WO2023196988A1

WO2023196988A1 - Methods of use of mrnas encoding il-12

Info

Publication number: WO2023196988A1
Application number: PCT/US2023/065543
Authority: WO
Inventors: Shaad Essa ABEDIN; Lolke De Haan; Nadia Mohamed LUHESHI; Paolo VICINI
Original assignee: Modernatx, Inc.
Priority date: 2022-04-07
Filing date: 2023-04-07
Publication date: 2023-10-12
Also published as: WO2023196988A9

Abstract

The disclosure features methods for treating solid tumor malignancies by administering LNP encapsulated mRNAs encoding human IL-12 polypeptides in combination with immune checkpoint blockade (e.g., a PD-L1 antagonist). The disclosure also features compositions for use in the methods.

Description

METHODS OF USE OF MRNAS ENCODING IL-12

RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application Serial No. 63/328.678 filed on April 7, 2022; and U.S. Provisional Application 63/423,681 filed on November 8, 2022. The entire contents of the above-referenced applications are incorporated herein by this reference.

BACKGROUND

Cancer is a disease characterized by uncontrolled cell division and growth within the body. In the United States, roughly a third of all women and half of all men will experience cancer in their lifetime. Cancer cells utilize a number of mechanisms to evade the immune system, which results in persistence of tumor cells. Cancers can generally be divided into two categories, solid tumors and disseminated cancers. Each type requires different considerations for developing effective therapeutic approaches. The treatment of solid tumors includes surgery, chemotherapy and/or radiotherapy. In surgery, most of the tumor or even the invaded organ is excised. Chemotherapy includes the use of drugs to destroy cancer cells. Some cancers are curable by chemotherapy while others are not. Chemotherapeutic drugs can affect not only cancer cells but also other rapidly dividing normal cells such as those in the gastrointestinal tract, bone marrow, hair follicles, and reproductive system which result in adverse side effects. Radiotherapy includes the use of x-rays to treat cancers. Some are curable by radiotherapy while others are not.

Despite progress in the treatment of cancer, there continues to be an unmet medical need for more effective and less toxic therapies, especially for those patients with advanced disease that do not respond or have become resistant to existing therapies. Failure of immune surveillance of pre-neoplastic lesions and micro-metastases is a key step in cancer development. Though some tumors are minimally immunogenic, allowing for passive escape from immune surveillance, at least some sporadic tumors are highly immunogenic, but actively suppress the local immune environment through production of immunosuppressive cytokines (Shields et al, 2010 Science 328:749-52). As such, the local tumor environment is likely a highly dynamic environment where most tumors grow and metastasize through adaptive responses that modulate antitumor immunity. Immune responses may be augmented by directly stimulating effector cells, indirectly stimulating effectors by augmenting antigen presentation activity or costimulation, or by suppressing immunosuppressive factors, cells, or messages (Monti et al, 2005, Blood 105:1851-61).

Recent advances in immunotherapy have yielded durable disease control (DC) and benefit for some patients but despite these advances, a significant number of subjects have primary, adaptive or acquired resistance to such therapy (Sharma et al, 2017, Cell 168:707- 23). For example, checkpoint inhibitors, such as antibodies agonistic to programmed death 1 (PD-1) and programmed cell death ligand- 1 (PD-L1) have demonstrated prolonged tumor responses in certain lung cancer patients, but the majority do not respond and resistance eventually develops in those who have an initial response (see, e.g., Herbst et al, 2016 Lancet 387: 1540; Reck, et al 2016 AE/M 375: 1823-33: Syn et al 2017 Lancet Oncol 18:e731-741).

A potential avenue for stimulating anti-tumor immune responses is the use of pro- inflammatory cytokines as immunomodulators. Interleukin- 12 (IL-12) is a pro-inflammatory cytokine that plays an important role in innate and adaptive immunity (see, e.g., Gately, MK et al., Annu Rev Immunol. 16: 495-521 (1998)). Endogenous IL-12 is produced by activated myeloid lineage cells (monocytes, macrophages and dendritic cells). IL-12 functions primarily as a 70 kDa heterodimenc protein consisting of two disulfide-hnked p35 and p40 subunits. The IL-12p70 protein drives innate and adaptive immune cell activation by signaling through IL-12R01 and IL-12RP2 on innate and adaptive immune cells (see, e.g., Vignali and Kuchroo, 2012; Nat. Immunol. 13:722-8). The precursor form of the IL-12 p40 subunit (NM 002187; P29460; also referred to as IL-12B, natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2) is 328 amino acids in length, while its mature form is 306 amino acids long. The precursor form of the IL- 12 p35 subunit (NM_000882; P29459; also referred to as IL-12A, natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1) is 219 amino acids in length and the mature form is 197 amino acids long. Id. The genes for the IL-12 p35 and p40 subunits reside on different chromosomes and are regulated independently of each other. Gately, MK et al., Annu Rev Immunol. 16: 495-521 (1998). Many different immune cells (e.g., dendritic cells, macrophages, monocytes, neutrophils, and B cells) produce IL-12 upon antigenic stimuli. The active IL-12 heterodimer is formed following protein synthesis. Id.

Due to its ability to activate both NK cells and cytotoxic T cells, IL- 12 protein has been studied as a promising anti-cancer therapeutic for several decades (see, e.g., Nastala, C. L. et al., J Immunol 153: 1697-1706 (1994)). But despite high expectations, early clinical studies did not yield satisfactory results (see, e.g., Lasek W. et al., Cancer Immunol Immunother 63: 419-435, 424 (2014)). These studies demonstrated that a significant issue with administration of systemic recombinant IL- 12 in cancer patients is its unpredictable pharmacokinetic profile, wherein tolerable doses of IL-12 therapy fails to provide adequate efficacy (see, e.g., Leonard et al (1997) Blood 90:2451; Tugues et al (2015) Cell Death Differ 22:237). Thus, there is a need in the art for an improved therapeutic approach for using IL-12 to treat tumors.

SUMMARY OF DISCLOSURE

In some aspects, the present disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of a lipid nanoparticle (LNP) encapsulated messenger RNA (mRNA) therapeutic agent, wherein the mRNA therapeutic agent comprises an open reading frame (ORF) encoding a human IL- 12 polypeptide, wherein the patient is administered a dose of 0.1 -12.0pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives an immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some aspects, the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor 21 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor once every four weeks. In some aspects, the patient receives the immune checkpoint inhibitor once every four weeks, wherein the patient receives a first dose of the immune checkpoint inhibitor at 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives a first dose of the immune checkpoint inhibitor on the same day as receiving the dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor every four weeks, wherein the patient receives the first dose of the immune checkpoint inhibitor on the same day as receiving the dose of the mRNA therapeutic agent.

In some aspects, the present disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of a lipid nanoparticle (LNP) encapsulated messenger RNA (mRNA) therapeutic agent, wherein the mRNA therapeutic agent comprises an open reading frame (ORF) encoding a linked monomeric human IL- 12p70 polypeptide, wherein the patient is administered a dose of 0.1-12.0μg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives a PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some aspects, the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist 21 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist once every four weeks. In some aspects, the patient receives the PD-L1 antagonist once every four weeks, wherein the patient receives a first dose of the PD-L1 antagonist at 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives a first dose of the PD-L1 antagonist on the same day as receiving the dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist every four weeks, wherein the patient receives the first dose of the PD-L1 antagonist on the same day as receiving the dose of the mRNA therapeutic agent.

In some aspects, the present disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL-12 polypeptide, wherein the patient is administered an initial dose of 0. 1- I 2,()ug of the mRNA therapeutic agent, and optionally an additional dose of 0. l-12.0pg of the mRNA therapeutic agent, wherein the patient receives an immune checkpoint inhibitor every 4 weeks after administration of the initial dose, or optional additional dose, of the mRNA therapeutic agent, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some aspects, the present disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered an initial dose of 0. l-12.0pg of the mRNA therapeutic agent, and optionally an additional dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient receives a PD-L1 antagonist every 4 weeks after administration of the initial dose, or optional additional dose, of the mRNA therapeutic agent, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some aspects, the PD-L1 antagonist is durvalumab. In some aspects, the patient receives durvalumab at a dose of 1500mg every four weeks. In some aspects, the patient receives durvalumab intravenously. In some aspects, the advanced or metastatic solid tumor is head and neck cancer.

Tn some aspects, the patient receives an initial dose of 0.1 pg of the mRNA therapeutic agent. In some aspects, the patient receives an initial dose of 0.3 pg of the mRNA therapeutic agent. In some aspects, the patient receives an initial dose of l.0μg of the mRNA therapeutic agent. In some aspects, the patient receives an initial dose of 8.0pg of the mRNA therapeutic agent. In some aspects, the patient receives an initial dose of 12.0pg of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor 21 days after the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor once every four weeks. In some aspects, the patient receives the immune checkpoint inhibitor once every four weeks, wherein the patient receives a first dose of the immune checkpoint inhibitor at 28 days, 21 days, 14 days, or 7 days after the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives a first dose of the immune checkpoint inhibitor on the same day as receiving the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor every four weeks, wherein the patient receives the first dose of the immune checkpoint inhibitor on the same day as receiving the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist 21 days after the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist once every four weeks. In some aspects, the patient receives the PD-L1 antagonist once every four weeks, wherein the patient receives a first dose of the PD-L1 antagonist at 28 days, 21 days, 14 days, or 7 days after the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives a first dose of the PD-L1 antagonist on the same day as receiving the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist every four weeks, wherein the patient receives the first dose of the PD-L1 antagonist on the same day as receiving the initial dose of the mRNA therapeutic agent.

In any of the foregoing or related aspects, the method comprises administering to the patient the at least one additional dose of 0. l-12.0pg of the mRNA therapeutic agent. In some aspects, the patient receives at least one additional dose of 0.1 pg of the mRNA therapeutic agent. In some aspects, the patient receives at least one additional dose of 0.3pg of the mRNA therapeutic agent. In some aspects, the patient receives at least one additional dose of l.0μg of the mRNA therapeutic agent. In some aspects, the patient receives at least one additional dose of 8.0pg of the mRNA therapeutic agent. In some aspects, the patient receives at least one additional of 12.0pg of the mRNA therapeutic agent. In some aspects, the at least one additional dose is administered to the patient 7-28 days, 7-21 days, 7-14 days, 14-28 days, 14-21 days, 21-28 days, 28 days, 21 days, 14 days or 7 days after the dose or the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the additional dose of the mRNA therapeutic agent. In some aspects, the at least one additional dose is administered to the patient 21 days after the dose or the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor 21 days after the additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor once every four weeks. In some aspects, the patient receives the immune checkpoint inhibitor once every four weeks, wherein the patient receives the first dose of the immune checkpoint inhibitor at 28 days, 21 days, 14 days, or 7 days after the at least one additional dose of the mRNA therapeutic agent. In some aspects, the patient receives a first dose of the immune checkpoint inhibitor on the same day as receiving the at least one additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor every four weeks, wherein the patient receives the first dose of the immune checkpoint inhibitor on the same day as receiving the at least one additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the additional dose of the mRNA therapeutic agent. In some aspects, the at least one additional dose is administered to the patient 21 days after the dose or the initial dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD- L1 antagonist 28 days, 21 days, 14 days, or 7 days after the additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist 21 days after the additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD- L1 antagonist once every' four weeks. In some aspects, the patient receives the PD-L1 antagonist once every four weeks, wherein the patient receives the first dose of the PD-L1 antagonist at 28 days, 21 days, 14 days, or 7 days after the at least one additional dose of the mRNA therapeutic agent. In some aspects, the patient receives a first dose of the PD-L1 antagonist on the same day as receiving the at least one additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist every four weeks, wherein the patient receives the first dose of the PD-L1 antagonist on the same day as receiving the at least one additional dose of the mRNA therapeutic agent.

In any of the foregoing or related aspects, the at least one additional dose of the mRNA therapeutic agent is administered to the patient in a dosing cycle of once every 28 days for 8 weeks. In some aspects, the at least one additional dose of the mRNA therapeutic agent is administered to the patient once every 8 weeks after the dosing cycle, and the patient receives the immune checkpoint inhibitor every 4 weeks after the dosing cycle. In some aspects, the at least one additional dose of the mRNA therapeutic agent is administered to the patient once every 8 weeks after the dosing cycle, and the patient receives the PD-L1 antagonist every 4 weeks after the dosing cycle.

In any of the foregoing or related aspects, the patient receives the immune checkpoint inhibitor on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose. In some aspects, the patient receives a first dose of the immune checkpoint inhibitor on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose.

In any of the foregoing or related aspects, the patient receives the PD-L1 antagonist on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose. In some aspects, the patient receives a first dose of the PD-L1 antagonist on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose.

In any of the foregoing or related aspects, the method comprises administering to the patient an additional dose of 0. 1 -12.0pg of the mRNA therapeutic agent, wherein the at least one additional dose is administered 21 days after the dose or initial dose of the mRNA therapeutic agent, wherein the PD-L1 antagonist is durvalumab, and wherein the patient receives durvalumab intravenously at a dose of 1500mg every 4 weeks after administration of the additional dose of the mRNA therapeutic agent. In some aspects, the patient receives durvalumab 21 days after the additional dose of the mRNA therapeutic agent is administered.

In any of the foregoing or related aspects, the method comprises (i) at least one additional dose of 0. 1-12.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administering the at least one additional dose every 28 days for 8 weeks, and (ii) at least one additional dose of 0.1 -12.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administering the at least one additional dose every 8 weeks for a specified period of time, wherein the additional doses of the mRNA therapeutic agent are the same or different, wherein the PD-L1 antagonist is durvalumab, and wherein the patient receives durvalumab intravenously at a dose of 1500mg every 4 weeks starting on the same day as the dose of the mRNA therapeutic agent.

In any of the foregoing or related aspects, the dose or the initial dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0μg; 0.1 to 3.0μg; 0.1-1.0μg; 0.1-0.3pg; 0.3 to 12.0μg; 0.3 to 8.0μg; 0.3 to 3.0 pg; 0.3 to l.0μg; 1.0 to 12.0pg; 1.0 to 8.0pg; 1.0 to 3.0pg; 3 0 to 12.0pg; 3.0 to 8.0μg; and 8.0 to 12.0pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is from 1.0 to 8.0pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 0.10 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 0.30 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 1.0 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 3.0 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 8.0 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 12.0 pg.

In any of the foregoing or related aspects, the at least one additional dose of the mRNA therapeutic agent is 0. l-12.0pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0pg; 0.1 to 3.0pg; 0.1-1.0μg; 0.1- 0.3pg; 0.3 to 12.0μg; 0.3 to 8.0μg; 0.3 to 3.0 pg; 0.3 to l.0μg; 1.0 to 12.0μg; 1.0 to 8.0μg; 1.0 to 3.0μg; 3.0 to 12.0μg; 3.0 to 8.0μg; and 8.0 to 12.0pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is from 1.0 to 8.0μg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 0.10 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 0.30 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 1.0 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 3.0 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 8.0 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 12.0 pg.

In some aspects, the present disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered an initial dose of 1.0-8.0pg of the mRNA therapeutic, and optionally (i) at least one additional dose of 1.0- 8.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some aspects, the present disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL-12 polypeptide, wherein the patient is administered an initial dose of 0. 1- I 2.()ug of the mRNA therapeutic, and optionally (i) at least one additional dose of 0. l-12.0pg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-12.0pg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some aspects, the present disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered an initial dose of 0. l-12.0pg of the mRNA therapeutic, and optionally (i) at least one additional dose of 0. 1- 12.0pg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-12.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some aspects, the PD-L1 antagonist is durvalumab. In some aspects, the patient receives durvalumab at a dose of 1500mg every four weeks. In some aspects, the patient receives durvalumab intravenously. In some aspects, the advanced or metastatic solid tumor malignancy CPI-refractory melanoma. In some aspects, the patient comprises two or more malignant lesions, and wherein the size of at least one non-injected malignant lesion is reduced by at least 30%.

In any of the foregoing or related aspects, the dose or the initial dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0μg; 0.1 to 3.0μg; 0.1-1.0μg; 0.1-0.3pg; 0.3 to 12.0μg; 0.3 to 8.0μg; 0.3 to 3.0 pg; 0.3 to l.0μg; 1.0 to 8.0μg; 1.0 to 3.0pg; and 3.0 to 8.0pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is from 1.0 to 8.0μg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 0. 1 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 0.3 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 1.0 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 3.0 pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 8.0 pg. In any of the foregoing or related aspects, at least one additional dose of the mRNA therapeutic agent is 0. 1-8.0μg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0μg; 0.1 to 3.0μg; 0.1-1.0μg; 0.1-0.3pg; 0.3 to 8.0μg; 0.3 to 3.0 pg; 0.3 to l.0μg; 1.0 to 8.0μg; 1.0 to 3.0μg; and 3.0 to 8.0μg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is from 1.0 to 8.0μg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 0.1 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 0.3 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 1.0 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 3.0 pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is 8.0 pg. In some aspects, the method comprises administering to the patient (i) the at least one additional dose every 28 days in the first dosing cycle for 8 weeks, and (n) the least one additional dose every 8 weeks in the second dosing cycle for the specified period of time. In some aspects, the first dosing cycle comprises three doses 28 days apart.

In any of the foregoing or related aspects, the dose or the initial dose of the mRNA therapeutic agent is selected from: 0.1-12.0pg; 0.1 to 8.0μg; 0.1 to 3.0 pg; 0.1 to l.0μg; 0.1 to 0.3pg; 0.3 to 12.0pg; 0.3 to 8.0pg; 0.3 to 3.0 pg; 0.3 to l.0μg; 1.0 to 12.0 pg; 1.0 to 8.0pg; 1.0 to 3.0pg; 3.0 to 12.0 pg; and 3.0 to 8.0pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is from 1.0 to 12.0pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is 12.0 pg.

In any of the foregoing or related aspects, the at least one additional dose of the mRNA therapeutic agent is 0. l-12.0pg. In some aspects, the at least one additional dose of the mRNA therapeutic agent is selected from: 0.1-12.0pg; 0.1 to 8.0pg; 0.1 to 3.0 pg; 0.1 to l.0μg; 0.1 to 0.3pg; 0.3 to 12.0pg; 0.3 to 8.0pg; 0.3 to 3.0 pg; 0.3 to l.0μg; 1.0 to 12.0 pg; 1.0 to 8.0pg; 1.0 to 3.0pg; 3.0 to 12.0 pg; and 3.0 to 8.0pg. In some aspects, the dose or the initial dose of the mRNA therapeutic agent is from 1.0 to 12.0pg.

In some aspects, the disclosure provides an mRNA therapeutic agent for use in a method of treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL- 12 polypeptide, wherein the patient is administered a dose of 0. 1-12.0 pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives an immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some aspects, the disclosure provides an mRNA therapeutic agent for use in a method of treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered a dose of 0. 1-12.0 pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives a PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some aspects, the disclosure provides an immune checkpoint inhibitor for use in a method of treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient an effective amount of the immune checkpoint inhibitor , wherein the patient is receiving, has received, or subsequently receives by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL- 12 polypeptide, wherein the patient is administered a dose of 0. 1-12.0 pg of the mRNA therapeutic agent, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some aspects, the disclosure provides a PD-L1 antagonist for use in a method of treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient an effective amount of the PD-L1 antagonist, wherein the patient is receiving, has received, or subsequently receives by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered a dose of 0. 1-12.0 pg of the mRNA therapeutic agent, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In any of the foregoing or related aspects, the dose of the mRNA therapeutic agent achieves a human plasma IL-12p70 maximum peak of about 3-5 pg/mL in the patient. In some aspects, the dose of the mRNA therapeutic agent achieves a human plasma or serum IL- 12p70 maximum peak of about 3-450 pg/mL in the patient. In some aspects, the initial dose of the mRNA therapeutic agent achieves a human plasma IL-12p70 maximum peak of about 3-5 pg/mL in the patient. In some aspects, the initial dose of the mRNA therapeutic agent achieves a human plasma or serum IL-12p70 maximum peak of about 3-450 pg/mL in the patient. In some aspects, the at least one additional dose of the mRNA therapeutic agent achieves a human plasma IL-12p70 maximum peak of about 3-5 pg/mL in the patient. In some aspects, the at least one additional dose of the mRNA therapeutic agent achieves a human plasma or serum IL-12p70 maximum peak of about 3-450 pg/mL in the patient.

In any of the foregoing or related aspects, the dose of the mRNA therapeutic agent achieves a human plasma or serum IFNy maximum peak of about 3-3100 pg/mL in the patient. In some aspects, the initial dose of the mRNA therapeutic agent achieves a human plasma or serum IFNy maximum peak of about 3-3100 pg/mL in the patient. In some aspects, the additional dose of the mRNA therapeutic agent achieves a human plasma or serum IFNy maximum peak of about 3-3100 pg/mL in the patient.

In any of the foregoing or related aspects, the patient comprises at least two malignant lesions, wherein one malignant lesion is an injected malignant lesion and one malignant lesion is a non-injected malignant lesion. In some aspects, the patient has at least two malignant lesions, wherein one malignant lesion is an injected malignant lesion and one malignant lesion is anon-injected malignant lesion. In some aspects, the treatment results in a reduction in malignant lesion size. In some aspects, the size of a malignant lesion is reduced by at least 10%, at least 20%, at least 30%, at least 40% , at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some aspects, the malignant lesion is reduced by at least 30%. In some aspects, the treatment results in a reduction in size of the non-injected malignant lesion. In some aspects, the size of the non-injected malignant lesion is reduced by at least 10%, at least 20%, at least 30%, at least 40% , at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some aspects, the malignant lesion size is determined by imaging or visual inspection. In some aspects, the malignant lesion size is determined by RECIST vl . l . In some aspects, the malignant lesion is a cutaneous, a subcutaneous, or a deep-seated malignant lesion. In some aspects, the malignant lesion is a deep-seated tumor lesion, and wherein the dose or the initial dose, and optionally at least one additional dose, is administered to the deep-seated malignant lesion via image guided-inj ection. In some aspects, the at least two malignant lesions comprise an injected malignant lesion and one or more noninjected malignant lesions, wherein the injected malignant lesion, and optionally the one or more non-injected malignant lesions, comprises a cutaneous or subcutaneous lesion. In some aspects, the cutaneous or subcutaneous lesion is a cancer selected from melanoma, head and neck cancer, colorectal cancer, breast cancer, pancreatic cancer, non-small-cell lung cancer, vulvar cancer, bladder cancer, gastric cancer, squamous cell carcinoma, and cervical cancer. In some aspects, the cutaneous or subcutaneous lesion is a melanoma. In some aspects, the cutaneous or subcutaneous lesion is a head and neck cancer. In some aspects, the at least two malignant lesions comprise an injected malignant lesion and one or more non-injected malignant lesions, wherein the injected malignant lesion, and optionally the one or more noninjected malignant lesions, comprises a deep-seated lesion. In some aspects, the deep-seated lesion is a cancer selected from melanoma, colorectal cancer, pancreatic cancer, gastric cancer, and anal cancer. In some aspects, the at least two malignant lesions comprise one or more hepatic metastases. In some aspects, the at least two malignant lesions comprise one or more brain metastases. In some aspects, the patient has at least one malignant lesion (e.g., an injected and/or non-injected malignant lesion) comprising a cutaneous or subcutaneous lesion and at least one malignant lesion comprising one or more hepatic metastases. In some aspects, the patient has at least one malignant lesion (e.g., an injected and/or non-injected malignant lesion) comprising a cutaneous or subcutaneous lesion and at least one malignant lesion comprising one or more brain metastases. In some aspects, the patient has at least one malignant lesion (e.g., an injected and/or non-injected malignant lesion) comprising a deep- seated lesion and at least one malignant lesion comprising one or more hepatic metastases. In some aspects, the patient has at least one malignant lesion (e.g., an injected and/or non- injected malignant lesion) comprising a deep-seated lesion and at least one malignant lesion comprising one or more brain metastases.

In any of the foregoing or related aspects, administering the mRNA therapeutic agent does not result in an adverse event to discontinue treatment. In some aspects, administering the mRNA therapeutic agent is tolerated in a patient. In some aspects, the treatment results in stable disease, a partial response, or a complete response in the patient. In some aspects, the treatment results in stable disease for at least 12 weeks in the patient. In some aspects, the treatment results in a duration of response (e g., duration of stable disease or a partial response, e.g., from the time of receiving a first dose of the mRNA therapeutic agent to the time of disease progression or death) of at least about 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months. In some aspects, the duration of response is about 1 month to about 24 months, about 2 months to about 24 months, about 3 months to about 24 months, about 4 months to about 24 months, about 5 months to about 24 months, or about 6 months to about 24 months. In some aspects, the treatment results in increased survival of the patient. In some aspects, the mRNA therapeutic agent increases IL-12 and/or IFNy protein expression in the serum or plasma of the patient. In some aspects, the mRNA therapeutic agent increases expression of one or more IFNy-inducible chemokines in the serum or plasma of the patient. In some aspects, the one or more IFNy-inducible chemokines is selected from CXCL9, CXCL10, CXCL11 and a combination thereof. In some aspects, the mRNA therapeutic agent increases expression of one or more mediators of CD8+ T cell activity in the serum or plasma of the patient. In some aspects, the one or more mediators are selected from granzyme B, perforin, IFNy, IL 12 receptor, CD38, and a combination thereof. In some aspects, the increase positively correlates with expression of CD8a in the serum or plasma of the patient. In some aspects, the mRNA therapeutic agent increases intratumoral CD8+ T cell levels in the patient. In some aspects, the mRNA therapeutic agent increases PD-L1 expression in tumor epithelium of the patient. In some aspects, the mRNA therapeutic agent increases intratumoral T cell proliferation in the patient. In some aspects, the mRNA therapeutic agent increases intratumoral expression of one or more mediators of CD8+ T cell activity. In some aspects, the one or more mediators are selected from granzyme B, perforin, IFNy, IL12 receptor, CD38, and a combination thereof. In some aspects, the increase positively correlates with intratumoral expression of CD8a. In some aspects, the mRNA therapeutic agent increases intratumoral expression of one or more IFNy-inducible chemokines. In some aspects, the one or more IFNy-inducible chemokines are selected from CXCL9, CXCL10, CXCL11, and a combination thereof. In some aspects, the mRNA therapeutic agent increases intratumoral expression of one or more mediators of a Thl response. In some aspects, the one or more mediators of a Thl response are selected from T-Box Transcription Factor 21 (TBX21), Signal Transducer And Activator Of Transcription 4 (STAT4), CXCR3, and a combination thereof. In some aspects, the mRNA therapeutic agent increases intratumoral expression of one or more mediators of dendritic cell activation. In some aspects, the one or more mediators are selected from CD80, CD83, CD86, and a combination thereof. In some aspects, the mRNA therapeutic agent increases intratumoral expression of one or more mediators of natural killer (NK) cell activation. In some aspects, the one or more mediators are selected from KLRB1, KLRK1, and a combination thereof. In some aspects, the mRNA therapeutic agent increases intratumoral expression of one or more mediators of antigen presenting cells. In some aspects, the one or more mediators is selected from IFNy Receptor 1 (IFNGR1), IFNGR2, and a combination thereof. In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1 - 12.0pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives an immune checkpoint inhibitor, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL- 12 polypeptide.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable earner, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives a PD-L1 antagonist, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a linked monomeric human IL-12p70 polypeptide. In some aspects, the container comprises a vial comprising 0.8mL of a dispersion comprising the LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable buffer. In some aspects, the dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0pg; 0.1 to 3.0pg; 0.1-1.0μg; 0.1-0.3pg; 0.3 to 12.0pg; 0.3 to 8.0pg; 0.3 to 3.0pg; 0.3 to l.0μg; 1.0 to 12.0pg; 1.0 to 8.0pg; 1.0 to 3.0pg; 3.0 to 12.0pg; 3.0 to 8.0pg; and 8.0 to 12.0pg. In some aspects, the dose of the mRNA therapeutic agent is 0. l0μg, 0.30pg, l.0μg, 3.0pg, 8.0pg, or 12.0pg. In some aspects, the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor once every four weeks. In some aspects, the patient receives the immune checkpoint inhibitor on the same day as receiving the dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist once every four weeks. In some aspects, the patient receives the PD-L1 antagonist on the same day as receiving the dose of the mRNA therapeutic agent.

In any of the foregoing or related aspects, the treatment further comprises administering at least one additional dose of the mRNA therapeutic agent to the patient. In some aspects, the treatment comprises administering the at least one additional dose 7-28 days, 7-21 days, 7-14 days, 14-28 days, 14-21 days, 21-28 days, 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the dose or the at least one additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the immune checkpoint inhibitor once every four weeks. In some aspects, the patient receives the immune checkpoint inhibitor on the same day as receiving the at least one additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the dose or the at least one additional dose of the mRNA therapeutic agent. In some aspects, the patient receives the PD-L1 antagonist once every four weeks. In some aspects, the patient receives the PD-L1 antagonist on the same day as receiving the at least one additional dose of the mRNA therapeutic agent. In some aspects, the at least one additional dose of the mRNA therapeutic agent is administered to the patient in a dosing cycle of every 28 days for 8 weeks. In some aspects, the at least one additional dose of the mRNA therapeutic agent is administered to the patient every 8 weeks after the dosing cycle, and the patient receives the immune checkpoint inhibitor every 4 weeks after the dosing cycle. In some aspects, the at least one additional dose of the mRNA therapeutic agent is administered to the patient every 8 weeks after the dosing cycle, and the patient receives the PD-L1 antagonist every 4 weeks after the dosing cycle. In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 0. 1 - 12. Opig of the mRNA therapeutic agent, and optionally at least one additional dose of 0 1-12.0μg of the mRNA therapeutic agent, wherein the patient subsequently receives an immune checkpoint inhibitor every 4 weeks after administration of the initial dose, or optional additional dose, of the mRNA therapeutic agent, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL- 12 polypeptide.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 0. l-12.0pg of the mRNA therapeutic agent, and optionally at least one additional dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD- L1 antagonist every 4 weeks after administration of the initial dose, or optional additional dose, of the mRNA therapeutic agent, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a linked monomeric human IL-12p70 polypeptide.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 1.0-8.0μg of the mRNA therapeutic agent, and optionally (i) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL- 12 polypeptide.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by mtratumoral injection at an initial dose of 1.0-8.0μg of the mRNA therapeutic agent, and optionally (i) at least one additional dose of 1.0-8. Ong of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a linked monomeric human IL-12p70 polypeptide.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 0. l-12.0pg of the mRNA therapeutic agent, and optionally (i) at least one additional dose of 0. l-12.0pg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 0. 1 - 12.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL- 12 polypeptide.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 0. 1 -12.0pg of the mRNA therapeutic agent, and optionally (i) at least one additional dose of 0. l-12.0 g of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 0.1-12.0pg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a linked monomeric human IL-12p70 polypeptide.

In any of the foregoing or related aspects, the immune checkpoint inhibitor is a PD-L1 antagonist. In some aspects, the immune checkpoint inhibitor is a PD-1 antagonist. In some aspects, the immune checkpoint inhibitor is a CTLA4 antagonist.

In any of the foregoing or related aspects, the PD-L1 antagonist is an anti-PD-1 antibody or an anti-PD-Ll antibody. In some aspects, the anti-PD-1 antibody is selected from nivolumab, pembrolizumab, and cemiplimab. In some aspects, the anti-PD-Ll antibody is selected from atezolizumab, avelumab, durvalumab, and envafolimab. In some aspects, the PD-L1 antagonist is durvalumab. In some aspects, the patient receives the PD-L1 antagonist intravenously. In some aspects, the patient receives the PD-L1 antagonist at a dose of 1500mg. In some aspects, the PD-L1 antagonist is durvalumab and the patient receives durvalumab at a dose of 1500mg every 4-8 weeks.

In any of the foregoing or related aspects, the advanced or metastatic solid tumor malignancy is selected from melanoma, breast cancer, head and neck cancer, non-small-cell lung cancer, colorectal cancer, gastric cancer, and bladder cancer. In some aspects, the advanced or metastatic solid tumor malignancy is selected from melanoma, breast cancer, head and neck cancer, non-small-cell lung cancer, colorectal cancer, gastric cancer, bladder cancer, anal cancer, cervical cancer, pancreatic cancer, squamous cell carcinoma, and vulvar cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises melanoma. In some aspects, the advanced or metastatic solid tumor malignancy comprises breast cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises head and neck cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises non-small-cell lung cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises colorectal cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises gastric cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises bladder cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises anal cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises cervical cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises pancreatic cancer. In some aspects, the advanced or metastatic solid tumor malignancy comprises squamous cell carcinoma. In some aspects, the advanced or metastatic solid tumor malignancy comprises vulvar cancer. In some aspects, the advanced or metastatic solid tumor malignancy is head and neck cancer. In some aspects, the advanced or metastatic solid tumor malignancy is refractory to immune checkpoint inhibitor (CPI) therapy. In some aspects, the advanced or metastatic solid tumor malignancy is CPI-refractory melanoma. In some aspects, the immune CPI therapy is PD-1 inhibition, PD-L1 inhibitor, or CTLA-4 inhibition.

In any of the foregoing or related aspects, the patient has received at least one treatment prior to administering the mRNA therapeutic. In some aspects, the at least one treatment is selected from surgery, chemotherapy, radiation, and immunotherapy.

In any of the foregoing or related aspects, the human IL- 12 polypeptide comprises an IL-12A polypeptide operably linked, with or without a linker, to an IL-12B polypeptide. In some aspects, the human IL-12 polypeptide comprises an IL-12A polypeptide operably linked with a linker to an IL-12B polypeptide. In some aspects, the human IL- 12 polypeptide comprises a an IL-12A polypeptide operably linked without a linker to an IL-12B polypeptide. In some aspects, the human IL-12 polypeptide comprises a heterologous signal peptide. In some aspects, the human IL-12 polypeptide comprises a human IL-12B signal peptide (e.g., a human IL-12B signal peptide comprising the amino acid sequence of SEQ ID NO: 8). In some aspects, the ORF comprises from 5’ to 3’ a nucleotide sequence selected from the group consisting of: (i) a nucleotide sequence encoding the IL-12B polypeptide, a nucleotide sequence encoding a peptide linker, and a nucleotide sequence encoding the IL- 12A polypeptide; (ii) a nucleotide sequence encoding the IL-12B polypeptide, and a nucleotide sequence encoding the IL-12A polypeptide; (m) a nucleotide sequence encoding the IL-12A polypeptide, a nucleotide sequence encoding a peptide linker, and a nucleotide sequence encoding the IL-12B polypeptide; and (iv) a nucleotide sequence encoding the IL- 12A polypeptide, and a nucleotide sequence encoding the IL-12B polypeptide. In some aspects, the ORF comprises a nucleotide sequence encoding a signal peptide located at the 5' terminus of the ORF In some aspects, the peptide linker is a Gly/Ser linker. In some aspects, the human IL-12 polypeptide comprises the amino acid sequence of SEQ ID NO: 5. In some aspects, the mRNA comprises (i) a 3’ untranslated region (UTR); (ii) a 5’ UTR; and (iii) a polyA tail. In some aspects, the 3’ UTR comprises a miR-122-5p binding site. In some aspects, the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 4. In some aspects, the 5’ UTR comprises the nucleotide sequence of SEQ ID NO: 3. In some aspects, the ORF comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 2. In some aspects, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some aspects, the mRNA comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 1. In some aspects, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some aspects, the mRNA comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 19. In some aspects, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19.

In any of the foregoing or related aspects, the linked monomeric human IL-12p70 polypeptide comprises an IL-12A polypeptide operably linked, with or without a linker, to an IL-12B polypeptide. In some aspects, the IL-12A polypeptide is operably linked to the IL- 12A polypeptide without a linker. In some aspects, the 1L-12A polypeptide is operably linked to the IL-12A polypeptide with a linker. In some aspects, the linked monomeric human IL- 12p70 polypeptide comprises a heterologous signal peptide. In some aspects, the linked monomeric human IL-12p70 polypeptide comprises a human IL-12B signal peptide. In some aspects, the human IL-12B signal peptide comprises the amino acid sequence of SEQ ID NO: 8. In some aspects, the ORF comprises from 5’ to 3’ a nucleotide sequence selected from the group consisting of: (i) a nucleotide sequence encoding the IL-12B polypeptide, a nucleotide sequence encoding a peptide linker, and a nucleotide sequence encoding the IL-12A polypeptide; (ii) a nucleotide sequence encoding the IL-12B polypeptide, and a nucleotide sequence encoding the IL-12A polypeptide; (iii) a nucleotide sequence encoding the IL-12A polypeptide, a nucleotide sequence encoding a peptide linker, and a nucleotide sequence encoding the IL-12B polypeptide; and (iv) a nucleotide sequence encoding the IL-12A polypeptide, and a nucleotide sequence encoding the IL-12B polypeptide. In some aspects, the ORF comprises a nucleotide sequence encoding a signal peptide located at the 5’ terminus of the ORF. In some aspects, the peptide linker is a Gly/Ser linker. In some aspects, the linked monomeric human IL-12p70 polypeptide comprises the amino acid sequence of SEQ ID NO: 5. In some aspects, the mRNA comprises (i) a 3’ untranslated region (UTR); (ii) a 5’ UTR; and (iii) a polyA tail. In some aspects, the 3’ UTR comprises a miR-122-5p binding site. In some aspects, the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 4. In some aspects, the 5’ UTR comprises the nucleotide sequence of SEQ ID NO: 3. In some aspects, the ORF comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 2. In some aspects, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some aspects, the mRNA comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 1. In some aspects, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some aspects, the mRNA comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 19. In some aspects, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19.

In any of the foregoing or related aspects, the mRNA comprises a modified nucleotide. In some aspects, the mRNA is fully modified with chemically -modified uridines. In some aspects, 100% of the uridines of the mRNA are chemically -modified uridines. In some aspects, the chemically-modified uridines are N1 -methylpseudouridines (ml'P).

In any of the foregoing or related aspects, the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some aspects, the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some aspects, the LNP comprises a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid. In some aspects, the LNP comprises a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some aspects, the ionizable lipid is Compound II, the phospholipid is DSPC, the sterol is cholesterol, and the PEG-modified lipid is PEG DMG.

BRIEF DESCRIPTION OF THE FIGURES

FIGs. 1A-1B are graphs showing the in vivo anti-tumor efficacy of a single intratumoral dose of IL 12 mRNA (4 pg) in a lipid nanoparticle (LNP) administered to mice bearing adenocarcinoma (MC38) tumors. FIG. 1A shows the tumor volume means (mm³), up to day 24, starting at day 10 post implantation. Group 1 (circles) represents mice (n = 7) administered 4 pg IL 12 mRNA LNP at day 10 post-implantation; Group 2 (squares) represents mice (n = 7) administered 4 pg of control mRNA encoding non-translated factor IX (NST-FIX LNP); and Group 3 (triangles) represents another control group of mice (n = 7) administered PBS. FIG. IB shows the individual tumor volumes (mm³) for each group of mice, up to day 47, starting at day 10 post implantation. Complete responses (CR) were achieved in 3 of 7 (44%) animals administered 4 pg IL 12 mRNA LNP (circles). FIG. 2A is a graph showing in vivo anti -tumor efficacy of a single dose of 0.5 pg IL 12 mRNA in MC3-based lipid nanoparticle (LNP) administered to mice bearing A20 B- cell lymphoma tumors. Complete responses (CR) were achieved in 3 of 12 mice.

FIG. 2B is a graph showing enhanced in vivo anti-tumor efficacy in a B-cell lymphoma tumor model (A20) by administering multiple doses of 0.5 pg IL12 mRNA in MC3-based lipid nanoparticle (LNP) to mice bearing A20 tumors. Complete responses (CR) were achieved in 5 out of 12 mice administered weekly dosing of 0.5 pg IL12 for seven (7) days x 6.

FIG. 2C is a graph showing the in vivo anti-tumor efficacy of weekly intratumoral doses of 0.5 pg IL 12 mRNA in lipid nanoparticle (LNP) (i.e., Compound II) administered to mice bearing A20 B-cell lymphoma tumors. Complete responses (CR) were also achieved in 5 out of 12 animals.

FIGs. 2D-2E are graphs showing tumor growth in mice bearing A20 tumors administered weekly dosing (7 days x 6) of 0.5 pg non-translated negative control mRNA (NST) in MC3-based lipid nanoparticle (LNP) (FIG. 2D) and 0.5 pg non-translated negative control mRNA (NST) in Compound Il-based LNP (FIG. 2E).

FIGs. 3A-3B are graphs showing dose-dependent levels of IL12 (FIG. 3A) and IFNy (FIG. 3B) in plasma at 24 hours following intratumoral administration of the indicated doses of IL12 mRNA to mice bearing tumors. From left to right, the mice were given (i) no treatment, (ii) 5 pg NST, (iii) 0.05 pg IL12, (iv) 0.5 pg IL12, (v) 5 pg IL12, (vi) 5 pg NST, (vii) 0.5 pg IL12 (4 doses), (viii) 2.5 pg IL12 (4 doses), and (ix) 5 pg IL12 (4 doses)

FIG. 4A-4D are graphs showing individual tumor volumes through 75 days following a single dose of IL12 mRNA to mice bearing MC38-R tumors. Mice were given 0.05 pg IL12 mRNA (FIG. 4A), 0.5 pg IL12 mRNA (FIG. 4B), 5 pg IL12 mRNA (FIG. 4C), or NST (FIG. 4D)

FIG. 4E-4J are graphs showing individual tumor volumes through 75 days following a single dose or multiple doses of IL12 mRNA to mice bearing MC38-R tumors. Mice were given a single dose of 0.05 pg IL12 mRNA (FIG. 4E), a single dose of 0.5 pg IL12 mRNA (FIG. 4F), a single dose of 5 pg IL 12 mRNA (FIG. 4G), multiple doses of 0.05 pg IL 12 mRNA (FIG. 4H), multiple doses of 0.5 pg IL12 mRNA (FIG. 41), or multiple doses of 5 pg IL 12 mRNA (FIG. 4 J).

FIG. 5 is a Kaplan-Meier curve showing the percent survival of mice treated with LNPs carrying IL12 mRNA compared to NST-OX40L negative controls. The graph shows survival to day 80 post implantation with MC38-R tumor. FIGs. 6A-6B are graphs showing individual tumor volumes through 55 days following administration of anti-PD-Ll antibody to mice bearing MC38-R tumors. Mice were given an antibody control (FIG. 6A) or an anti-PD-Ll antibody (clone 80) (FIG. 6B).

FIGs. 6C-6G are graphs showing individual tumor volumes in mice bearing MC38-R tumors through 90 days following administration of IL12 mRNA alone or in combination with an anti-PD-Ll antibody. Mice were given (i) a single iTu dose of 0.5 pg IL12 mRNA as a monotherapy (FIG. 6C), (ii) a single iTu dose of 5.0 pg IL12 miR122 as a monotherapy (FIG. 6D), (iii) a single iTu dose of 0.5 pg IL12 miR122 in combination with multiple intraperitoneal doses of anti-PD-Ll antibody (FIG. 6E), (iv) a single iTu dose of 5.0 pg IL12 mRNA in combination with multiple intraperitoneal doses of anti-PD-Ll antibody (FIG. 6F); or (v) multiple intraperitoneal doses of anti-PD-Ll antibody (FIG. 6G).

FIGs. 7A-7C are graphs showing individual tumor volumes through 75 days. Mice bearing MC38-R tumors were treated 10 days post implant with an anti-PD-Ll antibody alone (FIG. 7A), 0.5 pg IL12 mRNA alone (FIG. 7B), or both an anti-PD-Ll antibody and 0.5 pg IL12 mRNA (FIG. 7C). The anti-PD-Ll antibody was administered over 6 doses. Vertical dashed lines indicate dose days.

FIGs. 8A-8D are graphs showing individual tumor volumes through 70 days. Mice bearing B16F10-AP3 tumors were treated 10 days post implant with a negative control (FIG. 8A), an anti-PD-Ll antibody alone (FIG. 8B), a single dose of 0.5 pg IL 12 mRNA alone (FIG. 8C), or with both an anti-PD-Ll antibody and 0.5 pg IL12 mRNA (FIG. 8D). The anti-PD-Ll antibody was administered over 6 doses. Vertical dashed lines indicate dose days.

FIG. 9A is a schematic of a mouse implanted bilaterally with tumor cells. FIGs. 9B- 9G are graphs showing individual tumor volumes in bilaterally implanted MC38-S mice through 60 days in treated (FIG. 9B, 9D, and 9F) and distal (FIG. 9C, 9E, and 9G) tumors following treatment with a negative control (NST mRNA plus isotype antibody control) (FIGs. 9B-9C), 0.5 pg IL12 mRNA (FIGs. 9D-9E), or 5 pg IL12 mRNA (FIGs. 9F-9G). Vertical dashed lines indicate dose days.

