5 ⁇ g IL12 in MC3, (vi) 2.5 ⁇ g IL12 in MC3, (vii) 5 ⁇ g IL12 in MC3, (viii) 0.5 ⁇ g IL12 miR122 in MC3, (ix) 2.5 ⁇ g IL12 miR122 in MC3, (x) 5 ⁇ g IL12 miR122 in MC3, (xi) 0.5 ⁇ g NST in Compound 18, (xii) 2.5 ⁇ g NST in Compound 18, (xiii) 0.5 ⁇ g IL12
  • FIGs. 10A-10B are graphs showing individual tumor volumes through day 35 post disease induction with A20 tumor following treatment with IL12_miR122 mRNA (FIG. 10B) compared to negative control mRNA (FIG. 10A).
  • FIGs. 10C-10D are graphs showing body weight measurements of mice through day 35 post disease induction with A20 tumor following treatment with IL12_miR122 mRNA (FIG. 10D) compared to negative control mRNA (FIG. IOC).
  • FIG. 11A is a graph depicting bioluminescence (BL) as a surrogate for tumor burden at day 22 post disease induction with a luciferase-enabled MC38 colon cancer cell line in mice. From left to right, mice were administered no treatment, 2 ⁇ g
  • mIL12_miRless 2 ⁇ g mIL12_miR122, 2 ⁇ g NST_OX40L_122, 4 ⁇ g mIL12_miRless, 4 ⁇ g mIL12_miR122, 4 ⁇ g NST_OX40L_122, and 1 ⁇ g rm IL12.
  • FIG. 1 IB is a Kaplan-Meier curve showing the percent survival of mice treated with LNPs carrying IL12 mRNA compared to NST-OX40L negative controls. The graph shows survival to day 150 post implantation with A20 tumor.
  • FIG. 12A shows uracil (U) metrics corresponding to wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_001 to hIL12AB_020).
  • FIG. 12B shows guanine (G) metrics corresponding to wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_001 to hIL12AB_020).
  • FIG. 12C shows cytosine (C) metrics corresponding to wild type IL12B and 20 sequence optimized IL12B
  • FIG. 12D shows guanine plus cytosine (G/C) metrics corresponding to wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_001 to hIL12AB_020).
  • FIG. 13A shows uracil (U) metrics corresponding to wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_021 to ML12AB 040).
  • FIG. 13B shows guanine (G) metrics corresponding to wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_021 to hIL12AB_040).
  • FIG. 13C shows cytosine (C) metrics corresponding to wild type IL12B and 20 sequence optimized IL12B
  • FIG. 13D shows guanine plus cytosine (G/C) metrics corresponding to wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_021 to hIL12AB_040).
  • FIG. 14A shows uracil (U) metrics corresponding to wild type IL12A and 20 sequence optimized IL12A polynucleotides (hIL12AB_001 to hIL12AB_020).
  • FIG. 14B shows guanine (G) metrics corresponding to wild type IL12A and 20 sequence optimized IL12A polynucleotides (ML12AB 001 to hIL12AB_020).
  • FIG. 14C shows cytosine (C) metrics corresponding to wild type IL12A and 20 sequence optimized IL12A
  • FIG. 14D shows guanine plus cytosine (G/C) metrics corresponding to wild type IL12A and 20 sequence optimized IL12A polynucleotides (ML12AB 001 to hIL12AB_020).
  • FIG. 15A shows uracil (U) metrics corresponding to wild type IL12A and 20 sequence optimized IL12A polynucleotides (hIL12AB_021 to hIL12AB_040).
  • FIG. 15B shows guanine (G) metrics corresponding to wild type IL12A and 20 sequence optimized IL12A polynucleotides (ML12AB 021 to hIL12AB_040).
  • FIG. 15C shows cytosine (C) metrics corresponding to wild type IL12A and 20 sequence optimized IL12A
  • FIG. 15D shows guanine plus cytosine (G/C) metrics corresponding to wild type IL12A and 20 sequence optimized IL12A polynucleotides (ML12AB 021 to hIL12AB_040).
  • G/C Content (%) corresponds to %G/C TL .
  • FIG. 16A shows a comparison between the G/C compositional bias for codon positions 1, 2, 3 corresponding to the wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_001 to hIL12AB_020).
  • FIG. 16B shows a comparison between the G/C compositional bias for codon positions 1, 2, 3 corresponding to the wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_021 to hIL12AB_040).
  • FIG. 16A shows a comparison between the G/C compositional bias for codon positions 1, 2, 3 corresponding to the wild type IL12B and 20 sequence optimized IL12B polynucleotides (hIL12AB_021 to hIL12AB_040).
  • FIG. 16C shows a comparison between the G/C compositional bias for codon positions 1, 2, 3 corresponding to the wild type IL12A and 20 sequence optimized IL12A polynucleotides (hIL12AB_0-l to hIL12AB_020).
  • FIG. 16D shows a comparison between the G/C compositional bias for codon positions 1, 2, 3 corresponding to the wild type IL12A and 20 sequence optimized IL12A polynucleotides (hIL12AB_021 to hIL12AB_040).
  • FIG. 17A is a graph showing dose-dependent levels of IL12 in plasma at 24 hours following intratumoral administration of the indicated doses of IL12 mRNA to mice bearing tumors. From left to right, the mice were given (i) no treatment, (ii) 5 ⁇ g NST,
  • FIG. 17B is a graph showing increased levels of IFNy in plasma at 24 hours
  • mice were given (i) no treatment, (ii) 5 ⁇ g NST, (iii) 0.05 ⁇ g IL12 miR122,
  • FIGs. 18A-18B are graphs showing increased levels of IL12 in plasma (FIG.
  • mice bearing MC38 tumors were given (i) no treatment, (ii) 2 ⁇ g IL12 miRless, (iii) 2 ⁇ g IL12 miR122, (iv) 4 ⁇ g IL12 miRless, (v) 4 ⁇ g miR122, (vi) 1 ⁇ g IL12 protein, (vii) 2 ⁇ g NST_OX40L_122, or (viii) 4 ⁇ g NST_OX40L_122.
  • FIGs. 19A-19B are graphs showing individual tumor volumes through day 90 post disease induction with A20 tumor following treatment with 0.5 ⁇ g IL12_miR122 mRNA in a Compound 18-based lipid nanoparticle (LNP) (FIG. 19B) compared to negative control mRNA (FIG. 19A).
  • LNP Compound 18-based lipid nanoparticle
  • FIGs. 19C-19D are graphs showing individual tumor volumes through day 60 post disease induction with A20 tumor in naive mice (FIG. 19C) or in complete responder mice previously treated with IL12_miR122 mRNA and rechallenged (FIG. 19D)
  • FIGs. 20A-20D are graphs showing individual tumor volumes through 80 days following a single intratumoral dose of IL12 mRNA to mice bearing MC38-S tumors. Mice were given 0.05 ⁇ g IL12 mRNA (FIG. 20A), 0.5 ⁇ g IL12 mRNA (FIG. 20B), 5 ⁇ g IL12 mRNA (FIG. 20C), or NST (FIG. 20D).
  • FIGs. 21A-21F are graphs showing individual tumor volumes through 80 days following a single dose or multiple doses of IL12 mRNA to mice bearing MC38-S tumors. Mice were given a single dose of 0.05 ⁇ g IL12 mRNA (FIG.
  • FIG. 21A a single dose of 0.5 ⁇ g IL12 mRNA
  • FIG. 21B a single dose of 5 ⁇ g IL12 mRNA
  • FIG. 21C a single dose of 5 ⁇ g IL12 mRNA
  • FIG. 21D two doses of 0.05 ⁇ g IL12 mRNA
  • FIG. 21E two doses of 5 ⁇ g IL12 mRNA
  • FIG. 22 is a Kaplan-Meier curve showing the percent survival of mice treated with LNPs carrying IL12 mRNA compared to NST-FIX negative controls. The graph shows survival to day 80 post implantation with MC38-S tumor.
  • FIG. 23A-23D are graphs showing individual tumor volumes through 75 days following a single dose of IL12 mRNA to mice bearing MC38-R tumors. Mice were given 0.05 ⁇ g IL12 mRNA (FIG. 23A), 0.5 ⁇ g IL12 mRNA (FIG. 23B), 5 ⁇ g IL12 mRNA (FIG. 23C), or NST (FIG. 23D).
  • FIG. 23E-23J are graphs showing individual tumor volumes through 75 days following a single dose or multiple doses of IL12 mRNA to mice bearing MC38-R tumors.
  • Mice were given a single dose of 0.05 ⁇ g IL12 mRNA (FIG. 23E), a single dose of 0.5 ⁇ g IL12 mRNA (FIG. 23F), a single dose of 5 ⁇ g IL12 mRNA (FIG. 23G), multiple doses of 0.05 ⁇ g IL12 mRNA (FIG. 23H), multiple doses of 0.5 ⁇ g IL12 mRNA (FIG. 231), or multiple doses of 5 ⁇ g IL12 mRNA (FIG. 23J).
  • FIG. 24 is a Kaplan-Meier curve showing the percent survival of mice treated with LNPs carrying IL12 mRNA compared to NST-OX40L negative controls. The graph shows survival to day 80 post implantation with MC38-R tumor.
  • FIG. 25 is a graph showing depletion of CD8+ T cells over the course of 28 days.
  • FIGs. 26A-26E are graphs showing individual tumor volumes through 90 days following CD8+ T cell depletion and subsequent administration of a single dose of IL12 mRNA to mice bearing MC38-R tumors. Mice were given an antibody control for CD8+ T cell depletion and then 0.5 ⁇ g negative control mRNA (FIG. 26A), an antibody control for CD8+ T cell depletion and then 0.5 ⁇ g IL12 mRNA (FIG. 26B), CD8+ T cell- depleting antibody clone 24.3 and then 0.5 ⁇ g negative control mRNA (FIG.
  • FIG. 26E is a Kaplan-Meier curve showing the percent survival of mice treated with IL12 mRNA absent CD8+ T cell depletion compared to mice treated with IL12 mRNA after CD8+ T cell depletion. The graph shows survival to day 90 post implantation with MC38-R tumor.
  • FIGs. 27A-27B are graphs showing the percent of CD1 lb+ myeloid cells
  • FIG. 27A staining positive for PDL1 expression in MC38-R (FIG. 27A) and B16F10-AP3 (FIG. 27B) tumors 24 hours or 72 hours after no treatment, treatment with an NST negative control or two different intratumoral doses of IL12 mRNA.
  • Statistical significance is indicated by asterisks.
  • FIGs. 28A-28B are graphs showing CD8+ T cells in tumors as a proportion of the immune infiltrate (CD45+ cells) (left panels) and per mg of tumor (right panels) in MC38-R (FIG. 28A) and B16F10-AP3 (FIG. 28B) tumors 7 days after no treatment, treatment with an NST negative control or two different doses of IL12 mRNA. Statistical significance is indicated by asterisks.
  • FIGs. 29A-29B are graphs showing ratio of CD8+ T cells to Treg cells in MC38-
  • FIG. 29A R (FIG. 29A) and B 16F10-AP3 (FIG. 29B) tumors 7 days after no treatment, treatment with an NST negative control or two different doses of IL12 mRNA. Statistical significance is indicated by asterisks.
  • FIGs. 30A-30B are graphs showing the percent of cells CD8+ T cells staining positive for the early activation marker CD69 in MC38-R (FIG. 30A) and B16F10-AP3 (FIG. 30B) tumors 24 hours after no treatment, treatment with an NST negative control or two different doses of IL12 mRNA. Statistical significance is indicated by asterisks.
  • FIGs. 31A-31B are graphs showing the percent of NK cells staining positive for the early activation marker CD69 in MC38-R (FIG. 31 A) and B16F10-AP3 (FIG. 31B) tumors 24 hours or 72 hours after no treatment, treatment with an NST negative control or two different doses ofTL12 mRNA. Statistical significance is indicated by asterisks.
  • FIGs. 32A-32B are graphs showing the number of CD 103+ classical dendritic cells per mg of MC38-R (FIG. 32A) and B16F10-AP3 (FIG. 32B) tumors 7 days after no treatment, treatment with an NST negative control or two different doses of IL12 mRNA.
  • FIG. 32C is a graph showing the percent of CD8+ classical dendritic cells staining positive for CD86 in the tumor draining lymph node (LN) of a B16F10-AP3 tumor 24 hours, 72 hours, or 7 days after no treatment, treatment with an NST negative control or two different dose of IL12 mRNA. Statistical significance is indicated by asterisks. [0079] FIGs.
  • FIGs. 33A-33B are graphs showing individual tumor volumes through 55 days following administration of anti-PD-Ll antibody to mice bearing MC38-R tumors. Mice were given an antibody control (FIG. 33 A) or an anti-PD-Ll antibody (clone 80) (FIG. 33B).
  • FIGs. 33C-33G are graphs showing individual tumor volumes in mice bearing MC38-R tumors through 90 days following administration of IL12 mRNA alone or in combination with an anti-PD-Ll antibody. Mice were given (i) a single iTu dose of 0.5 ⁇ g IL12 mRNA as a monotherapy (FIG.
  • FIGs. 34A-34C are graphs showing individual tumor volumes through 75 days.
  • mice bearing MC38-R tumors were treated 10 days post implant with an anti-PD-Ll antibody alone (FIG. 34A), 0.5 ⁇ g IL12 mRNA alone (FIG. 34B), or both an anti-PD-Ll antibody and 0.5 ⁇ g IL12 mRNA (FIG. 34C).
  • the anti-PD-Ll antibody was administered over 6 doses. Vertical dashed lines indicate dose days.
  • FIGs. 35A-35D are graphs showing individual tumor volumes through 70 days.
  • mice bearing B16F10-AP3 tumors were treated 10 days post implant with a negative control (FIG. 35A), an anti-PD-Ll antibody alone (FIG. 35B), a single dose of 0.5 ⁇ g IL12 mRNA alone (FIG. 35C), or with both an anti-PD-Ll antibody and 0.5 ⁇ g IL12 mRNA (FIG. 35D).
  • the anti-PD-Ll antibody was administered over 6 doses. Vertical dashed lines indicate dose days.
  • FIG. 36A is a drawing of a mouse implanted bilaterally with tumor cells.
  • FIGs. 36A is a drawing of a mouse implanted bilaterally with tumor cells.
  • 36B-36G are graphs showing individual tumor volumes in bilaterally implanted MC38-S mice through 60 days in treated (FIG. 36B, 36D, and 36F) and distal (FIG. 36C, 36E, and 36G) tumors following treatment with a negative control (NST mRNA plus isotype antibody control) (FIGs. 36B-36C), 0.5 ⁇ g IL12 mRNA (FIGs. 36D-36E), or 5 ⁇ g IL12 mRNA (FIGs. 36F-36G). Vertical dashed lines indicate dose days.
  • FIGs. 37A-37F are graphs showing individual tumor volumes in bilaterally
  • FIGs. 37A-37B no active mRNA
  • FIGs. 37C-37D 0.5 ⁇ g IL12 mRNA
  • FIGs. 37E-37F 5 ⁇ g IL12 mRNA
  • FIG. 37A, 37C, or 37E isotype control antibody
  • FIG. 37B, 37D, or 37F isotype control antibody
  • FIG. 38 is a graph showing human IL-12 expression in vitro and in vivo by wild- type and codon optimized IL-12 mRNA constructs.
  • the present disclosure provides a new approach to treat cancer involving the
  • the disclosure relates to methods of treating cancer using a
  • an IL12 polypeptide as disclosed herein comprises IL12A, IL12B, or both IL12A and IL12B.
  • an anti-cancer agent e.g., an immune-checkpoint inhibitor, e.g., anti-PD-1 antibody, anti-PD-Ll antibody, and/or anti-CTLA-4 antibody.
  • an anti-cancer immune response is possible by administering, e.g., intratumorally, mRNAs encoding IL12 in the stimulation of, for example, T-cells and/or natural killer cells. Therefore, an mRNA encoding IL12 is believed to provide a first stimulation signal to the immune system, for example, within the tumor environment, e.g., via intratumoral injection of the mRNA. IL12 can also stimulate the production of interferon-gamma (IFN- ⁇ ) and tumor necrosis factor-alpha (TNF-a) from T cells and natural killer (NK) cells.
  • IFN- ⁇ interferon-gamma
  • TNF-a tumor necrosis factor-alpha
  • the disclosure provides a method of treating tumor comprising administering a polynucleotide ⁇ e.g., mRNA) encoding IL12 in combination with an anti-PD-1 antibody or anti-PD-Ll antibody to block the interaction between PD-Ll and its receptor, i.e., PD-1.
  • the disclosure includes a method of treating tumor comprising administering a polynucleotide ⁇ e.g., mRNA) encoding IL12 in combination with an anti-CTLA-4 antibody.
  • the disclosure provides a method of treating tumor comprising administering a polynucleotide ⁇ e.g., mRNA) encoding IL12 in combination with an anti-PD-1 antibody or anti-PD-Ll antibody and an anti-CTLA-4 antibody.
  • a polynucleotide ⁇ e.g., mRNA) encoding IL12 in combination with an anti-PD-1 antibody or anti-PD-Ll antibody and an anti-CTLA-4 antibody.
  • additional agents e.g., OX40L, a polynucleotide encoding OX40L, or mRNA encoding an OX40L.
  • the anti-PD-1 antibody or anti-PD-Ll antibody can be administered in the form of a polynucleotide.
  • the anti-CTLA-4 antibody can be administered in the form of a polynucleotide.
  • Exemplary aspects feature treatment with lipid nanoparticle-(L P-) encapsulated mRNAs.
  • Certain aspects of the present disclosure are directed to methods of reducing or decreasing size, mass, and/or volume of a tumor or preventing the growth of a tumor in a subject in need thereof comprising administering a polynucleotide, e.g., mRNA, encoding an IL12B and/or IL12A polypeptide disclosed herein, or a vector or a host cell comprising the polynucleotide, or an IL12B and/or IL12A polypeptide encoded by the polynucleotide.
  • the polynucleotide encodes an IL-12
  • the methods of reducing the size (including mass and/or volume) of a tumor or inhibiting growth of a tumor in a subject in need thereof comprise administering to the subject an effective amount of a composition comprising one or more polynucleotides.
  • the one or more polynucleotides encode an IL-12 polypeptide.
  • the one or more polynucleotides comprise an ORF encoding an IL12B polypeptide.
  • the one or more polynucleotides comprise an ORF encoding an IL12A polypeptide. In certain embodiments, the one or more polynucleotides comprise an ORF encoding an IL12B polypeptide and an IL12A polypeptide.
  • the methods further comprise administering a second
  • the second agent comprises an effective amount of a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide. In some embodiments, the second agent comprises an effective amount of a composition comprising a checkpoint inhibitor polypeptide. In some embodiments, the checkpoint inhibitor is any checkpoint inhibitor known in the art or described herein. In some embodiments, the checkpoint inhibitor is an anti-PD-1 antibody. In other embodiments, the checkpoint inhibitor is an anti-PD-Ll antibody. In other embodiments, the checkpoint inhibitor is an anti-CTLA-4 antibody. In some embodiments, the second agent comprises an effective amount of a composition comprising a polynucleotide comprising an ORF encoding OX40L. In some
  • the checkpoint inhibitor is selected from an anti-PD-1 antibody, an anti- PD-Ll antibody, and/or an anti-CTLA-4 antibody, or a polynucleotide encoding OX40L or any other agents disclosed herein.
  • the composition comprising a checkpoint inhibitor comprises more than one checkpoint inhibitor.
  • the method comprises administering (i) an mRNA, encoding an IL12B and/or IL12A polypeptide disclosed herein, and (ii) an anti-PD-Ll antibody, an anti-PD-1 antibody, an anti-CTLA-4 antibody, a polynucleotide encoding OX40L, or any combination thereof.
  • the methods reduce the size of a tumor in a subject as compared to the size of the tumor before the administration.
  • the size of the tumor is reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%), at least about 45%, at least about 50%, least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%.
  • the subject exhibits a partial resonse. In certain embodiments, the subject exhibits a complete response.
  • the methods of the present disclosure inhibit, stop or delay tumor growth in a subject in need thereof.
  • the tumor growth is inhibited, stopped or delayed for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 15 months, at least about 18 months, at least about 24 months, or at least about 36 months.
  • the tumor growth is inhibited indefinitely.
  • the present disclosure provides methods of promoting an anti -tumor effect (e.g., induce T cell proliferation, induce T cell infiltration in a tumor, induce a memory T cell response, increasing the number of K cells, etc.) by administering the polynucleotide (e.g., mRNA) encoding IL12 alone or the polynucleotide in combination with any agents disclosed herein.
  • an anti -tumor effect e.g., induce T cell proliferation, induce T cell infiltration in a tumor, induce a memory T cell response, increasing the number of K cells, etc.
  • the present disclosure provides a method of activating T cells in a subject in need thereof, inducing T cell proliferation in a subject in need thereof, inducing T cell infiltration in a tumor of a subject in need thereof, and/or inducing a memory T cell response in a subject in need thereof, comprising administering to the subject a composition disclosed herein, e.g., a polynucleotide (e.g., mRNA) encoding IL12, alone or in combination with composition comprising a second agent, e.g., a checkpoint inhibitor polypeptide or a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide, e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, or a polynucleotide encoding OX40L or any other agents disclosed herein.
  • a composition disclosed herein e.g., a polynucleotide
  • the intratumoral administration of the polynucleotide (e.g., mRNA) encoding IL12 alone or in combination with a second agent can increase the efficacy of the anti -tumor effect (e.g., T cell infiltration in a tumor) compared to other routes of administration.
  • the polynucleotide e.g., mRNA
  • the anti -tumor effect e.g., T cell infiltration in a tumor
  • the administering of the compositions described herein activates T cells in the subject.
  • T cell activation can be characterized in any way known in the art.
  • the activated T cells express CD4.
  • the activated T cells express CD8.
  • the activated T cells express CD4 and CD8.
  • the activated T cells comprise CD4 + T cells, CD8 + T cells, or both CD4 + T cells and CD8 + T cells.
  • activated T cells in the subject reduce the size of a tumor or inhibit the growth of a tumor in the subject.
  • Activation of T cells can be measured using applications in the art such as measuring T cell proliferation; measuring cytokine production with enzyme-linked immunosorbant assays (ELISA) or enzyme-linked immunospot assays (ELISPOT); or detection of cell-surface markers associated with T cell activation (e.g., CD69, CD40L, CD137, CD25, CD71, CD26, CD27, CD28, CD30, CD 154, and CD 134) with techniques such as flow cytometry.
  • T cell activation comprises inducing T cell proliferation.
  • T cell proliferation is increased by at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 20 fold, at least about 30 fold, at least about 50 fold, or at least about 100 fold, as compared to the level of T cell proliferation prior to the administration of the IL12 encoding polynucleotide (e.g., mRNA).
  • the IL12 encoding polynucleotide e.g., mRNA
  • T cell proliferation in the subject is directed to an anti -tumor immune response in the subject.
  • the T cell proliferation in the subject reduces or decreases the size of a tumor or inhibits the growth of a tumor in the subject.
  • T cell proliferation can be measured using applications in the art such as cell counting, viability staining, optical density assays, or detection of cell-surface markers associated with T cell activation (e.g., CD69, CD40L, CD137, CD25, CD71, CD26, CD27, CD28, CD30, CD154, and CD134) with techniques such as flow cytometry.
  • T cell activation comprises induction of T cell infiltration of the tumor.
  • T cell infiltration in the tumor is increased by at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 20 fold, at least about 30 fold, at least about 50 fold, or at least about 100 fold, as compared to the level of T cell infiltration of the tumor prior to the administration of the IL12 encoding polynucleotide (e.g., mRNA).
  • the IL12 encoding polynucleotide e.g., mRNA
  • T cell activation comprises increasing the number of
  • the number of tumor-infiltrating T cells in the tumor is increased by at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 20 fold, at least about 30 fold, at least about 50 fold, or at least about 100 fold, as compared to the number of tumor infiltrating T cells in the tumor prior to the administration of the IL12 encoding polynucleotide (e.g., mRNA)
  • the IL12 encoding polynucleotide e.g., mRNA
  • T cell infiltration in a tumor of the subject is directed to an anti -tumor immune response in the subject.
  • the T cell infiltration in a tumor of the subject reduces or decreases the size of a tumor or inhibits the growth of a tumor in the subject.
  • T cell infiltration in a tumor can be measured using applications in the art such as tissue sectioning and staining for cell markers, measuring local cytokine production at the tumor site, or detection of T cell-surface markers with techniques such as flow cytometry.
  • T cell activation comprises inducing a memory T cell response in a subject in need thereof.
  • the memory T cell response is increased by at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 20 fold, at least about 30 fold, at least about 50 fold, or at least about 100 fold, as compared to the memory T cell response prior to the administration of the IL12 encoding polynucleotide (e.g., mRNA).
  • the IL12 encoding polynucleotide e.g., mRNA
  • the memory T cell response in the subject is directed to an anti -tumor immune response in the subject.
  • the memory T cell response in the subject reduces or decreases the size of a tumor or inhibits the growth of a tumor in the subject.
  • a memory T cell response can be measured using applications in the art such as measuring T cell markers associated with memory T cells, measuring local cytokine production related to memory immune response, or detecting memory T cell-surface markers with techniques such as flow cytometry.
  • the administering of the compositions described herein increases an effector to suppressor T cell ratio in the tumor.
  • the effector to suppressor T cell ratio is characterized by the ratio of (i) CD8+, CD4+, or CD8+/CD4+ T cells to (ii) Treg cells in a subject.
  • the increase in the effector to suppressor T cell ratio correlates with an increase in the number of CD8+ T cells. In some embodiments, the increase in the effector to suppressor T cell ratio correlates with an increase in the number of CD4+ T cells. In some embodiments, the increase in the effector to suppressor T cell ratio correlates with an increase in the number of
  • the increase in the effector to suppressor T cell ratio correlates with a decrease in the number of Treg cells.
  • the effector to suppressor T cell ratio e.g., the CD8 + T cell to Treg cell ratio, following administration of the IL12 encoding polynucleotide (e.g., mRNA) (alone or in combination with an anti-PD-Ll antibody, an anti-PD-1 antibody, an anti-CTLA-4 antibody, or a polynucleotide encoding OX40L) is at least about 1.5: 1, at least about 2: 1, at least about 2.5: 1, at least about 3 : 1, at least about 3.5: 1, at least about 3.5: 1, at least about 4: 1, at least about 4.5: 1, at least about 5: 1, at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 9: 1, at least about 10: 1, at least about 15: 1, at least about 20: 1,
  • the effector to suppressor T cell ratio e.g., the CD8 + T cell to Treg cell ratio
  • the IL12 encoding polynucleotide e.g., mRNA
  • an anti-PD-Ll antibody, an anti-PD-1 antibody, an anti-CTLA-4 antibody, or a polynucleotide encoding OX40L is at least about 1.5, at least about 2, at least about 2.5, at least about 3, at least about 3.5, at least about 3.5, at least about 4, at least about 4.5, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at
  • the increase in the effector to suppressor T cell ratio in the tumor is directed to an anti -tumor immune response in the subject.
  • the increase in the effector to suppressor T cell ratio in the tumor reduces or decreases the size of a tumor or inhibits the growth of a tumor in the subject.
  • the effector to suppressor T cell ratio in the tumor can be measured using applications in the art such as measuring the ratio of CD8+, CD4+, or CD8+/CD4+ T cells to Treg cells, using any methods known in the art including IHC and/or flow cytometry.
  • the activated T cells by the present methods are CD4 + cells, CD8 + cells, CD62 + (L-selectin + ) cells, CD69 + cells, CD40L + cells, CD137 + cells, CD25 + cells, CD71 + cells, CD26 + cells, CD27 + cells, CD28 + cells, CD30 + cells, CD45 + cells, CD45RA + cells, CD45RO + cells, CDl lb + cells, CD154 + cells, CD134 + cells, CXCR3 + cells, CCR4 + cells, CCR6 + cells, CCR7 + cells, CXCR5 + cells, Crth2 + cells, gamma delta T cells, or any combination thereof.
  • the activated T cells by the present methods are Thi cells.
  • the T cells activated by the present methods are Th 2 cells.
  • the T cells activated by the present disclosure are cytotoxic T cells.
  • the infiltrating T cells by the present methods are CD4 + cells, CD8 + cells, CD62 + (L-selectin + ) cells, CD69 + cells, CD40L + cells, CD137 + cells, CD25 + cells, CD71 + cells, CD26 + cells, CD27 + cells, CD28 + cells, CD30 + cells, CD45 + cells, CD45RA + cells, CD45RO + cells, CDl lb + cells, CD154 + cells, CD134 + cells, CXCR3 + cells, CCR4 + cells, CCR6 + cells, CCR7 + cells, CXCR5 + cells, Crth2 + cells, gamma delta T cells, or any combination thereof.
  • the infiltrating T cells by the present methods are Thi cells. In other embodiments, the infiltrating T cells by the present methods are Th 2 cells. In other embodiments, the infiltrating T cells by the present disclosure are cytotoxic T cells.
  • the memory T cells induced by the present methods are
  • the memory T cells by the present methods are Thi cells.
  • the memory T cells by the present methods are Th 2 cells.
  • the memory T cells by the present disclosure are cytotoxic T cells.
  • the disclosure includes a method of inducing an adaptive immune response, an innate immune response, or both adaptive and innate immune response against tumor comprising administering a polynucleotide, e.g., mRNA, encoding IL12 alone or in combination with a second agent, e.g., a checkpoint inhibitor, e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, a polynucleotide encoding OX40L, and/or any other agents disclosed herein.
  • a polynucleotide e.g., mRNA
  • encoding IL12 alone or in combination with a second agent, e.g., a checkpoint inhibitor, e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody
  • a polynucleotide encoding OX40L e.g., a polynu
  • Natural Killer (NK) cells in a subject in need thereof comprising administering a polynucleotide comprising an mRNA encoding IL12 alone or in combination with a second agent, e.g., a checkpoint inhibitor, e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, a polynucleotide encoding OX40L, and/or any other agents disclosed herein.
  • a checkpoint inhibitor e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody
  • the increase in the number of NK cells in the subject is directed to an anti -tumor immune response in the subject.
  • the increase in the number of NK cells in the subject reduces or decreases the size of a tumor or inhibits the growth of a tumor in the subject.
  • Increases in the number of NK cells in a subject can be measured using applications in the art such as detection of NK cell-surface markers (e.g., CD335/NKp46; CD336/NKp44; CD337/NPp30) or intracellular NK cell markers (e.g., perforin; granzymes; granulysin).
  • NK cell-surface markers e.g., CD335/NKp46; CD336/NKp44; CD337/NPp30
  • intracellular NK cell markers e.g., perforin; granzymes; granulysin.
  • the administering of the compositions described herein e.g., a polynucleotide (e.g., mRNA) encoding an IL12, alone or in combination with a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide or a composition comprising a checkpoint inhibitor polypeptide, increases the number of activated NK cells in the subject as compared to the number of activated NK cells prior to the administration.
  • a polynucleotide e.g., mRNA
  • the number of activated NK cells is increased by at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 15 fold, at least about 20 fold, at least about 25 fold, at least about 30 fold, at least about 35 fold, at least about 40 fold, at least about 45 fold, at least about 50 fold, at least about 60 fold, at least about 70 fold, at least about 80 fold, at least about 90 fold, or at least about 100 fold.
  • the increase in activated NK cells is maintained for at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, at least about 15 days, at least about 16 days, at least about 17 days, at least about 18 days, at least about 19 days, at least about 20 days, at least about 21 days, or at least about 28 days.
  • the administering of the compositions described herein e.g., a polynucleotide (e.g., mRNA) encoding an IL12, alone or in combination with a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide or a composition comprising a checkpoint inhibitor polypeptide, increases the number of cross-presenting dendritic cells in the tumor of the subject as compared to the number of cross-presenting dendritic cells in the tumor prior to the administration.
  • a polynucleotide e.g., mRNA
  • a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide or a composition comprising a checkpoint inhibitor polypeptide increases the number of cross-presenting dendritic cells in the tumor of the subject as compared to the number of cross-presenting dendritic cells in the tumor prior to the administration.
  • the number of cross-presenting dendritic cells in the tumor is increased by at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 15 fold, at least about 20 fold, at least about 25 fold, at least about 30 fold, at least about 35 fold, at least about 40 fold, at least about 45 fold, at least about 50 fold, at least about 60 fold, at least about 70 fold, at least about 80 fold, at least about 90 fold, or at least about 100 fold.
  • the increase in cross-presenting dendritic cells in the tumor is maintained for at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, at least about 15 days, at least about 16 days, at least about 17 days, at least about 18 days, at least about 19 days, at least about 20 days, at least about 21 days, or at least about 28 days.
  • the present disclosure is also directed to a method of increasing IFNy expression in a subject having tumor comprising administering a polynucleotide, e.g., mRNA, encoding IL12 alone or in combination with a second agent, e.g., a checkpoint inhibitor, e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, a polynucleotide encoding OX40L, and/or any other agents disclosed herein.
  • a polynucleotide e.g., mRNA
  • encoding IL12 alone or in combination with a second agent, e.g., a checkpoint inhibitor, e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody
  • a polynucleotide encoding OX40L e.g., a polynucleotide encoding IL
  • Other embodiments also include a method of increasing expression of IFNy
  • a polynucleotide e.g., mRNA, encoding IL12 alone or in combination with another agent disclosed herein.
  • the methods of the present disclosure can include methods of inducing expression of GM-CSF, IL-18, IL-3, RANTES, IL-6, or any combination thereof.
  • polynucleotide encoding IL12 can be formulated as a pharmaceutical
  • tumor is used herein in a broad sense and refers to any abnormal new growth of tissue that possesses no physiological function and arises from uncontrolled usually rapid cellular proliferation.
  • tumor as used herein relates to both benign tumors and to malignant tumors.
  • Certain aspects of the disclosure provide methods of intratumorally administering a single administration dose of a polynucleotide, e.g., mRNA, encoding IL12 alone or in combination with any agents disclosed herein.
  • a polynucleotide e.g., mRNA, encoding IL12
  • an mRNA encoding IL12 can be administered only once while the other agent can be administered regularly, following its regular dosing schedule.
  • a checkpoint inhibitor e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, is administered prior to administration of a polynucleotide, e.g., mRNA, encoding IL12.
  • the polynucleotide is formulated in a lipid nanoparticle, e.g., Compound 18, disclosed herein.
  • a lipid nanoparticle e.g., Compound 18, disclosed herein.
  • the intratumoral delivery of a polynucleotide encoding IL12 and/or the lipid nanoparticle formulation disclosed herein allow single dose administration that is sufficient for the dose to trigger anti -tumor efficacy and treat tumor. Given the potential toxicity of IFNy induced by IL-12, this single dosing regimen of the disclosed polynucleotide can be beneficial to the subjects in need of the treatment.
  • the method comprises administering a single dose of a polynucleotide encoding IL12 in combination with a second agent, e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, which can be given also in single administration or multiple administrations following its regular (e.g., approved) schedule.
  • a second agent e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody
  • the method comprises not more than two administrations of a polynucleotide encoding IL12, not more than three administrations of a polynucleotide encoding IL12, not more than four administrations of a polynucleotide encoding IL12, or not more than five administrations of a polynucleotide encoding IL12, optionally in combination with a checkpoint inhibitor, e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, or a polynucleotide encoding an OX40L polypeptide.
  • a checkpoint inhibitor e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, or a polynucleotide encoding an OX40L polypeptide.
  • the present methods can result in abscopal effects, e.g., a treatment of tumor where localized treatment of a tumor, e.g., intratumoral delivery, by a polynucleotide, e.g., mRNA, encoding IL12 causes not only a shrinking of the treated tumor, but also a shrinking of tumors outside the scope of the localized treatment ("distal tumor").
  • abscopal effects e.g., a treatment of tumor where localized treatment of a tumor, e.g., intratumoral delivery, by a polynucleotide, e.g., mRNA, encoding IL12 causes not only a shrinking of the treated tumor, but also a shrinking of tumors outside the scope of the localized treatment ("distal tumor").
  • the administering of the compositions described herein e.g., a polynucleotide encoding an IL12 polypeptide, alone or in combination with a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide or a composition comprising a checkpoint inhibitor polypeptide, reduces the size of a distal tumor.
  • the administering is intratumoral to a first tumor, and the administering reduces the size of a second, distal tumor.
  • the size of the distal tumor is reduced by at least about 10%, at least about 20% at least about 30%>, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100%.
  • the administering of the compositions described herein e.g., a polynucleotide encoding an IL12 polypeptide, alone or in combination with a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide or a composition comprising a checkpoint inhibitor polypeptide, inhibits the growth of a distal tumor.