FIGs. 10A-10F are graphs showing individual tumor volumes in bilaterally implanted MC38-S mice through 60 days following treatment with no active mRNA (NST mRNA) (FIGs. 10A-10B), 0.5 pg IL12 mRNA (FIGs. 10C-10D), or 5 pg IL12 mRNA (FIGs. 10E- 10F), combined with either an isotype control antibody (FIG. 10A, 10C, or 10E) or an anti- PD-Ll antibody (FIG. 10B, 10D, or 10F). Vertical dashed lines indicate dose days.

FIGs. 11A-11B are schematics depicting the clinical study design to evaluate huIL- 12_mRNA_01 (mRNA encoding single chain IL- 12) administered in combination with durvalumab (anti-PD-Ll). FIG. 11A shows design of the dose-escalation phase (Phase 1, with three sub-parts A, B, and D) and FIG. 11B shows design of the dose-expansion phase. In Part 1A (sequential treatment), patients having cutaneous/subcutaneous (C/SC) lesions received an intratumoral injection of huIL-12_mRNA_01 on Days 1 and 22 and an intravenous injection of durvalumab (1500 mg) on Day 43 and then every 4 weeks (Q4W). In Part IB (concurrent treatment), patients having C/SC lesions received an intratumoral injection of huIL-12_mRNA_01 on Days I, 29, 57, and then every 8 weeks (Q8W), and an intravenous injection of durvalumab (1500 mg) on Day 1 and then Q4W. In Part ID (concurrent treatment), patients having deep-seated lesions receive the therapeutic regimen of Part IB.

FIGs. 11C-11D are schematics depicting the enrollment status of the clinical study shown in FIGs. 11A-11B.

FIG. HE is a schematic showing the study dosing scheme for Part 1A and Part IB of the clinical study design depicted in FIG. 11A and FIG. 11C. In Part 1A, for subjects whose lesions no longer meet the criteria for huIL-12_mRNA_01 injection or who have complete response (CR) at Day 22, durvalumab is started on Day 22 and repeated Q4W. In Part IB, hu- IL-12_mRNA_01 dosing is omitted for subjects whose lesions no longer meet criteria for huIL-12_mRNA_01 injection, or who have CR following at least one huIL-12_mRNA_01 injection, optionally with continuation of durvalumab administration. If a lesion subsequently becomes available for injection, then huIL-12 mRNA 01 administration continues at the next scheduled administration. DLT = dose limiting toxicity.

FIG. 12 is a graph showing the best change in target lesion size per RECIST 1.1 in 31 patients that received sequential huIL-12_mRNA_01 and durvalumab (Part 1A doseescalation cohort; huIL-12_mRNA_01 0.1-12 pg; n=20) or concurrent huIL-12_mRNA_01 and durvalumab (Part IB dose-escalation cohort; huIL-12_mRNA_01 1.0 or 3.0 pg; n=l l). Patient demographics and disease characteristics are provided in Table 3. CR = Complete response; PR = partial response; SD = stable disease; PD = progressive disease.

FIG. 13A is a graph showing serum IL- 12 levels in pg/mL (left) and fold change from baseline (right) across Part 1A or Part IB dose cohorts. Serum samples were obtained prior to the start of treatment (screening visit; SCR) and at visit 2-8 (V2-V8). For Part 1 A, V2-V8 corresponds to day 1, 2, 8, 15, 22, 23 and 43 respectively as depicted by the dosing scheme shown in FIG. HE. For Part IB, V2-V8 correspond to day 1, 2, 8, 15, 29, 30, and 42 respectively. Points and error bars show mean ± SD. FIG. 13B is a graph showing serum IFNy levels in pg/rnL (left) and fold change from baseline (right) across Part 1A or Part IB dose cohorts. Serum samples collected at time points as described in FIG. 13 A. Number of patients analyzed as described in FIG. 13 A. Points and error bars show mean ± SD.

FIGs. 14A-14B are graphs showing intratumoral CD3+ T cell density in cells/mm² measured by immunohistochemistry in patient tumor biopsies and quantified by a study pathologist. FIG. 14A shows cells/mm² at baseline and visit 5 (V5; Day 15) with each line representing a patient. FIG. 14B shows fold-change at V5 relative to baseline for each dose cohort (horizontal lines represent medians, and dotted lines represent the cutoff set at >2 -fold increase).

FIGs. 15A-15B are graphs showing intratumoral CD8+ T cell density in cells/mm² measured by immunohistochemistry in patient tumor biopsies and quantified by the study pathologist. FIG. 15A shows cells/mm² at baseline and visit 5 (V5; Day 15) with each line representing a patient. FIG. 15B shows fold-change at V5 relative to baseline for each dose cohort (horizontal lines represent medians, and dotted lines represent the cutoff set at >2 -fold increase).

FIGs. 16A-16B are graphs showing percentage of PD-L1 -positive tissue in tumor epithelium as measured by immunohistochemistry of patient tumor biopsies and quantification by the study pathologist. FIG. 16A shows percentage of tissue positive for PD- L1 at baseline and V5, with each line representing a patient. FIG. 16B shows fold-change at V5 relative to baseline for each dose cohort (horizontal lines represent medians, and dotted lines represent the cutoff set at >2 -fold increase).

FIGs. 17A-17B are graphs showing percentage of Ki-67 -positive T-cells in tumor epithelium tissue as measured by immunohistochemistry of patient tumor biopsies and quantification by the study pathologist. FIG. 17A shows density of Ki-67 positive T-cells in cells/mm² at baseline and V5, with each line representing a patient. FIG. 17B shows foldchange at V5 relative to baseline for each dose cohort (horizontal lines represent medians, and dotted lines represent the cutoff set at >2 -fold increase).

FIGs. 18A-18B are graphs showing median concentration (pg/mL) of IL-12 (FIG. ISA) and IFNy (FIG. 18B) measured in serum collected from human patients at different time points in the dosing cohorts shown in FIG. 11C. “PartlA_0. 1” refers to Part 1A (sequential mRNA + durvalumab) Cohort 1 (0.1 pg; n=4); “PartlA_0.3” refers to Part 1A Cohort 2 (0.3 pg; n=3); “PartlA 1.0” refers to Part 1A Cohort 3 (1 pg; n=3); “Parti A 3.0” refers to Part 1 A Cohort 4 (3 pg; n=4); “PartlA_8.0” refers to Part 1A Cohort 5 (8 pg; n=3); “Parti A_12.0” refers to Part 1A Cohort 6 (12 ig; n=6); “PartlB_1.0” refers to Part IB (concurrent mRNA + durvalumab) Cohort 1 (1 pig; n=9); “PartlB_3.0” refers to Part IB Cohort 2 (3pig, n=5); “PartlB_8.0” refers to Part IB Cohort 2 (8 pig, n=3); and “PartlB_12.0” refers to Part IB Cohort 2 (12pig, n=l). The graphs are labeled to indicate the time points at which huIL-12_mRNA_01 (“M”) and durvalumab (“D”) were administered. For the x-axis, VI represents a time point prior to huIL-12_mRNA_01 administration; V2, V3, V4, V5, and V6 respectively represent time points approximately 24 hours, 2 days, 8 days, and 15 days after the first dose of huIL-12_mRNA_01; V6 represents a time point approximately 22 days (Part 1A) or 29 days (Part IB) after the first dose of huIL-12_mRNA_01; V7 represents a time point approximately 24 hours after the second dose of huIL-12_mRNA_01 (i.e., 23 days (Part 1A) or 30 days (Part IB) after the first dose of huIL-12 mRNA 01); and V8, V9, V12, V13, and V15 respectively represent a time point at 43 days (Part 1A) or 42 days (Part IB), 71 days (Part 1A) or 57 days (Part IB), 155 days (Part 1A) or 85 days (Part IB), 183 days (Part 1A) or 113 days (Part IB), and 239 days (Part 1 A) or 141 days (Part IB) after the first dose of huIL-12_mRNA_01. Lines indicate the median concentration per cohort, with the shaded areas indicating 95% confidence interval around the median for dosing cohorts having n>l.

FIGs. 19A-19B provide graphs showing median concentration (pg/mL) of IFN- inducible chemokines (CXCL9, CXCL10, and CXCL11) (FIG. 19A) and median expression of gene transcripts encoding the chemokines (FIG. 19B) in serum collected from human patients in dosing cohorts as indicated in FIGs. 18A-18B. Expression of gene transcripts was measured by RNAseq and presented as log2 of the transcript count per million (Log2TPM). Lines indicate the median concentration per cohort, with the shaded areas indicating 95% confidence interval around the median when n>l. The x-axis indicates visit days on which serum samples were collected for evaluation and correspond to study time points as described in FIGs. 18A-18B.

FIG. 20 provides graphs showing expression of gene transcripts encoding proteins associated with T cell activation and cytotoxic activity (granzyme B (GZMB); Perforin (PRF1); IFNgamma (IFNG); IL12 receptor beta 1 (IL12RB1); IL12 receptor beta 2 (IL12RB2); and CD38) versus expression of gene transcript encoding CD8a (CD8A) as measured in blood collected on V3 (approximately 2 days after first dose of huIL- 12_mRNA_01) from human patients in dosing cohorts as indicated in FIGs. 18A-18B. Expression of gene transcripts was measured by RNAseq and presented as Log2TPM. Each symbol represents a measurement in blood collected from a patient that had a partial response (“PR”; n=3), stable disease (“SD”; n=9), or progressive disease (“PD”; n=10) following the therapeutic regimen. Shown are significant correlations between expression of the indicated gene transcript and CD8A (Pearson’s correlation, R>0.5, p<0.05).

FIG. 21 provides graphs showing median expression of gene transcripts encoding proteins associated with T cell activation and cytotoxic activity (granzyme B (GZMB), Perforin (PRF1), IFNgamma (IFNG), IL12 receptor beta (IL12RB1, IL12RB2) and CD38) in blood collected at different time points from patients in dosing cohorts as indicated in FIGs. 18A-18B that had a PR, SD, or PD. Gene expression was measured by RNAseq and presented as Log2TPM. Circles represent an increase in gene expression over time in PR patients. Asterix represents a significant difference between PR/SD patients and PD patients. Lines indicate the median concentrations per cohort, and the shaded areas represent the 95% confidence interval around the median for dosing cohorts with n>l.

FIG. 22 provides graphs showing median expression of gene transcripts encoding proteins associated with T cell exhaustion and Treg and myeloid derived suppressor cells (MDSC) suppressive functions (FoxP3, IL10, Arginase 1 (ARG1), STAT3, PD-1, and TIGIT) in blood collected at different time points from patients in dosing cohorts as indicated in FIGs. 18A-18B that had a PR, SD, or PD. Gene expression was measured by RNAseq and presented as Log2TPM. Circles represent an increase in expression of the indicated gene transcript in patients that had a PR. Lines indicate the median concentrations per cohort, and the shaded areas represent the 95% confidence interval around the median for dosing with n>l .

FIGs. 23A-23B provide graphs showing CD8 T cell density (FIG. 23A) and Ki-67 positive CD3 T cell density (FIG. 23B) measured by immunohistochemistry (IHC) in tumor biopsies collected from patients in dosing cohorts as indicated in FIGs. 18A-18B that had a PR, SD, or PD. The left panels show cells/mm² at baseline and day 15 after the first dose of huIL-12_mRNA_01, with each line representing a patient. The right panels show' the fold change in cell density between day 15 and baseline for each dose cohort, with the horizontal line representing median fold change. The dotted line indicates the cutoff set at > 2-fold increase.

FIG. 23C provides graphs showing PD-L1 positive tissue in tumor epithelium measured by immunohistochemistry (IHC) in tumor biopsies collected from patients in dosing cohorts as indicated in FIGs. 18A-18B that had a PR, SD, or PD. The left panels show the percentage of PD-L1 positive tissue at baseline and day 15 after the first dose ofhuIL- 12_mRNA_01, with each line representing a patient and the dotted line representing a cutoff of 1%. The right panels show the fold change between day 15 and baseline for each dose cohort, with the horizontal line representing median fold change and the dotted line representing a cutoff of > 2-fold increase . Asterisk (*) represents patients having a foldchange and percent area PD-L1 positive on day 15 above the indicated thresholds (i.e., > 2- fold and 1 % area respectively).

FIG. 24 provides graphs showing correlation between CD8 T cell density (cells/mm²) at approximately day 15 after the first dose of huIL-12_mRNA_01 (V5) versus expression of gene transcripts encoding proteins associated with T cell activation and cytotoxic activity (granzyme B (GZMB), Perforin (PRF1), IFNgamma (IFNG), IL12 receptor beta 2 (IL12RB2)). Cell density was measured by IHC and gene transcript expression was measured by RNASeq in tumor biopsies collected from patients in dosing cohorts as indicated in FIGs. 18A-18B that had a PR, SD, or PD. Spearman’s (p) and Pearson’s (r) correlation between the two values for the indicated gene transcripts are shown.

FIG. 25 provides graphs showing fold change in expression of gene transcripts encoding proteins associated with anti -tumor activity in tumor biopsies collected at day 15 after the first dose of huIL-12_mRNA_01 (V5) compared to tumor biopsies collected at baseline. Tumor biopsies were collected from patients in dosing cohorts as indicated in FIGs. 18A-18B that had a PR or SD (PR+SD) or PD. Asterix represent a significant difference between the PR+SD and PD patient groups as determined using a Wilcoxon Rank Sums Test (p<0.05). Horizontal lines indicate the mean fold change per group.

FIG. 26 provides graphs showing fold change in expression of gene transcripts encoding proteins associated with anti-tumor activity and immunosuppressive activity in tumor biopsies at day 15 after the first dose of huIL-12_mRNA_01 (V5) versus baseline. Tumor biopsies were collected from patients in dosing cohorts as indicated in FIGs. 18A-18B that had a PR or SD (PR+SD) or PD. Asterix represent a significant difference between the PR+SD and PD patient groups as determined using a Wilcoxon Rank Sums Test (p<0.05). Horizontal lines indicate the mean fold change per group.

FIG. 27A is a graph showing the proportion of patients having a tumor mutational burden (TMB) score measured at baseline as being high or low (respectively greater or less than 20 mutations per Mb). The patients were in dosing cohorts as indicated in FIGs. 18A- 18B and had a PR or SD (PR+SD) or PD. TMB score was measured as the rate of single nucleotide variants (SNVs) and insertions and deletions (indels) per Mb, excluding drivers and clonal hematopoiesis (CH) variants, with correction for tumor shedding of cell free DNA. FIG. 27B provides graphs showing the percent change in max variant allele fraction (VAF) at time points following administration of huIL-12_mRNA_01 compared to baseline (V2) in patients that were in dosing cohorts as indicated in FIGs. 18A-18B and had a PR, SD, or PD. The max VAF EOT represents the time point at the end of treatment.

FIGs. 28A-28B are schematics depicting the enrollment status of the dose escalation Phase 1A, IB, and ID of the clinical study shown in FIGs. 11A-11B.

FIG. 28C is a schematic showing the study dosing scheme for Part I A, IB, and ID of the clinical study design depicted in FIGs. 11A and 28A. In Part 1A (sequential treatment), patients having cutaneous/subcutaneous (C/SC) lesions received an intratumoral injection of huIL-12_mRNA_01 on Days 1 and 22 and an intravenous injection of durvalumab (1500 mg) on Day 43 and then every 4 weeks (Q4W). In Parts IB and ID (concurrent treatment), patients having C/SC lesions (Part IB) or deep-seated lesions (Part ID) received an intratumoral injection of huIL-12_mRNA_01 on Days 1, 29, 57, and then every 8 weeks (Q8W), and an intravenous injection of durvalumab (1500 mg) on Day 1 and then Q4W.

FIG. 29 provides a graph showing percentage of patients in the clinical study (Part 1 A, IB, ID, or total) having enrollment status as shown in FIG. 28A that experienced a treatment-related event, a huIL-12_mRNA_01 event, or a durvalumab-related event. AE, adverse event; SAE, serious AE: TEAE, treatment-emergent AE. The asterisk (*) indicates 2 patients that had huIL-12_mRNA_01 -related grade 3 pyrexia and asthenia (each n=l; both also considered durvalumab-related), and 1 patient had huIL-12 mRNA 01 -related grade 4 lymphocyte count decreased, (f) indicates 3 patients that had durvalumab-related grade 3 AEs of pyrexia, asthenia (each n=l; both also considered huIL-12_mRNA_01 -related), and pruritus (n=l).

FIG. 30 is a graph showing the best change in target lesion size per RECIST 1.1 in patients having subcutaneous or cutaneous (“SC/C”) lesions that received sequential huIL- 12_mRNA_01 (“M”) and durvalumab (“D”) (Part 1A cohorts) or concurrent huIL- 12_mRNA_01 and durvalumab (Part IB cohorts) or patients having deep-seated lesions (“deep”) that received concurrent huIL-12_mRNA_01 and durvalumab (Part ID cohorts), with enrollment status as depicted in FIG. 28A. CR = Complete response; PR = partial response; SD = stable disease; PD = progressive disease; NE = not evaluable. (+) indicates patients who previously received checkpoint inhibitor therapy and had at least a 30% fold reduction from baseline in target lesion size on study treatment. The legend indicates the treatment regimen (Part 1 A (sequential M+D (SC/C)), Part IB (concurrent M+D (SC/C)), or Part ID (concurrent M+D (deep)) received by subjects shown to have a best change from baseline of greater or less than zero (with the dose of huIL-12_mRNA_01 received as indicated). Subjects who had a best change from baseline of 0% belonged to the following cohorts: subjects indicated as SD were in the Part 1A 1 pg or Part IB 1 pg cohort; subjects indicated as PD were in the Part 1A 0.1 pg or Part ID 3 pg cohort; and the 16 subjects indicated as NE belonged to the Part 1 A 0. 1 pg (n=l), Part IB 8 pg (n=l), Part 1 A 3 pg (n=l), Part 1A 8 pg (n=l), Part ID 3 pg (n=2), Part IB 12 pg (n=2), Part 1A 12 pg (n=3), or Part IB 1 pg (n=5) cohorts.

DETAILED DESCRIPTION

The present disclosure is directed to methods of treating solid tumor malignancies (e.g., advanced or metastatic solid tumor malignancies) in a human patient by administering an effective amount of an mRNA encoding a human IL- 12 polypeptide described herein (e.g., a linked monomeric human IL-12p70 polypeptide described herein). An IL-12 polypeptide as disclosed herein comprises operably linked IL-12A and IL-12B. In some aspects, the method comprises administering a composition comprising the mRNA. In some aspects, the composition comprises an LNP-encapsulated mRNA. In some aspects, the method comprises intratumoral administration of the composition, e.g., via injection to one or more malignant lesions. In some aspects, the patient is receiving, has received, or subsequently receives an immune checkpoint inhibitor (e.g., a PD-L1 antagonist). Without being bound by any theory, it is believed that priming of an anti-cancer immune response is possible by administering (e.g., via intratumoral injection) an mRNA encoding a human IL- 12 polypeptide to stimulate innate and adaptive immune cells, e.g., tumor macrophages, tumor dendritic cells, effector T- cells and/or natural killer cells. As described herein, administration of an mRNA encoding a human IL-12 polypeptide (e g., via intratumoral injection) provides a first stimulation signal to the immune system, for example, within the tumor microenvironment (TME). IL-12 can also stimulate the production of interferon-gamma (IFNy) and tumor necrosis factor-alpha (TNFa) from T cells and natural killer (NK) cells. In some aspects, administration (e.g., intratumoral administration) of the mRNA increases expression (e.g., intratumoral expression) of IL-12. In some aspects, IL-12 expression is increased in the TME. In some aspects, administration (e.g., intratumoral administration) of the mRNA increases expression (e.g., intratumoral expression) of IFNy. In some aspects, IFNy expression is increased in the TME. In some aspects, administration (e.g., intratumoral administration) of the mRNA increases expression of one or more IFNy-inducible chemokines (e.g., CXCL9, CXCL10, and/or CXCL11). In some aspects, expression of the one or more IFNy-inducible chemokines is increased in the TME. In some aspects, administration (e.g., intratumoral administration) of the mRNA increases maturation of antigen presenting cells (APCs). In some aspects, maturation of APCs is increased in the TME. In some aspects, increased maturation of APCs is associated with presentation of tumor antigens, e.g., to tumor-specific CD8+ T cells. In some aspects, administration (e.g., intratumoral administration) of the mRNA increases recruitment and activation of tumor-specific CD8+ T cells to the TME. As disclosed herein, IL-12, either directly or indirectly through IFN-y, also increases expression of PD-L1 in tumor cells, which can impair local tumor immunity. Therefore, in some aspects, the disclosure provides a method of treating a solid tumor malignancy in a subject comprising administering an mRNA encoding a human IL-12 polypeptide (e.g., via intratumoral injection) at an effective dose in combination with an immune checkpoint inhibitor, e.g., an anti-PD-Ll antibody to block the interaction between PD-L1 and its receptor, i.e., PD-1.

In some aspects, administering an effective amount of the mRNA encoding the human IL- 12 polypeptide to a patient that has received, is receiving or will subsequently receive a PD-L1 antagonist reduces or decreases the size of a solid tumor malignancy (e.g., the solid tumor malignancy which has been injected and/or a proximal, un-injected tumor malignancy). In some aspects, administering an effective amount of the mRNA encoding the human IL-12 polypeptide to a patient that has received, is receiving or will subsequently receive a PD-L1 antagonist reduces or decreases the size of an advanced or metastatic solid tumor malignancy (e g., an advanced or metastatic solid tumor malignancy which has been injected and/or a proximal, un-injected advanced or metastatic tumor malignancy). In some aspects, the solid tumor malignancy (e.g., the advanced or metastatic solid tumor malignancy) comprises a cutaneous lesion. In some aspects, the solid tumor malignancy (e.g., the advanced or metastatic solid tumor) comprises a subcutaneous lesion. In some aspects, the solid tumor malignancy (e.g., the advanced or metastatic solid tumor) comprises a deep- seated lesion. In some aspects, the patient has one or more metastasis, e.g., hepatic and/or brain metastases.

In some aspects, administering an effective amount of the mRNA encoding the human IL- 12 polypeptide to a patient that has received, is receiving or will subsequently receive an immune checkpoint inhibitor (e.g., a PD-L1 antagonist) reduces or decreases the size of the solid tumor malignancy (e.g., of the solid tumor malignancy which has been injected and/or a proximal, un-injected tumor malignancy) in a patient. In some aspects, administering an effective amount of the mRNA encoding the human IL- 12 polypeptide to a patient that has received, is receiving or will subsequently receive an immune checkpoint inhibitor (e.g., a PD-L1 antagonist) reduces or decreases the size one or more cutaneous, subcutaneous, and/or deep-seated lesions (e.g., one or more cutaneous, subcutaneous, and/or deep-seated lesions which has been injected with the effective amount and/or has not been injected with the effective amount). In some aspects, the administering reduces or decreases the size of one or more un-injected lesions by an abscopal effect.

In some aspects, the disclosure provides a method of treating a solid tumor malignancy comprising administration (e.g., intratumoral administration) of the mRNA encoding a human IL- 12 polypeptide to a subject that is receiving, has received, or subsequently receives an immune checkpoint inhibitor (e.g., a PD-L1 antagonist), wherein the administration results in an anti-tumor immune response. In some aspects, administering the mRNA encoding a human IL-12 polypeptide induces an anti-tumor immune response in the patient. In some embodiments, intratumoral administration of the mRNA encoding a human IL-12 polypeptide induces an anti-tumor immune response in the patient. In some aspects, the anti-tumor immune response comprises increased expression of IL-12 (e.g., by tumor macrophages and/or tumor dendritic cells). In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of IL-12 (e.g., by tumor macrophages and/or tumor dendritic cells). In some aspects, the anti-tumor immune response comprises increased expression of IFNy (e.g., by T cells and/or NK cells). In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of IFNy (e.g., by T cells and/or NK cells). In some embodiments, the anti-tumor immune response comprises increased expression of one or more IFNy-inducible chemokines. In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of the one or more IFNy-inducible chemokines. In some embodiments, the one or more IFNy- inducible chemokines is selected from CXCL9, CXCL10, and CXCL11. In some embodiments, the anti-tumor immune response comprises increased expression of one or more mediators of CD8+ T cell function (e.g., cytokine expression, proliferation, differentiation, and/or cytotoxicity). In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of the one or more mediators of CD8+ T cell function. In some embodiments, the one or more mediators of CD8+ T cell function is selected from GZMB (encoding granzyme B), PRF1 (encoding perforin), IFNy, IL12RB1 (encoding IL 12 Receptor beta 1), IL12RB2 (encoding IL 12 Receptor beta 2), CD38, and a combination thereof. In some embodiments, the anti-tumor immune response comprises increased expression of one or more mediators of antigen presenting cell (APC) function (e.g., APC activation, maturation, and/or differentiation). In some embodiments, the antitumor immune response comprises increased expression of one or more mediators of dendritic cell (DC) function (e.g., DC activation, maturation, and/or differentiation). In some embodiments, the one or more mediators of APC function is selected from major histocompatibility complex type I (MHC-I), CD80, CD83, CD86, IFNy receptor, and a combination thereof. In some embodiments, the anti-tumor immune response comprises increased expression of one or more mediators of NK cell function (e.g., NK cell activation, maturation, and/or differentiation) In some embodiments, the one or more mediators of NK cell function is selected from KLRB1, KLRK1, and a combination thereof. In some embodiments, the anti-tumor immune response comprises increased expression of one or more immune checkpoint inhibitor molecules. In some embodiments, the anti-tumor immune response comprises increased mtratumoral expression of one or more immune checkpoint inhibitor molecules, e.g., by tumor cells, tumor epithelial cells, and/or tumor immune cells. In some aspects, the anti -tumor immune response comprises increased expression of PD-L1 by tumor cells and/or leukocytes. In some embodiments, the anti-tumor immune response comprises increased expression of PD-L1 and/or PD-1. In some embodiments, the anti -tumor immune response comprises increased intratumoral expression of PD-L1 and/or PD-1, e.g., by tumor cells, tumor epithelial cells, and/or tumor immune cells. In some aspects, the antitumor immune response comprises increased expression of PD-L1 by tumor epithelial cells. In some aspects, the anti-tumor immune response comprises increased cell-mediated immune response. In some aspects, the anti-tumor immune response comprises increased abundance of tumor-infiltrating T cells (e.g., CD3+ T cells and/or CD8+ T cells). In some aspects, the anti-tumor immune response comprises increased proliferation of T cells in the tumor microenvironment. In some aspects, the anti-tumor immune response comprises increased proliferation of NK cells in the tumor microenvironment. In some embodiments, the antitumor immune response comprises increased proliferation of T cells (e.g., CD3+ and/or CD8+ T cells). In some embodiments, the anti-tumor immune response comprises increased intratumoral proliferation of T cells (e.g., CD3+ and/or CD8+ T cells). In some embodiments, the anti-tumor immune response comprises increased intratumoral infiltration of CD8+ T cells (e g , tumor-specific CD8+ T cells).

As described herein, it was demonstrated that intratumoral administration of mRNA encoding a murine IL-12 polypeptide comprising an IL-12A and IL-12B subunits induced complete regression of both treated and untreated lesions, and the effect was further improved by the addition of an immune checkpoint inhibitor (e.g., anti-PD-Ll). Such effects depend, at least in part, the induction of IFNy production and activation of cytotoxic T cells. However, it remained uncertain whether desirable anti-tumor effects could be achieved in humans administered an IL- 12 therapy at a tolerated dose, as dose limiting toxi cities have been observed in clinical studies of recombinant IL- 12 administered to human patients (e.g., fever, elevated hepatic enzymes, hemodynamic toxicities, and death).

In some aspects, the disclosure provides an exemplary composition comprising an LNP-encapsulated mRNA, wherein the mRNA comprises an ORF encoding 5' to 3': a human IL-12B signal peptide, a human IL-12B subunit, a peptide linker, and a mature human IL- 12A subunit, referred to herein as “huIL-12_mRNA_001.” In some aspects, the present disclosure is based on the clinical evaluation of human patients having a solid tumor malignancy administered an intratumoral injection of the exemplary composition, wherein the patient is receiving or will subsequently receive systemic administration of a PD-L1 antagonist. It was discovered that intratumoral administration of the exemplary composition was associated with a substantial increase (e.g., >2 -fold) in T cell recruitment in malignant tumor lesions in a majority of patients evaluated. Moreover, it was demonstrated that administration of the exemplary composition in combination with the PD-L1 antagonist was well-tolerated. Without being bound by theory', the exemplary' composition is administered to a subject via intratumoral injection to provide improved tolerability compared to systemic administration (e.g., via intravenous injection). For example, intratumoral injection of the exemplary composition in combination with the PD-L1 antagonist according to the Part 1A “sequential” or Part 1 B “concurrent” treatment regimens depicted in FIG. 11 A was shown to be safe in patients having advanced or metastatic solid tumor malignant subcutaneous or cutaneous lesions. Furthermore, as demonstrated herein, a concurrent treatment regimen in patients having deep-seated lesions was well tolerated. Indeed, each dose level of the exemplary composition that was evaluated (e.g., having a dose of the mRNA therapeutic agent of at least 0. 1 pg and up to 12 pg) was demonstrated to be well-tolerated and without adverse events requiring discontinuation of treatment or resulting in death. As described herein, the sequential or concurrent treatment regimens resulted in antitumor activity observed at the injected lesions and un-injected lesions (including local and distant uninjected lesions) for a variety' of tumor types. The responses were durable (e.g., having a duration of response of greater than about 2 months and up to about 22 months with the median not reached) and observed in patients that had received a prior PD-L1 antagonist (i.e., anti-PD-Ll or anti-PD-1) and/or CTLA4 antagonist (i.e., anti-CTLA4). Methods of Use

In some embodiments, the present disclosure provides methods of intratumoral (ITu) administration of an LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL-12 polypeptide for treating a solid tumor malignancies (e.g., advanced or metastatic solid tumor malignancies) in a subject. In some embodiments, the subject is receiving, has received, or subsequently receives an immune checkpoint inhibitor (e.g., a PD- L1 antagonist). In some embodiments, the subject is receiving, has received, or subsequently receives the immune checkpoint inhibitor by systemic administration. While immune checkpoint inhibitors, such as monoclonal antibodies directed against PD-1 and PD-L1, have shown antitumor activity and are approved in multiple tumor types, efficacy is limited with the majority of patients failing to respond (see, e.g., Herbst et al, 2016 Lancet. 387 : 1540-50; Reck et al, 2016 N Engl J Med. 375(19): 1823-33). In some embodiments, the disclosure provides a method of treating a solid tumor malignancy (e.g., advanced or metastatic solid tumor malignancy) in a human subject comprising ITu administration of an LNP- encapsulated mRNA therapeutic agent described herein and systemic administration of an immune checkpoint inhibitor (e.g., a PD-L1 antagonist) described herein, wherein the ITu administration increases responsiveness of the solid tumor malignancy to systemic administration of the immune checkpoint inhibitor. In some embodiments, the human subject has previously received administration of an immune checkpoint inhibitor for treatment of the solid tumor malignancy, wherein the human subject has failed to respond or has experienced disease progression following the previous administration and prior to receiving a method of treatment described herein. In some embodiments, the human subject has previously received administration of a PD-L1 antagonist (e.g., anti-PD-Ll or anti-PD-1), a CTLA-4 antagonist (e.g., anti-CTLA-4), or both, for treatment of the solid tumor malignancy, and has failed to respond or has experienced disease progression following the previous administration and prior to receiving a method of treatment described herein. In some embodiments, ITu administration of the LNP-encapsulated mRNA therapeutic agent in combination with systemic administration of the immune checkpoint inhibitor (e.g., a PD-L1 antagonist) promotes responsiveness (e.g., tumor regression or decreased tumor growth) of a solid tumor malignancy in a human subject that has previously received administration of an immune checkpoint inhibitor and failed to respond or experienced disease progression subsequent to the previous administration. In some embodiments, the methods described herein comprise administering to the subject an LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL-12 polypeptide described herein as a pharmaceutical composition suitable for ITu injection.

Compositions of the disclosure are administered to the subject in an effective amount. In general, an effective amount of the composition will allow for efficient production of the encoded polypeptide in cells of the subject. Metrics for efficiency may include polypeptide translation (indicated by polypeptide expression), level of mRNA degradation, and immune response indicators.

Dosing Regimens

The methods of the disclosure for treating a solid tumor malignancy (e.g., advanced or metastatic solid tumor malignancy) are used in a variety of clinical or therapeutic applications. For example, the methods are used to stimulate an anti-tumor immune response in a subject having a solid tumor malignancy (e.g., a cutaneous lesion, a subcutaneous lesion, and/or a deep-seated lesion). In some embodiments, the methods are used to stimulate an anti-tumor immune response in a subject having a solid tumor malignancy (e.g., a cutaneous lesion, a subcutaneous lesion, and/or a deep-seated lesion) who is receiving, has received, or subsequently receives an immune checkpoint inhibitor (e.g., a PD-Ll antagonist). The mRNA and compositions of the present disclosure are useful in methods for treating or delaying progression of a solid tumor malignancy in a subject (e.g., a human patient) by intratumoral injection. In some embodiments, the injection is a single injection at a single site (in one malignant lesion). In some embodiments, the injection is multiple injections at one or more sites (to one or more malignant lesions). In some embodiments, the injection is a bolus injection or a continuous infusion.

In some embodiments, the intratumoral administration of the composition comprising an mRNA encoding an IL-12 polypeptide increases the efficacy of an anti-tumor effect e.g., T cell infiltration in a tumor). In some embodiments, the increase is compared to other routes of administration.

In some embodiments, a subject is administered a composition comprising an mRNA encoding an IL- 12 polypeptide described herein. In some embodiments, the subject is provided with or administered a nanoparticle (e.g., an LNP) comprising the mRNA. In some embodiments, the subject is provided with or administered a pharmaceutical composition of the disclosure to the subject. In some embodiments, the pharmaceutical composition comprises an mRNA as described herein, or it comprises a nanoparticle comprising the mRNA. In some embodiments, the mRNA is encapsulated in a nanoparticle, e.g., an LNP. In some embodiments, the mRNA or nanoparticle-encapsulated mRNA (e.g., LNP- encapsulated mRNA) is present in a pharmaceutical composition, e.g., a composition suitable for intratumoral injection.

In some embodiments, the mRNA, nanoparticle-encapsulated mRNA (e.g., LNP- encapsulated mRNA), or pharmaceutical composition thereof is administered to the patient parenterally, e.g., intratumorally. In some embodiments, the subject is a mammal, e.g., a human. In some embodiments, the subject is provided with an effective amount of the mRNA.

A suitable dose of an mRNA is a dose which treats or delays progression of a solid tumor malignancy in a subject, and may be affected by a variety of factors including, e.g., the age, sex, and weight of a subject to be treated and the particular mRNA to be used. Other factors affecting the dose administered to the subject include, e.g., the type or severity of the malignancy in the patient. Other factors can include, e.g., other medical disorders concurrently or previously affecting the subject, the general health of the subject, the genetic disposition of the subject, diet, time of administration, rate of excretion, drug combination, and any other additional therapeutics that are administered to the subject.

Suitable doses for human patients can be evaluated in, e.g., a Phase I dose escalation study. Data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such mRNA described herein lies generally within a range of local concentrations of the mRNA that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For the mRNA and compositions described herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a therapeutically effective concentration within the local site that includes the IC50 (i.e., the concentration of the mRNA which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.

In some embodiments, the composition is administered to a subject according to a route of injection (e.g., intratumoral injection) and a dose of mRNA (e.g., a dose of about 0. 1 pg to about 12 pg of mRNA) that results in a level of IL-12 in one or more malignant lesions that is tolerated by the subject (e.g., does not result in an adverse event sufficient to discontinue treatment, result in undesirable adverse side effects, or cause death). In some embodiments, the administration results in a level of IL-12 in one or more malignant lesions that contributes to an anti -tumor immune response (e.g., by increasing tumor infiltration of effector T cells and/or NK cells, by increasing expression of pro-inflammatory cytokines by adaptive and/or innate immune cells, by increasing tumor cell death, and/or by increasing expression of an immune checkpoint molecule by tumor cells, epithelial cells, and/or immune cells in the tumor microenvironment). In some embodiments, the level of IL-12 that is tolerated by the patient is determined based on a maximum peak for IL-12. As used herein, “maximum peak” refers to the maximum (or peak) concentration of a biomarker (e.g., IL- 12 polypeptide) as measured in serum and/or a tissue sample (e.g., tumor biopsy sample) obtained from a subject after administration of a first dose of the composition and prior to administration of a subsequent dose. As is understood by one of skill in the art, the maximum peak may be measured following each dose administered to the subject (e.g., the first, second, third, fourth, etc dose). The “time to maximum peak” refers to the time at which the maximum concentration (maximum peak) is observed relative to the time of administration.

In some embodiments, the administration results in a level of IL- 12 in one or more malignant lesions in a subject that is evaluated based upon the maximum peak measured in serum obtained from the patient. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 3 pg/mL and up to about 5 pg/mL as measured in serum of the subject. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 3 pg/mL and up to about 10 pg/mL as measured in serum of the subject. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 3 pg/mL and up to about 15 pg/mL as measured in serum of the subject. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 3 pg/mL and up to about 20 pg/mL. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 3 pg/mL and up to about 50 pg/mL. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 3 pg/mL and up to about 100 pg/mL. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 3 pg/mL and up to about 200 pg/mL. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 3 pg/mL and up to about 300 pg/mL. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 3 pg/mL and up to about 400 pg/mL. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 3 pg/mL and up to about 450 pg/mL. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 10 pg/mL and up to about 450 pg/mL. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 5 pg/mL and up to about 10 pg/mL. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 5 pg/mL and up to about 20 pg/mL. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 5 pg/mL and up to about 30 pg/mL. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 5 pg/mL and up to about 50 pg/mL. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 5 pg/mL and up to about 100 pg/mL. In some embodiments, the administration results in a level of IL-12 having a maximum peak of at least about 5 pg/mL and up to about 200 pg/mL. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 5 pg/mL and up to about 300 pg/mL. In some embodiments, the administration results in a level of IL- 12 having a maximum peak of at least about 5 pg/mL and up to about 400 pg/mL. In some embodiments, the time to maximum peak for IL-12 measured in serum occurs at about 0.5 days, about 1 day, about 1.5 days, about 2 days, or about 2.5 days from the time of administration. In some embodiments, the time to maximum peak for IL- 12 measured in serum occurs at about 1 day (e.g., 24 hours ±1 hour, ±2 hours, ±3 hours, ±4 hours, or ±5 hours). In some embodiments, a maximum peak of IL-12 of up to about 5 pg/mL as measured in serum of the subject is tolerated by the subject (e.g., does not result in an adverse event sufficient to discontinue treatment). In some embodiments, a maximum peak of IL- 12 of up to about 10 pg/mL as measured in serum of the subject is tolerated by the subject (e.g., does not result in an adverse event sufficient to discontinue treatment). In some embodiments, a maximum peak of IL-12 of up to about 15 pg/mL as measured in serum of the subject is tolerated by the subject (e.g., does not result in an adverse event sufficient to discontinue treatment).

In some embodiments, the composition is administered to a subject according to a route of injection (e g., intratumoral injection) and a dose of mRNA (e.g., a dose of about 0. 1 pg to about 12 pg of mRNA) that results in a level of IFNy in one or more malignant lesions that contributes to an anti -tumor immune response (e.g., by increasing tumor infiltration of effector T cells and/or NK cells, by increasing expression of pro-inflammatory cytokines by adaptive and/or innate immune cells, by increasing tumor cell death, and/or by increasing expression of an immune checkpoint molecule by tumor cells, epithelial cells, and/or immune cells in the tumor microenvironment). In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 100 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 100 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 150 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 200 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 250 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 500 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 1000 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 1500 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 2000 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 3000 pg/mL as measured in serum of the subject. In some embodiments, the level of IFNy is one having a maximum peak of at least about 25 pg/mL and up to about 3500 pg/mL as measured in serum of the subject. In some embodiments, the time to maximum peak for IFNy measured in serum occurs at about 0.5 days, about 1 day, about 1.5 days, about 2 days, or about 2.5 days from the time of administration. In some embodiments, the time to maximum peak for IFNy measured in serum occurs at about 1 day (e.g., 24 hours ±1 hour, ±2 hours, ±3 hours, ±4 hours, or ±5 hours).

In some embodiments, the composition is administered to a subject according to a route of injection (e.g., intratumoral injection) and a dose of mRNA (e.g., a dose of about 0. 1 pg to about 12 pg of mRNA) that results in a level of one or more IFNy-induced chemokines (e.g., CXCL9, CXCL10, and/or CXCL11) in one or more malignant lesions that contributes to an anti -tumor immune response (e.g., by increasing tumor infiltration of effector T cells and/or NK cells, by increasing expression of pro-inflammatory cytokines by adaptive and/or innate immune cells, by increasing tumor cell death, and/or by increasing expression of an immune checkpoint molecule by tumor cells, epithelial cells, and/or immune cells in the tumor microenvironment). In some embodiments, the level of IFNy-induced chemokines (e.g., CXCL9, CXCL10, and/or CXCL11) is one having a maximum peak of at least about 10 pg/mL and up to about 10,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL9, wherein the level of the IFNy- induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 1,000 pg/mL as measured in serum of the subject.

In some embodiments, the IFNy-induced chemokine is CXCL9, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 2,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL9, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 3,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL9, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 4,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL9, wherein the level of the IFNy- induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 5,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy- induced chemokine is CXCL9, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 6,000 pg/mL as measured in serum of the subject.

In some embodiments, the IFNy-induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 2,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 3,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 4,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 5,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy- induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 6,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 7,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 8,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy- induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 9,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL10, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 10,000 pg/mL as measured in serum of the subject.

In some embodiments, the IFNy-induced chemokine is CXCL11, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 2,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL11, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 3,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL11, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 4,000 pg/mL as measured in serum of the subject. In some embodiments, the IFNy-induced chemokine is CXCL11, wherein the level of the IFNy-induced chemokine is one having a maximum peak of at least about 10 pg/mL and up to about 5,000 pg/mL as measured in serum of the subject.

In some embodiments, the frequency of dosing will take into account the pharmacokinetic parameters of the mRNA in the formulation used. In some embodiments, a clinician will administer the composition until a dosage is reached that achieves or maintains the desired effect. In some embodiments, the desired effect is tumor size reduction or resolution of the injected and/or uninjected tumors. In some embodiments, the desired effect is expression of IL-12 and/or IFNy within the tumor and/or serum of the subject. In some embodiments, achievement of a desired effect occurs immediately after administration of a dose. In some embodiments, achievement occurs at any point in time following administration. In some embodiments, achievement occurs at any point in time during a dosing interval. In some embodiments, achievement of a desired effect is determined by analyzing a biological sample (e.g., tumor biopsy) immediately after administration of a dose, at any point in time following administration of a dose, at any point in time during a doing interval, or combinations thereof.

In some embodiments, maintenance of a desired effect (e.g., IL- 12 and/or IFNy protein expression) is determined by analyzing one or more biological sample(s) (e.g., tumor biopsy and/or serum sample) at least once during a dosing interval. In some embodiments, maintenance of a desired effect (e.g., IL-12 and/or IFNy protein expression) is determined by analyzing one or more biological sample(s) (e.g., tumor biopsy and/or serum sample) at regular intervals during a dosing interval. In some embodiments, maintenance of a desired effect (e.g., IL- 12 and/or IFNy protein expression) is determined by analyzing one or more biological sample(s) (e.g., tumor biopsy and/or serum sample) before a subsequent dose is administered.

In some embodiments, the mRNA, nanoparticle-encapsulated mRNA (e.g., LNP- encapsulated mRNA), or pharmaceutical composition thereof is administered to the subject as a single dose. In some embodiments, the single dose is administered over time, e.g., as a continuous infusion via an implantation device or catheter. In some embodiments, the single dose is administered as a bolus injection. In some embodiments, the bolus injection is administered at a single site in a first malignant lesion.

In some embodiments, the mRNA, nanoparticle-encapsulated mRNA (e.g., LNP- encapsulated mRNA), or pharmaceutical composition thereof is administered to the subject as two or more doses (which may or may not contain the same amount of the therapeutic agent). In some embodiments, the two or more doses are each administered over time, or as a continuous infusion via an implantation device or catheter. In some embodiments, the two or more doses are each administered as a bolus injection.

In some embodiments, a bolus injection comprising a dose of the mRNA, nanoparticle-encapsulated mRNA (e.g., LNP-encapsulated mRNA), or pharmaceutical composition thereof is administered at a single site in a first malignant lesion. In some embodiments, the bolus injection is administered at multiple sites. In some embodiments, the multiple sites comprise a first site and at least one second site. In some embodiments, the first site and at least one second site are in the first malignant lesion. In some embodiments, the first site is in a first malignant lesion and the at least one second site is in a second malignant lesion. In some embodiments, up to 2, 3, 4, or 5 malignant lesions are injected with a portion of the bolus injection, wherein the full volume of the bolus injection is administered.

Further refinement of the appropriate dosage is routinely made by those of ordinary skill in the art and is within the ambit of tasks routinely performed by them. In certain embodiments, appropriate dosages can be ascertained through use of appropriate doseresponse data.

In some embodiments, the dosing regimen is determined by the pharmacodynamics effects of the IL- 12 polypeptide. In some embodiments, the pharmacodynamics effects include an increase in T cells within tumors after administration. In some embodiments, the increase in T cells is maintained over a specified period of time (e.g., 15 days).

In some embodiments, the subject is administered a composition comprising an mRNA encoding a human IL-12 polypeptide (e g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide) at a dosing interval comprising a duration of about 14-28 days or about 21-28 days. In some embodiments, the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) is administered at a dosing interval comprising a duration of about 7-77 days, about 7-70 days, about 7-63 days, about 7-56 days, about 7-49 days, about 7-42 days, about 7-35 days, about 7-28 days, about 7-21 days, about 14-77 days, about 14-70 days, about 14- 63 days, about 14-56 days, about 14-49 days, about 14-35 days, about 14-28 days, about 14-

21 days, about 21-77 days, about 21-70 days, about 21-63 days, about 21-56 days, about 21-

49 days, about 21-42 days, about 21-35 days, about 21-28 days, about 28-77 days, about 28-

70 days, about 28-63 days, about 28-56 days, about 28-49 days, about 35-77 days, about 35-

70 days, about 35-63 days, about 35-56 days, about 35-49 days, or about 35-42 days. In some embodiments, the dosing interval is about 7 days. In some embodiments, the dosing interval is about 14 days. In some embodiments, the dosing interval is about 21 days In some embodiments, the dosing interval is about 28 days. In some embodiments, the dosing interval is about 35 days. In some embodiments, the dosing interval is about 42 days. In some embodiments, the dosing interval is at least about 7 days. In some embodiments, the dosing interval is at least about 14 days. In some embodiments, the dosing interval is at least about 21 days. In some embodiments, the dosing interval is at least about 28 days. In some embodiments, the dosing interval is at least about 35 days. In some embodiments, the dosing interval is at least about 42 days.

In some embodiments, the subject is administered an initial dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) and at least one subsequent dose, wherein the dosing interval comprises a duration of about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks. In some embodiments, the subject is administered at least one subsequent dose. In some embodiments, the subject is administered two, three, four, or five subsequent doses. In some embodiments, the dosing interval between the first dose and the first subsequent dose comprises a duration of about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks; and the dosing interval between the subsequent doses comprises a duration of about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks. In some embodiments, the dosing interval between the subsequent intervals is the same or different.

In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every 7-42 days for a specified time period. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every 7-21 days for a specified time period. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every' 14-21 days for a specified time period. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide) about every' 14-28 days for a specified time period. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every' 21-28 days for a specified time period. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every' 21-35 days for a specified time period. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every' 28-42 days for a specified time period.

In some embodiments, the subject is administered the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) for a first dosing cycle and at least one subsequent dosing cycle, wherein the first and subsequent dosing cycles each independently comprise administering a dose of the composition at a dosing interval of once a week, once every 2 weeks, once every 3 weeks, or once every 4 weeks, once every 5 weeks, or once every 6 weeks, for a duration of time (e.g., a duration of time that is a 2x, 3x, 4x, 5x, or 6x multiple of the dosing interval). In some embodiments, the first and subsequent dosing cycles comprise administering a dose of the composition at different dosing intervals (e.g., first dosing cycle comprises administering a dose of the composition at a dosing interval of once every 4 weeks, and at least one subsequent dosing cycle comprises administering a dose of the composition at a dosing interval of once every 8 weeks). In some embodiments, the subject is administered the composition in two or more subsequent dosing cycles after the first dosing cycle, wherein the two or more subsequent dosing cycles comprise the same or different dosing intervals.

In some embodiments, the subject receives a first dose cycle comprising administering a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide) once every about 2 weeks, once every about 3 weeks, or once every about 4 weeks; and at least one subsequent dose cycle comprising administering a dose of the composition once every about 4 weeks, once every about 6 weeks, or once every about 8 weeks for a duration. In some embodiments, the duration of the at least one subsequent dose cycle is up to about 16 weeks, about 32 weeks, about 48 weeks, or about 84 weeks. In some embodiments, the duration of the at least one subsequent dose cycle is indefinite, or occurs until a positive therapeutic outcome (e.g., a partial response, a complete response, or stable disease) is achieved. In some embodiments, the interval between a first dosing cycle and a subsequent dosing cycle is about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 14 months, about 16 months, or about 18 months.

In some embodiments, a dosing cycle comprises at least one dose. In some embodiments, a dosing cycle comprises at least two doses. In some embodiments, a dosing cycle comprises at least three doses. In some embodiments, a dosing cycle comprises at least four doses. In some embodiments, a dosing cycle is for a duration of time. In some embodiments, a dosing cycle is about 7-42 days, about 7-21 days, about 14-28 days, about 21-28 days, about 21-35 days, about 28-35 days, about 21-42 days, or about 28-42 days. In some embodiments, a dosing cycle is 28 days. In some embodiments, a dosing cycle is 35 days. In some embodiments, a dosing cycle is 42 days. In some embodiments, a dosing cycle is 56 days. In some embodiments, a dosing cycle is about 3 weeks. In some embodiments, a dosing cycle is about 4 weeks. In some embodiments, a dosing cycle is about 6 weeks. In some embodiments, a dosing cycle is about 8 weeks.

In some embodiments, the composition is administered to a subject about every 14 days for a specified time period. In some embodiments, the composition is administered to a subject about every 21 days for a specified time period. In some embodiments, the composition is administered to a subject about every 28 days for a specified time period. In some embodiments, the composition is administered to a subject about every 35 days for a specified time period. In some embodiments, the composition is administered to a subject about every 42 days for a specified time period. In some embodiments, the composition is administered to a subject about every 47 days for a specified time period. In some embodiments, the composition is administered to a subject about every 56 days for a specified time period.

In some embodiments, the specified time period is determined by a clinician. In some embodiments, dosing occurs until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. For example, in some embodiments, dosing occurs until growth of cancer cells, tumor cells or tumors is inhibited. In some embodiments, dosing occurs until growth of cancer cells, tumor cells or tumors is reduced. In some embodiments, dosing occurs until there is no detection of cancer cells, tumor cells or tumors in a biological sample. In some embodiments, dosing occurs until progression of a cancer is delayed. In some embodiments, dosing occurs until progression of a cancer is inhibited. In some embodiments, the specified time period is determined once a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved.

In some embodiments, dosing of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) occurs for a duration that is indefinite, or until a positive therapeutic outcome (e.g., a partial response, a complete response, or stable disease) is achieved. In some embodiments, the dosing interval remains consistent. In some embodiments, the dosing interval changes as needed based on a clinician’s assessment. In some embodiments, dosing occurs indefinitely to maintain stable disease. In some embodiments, dosing occurs indefinitely to maintain remission of a cancer.

In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every 14-56 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every 14-28 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) about every 14-21 days indefinitely, or until a positive therapeutic outcome (e g., partial response, complete response, or stable disease) is achieved. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding ahuman IL-12 polypeptide) about every 21-28 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding ahuman IL-12 polypeptide) about every 21-35 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding ahuman IL-12 polypeptide) about every 21-42 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding ahuman IL-12 polypeptide) about every 28-42 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the subject is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding ahuman IL-12 polypeptide) about every 28-56 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved.

In some embodiments, the composition is administered to a subject about every 14 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the composition is administered to a subject about every 21 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the composition is administered to a subject about every 28 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the composition is administered to a subject about every 35 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the composition is administered to a subject about every 42 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the composition is administered to a subject about every 56 days indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, a dose of the composition is administered to a subject for at least two dosing cycles, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved.

In some embodiments, the subject having a solid tumor malignancy is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide) by intratumoral injection to one or more malignant lesion(s), wherein the dose is at least about 0. 1 pg and up to about 12.0 pg, at least about 0.1 pg and up to about 10.0 pg, at least about 0.1 pg and up to about 8.0 pg, at least about 0. 1 pg and up to about 6.0 pg, at least about 0.1 pg and up to about 3.0 pg, at least about 0. 1 pg and up to about 2.0 pg, at least about 0. 1 pg and up to about 1.0 pg, at least about 0.3 pg and up to about 12.0 pg, at least about 0.3 pg and up to about 10.0 pg, at least about 0.3 pg and up to about 8.0 pg, at least about 0.3 pg and up to about 6.0 pg, at least about 0.3 pg and up to about 3.0 pg, at least about 0.3 pg and up to about 2.0 pg, at least about 0.3 pg and up to about 1.0 pg, at least about 1.0 pg and up to about 12.0 pg, at least about 1.0 pg and up to about 10.0 pg, at least about 1.0 pg and up to about 8.0 pg, at least about 1.0 pg and up to about 6.0 pg, at least about 1.0 pg and up to about 3.0 pg, or at least about 1.0 pg and up to about 2.0 pg.

In some embodiments, the subject having a solid tumor malignancy is administered a dose of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide) by intratumoral injection to one or more malignant lesion(s), wherein the dose is about 0.1 pg. In some embodiments, the dose is about 0.3 pg. In some embodiments, the dose is about 1.0 pg. In some embodiments, the dose is about 3.0 pg. In some embodiments, the dose is about 8.0 pg. In some embodiments, the dose is about 12.0 pg. In some embodiments, the dose is based upon the total amount of RNA administered to the subject. In some embodiments, a single dose may be administered, for example, prior to or after, or in lieu of a surgical procedure or in the instance of an acute disease, disorder, or condition. The specific therapeutically effective, prophylactically effective, or otherwise appropriate dose level for any particular patient will depend upon a variety of factors including the severity and identify of a disorder being treated, if any; the one or more mRNAs employed; the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific pharmaceutical composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific pharmaceutical composition employed; and like factors well known in the medical arts.

Tumor Size Reduction or Growth Inhibition

Certain aspects of the present disclosure are directed to methods of reducing or decreasing size, mass, and/or volume of one or more malignant lesions, or preventing the growth of one or more malignant lesions in a subject in need thereof comprising administering a composition comprising an mRNA encoding an IL- 12 polypeptide disclosed herein (e.g., an LNP-encapsulated mRNA encoding an IL- 12 polypeptide). In some embodiments, the subject has received, is receiving, or will subsequently receive administration of an immune checkpoint inhibitor (e.g., an PD-L1 agonist).

In some embodiments, the subject having a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) has at least one malignant lesion. In some embodiments, the composition is administered locally to the at least one malignant lesion (/.£., mtratumorally). In some embodiments, the composition is administered locally to the at least one malignant lesion (z.e., intratumorally). In some embodiments, administration of the composition to the at least one malignant lesion reduces the size and/or volume of the injected malignant lesion. In some embodiments, administration of the composition to the at least one malignant lesion reduces or slows the growth rate of the injected malignant lesion (e.g., as compared to the baseline growth rate of the injected malignant lesion prior to the administration).

In some embodiments, the subject having a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) has a first malignant lesion accessible to intratumoral injection (e.g., according to criteria further described herein such as distal to cntical anatomical structures, comprising at least 50% viable tumor tissue, and/or having a smallest diameter of at least 1.5 cm) and at least one additional lesion (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more malignant lesions). In some embodiments, the at least one additional lesion is a measurable target lesion according to RECIST vl. l criteria. In some embodiments, the at least one additional lesion (e.g., the at least one additional lesion that is a measurable target lesion) is used to monitor for treatment efficacy and/or an abscopal disease response.

In some embodiments, the composition is administered locally to the first malignant lesion accessible to intratumoral injection. In some embodiments, administration of the composition to the first malignant lesion reduces the size and/or volume of the injected malignant lesion. In some embodiments, administration of the composition to the first malignant lesion reduces or slows the rate of growth of the injected lesion. In some embodiments, administration of the composition to the first malignant lesion reduces or slows the size and/or volume of the at least one additional lesion. In some embodiments, administration of the composition to the first malignant lesion reduces or slows the rate of growth of at least one additional lesion. In some embodiments, administration of the composition to the first malignant lesion reduces or slows the size and/or volume of the at least one additional lesion that is a measurable target lesion according to RECIST vl. l criteria. In some embodiments, administration of the composition to the first malignant lesion reduces or slows the rate of growth of at least one additional lesion that is a measurable target lesion according to RECIST vl. l criteria.

In some embodiments, the composition is administered locally to a first malignant lesion (i.e., intratumorally) of a subject having at least one additional malignant lesion, wherein the first malignant lesion and the at least one additional malignant lesion are measurable target lesions according to RECIST vl. l criteria, and wherein the first malignant lesion is accessible for safe injection (e.g., according to criteria further described herein). In some embodiments, the composition is administered locally (i.e., intratumorally) to the first malignant lesion. In some embodiments, the composition is administered locally to more than one malignant lesion of the subject. In some embodiments, administration of the composition reduces the size and/or volume of the injected malignant lesion(s). In some embodiments, administration of the composition reduces or slows the growth rate of the injected malignant lesion(s) (e g., as compared to the baseline growth rate of the injected malignant lesion(s) prior to the administration). In some embodiments, administration of the composition reduces the size and/or volume of one or more uninjected malignant lesion(s). In some embodiments, administration of the composition reduces the size and/or volume of the at least one additional malignant lesion that is a measurable target lesion according to RECIST vl.l criteria. In some embodiments, administration of the composition to the first malignant lesion reduces or slows the growth rate of one or more uninjected malignant lesion(s) (e.g., as compared to the baseline growth rate of the one or more uninjected malignant lesion(s) prior to the administration).

In some embodiments, the one or more uninjected malignant lesion(s) is located near to or proximal to the injected malignant lesion (e.g., within about 1-5 cm, about 1-10 cm, or about 1-20 cm and/or in the same anatomical area). In some embodiments, the one or more uninjected malignant lesion(s) is located distal to the injected malignant lesion (e.g., present in a different anatomical area). In some embodiments, the reduction in size and/or inhibition of growth in the one or more uninjected malignant lesion(s) occurs via an abscopal effect.

In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 10%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 20%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 30%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 40%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 50%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 60%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 70%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 80%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is reduced by at least about 90%. In some embodiments, the size of the malignant lesion (e.g., the injected and/or the uninjected malignant lesion) is completely resolved.

In some embodiments, the size of the at least one injected malignant lesion(s) is reduced by at least about 10%. In some embodiments, the size of the at least one injected malignant lesion(s) is reduced by at least about 20%. In some embodiments, the size of the at least one injected malignant lesion(s) is reduced by at least about 30%. In some embodiments, the size of the at least one inj ected malignant lesion(s) is reduced by at least about 40%. In some embodiments, the size of the at least one injected malignant lesion(s) is reduced by at least about 50%. In some embodiments, the size of the at least one injected malignant lesion(s) is reduced by at least about 60%. In some embodiments, the size of the at least one injected malignant lesion(s) is reduced by at least about 70%. In some embodiments, the size of the at least one injected malignant lesion(s) is reduced by at least about 80%. In some embodiments, the size of the at least one injected malignant lesion(s) is reduced by at least about 90%. In some embodiments, the size of the at least one injected malignant lesion(s) is completely resolved.

In some embodiments, the size of the one or more uninjected malignant lesion(s) is reduced or are each reduced by at least about 10%. In some embodiments, the size of the one or more uninjected malignant lesion(s) is reduced or are each reduced by at least about 20%. In some embodiments, the size of the one or more uninjected malignant lesion(s) is reduced or are each reduced by at least about 30%. In some embodiments, the size of the one or more uninjected malignant lesion(s) is reduced or are each reduced by at least about 40%. In some embodiments, the size of the one or more uninjected malignant lesion(s) is reduced or are each reduced by at least about 50%. In some embodiments, the size of the one or more uninjected malignant lesion(s) is reduced or are each reduced by at least about 60%. In some embodiments, the size of the one or more unmjected malignant lesion(s) is reduced or are each reduced by at least about 70%. In some embodiments, the size of the one or more uninjected malignant lesion(s) is reduced or are each reduced by at least about 80%. In some embodiments, the size of the one or more uninjected malignant lesion(s) is reduced or are each reduced by at least about 90%. In some embodiments, the size of the at least one injected malignant lesion(s) is completely resolved.

In some embodiments, a reduction in size of a malignant lesion in a patient administered an mRNA or an LNP-encapsulated mRNA according to method described herein is measured by comparison to the size of patient’s malignant lesion at baseline, against an expected size of a malignant lesion, against an expected malignant size based on a large patient population, or against the size of a malignant lesion of a control population.

In some embodiments, the size of a malignant lesion is determined by visual methods, such as image scanning. Methods for determining tumor size and tumor volume are known to those of skill in the art. In some embodiments, the size of the malignant lesion is measured according to Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST vl .l) guidelines (see Eisenhauer, et al (2009) Eur J. Cancer 45:228-247). In some embodiments, the method comprises a CT scan. In some embodiments, the method comprises an MRI. In some embodiments, the method comprises digital imaging using a measuring device (e.g., calipers). Biomarker Expression

In some embodiments, expression of one or more biomarkers is increased or enhanced in a subject having a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) following administration of a composition comprising an mRNA encoding an IL- 12 polypeptide (e g., an LNP-encapsulated mRNA encoding an IL- 12 polypeptide) according to a method described herein (e.g., via intratumoral injection to one or more malignant lesions). In some embodiments, expression of the one or more biomarkers is assessed in a biopsy of one or more malignant lesions obtained from the subject in a period following the administration as compared to a biopsy obtained from the subject prior to the administration. In some embodiments, the one or more biomarkers is assessed in a serum sample obtained from the subject in a period following the administration as compared to a serum sample obtained prior to the administration. In some embodiments, the period following the administration has a duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. In some embodiments, the period following the administration has a duration not more than about 15, 16, 17, 18, 19, or 20 days.

In some embodiments, IL-12 expression is increased or enhanced in a subject having a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) following administration of the composition comprising an mRNA (e.g., an LNP-encapsulated mRNA) according to a method described herein (e.g., via intratumoral injection to one or more malignant lesions). In some embodiments, IL-12 expression is increased or enhanced as measured within the tumor of the subject (e.g., within one or more malignant lesions of the subject, such as one or more injected malignant lesions and/or one or more uninjected malignant lesions). In some embodiments, IL-12 expression is increased or enhanced as measured within the tumor of the subject following a first dose of the composition. In some embodiments, IL- 12 expression is increased or enhanced as measured within the tumor of the subject following at least one subsequent dose of the composition. In some embodiments, IL- 12 expression is increased or enhanced as measured within the plasma or serum of the subject. In some embodiments, IL-12 expression is increased or enhanced as measured within the plasma or serum of the subject following a first dose of the composition. In some embodiments, IL- 12 expression is increased or enhanced as measured within the plasma or serum of the subject following at least one subsequent dose of the composition. In some embodiments, IL- 12 expression is increased or enhanced relative to IL- 12 expression prior to the administration of the composition (e g , prior to administration of the first dose of the composition). In some embodiments, IL-12 expression is increased or enhanced relative to IL-12 expression prior to the administration of the composition (e.g., prior to administration of the first dose of the composition) for a duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. In some embodiments, IL- 12 expression is increased or enhanced relative to IL- 12 expression prior to the administration of the composition (e.g., prior to administration of the first dose of the composition) for a duration of not more than about 15, 16, 17, 18, 19, or 20 days.

In some embodiments, IFNy expression is increased or enhanced in a subject having a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) following administration of a composition comprising an mRNA (e.g., an LNP-encapsulated mRNA) according to a method described herein (e.g., via intratumoral injection to one or more malignant lesions). In some embodiments, IFNy expression is increased or enhanced within the tumor of the subject (e.g., within one or more malignant lesions of the subject, such as one or more injected malignant lesions and/or one or more uninjected malignant lesions). In some embodiments, IFNy expression is increased or enhanced within the tumor of the subject following the first dose of the composition. In some embodiments, IFNy expression is increased or enhanced within the tumor of the subject following at least one subsequent dose of the composition. In some embodiments, IFNy expression is increased or enhanced within the plasma or serum of the subject. In some embodiments, IFNy expression is increased or enhanced within the plasma or serum of the subject following the first dose of the composition. In some embodiments, IFNy expression is increased or enhanced within the plasma or serum of the subject at least one subsequent dose of the composition. In some embodiments, IFNy expression is increased or enhanced relative to IFNy expression prior to the administration of the composition (e.g., prior to administration of the first dose of the composition). In some embodiments, IFNy expression is increased or enhanced relative to IFNy expression prior to the administration of the composition (e g., prior to administration of the first dose of the composition) for a duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. In some embodiments, IFNy expression is increased or enhanced relative to IFNy expression prior to the administration of the composition (e.g., prior to administration of the first dose of the composition) for a duration of not more than about 15, 16, 17, 18, 19, or 20 days.

In some embodiments, expression of an IFNy-induced chemokine (e.g., CXCL9, CXCL10, and/or CXCL11) is increased or enhanced in a subject having a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) following administration of a composition comprising an mRNA (e.g., an LNP-encapsulated mRNA) according to a method described herein (e g., via intratumoral injection to one or more malignant lesions). In some embodiments, expression of the IFNy-induced chemokine (e.g., CXCL9, CXCL10, and/or CXCL11) is increased or enhanced within the tumor of the subject (e.g., within one or more malignant lesions of the subject, such as one or more injected malignant lesions and/or one or more uninjected malignant lesions). In some embodiments, expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCLI l) is increased or enhanced within the tumor of the subject following the first dose of the composition. In some embodiments, expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCLIl) is increased or enhanced within the tumor of the subject following at least one subsequent dose of the composition. In some embodiments, expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCL11) is increased or enhanced within the plasma or serum of the subject. In some embodiments, IFNy expression is increased or enhanced within the plasma or serum of the subject following the first dose of the composition. In some embodiments, expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCLIl) is increased or enhanced within the plasma or serum of the subject at least one subsequent dose of the composition. In some embodiments, expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCLI l) is increased or enhanced relative to expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCL11) prior to the administration of the composition (e.g., prior to administration of the first dose of the composition). In some embodiments, expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCLI l) is increased or enhanced relative to expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCL11) prior to the administration of the composition (e.g., prior to administration of the first dose of the composition) for a duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. In some embodiments, expression of the IFNy-induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCL11) is increased or enhanced relative to expression of the IFNy- induced chemokine (e.g., CXCL9, CXCLIO, and/or CXCLI l) prior to the administration of the composition (e.g., prior to administration of the first dose of the composition) for a duration of not more than about 1 , 16, 17, 18, 19, or 20 days.

In some embodiments, a biopsy is obtained from one or more malignant lesions (e.g., one or more injected malignant lesions and/or one or more uninjected malignant lesions) prior to the administration of the composition (e.g., prior to administration of the first dose of the composition) and within a period following the administration of a first dose of the composition and/or a subsequent dose of the composition (e.g., a period having a duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days) and protein abundance is assessed. Methods to measure protein abundance in a biological tissue sample are known in the art and include, e.g., ELISA, western blot, and cytometric bead array. In some embodiments, abundance of a gene transcript encoding the protein is assessed. Methods to measure expression of a gene transcript in a biological tissue sample are known in the art and include, e.g., RNAseq, Northern blotting, and reverse transcription and quantitative polymerase chain reaction (RT- qPCR). In some embodiments, abundance of a gene encoding the protein is assessed. Methods to measure gene expression in a biological tissue sample are known in the art and include, e.g., next generation sequencing, qPCR, and DNA microarray. In some embodiments, the abundance of IL-12 measured in the biopsy obtained following the administration is increased by at least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15- fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold relative to the biopsy obtained prior to the administration. In some embodiments, the abundance of IFNy measured in the biopsy obtained following the administration is increased by at least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15- fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold relative to the biopsy obtained prior to the administration. In some embodiments, the abundance of an IFNy-induced chemokine (e g., CXCL9, CXCL10, and/or CXCL11) measured in the biopsy obtained following the administration is increased by at least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold relative to the biopsy obtained prior to the administration.

In some embodiments, a serum sample is obtained prior to the administration of the composition (e.g., prior to administration of a first dose of the composition) and within a period following the administration of a first dose of the composition and/or a subsequent dose of the composition (e g , a period having a duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days) and protein expression is assessed. In some embodiments, expression of a gene transcript encoding the protein is assessed. In some embodiments, expression of a gene encoding the protein is assessed. In some embodiments, the abundance of IL-12 measured in the serum sample obtained following the administration is increased by at least about 1.5- fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15 -fold, about 20-fold, about 25 -fold, about 30- fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold relative to the serum sample obtained prior to the administration. In some embodiments, the abundance of IFNy measured in the serum sample obtained following the administration is increased by at least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold relative to the serum sample obtained prior to the administration. In some embodiments, the abundance of an IFNy-induced chemokine (e.g., CXCL9, CXCL10, and/or CXCL11) measured in the serum sample obtained following the administration is increased by at least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8- fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35 -fold, about 40-fold, about 45-fold, or about 50-fold relative to the serum sample obtained prior to the administration.

In some embodiments, a biopsy is obtained from one or more malignant lesions (e g., one or more injected malignant lesions and/or one or more uninjected malignant lesions) prior to the administration of the composition (e.g., prior to administration of a first dose of the composition) according to a method described herein (e.g., via intratumoral injection to one or more malignant lesions) and within a period following the administration of a first dose and/or a subsequent dose of the composition (e.g., a period having a duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days) and protein expression on specific cell types present in the biopsy is assessed. In some embodiments, the level a gene transcript encoding the protein expressed by a specific cell type present in the biopsy is assessed. In some embodiments, the level of a gene encoding the protein expressed by a specific cell type present in the biopsy is assessed. In some embodiments, expression of the one or more biomarkers is increased on tumor cells in the biopsy obtained following the administration as compared to the biopsy obtained prior to the administration. In some embodiments, expression of the one or more biomarkers is increased on tumor epithelial cells in the biopsy obtained following the administration as compared to the biopsy obtained prior to the administration. In some embodiments, the one or more biomarkers comprises an immune checkpoint molecule. In some embodiments, the immune checkpoint molecule is PD-L1. In some embodiments, expression of the one or more biomarkers is increased on a population of tumor immune cells in the biopsy obtained following the administration as compared to the biopsy obtained prior to the administration. In some embodiments, the population of tumor immune cells comprises CD8+ T cells. In some embodiments, the one or more biomarkers is associated with CD8+ T cell activation and/or function. In some embodiments, the one or more biomarker is selected from granzyme B, perforin, IFNy, IL12 Receptor beta 1, IL12 Receptor beta 2, CD38, and a combination thereof. In some embodiments, the population of tumor immune cells comprises NK cells. In some embodiments, the one or more biomarkers comprises is associated with NK cell activation and/or function. In some embodiments, the one or more biomarkers is selected from KLRB1, KLRK1, and a combination thereof. In some embodiments, the population of tumor immune cells comprises Thl cells. In some embodiments, the one or more biomarkers is associated with Thl activation and/or function. In some embodiments, the one or more biomarkers is selected from TBX21, STAT4, CXCR3, and a combination thereof. In some embodiments, the population of tumor immune cells comprises antigen presenting cells (APCs). In some embodiments, the one or more biomarkers is associated with APC activation and/or function. In some embodiments, the one or more biomarkers is selected from IFNy Receptor 1 (IFNGR1), IFNGR2, and a combination thereof. In some embodiments, the population of tumor immune cells comprises DCs. In some embodiments, the one or more biomarkers is associated with DC activation and/or function. In some embodiments, the one or more biomarkers is selected from CD80, CD83, CD86, and a combination thereof. In some embodiments, the one or more biomarkers comprises MHCI (e.g., HLA-A).

In some embodiments, expression of PD-L1 on tumor cells in a biopsy of one or more malignant lesions obtained within a period following administration of a first dose and/or a subsequent dose of the composition according to a method described herein (e.g., via intratumoral injection to one or more malignant lesions) is increased relative to expression of PD-L1 on tumor cells in a biopsy of the one or more malignant lesions obtained prior to the administration (e.g., prior to the administration of a first dose of the composition). In some embodiments, expression of PD-L1 on tumor epithelial cells in a biopsy of one or more malignant lesions obtained within a period following administration of a first dose and/or a subsequent dose of the composition according to a method described herein (e.g., via intratumoral injection to one or more malignant lesions) is increased relative to expression of PD-L1 on tumor epithelium in a biopsy of the one or more malignant lesions obtained prior to the administration (e.g., prior to the administration of a first dose of the composition). In some embodiments, PD-L1 expression in a biopsy obtained following the administration is increased by at least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20- fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50- fold relative to the biopsy obtained prior to the administration.

Methods for determining human protein expression on appropriate cell types, such as immune cells or tumor cells located within a tumor are known to those of skill in the art and described herein. Such methods include, but are not limited to, quantitative immunofluorescence (QIF), flow cytometry, reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), northern blotting, nucleic acid microarray using DNA, western blotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), tissue immunostaining, immunoprecipitation assay, complement fixation assay, fluorescence-activated cell sorting (FACS), mass spectrometry, magnetic bead-antibody immunoprecipitation, or protein chip. In some embodiments, protein expression is measured by immunohistochemistry (IHC). In some embodiments, expression of a gene transcript encoding the protein is measured by RNAseq. In some embodiments, expression of a gene encoding the protein is measured by next generation sequencing.

In some embodiments, the circulating tumor fraction measured in a liquid biopsy sample (e.g., plasma and/or serum sample) obtained within a period following administration of a first dose and/or a subsequent dose of the composition according to a method described herein (e.g., via intratumoral injection to one or more malignant lesions) is decreased relative circulating tumor fraction in a liquid biopsy sample obtained prior to the administration (e.g., prior to the administration of a first dose of the composition). Genomic alterations in cancerous tissues can be identified from cfDNA isolated from cancer patients, see, e.g., Stroun et al., Oncology, 46(5):318-22 (1989); Goessl et al., Cancer Res., 60(21):5941-45 (2000); and Frenel et al., Clin. Cancer Res. 21(20):4586-96 (2015). The circulating tumor fraction is the fraction of cfDNA in a liquid biopsy sample that originate from cancerous tissue of the subject, rather than from non-cancerous tissue (e.g., a germline or hematopoietic tissue). In some embodiments, the circulating tumor fraction is estimated from the maximum VAF. As used herein, the term “variant allele fraction,” “VAF,” “allelic fraction,” or “AF” refers to the number of times a variant or mutant allele is observed (e g , a number of reads supporting a candidate variant allele) divided by the total number of times the position was sequenced (e.g., a total number of reads covering a candidate locus). Methods to measure VAF are known in the art, and include isolating cfDNA from a liquid biological sample obtained from the patient and performing next generation sequencing to detect mutations (e.g., single nucleotide variations, amplifications, fusions, short insertions/deletions, splice site-disrupting events, and any combination thereof) relative to a reference genome. In some embodiments, the VAF is the number of mutant molecules at a specific nucleotide location over total number of molecules present in the reference genome at a specific genomic location. In some embodiments, the maximum VAF measured in a liquid biopsy sample obtained from the subject is decreased by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% relative to the maximum VAF in a liquid biopsy sample obtained prior to the administration. Enhancing Anti-Tumor Immune Responses

In some embodiments, the disclosure provides a method for enhancing an immune response in a subject with solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy). In some embodiments, the disclosure provides a method for enhancing an immune response to a solid tumor malignancy.

In some embodiments, enhancing an immune response comprises stimulating cytokine production. In another embodiment, enhancing an immune response comprises enhancing cellular immunity (T cell responses), such as activating T cells. In some embodiments, enhancing an immune response comprises activating NK cells. Enhancement of an immune response in a subject can be evaluated by a variety of methods established in the art for assessing immune response, including but not limited to determining the level of T cell activation and NK cell activation by intracellular staining of activation markers in the area of the tumor.

In some embodiments, local administration (e.g., via intratumoral injection of one or more malignant lesions) of a composition comprising an mRNA encoding an IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding an IL- 12 polypeptide) to a tumor in a subject with a solid tumor malignancy induces T cell activation within the tumor. In some embodiments, the activation of T cells results in an anti -tumor immune response in the subject. In some embodiments, the activated T cells in the subject reduce or decrease the size of a tumor or inhibit the growth of a tumor in the subject. Activation of T cells can be measured using applications in the art such as measuring T cell proliferation; measuring cytokine production with enzyme-linked immunosorbant assays (ELISA) or enzy me-linked immunospot assays (ELISPOT); or detection of cell-surface markers associated and/or intracellular markers associated with T cell activation (e.g., CD69, CD40L, CD137, CD25, CD71, CD26, CD27, CD28, CD30, CD 154, and CD 134) with techniques such as flow cytometry. In some embodiments, the activated T cells are CD4⁺ cells, CD8⁺ cells, CD62⁺ (L- selectin⁺) cells, CD69⁺ cells, CD40L⁺ cells, CD137⁺ cells, CD25⁺ cells, CD71⁺ cells, CD26⁺ cells, CD27⁺ cells, CD28⁺ cells, CD30⁺ cells, CD45⁺ cells, CD45RA⁺ cells, CD45RO⁺ cells, CDllb⁺ cells, CD154⁺ cells, CD134⁺ cells, CXCR3⁺ cells, CCR4⁺ cells, CCR6⁺ cells, CCR7⁺ cells, CXCR5⁺ cells, Crth2⁺ cells, gamma delta T cells, or any combination thereof. In some embodiments, the activated T cells are Thi cells. In other embodiments, the T cells are TI12 cells. In other embodiments, the activated T cells activated are cytotoxic T cells.

In some embodiments, local administration (e.g., via intratumoral injection of one or more malignant lesions) of a composition comprising an mRNA encoding an IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding an IL- 12 poly peptide) to a tumor in a subject with a solid tumor malignancy induces T cell proliferation within the tumor. In some embodiments, T cell proliferation results in an anti-tumor immune response in the subject. In some embodiments, T cell proliferation in the subject reduce or decrease the size of a tumor or inhibit the growth of a tumor in the subject. T cell proliferation can be measured using applications in the art such as cell counting, viability staining, optical density assays, or detection of cell-surface and/or intracellular markers associated with T cell proliferation (e.g., KI-67) with techniques such as flow cytometry or immunohistochemistry.

In some embodiments, local administration (e.g., via intratumoral injection of one or more malignant lesions) of a composition comprising an mRNA encoding an IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding an IL- 12 polypeptide) to a tumor in a subject with a solid tumor malignancy induces infiltration of T cells to the tumor. In some embodiments, T cell infiltration results in an anti-tumor immune response in the subject. In some embodiments, T cell infiltration in the subject reduce or decrease the size of a tumor or inhibit the growth of a tumor in the subj ect. T cell infiltration in a tumor can be measured using applications in the art such as tissue sectioning and staining for cell markers, measuring local cytokine production at the tumor site, or detection of T cell-surface markers with techniques such as flow cytometry.

In some embodiments, the infiltrating T cells are CD4⁺ cells, CD8⁺ cells, CD62⁺ (L- selectm⁺) cells, CD69⁺ cells, CD40L⁺ cells, CD137⁺ cells, CD25⁺ cells, CD71⁺ cells, CD26⁺ cells, CD27⁺ cells, CD28⁺ cells, CD30⁺ cells, CD45⁺ cells, CD45RA⁺ cells, CD45RO⁺ cells, CDllb⁺ cells, CD154⁺ cells, CD134⁺ cells, CXCR3⁺ cells, CCR4⁺ cells, CCR6⁺ cells, CCR7⁺ cells, CXCR5⁺ cells, Crth2⁺ cells, gamma delta T cells, or any combination thereof. In some embodiments, the infiltrating T cells are Thi cells. In other embodiments, the infiltrating T cells are Th2 cells. In other embodiments, the infiltrating T cells are cytotoxic T cells. In some embodiments, local administration (e.g., via intratumoral injection of one or more malignant lesions) of a composition comprising an mRNA encoding an IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding an IL- 12 polypeptide) to a tumor in a subject with a solid tumor malignancy increases the number of Natural Killer (NK) cells within the tumor. In some embodiments, the increase in the number of NK cells results in an anti -tumor immune response in the subject. In some embodiments, the increase in the number of NK cells reduces or decreases the size of a tumor or inhibits the growth of a tumor in the subject. Increases in the number of NK cells in a subject can be measured using applications in the art such as detection of NK cell-surface markers (e.g., CD335/NKp46; CD336/NKp44; CD337/NPp30) or intracellular NK cell markers (e.g., perforin; granzymes; granulysin).

In some embodiments, a biopsy is obtained from one or more malignant lesions (e.g., one or more injected malignant lesions and/or one or more uninjected malignant lesions) prior to the administration of the composition (e.g., prior to administration of a first dose of the composition) and within a period following the administration a first dose and/or a subsequent dose of the composition (e.g., a period having a duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days) and abundance of specific cell types is assessed, e.g., using flow cytometry or immunohistochemistry.

In some embodiments, the abundance of CD3+ T cells measured in the biopsy obtained following the administration is increased by at least about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10- fold relative to the abundance of CD3+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD3+ T cells measured in the biopsy obtained following the administration is increased by about 2-fold relative to the abundance of CD3+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD3+ T cells measured in the biopsy obtained following the administration is increased by about 3-fold relative to the abundance of CD3+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD3+ T cells measured in the biopsy obtained following the administration is increased by about 3-fold relative to the abundance of CD3+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD3+ T cells measured in the biopsy obtained following the administration is increased by about 4-fold relative to the abundance of CD3+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD3+ T cells measured in the biopsy obtained following the administration is increased by about 5 -fold relative to the abundance of CD3+ T cells measured in the biopsy obtained prior to the administration.

In some embodiments, the abundance of CD8+ T cells measured in the biopsy obtained following the administration is increased by at least about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10- fold relative to the abundance of CD8+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD8+ T cells measured in the biopsy obtained following the administration is increased by about 2-fold relative to the abundance of CD8+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD8+ T cells measured in the biopsy obtained following the administration is increased by about 3-fold relative to the abundance of CD8+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD8+ T cells measured in the biopsy obtained following the administration is increased by about 3-fold relative to the abundance of CD8+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD8+ T cells measured in the biopsy obtained following the administration is increased by about 4-fold relative to the abundance of CD8+ T cells measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of CD8+ T cells measured in the biopsy obtained following the administration is increased by about 5-fold relative to the abundance of CD8+ T cells measured in the biopsy obtained prior to the administration.

In some embodiments, the abundance of proliferating T cells (e g., Ki-67+ T cells) measured in the biopsy obtained following the administration is increased by at least about 2- fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold relative to the abundance of proliferating T cells (e.g., Ki-67+ T cells) measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of proliferating T cells (e.g., Ki-67+ T cells) measured in the biopsy obtained following the administration is increased by about 2-fold relative to the abundance of proliferating T cells (e.g., K1-67+ T cells) measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of proliferating T cells (e.g., Ki-67+ T cells) measured in the biopsy obtained following the administration is increased by about 3- fold relative to the abundance of proliferating T cells (e g., Ki-67+ T cells) measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of proliferating T cells (e.g., K1-67+ T cells) measured in the biopsy obtained following the administration is increased by about 3 -fold relative to the abundance of proliferating T cells (e.g., Ki-67+ T cells) measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of proliferating T cells (e.g., Ki-67+ T cells) measured in the biopsy obtained following the administration is increased by about 4-fold relative to the abundance of proliferating T cells (e.g., Ki-67+ T cells) measured in the biopsy obtained prior to the administration. In some embodiments, the abundance of proliferating T cells (e.g., Ki-67+ T cells) measured in the biopsy obtained following the administration is increased by about 5-fold relative to the abundance of proliferating T cells (e.g., Ki-67+ T cells) measured in the biopsy obtained prior to the administration.

In some embodiments, local administration (e.g., via intratumoral injection of one or more malignant lesions) of a composition comprising an mRNA encoding an IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding an IL- 12 polypeptide) to a tumor in a subject with a solid tumor malignancy increases cytokine levels in at least one malignant lesion and/or increases systemic cytokine levels. In some embodiments, the increased cytokine is one or a combination of IL-12, IFNy, CXCL9, CXCL10, CXCL11, IL-22, IL-6, TNFa, IFNy, IL-8, IL-2, IL-10, IL-27 and MIP3a. In some embodiments, the increased cytokine is IL-12. In some embodiments, the increased cytokine is IFNy. In some embodiments, the increased cytokine is CXCL9. In some embodiments, the increased cytokine is CXCL10. In some embodiments, the increased cytokine is CXCL11. In some embodiments, the increased cytokine levels are below the levels indicated as being associated with cytokine release syndrome (CRS). CRS is an acute systemic inflammatory syndrome characterized by fever and multiple organ dysfunction that can be triggered by a variety of infections and certain drugs, such as antibody -based therapies. IL-6, IL- 10 and IFNy are among the core cytokines that are consistently found to be elevated in serum of patients with CRS. In some embodiments, increased cytokine levels are at least 1.5-fold, 2-fold, 3-fold, 4- fold, or 5-fold less than the levels reported for CRS. In some embodiments, the composition comprising an mRNA encoding an IL- 12 polypeptide does not induce CRS.

In some embodiments, local administration (e.g., via intratumoral injection of one or more malignant lesions) of a composition comprising an mRNA encoding an IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding an IL- 12 polypeptide) to a tumor in a subject with a solid tumor malignancy increases expression of PD-L1 in immune cells and/or tumor cells in the tumor microenvironment. In some embodiments, the administration increases expression of PD-L1 by tumor cells. In some embodiments, PD-L1 expression is increased relative to an expression level that is negative. In some embodiments, PD-L1 expression is increased relative to an expression level that is a low expression level. In some embodiments, a low expression level is characterized as 5% or fewer tumor cells expressing a level of PD-L1+ above the level of detection. In some embodiments, PD-L1 expression is increased relative to an expression level that is a moderate expression level. In some embodiments, a moderate expression level is characterized as more than 5% and up to 10% of tumor cells expressing a level of PD-L1+ above the level of detection.

In some embodiments, expression of a protein (e.g., IL-12, IFNy, PD-L1, etc.) is determined by measuring the amount of protein in a sample (e g., plasma or tumor). Methods for measuring protein levels are known to those of skill in the art and described herein.

Combination Therapy

In some embodiments, the disclosure provides a method of treating a solid tumor malignancy in a subject comprising administering a composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide) in combination with another agent, for example, another therapeutic agent, a prophylactic agent, and/or a diagnostic agent. By “in combination with,” it is not intended to imply that the agents must be administered at the same time and/or formulated for delivery together, although these methods of delivery are within the scope of the present disclosure. Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent. In some embodiments, the present disclosure encompasses the delivery of compositions of the disclosure, or imaging, diagnostic, or prophylactic compositions thereof in combination with agents that improve their bioavailability, reduce and/or modify their metabolism, inhibit their excretion, and/or modify their distribution within the body.

Exemplary therapeutic agents that may be administered in combination with the compositions of the disclosure include, but are not limited to, cytotoxic, chemotherapeutic, hypomethylating agents, pro-apoptotic agents, small molecules/kinase inhibitors, immunostimulatory agents and other therapeutic agents including therapeutics approved for solid tumor malignancy or lymphoma, now or at a later date. Cytotoxic agents may include, for example, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, temposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicm, dihydroxyanthracinedione, mitoxantrone, mithramycin, actinomycin D, 1- dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, rachelmycin, and analogs thereof. Radioactive ions may also be used as therapeutic agents and may include, for example, radioactive iodine, strontium, phosphorous, palladium, cesium, iridium, cobalt, yttrium, samarium, and praseodymium. Other therapeutic agents may include, for example, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, and 5 -fluorouracil, and decarbazine), alkylating agents (e.g., mechlorethamine, thiotepa, chlorambucil, rachelmycin, melphalan, carmustine, lomustine, cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamine platinum (II) (DDP), and cisplatin), anthracy clines (e.g., daunorubicin and doxorubicin), antibiotics (e.g., dactinomycin, bleomycin, mithramycin, and anthramycin), and anti-mitotic agents (e.g., vincristine, vinblastine, taxol, and maytansinoids).

In some embodiments, a composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide) is administered to a subject having a solid tumor malignancy (e.g., a cutaneous lesion, a subcutaneous lesion, and/or a deep seated lesion), wherein the subject has received, is receiving, or will subsequently receive treatment with one or more therapeutics. In some embodiments, a composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) is administered in combination with one or more therapeutics to a subject having a solid tumor malignancy (e.g., a cutaneous lesion, a subcutaneous lesion, and/or a deep seated lesion).

In some embodiments, the one or more anti-cancer agents are approved by the United States Food and Drug Administration. In other embodiments, the one or more anti-cancer agents are pre-approved by the United States Food and Drug Administration.