  • the administering is intratumoral to a first tumor, and the administering inhibits the growth of a second, distal tumor.
  • the growth of the distal tumor is inhibited for at least about 7 days, at least about 14 days, at least about 21 days, at least about 28 days, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, at least about 12 months, at least about 18 months, at least about 24 months, at least about 30 months, at least about 36 months, at least about 4 years, or at least about 5 years.
  • compositions for intratumoral administration disclosed herein can: (i) increase the retention of the polynucleotide in the tumor;
  • a corresponding reference composition e.g., composition in which compounds of formula (I) are not present or have been substituted by another ionizable amino lipid, e.g., MC3
  • a decrease in leakage can be quantified as decrease in the ratio of polypeptide expression in the tumor to polypeptide expression in non-tumor tissues, such as peritumoral tissue or to another tissue or organ, e.g., liver tissue.
  • Delivery of a polynucleotide encoding IL12 to a tumor involves administering a pharmaceutical composition disclosed herein, e.g., in nanoparticle form, including the polynucleotide encoding IL12 to a subject, where administration of the pharmaceutical composition involves contacting the tumor with the composition.
  • polynucleotide encoding IL12 is an mRNA
  • a translatable mRNA may be translated in the cell to produce a polypeptide of interest.
  • mRNAs that are substantially not translatable may also be delivered to tumors.
  • Substantially non- translatable mRNAs may be useful as vaccines and/or may sequester translational components of a cell to reduce expression of other species in the cell.
  • compositions disclosed herein can increase specific delivery.
  • the term "specific delivery,” means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a polynucleotide encoding an IL12B polypeptide, IL12A polypeptide, or both IL12B and IL12A polypeptides by pharmaceutical composition disclosed herein (e.g., in nanoparticle form) to a target tissue of interest (e.g., a tumor) compared to an off- target tissue (e.g., mammalian liver).
  • a target tissue of interest e.g., a tumor
  • an off- target tissue e.g., mammalian liver
  • the level of delivery of a nanoparticle to a particular tissue may be measured, for example, by comparing (i) the amount of protein expressed from a polynucleotide encoding IL12 in a tissue to the weight of the tissue;
  • Specific delivery to a tumor or a particular class of cells in the tumor implies that a higher proportion of pharmaceutical composition including a polynucleotide encoding an IL12B polypeptide, IL12A polypeptide, or both IL12B and IL12A polypeptides is delivered to the target destination (e.g., target tissue) relative to other off-target destinations upon administration of a pharmaceutical composition to a subject.
  • target destination e.g., target tissue
  • the present disclosure also provides methods to deliver intratumorally a
  • the intratumoral administration can show one or more properties selected from the group consisting of:
  • a corresponding reference composition e.g., composition in which compounds of formula (I) are not present or have been substituted by another ionizable amino lipid, e.g., MC3
  • a decrease in leakage can be quantified as decrease in the ratio of polypeptide expression in the tumor to polypeptide expression in non-tumor tissues, such as peritumoral tissue or to another tissue or organ, e.g., liver tissue.
  • another property in delivery caused as a result of using the pharmaceutical compositions disclosed herein is a reduction in immune response with respect to the immune response observed when other lipid components are used to deliver the same a therapeutic agent or polynucleotide encoding a therapeutic agent.
  • the present disclosure provides a method of increasing retention of a therapeutic agent (e.g., a polynucleotide or a polypeptide administered as part of the pharmaceutical composition or a polypeptide expressed as a result of the administration) in a tumor tissue in a subject, comprising administering intratumorally to the tumor tissue a pharmaceutical composition disclosed herein, wherein the retention of the therapeutic agent in the tumor tissue is increased compared to the retention of the therapeutic agent in the tumor tissue after administering a corresponding reference composition (e.g., MC3).
  • a therapeutic agent e.g., a polynucleotide or a polypeptide administered as part of the pharmaceutical composition or a polypeptide expressed as a result of the administration
  • a corresponding reference composition e.g., MC3
  • Also provided is a method of increasing retention of an expressed polypeptide in a tumor tissue in a subject comprising administering to the tumor tissue a pharmaceutical composition disclosed herein, wherein the pharmaceutical composition comprises a polynucleotide encoding the expressed polypeptide, and wherein the retention of the expressed polypeptide in the tumor tissue is increased compared to the retention of the polypeptide in the tumor tissue after administering a corresponding reference composition (e.g., MC3).
  • a corresponding reference composition e.g., MC3
  • the present disclosure also provides a method of decreasing expression leakage of a polynucleotide administered intratumorally to a subject in need thereof, comprising administering said polynucleotide intratumorally to the tumor tissue as a pharmaceutical composition disclosed herein, wherein the expression level of the polypeptide in non- tumor tissue is decreased compared to the expression level of the polypeptide in non- tumor tissue after administering a corresponding reference composition (e.g., MC3).
  • a corresponding reference composition e.g., MC3
  • a corresponding reference composition e.g., MC3
  • polypeptide in a tumor in a subject comprising administering to the tumor tissue a pharmaceutical composition disclosed herein, wherein the pharmaceutical composition comprises a polynucleotide encoding the expressed polypeptide, and wherein the amount of expressed polypeptide in non-tumor tissue is decreased compared to the amount of expressed polypeptide in non-tumor tissue after administering a corresponding reference composition (e.g., MC3).
  • a pharmaceutical composition e.g., MC3
  • the non-tumoral tissue is liver tissue.
  • the present disclosure also provides a method to reduce or prevent the immune response caused by the intratumoral administration of a pharmaceutical composition, e.g., a pharmaceutical composition comprising lipids known in the art, by replacing one or all the lipids in such composition with a compound of Formula (I).
  • a pharmaceutical composition e.g., a pharmaceutical composition comprising lipids known in the art
  • a compound of Formula (I) for example, the immune response caused by the administration of a polynucleotide encoding an IL12B
  • polypeptide IL12A polypeptide, or both IL12B and IL12A polypeptides in a
  • composition comprising MC3 (or other lipids known in the art) can be prevented (avoided) or ameliorated by replacing MC3 with a compound of Formula (I), e.g., Compound 18.
  • MC3 or other lipids known in the art
  • a compound of Formula (I) e.g., Compound 18.
  • a pharmaceutical composition disclosed herein is not elevated compared to the immune response observed when the therapeutic agent or a polynucleotide encoding an IL12B polypeptide, IL12A polypeptide, or both IL12B and IL12A polypeptides is administered in phosphate buffered saline (PBS) or another physiological buffer solution (e.g., Ringer's solution, Tyrode's solution, Hank's balanced salt solution, etc.).
  • PBS phosphate buffered saline
  • another physiological buffer solution e.g., Ringer's solution, Tyrode's solution, Hank's balanced salt solution, etc.
  • the immune response observed after a therapeutic agent or a polynucleotide encoding an IL12B polypeptide, IL12A polypeptide, or both IL12B and IL12A polypeptides is administered in a pharmaceutical composition disclosed herein is not elevated compared to the immune response observed when PBS or another physiological buffer solution is administered alone.
  • no immune response is observed when a pharmaceutical composition disclosed herein is administered intratumorally to a subject.
  • the present disclosure also provides a method of delivering a
  • polypeptide, or both IL12B and IL12A polypeptides to a subject in need thereof, comprising administering intratumorally to the subject a pharmaceutical composition disclosed herein, wherein the immune response caused by the administration of the pharmaceutical composition is not elevated compared to the immune response caused by the intratumoral administration of
  • a corresponding reference composition i.e., the same pharmaceutical composition in which the compound of Formula (I) is substituted by another ionizable amino lipid, e.g., MC3.
  • the administration treats a cancer.
  • polynucleotide e.g., mRNA
  • the polynucleotide (e.g., mRNA) of the present disclosure can be administered in any route available, including, but not limited to, intratumoral, enteral, gastroenteral, epidural, oral, transdermal, epidural (peridural), intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal
  • intravenous intravenous
  • intramuscular into a muscle
  • intracardiac into the heart
  • intraosseous infusion into the bone marrow
  • intrathecal into the spinal canal
  • intraperitoneal infusion or injection into the peritoneum
  • intravesical infusion intravitreal, through the eye
  • intracavernous injection into the base of the penis
  • intravaginal administration intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), or in ear drops.
  • the mRNA of the present disclosure is administered parenterally (e.g., includes subcutaneous, intravenous, intraperitoneal, intratumoral, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques), intraventricularly, orally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir.
  • the polynucleotide, composition, or polypeptide is administered subcutaneously, intravenously,
  • the polynucleotide (e.g., mRNA) of the present disclosure is administered intratumorally.
  • the polynucleotide is delivered by a device comprising a pump, patch, drug reservoir, short needle device, single needle device, multiple needle device, micro-needle device, jet injection device, ballistic powder/particle delivery device, catheter, lumen, cryoprobe, cannula, microcanular, or devices utilizing heat, RF energy, electric current, or any combination thereof.
  • Other aspects of the present disclosure relate to transplantation of cells containing polynucleotides to a mammalian subject.
  • Administration of cells to mammalian subjects is known to those of ordinary skill in the art, and includes, but is not limited to, local implantation (e.g., topical or subcutaneous administration), organ delivery or systemic injection (e.g., intravenous injection or inhalation), and the formulation of cells in pharmaceutically acceptable carriers.
  • the polynucleotide e.g., mRNA
  • the administration of the polynucleotide, pharmaceutical composition or formulation of the disclosure results in expression of IL12 in cells of the subject.
  • administering the polynucleotide, pharmaceutical composition or formulation of the disclosure results in an increase of IL12 activity in the subject.
  • the polynucleotides of the present disclosure are used in methods of administering a composition or formulation comprising an mRNA encoding an IL12B polypeptide, IL12A polypeptide, and both IL12B and IL12A polypeptides to a subject, wherein the method results in an increase of IL12 activity in at least some cells of a subject.
  • compositions or formulations [0149] In some embodiments, the administration of a composition or formulation
  • IL12B polypeptide comprising an mRNA encoding an IL12B polypeptide, IL12A polypeptide, and both IL12B and IL12A polypeptides to a subject results in an increase of IL12 activity in cells subject to a level at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%), at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or to 100%) or more of the activity level expected in a normal subject.
  • inventions of the disclosure also provide a method of treating a cancer in a subject in need thereof comprising administering (e.g., intratumorally, intraperitoneally, or intravenously) a polynucleotide comprising an mRNA encoding an IL12B polypeptide, IL12A polypeptide, and both IL12B and IL12A polypeptides with one or more anticancer agents to the subject.
  • administering e.g., intratumorally, intraperitoneally, or intravenously
  • a polynucleotide comprising an mRNA encoding an IL12B polypeptide, IL12A polypeptide, and both IL12B and IL12A polypeptides with one or more anticancer agents to the subject.
  • the polynucleotides e.g., mRNA
  • IL12B polynucleotide encoding an IL12B
  • polypeptide, IL12A polypeptide, and both IL12B and IL12A polypeptides of the present disclosure can be used to reduce the size of a tumor or inhibit tumor growth in a subject in need thereof.
  • the tumor is associated with a disease, disorder, and/or condition.
  • the disease, disorder, and/or condition is a cancer.
  • the administration of the polynucleotide (e.g., mRNA) encoding an IL12B polypeptide, IL12A polypeptide, and both IL12B and IL12A polypeptides treats a cancer.
  • a "cancer” refers to a broad group of various diseases characterized by the
  • a "cancer” or “cancer tissue” can include a tumor at various stages.
  • the cancer or tumor is stage 0, such that, e.g., the cancer or tumor is very early in development and has not metastasized.
  • the cancer or tumor is stage I, such that, e.g., the cancer or tumor is relatively small in size, has not spread into nearby tissue, and has not metastasized.
  • the cancer or tumor is stage II or stage III, such that, e.g., the cancer or tumor is larger than in stage 0 or stage I, and it has grown into neighboring tissues but it has not metastasized, except potentially to the lymph nodes.
  • the cancer or tumor is stage IV, such that, e.g., the cancer or tumor has metastasized. Stage IV can also be referred to as advanced or metastatic cancer.
  • the cancer can include, but is not limited to, adrenal cortical cancer, advanced cancer, anal cancer, aplastic anemia, bileduct cancer, bladder cancer, bone cancer, bone metastasis, brain tumors, brain cancer, breast cancer, childhood cancer, cancer of unknown primary origin, Castleman disease, cervical cancer, colon/rectal cancer, endometrial cancer, esophagus cancer, Ewing family of tumors, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gestational trophoblastic disease, Hodgkin disease, Kaposi sarcoma, renal cell carcinoma, laryngeal and hypopharyngeal cancer, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic
  • myelomonocytic leukemia liver cancer, hepatocellular carcinoma (HCC), non-small cell lung cancer, small cell lung cancer, lung carcinoid tumor, lymphoma of the skin, malignant mesothelioma, multiple myeloma, myelodysplastic syndrome, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary tumors, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma in adult soft tissue, basal and squamous cell skin cancer, melanoma, small intestine cancer, stomach cancer, testicular cancer, throat cancer, thymus cancer, thyroid cancer, uterine sarcoma, vaginal cancer, vul
  • the tumor is a solid tumor.
  • a “solid tumor” includes, but is not limited to, sarcoma, melanoma, carcinoma, or other solid tumor cancer.
  • Sparcoma refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance.
  • Sarcomas include, but are not limited to, chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sar
  • melanoma refers to a tumor arising from the melanocytic system of the skin and other organs.
  • Melanomas include, for example, acra-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, metastatic melanoma, nodular melanoma, subungal melanoma, or superficial spreading melanoma.
  • carcinoma refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases.
  • exemplary carcinomas include, e.g., acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma
  • basocellulare basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatiniform carcinoma, gelatinous carcinoma, giant cell carcinoma, carcinoma gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair-matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma, Hurthle cell carcinoma, hyaline carcinoma, hypemephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's
  • Additional cancers that can be treated include, e.g., Leukemia, Hodgkin's Disease,
  • Non- Hodgkin's Lymphoma multiple myeloma, neuroblastoma, breast cancer, ovarian cancer, lung cancer, rhabdomyosarcoma, primary thrombocytosis, primary
  • macroglobulinemia small-cell lung tumors, primary brain tumors, stomach cancer, colon cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, papillary thyroid cancer, neuroblastoma, neuroendocrine cancer, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, adrenal cortical cancer, prostate cancer, Miillerian cancer, ovarian cancer, peritoneal cancer, fallopian tube cancer, or uterine papillary serous carcinoma.
  • the disclosure further includes a polynucleotide comprising an ORF (e.g.,
  • the polynucleotide encodes an IL-12 polypeptide, wherein the polynucleotide comprises an ORF encoding an IL12B polypeptide and an IL12A polypeptide or uses thereof as a combination therapy, i.e., with any other anti-cancer agent in combination.
  • the disclosure is directed to a polynucleotide comprising an mRNA encoding an IL12B polypeptide, IL12A polypeptide, or both IL12B and IL12A polypeptide in combination with one or more anti-cancer agents or uses of the
  • the combination therapy can be a combination of the polynucleotide encoding IL12 and one or more standard therapy.
  • the methods of the disclosure include two additional anti-cancer agents, three additional agents, four additional agents, etc.
  • the additional anti-cancer agents can be a protein, e.g., an antibody, or a polynucleotide, e.g., mRNA.
  • the one or more anticancer agents are an mRNA.
  • the one or more anti-cancer agents are an mRNA encoding a tumor antigen.
  • the one or more anticancer agents are not a tumor antigen or an mRNA encoding a tumor antigen.
  • the one or more anti-cancer agents are a protein, e.g., an antibody.
  • the one or more anti-cancer agents are an approved agent by the United States Food and Drug Administration. In other embodiments, the one or more anti-cancer agents are a pre-approved agent by the United States Food and Drug Administration.
  • IL12 IL12
  • any other agents e.g., an anti-PD-1 antibody, an anti-PD-Ll antibody, and/or an anti-CTLA-4 antibody, or OX40L as polynucleotides and/or proteins.
  • the present disclosure encompasses combination therapy of (i) a polynucleotide (e.g., mRNA) encoding IL12 and a protein comprising an anti-PD-1 antibody or an anti-PD-Ll antibody; (iii) a polynucleotide (e.g., mRNA) encoding IL12 and a second protein comprising an anti-CTLA-4 antibody, or (iv) a polynucleotide (e.g., mRNA) encoding IL12 and a second protein comprising OX40L.
  • the IL12 can also be administered as a protein.
  • the additional agents can be formulated together with the polynucleotide encoding IL12, e.g., mRNA, or separately. Moreover, even when formulated separately, the additional agents can be administered concurrently with the polynucleotide encoding IL12 or sequentially. In one embodiment, the polynucleotide encoding IL12 is administered prior to the second agent. In another embodiment, the polynucleotide encoding IL12 is administered after the second agent. [0164] In certain embodiments, the additional agents, e.g., any antibody disclosed herein or a polynucleotide encoding OX40L, are also administered intratumorally. In other embodiments, the second agents, e.g., any antibody disclosed herein or a polynucleotide encoding OX40L, are administered via different routes, e.g., intravenously,
  • the subject for the present methods or compositions has been treated with one or more standard of care therapies. In other aspects, the subject for the present methods or compositions has not been responsive to one or more standard of care therapies or anti-cancer therapies. In one aspect, the subject has been previously treated with an IL12 protein or an IL 12 DNA gene therapy. In another aspect, the subject is treated with an anti-PD-1 antagonist or an anti-CTLA-4 antagonist prior to the polynucleotide of the present disclosure.
  • the subject has been treated with a monoclonal antibody that binds to PD-1 prior to the polynucleotide of the present disclosure and/or a monoclonal antibody that binds to CTLA-4 prior to the polynucleotide of the present disclosure.
  • the subject has been treated with an anti-PD-1 monoclonal antibody and/or anti-CTLA-4 monoclonal antibody therapy prior to the polynucleotide of the present methods or compositions.
  • T cell regulation i.e., activation or inhibition is mediated via co-stimulatory or co- inhibitory signals. This interaction is exerted via ligand/receptor interaction.
  • T cells harbor a myriad of both activating receptors, such as OX40, and inhibitory receptors (i.e., immune checkpoints) such as programmed death receptor 1 (PD-1) or cytotoxic T lymphocyte-associated protein 4 (CTLA-4) (Mellman et al. 2011 Nature.;480:480-489).
  • PD-1 programmed death receptor 1
  • CTL-4 cytotoxic T lymphocyte-associated protein 4
  • the methods of reducing the size of a tumor or inhibiting growth of a tumor in a subject in need thereof comprise administering to the subject an effective amount of a composition comprising one or more polynucleotides.
  • the one or more polynucleotides encode an IL-12 polypeptide.
  • the one or more polynucleotides comprise an open reading frame ("ORF") encoding an IL12B polypeptide.
  • the one or more polynucleotides comprise an ORF encoding an IL12A polypeptide.
  • the one or more polynucleotides comprise an ORF encoding an IL12B polypeptide and an IL12A polypeptide.
  • the methods further comprise administering a second
  • the second agent comprises an effective amount of a composition comprising a polynucleotide comprising an ORF encoding a checkpoint inhibitor polypeptide. In some embodiments, the second agent comprises an effective amount of a composition comprising a checkpoint inhibitor polypeptide. In some embodiments, the checkpoint inhibitor is any checkpoint inhibitor known in the art or described herein. In some embodiments, the checkpoint inhibitor is an anti-PD-1 antibody. In other embodiments, the checkpoint inhibitor is an anti-PD-Ll antibody. In other embodiments, the checkpoint inhibitor is an anti-CTLA-4 antibody. In some embodiments, the second agent comprises an effective amount of a composition comprising a polynucleotide comprising an ORF encoding OX40L. In some
  • the checkpoint inhibitor is selected from the group consisting of an anti- PD-1 antibody, an anti-PD-Ll antibody, an anti-CTLA-4 antibody, a polynucleotide encoding OX40L any other agents disclosed herein, and any combination thereof.
  • the composition comprising a checkpoint inhibitor comprises more than one checkpoint inhibitor.
  • the method comprises administering (i) an mRNA, encoding an IL12B and/or IL12A polypeptide disclosed herein, and (ii) an anti-PD-Ll antibody, an anti-PD-1 antibody, anti-CTLA-4 antibody, a polynucleotide encoding OX40L, or any combination thereof.
  • the checkpoint inhibitor comprises an antigen binding fragment of an antibody.
  • the antibody is an anti-CTLA-4 antibody or antigen-binding fragment thereof that specifically binds CTLA-4, an anti-PD-1 antibody or antigen-binding fragment thereof that specifically binds PD-1, an anti-PD-Ll antibody or antigen-binding fragment thereof that specifically binds PD-L1, or a combination thereof.
  • the antibody is an anti-CTLA4 antibody or antigen-binding fragment thereof that specifically binds CTLA4.
  • the antibody is an anti-PD-1 antibody or antigen-binding fragment thereof that specifically binds PD-1.
  • the antibody is an anti-PD-Ll antibody or antigen-binding fragment thereof that specifically binds PD-Ll .
  • Immune checkpoint inhibitors such as pembrolizumab or nivolumab, which target the interaction between programmed death receptor 1/programmed death ligand 1 (PD- 1/PDL-l) and PDL-2, have been recently approved for the treatment of various malignancies and are currently being investigated in clinical trials for cancers including melanoma, head and neck squamous cell carcinoma (HNSCC). Data available from these trials indicate substantial activity accompanied by a favorable safety and toxicity profile in these patient populations.
  • HNSCC head and neck squamous cell carcinoma
  • checkpoint inhibitors have been tested in clinical trials for the
  • phase III clinical trials have revealed that therapies such as ipilimumab and pembrolizumab, which target the CTLA-4 and PD-1 immune checkpoints, respectively, have raised the three-year survival of patients with melanoma to ⁇ 70%, and overall survival (>5years) to ⁇ 30%.
  • the subject has been previously treated with a PD-1 antagonist prior to the polynucleotide of the present disclosure.
  • the subject has been treated with a monoclonal antibody that binds to PD-1 prior to the polynucleotide of the present disclosure.
  • the subject has been treated with an anti-PD-1 monoclonal antibody therapy prior to the polynucleotide of the present methods or compositions.
  • the anti-PD-1 monoclonal antibody therapy comprises nivolumab, pembrolizumab, pidilizumab, or any combination thereof.
  • the subject has been treated with a monoclonal antibody that binds to PD-L1 prior to the polynucleotide of the present disclosure.
  • the subject has been treated with an anti-PD-Ll monoclonal antibody therapy prior to the polynucleotide of the present methods or compositions.
  • the anti-PD-Ll monoclonal antibody therapy comprises durvalumab, avelumab, MEDI473, BMS-936559, aezolizumab, or any combination thereof.
  • the subject has been treated with a CTLA-4 antagonist prior to treatment with the compositions of present disclosure.
  • the subject has been previously treated with a monoclonal antibody that binds to CTLA-4 prior to the compositions of the present disclosure.
  • the subject has been treated with an anti-CTLA-4 monoclonal antibody prior to the polynucleotide of the present disclosure.
  • the anti-CTLA-4 antibody therapy comprises ipilimumab or tremelimumab.
  • the disclosure is directed to a method of treating cancer and/or a method of immunotherapy in a subject in need thereof comprising administering to the subject (e.g., intratumorally, intraperitoneally, or intravenously) the polynucleotide (e.g., RNA, e.g., mRNA) encoding an IL12 polypeptide in combination with a PD-L1 antagonist, e.g., an antibody or antigen-binding portion thereof that specifically binds to PD-L1, e.g., an anti-PD-Ll monoclonal antibody, e.g., an anti-PD-Ll monoclonal antibody comprises Durvalumab, Avelumab, MEDI473, BMS-936559, Atezolizumab, or any combination thereof.
  • the polynucleotide e.g., RNA, e.g., mRNA
  • a PD-L1 antagonist e.g., an antibody or antigen-bind
  • the anti-PD-Ll antibody useful for the disclosure is N-(2-PD-Ll antibody
  • MSB0010718C also called Avelumab; See US 2014/0341917) or BMS-936559
  • the anti-PD-Ll antibody is atezolizumab (also known as
  • the anti-PD-Ll antibody is MPDL3280A (also known as atezolizumab, TECENTRIQ ® , and RG7446) (see, e.g., Herbst et al. (2013) J Clin Oncol 3 l(suppl): 3000. Abstract; U.S. Patent No. 8,217, 149), MEDI4736 (also called Durvalumab; Khleif (2013) In: Proceedings from the European Cancer Congress 2013; September 27-October 1, 2013; Amsterdam, The Netherlands.
  • the disclosure is directed to a method of treating cancer and/or a method of immunotherapy in a subject in need thereof comprising administering to the subject (e.g., intratumorally, intraperitoneally, or intravenously) the polynucleotide (e.g., RNA, e.g., mRNA) encoding an IL12 polypeptide, in combination with a PD-1 antagonist, e.g., an antibody or antigen-binding portion thereof that specifically binds to PD-1, e.g., an anti-PD-1 monoclonal antibody.
  • the polynucleotide e.g., RNA, e.g., mRNA
  • a PD-1 antagonist e.g., an antibody or antigen-binding portion thereof that specifically binds to PD-1, e.g., an anti-PD-1 monoclonal antibody.
  • the anti-PD-1 antibody (or an antigen-binding portion
  • the anti-PD-1 antibody useful for the disclosure is N-PD-1 antibody
  • Nivolumab (also known as "OPDIVO ® "; formerly designated 5C4, BMS- 936558, MDX-1106, or ONO-4538) is a fully human IgG4 (S228P) PD-1 immune checkpoint inhibitor antibody that selectively prevents interaction with PD-1 ligands (PD- Ll and PD-L2), thereby blocking the down-regulation of antitumor T-cell functions (U.S. Patent No. 8,008,449; Wang et al, 2014 Cancer Immunol Res. 2(9):846-56).
  • Nivolumab has shown activity in a variety of advanced solid tumors including renal cell carcinoma (renal adenocarcinoma, or hypernephroma), melanoma, and non-small cell lung cancer (NSCLC) (Topalian et al., 2012a; Topalian et al., 2014; Drake et al., 2013; WO
  • renal cell carcinoma renal adenocarcinoma, or hypernephroma
  • NSCLC non-small cell lung cancer
  • the anti-PD-1 antibody is MEDI0680 (formerly AMP-514), which is a monoclonal antibody against the PD-1 receptor.
  • MEDI0680 is described, for example, in U.S. Patent No. 8,609,089B2 or in
  • the anti-PD-1 antibody is BGB-A317, which is a
  • BGB-A317 is described in U.S. Publ. No.
  • a PD-1 antagonist is AMP-224, which is a B7-DC Fc fusion protein.
  • AMP-224 is discussed in U.S. Publ. No. 2013/0017199 or in
  • the disclosure includes a method of treating cancer and/or a method of immunotherapy in a subject in need thereof comprising administering to the subject (e.g., intratumorally, intraperitoneally, or intravenously) the polynucleotide (e.g., RNA, e.g., mRNA) encoding an IL12 polypeptide together with an antibody or an antigen binding portion thereof that specifically binds to PD-1, e.g., an anti-PD-1 monoclonal antibody, e.g., an anti-PD-1 monoclonal antibody comprises Nivolumab, Pembrolizumab, Pidilizumab, or any combination thereof.
  • the polynucleotide e.g., RNA, e.g., mRNA
  • an antigen binding portion thereof that specifically binds to PD-1
  • an anti-PD-1 monoclonal antibody e.g., an anti-PD-1 monoclonal antibody comprises Nivolumab, Pembroli
  • the disclosure is directed to a method of treating cancer and/or a method of immunotherapy in a subject in need thereof comprising administering to the subject (e.g., intratumorally, intraperitoneally, or intravenously) the polynucleotide (e.g., RNA, e.g., mRNA) encoding an IL12 polypeptide in combination with a CTLA-4 antagonist, e.g., an antibody or antigen-binding portion thereof that specifically binds to CTLA-4, e.g., an anti-CTLA-4 monoclonal antibody, e.g., an anti-CTLA-4 monoclonal antibody comprises Ipilimumab or Tremelimumab, or any combination thereof.
  • the polynucleotide e.g., RNA, e.g., mRNA
  • CTLA-4 antagonist e.g., an antibody or antigen-binding portion thereof that specifically binds to CTLA-4, e.g., an anti-CT
  • An exemplary clinical anti-CTLA-4 antibody is the human mAb 10D1 (now
  • Tremelimumab also known as CP-675,206.
  • Tremelimumab is human IgG2 monoclonal anti-CTLA-4 antibody.
  • Tremelimumab is described in WO/2012/122444, U.S. Publ. No. 2012/263677, or WO Publ. No. 2007/113648 A2.
  • a first polynucleotide e.g. a first mRNA
  • a second polynucleotide e.g., a second mRNA
  • an OX40L polypeptide are administered in combination.
  • the first polynucleotide e.g. a first mRNA
  • the second polynucleotide e.g.
  • a second mRNA) encoding an OX40L polypeptide are administered in combination with an antibody or an antigen- binding portion thereof which specifically binds to CTLA-4, an antibody or antigen- binding portion thereof which specifically binds to a PD-1 receptor, or an antibody or antigen-binding portion thereof which specifically binds to a PD-L1 receptor.
  • a first polynucleotide e.g. a first mRNA
  • a second polynucleotide e.g.
  • a second mRNA) encoding an OX40L polypeptide are administered in combination with an antibody or an antigen-binding portion thereof that specifically binds to a PD-1 or PD-Ll receptor or a polynucleotide encoding the same.
  • a first polynucleotide e.g. a first mRNA encoding an
  • IL12 polypeptide and a second polynucleotide e.g. a second mRNA
  • a second polynucleotide e.g. a second mRNA
  • an antibody or an antigen- binding portion thereof that specifically binds to a CTLA-4 or a polynucleotide encoding the same.
  • a first polynucleotide e.g. a first mRNA encoding an
  • IL12 polypeptide and a second polynucleotide e.g. a second mRNA
  • a second polynucleotide e.g. a second mRNA
  • compositions disclosed herein comprise (i) a first polynucleotide (e.g. a first mRNA) encoding IL12 and (ii) a second polynucleotide (e.g. a second mRNA) encoding an antibody or an antigen binding portion thereof which specifically binds to CTLA-4 in a single formulation.
  • a first polynucleotide e.g. a first mRNA
  • a second polynucleotide e.g. a second mRNA
  • compositions disclosed herein comprise a
  • polynucleotide encoding IL12 and a polynucleotide encoding an OX40L protein in a single formulation are polynucleotide encoding IL12 and a polynucleotide encoding an OX40L protein in a single formulation.
  • OX40L was first identified on the surface of human lymphocytes infected with human T-cell leukemia virus type-I (HTLV-I) by Tanaka et al. (Tanaka et al., International Journal of Cancer (1985), 36(5):549-55).
  • OX40L is the ligand for OX40 (CD134).
  • CD252 cluster of differentiation 252
  • ligand tumor necrosis factor
  • member 4 tax-transcriptionally activated glycoprotein 1, TXGP1, or gp34.
  • Human OX40L is 183 amino acids in length and contains three domains: a cytoplasmic domain of amino acids 1 - 23; a transmembrane domain of amino acids 24 - 50, and an extracellular domain of amino acids 51 - 183.
  • a polynucleotide encoding OX40L that can be combined with the polynucleotide encoding IL12 comprises an mRNA encoding a mammalian OX40L polypeptide.
  • the mammalian OX40L polypeptide is a murine OX40L polypeptide.
  • the mammalian OX40L polypeptide is a human OX40L polypeptide.
  • the OX40L polypeptide comprises an amino acid sequence set forth in Table 1.
  • each polynucleotide of the disclosure comprises an mRNA, i.e., an mRNA encoding an IL12 polypeptide and an mRNA encoding an OX40L polypeptide.
  • the mRNA encoding an IL12 polypeptide encodes a mammalian IL12 polypeptide.
  • the mRNA encoding an OX40L polypeptide encodes a mammalian OX40L polypeptide.
  • the mRNA encoding an IL12 polypeptide encodes a murine IL12 polypeptide.
  • the mRNA encoding an OX40L polypeptide encodes a murine OX40L polypeptide. In some embodiments, the mRNA encoding an IL12 polypeptide encodes a human IL12 polypeptide. In some embodiments, the mRNA encoding an OX40L polypeptide encodes a human OX40L polypeptide.
  • the IL12 polypeptide comprises a human amino acid
  • the OX40L polypeptide comprises a human amino acid sequence set forth in Table 1.
  • the OX40L polypeptide comprises an amino acid sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%), at least 99%, or 100% identical to an amino acid sequence listed in Table 1 or an amino acid sequence encoded by a nucleotide sequence listed in Table 1, wherein the amino acid sequence is capable of binding to an OX40 receptor.
  • the OX40L polypeptide encoded by a polynucleotide of the disclosure comprises an amino acid sequence listed in Table 1 with one or more conservative substitutions, wherein the conservative substitutions do not significantly affect the binding activity of the OX40L polypeptide to its receptor, i.e., the OX40L polypeptide binds to the OX40 receptor after the substitutions.
  • a nucleotide sequence ⁇ i.e., mRNA) encoding an OX40L polypeptide comprises a sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to a nucleic acid sequence listed in Table 1.
  • a sequence is written in DNA form (containing thymidine) in the present application, the corresponding RNA sequence would contain uridine instead of thymidine.
  • the polynucleotide (e.g., mRNA) useful for the methods and compositions comprises an open reading frame encoding an extracellular domain of OX40L.
  • the polynucleotide (e.g., mRNA) comprises an open reading frame encoding a cytoplasmic domain of OX40L.
  • the polynucleotide (e.g., mRNA) comprises an open reading frame encoding a
  • the polynucleotide (e.g., mRNA) comprises an open reading frame encoding an extracellular domain of OX40L and a transmembrane of OX40L.
  • the polynucleotide (e.g., mRNA) comprises an open reading frame encoding an extracellular domain of OX40L and a cytoplasmic domain of OX40L.
  • the polynucleotide (e.g., mRNA) comprises an open reading frame encoding an extracellular domain of OX40L, a transmembrane of OX40L, and a cytoplasmic domain of OX40L.
  • Table 1 presents, e.g., precursor and mature sequences for OX40L as well as constructs comprising the OX40L sequences. Furthermore, a construct comprising a polynucleotide encoding OX40L and further comprising components such 3 ' UTR and 5' UTR would be considered an OX40L encoding polynucleotide.