In some embodiments, the subject for the present methods has been treated with one or more standard of care therapies. In other embodiments, the subject for the present methods has not been responsive to one or more standard of care therapies or therapeutics.

In some embodiments, the one or more therapeutics comprises an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is a PD-L1 antagonist. In some embodiments, the immune checkpoint inhibitor is a PD-1 antagonist. In some embodiments, the immune checkpoint inhibitor is a CTLA-4 antagonist.

PD-L1 antagonists In some embodiments, the immune checkpoint inhibitor antagonizes the PD-1/PD-L1 axis. PD-1, is a key receptor expressed on activated T cells that when bound by its ligand, PD-L1, suppresses T cell mediated immune responses (Francisco et al, 2009, J Exp Med 206:3015-29; Hamanishi et al, 2007 PNAS 104:3360-5; Keir et al, 2008 Annu Rev Immunol 26:677-704; Zou and Chen, 2008 Nat Rev Immunol 8:467-77). Tumor cells often hijack the PD-1/PD-L1 pathway by upregulating PD-L1 to protect themselves from tumor-specific T cells (Postow et al, 2015 J Clin Oncol 33: 1974-82). In addition, immune cells in the tumor microenvironment may also express PD-L1 and similarly inhibit T cell responses at the tumor site (Powles et al, 2014 Nature 5156:558-62). In some embodiments, the immune checkpoint inhibitor is a PD-L1 antagonist, a monoclonal antibody that binds to PD-L1, and/or an anti- PD-L1 monoclonal antibody.

In some embodiments, the subject has been previously treated with a PD-L1 antagonist prior to a treatment with IL- 12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with a PD-L1 antagonist at the time of receiving treatment with an IL-12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with a PD-L1 antagonist subsequent to the time of receiving treatment with an IL- 12 encoding mRNA described herein.

In some embodiments, the subject has been previously treated with a monoclonal antibody that binds to PD-L1 prior to a treatment with IL- 12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with a monoclonal antibody that binds to PD-L1 at the time of receiving treatment with an IL-12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with a monoclonal antibody that binds to PD-L1 subsequent to the time of receiving treatment with an IL-12 encoding mRNA described herein.

In some embodiments, the subject has been previously treated with an anti-PD-Ll monoclonal antibody therapy prior to a treatment with IL- 12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with an anti-PD-Ll monoclonal antibody therapy at the time of receiving treatment with an IL-12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with an anti-PD-Ll monoclonal antibody therapy subsequent to the time of receiving treatment with an IL- 12 encoding mRNA described herein.

In some embodiments, the anti-PD-Ll monoclonal antibody therapy comprises Durvalumab, Avelumab, MEDI473, BMS-936559, Atezolizumab, or any combination thereof. In some embodiments, the anti-PD-Ll antibody is Durvalumab. Durvalumab is a human IgGl, kappa mAb that blocks the interaction of PD-L1 (but not PD-L2) with PD-1 on T-cells and CD80 proteins on immune cells. Durvalumab is developed for use in the treatment of cancer. The proposed mechanism of action for durvalumab is interference in the interaction of PD-L1 with PD-1 and CD80. Blockade of PD-L1/PD-1 and PD-L1/CD80 interactions releases the inhibition of immune responses, including those that may result in tumor elimination. Durvalumab is engineered to reduce antibody-dependent cellular cytotoxicity and complement-dependent cytotoxicity. Thus, durvalumab is expected to stimulate anti -tumor immune response by binding to PD-L1 and shifting the balance toward anti-tumor response.

In some embodiments, the anti-PD-Ll antibody useful for the disclosure is MSB0010718C (also called Avelumab; See US 2014/0341917) or BMS-936559 (formerly 12A4 or MDX-1105) (see, e.g, U.S. Patent No. 7,943,743; WO 2013/173223). In other embodiments, the anti-PD-Ll antibody is MPDL3280A (also known as RG7446) (see, e.g., Herbst et al. (2013) J Clin Oncol 3 l(suppl):3000. Abstract; U.S. Patent No. 8,217,149), MEDI4736 (also called Durvalumab; Khleif (2013) In: Proceedings from the European Cancer Congress 2013; September 27-October 1, 2013; Amsterdam, The Netherlands).

PD-1 Antagonists

In some embodiments, the immune checkpoint inhibitor is a PD-1 antagonist, a monoclonal antibody that binds to PD-1, and/or an anti-PD-1 monoclonal antibody.

In some embodiments, the subject has been previously treated with a PD-1 antagonist prior to a treatment with IL-12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with a PD-1 antagonist at the time of receiving treatment with an IL- 12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with a PD-1 antagonist subsequent to the time of receiving treatment with an IL-12 encoding mRNA described herein.

In some embodiments, the subject has been previously treated with a monoclonal antibody that binds to PD-1 prior to a treatment with IL- 12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with a monoclonal antibody that binds to PD-1 at the time of receiving treatment with an IL- 12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with a monoclonal antibody that binds to PD-1 subsequent to the time of receiving treatment with an IL- 12 encoding mRNA described herein.

In some embodiments, the subject has been previously treated with an anti-PD-1 monoclonal antibody therapy prior to a treatment with IL- 12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with an anti-PD-1 monoclonal antibody therapy at the time of receiving treatment with an IL-12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with an anti-PD-1 monoclonal antibody therapy subsequent to the time of receiving treatment with an IL- 12 encoding mRNA described herein.

In some embodiments, the anti-PD-1 monoclonal antibody therapy comprises Nivolumab, Pembrolizumab, Pidilizumab, or any combination thereof. In some embodiments, the anti-PD-1 antibody (or an antigen-binding portion thereol) useful for the disclosure is pembrolizumab.

Pembrolizumab (also known as "KEYTRUDA®", lambrolizumab, and MK-3475) is a humanized monoclonal IgG4 antibody directed against human cell surface receptor PD-1 (programmed death- 1 or programmed cell death- 1). Pembrolizumab is described, for example, in U.S. Patent No. 8,900,587. Pembrolizumab has been approved by the FDA for the treatment of relapsed or refractory melanoma and advanced NSCLC.

In some embodiments, the anti-PD-1 antibody useful for the disclosure is nivolumab. Nivolumab (also known as "OPDIVO®"; formerly designated 5C4, BMS-936558, MDX- 1 106, or ONO-4538) is a fully human IgG4 (S228P) PD-1 immune checkpoint inhibitor antibody that selectively prevents interaction with PD-1 ligands (PD-L1 and PD-L2), thereby blocking the down-regulation of antitumor T-cell functions (U.S. Patent No. 8,008,449; Wang et al., 2014 Cancer Immunol Res. 2(9): 846-56). Nivolumab has shown activity in a variety of advanced solid tumors including renal cell carcinoma (renal adenocarcinoma, or hypernephroma), melanoma, and non-small cell lung cancer (NSCLC) (Topalian et al., 2012a; Topalian et al., 2014; Drake et al., 2013; WO 2013/173223).

In other embodiments, the anti-PD-1 antibody is MEDI0680 (formerly AMP-514), which is a monoclonal antibody against the PD-1 receptor. MEDI0680 is described, for example, in U.S. Patent No. 8,609,089B2.

In some embodiments, the anti-PD-1 antibody is BGB-A317, which is a humanized monoclonal antibody. BGB-A317 is described in U.S. Publ. No. 2015/0079109.

In some embodiments, a PD-1 antagonist is AMP-224, which is a B7-DC Fc fusion protein. AMP-224 is discussed in U.S. Publ. No. 2013/0017199. CTLA-4 Antagonists

In some embodiments, the immune checkpoint inhibitor is a CTLA-4 antagonist, a monoclonal antibody that binds to CTLA-4, and/or an anti-CTLA-4 monoclonal antibody.

In some embodiments, the subject has been previously treated with a CTLA-4 antagonist prior to a treatment with IL- 12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with a CTLA-4 antagonist at the time of receiving treatment with an IL-12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with a CTLA-4 antagonist subsequent to the time of receiving treatment with an IL-12 encoding mRNA described herein.

In some embodiments, the subject has been previously treated with a monoclonal antibody that binds to CTLA-4 prior to a treatment with IL- 12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with a monoclonal antibody that binds to CTLA-4 at the time of receiving treatment with an IL- 12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with a monoclonal antibody that binds to CTLA-4 subsequent to the time of receiving treatment with an IL-12 encoding mRNA described herein.

In some embodiments, the subject has been previously treated with an anti-CTLA-4 monoclonal antibody therapy prior to a treatment with IL- 12 encoding mRNA described herein. In some embodiments, the subject is receiving treatment with an anti-CTLA-4 monoclonal antibody therapy at the time of receiving treatment with an IL-12 encoding mRNA described herein. In some embodiments, the subject will receive treatment with an anti-CTLA-4 monoclonal antibody therapy subsequent to the time of receiving treatment with an IL- 12 encoding mRNA described herein.

In some aspects, the anti-CTLA-4 antibody therapy comprises Ipilimumab or Tremelimumab. An exemplary clinical anti-CTLA-4 antibody is the human mAb 10D1 (now known as ipilimumab and marketed as YERVOY®) as disclosed in U.S. Patent No. 6,984,720. Another anti-CTLA-4 antibody useful for the present methods is tremelimumab (also known as CP-675, 206). Tremelimumab is human IgG2 monoclonal anti-CTLA-4 antibody. Tremelimumab is described in WO/2012/122444, U.S. Publ. No. 2012/263677, or WO Publ. No. 2007/113648 A2.

In some embodiments, an mRNA therapeutic agent described herein is administered to a subject having a solid tumor malignancy in combination with the immune checkpoint inhibitor (e g., a PD-L1 antagonist), wherein the immune checkpoint inhibitor is administered intravenously. In some embodiments, the immune checkpoint inhibitor (e.g., anti-PD-Ll antagonist) is administered once every 4 weeks for a duration of time. In some embodiments, the immune checkpoint inhibitor (e.g., anti-PD-Ll antagonist) is administered once every 6 weeks for a duration of time. In some embodiments, the immune checkpoint inhibitor (e.g., anti-PD-Ll antagonist) is administered once every 8 weeks for a duration of time.

In some embodiments, a dose of the composition of mRNA encoding an IL- 12 polypeptide (e.g. an LNP-encapsulated mRNA encoding an IL-12 polypeptide) is administered at a dosing frequency of once every about 2 weeks, once every about 3 weeks, or once every about 4 weeks for a duration that is a multiple (e.g., 2x, 3x, 4x, 5x, or 6x) the dosing frequency, and the immune checkpoint inhibitor (e.g., anti-PD-Ll) is administered once every about 4 weeks, once every about 6 weeks, or once every about 8 weeks for a duration of time. In some embodiments, dosing of the composition is completed prior to administering the first dose of the immune checkpoint inhibitor (e.g., anti-PD-Ll). In some embodiments, dosing of the composition is ongoing during administration of the first dose of the immune checkpoint inhibitor (e.g., anti-PD-Ll). In some embodiments, dosing of the composition is subsequent to dosing of the immune checkpoint inhibitor (e.g., anti-PD-Ll).

The particular combination of therapies (therapeutics or procedures) to employ in a combination regimen will take into account compatibility of the desired therapeutics and/or procedures and the desired therapeutic effect to be achieved. It will also be appreciated that the therapies employed may achieve a desired effect for the same disorder (for example, a composition useful for treating cancer may be administered concurrently with a chemotherapeutic agent), or they may achieve different effects (e.g., control of any adverse effects).

Exemplary Cancers

The mRNA therapeutic agents described herein, alone or in combination, are useful for treating solid tumor malignancies. In some embodiments, the solid tumor malignancy is an advanced and/or metastatic solid tumor malignancy.

In some embodiments, the solid tumor malignancy is selected from melanoma, breast cancer, head and neck cancer, non-small-cell lung cancer, colorectal cancer, gastric cancer, and bladder cancer. In some embodiments, the solid tumor malignancy comprises an anal cancer, a bladder cancer, a breast cancer, a cervical cancer, a colorectal cancer, a gastric cancer, a head and neck cancer, a lung cancer (e.g., a NSCLC cancer), a pancreatic cancer, a skin cancer (e.g., a squamous cell carcinoma or melanoma), and/or a vulvar cancer. In some embodiments, the solid tumor malignancy comprises anal cancer. In some embodiments, the solid tumor malignancy comprises bladder cancer. In some embodiments, the solid tumor malignancy comprises breast cancer. In some embodiments, the solid tumor malignancy comprises cervical cancer. In some embodiments, the solid tumor malignancy comprises colorectal cancer. In some embodiments, the solid tumor malignancy comprises gastric cancer. In some embodiments, the solid tumor malignancy comprises head and neck cancer. In some embodiments, the solid tumor malignancy comprises lung cancer. In some embodiments, the solid tumor malignancy comprises NSCLC. In some embodiments, the solid tumor malignancy comprises pancreatic cancer. In some embodiments, the solid tumor malignancy comprises skin cancer. In some embodiments, the solid tumor malignancy comprises squamous cell carcinoma. In some embodiments, the solid tumor malignancy comprises melanoma. In some embodiments, the solid tumor malignancy comprises vulvar cancer.

In some embodiments, the solid tumor malignancy is selected from melanoma, head and neck cancer, colorectal cancer, breast cancer, pancreatic cancer, non-small-cell lung cancer, vulvar cancer, bladder cancer, gastric cancer, squamous cell carcinoma, anal cancer, pancreatic cancer, and cervical cancer. In some embodiments, the solid tumor malignancy a melanoma. In some embodiments, the solid tumor malignancy is a head and neck cancer. In some embodiments, the solid tumor malignancy comprises one or more hepatic metastases. In some embodiments, the solid tumor malignancy comprises one or more brain metastases. In some aspects, the patient has at least one malignant lesion (e.g., an injected and/or noninjected malignant lesion) comprising a cutaneous or subcutaneous lesion and at least one malignant lesion comprising one or more hepatic metastases. In some aspects, the patient has at least one malignant lesion (e.g., an injected and/or non-injected malignant lesion) comprising a cutaneous or subcutaneous lesion and at least one malignant lesion comprising one or more brain metastases. In some aspects, the patient has at least one malignant lesion (e.g., an injected and/or non-injected malignant lesion) comprising a deep-seated lesion and at least one malignant lesion comprising one or more hepatic metastases. In some aspects, the patient has at least one malignant lesion (e g., an injected and/or non-injected malignant lesion) comprising a deep-seated lesion and at least one malignant lesion comprising one or more brain metastases.

In some embodiments, the patient has received at least one treatment prior to administration of composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide) described herein. In some embodiments, the at least one treatment is any one or combination of chemotherapy, radiation, and immunotherapy. In some embodiments, the immunotherapy comprises immune checkpoint inhibitor (CPI) therapy. In some embodiments, the subject is experiencing stable disease as a result of the at least one treatment and prior to administration of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide). In some embodiments, the subject is experiencing disease progression following the at least one treatment and prior to administration of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide).

In some embodiments, the solid tumor malignancy does not express PD-L1 or expresses low levels of PD-L1. In some embodiments, the lack of expression or low expression of PD-L1 indicates lack of T cell infiltration into the tumor. In some embodiments, cancer that does not express or has low expression of PD-L1 does not respond to CPI antibody therapy. In some embodiments, the mRNA therapeutic agent described herein induces or increases PD-L1 expression in the solid tumor malignancy. In some embodiments, the solid tumor malignancy is responsive to CPI antibody therapy after administration with the mRNA therapeutic agent described herein.

In some embodiments, the patient with a solid tumor malignancy has not previously been treated or exposed to an anti-cancer treatment prior to administration with the mRNA therapeutic agent described herein. In some embodiments, the patient with a solid tumor malignancy is primary refractory' to CPI. In some embodiments, CPI-primary refractory cancer occurs when a demonstration of progression of cancer has been observed in the patient after exposure to CPI. In some embodiments, the patient with a solid tumor malignancy is acquired secondary' resistance to CPI. In some embodiments, CPI-acquired secondary resistance occurs when a demonstration of progression of cancer has been observed in the patient after a confirmed objective response or prolonged stable disease after exposure to CPI followed by disease progression in the setting of ongoing treatment with CPI. In some embodiments, the patient has any one of the cancers described herein which is CPI- refractory.

In some embodiments, the solid tumor malignancy comprises one or more cutaneous or subcutaneous malignant lesions. As used herein, a “cutaneous or subcutaneous malignant lesion” or “cutaneous or subcutaneous lesion” or “SC/C lesion” each refer to a visible or palpable non-visceral tumor lesion (e.g., as measured by CT scan, MRI, and/or calipers). In some embodiments, the cutaneous or subcutaneous malignant lesion comprises superficial muscle tissue and/or fascia overlying these muscles (e.g., breast mass, supraclavicular lymph nodes, etc.). In some embodiments, the patient with a solid tumor malignancy has at least one cutaneous or subcutaneous malignant lesion that is injectable. In some embodiments, a cutaneous or subcutaneous malignant lesion that is injectable is one that is accessible for direct injection, e.g., without close proximity to critical structures (e.g., carotid artery', jugular vein, or other major blood vessels, nerve bundle, trachea, or other major airway tract). In some embodiments, a cutaneous or subcutaneous malignant lesion that is injectable has a smallest diameter of at least about 1.5 cm. In some embodiments, a cutaneous or subcutaneous malignant lesion that is injectable is one having at least about 50% tumor tissue that is viable (e.g., non-necrotic and/or non-cystic).

In some embodiments, the solid tumor malignancy comprises one or more deep seated malignant lesions. As used herein, a “deep seated malignant lesion” or “deep seated lesion” refers to a visceral tumor lesion that is not visible or palpable. In some embodiments, injection of a deep seated malignant lesion is achieved using image-guided injection. In some embodiments, the patient with a solid tumor malignancy has at least one deep seated malignant lesion that is injectable. In some embodiments, a deep seated malignant lesion that is injectable has a smallest diameter greater than 2 cm and a longest diameter less than 5 cm, e.g., based upon image analysis by a skilled clinician. In some embodiments, a deep seated malignant lesion that is injectable is located in an anatomic location that allows for safe administration of a composition comprising an mRNA encoding an IL-12 polypeptide, such as, not encasing, abutting, infiltrating or in close proximity to critical structures (e.g., such as trachea or other major airway tract, urinary tract, major blood vessels, biliary tract, or nerve bundles) or located in the brain, mediastinum, or bone. In some embodiments, the deep seated malignant lesion that is injectable is radially surrounded by viable normal organ parenchyma having a minimum diameter of 5 cm in all directions. In some embodiments, the deep seated malignant lesion that is injectable is not predominantly necrotic or cystic, e.g., based upon imaging. In some embodiments, the non-necrotic or non-cystic tumor tissue must have a smallest diameter of 2 cm or more and a longest diameter of less than 5 cm at the time of injection.

In some embodiments, the solid tumor malignancy is head and neck squamous cell carcinoma (HNSCC). HNSCC accounts for almost 90% of cancers involving the upper aerodigestive tract. Five-year survival rates for HNSCC are low and have not improved in several decades. Patients with this disease experience sever morbidity including disfigurement, speech, swallowing and breathing problems.

In some embodiments, the solid tumor malignancy is melanoma. Melanoma is a malignant tumor of melanocytes, has the ability to spread to other organs, and is among the most commonly occurring cancers. Melanoma carcinomas include superficial spreading melanoma, nodular melanoma, acral lentiginous melanoma, and lentigo maligna. The overall 5-year survival for melanoma is 91%. However, if distal metastasis occurs, cure rates are <15%. In some embodiments, the melanoma is refractory to immune CPI therapy. In some embodiments, the melanoma is primary refractory to immune CPI therapy. In some embodiments, the melanoma is secondary acquired resistance to immune CPI therapy. In some embodiments, the immune CPI therapy comprises PD-1 inhibition, PD-L1 inhibition, and/or CTLA-4 inhibition. In some embodiments, the melanoma has not received anti-cancer treatment prior to administration of a composition comprising an mRNA encoding human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) described herein, and is referred to herein as “neoadjuvant melanoma.”

In some embodiments, the solid tumor malignancy is non-small cell lung carcinoma (NSCLC). NSCLC is any type of epithelial lung cancer other than small-cell lung carcinoma (SCLC), and accounts for about 80-85% of all lung cancers. The main subtypes of NSCLC are adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. Generally, NSCLCs are less sensitive to chemotherapy and radiation therapy compared to SCLC. In some embodiments, the NSCLC is refractory to CPI. In some embodiments, the NSCLC is primary refractory to CPI. In some embodiments, the NSCLC is secondary acquired resistance to CPI.

Exemplary Methods of Treating Cancer

In some embodiments, the disclosure provides a method of treating a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) in a subject comprising administering to the subject an immune checkpoint inhibitor and a composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide). In some embodiments, the disclosure provides a method of treating a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) in a subject composing administering to the subject an immune checkpoint inhibitor, wherein the subject is receiving, has received, or will subsequently receive a composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide). In some embodiments, the disclosure provides a method of treating a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) in a subject comprising administering to the subject a composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide), wherein the subject is receiving, has received, or will subsequently receive an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is a PD-L1 antagonist. In some embodiments, the immune checkpoint inhibitor is a PD-1 antagonist. In some embodiments, the immune checkpoint inhibitor is a CTLA-4 antagonist.

In some embodiments, the disclosure provides a method of treating a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) in a subject comprising administering a composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide), wherein the subject is receiving, has received, or will subsequently receive an PD-L1 antagonist. In some embodiments, the disclosure provides a method of treating a solid tumor malignancy (e.g., an advanced or metastatic solid tumor malignancy) in a subject comprising administering PD-L1 antagonist to the subject, wherein the subject is receiving, has received, or will subsequently receive a composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide).

In some embodiments, the composition is huIL-12_mRNA_01 . In some embodiments, the PD-L1 antagonist is durvalumab.

In some embodiments, the subject has an advanced or metastatic solid tumor malignancy. In some embodiments, the advanced or metastatic solid tumor malignancy comprises one or more malignant lesions. In some embodiments, the one or more malignant lesions comprises a subcutaneous or cutaneous lesion. In some embodiments, the one or more malignant lesions comprises a deep-seated lesion. In some embodiments, the advanced or metastatic solid tumor malignancy is refractory to one or more therapeutic agents (e.g., an immune checkpoint inhibitor). In some embodiments, the advanced or metastatic solid tumor malignancy has developed resistance to the one or more therapeutic agents (e g., an immune checkpoint inhibitor) during a standard course of treatment. In some embodiments, the advanced or metastatic solid tumor malignancy is selected from melanoma, breast cancer, head and neck cancer, non-small-cell lung cancer, colorectal cancer, gastric cancer, and bladder cancer. In some embodiments, the disclosure provides a method of treating an advanced or metastatic solid tumor malignancy in a subject having a first malignant lesion accessible to injection (e.g., comprising at least 50% viable tumor tissue, having a location that is suitable for safe administration, such as not in close proximity to critical anatomical structures, and/or having a smallest diameter of at least 1.5 cm) and at least one additional malignant lesion that is a measurable target lesion according to RECIST vl.l criteria, wherein the first malignant lesion and the at least one additional malignant lesion are each a subcutaneous or cutaneous lesion, the method comprising administering an effective amount of the composition by intratumoral injection to the first malignant lesion, and wherein the subject is receiving, has received, or will receive systemic administration of an effective amount of durvalumab.

In some embodiments, the disclosure provides a method of treating an advanced or metastatic solid tumor malignancy in a subject having at least one deep-seated lesion that is injectable (e.g., having a smallest diameter greater than 2 cm; having a longest diameter less than 5 cm based upon image analysis; having a location that is in an anatomic location suitable for safe administration, such as not encasing, abutting, infiltrating, or in close proximity to cntical anatomical structures or located in the bram, mediastinum, or bone; having a radius of viable normal organ parenchyma with a minimum diameter of 5 cm in all directions; and/or comprises predominantly viable tumor tissue) comprising administering an effective amount of the composition by intratumoral injection to the at least one deep-seated lesion (e.g., using image guided injection), wherein the subject is receiving, has received, or will receive systemic administration of an effective amount of durvalumab.

In some embodiments, the subject has at least two malignant lesions. In some embodiments, the at least two malignant lesions comprise a first malignant lesion accessible to injection (e.g., a subcutaneous, cutaneous, or deep-seated lesion accessible to injection) and at least one additional malignant lesion (e.g., a subcutaneous, cutaneous, or deep-seated lesion), wherein the first malignant lesion and the at least one additional malignant lesion are proximal (e.g., localized to specific region of a tissue or organ) and/or distal (e.g., occurring at different anatomical regions). In some embodiments, the first malignant lesion and the at least one additional lesion are proximal. In some embodiments, the first malignant lesion and the at least one additional lesion are distal. In some embodiments, the first malignant lesion is an anal cancer, a bladder cancer, a breast cancer, a cervical cancer, a colorectal cancer, a gastric cancer, a head and neck cancer, a lung cancer (e.g., aNSCLC cancer), a pancreatic cancer, a skin cancer (e.g., a squamous cell carcinoma or melanoma), or a vulvar cancer. In some embodiments, the at least one additional lesion occurs at a site local to the first malignant lesion. In some embodiments, the at least one additional lesion occurs at a site distal from the first malignant lesion. In some embodiments, the at least one additional lesion comprises hepatic metastases. In some embodiments, the at least one additional lesion comprises brain metastases.

In some embodiments, the dose of the composition comprising an mRNA encoding a human IL-12 polypeptide is at least 0. 1 pg and up to 12.0 pg. In some embodiments, the dose of the composition is 0.1 pg. In some embodiments, the dose of the composition is 0.3 pg. In some embodiments, the dose of the composition is 1.0 pg. In some embodiments, the dose of the composition is 3.0 pg. In some embodiments, the dose of the composition is 8.0 pg. In some embodiments, the dose of the composition is 8.0 pg. In some embodiments, the dose of the composition is 12.0 pg. In some embodiments, the dose of the composition is based on the total amount of RNA administered to the subject.

In some embodiments, the dose of the durvalumab is at least about 1500 mg. In some embodiments, the dose of the durvalumab is about 1500 mg.

In some embodiments, systemic administration of durvalumab comprises intravenous injection.

In some embodiments, the subject is administered one or more dosing cycles of the composition, wherein the subject subsequently receives a dose of durvalumab once every about 3 weeks, once every about 4 weeks, or once every' about 5 weeks. In some embodiments, the subject is administered a first dose of the composition and at least one additional dose, wherein the subject subsequently receives a dose of durvalumab once every about 3 weeks, once every about 4 weeks, or once every about 5 weeks. In some embodiments, the subject is administered a first dose of the composition and at least one additional dose of the composition, wherein the dosing interval for the composition has a duration of about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, or about 5 weeks, and wherein the subject subsequently receives a dose of durvalumab once every about 3 weeks, once every about 4 weeks, or once every about 5 weeks. In some embodiments, the subject is administered a first dose and an additional dose of the composition, wherein the dosing interval for the composition has a duration of about 3 weeks, and wherein the subject subsequently receives a dose of durvalumab once every about 4 weeks. In some embodiments, the subject is administered a first dose of the composition and at least one additional dose of the composition, wherein the dosing interval for the composition has a duration of about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, or about 5 weeks, and wherein the subject subsequently receives a dose of durvalumab once every about 3 weeks, once every about 4 weeks, or once every about 5 weeks for a duration of up to about 1 year, about 2 years, about 3 years, indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved. In some embodiments, the subject is administered a first dose of the composition and an additional dose of the composition, wherein the dosing interval is about 3 weeks; and wherein the subject subsequently receives a dose of durvalumab once every about 4 weeks for a duration of up to about 1 year, about 2 years, about 3 years, indefinitely, or until a positive therapeutic outcome (e g., partial response, complete response, or stable disease) is achieved.

In some embodiments, the subject is administered a dosing cycle of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide), wherein the subject subsequently receives a dosing cycle of durvalumab, and wherein the duration between the dosing cycle of the composition and the dosing cycles of durvalumab is less than about 1 week or is at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 6 weeks, or at least about 8 weeks. In some embodiments, the subject is administered a dosing cycle of the composition composing an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide), followed by one or more dosing cycles of durvalumab, wherein the duration between the dosing cycle of the composition and the one or more dosing cycles of durvalumab is at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 6 weeks, or at least about 8 weeks. In some embodiments, the subject is administered at least two dosing cycles of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide), followed by one or more dosing cycles of durvalumab, wherein the duration between the at least two dosing cycles of the composition and the one or more dosing cycles of durvalumab is at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 6 weeks, or at least about 8 weeks. In some embodiments, the dosing cycle of durvalumab comprises administering durvalumab at a dosing frequency of once every about 1 week, once every about 2 weeks, once every about 3 weeks, once every about 4 weeks, once every about 6 weeks for a duration that is a multiple (e g., 2x, 3x, 4x, 5x, 6x, 7x, or 8x) of the dosing frequency or a duration that is indefinite or continues until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved.

In some embodiments, the subject is administered the composition in a first dosing cycle and at least one additional dosing cycle, wherein the first dosing cycle comprises a first dose of the composition and at least one additional dose, wherein the dosing interval has a duration of about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, or about 5 weeks, wherein the at least one additional dosing cycle comprises a dosing frequency of once every about 6 weeks, once about every 7 weeks, or about once every 8 weeks, wherein the subject is receiving a dose of durvalumab at a dosing frequency of once every about 3 weeks, once every about 4 weeks, or once about every 5 weeks, and wherein the first dose of the composition and the first dose of durvalumab begins on the same day or within a period having a duration of about 0.5 hours, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, or about 72 hours. In some embodiments, the subject is administered the composition and durvalumab for a duration of up to about 1 year, about 2 years, about 3 years, indefinitely, or until a positive therapeutic outcome (e.g., partial response, complete response, or stable disease) is achieved.

In some embodiments, the subject is administered (i) a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) and (n) a dose of durvalumab, wherein the subject is administered (i) and (ii) simultaneously or within a period having a duration of about 0.5 hours, about 1 hour, about 2 hours, about 4 hours, about 6 hours, or about 8 hours. In some embodiments, the dose of durvalumab is administered within a period of ±0.5 hours, of about ±1 hour, about ±2 hours, about ±4 hours, about ±6 hours, or about ±8 hours relative to the dose of the composition.

In some embodiments, the subject is administered (i) a dose of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP-encapsulated mRNA encoding a human IL-12 polypeptide) and (ii) a dose of durvalumab, wherein the subject is administered (i) and (ii) on the same day or within a period having a duration of about 0.5 hours, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, or about 72 hours. In some embodiments, the dose of the composition is administered on the same day as the dose of durvalumab. In some embodiments, the dose of the composition is administered on day 1 , and the dose of durvalumab is administered on about day 1. In some embodiments, the dose of the composition is administered on day 1, and the dose of durvalumab is administered on about day 2, about day 3, or about day 4. In some embodiments, the dose of durvalumab is administered on day 1, and the dose of the composition is administered on day about 1. In some embodiments, the dose of durvalumab is administered on day 1, and the dose of the composition is administered on day about 2, about day 3, or about day 4.

In some embodiments, the subject is administered (i) a dosing cycle of the composition comprising an mRNA encoding a human IL-12 polypeptide (e.g., an LNP- encapsulated mRNA encoding a human IL-12 polypeptide) and (ii) a dosing cycle of durvalumab, wherein the subject is administered (i) and (ii) beginning on the same day or within a period having a duration of about 0.5 hours, about I hour, about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, or about 72 hours. In some embodiments, the subject is administered (i) a dosing cycle of the composition comprising an mRNA encoding a human IL- 12 polypeptide (e.g., an LNP -encapsulated mRNA encoding a human IL- 12 polypeptide), wherein the dosing cycle comprises a dosing frequency of once every about 2 weeks, about 3 weeks, or about 4 weeks for a duration that is a multiple (e.g., 2x, 3x, 4x, 5x, 6x, 7x, or 8x) of the dosing frequency, and (ii) a dosing cycle of durvalumab, wherein the subject is administered (i) and (ii) beginning on the same day or within a period having a duration of about 0.5 hours, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, or about 72 hours. In some embodiments, the dosing cycle of the composition begins on the same day as the dosing cycle of durvalumab. In some embodiments, the dosing cycle of the composition begins on day 1, and the dosing cycle of durvalumab begins on about day 1. In some embodiments, the dosing cycle of the composition begins on day 1 , and the dosing cycle of durvalumab begins on about day 2, about day 3, about day 4, about day 5, about day 6, or about day 7. In some embodiments, the dosing cycle of durvalumab begins on day 1, and the dosing cycle of the composition begins on about day 1. In some embodiments, the dosing cycle of durvalumab begins on day 1, and the dosing cycle of the composition begins on about day 2, about day 3, about day 4, about day 5, about day 6, or about day 7.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL-12 polypeptide, wherein the patient is administered a first dose of 0.1-12.0μg of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an immune checkpoint inhibitor by intravenous injection, wherein the first dose of the immune checkpoint inhibitor is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the immune checkpoint inhibitor is administered on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the immune checkpoint inhibitor by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered a first dose of 0. 1-12.0μg of the mRNA therapeutic agent and a second dose of 0. l-12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the patient is administered a first dose of 0. l-12.0pg of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an immune checkpoint inhibitor by intravenous injection, wherein the first dose of the immune checkpoint inhibitor is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the immune checkpoint inhibitor on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the immune checkpoint inhibitor by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the immune checkpoint inhibitor , thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF compnses the nucleotide sequence of SEQ ID NO: 2.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent compnses an ORF compnsing a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the patient is administered a first dose of 0. 1 - 12.0μg of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises (I) 40-60% ionizable amino lipid (e g , Compound II), 8-16% phospholipid (e.g., DSPC), 30- 45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0. 1 - 12. Ong of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an immune checkpoint inhibitor by intravenous injection, wherein the first dose of the immune checkpoint inhibitor is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the immune checkpoint inhibitor on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the immune checkpoint inhibitor by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the immune checkpoint inhibitor , thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30- 45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0. l-12.0pg of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5- 10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0.1-12.0μg of the mRNA therapeutic agent and a second dose of 0.1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an immune checkpoint inhibitor by intravenous injection, wherein the first dose of the immune checkpoint inhibitor is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the immune checkpoint inhibitor on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the immune checkpoint inhibitor by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0.1-12.0μg of the mRNA therapeutic agent and a second dose of 0.1 -12. Ogg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD- L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: 1 or 19, wherein the patient is administered a first dose of 0. l-12.0pg of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an immune checkpoint inhibitor by intravenous injection, wherein the first dose of the immune checkpoint inhibitor is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the immune checkpoint inhibitor on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the immune checkpoint inhibitor by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the immune checkpoint inhibitor , thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: l.In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: 1, wherein the patient is administered a first dose of 0. 1-12.0μg of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: 19, wherein the patient is administered a first dose of 0. l-12.0pg of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: 1 or 19, wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30- 45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable ammo lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0. 1 - 12.0ug of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an immune checkpoint inhibitor by intravenous injection, wherein the first dose of the immune checkpoint inhibitor is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the immune checkpoint inhibitor on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the immune checkpoint inhibitor by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5- 10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: 1, wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-1 % phospholipid (e g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0. 1 -12.0pg of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21 , about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5- 10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: 19, wherein the LNP comprises (1) 40- 60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable ammo lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0. 1 - 12.0ug of the mRNA therapeutic agent and a second dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5- 10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: I or 19, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0.1-12.0μg of the mRNA therapeutic agent and a second dose of 0. 1 - l 2.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an immune checkpoint inhibitor by intravenous injection, wherein the first dose of the immune checkpoint inhibitor is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the immune checkpoint inhibitor on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the immune checkpoint inhibitor by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: 1, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e g., cholesterol), and about 1 .5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0.1-12.0μg of the mRNA therapeutic agent and a second dose of 0.1 -12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD- L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least about 90% identity to SEQ ID NO: 19, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dose of 0.1-12.0μg of the mRNA therapeutic agent and a second dose of 0.1 -12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first dose and the second dose of the mRNA therapeutic agent is about 3 weeks (e.g., the first dose on about day 1 and the second dose on about day 21, about day 22, or about day 23), wherein the patient subsequently receives a first dose of an PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection, wherein the first dose of the PD-L1 antagonist is administered about 3 weeks after the second dose of the mRNA therapeutic agent (e.g., the first dose of the PD-L1 antagonist on about day 41, about day 42, about day 43, or about day 44 and the second dose of the mRNA therapeutic agent on about day 21, about day 22, or about day 23), and wherein the patient receives an additional dose of the PD-L1 antagonist (e.g., durvalumab) of about 1500 mg by intravenous injection every about 4 weeks beginning about 4 weeks following administration of the first dose of the PD- L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-8.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1-8.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a PD-L1 antagonist (e.g., durvalumab) of about 1500 mg administered by intravenous injection, wherein the first dose of the PD-L1 antagonist begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the PD-L1 antagonist (e.g., durvalumab), wherein the dosing cycle comprises administering to the patient a dose of PD-L1 antagonist (e.g., durvalumab) of about 1500 mg every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patent, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1-12.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of an immune checkpoint inhibitor administered by intravenous injection, wherein the first dose of the immune checkpoint inhibitor begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the immune checkpoint inhibitor , wherein the dosing cycle comprises administering to the patient a dose of immune checkpoint inhibitor every about 4 weeks beginning 4 weeks after the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patent, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1-12.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a PD-L1 antagonist (e.g., durvalumab) of about 1500 mg administered by intravenous injection, wherein the first dose of the PD-L1 antagonist begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the PD-L1 antagonist (e g., durvalumab), wherein the dosing cycle comprises administering to the patient a dose of PD-L1 antagonist (e.g., durvalumab) of about 1500 mg every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. l-12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. l-12.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of an immune checkpoint inhibitor administered by intravenous injection, wherein the first dose of the immune checkpoint inhibitor begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the immune checkpoint inhibitor , wherein the dosing cycle comprises administering to the patient a dose of immune checkpoint inhibitor every about 4 weeks beginning 4 weeks after the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-8.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. l-8.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a PD-L1 antagonist (e.g., durvalumab) of about 1500 mg administered by intravenous injection, wherein the first dose of the PD-L1 antagonist begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the PD-L1 antagonist (e.g., durvalumab), wherein the dosing cycle comprises administering to the patient a dose of PD-L1 antagonist (e.g., durvalumab) of about 1500 mg every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30- 45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. l-12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. l-12.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a immune checkpoint inhibitor administered by intravenous injection, wherein the first dose of the immune checkpoint inhibitor begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the immune checkpoint inhibitor, wherein the dosing cycle comprises administering to the patient a dose of immune checkpoint inhibitor every about 4 weeks beginning 4 weeks after the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5-10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30- 45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable ammo lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-8.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. l-8.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a PD-L1 antagonist (e.g., durvalumab) of about 1500 mg administered by intravenous injection, wherein the first dose of the PD-L1 antagonist begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the PD-L1 antagonist (e.g., durvalumab), wherein the dosing cycle comprises administering to the patient a dose of PD-L1 antagonist (e.g., durvalumab) of about 1500 mg every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5- 10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG. In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dose is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 - 12.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a immune checkpoint inhibitor administered by intravenous injection, wherein the first dose of the immune checkpoint inhibitor begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the immune checkpoint inhibitor, wherein the dosing cycle comprises administering to the patient a dose of immune checkpoint inhibitor every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0 l -8.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1-8.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a PD-Ll antagonist (e.g., durvalumab) of about 1500 mg administered by intravenous injection, wherein the first dose of the PD-L1 antagonist begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the PD-L1 antagonist (e g., durvalumab), wherein the dosing cycle comprises administering to the patient a dose of PD-L1 antagonist (e.g., durvalumab) of about 1500 mg every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, compnsing administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1 or 19, wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. l-12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0.1 -12.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a immune checkpoint inhibitor administered by intravenous injection, wherein the first dose of the immune checkpoint inhibitor begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the immune checkpoint inhibitor, wherein the dosing cycle comprises administering to the patient a dose of immune checkpoint inhibitor every about 4 weeks beginning 4 weeks after the first dose of the immune checkpoint inhibitor , thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1, wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-8.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0.1-8.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a PD-L1 antagonist (e.g., durvalumab) of about 1500 mg administered by intravenous injection, wherein the first dose of the PD-L1 antagonist begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the PD-L1 antagonist (e.g., durvalumab), wherein the dosing cycle comprises administering to the patient a dose of PD-L1 antagonist (e.g., durvalumab) of about 1500 mg every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1 or 19, wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. l-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. l-12.0|jg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a immune checkpoint inhibitor administered by intravenous injection, wherein the first dose of the immune checkpoint inhibitor begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the immune checkpoint inhibitor, wherein the dosing cycle comprises administering to the patient a dose of immune checkpoint inhibitor every about 4 weeks beginning 4 weeks after the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA compnses the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5-10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1, wherein the LNP compnses (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-8.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 -S.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a PD-L1 antagonist (e.g., durvalumab) of about 1500 mg administered by intravenous injection, wherein the first dose of the PD-L1 antagonist begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the PD-L1 antagonist (e g., durvalumab), wherein the dosing cycle comprises administering to the patient a dose of PD-L1 antagonist (e.g., durvalumab) of about 1500 mg every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5- 10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1 or 19, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. l-12.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a immune checkpoint inhibitor administered by intravenous injection, wherein the first dose of the immune checkpoint inhibitor begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the immune checkpoint inhibitor , wherein the dosing cycle comprises administering to the patient a dose of immune checkpoint inhibitor every about 4 weeks beginning 4 weeks after the first dose of the immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the disclosure provides a method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1, wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG), wherein the patient is administered a first dosing cycle and a second dosing cycle of the mRNA therapeutic agent, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1 -8. O ng of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 -S.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a first dose of a PD-Ll antagonist (e.g., durvalumab) of about 1500 mg administered by intravenous injection, wherein the first dose of the PD-L1 antagonist begins on the same day as the first dose of the first dosing cycle of the mRNA therapeutic agent, and wherein the patient subsequently receives a dosing cycle of the PD-L1 antagonist (e.g., durvalumab), wherein the dosing cycle comprises administering to the patient a dose of PD-L1 antagonist (e.g., durvalumab) of about 1500 mg every about 4 weeks beginning 4 weeks after the first dose of the PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

Clinical Outcome

In some aspects, the disclosure provides a method of treating a solid tumor malignancy comprising administration (e.g., intratumoral administration) of the mRNA encoding a human IL- 12 polypeptide to a subject that is receiving, has received, or subsequently receives an immune checkpoint inhibitor (e.g., a PD-L1 antagonist), wherein the administration results in an anti-tumor immune response. In some embodiments, administering the mRNA encoding a human IL-12 polypeptide induces an anti-tumor immune response in the patient. In some embodiments, intratumoral administration of the mRNA encoding a human IL-12 polypeptide induces an anti-tumor immune response in the patient. In some embodiments, detection of the anti-tumor immune response comprises collection of one or more clinical samples from the patient (e.g., semm, plasma, peripheral blood, and/or tumor biopsies), and assessing one or more soluble factors (e.g., C-reactive protein, cytokines, and/or chemokines), immunomodulatory molecules (e.g., immune checkpoint inhibitors, antigen receptors, major histocompatibility complex molecules), immune cell subpopulations (e.g., T cells, B cells, NK cells, monocytes, dendritic cells and myeloid-derived suppressor cell (MDSC) subpopulations), clonality of antigen-specific immune cells (e.g., B cells and/or T cells), and/or circulating tumor fraction in the one or more clinical samples according to a method of measurement described herein or known in the art. In some embodiments, detection of an anti-tumor immune response indicates the solid tumor malignancy will respond or will likely respond to a method of treatment described herein. In some embodiments, the response comprises a complete response. In some embodiments, the response comprises a partial response. In some embodiments, the response comprises stable disease. In some embodiments, a complete response, partial response, or stable disease is evaluated based on RECIST vl. l criteria.

In some embodiments, the anti-tumor immune response comprises increased expression of IL-12 (e.g., by tumor macrophages and/or tumor dendritic cells). In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of IL-12 (e g., by tumor macrophages and/or tumor dendritic cells). In some embodiments, increased expression (e.g., increased intratumoral expression) of IL-12 is detected in one or more clinical samples collected from the patient (e.g., a tumor biopsy, plasma, peripheral blood, and/or serum sample) according to a method of measurement described herein (e.g., a method comprising measuring expression of an IL- 12 polypeptide and/or a gene or transcript thereof encoding an IL- 12 polypeptide as further described herein). In some embodiments, increased expression of IL-12 is detected in a plasma and/or serum sample collected from the patient. In some embodiments, increased expression of IL-12 is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased expression (e.g., increased intratumoral expression) of IL-12 indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease.