  • a person of skill in the art would understand that in addition to the native signal sequences and propeptide sequences disclosed in Table 1 (sequences present in the precursor for and absent in the mature corresponding form) and the non-native signal peptide disclosed in Table 1, other signal sequences can be used.
  • references to an OX40L polypeptide or polynucleotide according to Table 1 encompass variants in which an alternative signal peptide (or encoding sequence) known in the art has been attached to the OX40L polypeptide (or polynucleotide). It is also understood that references to the sequences disclosed in Table 1 through the application are equally applicable and encompass orthologs and functional variants (for example polymorphic variants) and isoforms of those sequences known in the art at the time the application was filed.
  • OX40L member 4 LQVSHRYPRIQS I KVQFTEYKKEKGFI LTSQKEDEIMKVQNNSVI INCD
  • NTFSF4 isoform 1 GFYLI SLKGYFSQE I SLHYQKDEEPLFQLKKVRS SLMVASLTYKD
  • TNFSF4 ORF ACUU C C CAAAAG GAG GAU GAAAU CAU GAAG GU G SEQ ID NO: 1
  • CAGT T AC CAGAT GT GAGGAT GGGCAACTATT CAT C AG C T C AT AC AAGAA T GAGTAT CAAACTAT GGAGGT GCAGAACAATT CGGTT GT CAT CAAGTGC
  • CAGAACAAUU CU GUUAU CAU CAACU GU GAC GGA
  • IL12 (also shown as IL-12) is a pleiotropic cytokine, the actions of which create an interconnection between innate and adaptive immunity. IL12 functions primarily as a 70 kDa heterodimeric protein consisting of two disulfide-linked p35 and p40 subunits.
  • the precursor form of the IL12 p40 subunit ( M_002187; P29460; also referred to as IL12B, natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2) is 328 amino acids in length, while its mature form is 306 amino acids long.
  • the precursor form of the IL12 p35 subunit ( M_000882; P29459; also referred to as IL12A, natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1) is 219 amino acids in length and the mature form is 197 amino acids long.
  • the genes for the IL12 p35 and p40 subunits reside on different chromosomes and are regulated independently of each other. Gately, MK et al., Annu Rev Immunol. 16: 495-521 (1998). Many different immune cells ⁇ e.g., dendritic cells, macrophages, monocytes, neutrophils, and B cells) produce IL12 upon antigenic stimuli.
  • the active IL12 heterodimer is formed following protein synthesis. Id.
  • IL12 is composed of a bundle of four alpha helices. It is a heterodimeric cytokine encoded by two separate genes, IL12A (p35) and IL12B (p40). The active heterodimer (referred to as ' ⁇ 70'), and a homodimer of p40 are formed following protein synthesis.
  • the IL12 polypeptide of the present disclosure comprises a single polypeptide chain comprising the IL12B and IL12A fused directly or by a linker.
  • the IL12 polypeptide of the present disclosure comprises two polypeptides, the first polypeptide comprising IL12B and the second polypeptide comprising IL12A.
  • the disclosure provides an IL12A polypeptide and an IL12B polypeptide, wherein the IL12A and IL12B polypeptides are on the same chain or different chains.
  • the IL12A or IL12B polypeptide of the disclosure is a variant, a peptide or a polypeptide containing a substitution, and insertion and/or an addition, a deletion and/or a covalent modification with respect to a wild-type IL12A or IL12B sequence.
  • sequence tags such as epitope tags, e.g., a V5 tag
  • amino acids can be added to the sequences encoded by the polynucleotides of the disclosure ⁇ e.g., at the N-terminal or C-terminal ends), e.g., for localization.
  • amino acid residues located at the carboxy, amino terminal, or internal regions of a polypeptide of the disclosure can optionally be deleted providing for fragments.
  • polynucleotide of the disclosure ⁇ e.g., a RNA, e.g., an mRNA
  • a substitutional variant of an IL12A and/or IL12B sequence which can comprise one, two, three or more than three substitutions.
  • the substitutional variant can comprise one or more conservative amino acids substitutions.
  • the variant is an insertional variant.
  • the variant is a deletional variant.
  • polynucleotide ⁇ e.g., a RNA, e.g., an mRNA
  • a linker fusing the IL12A and IL12B polypeptides.
  • linkers are disclosed elsewhere herein.
  • Some aspects of the present disclosure are directed to a lipid nanoparticle comprising a polynucleotide (e.g., mRNA) encoding a human IL12 polypeptide, wherein the polynucleotide comprises an ORF encoding a human IL12B polypeptide operably linked to a human IL12A polypeptide.
  • the IL12B polypeptide is operably linked to the IL12A polypeptide by a peptide linker. In some embodiments, the IL12B polypeptide is located at the 5' terminus of the IL12A polypeptide or the peptide linker. In other embodiments, the IL12A polypeptide is located at the 5' terminus of the IL12B polypeptide or the peptide linker.
  • IL12 polypeptides of the disclosure are also considered to be within the scope of the IL12 polypeptides of the disclosure.
  • Nonlimiting examples of polypeptides encoded by the polynucleotides of the disclosure are shown in FIGs. 1 to 2.
  • Table 2 shows the correlating amino acid numbering in SEQ ID NOs, nucleotide numbering in SEQ ID NOs, and the 5' UTR, IL12B signal peptide, mature IL12A and IL12B peptides, and linker.
  • the disclosure provides polynucleotides (e.g., a RNA, e.g., an mRNA) that comprise a nucleotide sequence (e.g., an ORF, e.g., mRNA) encoding one or more IL12 polypeptides.
  • a nucleotide sequence e.g., an ORF, e.g., mRNA
  • the polynucleotides encode an IL-12 polypeptide, wherein the polynucleotides comprise a single ORF encoding an IL12B polypeptide and an IL12A polypeptide.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure encodes a single IL12 polypeptide chain comprising an IL12B polypeptide and an IL12A polypeptide, which are fused directly or by a linker, wherein the IL12B polypeptide is selected from the group consisting of: (i) the full-length IL12B polypeptide (e.g., having the same or essentially the same length as wild-type IL12B); (ii) a functional fragment of the full-length IL12B polypeptide (e.g., a truncated (e.g., deletion of carboxy, amino terminal, or internal regions) sequence shorter than an IL12B wild-type; but still retaining IL12B enzymatic activity);
  • the full-length IL12B polypeptide e.g., having the same or essentially the same length as wild-type IL12B
  • a variant thereof e.g., full length or truncated IL12B proteins in which one or more amino acids have been replaced, e.g., variants that retain all or most of the IL12B activity of the polypeptide with respect to the wild type IL12B polypeptide (such as, e.g., V33I, V298F, or any other natural or artificial variants known in the art); and
  • a fusion protein comprising (i) a full length IL12B wild-type, a functional
  • IL12A polypeptide is selected from the group consisting of:
  • IL12A polypeptide e.g., a truncated (e.g., deletion of carboxy, amino terminal, or internal regions) sequence shorter than an IL12A wild-type; but still retaining IL12A enzymatic activity;
  • a variant thereof e.g., full length or truncated IL12A proteins in which one or more amino acids have been replaced, e.g., variants that retain all or most of the IL12A activity of the polypeptide with respect to the wtIL12A polypeptide (such as natural or artificial variants known in the art); and
  • a fusion protein comprising (i) a full length IL12A wild-type, a functional
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure encodes two polypeptide chains, the first chain comprising an IL12B polypeptide and the second chain comprising an IL12A polypeptide, wherein the IL12B polypeptide is selected from the group consisting of:
  • a functional fragment of any of the mature IL12B polypeptide e.g., a truncated (e.g., deletion of carboxy, amino terminal, or internal regions) sequence shorter than an IL12B wild-type; but still retaining IL12B enzymatic activity
  • a variant thereof e.g., full length, mature, or truncated IL12B proteins in which one or more amino acids have been replaced, e.g., variants that retain all or most of the IL12B activity of the polypeptide with respect to the wild type IL12B polypeptide (such as, e.g., V33I, V298F, or any other natural or artificial variants known in the art); and
  • a fusion protein comprising (i) a mature IL12B wild-type, a functional fragment or a variant thereof, with or without a signal peptide and (ii) a heterologous protein;
  • IL12A is selected from the group consisting of:
  • IL12A polypeptide e.g., a truncated (e.g., deletion of carboxy, amino terminal, or internal regions) sequence shorter than an IL12A wild-type; but still retaining IL12A enzymatic activity;
  • a variant thereof e.g., full length, mature, or truncated IL12A proteins in which one or more amino acids have been replaced, e.g., variants that retain all or most of the IL12A activity of the polypeptide with respect to a reference isoform (such as natural or artificial variants known in the art); and
  • a fusion protein comprising (i) a mature IL12A wild-type, a functional fragment or a variant thereof, with or without a signal peptide and (ii) a heterologous protein.
  • the polynucleotide e.g., a RNA, e.g., an mRNA
  • the polynucleotide of the disclosure encodes a mammalian IL12 polypeptide, such as a human IL12 polypeptide, a functional fragment or a variant thereof.
  • the polynucleotide e.g., a RNA, e.g., an mRNA
  • the polynucleotide is introduced to the cells in vitro. In some embodiments, the polynucleotide is introduced to the cells in vivo.
  • the polynucleotides ⁇ e.g., a RNA, e.g., an mRNA) of the disclosure comprise a nucleotide sequence ⁇ e.g., an ORF) that encodes a wild-type human IL12B and/or IL12A, (see FIG. 1).
  • the polynucleotide ⁇ e.g., a RNA, e.g., an mRNA) of the disclosure comprises a codon optimized nucleic acid sequence, wherein the open reading frame (ORF) of the codon optimized nucleic sequence is derived from a wild-type IL12A and/or IL12B sequence.
  • ORF open reading frame
  • the polynucleotides ⁇ e.g., a RNA, e.g., an mRNA) of the disclosure comprise a nucleotide sequence encoding IL12B and/or IL12A having the full length sequence of human IL12B and/or IL12A (i.e., including the initiator methionine and the signal peptides).
  • the initiator methionine and/or signal peptides can be removed to yield a "mature IL12B" and/or "mature IL12A" comprising amino acid residues of SEQ ID NO: 1 and SEQ ID NO: 3, respectively.
  • SEQ ID NO: 1 corresponds to amino acids 23 to 328 of SEQ ID NO: 48
  • SEQ ID NO: 3 corresponds to amino acids 336 to 532 of SEQ ID NO: 48, respectively.
  • the teachings of the present disclosure directed to the full sequence of human IL12B and/or IL12A are also applicable to the mature form of human IL12B and/or IL12A lacking the initiator methionine and/or the signal peptide.
  • the polynucleotides (e.g., a RNA, e.g., an mRNA) of the disclosure comprise a nucleotide sequence encoding IL12B and/or IL12A having the mature sequence of human IL12B and/or IL12A.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprising a nucleotide sequence encoding IL12B and/or IL12A is sequence optimized.
  • the polynucleotides e.g., a RNA, e.g., an mRNA
  • the polynucleotides of the disclosure comprise a nucleotide sequence (e.g., an ORF) encoding a mutant IL12B and/or IL12A polypeptide.
  • the polynucleotides of the disclosure comprise an ORF encoding an IL12B and/or IL12A polypeptide that comprises at least one point mutation, at least two point mutations, at least three mutations, at least four mutations, at least five mutations, at least six mutations, at least seven mutations, at least eight mutations, at least nine mutations, or at least ten mutations in the IL12B and/or IL12A sequence and retains IL12B and/or IL12A enzymatic activity.
  • an ORF encoding an IL12B and/or IL12A polypeptide that comprises at least one point mutation, at least two point mutations, at least three mutations, at least four mutations, at least five mutations, at least six mutations, at least seven mutations, at least eight mutations, at least nine mutations, or at least ten mutations in the IL12B and/or IL12A sequence and retains IL12B and/or IL12A enzymatic activity.
  • the mutant IL12B and/or IL12A polypeptide has an IL12B and/or IL12A activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%>, at least 35%), at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the IL12B and/or IL12A activity of the corresponding wild-type IL12B and/or IL12A (i.e., the same IL12B and/or IL12A but without the mutation(s)).
  • IL12B and/or IL12A activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%>, at least 35%), at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%,
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprising an ORF encoding a mutant IL12B and/or IL12A polypeptide is sequence optimized.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a nucleotide sequence (e.g., an ORF) that encodes an IL12B and/or IL12A polypeptide with mutations that do not alter IL12B and/or IL12A enzymatic activity.
  • a mutant IL12B and/or IL12A polypeptides can be referred to as function- neutral.
  • the polynucleotide comprises an ORF that encodes a mutant IL12B and/or IL12A polypeptide comprising one or more function-neutral point mutations.
  • the mutant IL12B and/or IL12A polypeptide has higher
  • the mutant IL12B and/or IL12A polypeptide has an IL12B and/or IL12A activity that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%), or at least 100% higher than the activity of the corresponding wild-type IL12B and/or IL12A (i.e., the same IL12B and/or IL12A but without the mutation(s)).
  • the polynucleotides e.g., a RNA, e.g., an mRNA
  • the polynucleotides of the disclosure comprise a nucleotide sequence (e.g., an ORF) encoding a functional IL12B and/or IL12A fragment, e.g., where one or more fragments correspond to a polypeptide subsequence of a wild type IL12B and/or IL12A polypeptide and retain IL12B and/or IL12A enzymatic activity.
  • the IL12B and/or IL12A fragment has an IL12B and/or IL12A activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%), at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%), at least 95%, or at least 100% of the IL12 activity of the corresponding full length IL12B and/or IL12A.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprising an ORF encoding a functional IL12B and/or IL12A fragment is sequence optimized.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a nucleotide sequence (e.g., an ORF) encoding an IL12B and/or IL12A fragment that has higher IL12B and/or IL12A enzymatic activity than the corresponding full length IL12B and/or IL12A.
  • a nucleotide sequence e.g., an ORF
  • the IL12B and/or IL12A fragment has an IL12B and/or IL12A activity which is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%), at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%), at least about 85%, at least about 90%, at least about 95%, or about 100% higher than the IL12B and/or IL12A activity of the corresponding full length IL12B and/or IL 12 A.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a nucleotide sequence (e.g., an ORF) encoding an IL12B and/or IL12A fragment that is at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25% shorter than wild-type IL12B and/or IL12A.
  • a nucleotide sequence e.g., an ORF
  • the polynucleotide e.g., a RNA, e.g., an mRNA
  • the polynucleotide of the disclosure comprises a nucleotide sequence (e.g., an ORF) encoding an IL12B
  • polypeptide which has:
  • (x) at least about 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 67-984 of hIL12AB_016, hIL12AB_035, or
  • (xi) at least about 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 67-984 of hIL12AB_011, hIL12AB_028, or hIL12AB_033;
  • nucleotides 67-984 of hIL12AB_020 are nucleotides 67-984 of hIL12AB_020; or
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a nucleotide sequence (e.g., an ORF) encoding an IL12A
  • polypeptide which has:
  • (xii) at least about 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_021, hIL12AB_024,
  • hIL12AB_032 hIL12AB_033, hIL12AB_037, or hIL12AB_022;
  • (xiii) at least about 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_020, ML12AB 026, or hIL12AB_038;
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a single ORF encoding IL12B and IL12A, wherein the ORF comprises a sequence that has:
  • (x) at least about 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 67-984 of hIL12AB_016, hIL12AB_035, or
  • (xi) at least about 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 67-984 of hIL12AB_011, hIL12AB_028, or hIL12AB_033;
  • nucleotides 67-984 of hIL12AB_020 are nucleotides 67-984 of hIL12AB_020; or
  • (x) at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_039 or hIL12AB_040;
  • (xii) at least about 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_021, hIL12AB_024,
  • (xiii) at least about 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_020, ML12AB 026, or hIL12AB_038;
  • (xiv) at least about 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_015, hIL12AB_011, or hIL12AB_028; or
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a first ORF encoding IL12B and a second ORF encoding IL12A or , wherein the first ORF comprises a sequence that has:
  • sequence identity to nucleotides 67-984 of hIL12AB_021, ML12AB 023, hIL12AB_025, ML12AB 026, hIL12AB_027, hIL12AB_029, ML12AB 030, hIL12AB_034, ML12AB 039, or hIL12AB_040; (x) at least about 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 67-984 of hIL12AB_016, hIL12AB_035, or
  • (xi) at least about 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 67-984 of ML12AB 011, ML12AB 028, or ML12AB 033;
  • (xii) at least about 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 67-984 of ML12AB 015;
  • nucleotides 67-984 of hIL12AB_020 are nucleotides 67-984 of hIL12AB_020; or
  • (x) at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_039 or hIL12AB_040;
  • (xii) at least about 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_021, hIL12AB_024, hIL12AB_032, hIL12AB_033, hIL12AB_037, or hIL12AB_022;
  • (xiii) at least about 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1006-1596 of hIL12AB_020, ML12AB 026, or hIL12AB_038;
  • the polynucleotide sequence comprises an ORF comprising the sequence set forth as hIL12AB_002 (SEQ ID NO: 6) or a nucleotide sequence at least about 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to ML12AB 002 (SEQ ID NO: 6).
  • the first nucleotide sequence (e.g,. first ORF) encoding the
  • IL12B polypeptide and the second nucleotide sequence (e.g., second ORF) encoding the IL12A polypeptide are fused directly or by a linker.
  • first nucleotide sequence (e.g,. first ORF) encoding the IL12B polypeptide and the second nucleotide sequence (e.g., second ORF) encoding the IL12A polypeptide are not fused to each other.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a nucleotide sequence (e.g., an ORF) encoding an IL12B-IL12A fusion polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the nucleotide sequence has at least about 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 5 to 44. See Table 4.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a nucleotide sequence (e.g., an ORF) encoding an IL12B-IL12A fusion polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the nucleotide sequence has 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 70% to 95%, 80% to 95%, 70% to 85%, 75% to 90%, 80% to 95%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%, sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 5 to 44. See Table 4.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises from about 900 to about 100,000 nucleotides (e.g., from 900 to 1,000, from 900 to 1, 100, from 900 to 1,200, from 900 to 1,300, from 900 to 1,400, from 900 to 1,500, from 1,000 to 1, 100, from 1,000 to 1, 100, from 1,000 to 1,200, from 1,000 to 1,300, from 1,000 to 1,400, from 1,000 to 1,500, from 1,083 to 1,200, from 1,083 to 1,400, from 1,083 to 1,600, from 1,083 to 1,800, from 1,083 to 2,000, from 1,083 to 3,000, from 1,083 to 5,000, from 1,083 to 7,000, from 1,083 to 10,000, from 1,083 to 25,000, from 1,083 to 50,000, from 1,083 to 70,000, or from 1,083 to 100,000).
  • nucleotides e.g., from 900 to 1,000, from 900
  • the polynucleotide of the disclosure (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) encoding an IL12B-IL12A fusion polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the length of the nucleotide sequence (e.g., an ORF) is at least 500 nucleotides in length (e.g., at least or greater than about 500, 600, 700, 80, 900, 1,000, 1,050, 1,083, 1, 100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2, 100, 2,200, 2,300, 2,400, 2,500, 2,600, 2,700, 2,800, 2,900, 3,000, 3, 100, 3,200, 3,300, 3,400, 3,500, 3,600, 3,700, 3,800, 3,900, 4,000, 4, 100,
  • the polynucleotide of the disclosure (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) encoding an IL12B and/or IL12A polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof) further comprises at least one nucleic acid sequence that is noncoding, e.g., a miRNA binding site.
  • the polynucleotide of the disclosure e.g., a RNA, e.g., an mRNA
  • a nucleotide sequence e.g., an ORF
  • IL12B and/or IL12A polypeptide that is single stranded or double stranded.
  • the polynucleotide of the disclosure comprising a
  • nucleotide sequence e.g., an ORF
  • IL12B and/or IL12A polypeptide e.g., the wild-type sequence, functional fragment, or variant thereof
  • DNA or RNA is DNA or RNA.
  • the polynucleotide of the disclosure is RNA.
  • the polynucleotide of the disclosure is, or functions as, a messenger RNA (mRNA).
  • mRNA messenger RNA
  • the mRNA comprises a nucleotide sequence (e.g., an ORF) that encodes at least one IL12B and/or IL12A polypeptide, and is capable of being translated to produce the encoded IL12B and/or IL12A polypeptide in vitro, in vivo, in situ or ex vivo.
  • a nucleotide sequence e.g., an ORF
  • the polynucleotide of the disclosure (e.g., a RNA, e.g., an mRNA) comprises a sequence-optimized nucleotide sequence (e.g., an ORF) encoding an IL12B and/or IL12A polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the polynucleotide comprises at least one chemically modified nucleobase, e.g., 5-methoxyuracil.
  • the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miR-122.
  • the polynucleotide disclosed herein is formulated with a delivery agent, e.g., a compound having Formula (I), e.g., any of Compounds 1-147 or any of Compounds 1-232.
  • the polynucleotides e.g., a RNA, e.g., an mRNA
  • the polynucleotides of the disclosure can also comprise nucleotide sequences that encode additional features that facilitate trafficking of the encoded polypeptides to therapeutically relevant sites.
  • One such feature that aids in protein trafficking is the signal sequence, or targeting sequence.
  • the peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) that encodes a signal peptide operably linked a nucleotide sequence that encodes an IL12B and/or IL12A polypeptide described herein.
  • a nucleotide sequence e.g., an ORF
  • the "signal sequence” or “signal peptide” is a
  • polynucleotide or polypeptide respectively, which is from about 9 to 200 nucleotides (3- 70 amino acids) in length that, optionally, is incorporated at the 5' (or N-terminus) of the coding region or the polypeptide, respectively. Addition of these sequences results in trafficking the encoded polypeptide to a desired site, such as the endoplasmic reticulum or the mitochondria through one or more targeting pathways. Some signal peptides are cleaved from the protein, for example by a signal peptidase after the proteins are transported to the desired site.
  • the polynucleotide of the disclosure comprises a nucleotide sequence encoding an IL12B and/or IL12A polypeptide, wherein the nucleotide sequence further comprises a 5' nucleic acid sequence encoding a native signal peptide.
  • the polynucleotide of the disclosure comprises a nucleotide sequence encoding an IL12B and/or IL12A polypeptide, wherein the nucleotide sequence lacks the nucleic acid sequence encoding a native signal peptide.
  • the polynucleotide of the disclosure comprises a nucleotide sequence encoding an IL12B and/or IL12A polypeptide, wherein the nucleotide sequence further comprises a 5' nucleic acid sequence encoding a heterologous signal peptide.
  • the polynucleotide further comprises a nucleic acid
  • the first ORF comprises a nucleic acid sequence encoding a signal peptide.
  • the signal peptide is a human IL12B signal peptide.
  • the signal peptide comprises a sequence at least about
  • the polynucleotide of the disclosure e.g., a RNA, e.g., an mRNA
  • polynucleotides of the disclosure comprise a single ORF encoding an IL12B and/or IL12A polypeptide, a functional fragment, or a variant thereof.
  • the polynucleotide of the disclosure e.g., a RNA, e.g., an mRNA
  • polynucleotides of the disclosure comprise a single ORF encoding an IL12B and/or IL12A polypeptide, a functional fragment, or a variant thereof.
  • polynucleotide of the disclosure can comprise more than one nucleotide sequence, for example, a first nucleotide sequence encoding an IL12B polypeptide (a first polypeptide of interest), a functional fragment, or a variant thereof, a second nucleotide sequence encoding an IL12A polypeptide (a second polypeptide of interest), a functional fragment, or a variant thereof, and a third nucleotide sequence expressing a third polypeptide of interest (e.g., a polypeptide heterologous to IL12).
  • the third polypeptide of interest can be fused to the IL12B polypeptide directly or by a linker.
  • the third polypeptide of interest can be fused to the IL12A polypeptide directly or by a linker. In other embodiments, the third polypeptide of interest can be fused to both the IL12B polypeptide and the IL12A polypeptide directly or by a linker.
  • the polynucleotide of the disclosure can comprise more than three nucleotide sequences, for example, a first nucleotide sequence encoding an IL12B polypeptide (a first polypeptide of interest), a functional fragment, or a variant thereof, a second nucleotide sequence encoding an IL12A polypeptide (a second polypeptide of interest), a functional fragment, or a variant thereof, a third nucleotide sequence expressing a third polypeptide of interest, and a fourth nucleotide sequence expressing a fourth polypeptide of interest.
  • the third polypeptide of interest is fused to the IL12A polypeptide directly or by a linker
  • the fourth polypeptide of interest is fused to the IL12B polypeptide directly or by a linker.
  • two or more polypeptides of interest can be genetically fused, i.e., two or more polypeptides can be encoded by the same nucleotide sequence.
  • the polynucleotide can comprise a nucleic acid sequence encoding a linker (e.g., a G 4 S peptide linker or another linker known in the art) between two or more polypeptides of interest.
  • a linker e.g., a G 4 S peptide linker or another linker known in the art
  • a polynucleotide of the disclosure e.g., a RNA, e.g., an mRNA
  • the polynucleotide of the disclosure e.g., a RNA, e.g., an mRNA
  • a first nucleic acid sequence e.g., a first ORF
  • a second nucleic acid sequence e.g., a second ORF
  • the IL12B and/or IL12A can be fused directly or by a linker. In other embodiments, the IL12B and/or IL12A can be fused directly to by a linker to a heterologous polypeptide.
  • the linkers suitable for fusing the IL12B to IL12A or the IL12B and/or IL12A to a heterologous polypeptide can be a polypeptide (or peptide) moiety or a non-polypeptide moiety.
  • Some aspects of the present disclosure are directed to a lipid nanoparticle
  • the IL12B polypeptide is operably linked to the IL12A polypeptide by a peptide linker.
  • the IL12B polypeptide is located at the 5' terminus of the IL12A polypeptide or the peptide linker. In other embodiments, the IL12A polypeptide is located at the 5' terminus of the IL12B polypeptide or the peptide linker.
  • the linker is a peptide linker, including from one amino acid to about 200 amino acids.
  • the linker comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, or at least 40 amino acids.
  • the linker can be GS (Gly/Ser) linkers, for example,
  • the Gly/Ser linker comprises (G n S) m (SEQ ID NO: 203), wherein n is 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 and m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20.
  • the GS linker can comprise (GGGGS) 0 (SEQ ID NO: 204), wherein o is an integer from 1 to 5.
  • the GS linker can comprise
  • the Gly/Ser linker comprises (G n S) m , wherein n is 6 and m is 1.
  • the linker suitable for the disclosure can be a Gly-rich linker, for example, comprising (Gly) p (SEQ ID NO: 208), wherein p is an integer from 1 to 40.
  • a Gly-rich linker can comprise GGGGG, GGGGGG, GGGGGGG or GGGGGGGG.
  • the linker suitable for the disclosure can comprise
  • the linker suitable for the disclosure can comprise (EAAAK) 3 .
  • linkers include, but not limited to, GGGGSLVPRGSGGGGS
  • GSGSGS SEQ ID NO: 21 1
  • GGGGSLVPRGSGGGG SEQ ID NO: 212
  • GGSGGHMGSGG SEQ ID NO: 213
  • GGSGGSGGSGG SEQ ID NO: 214
  • GGSGG SEQ ID NO: 215
  • GSGSGSGS SEQ ID NO: 216
  • GGGSEGGGSEGGGSEGGG (SEQ ID NO: 217), AAGAATAA (SEQ ID NO: 218), GGSSG (SEQ ID NO: 219), GSGGGTGGGSG (SEQ ID NO: 220), GSGSGSGSGGSG (SEQ ID NO: 221), GSGGSGSGGSGGSG (SEQ ID NO: 222), and
  • the nucleotides encoding the linkers can be constructed to fuse the nucleotide sequences of the present disclosure. Based on the RNA sequences provided, a person of ordinary skill in the art would understand the corresponding DNA sequence (e.g., conversion of uracil to thymine). Likewise, based on the DNA sequences provided, a person of ordinary skill in the art would understand the corresponding RNA sequence (e.g., conversion of thymine to uracil).
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure is sequence optimized.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the disclosure comprises a nucleotide sequence (e.g., an ORF) encoding an IL12B and/or IL12A polypeptide, a nucleotide sequence (e.g., an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, a miRNA, a nucleotide sequence encoding a linker, or any combination thereof that is sequence optimized.
  • a sequence-optimized nucleotide sequence e.g., an codon-optimized mRNA
  • sequence encoding an IL12B and/or IL12A polypeptide is a sequence comprising at least one synonymous nucleobase substitution with respect to a reference sequence (e.g., a wild type nucleotide sequence encoding an IL12B and/or IL12A polypeptide).
  • a sequence-optimized nucleotide sequence can be partially or completely
  • a reference sequence encoding polyserine uniformly encoded by TCT codons can be sequence-optimized by having 100% of its nucleobases substituted (for each codon, T in position 1 replaced by A, C in position 2 replaced by G, and T in position 3 replaced by C) to yield a sequence encoding polyserine which would be uniformly encoded by AGC codons.
  • the percentage of sequence identity obtained from a global pairwise alignment between the reference polyserine nucleic acid sequence and the sequence-optimized polyserine nucleic acid sequence would be 0%.
  • the protein products from both sequences would be 100% identical.
  • sequence optimization also sometimes referred to codon optimization
  • results can include, e.g., matching codon frequencies in certain tissue targets and/or host organisms to ensure proper folding;
  • tandem repeat codons or base runs that can impair gene construction or expression; customizing transcriptional and translational control regions; inserting or removing protein trafficking sequences; removing/adding post translation modification sites in an encoded protein (e.g., glycosylation sites); adding, removing or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting translational rates to allow the various domains of the protein to fold properly; and/or reducing or eliminating problem secondary structures within the polynucleotide.
  • Sequence optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life
  • Codon options for each amino acid are given in Table 3.
  • a polynucleotide e.g., a RNA, e.g., an mRNA
  • a RNA e.g., an mRNA
  • sequence-optimized nucleotide sequence e.g., an ORF
  • a sequence-optimized nucleotide sequence e.g., an ORF
  • the IL12B and/or IL12A polypeptide, functional fragment, or a variant thereof encoded by the sequence-optimized nucleotide sequence has improved properties (e.g., compared to an IL12B and/or IL12A polypeptide, functional fragment, or a variant thereof encoded by a reference nucleotide sequence that is not sequence optimized), e.g., improved properties related to expression efficacy after administration in vivo.
  • Such properties include, but are not limited to, improving nucleic acid stability (e.g., mRNA stability), increasing translation efficacy in the target tissue, reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and/or decreasing protein aggregation.
  • nucleic acid stability e.g., mRNA stability
  • increasing translation efficacy in the target tissue reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and/or decreasing protein aggregation.
  • the sequence-optimized nucleotide sequence is codon optimized for expression in human subjects, having structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and/or protein concentrations; optimizing protein localization; and avoiding deleterious bio-responses such as the immune response and/or degradation pathways.
  • the polynucleotides of the disclosure comprise a nucleotide sequence (e.g., a nucleotide sequence (e.g., an ORF) encoding an IL12B and/or IL12A polypeptide, a nucleotide sequence (e.g., an ORF) encoding an additional polypeptide of interest, a 5'-UTR, a 3'-UTR, a microRNA, a nucleic acid sequence encoding a linker, or any combination thereof) that is sequence-optimized according to a method comprising:
  • sequence-optimized nucleotide sequence e.g., an ORF encoding an IL12B and/or IL12A polypeptide
  • the sequence optimization method is multiparametric and comprises one, two, three, four, or more methods disclosed herein and/or other optimization methods known in the art.
  • regions of the polynucleotide can be encoded by or within regions of the polynucleotide and such regions can be upstream (5') to, downstream (3') to, or within the region that encodes the IL12B and/or IL12A polypeptide. These regions can be incorporated into the polynucleotide before and/or after sequence-optimization of the protein encoding region or open reading frame (ORF). Examples of such features include, but are not limited to, untranslated regions (UTRs), microRNA sequences, Kozak sequences, oligo(dT) sequences, poly-A tail, and detectable tags and can include multiple cloning sites that may have Xbal recognition.
  • the polynucleotide of the disclosure comprises a 5' UTR, a
  • the polynucleotide comprises two or more 5' UTRs and/or 3' UTRs, which can be the same or different sequences. In some embodiments, the polynucleotide comprises two or more miRNA binding sites, which can be the same or different sequences. Any portion of the 5' UTR, 3' UTR, and/or miRNA binding site, including none, can be sequence-optimized and can independently contain one or more different structural or chemical modifications, before and/or after sequence optimization.
  • the polynucleotide is reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
  • a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
  • the optimized polynucleotide can be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein.
  • the polynucleotide of the disclosure comprises a sequence- optimized nucleotide sequence encoding an IL12B and/or IL12A polypeptide disclosed herein.
  • the polynucleotide of the disclosure comprises an open reading frame (ORF) encoding an IL12B and/or IL12A polypeptide, wherein the ORF has been sequence optimized.
  • ORF open reading frame
  • Exemplary sequence-optimized nucleotide sequences encoding human IL12B and/or IL12A are shown in Tables 4A-4D.
  • the sequence optimized IL12B and/or IL12A sequences in Table 4A-4D, fragments, and variants thereof are used to practice the methods disclosed herein.
  • the sequence optimized IL12B and/or IL12A sequences in Table 4A-4D, fragments and variants thereof are combined with or alternatives to the wild-type sequences disclosed in Figure 1.
  • RNA sequences provided a person of ordinary skill in the art would understand the corresponding DNA sequence (e.g., conversion of uracil to thymine).
  • the corresponding RNA sequence e.g., conversion of thymine to uracil.
  • hIL12AB CAAGCCAGACCCCCCCAAGAACCTGCAGCTGAAGCCCCTGAAGAACAGCCGGCAGGTGGAAGTTTCCTGGGAGTACCCA
  • hIL12AB CAAACCAGACCCTCCTAAGAACCTTCAGTTAAAACCGCTGAAGAACAGCCGGCAGGTGGAAGTTTCCTGGGAGTACCCA 010 GATACGTGGAGTACGCCGCACTCCTACTTCAGTTTAACCTTCTGTGTACAAGTACAAGGAAAATCAAAAAGAGAGAAGA
  • hIL12AB AAAACCTGACCCCCCCAAGAACCTGCAACTTAAACCCCTGAAAAACTCTCGGCAGGTCGAAGTTAGCTGGGAGTACCCT 012 GATACTTGGTCCACCCCCCACTCGTACTTCTCACTGACTTTCTGTGTGCAGGTGCAGGGCAAGAGCAAGAGAGAAAA
  • hIL12AB CAAGCCTGACCCACCTAAAAATCTGCAACTCAAGCCTTTGAAAAATTCACGGCAGGTGGAGGTGAGCTGGGAGTACCCT 017 GATACTTGGAGCACCCCCCATAGCTACTTTTCGCTGACATTCTGCGTCCAGGTGCAGGGCAAGTCAAAGAGAGAAGA
  • hIL12AB TAAGCCCGACCCTCCTAAAAACCTGCAACTTAAGCCCCTAAAGAATAGTCGGCAGGTTGAGGTCAGCTGGGAATATCCT 018 GACACATGGAGCACCCCCCACTCTTATTTCTCCCTGACCTTCTGCGTGCAGGTGCAGGGCAAGAGTAAACGGGAGAAAA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Dermatology (AREA)
  • Mycology (AREA)
  • Endocrinology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2017/033422 2016-05-18 2017-05-18 Polynucleotides encoding interleukin-12 (il12) and uses thereof Ceased WO2017201350A1 (en)