In some embodiments, the anti-tumor immune response comprises increased expression of IFNy (e.g., by T cells and/or NK cells). In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of IFNy (e.g., by T cells and/or NK cells). In some embodiments, increased expression (e.g., increased intratumoral expression) of IFNy is detected in one or more clinical samples collected from the patient (e.g., a tumor biopsy, plasma, peripheral blood, and/or serum sample) according to a method of measurement described herein (e.g., a method comprising measuring expression of an IFNy polypeptide and/or a gene or transcript thereof encoding an IFNy polypeptide as further described herein). In some embodiments, increased expression of IFNy is detected in a plasma and/or serum sample collected from the patient. In some embodiments, increased expression of IFNy is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased expression (e.g., increased intratumoral expression) of IFNy indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease.

In some embodiments, the anti-tumor immune response comprises increased expression of one or more IFNy-inducible chemokines. In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of the one or more IFNy- inducible chemokines. In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more IFNy-inducible chemokines is detected in one or more clinical samples collected from the patient (e g., a tumor biopsy, plasma, peripheral blood, and/or serum sample) according to a method of measurement described herein (e.g., a method comprising measuring expression of one or more IFNy-inducible chemokine polypeptides and/or a gene or transcript thereof encoding the one or more IFNy-inducible chemokine polypeptides as further described herein). In some embodiments, increased expression of the one or more IFNy-inducible chemokines is detected in a plasma and/or serum sample collected from the patient. In some embodiments, increased expression of the one or more IFNy-inducible chemokines is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more IFNy-inducible chemokines indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease. In some embodiments, the one or more IFNy-inducible chemokines is selected from CXCL9, CXCL10, and CXCL11.

In some embodiments, the anti-tumor immune response comprises increased expression of one or more mediators of CD8+ T cell function (e.g., cytokine expression, proliferation, differentiation, and/or cy totoxicity). In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of the one or more mediators of CD8+ T cell function. In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more mediators is detected in one or more clinical samples collected from the patient (e.g., a tumor biopsy, plasma, peripheral blood, and/or serum sample) according to a method of measurement described herein (e.g., a method comprising measuring expression of one or more polypeptide mediators of CD8+ T cell function and/or a gene or transcript thereof encoding the one or more polypeptide mediators of CD8+ T cell function as further described herein). In some embodiments, increased expression of the one or more mediators is detected in a plasma and/or serum sample collected from the patient. In some embodiments, increased expression of the one or more mediators is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more mediators indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease. In some embodiments, the one or more mediators of CD8+ T cell function is selected from GZMB (encoding granzyme B), PRF1 (encoding perforin), IFNy, IL12RB1 (encoding IL12 Receptor beta 1), IL12RB2 (encoding IL12 Receptor beta 2), CD38, and a combination thereof.

In some embodiments, the anti-tumor immune response comprises increased expression of one or more mediators of antigen presenting cell (APC) function (e.g., APC activation, maturation, and/or differentiation). In some embodiments, the anti-tumor immune response comprises increased expression of one or more mediators of dendritic cell (DC) function (e.g., DC activation, maturation, and/or differentiation). In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more mediators is detected in one or more clinical samples collected from the patient (e.g., a tumor biopsy, plasma, peripheral blood, and/or serum sample) according to a method of measurement described herein (e.g., a method comprising measuring expression of one or more polypeptide mediators of APC function and/or a gene or transcript thereof encoding the one or more polypeptide mediators of APC function as further described herein). In some embodiments, increased expression of the one or more mediators of APC function is detected in a plasma and/or serum sample collected from the patient. In some embodiments, increased expression of the one or more mediators of APC function is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more mediators of APC function indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease. In some embodiments, the one or more mediators of APC function is selected from major histocompatibility complex type I (MHC-I), CD80, CD83, CD86, IFNy receptor, and a combination thereof.

In some embodiments, the anti-tumor immune response comprises increased expression of one or more mediators of NK cell function (e.g., NK cell activation, maturation, and/or differentiation). In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more mediators of NK cell function is detected in one or more clinical samples collected from the patient (e.g., a tumor biopsy, plasma, peripheral blood, and/or serum sample) according to a method of measurement described herein (e.g., a method comprising measuring expression of one or more polypeptide mediators of NK cell function and/or a gene or transcript thereof encoding the one or more polypeptide mediators of NK cell function as further described herein). In some embodiments, increased expression of the one or more mediators of NK cell function is detected in a plasma and/or serum sample collected from the patient. In some embodiments, increased expression of the one or more mediators of NK cell function is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more mediators of NK cell function indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease. In some embodiments, the one or more mediators of NK cell function is selected from KLRB1, KLRK1 , and a combination thereof.

In some embodiments, the anti-tumor immune response comprises increased expression of one or more immune checkpoint inhibitor molecules. In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of one or more immune checkpoint inhibitor molecules, e.g., by tumor cells, tumor epithelial cells, and/or tumor immune cells. In some embodiments, the anti-tumor immune response comprises increased expression of PD-L1 by tumor cells and/or leukocytes. In some embodiments, the anti-tumor immune response comprises increased expression of PD-L1 and/or PD-1. In some embodiments, the anti-tumor immune response comprises increased intratumoral expression of PD-L1 and/or PD-1, e.g., by tumor cells, tumor epithelial cells, and/or tumor immune cells. In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more immune checkpoint inhibitor molecules (e.g., PD-L1 and/or PD-1) is detected in one or more clinical samples collected from the patient (e.g., a tumor biopsy, plasma, peripheral blood, and/or serum sample) according to a method of measurement described herein (e.g., a method comprising measuring expression of one or more immune checkpoint inhibitor polypeptides and/or a gene or transcript thereof encoding the one or more immune checkpoint inhibitor polypeptides as further described herein). In some embodiments, increased expression of the one or more one or more immune checkpoint inhibitor molecules (e.g., PD-L1 and/or PD-1) is detected in a plasma and/or serum sample collected from the patient. In some embodiments, increased expression of the one or more one or more immune checkpoint inhibitor molecules (e.g., PD-L1 and/or PD-1) is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased expression (e.g., increased intratumoral expression) of the one or more one or more immune checkpoint inhibitor molecules (e.g., PD-L1 and/or PD-1) indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease.

In some embodiments, the anti-tumor immune response comprises increased cell- mediated immune response. In some embodiments, the anti-tumor immune response comprises increased abundance of tumor-infiltrating T cells (e g., CD3+ T cells and/or CD8+ T cells). In some embodiments, the anti-tumor immune response comprises increased proliferation of T cells in the tumor microenvironment. In some embodiments, the anti-tumor immune response comprises increased proliferation of NK cells in the tumor microenvironment. In some embodiments, the anti-tumor immune response comprises increased proliferation of T cells (e.g., CD3+ and/or CD8+ T cells). In some embodiments, the antitumor immune response comprises increased intratumoral proliferation of T cells (e.g., CD3+ and/or CD8+ T cells). In some embodiments, increased proliferation (e.g., increased intratumoral proliferation) of the T cells (e.g., CD3+ and/or CD8+ T cells) is detected in one or more clinical samples collected from the patient (e.g., a tumor biopsy, plasma, peripheral blood, and/or serum sample) according to a method of measurement described herein. In some embodiments, increased proliferation of T cells (e g., CD3+ and/or CD8+ T cells) is detected in a plasma and/or serum sample collected from the patient. In some embodiments, increased proliferation of T cells (e.g., CD3+ and/or CD8+ T cells) is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased proliferation of T cells (e.g., CD3+ and/or CD8+ T cells) indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease.

In some embodiments, the anti-tumor immune response comprises increased intratumoral infiltration of CD8+ T cells (e.g., tumor-specific CD8+ T cells). In some embodiments, increased intratumoral infiltration of CD8+ T cells (e.g., tumor-specific CD8+ T cells) is detected in one or more tumor biopsies collected from the patient. In some embodiments, increased intratumoral infiltration of CD8+ T cells (e.g., tumor-specific CD8+ T cells) indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease.

In some embodiments, circulating tumor fraction detected in one or more liquid biopsy samples collected from the subject indicates whether the solid tumor malignancy will respond or will likely respond to the method of treatment described herein, wherein the response is a complete response, partial response, or stable disease. In some embodiments, a decreased circulating tumor fraction measured in a liquid biopsy obtained from the subject following administration of a composition described herein relative to the circulating tumor fraction measured in liquid biopsy obtained prior to the administration indicates whether the solid tumor malignancy will respond or will likely respond to the method of treatment described herein, wherein the response is a complete response, partial response, or stable disease. In some embodiments, a decrease in the circulating tumor fraction is measured as a decrease in the maximum VAF in the liquid biopsy obtained following the administration as compared to the maximum VAF in the liquid biopsy obtained prior to the administration. In some embodiments, a decrease in maximum VAF of about 10%, about 20%, about 30%,

I l l about 40%. about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% indicates the solid tumor malignancy will respond or will likely respond to the method of treatment, wherein the response is a complete response, partial response, or stable disease.

In some embodiments, a high tumor mutation burden (TMB) detected in one or more clinical samples collected from the subject (e.g., a tumor biopsy, plasma, peripheral blood, and/or serum sample), indicates the solid tumor malignancy will respond or will likely respond to the method of treatment described herein, wherein the response is a complete response, partial response, or stable disease. TMB is a measure of the number of somatic mutations carried by tumor cells and is measured by comparing the genome or exome of cancerous tissues to a reference genome or exome. In some embodiments, the TMB is measured by performing sequencing of a tumor sample or circulating tumor DNA (e.g., using whole exome or whole genome sequencing) and identifying somatic mutations in the sequencing data (e.g., single nucleotide variants, short insertions/deletions). In some embodiments, a high TMB score is one greater than about 10 mutations per Mb of DNA, about 15 mutations per Mb of DNA, about 20 mutations per Mb of DNA, about 25 mutations per Mb of DNA, or about 30 mutations per Mb of DNA.

Compositions Comprising mRNAs Encoding IL-12

The present disclosure provides compositions of an mRNA encoding a human IL-12 polypeptide, e.g., an LNP-encapsulated mRNA encoding a human IL- 12 polypeptide, for the treatment of cancer. In some embodiments, the composition is formulated for in vivo delivery, e.g., by intratumoral injection.

In some embodiments, the disclosure provides an LNP-encapsulated mRNA encoding a human IL-12 polypeptide, wherein the mRNA encoding a human IL-12 polypeptide comprises an open reading frame (ORF) comprising a nucleotide sequence at least 80% identical to the nucleotide sequence of SEQ ID NO: 2 or comprising the nucleotide sequence of SEQ ID NO: 2. mRNAs Encoding IL-12 Polypeptides

In some embodiments, the disclosure provides an mRNA encoding an IL-12 polypeptide. IL-12 (also shown as IL 12) is a pleiotropic cytokine, the actions of which create an interconnection between innate and adaptive immunity. IL-12 functions primarily as a 70 kDa heterodimeric protein consisting of two disulfide-linked p35 and p40 subunits. The precursor form of the IL-12 p40 subunit (NM_002187; P29460; also referred to as IL-12B, natural killer cell stimulator}' factor 2, cytotoxic lymphocyte maturation factor 2) is 328 amino acids in length, while its mature form is 306 amino acids long. The precursor form of the IL-12 p35 subunit (NM_000882; P29459; also referred to as IL-12A, natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1) is 219 amino acids in length and the mature form is 197 amino acids long. Id. The genes for the IL- 12 p35 and p40 subunits reside on different chromosomes and are regulated independently of each other. Gately, MK et al., Annu Rev Immunol. 16: 495-521 (1998). Many different immune cells (e.g., dendritic cells, macrophages, monocytes, neutrophils, and B cells) produce IL-12 upon antigenic stimuli. The active IL-12 heterodimer is formed following protein synthesis. Id.

IL-12 is composed of a bundle of four alpha helices. It is a heterodimeric cytokine encoded by two separate genes, IL-12A (p35) and IL-12B (p40). The active heterodimer (referred to as 'p70'), and a homodimer of p40 are formed following protein synthesis.

As used herein, the term “IL- 12 polypeptide” refers to a fusion protein comprising an IL-12A polypeptide and an IL-12B polypeptide. In some embodiments, the fusion protein comprises from N-termmus to C-terminus: an IL-12B signal peptide, a mature IL-12B polypeptide, a peptide linker, and a mature IL-12A polypeptide. In some embodiments, the IL-12B signal peptide comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to the amino acid sequence of SEQ ID NO: 8 In some embodiments, the IL-12B signal peptide comprises the amino acid sequence of SEQ ID NO: 8. In some embodiments, the mature IL-12B polypeptide comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to SEQ ID NO: 9. In some embodiments, the mature IL-12B polypeptide comprises an amino acid sequence of SEQ ID NO: 9. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 11. In some embodiments, the mature IL-12A polypeptide comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to SEQ ID NO: 10. In some embodiments, the mature IL-12A polypeptide comprises the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the IL- 12 polypeptide comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to SEQ ID NO: 5. In some embodiments, the IL-12 polypeptide comprises the amino acid sequence of SEQ ID NO: 5. In some embodiments, the IL-12 polypeptide consists of the amino acid sequence of SEQ ID NO: 5.

In some embodiments, the IL- 12 polypeptide comprises the amino acid sequence of SEQ ID NO: 5 with one or more conservative substitutions, wherein the conservative substitutions do not significantly affect the binding activity of the IL-12 polypeptide to its receptor relative to the IL- 12 polypeptide without the one or more conservative substitutions.

In some embodiments, the disclosure provides an mRNA encoding an IL-12 polypeptide comprising an ORF, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the ORF comprises SEQ ID NO: 2. In some embodiments, the ORF consists of SEQ ID NO: 2.

In some embodiments, the mRNA encoding an IL-12 polypeptide further comprises a 5 ’'cap, a 5'UTR, 3'UTR, and/or poly A tail.

In some embodiments, the mRNA encoding an IL- 12 polypeptide comprises from 5' to 3': (i) a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 3; (ii) an ORF encoding an IL-12 polypeptide comprising the nucleotide sequence of SEQ ID NO: 2; and (iii) a 3'UTR comprising a nucleotide sequence of SEQ ID NO: 4. In some embodiments, mRNA comprises a 5'cap. In some embodiments, the mRNA comprises a polyA tail.

In some embodiments, the mRNA encoding an IL-12 polypeptide comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA encoding an IL-12 polypeptide comprises a nucleotide sequence of SEQ ID NO: 1.

In some embodiments, the mRNA encoding an IL- 12 polypeptide comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the mRNA encoding an IL-12 polypeptide comprises a nucleotide sequence of SEQ ID NO: 19. mRNA Construct Components An mRN A may be a naturally or non-naturally occurring mRNA. An mRNA may include one or more modified nucleobases, nucleosides, or nucleotides, as described below, in which case it may be referred to as a “modified mRNA” or “mmRNA.” As described herein “nucleoside” is defined as a compound containing a sugar molecule (e.g., a pentose or ribose) or derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). As described herein, “nucleotide” is defined as a nucleoside including a phosphate group.

An mRNA may include a 5’ untranslated region (5’-UTR), a 3’ untranslated region (3’-UTR), and/or a coding region (e.g., an open reading frame). An exemplary 5’ UTR for use in the constructs is shown in SEQ ID NO: 3. An exemplary 3’ UTR for use in the constructs is shown in SEQ ID NO: 4. An mRNA may include any suitable number of base pairs, including tens (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100), hundreds (e.g., 200, 300, 400, 500, 600, 700, 800, or 900) or thousands (e.g., 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000) of base pairs. Any number (e.g., all, some, or none) of nucleobases, nucleosides, or nucleotides may be an analog of a canonical species, substituted, modified, or otherwise non-naturally occurring. In certain embodiments, all of a particular nucleobase type may be modified.

In some embodiments, an mRNA as described herein may include a 5 ’ cap structure, a chain terminating nucleotide, optionally a Kozak sequence (also known as a Kozak consensus sequence), a stem loop, a poly A sequence, and/or a poly adenylation signal.

A 5’ cap structure or cap species is a compound including two nucleoside moieties joined by a linker and may be selected from a naturally occurring cap, a non-naturally occurring cap or cap analog, or an anti-reverse cap analog (ARCA). A cap species may include one or more modified nucleosides and/or linker moieties. For example, a natural mRNA cap may include a guanine nucleotide and a guanine (G) nucleotide methylated at the 7 position joined by a triphosphate linkage at their 5’ positions, e.g., m⁷G(5’)ppp(5’)G, commonly written as m⁷GpppG. A cap species may also be an anti-reverse cap analog. A non-limiting list of possible cap species includes nf GpppG, m⁷Gpppm⁷G, m⁷3'dGpppG, m2^{7 03} GpppG, m2⁷⁰³ GppppG, m2^{7 O2}’GppppG, m⁷Gpppm⁷G, m⁷3'dGpppG, m2^{7 O3}’GpppG, m₂ ^/’°³ GppppG, and m2^{7 02} GppppG.

An mRNA may instead or additionally include a chain terminating nucleoside. For example, a chain terminating nucleoside may include those nucleosides deoxygenated at the 2’ and/or 3’ positions of their sugar group. Such species may include 3’-deoxy adenosine (cordycepin), 3'-deoxyuridine, 3'-deoxy cytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2', 3'-di deoxynucleosides, such as 2', 3’ -di deoxy adenosine, 2',3'-dideoxyuridine, 2^l,3'-dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine. In some embodiments, incorporation of a chain terminating nucleotide into an mRNA, for example at the 3 ’-terminus, may result in stabilization of the mRNA, as described, for example, in International Patent Publication No. WO 2013/103659.

An mRNA may instead or additionally include a stem loop, such as a histone stem loop. A stem loop may include 2, 3, 4, 5, 6, 7, 8, or more nucleotide base pairs. For example, a stem loop may include 4, 5, 6, 7, or 8 nucleotide base pairs. A stem loop may be located in any region of an mRNA. For example, a stem loop may be located in, before, or after an untranslated region (a 5’ untranslated region or a 3’ untranslated region), a coding region, or a polyA sequence or tail. In some embodiments, a stem loop may affect one or more function(s) of an mRNA, such as initiation of translation, translation efficiency, and/or transcriptional termination.

An mRNA may instead or additionally include a polyA sequence and/or polyadenylation signal. A polyA sequence may be comprised entirely or mostly of adenine nucleotides or analogs or denvatives thereof. A polyA sequence may be a tail located adjacent to a 3’ untranslated region of an mRNA. In some embodiments, a polyA sequence may affect the nuclear export, translation, and/or stability of an mRNA.

An mRNA may instead or additionally include a microRNA binding site.

MicroRNA Binding Sites

In some embodiments, the IL- 12 encoding mRNA comprises one or more microRNA binding sites. microRNAs (or miRNA) are 19-25 nucleotides long noncoding RNAs that bind to the 3'UTR of nucleic acid molecules and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation.

By engineering microRNA target sequences into an mRNA, one can target the molecule for degradation or reduced translation, provided the microRNA in question is available. In some embodiments, the miRNA binding site (e.g, miR-122 binding site) binds to the corresponding mature miRNA that is part of an active RNA-induced silencing complex (RISC) containing Dicer. In some embodiments, binding of the miRNA binding site to the corresponding miRNA in RISC degrades the mRNA containing the miRNA binding site or prevents the mRNA from being translated. Some microRNAs, e.g., miR-122, are abundant in normal tissue but are present in much lower levels in cancer or tumor tissue. Thus, engineering microRNA target sequences (i.e., microRNA binding site) into the IL- 12 encoding mRNA (e.g., in a 3'UTR like region or other region) can effectively target the molecule for degradation or reduced translation in normal tissue (where the microRNA is abundant) while providing high levels of translation in the cancer or tumor tissue (where the microRNA is present in much lower levels). This provides a tumor-targeting approach for the methods and compositions of the disclosure.

In some embodiments, the microRNA binding site (e.g., miR-122 binding site) is fully complementary to miRNA (e.g., miR-122), thereby degrading the mRNA fused to the miRNA binding site. In other embodiments, the miRNA binding site is not fully complementary to the corresponding miRNA. In certain embodiments, the miRNA binding site (e.g., miR-122 binding site) is the same length as the corresponding miRNA (e.g, miR- 122). The miRNA binding sites that are shorter than the corresponding miRNAs are still capable of degrading the mRNA incorporating one or more of the miRNA binding sites or preventing the mRNA from translation.

In some embodiments, the microRNA binding site (e.g., miR-122 binding site) has sufficient complementarity to miRNA (e.g., miR-122) so that a RISC complex comprising the miRNA (e.g., miR-122) cleaves the mRNA comprising the microRNA binding site. In other embodiments, the microRNA binding site (e.g., miR-122 binding site) has imperfect complementarity so that a RISC complex comprising the miRNA (e.g., miR-122) induces instability in the mRNA comprising the microRNA binding site. In another embodiment, the microRNA binding site (e.g., miR-122 binding site) has imperfect complementarity so that a RISC complex comprising the miRNA (e.g., miR-122) represses transcription of the mRNA comprising the microRNA binding site.

In some embodiments, the IL-12 encoding mRNA comprise at least one miR-122 binding site, at least two miR-122 binding sites, at least three miR-122 binding sites, at least four miR-122 binding sites, or at least five miR-122 binding sites. In some embodiments, the miRNA binding site binds miR-122 or is complementary to miR-122. In some embodiments, the miRNA binding site binds to miR-122-3p or miR-122-5p. In some embodiments, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 15, wherein the miRNA binding site binds to miR-122. In another particular aspect, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 16, wherein the miRNA binding site binds to miR-122. In some embodiments, a miRNA binding site (e.g, miR-122 binding site) is inserted in the mRNA in any position (e.g, 3' UTR); the insertion site in the mRNA can be anywhere in the mRNA as long as the insertion of the miRNA binding site in the mRNA does not interfere with the translation of the functional IL-12 polypeptide in the absence of the corresponding miRNA (e.g., miR122); and in the presence of the miRNA (e.g., miR122), the insertion of the miRNA binding site in the mRNA and the binding of the miRNA binding site to the corresponding miRNA are capable of degrading the mRNA or preventing the translation of the mRNA. In one embodiment, a miRNA binding site is inserted in a 3'UTR of the mRNA.

In certain embodiments, a miRNA binding site is inserted in at least about 30 nucleotides downstream from the stop codons of the IL- 12 encoding mRNA. In other embodiments, a miRNA binding site is inserted in at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides downstream from the stop codons of the IL- 12 encoding mRNA. In other embodiments, a miRNA binding site is inserted in about 10 nucleotides to about 100 nucleotides, about 20 nucleotides to about 90 nucleotides, about 30 nucleotides to about 80 nucleotides, about 40 nucleotides to about 70 nucleotides, about 50 nucleotides to about 60 nucleotides, about 45 nucleotides to about 65 nucleotides downstream from the stop codons of the IL- 12 encoding mRNA.

Modified mRNAs

In some embodiments, an mRNA of the disclosure comprises one or more modified nucleobases, nucleosides, or nucleotides (termed “modified mRNAs” or “mmRNAs”). In some embodiments, modified mRNAs may have useful properties, including enhanced stability, intracellular retention, enhanced translation, and/or the lack of a substantial induction of the innate immune response of a cell into which the mRNA is introduced, as compared to a reference unmodified mRNA. Therefore, use of modified mRNAs may enhance the efficiency of protein production, intracellular retention of nucleic acids, as well as possess reduced immunogenicity. In some embodiments, an mRNA includes one or more (e.g., 1, 2, 3 or 4) different modified nucleobases, nucleosides, or nucleotides. In some embodiments, an mRNA includes one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more) different modified nucleobases, nucleosides, or nucleotides. In some embodiments, the modified mRNA may have reduced degradation in a cell into which the mRNA is introduced, relative to a corresponding unmodified mRNA.

In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (e g., a combination of 2, 3 or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is pseudouridine (\|/), Nl- methylpseudouridine

2-thiouridine, 4 ’-thiouridine, 5-methylcytosine, 2-thio-l-methyl- 1-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine , 2-thio- dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2 -thiopseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio- pseudouridine, 5-aza-uridine, dihydropseudouridine, 5 -methoxy uridine, or 2’-O-methyl uridine. In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (e.g., a combination of 2, 3 or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having a modified cytosine include N4-acetyl-cytidine (ac⁴C), 5-methyl-cytidine (m⁵C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm⁵C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s²C), 2-thio-5-methyl-cytidine. In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (e.g., a combination of 2, 3 or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having a modified adenine include 7-deaza-adenine, 1 -methyladenosine (m¹ A). 2-methyl-adenine (m²A), N6-methyl-adenosine (m⁶A). In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (e g., a combination of 2, 3 or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m¹!), wyosine (imG), methylwyosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza- guanosine (preQo), 7-aminomethyl-7-deaza-guanosine (preQi), 7-methyl-guanosine (m⁷G), 1- methyl-guanosine (m'G). 8-oxo-guanosine, 7-methyl-8-oxo-guanosine. In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (e.g., a combination of 2, 3 or 4 of the aforementioned modified nucleobases).

In some embodiments, the modified nucleobase is 1-methyl-pseudouridine (m¹^), 5- methoxy-uridine (mo⁵U), 5-methyl-cytidine (m⁵C), pseudouridine (vp). a-thio-guanosine, or a-thio-adenosine. In some embodiments, an mRNA of the disclosure includes a combination of one or more of the aforementioned modified nucleobases (e.g., a combination of 2, 3 or 4 of the aforementioned modified nucleobases).

In some embodiments, the mRNA comprises pseudouridine (\|/)- In some embodiments, the mRNA comprises pseudouridine (\|/) and 5-methyl-cytidme (m⁵C). In some embodiments, the mRNA comprises 1-methyl-pseudouridine (m¹^). In some embodiments, the mRNA comprises 1-methyl-pseudouridine

and 5-methyl-cytidine (m⁵C). In some embodiments, the mRNA comprises 2-thiouridine (s²U). In some embodiments, the mRNA comprises 2-thiouridine and 5-methyl-cytidine (m⁵C). In some embodiments, the mRNA comprises 5-methoxy-uridine (mo⁵U). In some embodiments, the mRNA comprises 5-methoxy-uridine (mo⁵U) and 5-methyl-cytidine (m⁵C). In some embodiments, the mRNA comprises 2’-O-methyl uridine. In some embodiments, the mRNA comprises 2’-O-methyl uridine and 5-methyl-cytidine (m⁵C). In some embodiments, the mRNA comprises N6-methyl-adenosine (m⁶A). In some embodiments, the mRNA comprises N6-methyl-adenosine (m⁶A) and 5-methyl-cytidine (m⁵C).

In certain embodiments, an mRNA of the disclosure is uniformly modified (i.e., fully modified, modified through-out the entire sequence) for a particular modification. In some embodiments, an mRNA of the disclosure is modified wherein at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of a specified nucleotide or nucleobase is modified. For example, an mRNA can be uniformly modified with 5-methyl-cytidine (m⁵C), meaning that all cytosine residues in the mRNA sequence are replaced with 5-methyl- cytidme (m⁵C). Similarly, mRNAs of the disclosure can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above. In some embodiments, an mRNA of the disclosure is uniformly modified with 1 -methyl pseudouridine (m'\|/), meaning that all uridine residues in the mRNA sequence are replaced with 1-methyl pseudouridine f m ¹ \|/). In some embodiments, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of uridines are 1-methyl pseudouridine (m ¹ q/).

In some embodiments, an mRNA of the disclosure may be modified in a coding region (e.g., an open reading frame encoding a polypeptide). In other embodiments, an mRNA may be modified in regions besides a coding region. For example, in some embodiments, a 5'- UTR and/or a 3'-UTR are provided, wherein either or both may independently contain one or more different nucleoside modifications. In such embodiments, nucleoside modifications may also be present in the coding region.

Examples of nucleoside modifications and combinations thereof that may be present in mmRNAs of the present disclosure include, but are not limited to, those described in PCT Patent Application Publications: W02012045075, W02014081507, WO2014093924, WO2014164253, and WO2014159813.

The mRNAs of the disclosure can include a combination of modifications to the sugar, the nucleobase, and/or the intemucleoside linkage. These combinations can include any one or more modifications described herein.

In certain embodiments, the modified nucleosides may be partially or completely substituted for the natural nucleotides of the mRNAs of the disclosure. As a non-limiting example, the natural nucleotide uridine may be substituted with a modified nucleoside described herein. In another non-limiting example, the natural nucleoside uridine may be partially substituted (e.g., about 0.1%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99.9% of the natural uridines) with at least one of the modified nucleoside disclosed herein.

The mRNAs of the present disclosure, or regions thereof, may be codon optimized. Codon optimization methods are known in the art and may be useful for a variety of purposes: matching codon frequencies in host organisms to ensure proper folding, bias GC content to increase mRNA stability or reduce secondary structures, minimize tandem repeat codons or base runs that may impair gene construction or expression, customize transcriptional and translational control regions, insert or remove proteins trafficking sequences, remove/add post translation modification sites in encoded proteins (e.g., glycosylation sites), add, remove or shuffle protein domains, insert or delete restriction sites, modify ribosome binding sites and mRNA degradation sites, adjust translation rates to allow the various domains of the protein to fold properly, or to reduce or eliminate problem secondary structures within the mRNA. Codon optimization tools, algorithms and services are known in the art; non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA) and/or proprietary methods. In one embodiment, the mRNA sequence is optimized using optimization algorithms, e.g., to optimize expression in mammalian cells or enhance mRNA stability.

In certain embodiments, the present disclosure includes mRNAs having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any of the mRNA sequences described herein. mRNAs of the present disclosure may be produced by means available in the art, including but not limited to in vitro transcription (IVT) and synthetic methods. Enzymatic (IVT), solid-phase, liquid-phase, combined synthetic methods, small region synthesis, and ligation methods may be utilized. In one embodiment, mRNAs are made using IVT enzymatic synthesis methods. Methods of making mRNAs by IVT are known in the art and are described in International Application PCT/US2013/30062, the contents of which are incorporated herein by reference in their entirety. Accordingly, the present disclosure also includes mRNAs, e.g., DNA, constructs and vectors that may be used to in vitro transcribe an mRNA described herein.

Non-natural modified nucleobases may be introduced into mRNAs, e.g., mRNA, during synthesis or post-synthesis. In certain embodiments, modifications may be on intemucleoside linkages, purine or pyrimidine bases, or sugar. In particular embodiments, the modification may be introduced at the terminal of a mRNA chain or anywhere else in the mRNA chain; with chemical synthesis or with a polymerase enzyme. Examples of modified nucleic acids and their synthesis are disclosed in PCT application No PCT/US2012/058519. Synthesis of modified mRNAs is also described in Verma and Eckstein, Annual Review of Biochemistry , vol. 76, 99-134 (1998). Either enzymatic or chemical ligation methods may be used to conjugate mRNAs or their regions with different functional moieties, such as targeting or delivery agents, fluorescent labels, liquids, nanoparticles, etc. Conjugates of mRNAs and modified mRNAs are reviewed in Goodchild, Bioconjugate Chemistry, vol. 1(3), 165-187 (1990).

Delivery Agents

Lipid Compound

The present disclosure provides pharmaceutical compositions with advantageous properties. The lipid compositions described herein may be advantageously used in lipid nanoparticle compositions for the delivery of therapeutic and/or prophylactic agents, e.g., mRNAs, to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g, MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g.. MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.

In certain embodiments, the present application provides pharmaceutical compositions comprising:

(a) mRNA comprising a nucleotide sequence encoding IL- 12 ; and

(b) a delivery agent.

Lipid Nanoparticle Formulations

In some embodiments, nucleic acids of the disclosure are formulated as lipid nanoparticle (LNP) compositions. Lipid nanoparticles typically comprise amino lipid, phospholipid, structural lipid and PEG lipid components along with the nucleic acid cargo of interest. The lipid nanoparticles of the invention can be generated using components, compositions, and methods as are generally known in the art, see for example PCT/US2016/052352; PCT/US2016/068300; PCT/US2017/037551; PCT/US2015/027400; PCT/US2016/047406; PCT/US2016000129; PCT/US2016/014280; PCT/US2016/014280; PCT/US2017/038426; PCT/US2014/027077; PCT/US2014/055394; PCT/US2016/52117; PCT/US2012/069610; PCT/US2017/027492; PCT/US2016/059575; PCT/US2016/069491; PCT/US2016/069493; and PCT/US2014/66242, all of which are incorporated by reference herein in their entirety.

In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% amino lipid relative to the other lipid components. For example, the lipid nanoparticle may comprise a molar ratio of 20-50%, 20-40%, 20-30%, 30-60%, 30-50%, 30-40%, 40-60%, 40- 50%, or 50-60% amino lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 20%, 30%, 40%, 50, or 60% amino lipid.

In some embodiments, the lipid nanoparticle comprises a molar ratio of 5-25% phospholipid relative to the other lipid components. For example, the lipid nanoparticle may comprise a molar ratio of 5-30%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15- 20%, 20-25%, or 25-30% phospholipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 5%, 10%, 15%, 20%, 25%, or 30% non-cationic lipid.

In some embodiments, the lipid nanoparticle comprises a molar ratio of 25-55% structural lipid relative to the other lipid components. For example, the lipid nanoparticle may comprise a molar ratio of 10- 55%, 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30- 55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-55%, 35-50%, 35-45%, 35-40%, 40-55%, 40- 50%, 40-45%, 45-55%, 45-50%, or 50-55% structural lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 10%, 1 %, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 55% structural lipid.

In some embodiments, the lipid nanoparticle comprises a molar ratio of 0.5-15% PEG lipid relative to the other lipid components. For example, the lipid nanoparticle may comprise a molar ratio of 0.5-10%, 0.5-5%, 1-15%, 1-10%, 1-5%, 2-15%, 2-10%, 2-5%, 5- 15%, 5-10%, or 10-15% PEG lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% PEG- lipid.

In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% amino lipid, 5-25% phospholipid, 25-55% structural lipid, and 0.5-15% PEG lipid.

In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% amino lipid, 5-30% phospholipid, 10-55% structural lipid, and 0.5-15% PEG lipid.

Amino lipids

In some aspects, the amino lipids of the present disclosure may be one or more of compounds of Formula (I):

or their N-oxides, or salts or isomers thereof, wherein:

R₁ is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, -R*YR”, -YR”, and -R ’M’R’;

R2 and R3 are independently selected from the group consisting of H, C1-14 alkyl, C2-14 alkenyl, -R*YR”, -YR”, and -R*OR”, or R2 and R , together with the atom to which they are attached, form a heterocycle or carbocycle; R.4 is selected from the group consisting of hydrogen, a C3-6 carbocycle, -(CH₂)nQ, -(CH₂)nCHQR,

-CHQR, -CQ(R)₂, and unsubstituted C1-6 alkyl, where Q is selected from a carbocycle, heterocycle, -OR, -O(CH₂)_nN(R)₂, -C(O)OR, -OC(O)R, -CX3, -CX₂H, -CXH₂, -CN, -N(R)₂, -C(O)N(R)₂, -N(R)C(O)R, -N(R)S(O)₂R, -N(R)C(O)N(R)₂, -N(R)C(S)N(R)₂, -N(R)R₈,

-N(R)S(O)₂R8, -O(CH₂)_nOR, -N(R)C(=NR₉)N(R)₂, -N(R)C(=CHR₉)N(R)₂, -OC(O)N(

R)2,

-N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)₂R, -N(OR)C(O)OR, -N(OR)C(O)N(R)₂, -N(OR)C(S)N(R)₂, -N(OR)C(=NR₉)N(R)₂, -N(OR)C(=CHR₉)N(R)₂, -C(=NR₉)N(R)₂, -C(=NR₉)R, -C(O)N(R)OR, and -C(R)N(R)₂C(O)OR, and each n is independently selected from 1, 2, 3, 4, and 5; each R₅ is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R₆ is independently selected from the group consisting of C1-3 alkyl, C_2-3 alkenyl, and H;

M and M’ are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M”-C(O)O-, -C(O)N(R’)-,

-N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)₂-, -S -S-, an aryl group, and a heteroaryl group, in which M” is a bond, C1-13 alkyl or C2-13 alkenyl;

R7 is selected from the group consisting of C1-3 alkyl, C₂-3 alkenyl, and H;

Rs is selected from the group consisting of C3-6 carbocycle and heterocycle;

Rs> is selected from the group consisting of H, CN, NO₂, C1-6 alkyl, -OR, -S(O)₂R, -S(O)₂N(R)₂, C₂-6 alkenyl, C3-6 carbocycle and heterocycle; each R is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R’ is independently selected from the group consisting of Ci-is alkyl, C₂-is alkenyl, -R*YR”, -YR”, and H; each R” is independently selected from the group consisting of C3-15 alkyl and C3-15 alkenyl; each R* is independently selected from the group consisting of Ci-i₂ alkyl and C₂-i₂ alkenyl; each Y is independently a C3-6 carbocycle; each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; and wherein when Rr is -(CH₂)nQ, -(CH2)nCHQR, -CHQR, or -CQ(R)2, then (i) Q is not -N(R)2 when n is 1, 2, 3, 4 or 5, or (ii) Q is not 5, 6, or 7-membered heterocycloalkyl when n is 1 or 2. In certain embodiments, a subset of compounds of Formula (I) includes those of

Formula (IA):

or its N-oxide, or a salt or isomer thereof, wherein 1 is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; Mi is a bond or M’; Rr is hydrogen, unsubstituted C1-3 alkyl, or -(CH₂)nQ, in which Q is

OH, -NHC(S)N(R)₂, -NHC(O)N(R)₂, -N(R)C(O)R, -N(R)S(O)₂R, -N(R)R₈, -NHC(=NR₉)N(R)₂, -NHC(=CHR₉)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, heteroaryl or heterocycloalkyl; M and M’ are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M”-C(O)O-, -C(O)N(R’)-, -P(O)(OR’)O-, -S-S-, an aryl group, and a heteroaryl group,; and R₂ and R3 are independently selected from the group consisting of H, C1-14 alkyl, and C2-14 alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)₂, or -NHC(O)N(R)₂. For example, Q is -N(R)C(O)R, or -N(R)S(O)₂R.

In certain embodiments, a subset of compounds of Formula (I) includes those of Formula (IB):

(IB), or its N-oxide, or a salt or isomer thereof in which all variables are as defined herein. For example, m is selected from 5, 6, 7, 8, and 9; R4 is hydrogen, unsubstituted C1-3 alkyl, or -(CH2)nQ, in which Q is

OH, -NHC(S)N(R)₂, -NHC(0)N(R)2, -N(R)C(O)R, -N(R)S(O)₂R, -N(R)R₈, -NHC(=NR₉)N(R)₂, -NHC(=CHR₉)N(R)₂, -OC(O)N(R)2, -N(R)C(O)OR, heteroaryl or heterocycloalkyl; M and M’ are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M”-C(O)O-, -C(O)N(R’)-, -P(O)(OR’)O-, -S-S-, an aryl group, and a heteroaryl group; and R₂ and Rs are independently selected from the group consisting of H, C1-14 alkyl, and C2-14 alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)₂, or -NHC(O)N(R)₂. For example, Q is -N(R)C(O)R, or -N(R)S(0)2R.

In certain embodiments, a subset of compounds of Formula (I) includes those of

Formula (II):

(II), or its N-oxide, or a salt or isomer thereof, wherein 1 is selected from 1, 2, 3, 4, and 5; Mi is a bond or M’; R4 is hydrogen, unsubstituted C1-3 alkyl, or -(CH₂)_nQ, in which n is 2, 3, or 4, and Q is OH, -NHC(S)N(R)2, -NHC(0)N(R)2, -N(R)C(O)R, -N(R)S(O)₂R, -N(R)R₈, -NHC(=NR₉)N(R)₂, -NHC(=CHR₉)N(R)₂, -0C(0)N(R)2, -N(R)C(O)OR, heteroaiyl or heterocycloalkyl; M and M’ are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M”-C(O)O-, -C(O)N(R’)-, -P(O)(OR’)O-, -S-S-, an aryl group, and a heteroaryl group; and R2 and R3 are independently selected from the group consisting of H, C1-14 alkyl, and C2-14 alkenyl.

In one embodiment, the compounds of Formula (I) are of Formula (Ila),

or their N-oxides, or salts or isomers thereof, wherein R4 is as described herein.

In another embodiment, the compounds of Formula (I) are of Formula (lib),

In another embodiment, the compounds of Formula (I) are of Formula (lie) or (lie):

or their N-oxides, or salts or isomers thereof, wherein Rs is as described herein.

In another embodiment, the compounds of Formula (I) are of Formula (Ilf):

their N-oxides, or salts or isomers thereof, wherein M is -C(O)O- or -OC(O)-, M” is C1-6 alkyl or C2-6 alkenyl, R2 and Rs are independently selected from the group consisting of C5-14 alkyl and C5-14 alkenyl, and n is selected from 2, 3, and 4.

In a further embodiment, the compounds of Formula (I) are of Formula (II d),

(lid), or their N-oxides, or salts or isomers thereof, wherein n is 2, 3, or 4; and m, R’, R”, and R2 through R₆ are as described herein. For example, each of R2 and Rs may be independently selected from the group consisting of C5-14 alkyl and C5-14 alkenyl.

In a further embodiment, the compounds of Formula (I) are of Formula (Ilg),

(Ilg), or their N-oxides, or salts or isomers thereof, wherein 1 is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; Mi is a bond or M’; M and

M’ are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M”-C(O)O-, -C(O)N(R’)-, -P(O)(OR’)O-, -S-S-, an aryl group, and a heteroaryl group; and R2 and Rs are independently selected from the group consisting ofH, C1-14 alkyl, and C2-14 alkenyl. For example, M” is C1-6 alkyl (e.g., C1-4 alkyl) or C2-6 alkenyl (e.g. C2-4 alkenyl). For example, R2 and Rs are independently selected from the group consisting of C5-14 alkyl and C5-14 alkenyl. In some embodiments, the amino lipids are one or more of the compounds described in U.S. Application Nos. 62/220,091, 62/252,316, 62/253,433, 62/266,460, 62/333,557, 62/382,740, 62/393,940, 62/471,937, 62/471,949, 62/475,140, and 62/475,166, and PCT Application No. PCT/US2016/052352.

In some embodiments, the amino lipid is

In some embodiments, the amino lipid is

The central amine moiety of a lipid according to Formula (I), (I A), (IB), (II), (Ila), (lib), (lie), (lid), (lie), (Ilf), or (Ilg) may be protonated at a physiological pH. Thus, a lipid may have a positive or partial positive charge at physiological pH. Such amino lipids may be referred to as cationic lipids, ionizable lipids, cationic amino lipids, or ionizable amino lipids. Ammo lipids may also be zwitterionic, i.e., neutral molecules having both a positive and a negative charge.

In some aspects, the amino lipids of the present disclosure may be one or more of compounds of formula (III),

or salts or isomers thereof, wherein

ring

t is 1 or 2;

Ai and A2 are each independently selected from CH or N;

Z is CH2 or absent wherein when Z is CH2, the dashed lines (1) and (2) each represent a single bond; and when Z is absent, the dashed lines (1) and (2) are both absent;

R₁, R₂, R₃, R₄, and R₅ are independently selected from the group consisting of C_5-20 alkyl, C₅-

20 alkenyl, -R”MR', -R*YR”, -YR”, and -R*OR”;

Rxi and Rx2 are each independently H or C1-3 alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R’)-, -N(R )C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)

-CH(OH)-, -P(O)(OR’)O-, -S(O)₂-, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; M* is C₁-C₆ alkyl,

W¹ and W² are each independently selected from the group consisting of -O- and -N(R₆)-; each R₆ is independently selected from the group consisting of H and C1-5 alkyl;

X¹, X², and X³ are independently selected from the group consisting of a bond, -CH2-, -(CH₂)₂-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -(CH₂)n-C(O)-, -C(O)-(CH₂)n-, -(CH₂)n-C(O)O-, -OC(O)-(CH₂)n-, -(CH₂)n-OC(O)-, -C(O)O-(CH₂)n-, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C3-6 carbocycle; each R* is independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; each R is independently selected from the group consisting of C1-3 alkyl and a C3-6 carbocycle; each R’ is independently selected from the group consisting of C1-12 alkyl, C2-12 alkenyl, and H; each R” is independently selected from the group consisting of C3-12 alkyl, C3-12 alkenyl and -R*MR’; and n is an integer from 1-6;

i) at least one of X¹, X², and X³ is not -CH2-; and/or ii) at least one of R₁, R2, R3, R4, and R₅ is -R”MR’.

In some embodiments, the compound is of any of formulae (IIIal)-(IIIa8):

In some embodiments, the amino lipid is

The central amine moiety of a lipid according to Formula (III), (Illal ), (IIIa2), (IIIa3), (IIIa4), (IIIa5), (IIIa6), (IIIa7), or (IIIa8) may be protonated at a physiological pH. Thus, a lipid may have a positive or partial positive charge at physiological pH.

Phospholipids

The lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty' acid moieties.

A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin.

A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Particular phospholipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.

Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper- catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).

Phospholipids include, but are not limited to, glycerophosphohpids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin.

In some embodiments, a phospholipid of the invention comprises 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1 ,2-Distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn- glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC),

1.2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3- phosphochohne (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl- 2-oleoyl-sn-glycero-3-phosphocholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), l-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3-phosphocholine (Cl 6 Lyso PC),

1.2-dilinolenoyl-sn-glycero-3-phosphochohne,l,2-diarachidonoyl-sn-glycero-3- phosphocholine, 1 ,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1 ,2-diphytanoyl-sn- glycero-3-phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3- phosphoethanolamine, l,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl- sn-glycero-3-phosphoethanolamine, l,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, l,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, l,2-dioleoyl-sn-glycero-3- phospho-rac-(l -glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

In certain embodiments, a phospholipid useful or potentially useful in the present invention is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IV):

(IV), or a salt thereof, wherein: each R¹ is independently optionally substituted alkyl; or optionally two R¹ are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R¹ are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;

A is of the formula:

each instance of L² is independently a bond or optionally substituted Ci-6 alkylene, wherein one methylene unit of the optionally substituted Ci-6 alkylene is optionally replaced with O, N(R^N), S, C(O), C(O)N(R^N), NR^NC(O), C(O)O, OC(O), OC(O)O, OC(O)N(R^N), - NR^NC(O)O, orNR^NC(O)N(R^N); each instance of R² is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl, optionally wherein one or more methylene units of R² are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R^N), O, S, C(O), C(O)N(R^N), NR^NC(O), - NR^NC(O)N(R^N), C(O)O, OC(O), OC(O)O, OC(O)N(R^N), NR^NC(O)O, C(O)S, SC(O), - C(=NR^N), C(=NR^N)N(R^N), NR^NC(=NR^N), NR^NC(=NR^N)N(R^N), C(S), C(S)N(R^N), NR^NC(S), NR^NC(S)N(R^N), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)₂O, OS(O)₂O, N(R^N)S(O), - S(O)N(R^N), N(R^N)S(O)N(R^N), OS(O)N(R^N), N(R^N)S(O)O, S(O)₂, N(R^N)S(O)₂, S(O)₂N(R^N), N(R^N)S(O)₂N(R^N), OS(O)₂N(R^N), or N(R^N)S(O)₂O; each instance of R^N is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; provided that the compound is not of the formula:

wherein each instance of R² is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.

In some embodiments, the phospholipids may be one or more of the phospholipids described in U.S. Application No. 62/520,530.

Structural Lipids

The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids. As used herein, the term “structural lipid” refers to sterols and also to lipids containing sterol moieties.

Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, “sterols” are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol.

In some embodiments, the structural lipids may be one or more of the structural lipids described in U.S. Application No. 16/493,814.

Polyethylene Glycol (PEG)-Lipids The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more polyethylene glycol (PEG) lipids.

As used herein, the term “PEG-lipid” refers to polyethylene glycol (PEG)-modified lipids. Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG- CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified 1,2- diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.

In some embodiments, the PEG-lipid includes, but not limited to 1,2-dimyristoyl-sn- glycerol methoxypolyethylene glycol (PEG-DMG), l,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEGDAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-1, 2- dimyristyloxlpropy 1-3 -amine (PEG-c-DMA).

In one embodiment, the PEG-lipid is selected from the group consisting of a PEG- modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and/or PEG-DPG.

In some embodiments, the lipid moiety of the PEG-lipids includes those having lengths of from about C₁₄ to about C22, preferably from about Ci4to about Ci6. In some embodiments, a PEG moiety, for example a mPEG-NH₂, has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In one embodiment, the PEG-lipid is PEG2k-DMG. In one embodiment, the lipid nanoparticles described herein can comprise a PEG lipid which is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE.

PEG-lipids are known in the art, such as those described in U.S. Patent No. 8158601 and International Publ. No. WO 2015/130584 A2, which are incorporated herein by reference in their entirety .

In general, some of the other lipid components (e.g., PEG lipids) of various formulae, described herein may be synthesized as described International Patent Application No. PCT/US2016/000129, filed December 10, 2016, entitled “Compositions and Methods for Delivery of Therapeutic Agents,” which is incorporated by reference in its entirety. The lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid

In some embodiments the PEG-modified lipids are a modified form of PEG DMG. PEG-DMG has the following structure:

In one embodiment, PEG lipids useful in the present invention can be PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a “PEG-OH lipid” (also referred to herein as “hydroxy-PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-OH or hydroxy-PEGylated lipid comprises an -OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment of the present invention.

In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (V). Provided herein are compounds of Formula (V):

or salts thereof, wherein:

R³ is -OR°;

R° is hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive;

L¹ is optionally substituted Ci-io alky lene, wherein at least one methylene of the optionally substituted Ci-io alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(R^N), S, C(O), - C(O)N(R^N), NR^NC(O), C(O)O, OC(O), OC(O)O, OC(O)N(R^N), NR^NC(O)O, or - NR^NC(O)N(R^N);

D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;

A is of the formula:

each instance of L² is independently a bond or optionally substituted Ci-6 alkylene, wherein one methylene unit of the optionally substituted Ci-6 alkylene is optionally replaced with O, N(R^N), S, C(O), C(O)N(R^N), NR^NC(O), C(O)O, OC(O), OC(O)O, OC(O)N(R^N), - NR^NC(O)O, orNR^NC(O)N(R^N); each instance of R² is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl, optionally wherein one or more methylene units of R² are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R^N), O, S, C(O), C(O)N(R^N), NR^NC(O), - NR^NC(O)N(R^N), C(O)O, OC(O), OC(O)O, OC(O)N(R^N), NR^NC(O)O, C(O)S, SC(O), - C(=NR^N), C(=NR^N)N(R^N), NR^NC(=NR^N), NR^NC(=NR^N)N(R^N), C(S), C(S)N(R^N), NR^NC(S), NR^NC(S)N(R^N), S(O) , OS(O), S(O)O, OS(O)O, OS(O)2, S(O)₂O, OS(O)₂O, N(R^N)S(O), - S(O)N(R^N), N(R^N)S(O)N(R^N), OS(O)N(R^N), N(R^N)S(O)O, S(O)₂, N(R^N)S(O)₂, S(O)₂N(R^N), N(R^N)S(O)₂N(R^N), OS(O)₂N(R^N), or N(R^N)S(O)₂O; each instance of R^N is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2.

In certain embodiments, the compound of Formula (V) is a PEG-OH lipid (i.e., R³ is - OR°, and R° is hydrogen). In certain embodiments, the compound of Formula (V) is of Formula (V-OH):

or a salt thereof.

In certain embodiments, a PEG lipid useful in the present invention is a PEGylated fatty acid. In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (VI). Provided herein are compounds of Formula (VI):

or a salts thereof, wherein:

R³ is-OR°;

R° is hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive;

R⁵ is optionally substituted C10-40 alkyl, optionally substituted C10-40 alkenyl, or optionally substituted C 10-40 alkynyl; and optionally one or more methylene groups of R⁵ are replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R^N), O, S, C(O), - C(O)N(R^N), NR^NC(O), NR^NC(O)N(R^N), C(O)O, OC(O), OC(O)O, OC(O)N(R^N), - NR^NC(O)O, C(O)S, SC(O), C(=NR^N), C(=NR^N)N(R^N), NR^NC(=NR^N), NR^NC(=NR^N)N(R^N), C(S), C(S)N(R^N), NR^NC(S), NR^NC(S)N(R^N), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, - S(O)₂O, OS(O)₂O, N(R^N)S(O), S(O)N(R^N), N(R^N)S(O)N(R^N), OS(O)N(R^N), N(R^N)S(O)O, S(O)₂, N(R^N)S(O)₂, S(O)₂N(R^N), N(R^N)S(O)₂N(R^N), OS(O)₂N(R^N), or N(R^N)S(O)₂O; and each instance of R^N is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group.

In certain embodiments, the compound of Formula (VI) is of Formula (VI-OH):

or a salt thereof. In some embodiments, r is 40-50.

In yet other embodiments the compound of Formula (VI) is:

or a salt thereof.

In one embodiment, the compound of Formula (VI) is

In some aspects, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid.

In some embodiments, the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No. US15/674,872.

In some embodiments, a LNP of the invention comprises an amino lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG.

In some embodiments, a LNP of the disclosure comprises an amino lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI.

In some embodiments, a LNP of the disclosure comprises an amino lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.

In some embodiments, a LNP of the disclosure compnses an ammo lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.

In some embodiments, a LNP of the disclosure comprises an amino lipid of Formula I, II or III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI.

In some embodiments, a LNP of the disclosure comprises an N:P ratio of from about 2: 1 to about 30: 1.

In some embodiments, a LNP of the disclosure comprises an N:P ratio of about 6: 1.

In some embodiments, a LNP of the disclosure comprises an N:P ratio of about 3: 1, 4: 1, or 5:1.

In some embodiments, a LNP of the disclosure comprises a wt/wt ratio of the amino lipid component to the RNA of from about 10: 1 to about 100: 1.

In some embodiments, a LNP of the disclosure comprises a wt/wt ratio of the amino lipid component to the RNA of about 20: 1.

In some embodiments, a LNP of the disclosure comprises a wt/wt ratio of the amino lipid component to the RNA of about 10: 1. In some embodiments, a LNP of the disclosure has a mean diameter from about 30nm to about 150nm.

In some embodiments, a LNP of the disclosure has a mean diameter from about 60nm to about 120nm.

In some embodiments, a LNP of the disclosure comprises the mRNA therapeutic agent described herein in a concentration from about 0. 1 mg/ml to 2 mg/ml such as, but not limited to, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, 1.0 mg/ml, 1.1 mg/ml, 1.2 mg/ml, 1.3 mg/ml, 1.4 mg/ml, 1.5 mg/ml, 1.6 mg/ml, 1.7 mg/ml, 1.8 mg/ml, 1.9 mg/ml, 2.0 mg/ml or greater than 2.0 mg/ml. In some embodiments, a LNP of the disclosure comprises the mRNA therapeutic agent described herein in a concentration of about 2.0 mg/ml.

In some embodiments, the LNP comprises a molar ratio of about 50% ionizable amino lipid, about 10% phospholipid, about 38.5% structural lipid, and about 1.5% PEG lipid. In some embodiments, the LNP comprises a molar ratio of about 50% ionizable amino lipid, about 10% phospholipid, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the LNP comprises a molar ratio of: (1) 40-60% ionizable amino lipid, 8-16% phospholipid, 30-45% sterol, and 1-5% PEG modified lipid; or (2) 45- 65% ionizable amino lipid, 5-10% phospholipid, 25-40% sterol, and 0.5-5% PEG modified lipid. In some aspects, the LNP comprises a molar ratio of 40-60% ionizable amino lipid, 8- 16% phospholipid, 30-45% sterol, and 1-5% PEG modified lipid. In other aspects, the LNP comprises a molar ratio of 45-65% ionizable amino lipid, 5-10% phospholipid, 25-40% sterol, and 0.5-5% PEG modified lipid.

In some embodiments, the LNP comprises a molar ratio of: (1) 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG; or (2) 45-65% Compound II, 5- 10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG. In some embodiments, the LNP comprises a molar ratio of 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1- 5% PEG-DMG. In some embodiments, the LNP comprises a molar ratio of 45-65% Compound II, 5-10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG. In some embodiments, the LNP comprises a molar ratio of 50.0% Compound II, 10.0% DSPC, 38.5% cholesterol, and 1.5% PEG-DMG.

Exemplary mRNA Formulations of the Disclosure In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, and (ii) a 3'UTR comprising a miR-122 binding site. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, and (iii) a 3'UTR. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, and (iii) a 3'UTR comprising a miR-122 binding site.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12A polypeptide operably linked to a human IL- 1213 polypeptide, with or without a linker, and (ii) a 3'UTR comprising a miR-122 binding site. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR comprising a miR-122 binding site.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, and wherein the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, and (iii) a 3'UTR, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG- modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG- modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and wherein the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (lii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and wherein the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (hi) a 3'UTR, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and wherein the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises an ionizable ammo lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (hi) a 3'UTR, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, and wherein the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL- 12 polypeptide, and (ii) a 3'UTR comprising a miR-122 binding site. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, and (iii) a 3'UTR, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and wherein the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5- 15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and wherein the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid.

In some embodiments, the mRNA comprises an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and wherein the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20- 60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, and the LNP comprises

(i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5- 10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% ionizable ammo lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or

(ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, and (iii) a 3'UTR, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1 -5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5- 10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25- 40% sterol; and 0.5-5% PEG-modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and wherein the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG- modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR, and the LNP comprises (i) a molar ratio of about 40- 60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25- 40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL- 12B polypeptide, with or without a linker, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45- 65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid.

In some embodiments, the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and wherein the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5- 10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45- 65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises

(i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5- 10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and wherein the LNP comprises (i) a molar ratio of about 40-60% ionizable ammo lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or

(ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1 -5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25- 40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid, or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25-40% sterol; and 0.5-5% PEG-modified lipid. In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, and wherein the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, and (iii) a 3'UTR, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises Compound II, DSPC, cholesterol, and PEG- DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and wherein the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12A polypeptide operably linked to a human IL- 12B polypeptide, with or without a linker, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and wherein the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises Compound II, DSPC, cholesterol, and PEG- DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and wherein the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises Compound II, DSPC, cholesterol, and PEG- DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises Compound II, DSPC, cholesterol, and PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, and wherein the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL- 12 polypeptide, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, and (iii) a 3'UTR, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG- DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, and (hi) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and wherein the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG- DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (hi) a 3'UTR, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR comprising a miR- 122 binding site, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and wherein the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR- 122 binding site, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and wherein the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25- 55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises a molar ratio of about 20-60% Compound II; 5-25% DSPC; 25-55% cholesterol; and 0.5-15% PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, and wherein the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL- 12 polypeptide, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45- 65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, and (iii) a 3'UTR, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and wherein the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12A polypeptide operably linked to a human IL-12B polypeptide, with or without a linker, and (iii) a 3'UTR comprising a miR- 122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8- 16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and wherein the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the nucleotide sequence of SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides an LNP encapsulated mRNA, wherein the mRNA comprises an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and wherein the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (ii) a 3'UTR comprising a miR- 122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8- 16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL-12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG. In some embodiments, the mRNA comprises (i) a 5'UTR, (ii) an ORF encoding a human IL- 12 polypeptide, wherein the ORF comprises SEQ ID NO: 2, and (iii) a 3'UTR comprising a miR-122 binding site, and the LNP comprises (i) a molar ratio of about 40-60% Compound II; 8-16% DSPC; 30-45% cholesterol; and 1-5% PEG-DMG; or (ii) a molar ratio of about 45-65% Compound II; 5-10% DSPC; 25-40% cholesterol; and 0.5-5% PEG-DMG.

Pharmaceutical Compositions

The present disclosure includes pharmaceutical compositions comprising IL- 12 encoding mRNAs or a nanoparticle (e g., a lipid nanoparticle) described herein, in combination with one or more pharmaceutically acceptable excipient, carrier or diluent. In particular embodiments, the mRNA is present in a nanoparticle, e.g., a lipid nanoparticle. In particular embodiments, the mRNA or nanoparticle is present in a pharmaceutical composition.

Pharmaceutical compositions may optionally include one or more additional active substances, for example, therapeutically and/or prophylactically active substances. Pharmaceutical compositions of the present disclosure may be sterile and/or pyrogen-free. General considerations in the formulation and/or manufacture of pharmaceutical agents may be found, for example, in Remington: The Science and Practice of Pharmacy 21^st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety). In particular embodiments, a pharmaceutical composition comprises an mRNA and a lipid nanoparticle, or complexes thereof.

Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit. Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may include between 0.1% and 100%, e.g., between 0.5% and 70%, between 1% and 30%, between 5% and 80%, or at least 80% (w/w) active ingredient.

The mRNAs of the disclosure can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) permit the sustained or delayed release (e.g., from a depot formulation of the mRNA); (4) alter the biodistribution (e.g., target the mRNA to specific tissues or cell types); (5) increase the translation of a polypeptide encoded by the mRNA in vivo; and/or (6) alter the release profile of a polypeptide encoded by the mRNA in vivo. In addition to traditional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, excipients of the present disclosure can include, without limitation, hpidoids, liposomes, lipid nanoparticles (e.g., liposomes and micelles), polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, carbohydrates, cells transfected with mRNAs (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics and combinations thereof. Accordingly, the formulations of the disclosure can include one or more excipients, each in an amount that together increases the stability of the mRNA, increases cell transfection by the mRNA, increases the expression of a polypeptide encoded by the mRNA, and/or alters the release profile of an mRNA-encoded polypeptide. Further, the mRNAs of the present disclosure may be formulated using self-assembled nucleic acid nanoparticles.

Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the phamraceutical composition. Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxy toluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (com), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

In some embodiments, the formulations described herein may include at least one pharmaceutically acceptable salt. Examples of pharmaceutically acceptable salts that may be included in a formulation of the disclosure include, but are not limited to, acid addition salts, alkali or alkaline earth metal salts, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2- naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethyl amine, trimethylamine, triethylamine, ethylamine, and the like.

In some embodiments, the formulations described herein may contain at least one type of mRNA. As a non-limiting example, the formulations may contain 1, 2, 3, 4, 5 or more than 5 mRNAs described herein. In some embodiments, the formulations described herein may contain at least one mRNA encoding a polypeptide and at least one nucleic acid sequence such as, but not limited to, an siRNA, an shRNA, a snoRNA, and an miRNA.

Liquid dosage forms for e.g., parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and/or elixirs. In addition to active ingredients, liquid dosage forms may comprise inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, com, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, oral compositions can include adjuvants such as wetting agents, emulsifying and/or suspending agents. In certain embodiments for parenteral administration, compositions are mixed with solubilizing agents such as CREMAPHOR®, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and/or combinations thereof.

Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing agents, wetting agents, and/or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions, and/or emulsions in nontoxic parenterally acceptable diluents and/or solvents, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P., and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables. Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, and/or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

In some embodiments, pharmaceutical compositions including at least one mRNA described herein are administered to mammals (e g., humans). Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to anon-human mammal. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats; and/or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and/or turkeys. In particular embodiments, a subject is provided with two or more mRNAs described herein. In particular embodiments, the first and second mRNAs are provided to the subject at the same time or at different times, e.g., sequentially. In particular embodiments, the first and second mRNAs are provided to the subject in the same pharmaceutical composition or formulation, e.g., to facilitate uptake of both mRNAs by the same cells.

The present disclosure also includes kits comprising a container comprising a mRNA encoding a polypeptide that enhances an immune response. In another embodiment, the kit comprises a container comprising a mRNA encoding a polypeptide that enhances an immune response, as well as one or more additional mRNAs encoding one or more antigens or interest. In other embodiments, the kit comprises a first container comprising the mRNA encoding a polypeptide that enhances an immune response and a second container comprising one or more mRNAs encoding one or more antigens of interest. In particular embodiments, the mRNAs for enhancing an immune response and the mRNA(s) encoding an antigen(s) are present in the same or different nanoparticles and/or pharmaceutical compositions. In particular embodiments, the mRNAs are lyophilized, dried, or freeze-dried.

Kits

In some embodiments, the disclosure provides a kit comprising IL-12 encoding mRNA, or composition (e.g. lipid nanoparticle) comprising IL-12 encoding mRNA, as described herein. In some embodiments, a kit comprises a container (e g., a vial) comprising a pharmaceutical composition comprising a lipid nanoparticle comprising mRNA encoding human IL- 12 polypeptides; and a pharmaceutically acceptable carrier, wherein the pharmaceutical composition comprises 1 mg/ml of the mRNA, and a package insert comprising instructions for administration of the mRNA by intratumoral injection to treat or delay progression of solid tumor malignancy in a human patient that has received, is receiving or will subsequently receive an immune checkpoint inhibitor.

In some embodiments, the disclosure provides a kit comprising IL-12 encoding mRNA, or composition (e.g. lipid nanoparticle) comprising IL-12 encoding mRNA, as described herein. In some embodiments, a kit comprises a container (e g., a vial) comprising a pharmaceutical composition comprising a lipid nanoparticle comprising mRNA encoding human IL- 12 polypeptides; and a pharmaceutically acceptable carrier, wherein the pharmaceutical composition comprises 1 mg/ml of the mRNA, and a package insert comprising instructions for administration of the mRNA by intratumoral injection to treat or delay progression of solid tumor malignancy in a human patient that has received, is receiving or will subsequently receive a PD-L1 antagonist.

In some embodiments, a kit comprises a container (e.g., a vial) comprising a pharmaceutical composition comprising a lipid nanoparticle comprising mRNA encoding a human IL-12 polypeptide; and a pharmaceutically acceptable carrier, wherein the pharmaceutical composition comprises a concentration of the mRNA of about 0. 1 pg/ml to about 16 pg/rnL, and a package insert compnsing instructions for administration of the mRNA by intratumoral injection and instruction for use in combination with a second composition comprising an immune checkpoint inhibitor, for use in treating or delaying progression of solid tumor malignancy in a human patient.

In some embodiments, a kit comprises a container (e.g., a vial) comprising a pharmaceutical composition comprising a lipid nanoparticle comprising mRNA encoding a human IL- 12 polypeptide; and a pharmaceutically acceptable carrier, wherein the pharmaceutical composition comprises a concentration of the mRNA of about 0. 1 pg/ml to about 16 pg/mL, and a package insert comprising instructions for administration of the mRNA by intratumoral injection and instruction for use in combination with a second composition comprising a PD-L1 antagonist, for use in treating or delaying progression of solid tumor malignancy in a human patient.

In some embodiments, a kit comprises a container (e.g., a vial) comprising a lipid nanoparticle encapsulating the mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the lipid nanoparticle or pharmaceutical composition. In some embodiments, a kit comprises a container comprising a lipid nanoparticle encapsulating the mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the lipid nanoparticle or pharmaceutical composition for treating or delaying progression of a solid tumor malignancy in an individual. In some aspects, the package insert further comprises instructions for administration of the lipid nanoparticle or pharmaceutical composition in combination with a composition comprising an immune checkpoint inhibitor (e.g., a PD-Ll antagonist) and an optional pharmaceutically acceptable carrier for treating or delaying progression of a solid tumor malignancy in an individual.

In some embodiments, a kit comprises a container comprising an LNP encapsulating an IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition thereof, and a package insert comprising instructions for administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof by intratumoral injection at a dose of 0. 1-12.0μg of the IL-12 encoding mRNA, wherein the patient is receiving, has received, or subsequently receives an immune checkpoint inhibitor.

In some embodiments, a kit comprises a container comprising an LNP encapsulating an IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition thereof, and a package insert comprising instructions for administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof by intratumoral injection at a dose of 0. 1-12.0μg of the IL-12 encoding mRNA, wherein the patient is receiving, has received, or subsequently receives a PD-Ll antagonist (e.g., durvalumab).

In some embodiments, a kit comprises a container comprising an LNP encapsulating an IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition thereof, and a package insert comprising instructions for administration of the LNP encapsulating an IL-12 encoding mRNA or pharmaceutical composition thereof for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the LNP encapsulating an IL-12 encoding mRNA or pharmaceutical composition thereof by intratumoral injection at an initial dose of 0. 1-12.0 pg of the IL-12 encoding mRNA, and optionally at least one additional dose of 0. 1-12.0μg of the IL-12 encoding mRNA, wherein the patient subsequently receives an immune checkpoint inhibitor every 4 weeks after administration of the initial dose, or optional additional dose, of the LNP encapsulating an IL-12 encoding mRNA or pharmaceutical composition thereof.

In some embodiments, a kit comprises a container comprising an LNP encapsulating an IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition thereof, and a package insert comprising instructions for administration of the LNP encapsulating an IL-12 encoding mRNA or pharmaceutical composition thereof for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof by intratumoral injection at an initial dose of 0. 1-12.0 pg of the IL-12 encoding mRNA, and optionally at least one additional dose of 0. 1-12.0μg of the IL-12 encoding mRNA, wherein the patient subsequently receives a PD-L1 antagonist (e.g. durvalumab) every 4 weeks after administration of the initial dose, or optional additional dose, of the LNP encapsulating an IL-12 encoding mRNA or pharmaceutical composition thereof.

In some embodiments, a kit comprises a container comprising an LNP encapsulating an IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition thereof, and a package insert comprising instructions for administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof by intratumoral injection at an initial dose of 0. l-12.0pg of the IL-12 encoding mRNA, and optionally (i) at least one additional dose of 0. 1-12.0μg of the IL-12 encoding mRNA in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (li) at least one additional dose of 0.1-12.0pg of the IL-12 encoding mRNA in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof and every 4 weeks thereafter.

In some embodiments, a kit comprises a container comprising an LNP encapsulating an IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition thereof, and a package insert comprising instructions for administration of the LNP encapsulating an IL-12 encoding mRNA or pharmaceutical composition thereof for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof by intratumoral injection at an initial dose of 0. l-12.0pg of the IL-12 encoding mRNA, and optionally (i) at least one additional dose of 0. 1-12.0μg of the IL-12 encoding mRNA in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 0.1-12.0pg of the IL-12 encoding mRNA in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the LNP encapsulating an IL-12 encoding mRNA or pharmaceutical composition thereof and every 4 weeks thereafter.

In some embodiments, a kit comprises a container comprising an LNP encapsulating an IL-12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition thereof, and a package insert comprising instructions for administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the LNP encapsulating an IL- 12 encoding mRNA or pharmaceutical composition thereof by intratumoral injection at an initial dose of 1.0-8.0pg of the IL-12 encoding mRNA, and optionally (i) at least one additional dose of 1.0-8.0μg of the IL-12 encoding mRNA in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-8.0μg of the IL-12 encoding mRNA in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the LNP encapsulating an IL-12 encoding mRNA or pharmaceutical composition thereof and every 4 weeks thereafter.

In some embodiments, a kit comprises a medicament comprising a lipid nanoparticle encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament alone or in combination with a composition comprising an immune checkpoint inhibitor (e.g., a PD-L1 antagonist) and an optional pharmaceutically acceptable carrier. In some embodiments, a kit comprises a medicament comprising a lipid nanoparti cle encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament alone or in combination with a composition comprising an immune checkpoint inhibitor (e.g., a PD-L1 antagonist) and an optional pharmaceutically acceptable carrier for treating or delaying progression of solid tumor malignancy in an individual. In some aspects, the kit further comprises a package insert comprising instructions for administration of the first medicament prior to, current with, or subsequent to administration of the second medicament for treating or delaying progression of solid tumor malignancy in an individual.

In some embodiments, a kit comprises a medicament comprising an LNP encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the medicament by intratumoral injection at a dose of 0.1-12.0pg of the IL-12 encoding mRNA, wherein the patient is receiving, has received, or subsequently receives an immune checkpoint inhibitor.

In some embodiments, a kit comprises a medicament comprising an LNP encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the medicament by intratumoral injection at a dose of 0.1-12.0pg of the IL-12 encoding mRNA, wherein the patient is receiving, has received, or subsequently receives a PD-L1 antagonist (e g., durvalumab).

In some embodiments, a kit comprises a medicament comprising an LNP encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable earner, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the medicament by intratumoral injection at an initial dose of 0.1-12.0 pg of the IL-12 encoding mRNA, and optionally at least one additional dose of 0.1-12.0pg of the IL-12 encoding mRNA, wherein the patient subsequently receives an immune checkpoint inhibitor every 4 weeks after administration of the initial dose, or optional additional dose, of the medicament.

In some embodiments, a kit comprises a medicament comprising an LNP encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the medicament by intratumoral injection at an initial dose of 0.1-12.0 pg of the IL-12 encoding mRNA , and optionally at least one additional dose of 0. 1 - l2.0pg of the IL-12 encoding mRNA, wherein the patient subsequently receives a PD-L1 antagonist (e g. durvalumab) every 4 weeks after administration of the initial dose, or optional additional dose, of the medicament.

In some embodiments, a kit comprises a medicament comprising an LNP encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the medicament by intratumoral injection at an initial dose of 0.1-12.0 pg of the IL-12 encoding mRNA, and optionally (i) at least one additional dose of 0.1-12.0 pg of the IL-12 encoding mRNA in a first dosing cycle comprising administration of the at least one additional dose every' 28 days for a specified period of time, and (ii) at least one additional dose of 0. 1-12.0 pg of the IL-12 encoding mRNA in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the medicament and every 4 weeks thereafter.

In some embodiments, a kit comprises a medicament compnsing an LNP encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the medicament by intratumoral injection at an initial dose of 0.1-12.0 pg of the IL-12 encoding mRNA, and optionally (i) at least one additional dose of 0.1-12.0 pg of the IL-12 encoding mRNA in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 0. 1-12.0 pg of the IL-12 encoding mRNA in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the medicament and every 4 weeks thereafter.

In some embodiments, a kit comprises a medicament comprising an LNP encapsulating the IL- 12 encoding mRNA described herein, and an optional pharmaceutically acceptable carrier, or a pharmaceutical composition, and a package insert comprising instructions for administration of the medicament for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the medicament by intratumoral injection at an initial dose of 1.0-8.0μg of the IL-12 encoding mRNA, and optionally (i) at least one additional dose of 1.0-8.0μg of the IL-12 encoding mRNA in a first dosing cycle comprising administration of the at least one additional dose ever}' 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-8.0pg of the IL-12 encoding mRNA in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the medicament and every 4 weeks thereafter.

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0μg of the mRNA therapeutic agent, wherein the patient subsequently receives an immune checkpoint inhibitor, wherein the an immune checkpoint inhibitor is systemically administered once every about four weeks, wherein a first dose of the an immune checkpoint inhibitor is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, and wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2. In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1 -12.0pg of the mRNA therapeutic agent, and a second dose of 0 1 - 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist, wherein the PD-L1 antagonist is systemically administered once every about four weeks, wherein a first dose of the PD-L1 antagonist is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, and wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2.

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives an immune checkpoint inhibitor, wherein the an immune checkpoint inhibitor is systemically administered once every about four weeks, wherein a first dose of the an immune checkpoint inhibitor is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5- 5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1 - 12. Oprg of the mRNA therapeutic agent, and a second dose of 0. l-12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist, wherein the PD-L1 antagonist is systemically administered once every about four weeks, wherein a first dose of the PD-L1 antagonist is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5-10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives an immune checkpoint inhibitor, wherein the an immune checkpoint inhibitor is systemically administered once every about four weeks, wherein a first dose of the an immune checkpoint inhibitor is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, and wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0.1 - 12.0pg of the mRNA therapeutic agent, and a second dose of 0.1-12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist, wherein the PD-L1 antagonist is systemically administered once every about four weeks, wherein a first dose of the PD-L1 antagonist is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, and wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor is systemically administered once every about four weeks, wherein a first dose of the immune checkpoint inhibitor is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, and wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1. In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1- 12.0pg of the mRNA therapeutic agent, and a second dose of 0.1-12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist, wherein the PD-L1 antagonist is systemically administered once every about four weeks, wherein a first dose of the PD-L1 antagonist is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, and wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1.

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor is systemically administered once every about four weeks, wherein a first dose of the immune checkpoint inhibitor is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, and wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 19. In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable earner, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1- 12.0pg of the mRNA therapeutic agent, and a second dose of 0.1-12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist, wherein the PD-L1 antagonist is systemically administered once every about four weeks, wherein a first dose of the PD-L1 antagonist is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, and wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 19. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19.

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor is systemically administered once every about four weeks, wherein a first dose of the immune checkpoint inhibitor is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1, and wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e g. Compound II), 5-1 % phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist, wherein the PD-L1 antagonist is systemically administered once every about four weeks, wherein a first dose of the PD-L1 antagonist is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1, and wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5-10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG. In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a immune checkpoint inhibitor, wherein the immune checkpoint inhibitor is systemically administered once every about four weeks, wherein a first dose of the immune checkpoint inhibitor is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 19, and wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist, wherein the PD-L1 antagonist is systemically administered once every about four weeks, wherein a first dose of the PD-L1 antagonist is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 19, and wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable ammo lipid (e.g. Compound 11), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG- DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5-10% DSPC, 25- 40% cholesterol, and 0.5-5% PEG-DMG.

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1-12.0μg of the mRNA therapeutic agent, and a second dose of 0. 1- 12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist, wherein the PD-L1 antagonist is systemically administered once every about four weeks, wherein a first dose of the PD-L1 antagonist is administered at about 3 weeks after the second dose of the mRNA therapeutic agent, wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1, and wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LNP comprises about 50% Compound 11, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. l-12.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2. In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-12. 0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 - 12.0gg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-8. of0 thμeg mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1-8. 0 ofμg the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2. In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-8. of0 thμeg mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 -S.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, and wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound 11), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e g., cholesterol), and 1-5% PEG modified lipid (e g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG).

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 - 12.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks follow ing the third dose of the first dosing cycle, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, and wherein the LNP comprises (1) 40- 60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 -12. Op,g of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, and wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5-10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG. In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-8. of0 thμeg mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1-8. 0 ofμg the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, and wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG).

In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 - 12.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, and wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-12. of0 thμeg mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 - 12. of0 tμhge mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 2, and wherein the LNP comprises about 50% ionizable ammo lipid (e.g.. Compound II), about 10% phospholipid (e g., DSPC), about 38.5% sterol (e g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the ORF comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-8. of0 thμeg mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1-8. 0 ofμg the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, and wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-12.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 - 12. 0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, and wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1 or SEQ ID NO: 19. In some embodiments, the mRNA comprises a nucleotide sequence having 90% identity to SEQ ID NO: 1. In some embodiments, the mRNA comprise a nucleotide sequence having 90% identity to SEQ ID NO: 19. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-8.0μg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 -8.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1, and wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable ammo lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG).

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. l-12.0pg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1 or SEQ ID NO: 19, and wherein the LNP comprises (1) 40-60% ionizable amino lipid (e.g., Compound II), 8-16% phospholipid (e.g., DSPC), 30-45% sterol (e.g., cholesterol), and 1-5% PEG modified lipid (e.g., PEG-DMG); or (2) 45-65% ionizable amino lipid (e.g. Compound II), 5-10% phospholipid (e.g., DSPC), 25-40% sterol (e.g., cholesterol), and 0.5-5% PEG modified lipid (e.g., PEG-DMG). In some embodiments, the mRNA comprises a nucleotide sequence having 90% identity to SEQ ID NO: 1. In some embodiments, the mRNA comprise a nucleotide sequence having 90% identity to SEQ ID NO: 19. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises 40-60% Compound II, 8-16% DSPC, 30-45% cholesterol, and 1-5% PEG-DMG. In some embodiments, the LNP comprises 45-65% Compound II, 5-10% DSPC, 25-40% cholesterol, and 0.5-5% PEG-DMG.

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-8.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 -S.0μg of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1, and wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG).

In some aspects, the disclosure provides a kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition as a first dosing cycle and a second dosing cycle, wherein the first dosing cycle of the mRNA therapeutic agent comprises administering to the patient a first dose, a second dose, and a third dose each of 0.1-12.0pg of the mRNA therapeutic agent, wherein the dosing interval between the first, second, and third dosed is about 4 weeks, wherein the second dosing cycle of the mRNA therapeutic agent comprises administering to the patient a dose of 0. 1 -12.0 g of the mRNA therapeutic agent once every about 8 weeks, wherein the second dosing cycle begins about 8 weeks following the third dose of the first dosing cycle, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA, wherein the mRNA comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1 or SEQ ID NO: 19, and wherein the LNP comprises about 50% ionizable amino lipid (e.g., Compound II), about 10% phospholipid (e.g., DSPC), about 38.5% sterol (e.g., cholesterol), and about 1.5% PEG modified lipid (e.g., PEG-DMG).

In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG. In some embodiments, the mRNA comprises a nucleotide sequence having 90% identity to SEQ ID NO: 1. In some embodiments, the mRNA comprise a nucleotide sequence having 90% identity to SEQ ID NO: 19. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the LNP comprises about 50% Compound II, about 10% DSPC, about 38.5% cholesterol, and about 1.5% PEG-DMG.

OTHER EMBODIMENTS

The disclosure relates to the following embodiments. Throughout this section, the term “embodiment” is abbreviated as “E” followed by an ordinal. For example, El is equivalent to Embodiment 1.

El . A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of a lipid nanoparticle (LNP) encapsulated messenger RNA (mRNA) therapeutic agent, wherein the mRNA therapeutic agent comprises an open reading frame (ORF) encoding a human IL-12 polypeptide, wherein the patient is administered a dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives an immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient. E2. The method of El, wherein the dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0pg; 0.1 to 3.0pg; 0.1-1.0μg; 0.1-0.3pg; 0.3 to 12.0pg; 0.3 to 8.0pg; 0.3 to 3.0 pg;

0.3 to l.0μg; 1.0 to 12.0pg; 1.0 to 8.0pg; 1.0 to 3.0pg; 3.0 to 12.0pg; 3.0 to 8.0pg; and 8.0 to 12.0μg.

E3. The method of El, wherein the dose of the mRNA therapeutic agent is from 1.0 to 8.0μg.

E4. The method of El, wherein the dose of the mRNA therapeutic agent is 0. l0μg.

E5. The method of El, wherein the dose of the mRNA therapeutic agent is 0.30pg.

E6. The method of El, wherein the dose of the mRNA therapeutic agent is l.0μg.

E7. The method of El, wherein the dose of the mRNA therapeutic agent is 3.0pg.

E8. The method of El, wherein the dose of the mRNA therapeutic agent is 8.0pg.

E9. The method of El, wherein the dose of the mRNA therapeutic agent is 12.0pg.

El 0. The method of any one of El -E9, further comprising administering to the patient at least one additional dose of 0. 1-12.0μg of the mRNA therapeutic agent.

El l. The method of E10, wherein the at least one additional dose is administered to the patient 7-28 days, 7-21 days, 7-14 days, 14-28 days, 14-21 days, 21-28 days, 28 days, 21 days, 14 days or 7 days after the dose of the mRNA therapeutic.

El 2. The method of any one of El -9, wherein the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. E13. The method of E12, wherein the patient receives the immune checkpoint inhibitor 21 days after the dose of the mRNA therapeutic agent.

E14. The method of any one of E10-E11, wherein the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the additional dose of the mRNA therapeutic agent.

E15. The method of E14, wherein the patient receives the immune checkpoint inhibitor 21 days after the additional dose of the mRNA therapeutic agent.

El 6. The method of any one of E12-E15, wherein the patient receives the immune checkpoint inhibitor once every four weeks.

E17. The method of any one of E1-E9, wherein the patient receives the immune checkpoint inhibitor on the same day as receiving the dose of the mRNA therapeutic agent.

El 8. The method of El 0 or El 1 , wherein the patient receives the immune checkpoint inhibitor on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose. El 9. The method of El 8, wherein the at least one additional dose of the mRNA therapeutic agent is administered to the patient in a dosing cycle of every 28 days for 8 weeks.

E20. The method of El 9, wherein the at least one additional dose of the mRNA therapeutic agent is administered to the patient every 8 weeks after the dosing cycle, and the patient receives the immune checkpoint inhibitor every 4 weeks after the dosing cycle.

E21. The method of any one of El -E20, wherein the dose achieves a human plasma IL- 12p70 maximum peak of about 3-5 pg/mL in the patient.

E22. The method of any one of E1-E21, wherein the dose achieves a human plasma IL- 12p70 maximum peak of about 3-450 pg/mL.

E23. The method of any one of El -E22, wherein the dose achieves a human plasma IFNy maximum peak of about 3-3100 pg/mL.

E24. The method of any one of El -E23, wherein the patient comprises at least two malignant lesions, wherein one malignant lesion is an injected malignant lesion and one malignant lesion is anon-injected malignant lesion.

E25. The method of E24, wherein treatment results in a reduction in malignant lesion size. E26. The method of E25, wherein the size of a malignant lesion is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.

E27. The method of E26, wherein the malignant lesion is reduced by at least 30%.

E28. The method of E24, wherein treatment results in a reduction in size of the noninjected malignant lesion.

E29. The method of E28, wherein the size of the non-injected malignant lesion is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.

E30. The method of any one of E25-E29, wherein malignant lesion size is determined by imaging or visual inspection.

E31. The method of any one of E25-E30, wherein malignant lesion size is determined by RECIST v 1.1.

E32. The method of any one of E25-E31, wherein the malignant lesion is a cutaneous, a subcutaneous, or a deep-seated malignant lesion.

E33. The method of E32, wherein the malignant lesion is a deep-seated tumor lesion, and wherein the dose, and optionally at least one additional dose, is administered to the deep- seated malignant lesion via image guided-inj ection. E34. The method of any one of El -3E3, wherein the immune checkpoint inhibitor is selected from a PD-L1 antagonist, a PD-1 antagonist, or a CTLA-4 antagonist.

E35. The method of E34, wherein the immune checkpoint inhibitor is an anti-PD-1 antibody is selected from nivolumab, pembrolizumab, and cemiplimab.

E36. The method of E34, wherein the immune checkpoint inhibitor is an anti-PD-Ll antibody is selected from atezolizumab, avelumab, durvalumab, and envafolimab.

E37. The method of any one of E1-E34, wherein the immune checkpoint inhibitor is an anti-CTLA-4 antibody

E38. The method of any one of E34-E37, wherein the patient receives the immune checkpoint inhibitor intravenously.

E39. The method of any one of E34-E38, wherein the patient receives the immune checkpoint inhibitor at a dose of 1500mg.

E40. The method of any one of El -E33, wherein the immune checkpoint inhibitor is durvalumab, and wherein the patient receives durvalumab at a dose of 1500mg every 4-8 weeks.

E41. The method of any one of E1-E9, further comprising administering to the patient an additional dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the at least one additional dose is administered 21 days after the dose, wherein the immune checkpoint inhibitor is durvalumab, and wherein the patient receives durvalumab intravenously at a dose of 1500mg every 4 weeks after administration of the additional dose of the mRNA therapeutic agent.

E42. The method of E41, wherein the patient receives durvalumab 21 days after the additional dose of the mRNA therapeutic agent is administered.

E43. The method of any one of E1-E9, further comprising administering to the patient:

(i) at least one additional dose of 0. I - 12.0pg of the mRNA therapeutic agent in a first dosing cycle comprising administering the at least one additional dose every 28 days for 8 weeks, and

(ii) at least one additional dose of 0. l-12.0pg of the mRNA therapeutic agent in a second dosing cycle comprising administering the at least one additional dose every 8 weeks for a specified period of time, wherein the additional doses of the mRNA therapeutic agent are the same or different, wherein the immune checkpoint inhibitor is durvalumab, and wherein the patient receives durvalumab intravenously at a dose of 1500mg every 4 weeks starting on the same day as the dose of the mRNA therapeutic agent.

E44. The method of any one of E1-E43, wherein the advanced or metastatic solid tumor malignancy is selected from melanoma, breast cancer, head and neck cancer, non-small-cell lung cancer, colorectal cancer, gastric cancer, and bladder cancer.

E45. The method of E44, wherein the advanced or metastatic solid tumor malignancy is head and neck cancer.

E46. The method of any one of E1-E45, wherein the advanced or metastatic solid tumor malignancy is refractory to immune checkpoint inhibitor (CPI) therapy.

E47. The method of E46, wherein the advanced or metastatic solid tumor malignancy is CPI-refractory melanoma.

E48. The method of E46 or E47, wherein immune CPI therapy is PD-1 inhibition, PD-L1 inhibitor, or CTLA-4 inhibition.

E49. A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL-12 polypeptide, wherein the patient is administered an initial dose of 0. 1 - I 2.()pg of the mRNA therapeutic agent, and optionally an additional dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the patient receives an immune checkpoint inhibitor every 4 weeks after administration of the initial dose, or optional additional dose, of the mRNA therapeutic agent, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

E50. The method of E49, wherein the patient is administered an initial dose of 0.1 pg of the mRNA therapeutic agent.

E51. The method of E49 or E50, wherein the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after administration of the initial dose. E52. The method of E51, wherein the patient receives the immune checkpoint inhibitor 21 days after administration of the initial dose.

E53. The method of E49 or E50, wherein the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after administration of the additional dose. E54. The method of E53, wherein the patient receives the immune checkpoint inhibitor 21 days after administration of the additional dose. E55. The method of any one of E49-E54, wherein the patient is administered the additional dose 28 days, 21 days, 14 days, or 7 days after the initial dose.

E56. The method of E55, wherein the patient is administered the additional dose 21 days after the initial dose.

E57. The method of any one of E49-E56, wherein the immune checkpoint inhibitor is durvalumab.

E58. The method of E57, wherein the patient receives durvalumab at a dose of 1500mg every four weeks.

E59. The method of E57 or E58, wherein the patient receives durvalumab intravenously. E60. The method of any one of E49-E59, wherein the advanced or metastatic solid tumor malignancy is head and neck cancer.