Priority Applications (28)

Application Number Priority Date Filing Date Title
EP17726458.7A EP3458083B1 (en) 2016-05-18 2017-05-18 Polynucleotides encoding interleukin-12 (il12) and uses thereof
KR1020187036222A KR102469450B1 (ko) 2016-05-18 2017-05-18 인터류킨-12 (il12)를 코딩하는 폴리뉴클레오티드 및 그의 용도
LTEPPCT/US2017/033422T LT3458083T (lt) 2016-05-18 2017-05-18 Polinukleotidai, koduojantys interleukiną-12 (il12), ir jų naudojimas
CA3024470A CA3024470A1 (en) 2016-05-18 2017-05-18 Polynucleotides encoding interleukin-12 (il12) and uses thereof
EP22204799.5A EP4186518A1 (en) 2016-05-18 2017-05-18 Polynucleotides encoding interleukin-12 (il12) and uses thereof
SG11201809381XA SG11201809381XA (en) 2016-05-18 2017-05-18 Polynucleotides encoding interleukin-12 (il12) and uses thereof
HRP20230050TT HRP20230050T1 (hr) 2016-05-18 2017-05-18 Polinukleotidi koji kodiraju interleukin-12 (il12) i njihova upotreba
RS20230055A RS63912B1 (sr) 2016-05-18 2017-05-18 Polinukleotidi koji kodiraju interleukin-12 (il12) i njihove upotrebe
SM20230121T SMT202300121T1 (it) 2016-05-18 2017-05-18 Polinucleotidi codificanti l'interleuchina-12 (il12) e loro usi
JP2018560509A JP7246930B2 (ja) 2016-05-18 2017-05-18 インターロイキン-12(il12)をコードするポリヌクレオチドおよびその使用
SI201731299T SI3458083T1 (sl) 2016-05-18 2017-05-18 Polinukleotidi, ki kodirajo interlevkin-12 (IL12) in njihova uporaba
KR1020227040214A KR20220159479A (ko) 2016-05-18 2017-05-18 인터류킨-12 (il12)를 코딩하는 폴리뉴클레오티드 및 그의 용도
ES17726458T ES2941411T3 (es) 2016-05-18 2017-05-18 Polinucleótidos que codifican interleucina-12 (IL12) y usos de los mismos
DK17726458.7T DK3458083T5 (da) 2016-05-18 2017-05-18 Polynukleotider, der koder for interleukin-12 (il12), og anvendelser heraf
PL17726458.7T PL3458083T3 (pl) 2016-05-18 2017-05-18 Polinukleotydy kodujące interleukinę-12 (il12) i ich zastosowania
RU2018144292A RU2769316C2 (ru) 2016-05-18 2017-05-18 Полинуклеотиды, кодирующие интерлейкин-12 (il12), и их применения
FIEP17726458.7T FI3458083T3 (fi) 2016-05-18 2017-05-18 Interleukiini-12:ta (il12) koodittavia polynukleotideja ja niiden käyttötapoja
CN201780030730.8A CN109195621A (zh) 2016-05-18 2017-05-18 编码白细胞介素12(il12)的多核苷酸及其用途
MA45027A MA45027B1 (fr) 2016-05-18 2017-05-18 Polynucléotides codant pour l'interleukine 12 (il-12) et leurs utilisations
MX2018013509A MX393869B (es) 2016-05-18 2017-05-18 Polinucleotidos que codifican interleucina-12 (il12) y usos de los mismos.
AU2017268397A AU2017268397B2 (en) 2016-05-18 2017-05-18 Polynucleotides encoding interleukin-12 (IL12) and uses thereof
IL262501A IL262501A (en) 2016-05-18 2018-10-21 Polynucleotides encoding interleukin-12 (il12) and their uses
US16/192,274 US10646549B2 (en) 2016-05-18 2018-11-15 Polynucleotides encoding interleukin-12 (IL12) and uses thereof
US16/842,300 US11000573B2 (en) 2016-05-18 2020-04-07 Polynucleotides encoding interleukin-12 (IL12) and uses thereof
US17/308,686 US11311602B2 (en) 2016-05-18 2021-05-05 Polynucleotides encoding interleukin-12 (IL12) and uses thereof
US17/721,583 US11571463B2 (en) 2016-05-18 2022-04-15 Polynucleotides encoding interleukin-12 (IL12) and uses thereof
US18/164,796 US20240024422A1 (en) 2016-05-18 2023-02-06 Polynucleotides encoding interleukin-12 (il12) and uses thereof
JP2023040409A JP2023072056A (ja) 2016-05-18 2023-03-15 インターロイキン-12(il12)をコードするポリヌクレオチドおよびその使用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662338483P 2016-05-18 2016-05-18
US62/338,483 2016-05-18
US201762443693P 2017-01-07 2017-01-07
US62/443,693 2017-01-07

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/192,274 Continuation US10646549B2 (en) 2016-05-18 2018-11-15 Polynucleotides encoding interleukin-12 (IL12) and uses thereof

Publications (1)

Publication Number Publication Date
WO2017201350A1 true WO2017201350A1 (en) 2017-11-23

Family

ID=58794205

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/033422 Ceased WO2017201350A1 (en) 2016-05-18 2017-05-18 Polynucleotides encoding interleukin-12 (il12) and uses thereof

Country Status (23)

Country Link
US (5) US10646549B2 (cg-RX-API-DMAC7.html)
EP (2) EP4186518A1 (cg-RX-API-DMAC7.html)
JP (2) JP7246930B2 (cg-RX-API-DMAC7.html)
KR (2) KR102469450B1 (cg-RX-API-DMAC7.html)
CN (1) CN109195621A (cg-RX-API-DMAC7.html)
AU (1) AU2017268397B2 (cg-RX-API-DMAC7.html)
CA (1) CA3024470A1 (cg-RX-API-DMAC7.html)
DK (1) DK3458083T5 (cg-RX-API-DMAC7.html)
ES (1) ES2941411T3 (cg-RX-API-DMAC7.html)
FI (1) FI3458083T3 (cg-RX-API-DMAC7.html)
HR (1) HRP20230050T1 (cg-RX-API-DMAC7.html)
HU (1) HUE061077T2 (cg-RX-API-DMAC7.html)
IL (1) IL262501A (cg-RX-API-DMAC7.html)
LT (1) LT3458083T (cg-RX-API-DMAC7.html)
MX (2) MX393869B (cg-RX-API-DMAC7.html)
PL (1) PL3458083T3 (cg-RX-API-DMAC7.html)
PT (1) PT3458083T (cg-RX-API-DMAC7.html)
RS (1) RS63912B1 (cg-RX-API-DMAC7.html)
RU (1) RU2769316C2 (cg-RX-API-DMAC7.html)
SG (1) SG11201809381XA (cg-RX-API-DMAC7.html)
SI (1) SI3458083T1 (cg-RX-API-DMAC7.html)
SM (1) SMT202300121T1 (cg-RX-API-DMAC7.html)
WO (1) WO2017201350A1 (cg-RX-API-DMAC7.html)

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018170336A1 (en) * 2017-03-15 2018-09-20 Modernatx, Inc. Lipid nanoparticle formulation
US10195156B2 (en) 2015-12-22 2019-02-05 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US10266485B2 (en) 2015-09-17 2019-04-23 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
CN109932511A (zh) * 2019-03-22 2019-06-25 南昌大学第二附属医院 用于肝癌筛查的尿液外泌体磷脂标志物及其试剂盒
WO2020056304A1 (en) * 2018-09-14 2020-03-19 Modernatx, Inc. Methods and compositions for treating cancer using mrna therapeutics
US10646549B2 (en) 2016-05-18 2020-05-12 Modernatx, Inc. Polynucleotides encoding interleukin-12 (IL12) and uses thereof
WO2020146700A1 (en) * 2019-01-10 2020-07-16 Massachusetts Institute Of Technology Lipid nanoparticles
US10857105B2 (en) 2017-03-15 2020-12-08 MordernaTX, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
EP3836964A1 (en) * 2018-08-15 2021-06-23 University of Florida Research Foundation, Inc. Methods of sensitizing tumors to treatment with immune checkpoint inhibitors
US11066355B2 (en) 2019-09-19 2021-07-20 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
GB2592504A (en) * 2018-09-04 2021-09-01 Univ Texas Compositions and methods for organ specific delivery of nucleic acids
GB2592505A (en) * 2018-09-04 2021-09-01 Univ Texas Compositions and methods for organ specific delivery of nucleic acids
CN113509542A (zh) * 2021-04-20 2021-10-19 嘉晨西海(杭州)生物技术有限公司 一种基于mRNA的表达白介素12针对肿瘤的药物及其制备方法
US11203569B2 (en) 2017-03-15 2021-12-21 Modernatx, Inc. Crystal forms of amino lipids
WO2022020811A1 (en) 2020-07-24 2022-01-27 Strand Therapeutics, Inc. Lipidnanoparticle comprising modified nucleotides
EP3801562A4 (en) * 2018-05-31 2022-06-29 Beth Israel Deaconess Medical Center Rna-aided immunotherapeutics
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
WO2022150712A1 (en) 2021-01-08 2022-07-14 Strand Therapeutics, Inc. Expression constructs and uses thereof
US11421011B2 (en) 2017-05-18 2022-08-23 Modernatx, Inc. Polynucleotides encoding tethered interleukin-12 (IL12) polypeptides and uses thereof
CN114994331A (zh) * 2022-05-17 2022-09-02 广州顺泰生物医药科技有限公司 一种检测蛋白表达水平的试剂盒及其制备方法和应用
US11583504B2 (en) 2016-11-08 2023-02-21 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
WO2023031394A1 (en) 2021-09-03 2023-03-09 CureVac SE Novel lipid nanoparticles for delivery of nucleic acids
US11603396B2 (en) 2019-05-22 2023-03-14 Orna Therapeutics, Inc. Circular RNA compositions and methods
WO2023073228A1 (en) 2021-10-29 2023-05-04 CureVac SE Improved circular rna for expressing therapeutic proteins
US11679120B2 (en) 2019-12-04 2023-06-20 Orna Therapeutics, Inc. Circular RNA compositions and methods
WO2023144330A1 (en) 2022-01-28 2023-08-03 CureVac SE Nucleic acid encoded transcription factor inhibitors
WO2023196988A1 (en) * 2022-04-07 2023-10-12 Modernatx, Inc. Methods of use of mrnas encoding il-12
US11793843B2 (en) 2019-01-10 2023-10-24 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2023213320A1 (zh) * 2022-05-06 2023-11-09 珠海丽凡达生物技术有限公司 治疗性核酸分子、混合物、药物及在治疗实体瘤中的应用
WO2023227608A1 (en) 2022-05-25 2023-11-30 Glaxosmithkline Biologicals Sa Nucleic acid based vaccine encoding an escherichia coli fimh antigenic polypeptide
US11845950B2 (en) 2018-06-06 2023-12-19 Massachusetts Institute Of Technology Circular RNA for translation in eukaryotic cells
EP3937982A4 (en) * 2019-03-14 2024-02-21 Engene, Inc. LOCALIZED EXPRESSION, BASED ON CHITOSAN POLYPLEXER, OF IL-12 ALONE OR IN COMBINATION WITH TYPE I IFN INDUCTORS FOR THE TREATMENT OF MUCOSAL CANCERS
DE202023106198U1 (de) 2022-10-28 2024-03-21 CureVac SE Impfstoff auf Nukleinsäurebasis
US11951120B2 (en) 2021-12-08 2024-04-09 Nanjing GeneLeap Biotechnology Co., Ltd. Modification of gene transcription and translation efficiency by 5′UTR sequence variation
US12018289B2 (en) 2019-11-18 2024-06-25 Janssen Biotech, Inc. Vaccines based on mutant CALR and JAK2 and their uses
US12071633B2 (en) 2020-10-13 2024-08-27 Kriya Therapeutics, Inc. Viral vector constructs for delivery of nucleic acids encoding cytokines and uses thereof for treating cancer
US12077501B2 (en) 2017-06-14 2024-09-03 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
WO2024184500A1 (en) 2023-03-08 2024-09-12 CureVac SE Novel lipid nanoparticle formulations for delivery of nucleic acids
US12139617B2 (en) 2017-12-22 2024-11-12 North Carolina State University Polymeric fluorophores, compositions comprising the same, and methods of preparing and using the same
WO2024230934A1 (en) 2023-05-11 2024-11-14 CureVac SE Therapeutic nucleic acid for the treatment of ophthalmic diseases
US12263248B2 (en) 2018-09-19 2025-04-01 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US12297285B2 (en) 2022-06-24 2025-05-13 Orna Therapeutics, Inc. Circular RNA encoding chimeric antigen receptors targeting BCMA
US12295997B2 (en) 2020-07-06 2025-05-13 Janssen Biotech, Inc. Prostate neoantigens and their uses
US12350303B2 (en) 2017-02-03 2025-07-08 University of Pittsburgh—of the Commonwealth System of Higher Education Oncolytic virus therapy
US12357580B2 (en) 2018-06-19 2025-07-15 The Board Of Regents Of The University Of Texas System Lipid nanoparticle compositions for delivery of mRNA and long nucleic acids
US12595226B2 (en) 2019-09-19 2026-04-07 Modernatx, Inc. Carbonate containing lipid compounds and compositions for intracellular delivery of therapeutic agents

Families Citing this family (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
WO2015105955A1 (en) 2014-01-08 2015-07-16 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
PL4023249T3 (pl) 2014-04-23 2025-03-10 Modernatx, Inc. Szczepionki z kwasem nukleinowym
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
MA42543A (fr) 2015-07-30 2018-06-06 Modernatx Inc Arn épitope peptidiques concatémériques
EP4011451A1 (en) 2015-10-22 2022-06-15 ModernaTX, Inc. Metapneumovirus mrna vaccines
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
WO2017201342A1 (en) 2016-05-18 2017-11-23 Modernatx, Inc. Polynucleotides encoding jagged1 for the treatment of alagille syndrome
CA3036831A1 (en) 2016-09-14 2018-03-22 Modernatx, Inc. High purity rna compositions and methods for preparation thereof
MA46766A (fr) 2016-11-11 2019-09-18 Modernatx Inc Vaccin antigrippal
WO2018107088A2 (en) * 2016-12-08 2018-06-14 Modernatx, Inc. Respiratory virus nucleic acid vaccines
US11905525B2 (en) 2017-04-05 2024-02-20 Modernatx, Inc. Reduction of elimination of immune responses to non-intravenous, e.g., subcutaneously administered therapeutic proteins
MA49421A (fr) 2017-06-15 2020-04-22 Modernatx Inc Formulations d'arn
EP3668979A4 (en) 2017-08-18 2021-06-02 Modernatx, Inc. METHOD OF HPLC ANALYSIS
WO2019036682A1 (en) 2017-08-18 2019-02-21 Modernatx, Inc. RNA VARIANTS POLYMERASE
MA49914A (fr) 2017-08-18 2021-04-21 Modernatx Inc Procédés analytiques par hplc
KR102439221B1 (ko) 2017-12-14 2022-09-01 프로디자인 소닉스, 인크. 음향 트랜스듀서 구동기 및 제어기
EP3746090A4 (en) 2018-01-29 2021-11-17 ModernaTX, Inc. RSV RNA Vaccines
WO2020061295A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. High-purity peg lipids and uses thereof
CA3113025A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. Peg lipids and uses thereof
KR102524247B1 (ko) * 2018-12-21 2023-04-21 가톨릭대학교 산학협력단 p40-EBI3의 복합체 및 이의 용도
CN113874502A (zh) 2019-03-11 2021-12-31 摩登纳特斯有限公司 补料分批体外转录方法
US12070495B2 (en) 2019-03-15 2024-08-27 Modernatx, Inc. HIV RNA vaccines
WO2020209934A1 (en) * 2019-04-11 2020-10-15 Massachusetts Institute Of Technology Novel chimeric antigen receptors and libraries
EP4009955A1 (en) * 2019-08-07 2022-06-15 ModernaTX, Inc. Compositions and methods for enhanced delivery of agents
EP4106730A4 (en) * 2020-02-19 2024-03-27 University of Florida Research Foundation, Incorporated MULTILAMELLAR RNA NANOPARTICLES AND METHODS FOR SENSITIZING TUMORS TO TREATMENT WITH IMMUNE CHECKPOINT INHIBITORS
JP7539723B2 (ja) * 2020-02-21 2024-08-26 コンバインド セラピューティクス インコーポレイテッド コード化リボ核酸の器官保護発現及び調節のための組成物並びに方法
EP4132576A1 (en) 2020-04-09 2023-02-15 Suzhou Abogen Biosciences Co., Ltd. Nucleic acid vaccines for coronavirus
WO2021204175A1 (en) 2020-04-09 2021-10-14 Suzhou Abogen Biosciences Co., Ltd. Lipid nanoparticle composition
CN116648510A (zh) 2020-05-17 2023-08-25 贝林格尔.英格海姆国际有限公司 用于受调控基因治疗的病毒载体和核酸
MX2023001187A (es) * 2020-07-31 2023-04-04 Combined Therapeutics Inc Composiciones y métodos para una vacunación mejorada.
CZ310613B6 (cs) 2020-09-23 2026-01-28 Ústav organické chemie a biochemie AV ČR, v. v. i. Lipidoidy pro transfekci nukleových kyselin a jejich použití
EP4274607A1 (en) 2021-01-11 2023-11-15 ModernaTX, Inc. Seasonal rna influenza virus vaccines
US11524023B2 (en) 2021-02-19 2022-12-13 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same
AU2022268465A1 (en) * 2021-05-06 2023-03-09 Stemirna Therapeutics Co., Ltd. A lipid
US20220363937A1 (en) 2021-05-14 2022-11-17 Armstrong World Industries, Inc. Stabilization of antimicrobial coatings
JP2024521082A (ja) * 2021-05-18 2024-05-28 ユニバーシティ オブ テネシー リサーチ ファウンデーション アミロイド障害を処置するための抗体-ペプチド融合タンパク質
CZ310443B6 (cs) 2021-07-19 2025-06-25 Ústav organické chemie a biochemie AV ČR, v. v. i. Cyklohexanové lipidoidy pro transfekci nukleových kyselin a jejich použití
CN116829578B (zh) * 2021-10-08 2025-03-21 苏州艾博生物科技有限公司 编码白细胞介素-12(il-12)的多核苷酸以及其相关组合物和方法
US12529047B1 (en) 2021-12-21 2026-01-20 Modernatx, Inc. mRNA quantification methods
CN114044741B (zh) 2022-01-13 2022-04-15 北京悦康科创医药科技股份有限公司 一种阳离子脂质化合物、包含其的组合物及用途
CN114773217B (zh) * 2022-06-20 2022-10-18 深圳市瑞吉生物科技有限公司 用于递送核酸的阳离子脂质化合物和组合物及用途
WO2024020453A2 (en) * 2022-07-20 2024-01-25 Hdt Bio Corp. Immune system modulators and uses thereof
CN120112637A (zh) * 2022-11-11 2025-06-06 斯微(上海)生物科技股份有限公司 人工核酸分子