E61. A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL-12 polypeptide, wherein the patient is administered an initial dose of 1.0-8.0μg of the mRNA therapeutic, and optionally (i) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

E62. A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL-12 polypeptide, wherein the patient is administered an initial dose of 1.0-12.0μg of the mRNA therapeutic, and optionally (i) at least one additional dose of 1.0-12.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-12.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives an immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

E63. The method of E61 or E62, wherein the initial and optional additional doses are 3pg of the mRNA therapeutic agent.

E64. The method of any one of E61-E63, comprising administering to the patient (i) the at least one additional dose every 28 days in the first dosing cycle for 8 weeks, and (ii) the least one additional dose every 8 weeks in the second dosing cycle for the specified period of time. E65. The method of E64, wherein the first dosing cycle comprises three doses 28 days apart.

E66. The method of any one of E61-E65, wherein the immune checkpoint inhibitor is durvalumab.

E67. The method of E66, wherein the patient receives durvalumab at a dose of 1500mg every four weeks.

E68. The method of E66 or E67, wherein the patient receives durvalumab intravenously.

E69. The method of any one of E61-E68, wherein the advanced or metastatic solid tumor malignancy CPI-refractory melanoma.

E70. The method of any one of E49-E64, wherein the patient comprises two or more malignant lesions, and wherein the size of at least one non-injected malignant lesion is reduced by at least 30%.

E71. The method of any one of El -E70, wherein the patient has received at least one treatment prior to administering the mRNA therapeutic.

E72. The method of E71, wherein the at least one treatment is selected from surgery, chemotherapy, radiation, and immunotherapy.

E73. The method of any one of El -E72, wherein administering the mRNA therapeutic agent does not result in an adverse event to discontinue treatment.

E74. The method of any one of El -E73, wherein administering the mRNA therapeutic agent is tolerated in a patient.

E75. The method of any one of E1-E74, wherein treatment results in stable disease, a partial response, or a complete response in the patient.

E76. The method of E75, wherein treatment results in stable disease for at least 12 weeks in the patient. E77. The method of any one of E1-E76, wherein treatment results in increased survival of the patient.

E78. The method of any one of E1-E77, wherein the mRNA therapeutic agent increases IL- 12 and/or IFNy protein expression in the serum or plasma of the patient.

E79. The method of any one of E1-E78, wherein the mRNA therapeutic agent increases expression of one or more IFNy-inducible chemokines in the serum or plasma of the patient. E80. The method of E79, wherein the one or more IFNyinducible chemokines is elected from CXCL9, CXCL10, CXCL11 and a combination thereof.

E81. The method of any one of E1-E80, wherein the mRNA therapeutic agent increases expression of one or more mediators of CD8+ T cell activity in the serum or plasma of the patient.

E82. The method of E81, wherein the one or more mediators are selected from granzyme B, perforin, IFNy, IL12 receptor, CD38, and a combination thereof.

E83. The method of E81 or E82, wherein the increase positively correlates with expression of CD8a in the serum or plasma of the patient.

E84. The method of any one of E1-E83, wherein the mRNA therapeutic agent increases intratumoral CD8+ T cell levels in the patient.

E85. The method of any one of E1-E84, wherein the mRNA therapeutic agent increases PD-L1 expression in tumor epithelium of the patient.

E86. The method of any one of E1-E85, wherein the mRNA therapeutic agent increases intratumoral T cell proliferation in the patient.

E87. The method of any one of E1-E86, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of CD8+ T cell activity.

E88. The method of E87, wherein the one or more mediators are selected from granzyme B, perforin, IFNy, IL12 receptor, CD38, and a combination thereof.

E89. The method of E87 or E88, wherein the increase positively correlates with intratumoral expression of CD8a.

E90. The method of any one of E1-E89, wherein the mRNA therapeutic agent increases intratumoral expression of one or more IFNy-inducible chemokines.

E91. The method of E90, wherein the one or more IFNy-inducible chemokines are selected from CXCL9, CXCL10, CXCL11, and a combination thereof.

E92. The method of E1-E91, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of a Th 1 response. E93. The method of E92, wherein the one or more mediators of a Thl response are selected from T-Box Transcription Factor 21 (TBX21), Signal Transducer And Activator Of Transcription 4 (STAT4), CXCR3, and a combination thereof.

E94. The method of any one of E1-E93, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of dendritic cell activation.

E95. The method of E94, wherein the one or more mediators are selected from CD80, CD83, CD86, and a combination thereof.

E96. The method of any one of E1-E95, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of natural killer (NK) cell activation.

E97. The method of E96, wherein the one or more mediators are selected from KLRB1, KLRK1 , and a combination thereof.

E98. The method of any one of E1-E97, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of antigen presenting cells.

E99. The method of E98, wherein the one or more mediators is selected from IFNy Receptor 1 (IFNGR1), IFNGR2, and a combination thereof.

El 00. A kit composing a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of (). I - 12.0μg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives an immune checkpoint inhibitor, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL- 12 polypeptide.

E101. The kit of E100, wherein the container comprises a vial comprising 0.8mL of a dispersion comprising the LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable buffer.

El 02. The kit of El 00 or El 01, wherein the dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0pg; 0.1 to 3.0μg; 0.1-1.0μg; 0.1-0.3pg; 0.3 to 12.0pg; 0.3 to 8.0μg; 0.3 to 3.0μg; 0.3 to l.0μg; 1.0 to 12.0μg; 1.0 to 8.0μg; 1.0 to 3.0μg; 3.0 to 12.0μg; 3.0 to 8.0μg; and 8.0 to 12.0pg.

El 03. The kit of E100 or E101, wherein the dose of the mRNA therapeutic agent is O.l0μg, 0.30pg, L0μg, 3.0μg, 8.0μg, or 12.0pg. El 04. The kit of any one of E100-E103, wherein treatment further comprises administering at least one additional dose of the mRNA therapeutic agent to the patient.

El 05. The kit of El 04, wherein treatment comprises administering the at least one additional dose 7-28 days, 7-21 days, 7-14 days, 14-28 days, 14-21 days, 21-28 days, 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent.

El 06. The kit of any one of E100-103, wherein the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent. El 07. The kit of any one of E104-E105, wherein the patient receives the immune checkpoint inhibitor 28 days, 21 days, 14 days, or 7 days after the dose or the at least one additional dose of the mRNA therapeutic agent.

El 08. The kit of E106 or E107, wherein the patient receives the immune checkpoint inhibitor once every four weeks.

El 09. The kit of any one of E100-E103, wherein the patient receives the immune checkpoint inhibitor on the same day as receiving the dose of the mRNA therapeutic agent.

El 10. The kit of any one of E104-E105, wherein the patient receives the immune checkpoint inhibitor on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose.

El 11. The kit of El 10, wherein treatment comprises administering the at least one additional dose of the mRNA therapeutic agent is administered to the patient in a dosing cycle of every 28 days for 8 weeks.

El 12. The kit of El 1 1 , wherein treatment comprises administering the at least one additional dose of the mRNA therapeutic agent is administered to the patient every 8 weeks after the dosing cycle, and the patient receives the immune checkpoint inhibitor every 4 weeks after the dosing cycle.

El 13. A kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by mtratumoral injection at an initial dose of 0. 1- 12.0ug of the mRNA therapeutic agent, and optionally at least one additional dose of 0.1-12.0pg of the mRNA therapeutic agent, wherein the patient subsequently receives a immune checkpoint inhibitor every 4 weeks after administration of the initial dose, or optional additional dose, of the mRNA therapeutic agent, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL- 12 polypeptide.

El 14. A kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by mtratumoral injection at an initial dose of 1 .0-8.0pg of the mRNA therapeutic agent, and optionally (i) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (n) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL- 12 polypeptide.

El 15. A kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 0. 1- 12.0μg of the mRNA therapeutic agent, and optionally (i) at least one additional dose of 0.1-12.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 0. 1-12.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every' 8 weeks for a specified period of time, wherein the patient receives a immune checkpoint inhibitor on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a human IL- 12 polypeptide.

El 16. The kit of any one of E100-E115, wherein the immune checkpoint inhibitor is durvalumab.

El 17. The kit of E116, wherein the patient receives durvalumab at a dose of 1500mg. El 18. The kit of any one of E100-E117, wherein the advanced or metastatic solid tumor malignancy is selected from melanoma, breast cancer, head and neck cancer, non-small-cell lung cancer, colorectal cancer, gastric cancer, and bladder cancer.

El 19. The kit of E118, wherein the advanced or metastatic solid tumor malignancy is refractory to CPI therapy.

E120. The method or kit of any one of El-El 19, wherein the human IL-12 polypeptide comprises an IL-12A polypeptide and an IL-12B polypeptide.

E121. The method or kit of E120, wherein the IL-12A polypeptide is operably linked to the IL-12A polypeptide without a linker.

E122. The method or kit of E120, wherein the IL-12A polypeptide is operably linked to the IL-12A polypeptide with a linker.

El 23. The method or kit of any one of E120-E122, wherein the human IL- 12 polypeptide comprises a heterologous signal peptide.

El 24. The method or kit of any one of E120-E122, wherein the human IL- 12 polypeptide comprises a human IL-12B signal peptide.

E125. The method or kit of E124, wherein the human IL-12B signal peptide comprises the amino acid sequence of SEQ ID NO: 8.

E126. The method or kit of any one of E1-E120, wherein the ORF comprises from 5’ to 3’ a nucleotide sequence selected from the group consisting of:

(i) a nucleotide sequence encoding the IL-12B polypeptide, a nucleotide sequence encoding a peptide linker, and a nucleotide sequence encoding the IL-12A polypeptide;

(ii) a nucleotide sequence encoding the IL-12B polypeptide, and a nucleotide sequence encoding the IL-12A polypeptide;

(iii) a nucleotide sequence encoding the IL-12A polypeptide, a nucleotide sequence encoding a peptide linker, and a nucleotide sequence encoding the IL-12B polypeptide; and

(iv) a nucleotide sequence encoding the IL-12A polypeptide, and a nucleotide sequence encoding the IL-12B polypeptide.

E127. The method of kit of E126, wherein the ORF comprises anucleotide sequence encoding a signal peptide located at the 5’ terminus of the ORF.

E128. The method or kit of E126 or E127, wherein the peptide linker is a Gly/Ser linker. E129. The method or kit of any one of E1-E128, wherein the human IL-12 polypeptide comprises the amino acid sequence of SEQ ID NO: 5. E130. The method or kit of any one of E1-E129, wherein the mRNA comprises (i) a 3’ untranslated region (UTR); (ii) a 5’ UTR; and (iii) a polyA tail.

E131. The method or kit of E130, wherein the 3’ UTR comprises a miR-122-5p binding site. E132. The method or kit of E131, wherein the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 4

E133. The method or kit of any one of E130-E132, wherein the 5’ UTR comprises the nucleotide sequence of SEQ ID NO: 3.

E134. The method or kit of any one of E1-E133, wherein the ORF comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 2, or wherein the ORF comprises the nucleotide sequence of SEQ ID NO: 2.

E135. The method or kit of any one of E1-E134, wherein the mRNA comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 1 or 19, or wherein the mRNA comprises the nucleotide sequence of SEQ ID NO: 1 or 19.

E136. The method or kit of any one of E1-E135, wherein the mRNA comprises a modified nucleotide.

E137. The method or kit of any one of E1-E136, wherein the mRNA is fully modified with chemically-modified uridines.

E138. The method or kit of any one of E1-E136, wherein 100% of the uridines of the mRNA are chemically-modified uridines.

E139. The method or kit of E137 or 138, wherein the chemically -modified uridines are Nl- methylpseudouridines (m I ).

E140. The method or kit of any one of E1-E139, wherein the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid.

E141. The method or kit of E140, wherein the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG-modified lipid. E142. The method or kit of E141, wherein the LNP comprises (i) a molar ratio of about 40- 60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid; or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25- 40% sterol; and 0.5-5% PEG-modified lipid.

E143. The method or kit of any one of E140-E142, wherein the ionizable lipid is Compound II, the phospholipid is DSPC, the sterol is cholesterol, and the PEG-modified lipid is PEG DMG. E144. The method of any one of E1-E43, E46, E48-E68, E70-E99 and E120-E143 or the kit of any one of E100-E117, and E119-E143, wherein the advanced or metastatic solid tumor malignancy is selected from melanoma, head and neck cancer, colorectal cancer, breast cancer, pancreatic cancer, non-small-cell lung cancer, vulvar cancer, bladder cancer, gastric cancer, squamous cell carcinoma, anal cancer, pancreatic cancer, and cervical cancer.

E145. The method or kit of E144, wherein the advanced or metastatic solid tumor malignancy comprises one or more metastases.

E146. The method or kit of E145, wherein the one or more metastases are of the brain and/or liver.

El 47. An mRNA therapeutic agent for use in a method of treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL- 12 polypeptide, wherein the patient is administered a dose of 0. 1-12.0 pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives a immune checkpoint inhibitor, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

El 48. A immune checkpoint inhibitor for use in a method of treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient an effective amount of the immune checkpoint inhibitor, wherein the patient is receiving, has received, or subsequently receives by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a human IL-12 polypeptide, wherein the patient is administered a dose of 0. 1-12.0 pg of the mRNA therapeutic agent, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

Definitions

Abscopal effect: As used herein, “abscopal effect” refers to a phenomenon in the treatment of cancer, including metastatic cancer, where localized administration of a treatment (e.g., mRNA encoding IL-12) to a tumor causes not only a reduction in size of the treated tumor but also a reduction in size of tumors outside the treated area. In some embodiments, the abscopal effect is a local, regional abscopal effect, wherein a proximal or nearby tumor relative to the treated tumor is affected. In some embodiments, the abscopal effect occurs in a distal tumor relative to the treated tumor. In some embodiments, treatment (e.g., mRNA encoding IL-12) is administered via intratumoral injection, resulting in a reduction in tumor size of the injected tumor and a proximal or distal uninjected tumor.

Administering: As used herein, “administering” refers to a method of delivering a composition to a subject or patient. A method of administration may be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body. For example, an administration may be parenteral (e.g., subcutaneous, intracutaneous, intravenous, intraperitoneal, intramuscular, intraarticular, intraarterial, intrasynovial, intrastemal, intrathecal, intralesional, or intracranial injection, as well as any suitable infusion technique), oral, trans- or intra-dermal, interdermal, rectal, intravaginal, topical (e.g. by powders, ointments, creams, gels, lotions, and/or drops), mucosal, nasal, buccal, enteral, vitreal, intratumoral, sublingual, intranasal; by intratracheal instillation, bronchial instillation, and/or inhalation; as an oral spray and/or powder, nasal spray, and/or aerosol, and/or through a portal vein catheter.

Approximately, about. As used herein, the terms “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

Cell-free DNA'. As used herein, the term “cell -free DNA” and “cfDNA” interchangeably refer to DNA fragments that circulate in a subject's body (e.g., bloodstream) and originate from one or more healthy cells and/or from one or more cancer cells. These DNA molecules are found outside cells, in bodily fluids such as blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal material, saliva, sweat, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid of a subject, and are fragments of genomic DNA expelled from healthy and/or cancerous cells, e.g., upon apoptosis and lysis of the cellular envelope. As used herein, the term “locus” refers to a position (e.g., a site) within a genome, e.g., on a particular chromosome. In some embodiments, a locus refers to a single nucleotide position, on a particular chromosome, within a genome. In some embodiments, a locus refers to a group of nucleotide positions within a genome. In some instances, a locus is defined by a mutation (e.g., substitution, insertion, deletion, inversion, or translocation) of consecutive nucleotides within a cancer genome. In some instances, a locus is defined by a gene, a sub- genic structure (e.g., a regulatory element, exon, intron, or combination thereol), or a predefined span of a chromosome. Because normal mammalian cells have diploid genomes, a normal mammalian genome (e.g., a human genome) will generally have two copies of every locus in the genome, or at least two copies of every locus located on the autosomal chromosomes, e.g., one copy on the maternal autosomal chromosome and one copy on the paternal autosomal chromosome.

CPI-refractory: As used herein, the term “CPI-refractory” refers to a cancer in a human patient that fails to respond to immune checkpoint inhibitor (CPI) therapy. In some embodiments, CPI-refractory is primary, such that a cancer progresses in the patient after exposure to CPI therapy. In some embodiments, CPI-refractory is secondary acquired, such that a cancer in the patient initially responds to CPI therapy or stable disease is observed, followed by cancer progression in the patient in a setting of ongoing CPI therapy.

Conjugated: As used herein, the term “conjugated,” when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. In some embodiments, two or more moieties may be conjugated by direct covalent chemical bonding. In other embodiments, two or more moieties may be conj ugated by ionic bonding or hydrogen bonding.

Contacting: As used herein, the term “contacting” means establishing a physical connection between two or more entities. For example, contacting a cell with an mRNA or a lipid nanoparticle composition means that the cell and mRNA or lipid nanoparticle are made to share a physical connection. Methods of contacting cells with external entities both in vivo, in vitro, and ex vivo are well known in the biological arts. In exemplary embodiments of the disclosure, the step of contacting a mammalian cell with a composition (e.g., an isolated mRNA, nanoparticle, or pharmaceutical composition of the disclosure) is performed in vivo. For example, contacting a lipid nanoparticle composition and a cell (for example, a mammalian cell) which may be disposed within an organism (e.g., a mammal) may be performed by any suitable administration route (e.g., parenteral administration to the organism, including intravenous, intramuscular, intradermal, and subcutaneous administration). For a cell present in vitro, a composition (e.g., a lipid nanoparticle or an isolated mRNA) and a cell may be contacted, for example, by adding the composition to the culture medium of the cell and may involve or result in transfection. Moreover, more than one cell may be contacted by a nanoparticle composition.

Control: As used herein, the terms “control,” “control sample,” “reference,” “reference sample,” “normal,” and “normal sample” each describe a sample from a nondiseased tissue. In some embodiments, a control sample is from a subject that does not have a particular condition (e.g., cancer). In some embodiments, a control sample is a healthy tissue sample obtained from the subject receiving a method of treatment described herein. For example, where a liquid or solid tumor sample is obtained from a subject with cancer, an internal control sample may be obtained from a healthy tissue of the subject, e.g., a white blood cell sample from a subject without a blood cancer or a solid germtine tissue sample from the subject. Accordingly, in some embodiments, a reference sample is obtained from the subject or from a database, e.g., from a second subject who does not have the particular disease (e.g., cancer).

Dosing cycle: As used herein, the term “dosing cycle” refers to a discrete amount of time, expressed in units of time, during which at least one dose is administered. In some embodiments, a dosing interval occurs during a dosing cycle. For example, in some embodiments, a dosing interval of every two weeks occurs during a dosing cycle of 4 weeks.

Dosing interval: As used herein, the term “dosing interval”, “dosage interval” or “dosing regimen” refers to a discrete amount of time, expressed in units of time, (e.g., 14 days) that transpires between individual administrations (plural) of a dose of a therapeutic composition (e g , a composition comprising an mRNA). For example, in some embodiments, a dosing interval starts on the day a first dose is administered (e.g., initial dose), and ends on the day a second dose (e.g., a subsequent dose) is administered. In some embodiments, there are multiple dosing intervals during treatment.

Encapsulate: As used herein, the term “encapsulate” means to enclose, surround, or encase. In some embodiments, a compound, an mRNA, or other composition may be fully encapsulated, partially encapsulated, or substantially encapsulated. For example, in some embodiments, an mRNA of the disclosure may be encapsulated in a lipid nanoparticle, e.g., a liposome.

Effective amount: As used herein, the term “effective amount” of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an “effective amount” depends upon the context in which it is being applied. For example, in the context of administering an agent that treats cancer, an effective amount of an agent is, for example, an amount sufficient to achieve treatment, as defined herein, of cancer, as compared to the response obtained without administration of the agent. In some embodiments, a therapeutically effective amount is an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent or prophylactic agent) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.

Expression: As used herein, “expression” of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and/or 3' end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.

Fragment: A “fragment,” as used herein, refers to a portion. For example, fragments of proteins may include polypeptides obtained by digesting full-length protein isolated from cultured cells or obtained through recombinant DNA techniques.

Identity: As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two mRNA sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix. Methods commonly employed to detennine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology' between two sequences include, but are not limited to, GCG program package, Devereux et al., Nucleic Acids Research, 12(1): 387,1984, BLASTP, BLASTN, and FASTA, Altschul, S. F. et al., J. Molec. Biol., 215, 403, 1990.

Immune checkpoint inhibitor. An “immune checkpoint inhibitor” or simply “checkpoint inhibitor” refers to a molecule that prevents immune cells from being turned off by cancer cells. As used herein, the term checkpoint inhibitor refers to polypeptides (e.g., antibodies) or mRNAs encoding such polypeptides that neutralize or inhibit inhibitory checkpoint molecules such as cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), programmed death 1 receptor (PD-1), or PD-1 ligand 1 (PD-L1).

Immune response: The term “immune response” refers to the action of, for example, lymphocytes, antigen presenting cells, phagocytic cells, granulocytes, and soluble macromolecules produced by the above cells or the liver (including antibodies, cytokines, and complement) that results in selective damage to, destruction of, or elimination from the human body of invading pathogens, cells or tissues infected with pathogens, cancerous cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues. In some cases, the administration of a nanoparticle comprising a lipid component and an encapsulated therapeutic agent can trigger an immune response, which can be caused by (i) the encapsulated therapeutic agent (e.g., an mRNA), (ii) the expression product of such encapsulated therapeutic agent (e.g., a polypeptide encoded by the mRNA), (iii) the lipid component of the nanoparticle, or (iv) a combination thereof. Isolated'. As used herein, the term “isolated” refers to a substance or entity that has been separated from at least some of the components with which it was associated (whether in nature or in an experimental setting). Isolated substances may have varying levels of purity in reference to the substances from which they have been associated. Isolated substances and/or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially associated. In some embodiments, isolated agents are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is “pure” if it is substantially free of other components.

Linker'. As used herein, a "linker" (including a subunit linker, and a heterologous polypeptide linker as referred to herein) refers to a group of atoms, e.g., 10-1,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine. The linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety at a first end, and to a payload, e.g., a detectable or therapeutic agent, at a second end. The linker can be of sufficient length as to not interfere with incorporation into a nucleic acid sequence. The linker can be used for any useful purpose, such as to form polynucleotide multimers (e.g., through linkage of two or more chimeric polynucleotides molecules or IVT polynucleotides) or polynucleotides conjugates, as well as to administer a payload, as described herein. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof. Other examples include, but are not limited to, cleavable moieties within the linker, such as, for example, a disulfide bond (-S-S-) or an azo bond (-N=N-), which can be cleaved using a reducing agent or photolysis. Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2-carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis. Metastasis'. As used herein, the term “metastasis” means the process by which cancer spreads from the place at which it first arose as a primary tumor to distant locations in the body. A secondary tumor that arose as a result of this process may be referred to as “a metastasis.” mRNA'. As used herein, an “mRNA” refers to a messenger ribonucleic acid. An mRNA may be naturally or non-naturally occurring. For example, an mRNA may include modified and/or non-naturally occurring components such as one or more nucleobases, nucleosides, nucleotides, or linkers. An mRNA may include a cap structure, a chain terminating nucleoside, a stem loop, a poly A sequence, and/or a poly adenylation signal. An mRNA may have a nucleotide sequence encoding a polypeptide. Translation of an mRNA, for example, in vivo translation of an mRNA inside a mammalian cell, may produce a polypeptide. Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5 '-untranslated region (5’-UTR), a 3'UTR, a 5' cap and a polyA sequence. microRNA (miRNA)'. As used herein, a “microRNA (miRNA)” is a small non-coding RNA molecule which may function in post-transcriptional regulation of gene expression (e.g., by RNA silencing, such as by cleavage of the mRNA, destabilization of the mRNA by shortening its polyA tail, and/or by interfering with the efficiency of translation of the mRNA into a polypeptide by a ribosome). A mature miRNA is typically about 22 nucleotides long. microRNA-122 (miR-122): As used herein, “microRNA-122 (miR-122)” refers to any native miR-122 from any vertebrate source, including, for example, humans, unless otherwise indicated. miR-122 is typically highly expressed in the liver, where it may regulate fatty-acid metabolism. miR-122 levels are reduced in liver cancer, for example, hepatocellular carcinoma. miR-122 is one of the most highly-expressed miRNAs in the liver, where it regulates targets including but not limited to CAT-1, CD320, AldoA, Hjv, Hfe, ADAM10, IGFR1, CCNG1, and ADAM17. Mature human miR-122 may have a sequence of AACGCCAUUAUCACACUAAAUA (SEQ ID NO: 17, corresponding to hsa-miR-122-3p) or UGGAGUGUGACAAUGGUGUUUG (SEQ ID NO: 18, corresponding to hsa-miR-122- 5p). microRNA (miRNA) binding site: As used herein, a “microRNA (miRNA) binding site” refers to a miRNA target site or a miRNA recognition site, or any nucleotide sequence to which a miRNA binds or associates. In some embodiments, a miRNA binding site represents a nucleotide location or region of an mRNA to which at least the “seed” region of a miRNA binds. It should be understood that “binding” may follow traditional Watson-Crick hybridization rules or may reflect any stable association of the miRNA with the target sequence at or adjacent to the microRNA site.

Liquid Biopsy. As used herein, the term “liquid biopsy” refers to a liquid sample obtained from a subject comprising cell-free DNA. Examples of liquid biopsy samples include, but are not limited to, blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal material, saliva, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid of the subject. In some embodiments, a liquid biopsy sample is a cell-free sample, e.g., a cell free blood sample. In some embodiments, a liquid biopsy sample is obtained from a subject with cancer. In some embodiments, a liquid biopsy sample is collected from a subject with an unknown cancer status, e.g., for use in determining a cancer status of the subject. miRNA seed: As used herein, a “seed” region of a miRNA refers to a sequence in the region of positions 2-8 of a mature miRNA, which typically has perfect Watson-Crick complementarity to the miRNA binding site. A miRNA seed may include positions 2-8 or 2- 7 of a mature miRNA. In some embodiments, a miRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of a mature miRNA), wherein the seed-complementary site in the corresponding miRNA binding site is flanked by an adenine (A) opposed to miRNA position 1. In some embodiments, a miRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of a mature miRNA), wherein the seed-complementary site in the corresponding miRNA binding site is flanked by an adenine (A) opposed to miRNA position 1. When referring to a miRNA binding site, an miRNA seed sequence is to be understood as having complementarity (e g., partial, substantial, or complete complementarity) with the seed sequence of the miRNA that binds to the miRNA binding site.

Modified: As used herein “modified” refers to a changed state or structure of a molecule of the disclosure. Molecules may be modified in many ways including chemically, structurally, and functionally. In one embodiment, the mRNA molecules of the present disclosure are modified by the introduction of non-natural nucleosides and/or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and C. Noncanonical nucleotides such as the cap structures are not considered “modified” although they differ from the chemical structure of the A, C, G, U ribonucleotides.

Nanoparticle: As used herein, “nanoparticle” refers to a particle having any one structural feature on a scale of less than about lOOOnm that exhibits novel properties as compared to a bulk sample of the same material. Routinely, nanoparticles have any one structural feature on a scale of less than about 500 nm, less than about 200 nm, or about 100 nm. Also routinely, nanoparticles have any one structural feature on a scale of from about 50 nm to about 500 nm, from about 50 nm to about 200 nm or from about 70 to about 120 nm.

In exemplary embodiments, a nanoparticle is a particle having one or more dimensions of the order of about 1 - lOOOnm. In other exemplary embodiments, a nanoparticle is a particle having one or more dimensions of the order of about 10- 500 nm. In other exemplary embodiments, a nanoparticle is a particle having one or more dimensions of the order of about 50- 200 nm. A spherical nanoparticle would have a diameter, for example, of between about 50-100 or 70-120 nanometers. A nanoparticle most often behaves as a unit in terms of its transport and properties. It is noted that novel properties that differentiate nanoparticles from the corresponding bulk material typically develop at a size scale of under lOOOnm, or at a size of about lOOnm, but nanoparticles can be of a larger size, for example, for particles that are oblong, tubular, and the like. Although the size of most molecules would fit into the above outline, individual molecules are usually not referred to as nanoparticles.

Neoadjuvant: As used herein, the term “neoadjuvant” refers to an initial treatment of a disease in a human patient, and thus a “neoadjuvant” cancer refers to a cancer in a patient that has not received prior treatment to a therapeutic of interest (e.g., the mRNA therapeutic agent described herein). The term “neoadjuvant melanoma” refers to a melanoma in a patient that has not received anti-cancer treatment prior to administration of the mRNA therapeutic agent described herein.

Nucleic acid: As used herein, the term “nucleic acid” is used in its broadest sense and encompasses any compound and/or substance that includes a polymer of nucleotides. These polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of the disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), DNA-RNA hybrids, RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, RNAs that induce triple helix formation, threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a -D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino- LNA having a 2'-amino functionalization, and 2'-amino-a-LNA having a 2'-amino functionalization) or hybrids thereof.

Operably linked: As used herein, the phrase "operably linked" refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like.

Patient: As used herein, “patient” refers to a subject who may seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained professional for a particular disease or condition. In particular embodiments, a patient is a human patient. In some embodiments, a patient is a patient suffering from cancer (e.g., liver cancer or colorectal cancer).

Pharmaceutically acceptable: The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

Polypeptide-. As used herein, the term “polypeptide” or “polypeptide of interest” refers to a polymer of amino acid residues typically joined by peptide bonds that can be produced naturally (e.g., isolated or purified) or synthetically.

Subject. As used herein, the term “subject” refers to any organism to which a composition in accordance with the disclosure may be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and/or plants. In some embodiments, a subject may be a human patient having a solid tumor malignancy or lymphoma .

Substantially. As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary' skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

Suffering from-. An individual who is “suffering from” a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of a disease, disorder, and/or condition.

Targeting moiety: As used herein, a “targeting moiety” is a compound or agent that may target a nanoparticle to a particular cell, tissue, and/or organ type.

Therapeutic Agent: The term “therapeutic agent” refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and/or prophylactic effect and/or elicits a desired biological and/or phamiacological effect.

Treating-. As used herein, the term “treating” refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a solid tumor malignancy or lymphoma. For example, “treating” cancer may refer to inhibiting survival, growth, and/or spread of a tumor. Treatment may be measured by reduction in numbers of tumors or reduction in size of a particular tumor and/or reduction in metastasis. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.

Preventing'. As used herein, the term “preventing” refers to partially or completely inhibiting the onset of one or more symptoms or features of a particular infection, disease, disorder, and/or condition.

Tumor: As used herein, a “tumor” is an abnormal growth of tissue, whether benign or malignant.

Unmodified'. As used herein, “unmodified” refers to any substance, compound or molecule prior to being changed in any way. Unmodified may, but does not always, refer to the wild type or native form of a biomolecule. Molecules may undergo a series of modifications whereby each modified molecule may serve as the “unmodified” starting molecule for a subsequent modification.

Variant allele: As used herein, the term “variant allele” refers to a sequence of one or more nucleotides at a chromosomal locus that is either not the predominant allele represented at that chromosomal locus within the population of the species (e g., not the “wild-type” sequence), or not an allele that is predefined within a reference sequence construct (e.g., a reference genome or set of reference genomes) for the species.

Equivalents and Scope

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the disclosure described herein. The scope of the present disclosure is not intended to be limited to the Description below, but rather is as set forth in the appended claims.

In the claims, articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

It is also noted that the term "comprising" is intended to be open and permits but does not require the inclusion of additional elements or steps. When the term “comprising” is used herein, the term “consisting of’ is thus also encompassed and disclosed.

Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

All cited sources, for example, references, publications, databases, database entries, and art cited herein, are incorporated into this application by reference, even if not expressly stated in the citation. In case of conflicting statements of a cited source and the instant application, the statement in the instant application shall control.

EXAMPLES

Example 1: In Vivo Anti-Tumor Efficacy of Murine IL12 Modified mRNA in a Colon Adenocarcinoma (MC38) Model via intratumoral administration

The in vivo anti -tumor efficacy of murine IL 12 mRNA, administered intratumorally in mice bearing M38 adenocarcinoma tumors, was assessed.

A. Preparation ofIL12 modified mRNA and control mRNA comprising a codon-optimized nucleotide sequence encoding a wild-type murine IL12 polypeptide (murine IL12) and a miRNA binding site (miR-122) in its 3' UTR were prepared (mIL12_miR122) (SEQ ID NO: 12).

The miR-122 binding element was incorporated to decrease protein production from the liver. A negative control mRNA was also prepared (non-translatable version of mRNAs), e.g., NST-FIX. The mRNAs were fully modified with N1 -methylpseudouridine. Both modified mRNAs were fomrulated in MC3 lipid nanoparticles (LNP). B. MC-38 Colon Adenocarcinoma Mouse Model

MC-38 colon adenocarcinoma tumors were implanted subcutaneously in mice as described in Rosenberg et al., Science 233: 1318-1321 (1986)).

Eleven days after tumor implantation, animals were administered a single intratumoral dose of MC3 LNP-formulated murine IL12 modified mRNA (4 pg mRNA per dose). Two groups of control animals were treated with an equivalent dose and regimen of negative control mRNA (NST-FIX LNP) or PBS.

Tumor volume was measured at the indicated time points in FIG. IB using manual calipers. Tumor volume mean to day 24 (FIG. 1A) and individual tumor volume to day 47 (FIG. IB) were recorded in cubic millimeters (nun³). Endpoints in the study were either death of the animal or a tumor volume reaching 1500 mm³.

C. Results

FIG. 1A shows that mean tumor volume was reduced when MC3 LNP-formulated murine IL 12 modified mRNA was administered. In contrast, administering a control modified mRNA (NST-FIX) or PBS to the mice had little effect on reducing the tumor volume mean when assessed up to day 24.

FIG. IB shows that administering about 4 pg MC3 LNP-formulated murine IL12 modified mRNA per animal to the mice decreased individual tumor volumes in some animals compared to animals administered control modified mRNA (NST-FIX) or PBS. Complete responses (CRs) were seen in 3 of 7 animals (44%), with 3 animals removed due to ulceration. These data show that mIL12_miR122 polynucleotides have anti-tumor efficacy when administered intratumorally in vivo.

Example 2: Single and Multidose In Vivo Anti-tumor Efficacy of a Modified IL 12 mRNA

The in vivo anti -tumor efficacy of a modified murine IL 12 mRNA, administered as a single 0.5 pg dose and a multidose (0.5 pg for 7 days x 6), was studied in BALB/C mice bearing A20 B-cell lymphoma tumors.

A. Modified I I 2 mRNA The mIL12_miR122 polynucleotide as described in Example 1 was prepared. One group of mIL12_miR122 mRNA was formulated in MC3-based lipid nanoparticles (LNP) as described in Example 1. Another group of mIL12_miR122 mRNA was formulated in Compound Il-based lipid nanoparticles (LNP).

B. Dosing

On day 10 post implantation, two groups of mice bearing A20 tumors (n=12 in each group) were administered a single 0.5 pg dose of murine IL12 mRNA in the form of IL12 miR122-mRNA in MC3-based LNP.

Also on day 10 post implantation, another group of mice beanng A20 tumors was intratumorally administered weekly dosing of 0.5 pg of IL12 miR122 mRNA in AA '3-based LNP for 7 days x 6.

Also on day 10 post implantation, another group of mice bearing A20 tumors was intratumorally administered weekly dosing of 0.5 pg of IL12 miR122 mRNA in Compound Il-based LNP for 7 days x 6.

Finally, 10 days post implantation, another group of mice bearing A20 tumors (n=12 per group) was administered weekly dosing of 0.5 pg non-translated negative control mRNA (NST) in either MC3-based LNP or Compound Il-based LNP for 7 days x 6.

C. Results

As shown in FIG. 2A, in vivo anti-tumor efficacy in a B-cell lymphoma tumor model (A20) was achieved after mice bearing A20 tumors were administered a single dose of 0.5 pg murine IL 12 mRNA in MC3-based lipid nanoparticle (LNP). Decreased tumor volume was observed in some mice administered IL12 miR122 (0.5 pg), and three (3) complete responses (CR) were achieved.

As show n in FIG. 2B, in vivo anti-tumor efficacy was enhanced with a weekly dosing regimen of IL12 miR122 mRNA in MC3-based LNP (0.5 pg mRNA for 7 days x 6), compared to single dosing (see FIG. 2A). FIG. 2B shows that five (5) CRs were achieved in the 12 A20-bearing mice administered weekly dosing of 0.5 pg IL12 miR122 mRNA for seven (7) days x 6.

In vivo anti-tumor efficacy of IL12 mRNA in Compound-18 LNPs was enhanced as compared to the in vivo tumor efficacy of IL 12 mRNA in MC3 LNPs, as can be seen by delay in tumor growth (FIG. 2C). Shown is the individual tumor volumes for 12 mice administered 0.5 pg of murine IL12 mRNA in compound Il-based LNP for 7 days x 6. Complete responses (CR) were also achieved in 5 out of 12 animals.

As shown in FIGs. 2D-2E, tumor growth was observed in mice bearing A20 tumors administered weekly dosing (7 days x 6) of 0.5 pg non-translated negative control mRNA (NST) in MC3-based lipid nanoparticle (LNP) (FIG. 2D) and 0.5 pg NST in Compound II- based LNP (FIG. 2E).

This data shows that polynucleotides comprising modified murine IL 12 mRNA show anti -tumor efficacy at low doses (0.5 pg). It also shows that in vivo anti-tumor efficacy can potentially be enhanced with a multiple dosing regimen. Finally, the data shows in vivo antitumor efficacy when 0.5 pg IL12 miR122 mRNA in MC3-based and Compound Il-based LNP is administered intratumorally weekly (for 7 days x 6). In contrast, tumor growth was observed in mice bearing A20 tumors administered weekly dosing (7 days x 6) of 0.5 pg nontranslated negative control mRNA (NST) in MC3-based lipid nanoparticle (LNP) and in Compound Il-based LNP.

Example 3: Analysis of Levels of IL12 and IFNy in Mice Following Administration of Murine IL 12 mRNA

Mice bearing MC38 tumors were administered one or more doses of murine miR122 IL12 mRNA in standard Compound Il-based LNP intratumorally (iTu). In particular, mice were given a single intratumoral (iTu) dose of murine miR122 IL12 mRNA (at 0.05 pg, 0.5 pg, or 5.0 pg) in LNP, multiple iTu doses (4x) of murine miR122 IL12 mRNA at the same levels, or 5.0 pg NST as a control.

The levels of plasma IL 12 and IFNy were determined at 24 hours after administration of the dosages. The levels of IL12 and IFNy were determined using a Luminex-based multiplex panel (ProcartaPlex Mouse Cytokine & Chemokine Panel 1A 36 plex, Affymetrix eBioscience).

FIG. 3A shows dose-dependent levels of IL12 in plasma at 24 hours following administration of the indicated doses of murine IL 12 mRNA to mice bearing tumors. The plasma concentration of IL12 (ng/ml) is shown below in Table 1.

Table 1. IL12 protein levels in plasma (ng/ml).

FIG. 3B shows increased levels of IFNy at 24 hours in plasma following administration of murine IL12 mRNA to mice bearing tumors. This figure therefore shows that administration of murine IL 12 mRNA induces IFNy expression over multiple doses.

These data show that intratumoral administration of TL-12 induces increased plasma levels of IFNy. Additionally, multiple dosing of IL-12 in an MC38 tumor model induces repeated levels of both plasma IL-12 and IFNy.

Example 4: In Vivo Anti-tumor Efficacy of Intratumoral (iTu) Administration of IL12 miR122 mRNA in an MC38-R Model

MC38-R cells were implanted into mice. MC38-R tumor-bearing mice were cohorted into 4 treatment groups (N=13). Mice were iTu dosed with 0.05 pg, 0.5 pg, or 5 pg murine IL12 mRNA in Compound-II LNP. As a negative control, mice were iTu dosed with NST- FIX mRNA or untreated. In single and multiple dose studies, mice in the experimental and control groups received the same dosing regimen.

Tumor volumes and survival were measured in each group over the course of 75 days after implantation with MC38-R cells.

The individual tumor volumes from mice treated with a single iTu dose of 0.05 pg murine IL 12 mRNA are shown in FIG. 4A and FIG. 4E, mice treated with a single iTu dose of 0.5 pg murine IL 12 mRNA formulated in an LNP are shown in FIG. 4B and FIG. 4F, mice treated with a single iTu dose of 5 pg murine IL12 mRNA formulated in an LNP are shown in FIG. 4C and FIG. 4G, compared to appropriate negative controls in FIG. 4D. The pre-determined endpoint of 2000 mm³ tumor volume indicated by horizontal black hashed line. FIGs. 4A and 4E show that no mice bearing MC38-R tumor after administration of 0.05 pg of murine IL 12 mRNA achieved complete response. FIGs. 4B and 4F show that two mice bearing MC38-R tumor after administration of 0.5 pg of murine IL12 mRNA achieved complete response. FIGs. 4C and 4G show that four mice bearing MC38-R tumor after administration of 5 pg of murine IL12 mRNA achieved complete response.

The individual tumor volumes from mice treated with multiple iTu doses of 0.05 pg murine IL 12 mRNA are shown in FIG. 4H, mice treated with two iTu doses of 0.5 pg murine IL 12 mRNA formulated in an LNP are shown in FIG. 41, and mice treated with two iTu doses of 5 pg murine IL 12 mRNA formulated in an LNP are shown in FIG. 4 J. The predetermined endpoint of 2000 mm³ tumor volume indicated by horizontal black hashed line. FIGs. 4H-4J show that multiple administrations have similar efficacy as single administration.

These results indicate that despite the demonstrated resistance of MC38-R tumors to other immune mediated therapies, such as anti-PD l and anti-PD-Ll antagonist antibodies, mice administered murine IL12 mRNA displayed a survival benefit (FIG. 5). Survival events included tumor burden endpoints and animals off study due to ulceration/ eschar which occurred in treated and non-treated mice. The intratumoral administration of murine IL 12 mRNA delayed the growth of MC38-R tumors as compared to an appropriate negative control and provided a survival benefit and was generally well tolerated.

The levels of tumor and plasma IL 12 p70, as well as the level of other cytokines, were determined at 24 hours after administration of the dosages. The results show dose dependent levels of IL 12 in plasma with intratumoral administration of murine IL 12 mRNA as shown previously. The results also show sustained dose-dependent expression of TNFa, IL-10, IL- 13, IL-15/15R, IL-27, MIP-1 , MIP-la, MCP-1, MCP-3, M-CSF, IL-4, and IL-5 after multiple murine IL12 dosing (data not shown). GM-CSF, IL-18, IL-3, RANTES and IL-6 had elevated expression levels only following 5 pg murine IL12 dosing (data not shown).

Example 5: In Vivo Anti-Tumor Efficacy of IL12 Modified mRNA in Combination with Anti-PD-Ll Antibody in an MC38-R Model

Given the increased expression of PD-L1 (see Example 4 above) after administration of murine IL 12 mRNA, the efficacy of a combination therapy of murine IL 12 mRNA and an anti-PD-Ll antibody was studied. To evaluate the efficacy of anti-PD-Ll antibody monotherapy, mice bearing MC38-R tumor were administered a murine anti-PD-Ll antibody obtained from clone 80. FIG. 6A shows tumor volume changes in mice after administration of an antibody control. FIG. 6B shows tumor volume changes after administration of the anti-PD-Ll antibody. All mice reached the end point (i.e., 2000 mm³ tumor) demonstrating insensitivity of this model to anti-PD-Ll treatment.

Mice bearing MC38-R tumor were administered iTu either (i) murine IL12 mRNA alone, or (ii) murine IL12 mRNA and a murine anti-PD-Ll antibody in combination. Three dosages of mRNA were tested, i.e., 0.05 pg (data not shown), 0.5 pg, and 5 pg. Tumor volumes and survival were measured in each group (n=15) over the course of 90 days after implantation with MC38-R cells and general clinical observations made in accordance with an accepted protocol until a pre-determined endpoint of 2000 mm³ tumor volume was reached.

FIGs. 6C and 6E show that the combination therapy with 0.5 pg murine IL12 mRNA resulted in complete response in 6 out of 15 mice while only 1 out of 15 mice achieved complete response after administration of murine IL12 mRNA alone. FIGs. 6D and 6F show that 11 out of 15 mice achieved complete response in the combination therapy with 5 pg murine IL 12 mRNA while only 5 out of 15 mice achieved complete response after administration of murine IL 12 mRNA alone. FIG. 6G shows data that confirm a murine anti- PD-L1 antibody alone did not have any anti -tumor efficacy in mice bearing MC38-R in this study. The results show that the combination therapy of murine IL 12 mRNA and a checkpoint inhibitor, e g., an anti-PD-Ll antibody, can display synergistic efficacy in tumors otherwise resistant to checkpoint inhibitor therapy, e.g., MC38-R.