Citations (112)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5082767A (en) 1989-02-27 1992-01-21 Hatfield G Wesley Codon pair utilization
WO1999024595A1 (en) 1997-11-12 1999-05-20 The Brigham And Women's Hospital, Inc. The translation enhancer element of the human amyloid precursor protein gene
WO2000018778A1 (en) 1998-09-29 2000-04-06 Phylos, Inc. Synthesis of codon randomized nucleic acids
WO2001055371A1 (en) 2000-01-28 2001-08-02 The Scripps Research Institute Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same
US6617106B1 (en) 1990-10-09 2003-09-09 Steven Albert Benner Methods for preparing oligonucleotides containing non-standard nucleotides
US20050032730A1 (en) 2001-06-05 2005-02-10 Florian Von Der Mulbe Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US20050059005A1 (en) 2001-09-28 2005-03-17 Thomas Tuschl Microrna molecules
US20050261218A1 (en) 2003-07-31 2005-11-24 Christine Esau Oligomeric compounds and compositions for use in modulation small non-coding RNAs
US6984720B1 (en) 1999-08-24 2006-01-10 Medarex, Inc. Human CTLA-4 antibodies
US20070048776A1 (en) 2005-08-24 2007-03-01 The Scripps Research Institute Translation enhancer-element dependent vector systems
WO2007036366A2 (de) 2005-09-28 2007-04-05 Johannes Gutenberg-Universität Mainz, Vertreten Durch Den Präsidenten Modifikationen von rna, die zu einer erhöhten transkriptstabilität und translationseffizienz führen
US20070117112A1 (en) 2005-06-30 2007-05-24 Diener John L Materials and methods for the generation of fully 2'-modified nucleic acid transcripts
WO2007081740A2 (en) 2006-01-05 2007-07-19 The Ohio State University Research Foundation Micrornarna-based methods and compositions for the diagnosis and treatment of solid cancers
WO2007113648A2 (en) 2006-04-05 2007-10-11 Pfizer Products Inc. Ctla4 antibody combination therapy
US20080046192A1 (en) 2006-08-16 2008-02-21 Richard Lathrop Polypepetide-encoding nucleotide sequences with refined translational kinetics and methods of making same
US20080076161A1 (en) 2002-04-01 2008-03-27 The Government Of The United States, As Represented By The Secretary Of The Army Method of designing synthetic nucleic acid sequences for optimal protein expression in a host cell
WO2008054828A2 (en) 2006-11-01 2008-05-08 The Ohio State University Research Foundation Microrna expression signature for predicting survival and metastases in hepatocellular carcinoma
US7378262B2 (en) 2001-12-03 2008-05-27 Roche Molecular Systems, Inc. Reversibly modified thermostable enzymes for DNA synthesis and amplification in vitro
US7384739B2 (en) 2001-11-14 2008-06-10 Toyo Boseki Kabushiki Kaisha Compositions for enhancing DNA synthesis, DNA polymerase-related factors and utilization thereof
WO2008073915A2 (en) 2006-12-08 2008-06-19 Asuragen, Inc. Micrornas differentially expressed in leukemia and uses thereof
WO2008078180A2 (en) 2006-12-22 2008-07-03 Archemix Corp. Materials and methods for the generation of transcripts comprising modified nucleotides
WO2008154098A2 (en) 2007-06-07 2008-12-18 Wisconsin Alumni Research Foundation Reagents and methods for mirna expression analysis and identification of cancer biomarkers
US7468275B2 (en) 2000-01-28 2008-12-23 The Scripps Research Institute Synthetic internal ribosome entry sites and methods of identifying same
US20090131348A1 (en) 2006-09-19 2009-05-21 Emmanuel Labourier Micrornas differentially expressed in pancreatic diseases and uses thereof
WO2009070653A1 (en) 2007-11-30 2009-06-04 The Ohio State University Research Foundation Microrna expression profiling and targeting in peripheral blood in lung cancer
WO2009075886A1 (en) 2007-12-11 2009-06-18 The Scripps Research Institute Compositions and methods related to mrna translational enhancer elements
US7550264B2 (en) 2005-06-10 2009-06-23 Datascope Investment Corporation Methods and kits for sense RNA synthesis
US7561973B1 (en) 2008-07-31 2009-07-14 Dna Twopointo, Inc. Methods for determining properties that affect an expression property value of polynucleotides in an expression system
WO2009100430A2 (en) 2008-02-08 2009-08-13 Asuragen, Inc miRNAs DIFFERENTIALLY EXPRESSED IN LYMPH NODES FROM CANCER PATIENTS
EP2112235A1 (en) 2008-04-24 2009-10-28 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Compositions and methods for microRNA expression profiling of nasopharyngeal carcinoma
WO2010018563A2 (en) 2008-08-12 2010-02-18 Rosetta Genomics Ltd. Compositions and methods for the prognosis of lymphoma
US20100120024A1 (en) 2005-06-30 2010-05-13 Sharon Cload Materials and methods for the generation of transcripts comprising modified nucleotides
WO2010126766A1 (en) * 2009-04-30 2010-11-04 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Inducible interleukin-12
US20100286232A1 (en) 2006-03-02 2010-11-11 The Ohio State University Microrna expression profile associated with pancreatic cancer
US20100293625A1 (en) 2007-09-26 2010-11-18 Interexon Corporation Synthetic 5'UTRs, Expression Vectors, and Methods for Increasing Transgene Expression
WO2011015347A1 (en) 2009-08-05 2011-02-10 Biontech Ag Vaccine composition comprising 5'-cap modified rna
US20110065103A1 (en) 2007-12-14 2011-03-17 Ugur Sahin Use of rna for reprogramming somatic cells
US20110082055A1 (en) 2009-09-18 2011-04-07 Codexis, Inc. Reduced codon mutagenesis
US20110086904A1 (en) 2007-09-17 2011-04-14 The Trustees Of The University Of Pennsylvania GENERATION OF HYPERSTABLE mRNAs
US7943743B2 (en) 2005-07-01 2011-05-17 Medarex, Inc. Human monoclonal antibodies to programmed death ligand 1 (PD-L1)
WO2011076142A1 (en) 2009-12-24 2011-06-30 Fudan University Compositions and methods for microrna expession profiling in plasma of colorectal cancer
WO2011076143A1 (en) 2009-12-24 2011-06-30 Fudan University Compositions and methods for microrna expression profiling of lung cancer
WO2011095623A2 (en) 2010-02-05 2011-08-11 Febit Holding Gmbh miRNA IN THE DIAGNOSIS OF OVARIAN CANCER
US8008449B2 (en) 2005-05-09 2011-08-30 Medarex, Inc. Human monoclonal antibodies to programmed death 1 (PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
US20110281756A1 (en) 2008-11-13 2011-11-17 Ying Wu Compositions and methods for micro-rna expression profiling of colorectal cancer
WO2011157294A1 (en) 2010-06-16 2011-12-22 Universita' Degli Studi Di Padova Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto
WO2012009644A2 (en) 2010-07-16 2012-01-19 Arizona Board Of Regents Methods to identify synthetic and natural rna elements that enhance protein translation
US8126653B2 (en) 2008-07-31 2012-02-28 Dna Twopointo, Inc. Synthetic nucleic acids for expression of encoded proteins
US20120053224A1 (en) 2008-12-10 2012-03-01 Universitat Regensburg Compositions and methods for micro-rna expression profiling of cancer stem cells
WO2012072096A1 (en) 2010-12-03 2012-06-07 Biontech Ag Method for cellular rna expression
US8217149B2 (en) 2008-12-09 2012-07-10 Genentech, Inc. Anti-PD-L1 antibodies, compositions and articles of manufacture
US20120195936A1 (en) 2009-07-31 2012-08-02 Ethris Gmbh Rna with a combination of unmodified and modified nucleotides for protein expression
WO2012122444A1 (en) 2011-03-10 2012-09-13 Provectus Pharmaceuticals, Inc. Combination of local and systemic immunomodulative therapies for enhanced treatment of cancer
US8278036B2 (en) 2005-08-23 2012-10-02 The Trustees Of The University Of Pennsylvania RNA containing modified nucleosides and methods of use thereof
WO2012135805A2 (en) 2011-03-31 2012-10-04 modeRNA Therapeutics Delivery and formulation of engineered nucleic acids
US20120264626A1 (en) 2009-05-08 2012-10-18 The Ohio State University Research Foundation MicroRNA Expression Profiling and Targeting in Chronic Obstructive Pulmonary Disease (COPD) Lung Tissue and Methods of Use Thereof
US20120283310A1 (en) 2008-02-28 2012-11-08 Croce Carlo M MicroRNA Signatures Associated with Human Chronic Lymphocytic Leukemia (CLL) and Uses Thereof
WO2012151212A1 (en) 2011-05-01 2012-11-08 University Of Rochester Multifocal hepatocellular carcinoma microrna expression patterns and uses thereof
US20120316081A1 (en) 2010-01-29 2012-12-13 H. Lee Moffitt Cancer Center And Research Institute, Inc. Method of Identifying Myelodysplastic Syndromes
US20130017199A1 (en) 2009-11-24 2013-01-17 AMPLIMMUNE ,Inc. a corporation Simultaneous inhibition of pd-l1/pd-l2
WO2013011378A1 (en) 2011-07-15 2013-01-24 Leo Pharma A/S Diagnostic microrna profiling in cutaneous t-cell lymphoma (ctcl)
US8367328B2 (en) 1998-04-23 2013-02-05 Takara Bio Inc. Method for synthesizing DNA
US20130042333A1 (en) 2011-05-06 2013-02-14 Jean-Gabriel JUDDE Markers for cancer prognosis and therapy and methods of use
US20130053263A1 (en) 2009-12-30 2013-02-28 Febit Holding Gmbh miRNA FINGERPRINT IN THE DIAGNOSIS OF COPD
US8389210B2 (en) 2006-01-05 2013-03-05 The Ohio State University Research Foundation MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors
US20130059015A1 (en) 2010-03-11 2013-03-07 H. Lee Moffitt Cancer Center & Research Institute Human Cancer micro-RNA Expression Profiles Predictive of Chemo-Response
WO2013033640A1 (en) 2011-09-01 2013-03-07 Allegro Diagnostics Corp. Methods and compositions for detecting cancer based on mirna expression profiles
US8401798B2 (en) 2008-06-06 2013-03-19 Dna Twopointo, Inc. Systems and methods for constructing frequency lookup tables for expression systems
WO2013039857A1 (en) 2011-09-12 2013-03-21 modeRNA Therapeutics Engineered nucleic acids and methods of use thereof
US8415096B2 (en) 2007-05-23 2013-04-09 University Of South Florida Micro-RNAs modulating immunity and inflammation
WO2013052523A1 (en) 2011-10-03 2013-04-11 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
WO2013053775A1 (en) * 2011-10-11 2013-04-18 Universität Zürich Prorektorat Mnw Combination medicament comprising il-12 and an agent for blockade of t-cell inhibitory molecules for tumour therapy
WO2013066678A1 (en) 2011-10-26 2013-05-10 Georgetown University Microrna expression profiling of thyroid cancer
US20130183718A1 (en) 2010-09-21 2013-07-18 RibpxX GmbH Method for Synthesizing RNA using DNA Template
US20130195967A1 (en) 2009-12-01 2013-08-01 Shire Human Genetic Therapies, Inc. Liver specific delivery of messenger rna
US8519110B2 (en) 2008-06-06 2013-08-27 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College mRNA cap analogs
WO2013143555A1 (en) 2012-03-26 2013-10-03 Biontech Ag Rna formulation for immunotherapy
US20130259923A1 (en) 2012-04-02 2013-10-03 modeRNA Therapeutics Modified polynucleotides for the production of secreted proteins
WO2013173223A1 (en) 2012-05-15 2013-11-21 Bristol-Myers Squibb Company Cancer immunotherapy by disrupting pd-1/pd-l1 signaling
WO2013182623A2 (de) 2012-06-06 2013-12-12 Hörmann Energietechnik Gmbh & Co. Kg Montageanordnung zur dachseitigen montage von flächenkörpern an einem bauwerk
WO2013185069A1 (en) 2012-06-08 2013-12-12 Shire Human Genetic Therapies, Inc. Pulmonary delivery of mrna to non-lung target cells
WO2013185067A1 (en) 2012-06-08 2013-12-12 Shire Human Genetic Therapies, Inc. Nuclease resistant polynucleotides and uses thereof
US8609089B2 (en) 2008-08-25 2013-12-17 Amplimmune, Inc. Compositions of PD-1 antagonists and methods of use
US20140020675A1 (en) 2012-07-18 2014-01-23 Chandrashekhar Sonwane Solar receiver
US20140029490A1 (en) 2011-05-02 2014-01-30 Lg Electronics Inc. Method for transmitting/receiving data in wireless access system and base station for same
WO2014028429A2 (en) 2012-08-14 2014-02-20 Moderna Therapeutics, Inc. Enzymes and polymerases for the synthesis of rna
WO2014071963A1 (en) 2012-11-09 2014-05-15 Biontech Ag Method for cellular rna expression
WO2014089486A1 (en) 2012-12-07 2014-06-12 Shire Human Genetic Therapies, Inc. Lipidic nanoparticles for mrna delivering
WO2014093924A1 (en) 2012-12-13 2014-06-19 Moderna Therapeutics, Inc. Modified nucleic acid molecules and uses thereof
US20140200261A1 (en) 2013-01-17 2014-07-17 Moderna Therapeutics, Inc. Signal-sensor polynucleotides for the alteration of cellular phenotypes
US20140206753A1 (en) 2011-06-08 2014-07-24 Shire Human Genetic Therapies, Inc. Lipid nanoparticle compositions and methods for mrna delivery
US20140228558A1 (en) 2002-12-23 2014-08-14 Geneart Ag Method and device for optimizing a nucelotide sequence for the purpose of expression in a protein
WO2014144196A1 (en) 2013-03-15 2014-09-18 Shire Human Genetic Therapies, Inc. Synergistic enhancement of the delivery of nucleic acids via blended formulations
WO2014153052A2 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Cftr mrna compositions and related methods and uses
WO2014152513A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. RIBONUCLEIC ACIDs WITH 4'-THIO-MODIFIED NUCLEOTIDES AND RELATED METHODS
WO2014152774A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Methods and compositions for delivering mrna coded antibodies
WO2014152659A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Quantitative assessment for cap efficiency of messenger rna
WO2014152940A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Mrna therapeutic compositions and use to treat diseases and disorders
WO2014152966A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Methods for purification of messenger rna
WO2014152673A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Quantitative assessment for cap efficiency of messenger rna
WO2014164253A1 (en) 2013-03-09 2014-10-09 Moderna Therapeutics, Inc. Heterologous untranslated regions for mrna
US20140341917A1 (en) 2011-11-28 2014-11-20 Merck Patent Gmbh Anti-pd-l1 antibodies and uses thereof
US8900587B2 (en) 2007-06-18 2014-12-02 Merck Sharp & Dohme Corp. Antibodies to human programmed death receptor PD-1
WO2015024667A1 (en) 2013-08-21 2015-02-26 Curevac Gmbh Method for increasing expression of rna-encoded proteins
US20150079109A1 (en) 2013-09-13 2015-03-19 Beigene, Ltd. Anti-PD1 Antibodies and their Use as Therapeutics and Diagnostics
US9012219B2 (en) 2005-08-23 2015-04-21 The Trustees Of The University Of Pennsylvania RNA preparations comprising purified modified RNA for reprogramming cells
WO2015062738A1 (en) 2013-11-01 2015-05-07 Curevac Gmbh Modified rna with decreased immunostimulatory properties
WO2015095249A1 (en) * 2013-12-18 2015-06-25 Intrexon Corporation Single chain il-12 nucleic acids, polypeptids, and uses thereof
WO2015101414A2 (en) 2013-12-30 2015-07-09 Curevac Gmbh Artificial nucleic acid molecules
WO2015101415A1 (en) 2013-12-30 2015-07-09 Curevac Gmbh Artificial nucleic acid molecules
WO2016170176A1 (en) 2015-04-22 2016-10-27 Curevac Ag Rna containing composition for treatment of tumor diseases
WO2017049245A2 (en) 2015-09-17 2017-03-23 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents

Family Cites Families (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5891680A (en) 1995-02-08 1999-04-06 Whitehead Institute For Biomedical Research Bioactive fusion proteins comprising the p35 and p40 subunits of IL-12
US5811097A (en) 1995-07-25 1998-09-22 The Regents Of The University Of California Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling
US5922685A (en) 1996-06-05 1999-07-13 Powderject Vaccines, Inc. IL-12 gene therapy of tumors
JP2001503258A (ja) 1996-10-18 2001-03-13 バレンティス・インコーポレーテッド 遺伝子発現および搬送系および用途
US5994104A (en) 1996-11-08 1999-11-30 Royal Free Hospital School Of Medicine Interleukin-12 fusion protein
ATE550042T1 (de) 1997-11-20 2012-04-15 Vical Inc Behandlung von krebs mithilfe cytokin- exprimierender polynukleotide und zusammensetzungen dafür
AU761520B2 (en) 1998-09-15 2003-06-05 Genetics Institute, Llc Treatment of Kaposi's Sarcoma with IL-12
ATE305801T1 (de) * 2000-01-20 2005-10-15 Univ Zuerich Inst Fuer Medizin Intratumorale verabreichung nackter il-12 codierender nukleinsäuremoleküle
ES2164011B1 (es) 2000-02-25 2003-05-16 Inst Cientifico Tecnol Navarra Uso combinado de la quimiocina ip-10 y la interleucina-12 en la preparacion de composiciones para el tratamiento de tumores malignos.
AU3958101A (en) 2000-03-15 2001-09-24 Univ Pohang Genes of il-12p40 subunit mutated for improving the activity of il-12 and use thereof for dna vaccine adjuvant
KR20020010206A (ko) 2000-07-27 2002-02-04 이시우 인터루킨 12와 보조활성인자 b7.1 유전자를 함유하는dna 벡터 및 이벡터가 도입된 항암 세포백신
AU2002354799A1 (en) 2001-07-03 2003-01-21 University Of Utah Research Foundation Soluble steroidal peptides for nucleic acid delivery
US7595303B1 (en) 2002-09-05 2009-09-29 University Of South Florida Genetic adjuvants for immunotherapy
DE10248141B4 (de) 2002-10-11 2007-04-19 Universitätsklinikum Hamburg-Eppendorf Nukleinsäuren und deren Verwendung für die Gentherapie
CN1798502A (zh) 2003-05-30 2006-07-05 南佛罗里达大学 治疗恶性肿瘤的方法
GB0329146D0 (en) 2003-12-16 2004-01-21 Glaxosmithkline Biolog Sa Vaccine
DE102004042546A1 (de) 2004-09-02 2006-03-09 Curevac Gmbh Kombinationstherapie zur Immunstimulation
EP1640018A1 (en) 2004-09-24 2006-03-29 Universität Zürich Combinational therapy for treating cancer
PL1966238T3 (pl) 2005-12-30 2012-09-28 Merck Patent Gmbh Warianty interleukiny-12p40 o polepszonej stabilności
US7833754B2 (en) 2006-01-13 2010-11-16 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services IL-12 for expression in mammalian cell
KR101241477B1 (ko) 2006-01-27 2013-03-08 엘지이노텍 주식회사 질화물 반도체 발광소자 및 그 제조 방법
US7919079B2 (en) 2006-03-31 2011-04-05 Biosante Pharmaceuticals, Inc. Cancer immunotherapy compositions and methods of use
DE102006051516A1 (de) 2006-10-31 2008-05-08 Curevac Gmbh (Basen-)modifizierte RNA zur Expressionssteigerung eines Proteins
WO2008134879A1 (en) 2007-05-04 2008-11-13 University Health Network Il-12 immunotherapy for cancer
WO2009014708A2 (en) 2007-07-23 2009-01-29 Cell Genesys, Inc. Pd-1 antibodies in combination with a cytokine-secreting cell and methods of use thereof
TWI359030B (en) 2007-08-24 2012-03-01 Univ Nat Taiwan Treatment of cellular proliferative disorders
US8476419B2 (en) 2007-09-14 2013-07-02 Vrije Universiteit Brussel Enhancing the T-cells stimulatory capacity of human antigen presenting cells and their use in vaccination
WO2009040811A2 (en) * 2007-09-24 2009-04-02 Bar-Ilan University Polymer nanoparticles coated by magnetic metal oxide and uses thereof
WO2009086558A1 (en) * 2008-01-02 2009-07-09 Tekmira Pharmaceuticals Corporation Improved compositions and methods for the delivery of nucleic acids
CA2721333C (en) * 2008-04-15 2020-12-01 Protiva Biotherapeutics, Inc. Novel lipid formulations for nucleic acid delivery
US8715964B2 (en) 2008-05-11 2014-05-06 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Expression of IL-12 family heterodimers
WO2009149539A1 (en) 2008-06-10 2009-12-17 Université de Montréal Enhancing antigen-specific cd8+ t cell response using irf-7 mrna
KR101766408B1 (ko) 2009-06-10 2017-08-10 알닐람 파마슈티칼스 인코포레이티드 향상된 지질 조성물
KR20120066952A (ko) 2010-12-15 2012-06-25 주식회사 롤팩 7층 구조의 공압출 항균 진공포장 필름 및 그 제조방법
EP2651445A2 (en) 2010-12-16 2013-10-23 SPRNA GmbH Pharmaceutical composition consisting of rna having alkali metal as counter ion and formulated with dications
WO2012116714A1 (en) 2011-03-02 2012-09-07 Curevac Gmbh Vaccination in elderly patients
JP6333730B2 (ja) 2011-12-12 2018-05-30 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア 改善されたil−12遺伝子構築物を含む組成物、及びそれを用いたワクチン、免疫治療剤及び方法
EP2623121A1 (en) 2012-01-31 2013-08-07 Bayer Innovation GmbH Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen
CN102876684B (zh) * 2012-09-17 2014-10-08 青岛康立泰药业有限公司 人白细胞介素-12的编码基因、真核宿主细胞和表达方法
PL2922554T3 (pl) * 2012-11-26 2022-06-20 Modernatx, Inc. Na zmodyfikowany na końcach
US9974845B2 (en) 2013-02-22 2018-05-22 Curevac Ag Combination of vaccination and inhibition of the PD-1 pathway
CN107879960B (zh) 2013-03-08 2021-06-22 诺华股份有限公司 用于传递活性成分的脂质和脂质组合物
US20160367651A1 (en) 2013-10-01 2016-12-22 Mie University T cell inducing vaccine containing an interepitope sequence that promotes antigen presentation
AU2014337156A1 (en) 2013-10-18 2016-05-12 Modernatx, Inc. Compositions and methods for tolerizing cellular systems
JP6506749B2 (ja) 2013-10-22 2019-04-24 シャイアー ヒューマン ジェネティック セラピーズ インコーポレイテッド フェニルケトン尿症のためのmRNA療法
ES3032935T3 (en) 2013-10-22 2025-07-29 Translate Bio Inc Lipid formulations for delivery of messenger rna
WO2015095423A2 (en) * 2013-12-17 2015-06-25 Genentech, Inc. Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
PL4023249T3 (pl) 2014-04-23 2025-03-10 Modernatx, Inc. Szczepionki z kwasem nukleinowym
HUE060907T2 (hu) * 2014-06-25 2023-04-28 Acuitas Therapeutics Inc Új lipidek és lipid nanorészecske formulációk nukleinsavak bevitelére
EP3197911A4 (en) 2014-09-22 2018-06-20 Intrexon Corporation Improved therapeutic control of heterodimeric and single chain forms of interleukin-12
US11786457B2 (en) 2015-01-30 2023-10-17 President And Fellows Of Harvard College Peritumoral and intratumoral materials for cancer therapy
US10682401B2 (en) 2015-05-19 2020-06-16 Morphogenesis, Inc. Multi-indication mRNA cancer immunotherapy
WO2016187407A1 (en) 2015-05-19 2016-11-24 Morphogenesis, Inc. Cancer vaccine comprising mrna encoding a m-like-protein
EP3205356A1 (en) 2016-02-10 2017-08-16 Onkoloski Institut Ljubljana Plasmid expression vector encoding human interleukin 12 under transcriptional control of p21 promoter and without antibiotic resistance for cancer gene therapy and other uses thereof
EP3211000B1 (en) 2016-02-25 2019-01-30 Provecs Medical GmbH Novel immunostimulating vector system
SI3458083T1 (sl) 2016-05-18 2023-03-31 Modernatx, Inc. Polinukleotidi, ki kodirajo interlevkin-12 (IL12) in njihova uporaba
CN109715205A (zh) 2016-08-19 2019-05-03 库瑞瓦格股份公司 用于癌症治疗的rna
EP3523323A4 (en) 2016-10-07 2020-06-17 Board of Regents, The University of Texas System T-CELLS WITH EXPRESSION OF MEMBRANE-ANCHORED IL-12 FOR THE TREATMENT OF CANCER

Patent Citations (143)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5082767A (en) 1989-02-27 1992-01-21 Hatfield G Wesley Codon pair utilization
US6617106B1 (en) 1990-10-09 2003-09-09 Steven Albert Benner Methods for preparing oligonucleotides containing non-standard nucleotides
WO1999024595A1 (en) 1997-11-12 1999-05-20 The Brigham And Women's Hospital, Inc. The translation enhancer element of the human amyloid precursor protein gene
US6310197B1 (en) 1997-11-12 2001-10-30 The Brigham And Women's Hospital, Inc. Translation enhancer element of the human amyloid precursor protein gene
US6849405B2 (en) 1997-11-12 2005-02-01 The Brigham And Women's Hospital, Inc. Translation enhancer element of the human amyloid precursor protein gene
US8367328B2 (en) 1998-04-23 2013-02-05 Takara Bio Inc. Method for synthesizing DNA
WO2000018778A1 (en) 1998-09-29 2000-04-06 Phylos, Inc. Synthesis of codon randomized nucleic acids
US6984720B1 (en) 1999-08-24 2006-01-10 Medarex, Inc. Human CTLA-4 antibodies
US7183395B2 (en) 2000-01-28 2007-02-27 The Scripps Research Institute Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same
WO2001055371A1 (en) 2000-01-28 2001-08-02 The Scripps Research Institute Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same
US20090093049A1 (en) 2000-01-28 2009-04-09 The Scripps Research Institute Methods of Identifying Synthetic Transcriptional and Translational Regulatory Elements, and Compositions Related to Same
US7456273B2 (en) 2000-01-28 2008-11-25 The Scripps Research Institute Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same
US7468275B2 (en) 2000-01-28 2008-12-23 The Scripps Research Institute Synthetic internal ribosome entry sites and methods of identifying same
WO2001055369A1 (en) 2000-01-28 2001-08-02 The Scripps Research Institute Synthetic internal ribosome entry sites and methods of identifying same
US20050032730A1 (en) 2001-06-05 2005-02-10 Florian Von Der Mulbe Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US20050059005A1 (en) 2001-09-28 2005-03-17 Thomas Tuschl Microrna molecules
US7384739B2 (en) 2001-11-14 2008-06-10 Toyo Boseki Kabushiki Kaisha Compositions for enhancing DNA synthesis, DNA polymerase-related factors and utilization thereof
US7378262B2 (en) 2001-12-03 2008-05-27 Roche Molecular Systems, Inc. Reversibly modified thermostable enzymes for DNA synthesis and amplification in vitro
US20080076161A1 (en) 2002-04-01 2008-03-27 The Government Of The United States, As Represented By The Secretary Of The Army Method of designing synthetic nucleic acid sequences for optimal protein expression in a host cell
US20140228558A1 (en) 2002-12-23 2014-08-14 Geneart Ag Method and device for optimizing a nucelotide sequence for the purpose of expression in a protein
US20050261218A1 (en) 2003-07-31 2005-11-24 Christine Esau Oligomeric compounds and compositions for use in modulation small non-coding RNAs
US8008449B2 (en) 2005-05-09 2011-08-30 Medarex, Inc. Human monoclonal antibodies to programmed death 1 (PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
US7550264B2 (en) 2005-06-10 2009-06-23 Datascope Investment Corporation Methods and kits for sense RNA synthesis
US8101385B2 (en) 2005-06-30 2012-01-24 Archemix Corp. Materials and methods for the generation of transcripts comprising modified nucleotides
US20100120024A1 (en) 2005-06-30 2010-05-13 Sharon Cload Materials and methods for the generation of transcripts comprising modified nucleotides
US20070117112A1 (en) 2005-06-30 2007-05-24 Diener John L Materials and methods for the generation of fully 2'-modified nucleic acid transcripts
US7943743B2 (en) 2005-07-01 2011-05-17 Medarex, Inc. Human monoclonal antibodies to programmed death ligand 1 (PD-L1)
US8278036B2 (en) 2005-08-23 2012-10-02 The Trustees Of The University Of Pennsylvania RNA containing modified nucleosides and methods of use thereof
US8835108B2 (en) 2005-08-23 2014-09-16 The Trustees Of The University Of Pennsylvania RNA containing modified nucleosides and methods of use thereof
US9012219B2 (en) 2005-08-23 2015-04-21 The Trustees Of The University Of Pennsylvania RNA preparations comprising purified modified RNA for reprogramming cells
US8748089B2 (en) 2005-08-23 2014-06-10 The Trustees Of The University Of Pennsylvania RNA containing modified nucleosides and methods of use thereof
US20070048776A1 (en) 2005-08-24 2007-03-01 The Scripps Research Institute Translation enhancer-element dependent vector systems
WO2007025008A2 (en) 2005-08-24 2007-03-01 The Scripps Research Institute Translation enhancer-element dependent vector systems
US20110124100A1 (en) 2005-08-24 2011-05-26 The Scripps Research Institute Translation enhancer-element dependent vector systems
US20100129877A1 (en) 2005-09-28 2010-05-27 Ugur Sahin Modification of RNA, Producing an Increased Transcript Stability and Translation Efficiency
WO2007036366A2 (de) 2005-09-28 2007-04-05 Johannes Gutenberg-Universität Mainz, Vertreten Durch Den Präsidenten Modifikationen von rna, die zu einer erhöhten transkriptstabilität und translationseffizienz führen
US8389210B2 (en) 2006-01-05 2013-03-05 The Ohio State University Research Foundation MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors
US20120214699A1 (en) 2006-01-05 2012-08-23 The Ohio State University Methods for Diagnosing Breast Cancer Using MicroRNA Signatures
WO2007081740A2 (en) 2006-01-05 2007-07-19 The Ohio State University Research Foundation Micrornarna-based methods and compositions for the diagnosis and treatment of solid cancers
US20110171646A1 (en) 2006-03-02 2011-07-14 The Ohio State University Research Foundation Microrna expression profile associated with pancreatic cancer
US20100286232A1 (en) 2006-03-02 2010-11-11 The Ohio State University Microrna expression profile associated with pancreatic cancer
WO2007113648A2 (en) 2006-04-05 2007-10-11 Pfizer Products Inc. Ctla4 antibody combination therapy
US20080046192A1 (en) 2006-08-16 2008-02-21 Richard Lathrop Polypepetide-encoding nucleotide sequences with refined translational kinetics and methods of making same
US20090131348A1 (en) 2006-09-19 2009-05-21 Emmanuel Labourier Micrornas differentially expressed in pancreatic diseases and uses thereof
US8252538B2 (en) 2006-11-01 2012-08-28 The Ohio State University MicroRNA expression signature for predicting survival and metastases in hepatocellular carcinoma
US20120329672A1 (en) 2006-11-01 2012-12-27 Croce Carlo M MicroRNA Expression Signature for Predicting Survival and Metastases in Hepatocellular Carcinoma
WO2008054828A2 (en) 2006-11-01 2008-05-08 The Ohio State University Research Foundation Microrna expression signature for predicting survival and metastases in hepatocellular carcinoma
US20090092974A1 (en) 2006-12-08 2009-04-09 Asuragen, Inc. Micrornas differentially expressed in leukemia and uses thereof
WO2008073915A2 (en) 2006-12-08 2008-06-19 Asuragen, Inc. Micrornas differentially expressed in leukemia and uses thereof
WO2008078180A2 (en) 2006-12-22 2008-07-03 Archemix Corp. Materials and methods for the generation of transcripts comprising modified nucleotides
US8415096B2 (en) 2007-05-23 2013-04-09 University Of South Florida Micro-RNAs modulating immunity and inflammation
WO2008154098A2 (en) 2007-06-07 2008-12-18 Wisconsin Alumni Research Foundation Reagents and methods for mirna expression analysis and identification of cancer biomarkers
US8900587B2 (en) 2007-06-18 2014-12-02 Merck Sharp & Dohme Corp. Antibodies to human programmed death receptor PD-1
US20110086904A1 (en) 2007-09-17 2011-04-14 The Trustees Of The University Of Pennsylvania GENERATION OF HYPERSTABLE mRNAs
US20100293625A1 (en) 2007-09-26 2010-11-18 Interexon Corporation Synthetic 5'UTRs, Expression Vectors, and Methods for Increasing Transgene Expression
WO2009070653A1 (en) 2007-11-30 2009-06-04 The Ohio State University Research Foundation Microrna expression profiling and targeting in peripheral blood in lung cancer
US20100323357A1 (en) 2007-11-30 2010-12-23 The Ohio State University Research Foundation MicroRNA Expression Profiling and Targeting in Peripheral Blood in Lung Cancer
WO2009075886A1 (en) 2007-12-11 2009-06-18 The Scripps Research Institute Compositions and methods related to mrna translational enhancer elements
EP2610341A1 (en) 2007-12-11 2013-07-03 The Scripps Research Institute Compositions and methods related to mRNA translational enhancer elements
US20130177581A1 (en) 2007-12-11 2013-07-11 The Scripps Research Institute Compositions and Methods Related to mRNA Translational Enhancer Elements
US20090226470A1 (en) 2007-12-11 2009-09-10 Mauro Vincent P Compositions and methods related to mRNA translational enhancer elements
EP2610340A1 (en) 2007-12-11 2013-07-03 The Scripps Research Institute Compositions and methods related to mRNA translational enhancer elements
US20110065103A1 (en) 2007-12-14 2011-03-17 Ugur Sahin Use of rna for reprogramming somatic cells
US20090263803A1 (en) 2008-02-08 2009-10-22 Sylvie Beaudenon Mirnas differentially expressed in lymph nodes from cancer patients
WO2009100430A2 (en) 2008-02-08 2009-08-13 Asuragen, Inc miRNAs DIFFERENTIALLY EXPRESSED IN LYMPH NODES FROM CANCER PATIENTS
US20120283310A1 (en) 2008-02-28 2012-11-08 Croce Carlo M MicroRNA Signatures Associated with Human Chronic Lymphocytic Leukemia (CLL) and Uses Thereof
EP2112235A1 (en) 2008-04-24 2009-10-28 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Compositions and methods for microRNA expression profiling of nasopharyngeal carcinoma
US8401798B2 (en) 2008-06-06 2013-03-19 Dna Twopointo, Inc. Systems and methods for constructing frequency lookup tables for expression systems
US8519110B2 (en) 2008-06-06 2013-08-27 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College mRNA cap analogs
US8126653B2 (en) 2008-07-31 2012-02-28 Dna Twopointo, Inc. Synthetic nucleic acids for expression of encoded proteins
US7561973B1 (en) 2008-07-31 2009-07-14 Dna Twopointo, Inc. Methods for determining properties that affect an expression property value of polynucleotides in an expression system
WO2010018563A2 (en) 2008-08-12 2010-02-18 Rosetta Genomics Ltd. Compositions and methods for the prognosis of lymphoma
US8609089B2 (en) 2008-08-25 2013-12-17 Amplimmune, Inc. Compositions of PD-1 antagonists and methods of use
US20110281756A1 (en) 2008-11-13 2011-11-17 Ying Wu Compositions and methods for micro-rna expression profiling of colorectal cancer
US8217149B2 (en) 2008-12-09 2012-07-10 Genentech, Inc. Anti-PD-L1 antibodies, compositions and articles of manufacture
US20120053224A1 (en) 2008-12-10 2012-03-01 Universitat Regensburg Compositions and methods for micro-rna expression profiling of cancer stem cells
WO2010126766A1 (en) * 2009-04-30 2010-11-04 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Inducible interleukin-12
US20120264626A1 (en) 2009-05-08 2012-10-18 The Ohio State University Research Foundation MicroRNA Expression Profiling and Targeting in Chronic Obstructive Pulmonary Disease (COPD) Lung Tissue and Methods of Use Thereof
US20120195936A1 (en) 2009-07-31 2012-08-02 Ethris Gmbh Rna with a combination of unmodified and modified nucleotides for protein expression
WO2011015347A1 (en) 2009-08-05 2011-02-10 Biontech Ag Vaccine composition comprising 5'-cap modified rna
US20110082055A1 (en) 2009-09-18 2011-04-07 Codexis, Inc. Reduced codon mutagenesis
US20130017199A1 (en) 2009-11-24 2013-01-17 AMPLIMMUNE ,Inc. a corporation Simultaneous inhibition of pd-l1/pd-l2
US20130195967A1 (en) 2009-12-01 2013-08-01 Shire Human Genetic Therapies, Inc. Liver specific delivery of messenger rna
WO2011076142A1 (en) 2009-12-24 2011-06-30 Fudan University Compositions and methods for microrna expession profiling in plasma of colorectal cancer
WO2011076143A1 (en) 2009-12-24 2011-06-30 Fudan University Compositions and methods for microrna expression profiling of lung cancer
US20130053263A1 (en) 2009-12-30 2013-02-28 Febit Holding Gmbh miRNA FINGERPRINT IN THE DIAGNOSIS OF COPD
US20130053264A1 (en) 2009-12-30 2013-02-28 Febit Holding Gmbh Mirna fingerprint in the diagnosis of prostate cancer
US20120316081A1 (en) 2010-01-29 2012-12-13 H. Lee Moffitt Cancer Center And Research Institute, Inc. Method of Identifying Myelodysplastic Syndromes
US20120309645A1 (en) 2010-02-05 2012-12-06 Febit Holding Gmbh miRNA IN THE DIAGNOSIS OF OVARIAN CANCER
WO2011095623A2 (en) 2010-02-05 2011-08-11 Febit Holding Gmbh miRNA IN THE DIAGNOSIS OF OVARIAN CANCER
US20130059015A1 (en) 2010-03-11 2013-03-07 H. Lee Moffitt Cancer Center & Research Institute Human Cancer micro-RNA Expression Profiles Predictive of Chemo-Response
WO2011157294A1 (en) 2010-06-16 2011-12-22 Universita' Degli Studi Di Padova Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto
WO2012009644A2 (en) 2010-07-16 2012-01-19 Arizona Board Of Regents Methods to identify synthetic and natural rna elements that enhance protein translation
US20130183718A1 (en) 2010-09-21 2013-07-18 RibpxX GmbH Method for Synthesizing RNA using DNA Template
WO2012072096A1 (en) 2010-12-03 2012-06-07 Biontech Ag Method for cellular rna expression
WO2012122444A1 (en) 2011-03-10 2012-09-13 Provectus Pharmaceuticals, Inc. Combination of local and systemic immunomodulative therapies for enhanced treatment of cancer
US20120263677A1 (en) 2011-03-10 2012-10-18 Provectus Pharmaceuticals, Inc. Combination of Local and Systemic Immunomodulative Therapies for Enhanced Treatment of Cancer
WO2012135805A2 (en) 2011-03-31 2012-10-04 modeRNA Therapeutics Delivery and formulation of engineered nucleic acids
US8710200B2 (en) 2011-03-31 2014-04-29 Moderna Therapeutics, Inc. Engineered nucleic acids encoding a modified erythropoietin and their expression
WO2012151212A1 (en) 2011-05-01 2012-11-08 University Of Rochester Multifocal hepatocellular carcinoma microrna expression patterns and uses thereof
US20140029490A1 (en) 2011-05-02 2014-01-30 Lg Electronics Inc. Method for transmitting/receiving data in wireless access system and base station for same
US20130042333A1 (en) 2011-05-06 2013-02-14 Jean-Gabriel JUDDE Markers for cancer prognosis and therapy and methods of use
US20140206753A1 (en) 2011-06-08 2014-07-24 Shire Human Genetic Therapies, Inc. Lipid nanoparticle compositions and methods for mrna delivery
WO2013011378A1 (en) 2011-07-15 2013-01-24 Leo Pharma A/S Diagnostic microrna profiling in cutaneous t-cell lymphoma (ctcl)
WO2013033640A1 (en) 2011-09-01 2013-03-07 Allegro Diagnostics Corp. Methods and compositions for detecting cancer based on mirna expression profiles
WO2013039857A1 (en) 2011-09-12 2013-03-21 modeRNA Therapeutics Engineered nucleic acids and methods of use thereof
WO2013052523A1 (en) 2011-10-03 2013-04-11 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US20130115272A1 (en) 2011-10-03 2013-05-09 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
WO2013053775A1 (en) * 2011-10-11 2013-04-18 Universität Zürich Prorektorat Mnw Combination medicament comprising il-12 and an agent for blockade of t-cell inhibitory molecules for tumour therapy
WO2013066678A1 (en) 2011-10-26 2013-05-10 Georgetown University Microrna expression profiling of thyroid cancer
US20140341917A1 (en) 2011-11-28 2014-11-20 Merck Patent Gmbh Anti-pd-l1 antibodies and uses thereof
WO2013143555A1 (en) 2012-03-26 2013-10-03 Biontech Ag Rna formulation for immunotherapy
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2013151671A1 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of cosmetic proteins and peptides
US20130259923A1 (en) 2012-04-02 2013-10-03 modeRNA Therapeutics Modified polynucleotides for the production of secreted proteins
WO2013173223A1 (en) 2012-05-15 2013-11-21 Bristol-Myers Squibb Company Cancer immunotherapy by disrupting pd-1/pd-l1 signaling
WO2013182623A2 (de) 2012-06-06 2013-12-12 Hörmann Energietechnik Gmbh & Co. Kg Montageanordnung zur dachseitigen montage von flächenkörpern an einem bauwerk
WO2013185067A1 (en) 2012-06-08 2013-12-12 Shire Human Genetic Therapies, Inc. Nuclease resistant polynucleotides and uses thereof
WO2013185069A1 (en) 2012-06-08 2013-12-12 Shire Human Genetic Therapies, Inc. Pulmonary delivery of mrna to non-lung target cells
US20140020675A1 (en) 2012-07-18 2014-01-23 Chandrashekhar Sonwane Solar receiver
WO2014028429A2 (en) 2012-08-14 2014-02-20 Moderna Therapeutics, Inc. Enzymes and polymerases for the synthesis of rna
US20150307542A1 (en) 2012-10-03 2015-10-29 Moderna Therapeutics, Inc. Modified nucleic acid molecules and uses thereof
WO2014071963A1 (en) 2012-11-09 2014-05-15 Biontech Ag Method for cellular rna expression
WO2014089486A1 (en) 2012-12-07 2014-06-12 Shire Human Genetic Therapies, Inc. Lipidic nanoparticles for mrna delivering
WO2014093924A1 (en) 2012-12-13 2014-06-19 Moderna Therapeutics, Inc. Modified nucleic acid molecules and uses thereof
US20140200261A1 (en) 2013-01-17 2014-07-17 Moderna Therapeutics, Inc. Signal-sensor polynucleotides for the alteration of cellular phenotypes
WO2014164253A1 (en) 2013-03-09 2014-10-09 Moderna Therapeutics, Inc. Heterologous untranslated regions for mrna
WO2014152774A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Methods and compositions for delivering mrna coded antibodies
WO2014152513A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. RIBONUCLEIC ACIDs WITH 4'-THIO-MODIFIED NUCLEOTIDES AND RELATED METHODS
WO2014152966A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Methods for purification of messenger rna
WO2014152940A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Mrna therapeutic compositions and use to treat diseases and disorders
WO2014152659A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Quantitative assessment for cap efficiency of messenger rna
WO2014153052A2 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Cftr mrna compositions and related methods and uses
WO2014152673A1 (en) 2013-03-14 2014-09-25 Shire Human Genetic Therapies, Inc. Quantitative assessment for cap efficiency of messenger rna
WO2014144196A1 (en) 2013-03-15 2014-09-18 Shire Human Genetic Therapies, Inc. Synergistic enhancement of the delivery of nucleic acids via blended formulations
WO2015024667A1 (en) 2013-08-21 2015-02-26 Curevac Gmbh Method for increasing expression of rna-encoded proteins
US20150079109A1 (en) 2013-09-13 2015-03-19 Beigene, Ltd. Anti-PD1 Antibodies and their Use as Therapeutics and Diagnostics
WO2015062738A1 (en) 2013-11-01 2015-05-07 Curevac Gmbh Modified rna with decreased immunostimulatory properties
WO2015095249A1 (en) * 2013-12-18 2015-06-25 Intrexon Corporation Single chain il-12 nucleic acids, polypeptids, and uses thereof
WO2015101414A2 (en) 2013-12-30 2015-07-09 Curevac Gmbh Artificial nucleic acid molecules
WO2015101415A1 (en) 2013-12-30 2015-07-09 Curevac Gmbh Artificial nucleic acid molecules
WO2016170176A1 (en) 2015-04-22 2016-10-27 Curevac Ag Rna containing composition for treatment of tumor diseases
WO2017049245A2 (en) 2015-09-17 2017-03-23 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents

Non-Patent Citations (134)

* Cited by examiner, † Cited by third party
Title
A. R. GENNARO: "Remington: The Science and Practice of Pharmacy, 21st ed.", 2006, LIPPINCOTT, WILLIAMS & WILKINS
ALEXOPOULOU ET AL., NATURE, vol. 413, 2001, pages 732 - 738
AL-ZOGHAIBI ET AL., GENE, vol. 391, no. 1-2, 2007, pages 130 - 9
ANAND; CHERESH, CURR OPIN HEMATOL, vol. 18, 2011, pages 171 - 176
ANDRIES ET AL., J. CONTROL. RELEASE, vol. 217, 2015, pages 337 - 344
ANDRIES ET AL., MOL. PHARM., vol. 9, no. 8, 2012, pages 2136 - 2145
ASSELIN-PATUREL, C. ET AL., CANCER, vol. 91, 2001, pages 113 - 122
BAR M ET AL., STEM CELLS, vol. 26, 2008, pages 2496 - 2505
BARTEL, CELL, vol. 136, 2009, pages 215 - 233
BLACK ET AL., MOL. CELL. BIOL., vol. 17, no. 5, 1997, pages 2756 - 2763
BOADO ET AL., J. NEUROCHEM., vol. 67, no. 4, 1996, pages 1335 - 1343
BONAUER ET AL., CURR DRUG TARGETS, vol. 11, 2010, pages 943 - 949
BOROS ET AL., J. PHOTOCHEM. PHOTOBIOL. B., vol. 129, 2013, pages 93 - 99
BOROS ET AL., PLOS ONE, vol. 10, no. 6, 2015, pages E0131141
BRIEBA ET AL., BIOCHEMISTRY, vol. 41, 2002, pages 5144 - 5149
CAFRI ET AL., MOL. THER., vol. 23, no. 8, 2015, pages 1391 - 1400
CHAPPELL ET AL., PNAS, vol. 101, 2004, pages 9590 - 9594
CHENG ET AL., PNAS, vol. 91, 1994, pages 5695 - 5699
CHIU ET AL., J. VIROL., vol. 79, no. 13, 2005, pages 8303 - 8315
CHUNG ET AL., BIOCHEMISTRY, vol. 37, no. 46, 1998, pages 16298 - 16306
CHUNG ET AL., BMC SYSTEMS BIOLOGY, vol. 6, 2012, pages 134
COMERON; AGUADE, J. MOL. EVOL., vol. 47, 1998, pages 268 - 74
COMPTON, NATURE, vol. 350, 1991, pages 91 - 92
CONTRERAS; RAO, LEUKEMIA, vol. 26, 20 December 2011 (2011-12-20), pages 404 - 413
COUGHLIN, C. M. ET AL., CANCER RES., vol. 57, 1997, pages 2460 - 2467
CROWLEY ET AL., GENE THER., 30 June 2015 (2015-06-30)
DAUBENDIEK ET AL., JACS, vol. 117, 1995, pages 7818 - 7819
DIEBOLD ET AL., EUR. J. IMMUNOL., vol. 36, 2006, pages 3256 - 3267
DIEBOLD ET AL., SCIENCE, vol. 303, 2004, pages 1529 - 1531
DWYER ET AL., J. NEUROCHEM., vol. 66, no. 2, 1996, pages 449 - 458
ESVELT ET AL., NATURE, vol. 472, 2011, pages 499 - 503
ESVELT ET AL., NATURE, vol. 472, no. 7344, 2011, pages 499 - 503
F. Z. CHOWDHURY ET AL: "IL-12 selectively programs effector pathways that are stably expressed in human CD8+ effector memory T cells in vivo", BLOOD, vol. 118, no. 14, 6 October 2011 (2011-10-06), US, pages 3890 - 3900, XP055389495, ISSN: 0006-4971, DOI: 10.1182/blood-2011-05-357111 *
FERIZI ET AL., LAB CHIP., vol. 15, no. 17, 2015, pages 3561 - 3571
FOX; ERIL, DNA RES., vol. 17, no. 3, 2010, pages 185 - 96
FREEMAN ET AL., BIOTECHNIQUES, vol. 26, no. 1, 1999, pages 112 - 22,124-5
FROLOV; SCHLESINGER, J. VIROL., vol. 70, no. 2, 1996, pages 1182 - 1190
GAN; RHOADS, J. BIOL. CHEM., vol. 271, no. 2, 1996, pages 623 - 626
GARNEAU ET AL., J. VIROL, vol. 82, no. 2, 2008, pages 880 - 892
GATELY, MK ET AL., ANNU REV IMMUNOL., vol. 16, 1998, pages 495 - 521
GAYONG SHIM ET AL: "Application of cationic liposomes for delivery of nucleic acids", ASIAN JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 8, no. 2, 1 April 2013 (2013-04-01), pages 72 - 80, XP055198336, ISSN: 1818-0876, DOI: 10.1016/j.ajps.2013.07.009 *
GENTNER; NALDINI, TISSUE ANTIGENS, vol. 80, 2012, pages 393 - 403
GOFF LA ET AL., PLOS ONE, vol. 4, 2009, pages E7192
GRIMSON A; FARH KK; JOHNSTON WK; GARRETT-ENGELE P; LIM LP; BARTEL DP, MOL CELL, vol. 27, no. 1, 6 July 2007 (2007-07-06), pages 91 - 105
GUSTAFSSON ET AL., JOURNAL/TRENDS BIOTECHNOL, vol. 22, 2004, pages 346 - 53
GUSTAFSSON ET AL., PROTEIN EXPRESSION AND PURIFICATION, vol. 83, 2012, pages 37 - 46
HANSSON ET AL., J. BIOL. CHEM., vol. 290, no. 9, 2015, pages 5661 - 5672
HEIL ET AL., SCIENCE, vol. 303, 2004, pages 1526 - 1529
HEMMI ET AL., NATURE, vol. 408, 2000, pages 740 - 745
HERBST ET AL., J CLIN ONCOL, vol. 31, 2013, pages 3000
HOLCIK; LIEBHABER, PNAS, vol. 94, no. 6, 1997, pages 2410 - 2414
HOLDEN; HARRIS, VIROLOGY, vol. 329, no. 1, 2004, pages 119 - 133
HOLTKAMP ET AL., BLOOD, vol. 108, no. 13, 2006, pages 4009 - 4017
IKEMURA, J. MOL. BIOL., vol. 151, no. 3, 1981, pages 389 - 409
INNIS ET AL., PNAS, vol. 85, 1988, pages 9436 - 9440
ISMAIL M. MERAZ ET AL: "Adjuvant Cationic Liposomes Presenting MPL and IL-12 Induce Cell Death, Suppress Tumor Growth, and Alter the Cellular Phenotype of Tumors in a Murine Model of Breast Cancer", MOLECULAR PHARMACEUTICS, vol. 11, no. 10, 6 October 2014 (2014-10-06), US, pages 3484 - 3491, XP055388647, ISSN: 1543-8384, DOI: 10.1021/mp5002697 *
IZQUIERDO; CUEVZA, BIOCHEM. J., vol. 346, 2000, pages 849 - 855
IZQUIERDO; CUEVZA, MOL. CELL. BIOL., vol. 17, no. 9, 1997, pages 5255 - 5268
JIMA DD ET AL., BLOOD, vol. 116, 2010, pages L 18 - EL27
JUNJIE LI ET AL., CURRENT BIOLOGY, vol. 15, 23 August 2005 (2005-08-23), pages 1501 - 1507
KANG, W. K. ET AL., HUMAN GENE THERAPY, vol. 12, 2001, pages 671 - 684
KARIKO ET AL., IMMUNITY, vol. 23, 2005, pages 165 - 175
KARIKO ET AL., MOL. THER., vol. 16, no. 11, 2008, pages 1833 - 1840
KARIKO ET AL., MOL. THER., vol. 20, no. 5, 2012, pages 948 - 953
KARIKO ET AL., NUCLEIC ACIDS RES., vol. 39, no. 21, 2011, pages EL42
KAUFFMAN ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 240, 21 December 2015 (2015-12-21), pages 227 - 234, XP029759407
KEDDE ET AL., NATURE CELL BIOLOGY, vol. 12, no. 10, 2010, pages 1014 - 20
KEDDE ET AL.: "A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility.", NATURE CELL BIOLOGY, 2010
KHLEIF, PROCEEDINGS FROM THE EUROPEAN CANCER CONGRESS 2013, 2013
KIM ET AL., NATURE, vol. 351, no. 6324, 1991, pages 331 - 2
KNIRSCH; CLERCH, BIOCHEM. BIOPHYS. RES. COMMUN., vol. 272, no. 1, 2000, pages 164 - 168
KORE ET AL., BIOORGANIC & MEDICINAL CHEMISTRY, vol. 21, 2013, pages 4570 - 4574
KORMANN ET AL., NAT. BIOTECHNOL., vol. 29, no. 2, 2011, pages 154 - 157
KORMANN ET AL., NATURE BIOTECHNOLOGY, vol. 29, 2010, pages 154 - 157
KUPPUSAMY KT ET AL., CURR. MOL MED, vol. 13, no. 5, 2013, pages 757 - 764
LANDGRAF ET AL., CELL, vol. 129, 2007, pages 1401 - 1414
LASEK W. ET AL., CANCER IMMUNOL IMMUNOTHER, vol. 63, 2014, pages 419 - 435
LEONARD, J. P. ET AL., BLOOD, vol. 90, 1997, pages 2541 - 2548
LIZARDI ET AL., NATURE GENETICS, vol. 19, 1998, pages 225 - 232
MANDAL; ROSSI, NAT. PROTOC., vol. 8, no. 3, 2013, pages 568 - 582
MANDAL; ROSSI, NAT. PROTOC., vol. 8, no. 3, 2013, pages 568 - 82
MARIO P COLOMBO ET AL: "Interleukin-12 in anti-tumor immunity and immunotherapy", CYTOKINE AND GROWTH FACTOR REVIEWS, vol. 13, no. 2, 1 April 2002 (2002-04-01), GB, pages 155 - 168, XP055389487, ISSN: 1359-6101, DOI: 10.1016/S1359-6101(01)00032-6 *
MATSUDA; MAURO, PLOS ONE, vol. 5, 2010, pages 11
MEIJER HA ET AL., SCIENCE, vol. 340, 2013, pages 82 - 85
MELLMAN ET AL., NATURE, vol. 480, 2011, pages 480 - 489
MORIN RD ET AL., GENOME RES, vol. 18, 2008, pages 610 - 621
NASTALA, C. L. ET AL., J IMMUNOL, vol. 153, 1994, pages 1697 - 1706
NORBURY: "Nature Reviews Molecular Cell Biology", 29 August 2013, AOP, article "Cytoplasmic RNA: a case of the tail wagging the dog"
OCHMAN ET AL., GENETICS, vol. 120, no. 3, 1988, pages 621 - 623
P CHAROENSIT ET AL: "Enhanced growth inhibition of metastatic lung tumors by intravenous injection of ATRA-cationic liposome/IL-12 pDNA complexes in mice", CANCER GENE THERAPY, vol. 17, no. 7, 23 April 2010 (2010-04-23), GB, pages 512 - 522, XP055388601, ISSN: 0929-1903, DOI: 10.1038/cgt.2010.12 *
PANEK ET AL.: "An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5'UTRs and its implications for eukaryotic gene translation regulation", NUCLEIC ACIDS RESEARCH, 2013
PLOS ONE, vol. 5, 2010, pages 11
POGUE ET AL., J. VIROL., vol. 67, no. 12, pages 7106 - 7117
POLEGANOV ET AL., HUM. GEN. THER., vol. 26, no. 11, 2015, pages 751 - 766
POLIDOROS ET AL., BIOTECHNIQUES, vol. 41, 2006, pages 35 - 42
QUERIDO ET AL., J. CELL SCI., vol. 124, 2014, pages 1703 - 1714
RAMUNAS ET AL., FASEB J., vol. 29, no. 5, 2015, pages 1930 - 1939
REICHMUTH ET AL.: "mRNA vaccine delivery using lipid nanoparticles", THER. DELIV., vol. 7, no. 5, 1 May 2016 (2016-05-01), pages 319 - 334, XP055401839
REMINGTON: "The Science and Practice of Pharmacy, 21st ed.", 2005, LIPPINCOTT WILLIAMS & WILKINS
S TUGUES ET AL: "New insights into IL-12-mediated tumor suppression", CELL DEATH AND DIFFERENTIATION., vol. 22, no. 2, 5 September 2014 (2014-09-05), GB, pages 237 - 246, XP055285716, ISSN: 1350-9047, DOI: 10.1038/cdd.2014.134 *
SACCO, S. ET AL., BLOOD, vol. 90, 1997, pages 4473 - 4479
SAHIN ET AL., NATURE REVIEWS DRUG DISCOVERY I AOP, 19 September 2014 (2014-09-19)
SANDHU ET AL., IN SILICO BIOL., vol. 8, no. 2, 2008, pages 187 - 92
SAUDEMONT, A. ET AL., LEUKEMIA, vol. 16, 2002, pages 1637 - 1644
SHARP; LI, NUCLEIC ACIDS RES., vol. 15, no. 3, 1987, pages 1281 - 95
SJOBERG ET AL., BIOTECHNOLOGY (NY, vol. 12, no. 11, 1994, pages 1127 - 1131
STRONG ET AL., GENE THERAPY, vol. 4, 1997, pages 624 - 627
SUZUKI ET AL., DNA RES., vol. 15, no. 6, 2008, pages 357 - 65
SUZUKI R ET AL: "Cancer gene therapy by IL-12 gene delivery using liposomal bubbles and tumoral ultrasound exposure", JOURNAL OF CONTROLLED RELEASE, ELSEVIER, AMSTERDAM, NL, vol. 142, no. 2, 3 March 2010 (2010-03-03), pages 245 - 250, XP026905287, ISSN: 0168-3659, [retrieved on 20091031], DOI: 10.1016/J.JCONREL.2009.10.027 *
TANAKA ET AL., INTERNATIONAL JOURNAL OF CANCER, vol. 36, no. 5, 1985, pages 549 - 55
THESS ET AL., MOL. THER., vol. 23, no. 9, 2015, pages 1456 - 1464
TOURIOL ET AL., BIOLOGY OF THE CELL, vol. 95, 2003, pages 169 - 178
UGUR SAHIN ET AL: "mRNA-based therapeutics - developing a new class of drugs", NATURE REVIEWS DRUG DISCOVERY, vol. 13, no. 10, 19 September 2014 (2014-09-19), pages 759 - 780, XP055159205, ISSN: 1474-1776, DOI: 10.1038/nrd4278 *
VAZ C ET AL., BMC GENOMICS, vol. 11, 2010, pages 288
VIDIGAL JA; VENTURA A, SEMIN CANCER BIOL., vol. 22, no. 5-6, 2012, pages 428 - 436
VILLALOBOS ET AL., JOURNAL/BMC BIOINFORMATICS, vol. 7, 2006, pages 285
VIVINUS ET AL., EUR. J. BIOCHEM., vol. 268, no. 7, 2001, pages 1908 - 1917
VOELLENKLE C ET AL., RNA, vol. 18, 2012, pages 472 - 484
WALKER ET AL., PNAS, vol. 89, 1992, pages 392 - 396
WANG ET AL., CANCER IMMUNOL RES., vol. 2, no. 9, 2014, pages 846 - 56
WANG ET AL., CURR. GENE THER., vol. 15, no. 4, 2015, pages 428 - 435
WANG ET AL., EMBO J., vol. 16, no. 13, 1997, pages 4107 - 4116
WANG ET AL., NAT. MED., vol. 10, 2004, pages 1366 - 1373
WARREN ET AL., CELL STEM CELL, vol. 7, no. 5, 2010, pages 618 - 630
WELCH ET AL., PLOS ONE, vol. 4, no. 9, 2009, pages E7002
WELLENSIEK ET AL.: "Genome-wide profiling of human cap-independent translation-enhancing elements", NATURE METHODS, 2013
WIEDMANN ET AL., PCR METHODS AND APPLICATION, vol. 3, no. 4, 1994, pages S51 - S64
YAKUBOV ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 394, no. 1, 2010, pages 189 - 193
YOO JK ET AL., STEM CELLS DEV., vol. 21, no. 11, 2012, pages 2049 - 2057
YU ET AL., VACCINE, vol. 25, no. 10, 2007, pages 1701 - 1711
ZANDBERG ET AL., ORAL ONCOL., vol. 50, 2014, pages 627 - 632
ZHOU ET AL., PNAS, vol. 102, 2005, pages 6273 - 6278
ZHU ET AL., NUCLEIC ACIDS RESEARCH, 2013
ZINCKGRAF ET AL., VACCINE, vol. 21, no. 15, 2003, pages 1640 - 9

Cited By (89)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US12151995B2 (en) 2015-09-17 2024-11-26 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US12404232B2 (en) 2015-09-17 2025-09-02 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10392341B2 (en) 2015-09-17 2019-08-27 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US11220476B2 (en) 2015-09-17 2022-01-11 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10266485B2 (en) 2015-09-17 2019-04-23 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10442756B2 (en) 2015-09-17 2019-10-15 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10799463B2 (en) 2015-12-22 2020-10-13 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US10195156B2 (en) 2015-12-22 2019-02-05 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US12396961B2 (en) 2015-12-22 2025-08-26 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US10646549B2 (en) 2016-05-18 2020-05-12 Modernatx, Inc. Polynucleotides encoding interleukin-12 (IL12) and uses thereof
US11571463B2 (en) 2016-05-18 2023-02-07 Modernatx, Inc. Polynucleotides encoding interleukin-12 (IL12) and uses thereof
US11311602B2 (en) 2016-05-18 2022-04-26 Modernatx, Inc. Polynucleotides encoding interleukin-12 (IL12) and uses thereof
US11000573B2 (en) 2016-05-18 2021-05-11 Modernatx, Inc. Polynucleotides encoding interleukin-12 (IL12) and uses thereof
EP3458083B1 (en) 2016-05-18 2022-11-02 ModernaTX, Inc. Polynucleotides encoding interleukin-12 (il12) and uses thereof
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
US11583504B2 (en) 2016-11-08 2023-02-21 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
US12144895B2 (en) 2016-11-08 2024-11-19 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
US12350303B2 (en) 2017-02-03 2025-07-08 University of Pittsburgh—of the Commonwealth System of Higher Education Oncolytic virus therapy
US11203569B2 (en) 2017-03-15 2021-12-21 Modernatx, Inc. Crystal forms of amino lipids
US12324859B2 (en) 2017-03-15 2025-06-10 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US11969506B2 (en) 2017-03-15 2024-04-30 Modernatx, Inc. Lipid nanoparticle formulation
US10857105B2 (en) 2017-03-15 2020-12-08 MordernaTX, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
WO2018170336A1 (en) * 2017-03-15 2018-09-20 Modernatx, Inc. Lipid nanoparticle formulation
US12552738B2 (en) 2017-03-15 2026-02-17 Modernatx, Inc. Crystal forms of amino lipids
US11873327B2 (en) 2017-05-18 2024-01-16 Modernatx, Inc. Polynucleotides encoding tethered interleukin-12 (IL12) polypeptides and uses thereof
US11421011B2 (en) 2017-05-18 2022-08-23 Modernatx, Inc. Polynucleotides encoding tethered interleukin-12 (IL12) polypeptides and uses thereof
US12077501B2 (en) 2017-06-14 2024-09-03 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US12139617B2 (en) 2017-12-22 2024-11-12 North Carolina State University Polymeric fluorophores, compositions comprising the same, and methods of preparing and using the same
EP3801562A4 (en) * 2018-05-31 2022-06-29 Beth Israel Deaconess Medical Center Rna-aided immunotherapeutics
US11981909B2 (en) 2018-06-06 2024-05-14 Massachusetts Institute Of Technology Circular RNA for translation in eukaryotic cells
US12509701B2 (en) 2018-06-06 2025-12-30 Massachusetts Institute Of Technology Circular RNA for translation in eukaryotic cells
US11845950B2 (en) 2018-06-06 2023-12-19 Massachusetts Institute Of Technology Circular RNA for translation in eukaryotic cells
US12570996B2 (en) 2018-06-06 2026-03-10 Massachusetts Institute Of Technology Circular RNA for translation in eukaryotic cells
US12357580B2 (en) 2018-06-19 2025-07-15 The Board Of Regents Of The University Of Texas System Lipid nanoparticle compositions for delivery of mRNA and long nucleic acids
EP3836964A1 (en) * 2018-08-15 2021-06-23 University of Florida Research Foundation, Inc. Methods of sensitizing tumors to treatment with immune checkpoint inhibitors
US12514930B2 (en) 2018-08-15 2026-01-06 University Of Florida Research Foundation, Incorporated Methods of sensitizing tumors to treatment with immune checkpoint inhibitors
US11648209B2 (en) 2018-09-04 2023-05-16 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11648210B2 (en) 2018-09-04 2023-05-16 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11304911B2 (en) 2018-09-04 2022-04-19 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US12133924B2 (en) 2018-09-04 2024-11-05 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11229609B2 (en) 2018-09-04 2022-01-25 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
GB2592505B (en) * 2018-09-04 2023-05-03 Univ Texas Compositions and methods for organ specific delivery of nucleic acids
US11510880B2 (en) 2018-09-04 2022-11-29 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
GB2592505A (en) * 2018-09-04 2021-09-01 Univ Texas Compositions and methods for organ specific delivery of nucleic acids
US11590085B2 (en) 2018-09-04 2023-02-28 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
GB2592504A (en) * 2018-09-04 2021-09-01 Univ Texas Compositions and methods for organ specific delivery of nucleic acids
GB2592504B (en) * 2018-09-04 2023-02-15 Univ Texas Compositions and methods for organ specific delivery of nucleic acids
US11766408B2 (en) 2018-09-04 2023-09-26 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
WO2020056304A1 (en) * 2018-09-14 2020-03-19 Modernatx, Inc. Methods and compositions for treating cancer using mrna therapeutics
JP2022501336A (ja) * 2018-09-14 2022-01-06 モダーナティエックス・インコーポレイテッドModernaTX, Inc. mRNA治療薬を使用したがんを治療するための方法及び組成物
CN113015540A (zh) * 2018-09-14 2021-06-22 莫得纳特斯公司 使用mrna治疗剂治疗癌症的方法和组合物
JP7556848B2 (ja) 2018-09-14 2024-09-26 モデルナティエックス インコーポレイテッド mRNA治療薬を使用したがんを治療するための方法及び組成物
US12263248B2 (en) 2018-09-19 2025-04-01 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US11793843B2 (en) 2019-01-10 2023-10-24 Janssen Biotech, Inc. Prostate neoantigens and their uses
US11026894B2 (en) 2019-01-10 2021-06-08 Massachusetts Institute Of Technology Lipid nanoparticles and use thereof to deliver RNA polynucleotides
WO2020146700A1 (en) * 2019-01-10 2020-07-16 Massachusetts Institute Of Technology Lipid nanoparticles
US12582683B2 (en) 2019-01-10 2026-03-24 Janssen Biotech, Inc. Prostate neoantigens and their uses
EP3937982A4 (en) * 2019-03-14 2024-02-21 Engene, Inc. LOCALIZED EXPRESSION, BASED ON CHITOSAN POLYPLEXER, OF IL-12 ALONE OR IN COMBINATION WITH TYPE I IFN INDUCTORS FOR THE TREATMENT OF MUCOSAL CANCERS
CN109932511A (zh) * 2019-03-22 2019-06-25 南昌大学第二附属医院 用于肝癌筛查的尿液外泌体磷脂标志物及其试剂盒
US11802144B2 (en) 2019-05-22 2023-10-31 Orna Therapeutics, Inc. Circular RNA compositions and methods
US11603396B2 (en) 2019-05-22 2023-03-14 Orna Therapeutics, Inc. Circular RNA compositions and methods
US11066355B2 (en) 2019-09-19 2021-07-20 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US12312293B2 (en) 2019-09-19 2025-05-27 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US12595226B2 (en) 2019-09-19 2026-04-07 Modernatx, Inc. Carbonate containing lipid compounds and compositions for intracellular delivery of therapeutic agents
US11597698B2 (en) 2019-09-19 2023-03-07 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US12018289B2 (en) 2019-11-18 2024-06-25 Janssen Biotech, Inc. Vaccines based on mutant CALR and JAK2 and their uses
US11771715B2 (en) 2019-12-04 2023-10-03 Orna Therapeutics, Inc. Circular RNA compositions and methods
US11679120B2 (en) 2019-12-04 2023-06-20 Orna Therapeutics, Inc. Circular RNA compositions and methods
US11766449B2 (en) 2019-12-04 2023-09-26 Orna Therapeutics, Inc. Circular RNA compositions and methods
US12295997B2 (en) 2020-07-06 2025-05-13 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2022020811A1 (en) 2020-07-24 2022-01-27 Strand Therapeutics, Inc. Lipidnanoparticle comprising modified nucleotides
US12071633B2 (en) 2020-10-13 2024-08-27 Kriya Therapeutics, Inc. Viral vector constructs for delivery of nucleic acids encoding cytokines and uses thereof for treating cancer
WO2022150712A1 (en) 2021-01-08 2022-07-14 Strand Therapeutics, Inc. Expression constructs and uses thereof
JP2024503000A (ja) * 2021-01-08 2024-01-24 ストランド セラピューティクス インコーポレイテッド 発現構築物およびその使用
CN113509542A (zh) * 2021-04-20 2021-10-19 嘉晨西海(杭州)生物技术有限公司 一种基于mRNA的表达白介素12针对肿瘤的药物及其制备方法
WO2023031394A1 (en) 2021-09-03 2023-03-09 CureVac SE Novel lipid nanoparticles for delivery of nucleic acids
WO2023073228A1 (en) 2021-10-29 2023-05-04 CureVac SE Improved circular rna for expressing therapeutic proteins
US11951120B2 (en) 2021-12-08 2024-04-09 Nanjing GeneLeap Biotechnology Co., Ltd. Modification of gene transcription and translation efficiency by 5′UTR sequence variation
WO2023144330A1 (en) 2022-01-28 2023-08-03 CureVac SE Nucleic acid encoded transcription factor inhibitors
WO2023196988A1 (en) * 2022-04-07 2023-10-12 Modernatx, Inc. Methods of use of mrnas encoding il-12
WO2023213320A1 (zh) * 2022-05-06 2023-11-09 珠海丽凡达生物技术有限公司 治疗性核酸分子、混合物、药物及在治疗实体瘤中的应用
CN114994331A (zh) * 2022-05-17 2022-09-02 广州顺泰生物医药科技有限公司 一种检测蛋白表达水平的试剂盒及其制备方法和应用
CN114994331B (zh) * 2022-05-17 2023-02-24 无锡科金生物科技有限公司 一种检测蛋白表达水平的试剂盒及其制备方法和应用
WO2023227608A1 (en) 2022-05-25 2023-11-30 Glaxosmithkline Biologicals Sa Nucleic acid based vaccine encoding an escherichia coli fimh antigenic polypeptide
US12297285B2 (en) 2022-06-24 2025-05-13 Orna Therapeutics, Inc. Circular RNA encoding chimeric antigen receptors targeting BCMA
DE202023106198U1 (de) 2022-10-28 2024-03-21 CureVac SE Impfstoff auf Nukleinsäurebasis
WO2024184500A1 (en) 2023-03-08 2024-09-12 CureVac SE Novel lipid nanoparticle formulations for delivery of nucleic acids
WO2024230934A1 (en) 2023-05-11 2024-11-14 CureVac SE Therapeutic nucleic acid for the treatment of ophthalmic diseases

Also Published As

Publication number Publication date
MX2022008602A (es) 2022-08-11
RU2769316C2 (ru) 2022-03-30
RS63912B1 (sr) 2023-02-28
KR20220159479A (ko) 2022-12-02
CA3024470A1 (en) 2017-11-23
US20240024422A1 (en) 2024-01-25
IL262501A (en) 2018-12-31
US20200376081A1 (en) 2020-12-03
SMT202300121T1 (it) 2023-05-12
MX393869B (es) 2025-03-24
RU2018144292A3 (cg-RX-API-DMAC7.html) 2021-03-10
FI3458083T3 (fi) 2023-03-01
US11311602B2 (en) 2022-04-26
DK3458083T3 (da) 2023-01-30
RU2018144292A (ru) 2020-06-18
EP3458083B1 (en) 2022-11-02
KR20190008890A (ko) 2019-01-25
US11000573B2 (en) 2021-05-11
CN109195621A (zh) 2019-01-11
AU2017268397A1 (en) 2019-01-17
SG11201809381XA (en) 2018-12-28
US11571463B2 (en) 2023-02-07
JP7246930B2 (ja) 2023-03-28
DK3458083T5 (da) 2024-10-21
HUE061077T2 (hu) 2023-05-28
KR102469450B1 (ko) 2022-11-22
US20220265774A1 (en) 2022-08-25
AU2017268397B2 (en) 2023-07-06
LT3458083T (lt) 2023-02-10
EP3458083A1 (en) 2019-03-27
US20210299221A1 (en) 2021-09-30
EP4186518A1 (en) 2023-05-31
PL3458083T3 (pl) 2023-03-13
SI3458083T1 (sl) 2023-03-31
HRP20230050T1 (hr) 2023-03-03
ES2941411T3 (es) 2023-05-22
MX2018013509A (es) 2019-03-28
JP2019516710A (ja) 2019-06-20
US20190125839A1 (en) 2019-05-02
US10646549B2 (en) 2020-05-12
PT3458083T (pt) 2023-03-06
JP2023072056A (ja) 2023-05-23

Similar Documents

Publication Publication Date Title
US11571463B2 (en) Polynucleotides encoding interleukin-12 (IL12) and uses thereof
US11873327B2 (en) Polynucleotides encoding tethered interleukin-12 (IL12) polypeptides and uses thereof
US12239742B2 (en) Polynucleotides encoding Citrin for the treatment of Citrullinemia type 2
US20230323371A1 (en) Polynucleotides encoding alpha-galactosidase a for the treatment of fabry disease
EP3458105B1 (en) Polynucleotides encoding galactose-1-phosphate uridylyltransferase for the treatment of galactosemia type 1
US20240318187A1 (en) Polyribonucleotides containing reduced uracil content and uses thereof
US20190298657A1 (en) Polynucleotides Encoding Acyl-CoA Dehydrogenase, Very Long-Chain for the Treatment of Very Long-Chain Acyl-CoA Dehydrogenase Deficiency
EP3458107A1 (en) Polynucleotides encoding jagged1 for the treatment of alagille syndrome
HK40004215B (en) Polynucleotides encoding interleukin-12 (il12) and uses thereof
HK40004215A (en) Polynucleotides encoding interleukin-12 (il12) and uses thereof

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2018560509

Country of ref document: JP

Kind code of ref document: A

Ref document number: 3024470

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018073391

Country of ref document: BR

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17726458

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20187036222

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017726458

Country of ref document: EP

Effective date: 20181218

ENP Entry into the national phase

Ref document number: 2017268397

Country of ref document: AU

Date of ref document: 20170518

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112018073391

Country of ref document: BR

Free format text: EXPLIQUE A DIVERGENCIA NO NOME DE UM DOS INVENTORES (ELLALAHEWAGE SATHYAJITH KUMARASINGHE ) QUE CONSTA NA PUBLICACAO INTERNACIONAL WO/2017/201350 E O CONSTANTE DA PETICAO INICIAL NO 870180151169 EXPLIQUE A DIVERGENCIA NO NOME DO DEPOSITANTE MODERNATX, INC. QUE CONSTA NA PUBLICACAO INTERNACIONAL WO/2017/201350 E O CONSTANTE DA PRIORIDADE US 62/338,483

ENP Entry into the national phase

Ref document number: 112018073391

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20181113