Example 6: In Vivo Anti-Tumor Efficacy of Intratumoral Administration of IL12 Modified mRNA in Combination with an Anti-PD-Ll Antibody

MC-38 colon adenocarcinoma tumors were implanted subcutaneously in mice as described in Rosenberg el al., Science 233: 1318-1321 (1986)).

MC38-R or B16F10-AP3 mice tumor bearing-mice were administered a single intratumoral dose of LNP-formulated murine IL12 modified mRNA (IL12 mRNA with miR122 formulated with Compound Il-based LNP) at a dose of either 0.05 pg, 0.5 pg, or 5 pg, alone or in combination with an intraperitoneal dose of anti-PD-L l antibody (clone 80). Additional doses were administered as indicated below.

A. Results

To test the effect of combined treatment with a murine IL12 mRNA and an anti-PD- Ll antibody (aPD-Ll), MC38-R mice were treated eleven days post implant with a murine anti-PD-Ll antibody alone (FIG. 7A), 0.5 pg murine IL 12 mRNA alone (FIG. 7B), or both a murine anti-PD-Ll antibody and 0.5 pg murine IL12 mRNA (FIG. 7C). Treatment using an anti-PD-Ll antibody alone had little effect on tumor grow th (FIG. 7A), and treatment with a single dose of 0.5 pg murine IL12 mRNA resulted in one CR (FIGs. 7B). When murine IL12 mRNA intratumoral treatment was combined with anti-PD-Ll administration (administered in six doses), there was a large increase in the number of CRs observed. Eight out of fifteen mice (53%) exhibited a complete response following a single dose of 0.5 pg murine IL12 mRNA in combination with an anti-PD-Ll antibody (FIG. 7C),

The synergistic effect of combination treatment using murine IL 12 mRNA and an anti-PD-Ll antibody was further observed in B16F10-AP3 mice, which are thought to be immunologically barren and are also resistant to checkpoint blockade therapies such as anti- PDL1. While untreated B16F10-AP3 mice (FIG. 8A) and B16F10-AP3 treated with an anti- PD-Ll antibody alone (FIG. SB) or a single dose of 0.5 pg murine IL12 mRNA alone (FIG. SC) yielded no CRs, mice treated with a single dose of 0.5 pg murine IL 12 mRNA in combination with an anti-PD-Ll antibody (administered in six doses on days 11, 14, 18, 21, 25, and 28) resulted in two CRs out of fifteen mice (FIG. 8D).

Example 7: Abscopal Effect Following Murine IL12 mRNA Administration within a Distal Tumor

To investigate potential abscopal effects of murine IL 12 mRNA intratumoral administration, MC38 colon adenocarcinoma tumors were implanted bilaterally in mice (MC38-S; FIG. 9A). 17/20 MC38-S tumors treated with 0.5 pg murine IL12 mRNA (FIG. 9D) and 19/20 MC38-S tumors treated with 5 pg murine IL12 mRNA (FIG. 9F) have thus far exhibited a complete response after about 50 months. In addition, 3/20 distal tumors in the 0.5 pg murine IL 12 mRNA-treated mice (FIG. 9E) and 16/20 distal tumors in the 5 pg murine IL12 mRNA-treated mice have thus far exhibited a complete response after about 50 months (FIG. 9G). The results with negative control are shown in FIGs. 9B and 9C.

These abscopal effects are amplified when murine IL 12 mRNA treatment is combined with anti-PD-Ll treatment. Mice implanted with bilateral MC38 tumors were administered intratumorally into one tumor either 0.5 pg murine IL12 mRNA (FIG. 10C-10D) or 5 pg murine IL 12 mRNA (FIG. 10E-10F) either as a monotherapy (FIGs. 10C and 10E) or combined with an anti-PD-Ll antibody (administered by IP injection of 20 mg/kg twice per week for two weeks; FIGs. 10D and 10F). Thus far, 3/20 CRs and 16/20 CRs were observed bilaterally in the 0.5 pg (FIG. 10C) and 5 pg (FIG. 10E) murine IL12 mRNA-treated mice, and 8/20 CRs and 20/20 CRs were observed bilaterally in the mice treated with a combination of anti-PD-Ll and 0.5 pg (FIG. 10D) or 5 pg (FIG. 10F) murine IL12 mRNA. The results with negative control are shown in FIGs. 10A and 10B. Example 8: Clinical Study Design to Evaluate Safety and Antitumor Activity of LNP- formulated mRNA Encoding Human IL12 in Combination with Immune Checkpoint Blockade

Provided in FIGs. 11A-11B is a clinical study design for a Phase 1, first-in-human, multicenter, open-label study performed to evaluate the safety, tolerability, pharmacodynamic activity, immunogenicity, and antitumor activity of intratumoral injection of huIL- 12_mRNA_01 combined with either sequential or concurrent intravenous (IV) durvalumab (anti-PD-Ll) in patients with advanced or metastatic solid tumors. The initial dose-escalation phase is shown in FIG. 11 A.

Selection of an mRNA dose

A starting dose of 0.1 pg was selected based on nonclinical pharmacology and toxicology data and the concentration-response in human cell based assays, in conjunction with the findings in the GLP toxicology study in cynomolgus monkeys. The goal of the human dose projection was to select a human starting dose that would minimize detectable systemic levels of IL-12p70, e g., to avoid toxicity. The projection of systemic IL-12p70 concentrations in human was carried out by scaling IL 12p70 systemic concentrations in nonclinical species, using the allometrically -based species-invariant time method (Dedrick, J Pharmacokinet Biopharm. 1973 ; 1 (5):435-61). IL-12p70 concentrations used for scaling were from a single dose huIL-12_mRNA_01 IT administration study with 2 PDx mouse models (data not shown). The allometric approach consisted of scaling individual IL-12p70 concentrations and time points using body weight (0.02 kg for mouse and 60 kg for human) with allometric exponents for volume of distribution (1.0) and clearance (0.75). This resulted in simulated human IL12p70 concentration versus time profiles. Using this method, a starting dose of 0. 1 pg was projected to achieve a human plasma IL-12p70 Cmax of 3. 1 pg/mL. The safety margins for the starting dose of huIL-12_mRNA_01 were calculated based on a comparison predicted mean plasma Cmax in human at the 0.1 pg starting dose (3.1 pg/mL) with the mean plasma IL-12p70 Cmax observed at the lowest dose of huIL-12_mRNA_01 administered subcutaneously to cynomolgus monkeys in a toxicity study (0.02 mg/kg). The efficacious dose range of huIL-12_mRNA_01 was predicted based on scaling the efficacious dose range of mouse IL-12 mRNA in syngeneic mouse models (0.05 to 0.5 pg). The absolute amount of administered mouse IL-12 mRNA was corrected to an equivalent absolute amount of huIL-12_mRNA_01 using the mouse-to-human ratio of typical tumor volume, assuming equipotency of mouse IL- 12 mRNA and huIL-12_mRNA_01.

Clinical Study Design

The clinical study includes an initial dose-escalation phase with three sub-parts, indicated in FIG. 11A as Part 1A, Part IB, and Part ID. The enrollment status corresponding to data in Example 9 is shown in FIGs. 11A-11B. The enrollment status corresponding to data in Example 10 is shown in FIGs. 11C-11D. The dosing scheme for Part 1A and Part IB is shown in FIG. HE.

The treatment schedules for the sub-parts are as follows:

Part 1A: sequential intratumoral administration huIL-12_mRNA_01 with systemic administration of durvalumab in patients with cutaneous/subcutaneous (C/SC) lesions. Patients received an (i) intratumoral injection of huIL-12_mRNA_01 on days 1 and 22, and (ii) an intravenous injection of durvalumab on day 43 and then every 4 weeks (Q4W). The dose of huIL-12_mRNA_01 for cohorts 1-6 was 0.1 pg, 0.3 pg, 1 pg, 3 pg, 8 pg and 12 pg respectively. The dose of durvalumab was 1500 mg. In those subjects whose lesions no longer meet the criteria for huIL-12_mRNA_01 injection, or who have a complete response (CR) at Day 22, durvalumab may be started on Day 22 and repeated Q4W. The Q3W dosing cycle for huIL-12_mRNA_01 was selected based on GLP-compliant nonclinical toxicology studies in rats and cynomolgus monkeys. The nonclinical data indicated a plasma half-life of 5-6 days for IL-12p70 produced from huIL-12_mRNA_01, and a dosing cycle was selected to ensure IL-12 washout by the time a second dose was administered. The Q3W dosing cycle was also selected to allow rapid transition to durvalumab treatment.

Part IB: concurrent intratumoral administration huIL-12_mRNA_01 with systemic administration of durvalumab in patients with C/SC lesions. Patients received an (i) intratumoral injection of huIL-12_mRNA_01 on days 1, 29, 57, and then every 8 weeks (Q8W), and (ii) intravenous injection of durvalumab on day 1 and then Q4W. The starting dose level for Part IB was determined by a dose escalation committee (DEC) based on emerging safety, PK and pharmacodynamic data, and was selected to not exceed the highest tested dose deemed safe in Part 1 A (12 pg). In those subjects whose lesions no longer meet the criteria for huIL-12_mRNA_01 injection, or who have CR following at least one huIL- 12_mRNA_01 injection, hulL-12_mRNA_01 dosing may be omitted. The Q4W schedule for huIL-12_mRNA_01 was selected to align with durvalumab administration and reduce expected subject burden due to multiple visits required for investigational product infusion.

Part ID: concurrent intratumoral administration huIL-12_mRNA_01 with systemic administration of durvalumab in patients with deep-seated lesions. Patients receive an (i) intratumoral injection of huIL-12_mRNA_01 on days 1, 29, 57, and then Q8W, and (ii) intravenous injection of durvalumab on day 1 and then Q4W. The starting dose level for Part ID is determined by a dose escalation committee (DEC) based on emerging safety, PK and pharmacodynamic data, and will not exceed the highest tested dose that is deemed safe in Part 1A.

A minimum of 3 evaluable subjects are included in a dose cohort and evaluated prior decision to dose-escalate, stay, or de-escalate. Up to 12 evaluable subjects are enrolled at each dose level. Escalation to a higher dose level is not permitted until the current dose level has dosed at least 3 DLT-evaluable subjects and subjects have been observed for a minimum of 21 days in Part 1 A or 28 days in Part IB and ID, and the dose level is found to be safe.

Treatment continues for up to 2 years or until tumor progression or unacceptable toxicity.

The subsequent dose-expansion phase is shown in FIG. 11B and FIG. 11D. Part 2 (Dose Expansion) is designed to evaluate the antitumor activity of concurrent intratumoral huIL-12_mRNA_01 with systemic administration of durvalumab in NSCLC subjects with cutaneous, subcutaneous or supraclavicular lesions who have received prior immunotherapy (I/O) or in subjects with advanced or metastatic (deep-seated lesions) NSCLC who have received prior I/O. Part 2 starts after a recommended Phase 2 dose of concurrent huIL- 12_mRNA_01 with durvalumab is established in the respective lesion type (cutaneous, subcutaneous or supraclavicular lesions and deep-seated lesions).

Patient eligibility includes the following criteria:

• Age >18 years

• Histologic or cytologic confirmation of advanced solid tumors

• At least 1 lesion measurable by Response Evaluation Criteria in Solid Tumors (RECIST) vl.l, other than the planned injected lesion.

• Progression on or refractoriness to >1 line of standard systemic therapy for recurrent/metastatic disease

Study Objectives The primary objective of the clinical trial is to determine safety and tolerability of sequential and concurrent huIL-12_mRNA_01 with durvalumab as measured by adverse events (AEs), serious AEs (SAEs), and abnormal laboratory' parameters, vital signs, and ECG results, dose-limiting toxicities (DLTs), and discontinuations due to toxicities. An additional primary objective is to determine the maximum tolerated dose (MTD) or highest protocol- specified dose.

Secondary objectives include determining preliminary antitumor activity as measured by

1. obj ective response rate (ORR),

2. disease control rate (DCR, defined as complete responses [CRs], partial responses [PRs], and stable disease [SD] >12 weeks),

3. time to response,

4. duration of response, and

5. progression-free survival per RECIST vl.l and overall survival.

Additional secondary objectives include measuring clinical activity in terms of qualitative evaluation of non-target and injected lesions per RECIST vl. l, including abscopal effects (i.e., as reduction in tumor size in any non-injected lesion); measuring systemic pharmacokinetics of huIL-12_mRNA_01 and durvalumab; and determining immunogenicity as measured by antidrug antibodies to huIL-12_mRNA_01, huIL-12_mRNA_01-derived protein, and durvalumab. huIL-12_mRNA_01

“huIL-12_mRNA_01” evaluated in the clinical study refers to an mRNA encoding a linked monomeric bioactive human IL-12p70 polypeptide formulated in an LNP The linked monomeric IL-12p70 polypeptide is a fusion protein of the IL-12A and IL-12B subunits linked via a GlySer linker to form a single-chain human IL-12 polypeptide. The mRNA had an ORF encoding from 5' to 3': IL-12B signal peptide - IL-12B subunit - GS linker - IL-12A subunit. The amino acid sequence of the encoded IL- 12 polypeptide is set forth in SEQ ID NO: 5 and amino acid sequences of the IL-12B signal peptide, mature IL-12B subunit, mature IL-12A subunit, and Gly-Ser linker are set forth in SEQ ID NOs: 8, 9, 10, and 11 respectively, and the amino acid sequence for the single-chain human IL-12 is set forth in SEQ ID NO: 5. The ORF had the nucleotide sequence set forth in SEQ ID NO: 2. The IL- 12 mRNA had a 5'UTR with the nucleotide sequence set forth in SEQ ID NO: 3 and a 3'UTR with a miR-122 binding site having the nucleotide sequence set forth in SEQ ID NO: 4. The mRNA had a full-length nucleotide sequence as set forth in SEQ ID NO: 1. The mRNA is fully modified with N1 -methylpseudouridines (ml\|/ ) in place of uridine and has a 5’ Cap 1 (7MeGpppG2’OMe) structure. The mRNA was formulated in an LNP having the components and molar ratio shown in the below table. Methods for preparing huIL-12_mRNA_01 as evaluated in the clinical study is further described in US Patent No. 10,646,549, which is hereby incorporated by reference.

Table 2: Lipid components of hu-IL12_mRNA_01 LNP

Example 9: Initial Results of Clinical Study for Sequential or Concurrent Administration of huIL-12_mRNA_01 and Immune Checkpoint Blockade

This example provides results from Part 1 A and Part IB of the clinical study described in Example 8, with enrollment status as shown in FIGs. 11A-11B. The results are based on Part 1A cohorts 1-6 that received a huIL-12_mRNA_01 dose of 0.1-12 pg, with data for 20 patients; and Part IB cohorts 1-2 that received a huIL-12_mRNA_01 dose of 1.0 or 3.0 pg, with data for 11 patients. Baseline demographics and disease characteristics for the patients is provided in Table 3.

Table 3: Demographic and Disease Characteristics

Subjects were required to have a minimum of 2 lesions at baseline: (i) a minimum of 1 lesion must been accessible for safe injection as determined by the site investigator (nontarget lesion) (Re-injection is permitted); and (ii) a minimum of 1 other lesion that was a measurable target lesion selected per RECIST vl. l (see Eisenhauer EA, et al. Eur J Cancer. 2009;45(2):228-47) (target lesion) to monitor for efficacy and abscopal disease response Target lesions were any lesions that meet the definition of target lesion per RECIST vl. l.

Cutaneous or subcutaneous lesion(s) to be potentially injected were required to meet all the following criteria for safe injection at baseline (i.e., initial injection) and during the treatment period (i.e., all subsequent injections/re-injections): 6. Visible or palpable non-visceral lesion (lesions involving superficial muscle tissue or lesions involving the fascia overlying muscles (e.g., breast mass, supraclavicular lymph nodes) or lesions within the oral cavity that are readily visualized and are not in close proximity to crucial structures

7. Measured > 1.5 cm in the smallest diameter based on imaging or clinical examination.

8. Located in an anatomic location where huIL-12_mRNA_01 could be safely administered ie, not encasing, abutting, infiltrating or in close proximity to critical structures such as trachea or other major airway tract, urinary tract, major blood vessels (e.g., carotid artery, jugular vein), biliary tract, or nerve bundles.

9. Non-necrotic or non-cystic tumor tissue (viable tumor tissue) required for at least 50% of the lesion.

At each dosing day, only 1 lesion was injected (i.e., the dose was not split across 2 or more lesions).

Study Drug Exposure

The study drug exposure is provided in Table 4. In Part 1A, 15/20 (75.0%) patients completed the planned huIL-12_mRNA_01 treatment (2 doses); in Part IB, there was no planned total number of huIL-12_mRNA_01 doses. Across Parts 1A and IB, 14/31 (45.2%) patients discontinued huIL-12_mRNA_01 treatment. Most of those patients that discontinued huIL-12_mRNA_01 treatment was due to progressive disease (9/31; 29.0%). Across Parts 1A and IB, 27/31 patients received durvalumab treatment. Of these, 23/27 (85.2%) patients discontinued durvalumab, most commonly (20/27; 74.1%) due to progressive disease.

Table 4: Study Drug Exposure

Safety Profile

An objective of Part 1A and IB of the clinical study was to evaluate the safety and tolerability of sequential or concurrent administration of huIL-12_mRNA_01 with durvalumab result in patients with SC/C lesions.

Study treatment has been well tolerated in Part 1A and IB, with no dose limiting toxicities (DLTs) having occurred and the MTD has not been reached. A DLT is defined as any Grade 3 or higher toxicity reported during the DLT-evaluation period, with certain modifications and exceptions. For Part 1 A (dose escalation with sequential huIL- 12_mRNA_01 and durvalumab), the DLT-evaluation period is defined as the time from the first dose of huIL-12_mRNA_01 to Day 21. For Parts IB and ID (concurrent huIL- 12_mRNA_01 with durvalumab) the DLT-evaluation period is defined as the time from the first dose of huIL-12_mRNA_01 to Day 28 (i.e., DLT periods end just prior to the second dose of huIL-12_mRNA_01). Toxicity that is clearly and directly related to the primary disease or to another etiology is excluded from this definition. The MTD is the highest dose with a DLT rate closest to 30% in Part 1 dose escalation.

The safety profile of huIL-12_mRNA_01 combined with durvalumab is shown in Table 5. Overall, 30 (96.8%) patients had >1 treatment-emergent AE (TEAE), including 12 (38.7%) patients with >1 grade 3/4 TEAE. There were no grade 5 TEAEs.

The most common TEAEs were fatigue (19.4%), dyspnea (16.1%), pruritus (16.1%), pyrexia (12.9%), diarrhea (12.9%), and nausea (12.9%) (see Table 6). Apart from ascites (n=2, 6.5%), no individual grade 3/4 TEAE occurred in more than 1 patient. Furthermore, 13 (41.9%) patients had >1 huIL-12_mRNA_01 -related AE, but only 1 (3.2%) of them had a grade 3 event (pyrexia). There were no grade 4 huIL-12_mRNA_01-related AEs. 1 (3.2%) patient had a huIL-12_mRNA_01-related SAE (grade 2 confusion). 7 (22.6%) patients had >1 durvalumab-related AE, of whom 2 (6.5%) had grade 3 events (pyrexia also related to huIL-12_mRNA_01, and pruritus). There were no durvalumab-related grade 4 AEs or SAEs. Table 5: Safety Summary

*One patient had huIL- 12_mRNA_01 -related grade 3 pyrexia.

'Two patients had durvalumab-related grade 3 AEs of pyrexia (n=l, also considered huIL- 12_mRNA_01 -related) and pruritus (n=l).

Table 6: TEAEs occurring in >3 patients overall

Antitumor Efficacy

An objective of the Part 1A and IB of the clinical study was to determine whether sequential or concurrent administration of huIL-12_mRNA_01 with durvalumab will result in anti-tumor activity in patients with SC/C lesions.

Clinical lesions were considered measurable when they were superficial and > 1.5 cm diameter as assessed using calipers (e.g., skin nodules). CT was used to measure lesions selected for response assessment. When CT scans have slice thickness greater than 5 mm, the minimum size for a measurable lesion is twice the slice thickness. MRI was also acceptable in certain situations.

Target lesions (defined as per RECIST vl.l) included any tumors that have not been injected.

In accordance with RECIST vl . 1, an injected lesion was not selected as a target lesion and followed for efficacy response. However, the injected lesion was evaluated and measured qualitatively and quantitatively (if measurable) separately from target lesions. If not measurable, the injected lesion was evaluated qualitatively and is followed throughout the trial. Efficacy evaluations and subject treatment decisions was based on target lesions per RECIST vl. l. Tumor response was defined by the RECIST vl.l criteria.

Shown in FIG. 12 is the best change in target lesion size relative to baseline. Overall, 3 patients had confirmed or unconfirmed PRs (progressive responses), including:

10. 1 patient with head and neck cancer (unconfirmed PR) who received sequential huIL- 12_mRNA_01 0.1 pg with durvalumab;

11. 2 patients with anti-PD-1 -resistant melanoma: 1. one received sequential huIL-12_mRNA_01 0.3 ig with durvalumab and had a confirmed PR lasting 9+ months,

2. and the other received concurrent huIL-12_mRNA_01 3 pig with durvalumab and had an unconfirmed PR.

3. At data cutoff, treatment was ongoing in both patients.

Per RECISTvl.l criteria, a PR should be confirmed in a subsequent efficacy assessment (see CSPv3 section 4.8.3.1). If a subject exhibited PR but had not undergone a subsequent efficacy assessment at the time of data collection, the individual was deemed to have an “unconfirmed” PR.

10 (32.3%) patients had stable disease (including the 2 with unconfirmed PRs), 13 (41.9%) patients had progressive disease, and 5 (16.1%) patients were not evaluable for tumor response.

Three out of four patients with >30% target lesion regression had one confirmed PR and two unconfirmed PRs, and the disease control rate (DCR) was 29.0%.

Pharmacodynamic changes

Overall, 17 patients were evaluable for pharmacodynamic studies (up to huIL- 12_mRNA_01 3 pg in Part 1A and 1 pg in Part IB).

(i) Serum Cytokines

FIGS. 13A-13B show levels of serum IL-12 and IFNy, respectively, that were measured in peripheral blood across the 5 dose cohorts, provided on the left as pg/mL and on the right at fold change. Peripheral blood was obtained at the screening visit (SCR) and at visit number 2-8 (V2-V8). The SCR occurred prior to the start of treatment, V2-V8 corresponded to day 1, 2, 8, 15, 22, 23 and 43 respectively (Part 1A) or day 1, 2, 8, 15, 29, 30, and 42 respectively (Part IB). Serum IL-12 and serum IFNy levels were measured by Erenna immunoassay system Singulex and Meso Scale Discovery', respectively. The lower limit of quantification for IL-12 is 0.05 pg/mL and for IFNy is 1.3 pg/mL. huIL-12_mRNA_01 increased IL- 12 production in 15/17 (88.2%) patients as determined by >2-fold increases in serum IL-12 levels 24 hr after injection, compared with baseline (see FIG. 13A). The 0.1 pg dose of huIL-12_mRNA_01 resulted in the lowest increase in IL-12 levels in the periphery. No clear dose dependence was observed above the transition from huIL-12_mRNA_01 0.1 pg to 0.3 pg (FIG. 13A). Serum IL-12 levels were highest at 3 pg dose cohort in Part 1 A and the 1 pg dose cohort in Part IB.

Increased IL-12 was associated with >2-fold parallel increases in serum IFNy in 10/17 (58.8%) patients (see FIG. 13B). Dose dependence was similar to that observed for IL-12, with the 0. 1 pg dose of huIL-12_mRNA_01 resulting in the lowest increases in IFNy levels in the periphery and no clear dose dependence was observed above 0. 1 pg. The highest IFNy serum levels were observed in the 3 pg Part I A dose cohort, followed by the I pg Part IB dose cohort.

(ill) Tumor Infiltrating T cells andPD-Ll Expression In Tumor Epithelium

CD3+ T cell and CD8+ T cell densities (cells/mnr) were assessed with immunohistochemistry in patient tumor biopsies and quantified with HALO Al digital image analysis by the study pathologist. FIGs. 14A and 15A show CD3+ T cell and CD8+ T cell densities, respectively, measured as cells/mm² at baseline and visit 5 (V5). Each line represents a patient. FIGs. 14B and 15B show CD3+ T cell and CD8+ T cell densities, respectively, measured as fold change at day 15 (visit 5) for each dose cohort. The horizontal lines represent medians, and the dotted line represents the cutoff set at >2-fold increase.

Intratumoral huIL-12_mRNA_01 was associated with increases in tumor-infiltrating T cells compared with baseline:

12. 7/14 patients had a >2-fold increase from baseline in CD3+ T cells; and

13. 8/14 patients had a >2-fold increase from baseline in CD8+ T cells.

The percentage of PD-L1 -positive tissue in tumor epithelium and the density of Ki- 67 -positive T cells were assessed with immunohistochemistry in patient tumor biopsies and quantified with HALO Al digital image analysis by the study pathologist.

FIGs. 16A-16B show the percentage of tissue positive for PD-L1 and fold change, respectively, between visit 5 (V5; Day 15) and baseline for each dose cohort. Intratumoral huIL-12 mRNA 01 led to a >2-fold increase in PD-L1 expression on tumor epithelium (injected site) in 7/14 patients.

FIGs. 17A-17B show quantification of T cells positive for Ki-67 (cells/mm2 of tissue) and the fold change, respectively, between V5 and baseline. Ki-67 levels were used as an indicator of proliferation. It was shown that 6/14 patients had a >2-fold increase from baseline in proliferating T cells. Together, these data indicate that intratumoral injection of huIL-12_mRNA_01 combined with systemic administration of durvalumab in humans with SC/C tumor lesions is associated with tumor infiltrating T cells and biomarkers of increased T cell activation.

Example 10: Results of Clinical Study Demonstrate Induces Peripheral and Intratumoral Immunostimulatory Effects

This Example describes analysis of clinical samples (serum, plasma, peripheral blood, and tumor biopsies) obtained from patients enrolled in the clinical trial described in Example 8. The samples were evaluated for changes in cytokine levels, circulating tumor (ct) DNA, gene signature, and T cell infiltration. The enrollment status at the time of data collection is shown in FIGs. 11C-11D and indicated below:

• Part 1A: cohort 1 (0.1 pg; n=4); cohort 2 (0.3 pg; n=3); cohort 3 (1 pg; n=3); cohort 4 (3 pg; n=4); cohort 5 (8 pg; n=3); cohort 6 (12 pg; n=5); and PD cohort 6 (12 pg; n=3)

• Part IB: cohort 1 (1 pg; n=3); PD Cohort 1 (1 pg; n=8); cohort 2 (3pg; n=3); PD cohort 2 (3pg; n=5); cohort 2 (8 pg; n=3); and cohort 2 (12 pg; n=5).

PD " cohorts refer to pharmacodynamic backfill cohorts. These cohorts were added at the given dosing level and once the given dose level escalation cohort was completed and evaluated.

The methods used for analysis are shown in Table 7.

Table 7: Pharmacodynamic biomarker methods

Serum Cytokine & Chemokine Analysis

Blood was collected from patients enrolled in Part 1A dose cohort 0.1 mg, 0.3 mg, 1.0 mg, 8.0 mg, and 12.0 mg and Part IB dose cohort 1.0 mg, 3.0 mg, 8.0 mg, and 12.0 mg and analyzed for levels of soluble factors (e.g., C-reactive protein, cytokines, and chemokines). For Part 1A, measurements were performed on blood collected at visit 1 (VI) (Day -28 to Day -1), V2 (Day 1), V3 (Day 2±ld), V4 (Day 8±2d), V5 (Day 15±2d), V6 (Day 22±2d), V7 (Day 23±2d), V8 (Day 43±7d), V9 (Day 71±5d), V12 (Day 155±5d), and V13 (Day 183±5d). For Part IB, measurements were performed on blood collected at VI (Day -28 to Day -1), V2 (Day 1), V3 (Day 2±ld), V4 (Day 8±2d), V5 (Day 15±2d), V6 (Day 29±2d), V7 (Day 30±2d), V8 (Day 42±2d), V9 (Day 57±3d), V12 (Day 85±5d), V13 (Day 113±5d), and V15 (Day 141±5d). V2 is the pre-dose baseline; V3 is approx. 24 hours after the first mRNA dose; and V7 is approx. 24 hours after the second mRNA dose

FIGs. 18A-18B respectively show median concentrations (pg/mL) of IL-12 and IFNy measured in serum across the dose cohorts. Serum IL-12 and serum IFNy levels were measured by Erenna immunoassay system Singulex and Meso Scale Discovery respectively. The analysis revealed > 2-fold increase in serum IL-12 levels in 36/39 (92%) of patients following the first injection of huIL-12 mRNA 01 (Part 1A) or huIL-12 mRNA 01 and durvalumab (Part IB) (FIG. 18A). The increase was associated with a > 2-fold increase in serum IFNy in 34/41 (83%) of patients (FIG. 18B). The serum IL-12 levels were in picogram ranges (0.68-403.8 pg/mL), as were serum IFNy levels (0.65-3057.1 pg/mL).

FIGs. 19A-19B provide the median concentration (pg/mL) of IFN-inducible chemokines CXCL9, CXCL10, and CXCL11 in serum measured using Meso Scale Discovery (FIG. 19A) and the median expression of CXCL9, CXCL10, and CXCL11 transcripts in serum measured using RNAseq (FIG. 19B). The expression data shown in FIG. 19B is provided as log2 fold-change in transcripts per million (TPM). An increase in IFN- inducible chemokines was observed in the periphery when measured at the serum protein level (FIG. 19A) and the transcriptomic level (FIG. 19B).

Gene Expression for Peripheral CD8 T cells Peripheral blood was analyzed for expression of gene transcripts using RNAseq. As shown in FIG. 20, peripheral blood collected during visit 3 had a positive correlation between expression of gene transcripts encoding proteins associated with T cell activation and cytotoxic activity (i.e. , GZMB (encoding granzyme B), PRF1 (encoding perforin 1), IFNG (encoding interferon gamma), IL12RB1 (encoding IL12 Receptor subunit beta 1), IL12RB2 (encoding IL 12 receptor subunit beta 2), and CD38 (encoding CD38)) and expression of gene transcript encoding CD8A. These results indicate CD8 T cells acquired a cytotoxic phenotype post injection of huIL-12_mRNA_01.

As shown in FIG. 21, the expression of these gene transcripts was assessed over time for patients with a partial response (n=4), stable disease (n=12), and progressive disease (n=12). A trend of increased gene expression of GZMB, PRF1, IFNG, IL12RB1, and IL12RB2 was observed in patients with partial response. Patients with progressive disease generally showed reduced peripheral GZMB and PRF1 expression over time, indicating less T cell cytotoxicity.

As shown in FIG. 22, the expression of gene transcripts encoding proteins that suppress anti-tumor activity were increased over time in peripheral blood collected from patients with progressive disease (n=14). The gene transcripts evaluated encode FoxP3, IL- 10, arginase 1, STAT3, PD-1, and TIGIT. These results indicate key mediators of T cell suppression are increased over time following mRNA administration in patients with progressive disease, but not in patients with stable disease or partial response to the treatment.

Gene Signatures in the Tumor Microenvironment

Immunohistochemistry (IHC) was performed using tumor biopsies obtained from patients. Tumor biopsies were performed using a 4 core or punch biopsy, with at least 3 core biopsies requested at each time point. The first and third biopsies per time points were placed in formalin and processed for formalin-fixed paraffin-embedded samples, while the second and (if available) fourth core biopsies/time points were snap frozen per local practice and then stored at 80°C. IHC was used to measure levels of CD8 T cells, Ki-67+ CD3 T cells, and PD-L1 in tumor biopsies at approximately 15 days post first-injection of mRNA (V5).

A >2-fold increase in CD8 T cells was observed in 9/22 (41%) of patient tumor biopsies (FIG. 23A); a >2-fold increase in proliferating T cells (K1-67+CD3+ T cells) was observed in 11/23 (48%) of patient tumor biopsies (FIG. 23B); and a >2 -fold increase in PD- L1 positive tissue in tumor epithelium was observed in 9/22 (41%) of patient tumor biopsies (FIG. 23C). For each figure, the left panel shows cells/mm² at baseline relative to day 15 after the first dose, with each line representing a patient. The cohort for each patient is indicated by the label adjacent the line (Part 1 A is “1 A”; Part IB is “IB”; and the value indicates the dose). The right panel shows the fold-change at day 15 after the first dose relative to baseline.

Shown in Table 8 is the association between T-cell infiltration, proliferation, PD-L1 induction, and clinical response.

Table 8. Association between IHC readout and clinical response

Tumor biopsy samples were also analyzed for expression of genes associated with a cytotoxic phenotype (i.e., GZMB, PRF1, IFNg, 1L12RB2) using RNAseq. Comparison was made to the density of CD8 T cells in the tumor as measured by IHC. Tumor biopsy samples were collected on visit 5 (approx. 15 days from first dose). As shown in FIG. 24, a positive correlation was observed between CDS T cell density and expression of genes associated with T cell activation and cytotoxicity. These results demonstrate infiltrating T cells acquire a cytotoxic phenotype following administration of mRNA. A similar positive correlation was observed between expression of CD8A and GZMB, PRF1, IFNg, IL12RB2 (data not shown).

Tumor biopsies from patients having an evaluable biopsy at baseline and posttreatment were evaluated for expression of an antitumor gene signature using RNAseq. Shown in FIG. 25 is the fold change in expression of gene transcripts at day 15 following injection of the first mRNA dose compared to baseline in patients with stable disease or partial response (PR+SD) or patients with disease progression (PD). The gene signature indicated increased activated CD8 T cells, activated NK cells, Ml macrophages, and IFNg signaling in tumors from PR+SD patients. Shown in FIG. 26, is the fold-change in anti-tumor and immunosuppressive gene signature on day 15 following injection of the first mRNA dose compared to baseline in patients with PR+SD or patients with PD.

Tumor biopsy samples were further evaluated for tumor mutational burden (TMB) using next generation sequencing (Guardant Health Omni panel). Tumor biopsy samples collected at baseline were characterized as having a high or low TMB score based on a cutoff of 20 mutations/Mb (subject information for each biopsy sample indicated in Table 8). The TMB score was measured as the rate of single nucleotide variants (SNVs) and insertions and/or deletions (indels) per Mb, excluding drivers and clonal hematopoiesis (CH) variants and correction for tumor shedding in cell free DNA. As shown in FIG. 1 , the majority of patients with PR or SD had a high TMB score at baseline.

Longitudinal monitoring of circulating tumor DNA (ctDNA) levels was performed. The ctDNA was harvested from plasma samples collected on V2, V6, V8, V9, V10, V12, V14, V15, V16, and end of treatment (EOT) from patients with partial response disease or stable disease or on V2, V6, V8, and EOT from patients with progressive disease. The percent change in max variant allele fraction (VAF) relative to V2 was calculated. As shown in FIG. 27B, greater than 50% reduction in ctDNA mutant allele frequency from V2 was observed in 2/3 patients who developed PR.

Table 8: Subjects Evaluated for Tumor Mutational Burden

Example 11: Results of Clinical Study Demonstrate Tolerability and Antitumor Activity of IT huIL-12 mRNA 01 + IV Durvalumab in Patients with Advanced Solid Tumors

This Example describes analysis of safety and antitumor activity of intratumoral huIL-12_mRNA_01 with either sequential or concurrent intravenous durvalumab (anti-PD- Ll) in patients with advanced or metastatic tumors enrolled in the clinical trial described in Examples 8-10, with the data cutoff for the clinical study having the enrollment status as shown in FIGs 28A-28C and indicated below: • Part 1A: cohort 1 (0.1 pg; n=4); cohort 2 (0.3 pg; n=3); cohort 3 (1 pg; n=3); cohort 4 (3 pg; n=4); cohort 5 (8 pg; n=3); cohort 6 (12 pg; n=5); and backfill PD cohort 6 (12 hg; n=3);

• Part IB: cohort 1 (1 pg; n=3); PD Cohort 1 (1 pg; n=8); cohort 2 (3pg; n=3); PD cohort 2 (3pg; n=5); cohort 3 (8 pg; n=3); and cohort 4 (12 pg; n=5); and

• Part ID: cohort 1 (1 (ig, n=3); and cohort 2 (3 pg, n=6).

Baseline demographics and disease characteristics for the patients is provided in Table 8.

Table 8: Demographic and Disease Characteristics

M = huIL-12_mRNA_01; D = durvalumab

Safety Profile

The safety and tolerability of sequential or concurrent administration ofhulL- 12_mRNA_01 with durvalumab in patients with SC/C lesions or deep-seated lesions was evaluated. A DLT, MTD, and the DLT-evaluation period is defined as described in Example 9.

The safety profile of huIL-12_mRNA_01 combined with durvalumab is shown in FIG. 29. As of the data cutoff for the clinical study with enrollment as shown in FIGs. 28A- 28C, the median duration of exposure to huIL-12_mRNA_01 was 6.0 weeks (range 3.0-6.3) in Part 1A, 8.0 weeks (range 1.3-83.4) in Part IB and 4.0 weeks (range, 4.0-8.0) in Part ID. The respective durations of exposure to durvalumab were 8.0 weeks (range, 2.1-100.9), 8.0 weeks (range, 1.3-83.4) and 4.0 weeks (range, 4.0-8.0). Study treatment was well tolerated in Part 1 A, IB, and ID, with no dose limiting toxi cities (DLTs) and the MTD was not reached.

Overall, 59 (96.7%) patients had treatment-emergent adverse events (TEAEs), which were grade 3/4 in 25 (41.0%). In Part IB, one patient had a grade 5 TEAE (abnormal hepatic function unrelated to treatment). Overall, 35 (57.4%) patients had huIL-12_mRNA_01- related AEs, which were grade 3/4 in 3 patients (4.9%), including one with grade 3 asthenia and one with grade 3 pyrexia (both also durvalumab-related), and one with grade 4 lymphocyte count decreased. Two (3.3%) patients had a huIL-12_mRNA_01 -related SAE: one with grade 2 confusion and one with grade 2 pyrexia (which was also durvalumab- related). Overall, 22 (36.1%) patients had durvalumab-related AEs, which were grade 3 in 3 patients (4.9%); pyrexia, asthenia (both also huIL-12_mRNA_01 -related) and pruritus (each n=l). One patient (1.6%) had a durvalumab-related SAE (grade 2 pyrexia; also huIL- 12_mRNA_01 -related). A summary of the TEAEs is provided in Table 9. The most common TEAEs were fatigue (23.0%), pyrexia (23.0%), anemia (16.4%), diarrhea (13. 1%), nausea (13.1%) and vomiting (13.1%). The most common grade 3/4 TEAE was anemia (6.6%).

Table 9: TEAEs occurring in >5 patients overall

M = huIL-12_mRNA_01; D = durvalumab

Antitumor Efficacy

The anti -tumor activity of sequential or concurrent administration of huIL- 12_mRNA_01 with durvalumab in patients with SC/C lesions or deep-seated lesions was evaluated.

Criteria for identification of cutaneous or subcutaneous lesions in Part 1 A and Part IB is as described in Example 9. Subjects enrolled in Part ID, were required to have at least three lesions at baseline: (i) at least two lesions that were deemed accessible for safe injection by the site investigator (non-target lesions); and (ii) at least one other lesion to be used as a measurable target lesion selected per RECIST vl.l (target lesion) to monitor for efficacy and abscopal disease response. The target lesions were deemed as any lesion meeting the definition of target lesion per RECIST vl.l. Re-injection of a non-target lesion was not permitted unless the lesion progressed after an initial response or > 6 months of stable appearance and all the criteria for injection were met. Deep-seated lesions were selected based on imaging and clinical evaluation. Imaging was performed 1 to 3 days prior to injection. Deep seated lesions targeted for injection were required to meet all the following criteria for safe injection at baseline (i.e., initial injection) and during the treatment period (i.e., all subsequent injections):

• Must be visceral lesions not visible or palpable and which require image guidance for injection (e.g, hepatic, pulmonary lesions).

• Must measure > 2 cm in the smallest diameter and < 5 cm in longest diameter based on imaging.

• Must have > 0.5 cm of viable, normal organ parenchyma surrounding the lesion in all directions. o the selected lesion must be > 0.5 cm from the liver capsule or any serosal surface (i.e., no discontinuation of the organ surface or serosae) based on imaging. o If selected lesion is protruding, it must be protruding by < 30% (based on tumor volume) from the organ surface based on imaging.

• Be located in an anatomic location where huIL-12_mRNA_01 can be safely administered, i.e., not encasing, abutting, infiltrating or in close proximity to critical structures such as brain, mediastinum, bone, trachea or other major airway tract, urinary tract, major blood vessels (e.g., carotid artery, jugular vein), biliary tract, or nerve bundles.

• Non-necrotic or non-cystic tumor tissue (viable tumor tissue) must be > 2 cm in smallest diameter and < 5 cm in longest diameter at the time of injection based on imaging.

All deep-seated lesion injections were guided by imaging, e.g., preferably using CT- guided injection or ultrasound guidance following a CT or magnetic resonance imaging (MRI) to characterize the lesion and confirm its presence.

Criteria and methods for measuring target lesions (defined as per RECIST vl. 1) is as described in Example 9.

Shown in FIG. 30 is the best change in target lesion size relative to baseline. The primary cancer types (i.e., the tumor type at cancer diagnosis) were anal cancer; bladder cancer; breast cancer; cervical cancer; colorectal cancer; gastric cancer; head and neck cancer; lung cancer (NSCLC); melanoma; pancreatic cancer; squamous cell carcinoma of the skin; vulvar cancer; and other cancer types.

As shown in Table 9, (I) 5 patients had confirmed PRs (progressive responses), including: (i) two patients with melanoma (one enrolled in Part 1A 0.3 pg dose cohort; one enrolled in Part IB 12 pg dose cohort); (ii) one patient with sarcoma (enrolled in Part IB 1 pg dose cohort); (iii) one patient with breast cancer (enrolled in Part IB 3 pg dose cohort); (iv) one patient with neuroendocrine cancer (enrolled in Part IB 8 pg dose cohort); and (II) two patients had unconfirmed PRs: (i) one patient with head and neck cancer (enrolled in Part 1 A, 0. 1 pg dose cohort); and (ii) one patient with melanoma (Part IB 3pg dose cohort). The duration of response (DoR) was 1.9-22.3 months, and the median had not been reached at the time of the data cutoff (the DoR is defined as the duration from the date of first documentation of OR according to RECIST vl. 1 criteria to the first documented disease progression or death due to any cause, whichever occurs first; it is evaluated using the Kaplan-Meier method only for the subgroup of patients with an OR). Of the patients with confirmed PR, 3/5 had prior anti-PD-Ll or anti-PD-1 treatment. Of these 3 patients, 2/3 had received prior anti-CTLA-4 treatment. As of the data cutoff, 3 of the 5 patients with confirmed PR had ongoing PRs and 2 had stable disease. Overall, 15 (24.6%) patients had stable disease (including the two patients with unconfirmed PRs). The objective response rate was 8.2%. One PR in a patient with melanoma occurred early upon receiving huIL- 12_mRNA_01 alone. In correlative studies, this patient showed an increase in serum levels of IFNy and IL-12 and an inflammatory trans criptome.

Table 9: Disease Response

M = huIL-12_mRNA_01; D = durvalumab; objective response rate (ORR); complete response (CR); partial response (PR); stable disease (SD); disease control rate (DCR; CR+PR+SD >12 weeks); not applicable (NA); best overall response (BOR); confidence interval (CI)

Additionally, as shown in Table 10, abscopal disease response in target lesions was confirmed in all patients with confirmed and unconfirmed PRs at any dose level in the sequential and concurrent group. One patient with anal melanoma (sequential huIL- 12_mRNA_01 0.3 pg) had abscopal disease response in target lesions and non-target lesions (TL: cPR; NTL: CR). Table 10: Abscopal Disease Response in Target Lesions

M = huIL-12_mRNA_01; D = durvalumab; Seq = sequential; Con = concurrent; cPR, confirmed partial response; CR, complete response; Dx, durvalumab cycle; HNSCC, head and neck squamous cell carcinoma; IO, immunotherapy; LN, lymph node;

Mx, huIL-12_mRNA_01 cycle; NTL, non-target lesion; SC, subcutaneous; TL, target lesion; TNBC, triple-negative breast cancer; uPR, unconfirmed partial response

In summary, anti-tumor activity was observed in the target lesion and local or distant non-target lesions, with responses observed in a variety of tumor types. The responses were also durable (i.e., median duration of response was not reached).

Claims

1. A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of a lipid nanoparticle (LNP) encapsulated messenger RNA (mRNA) therapeutic agent, wherein the mRNA therapeutic agent comprises an open reading frame (ORF) encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered a dose of 0. l-12.0pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives a PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

2. The method of claim 1, wherein the dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0μg; 0.1 to 3.0μg; 0.1-1.0μg; 0.1-0.3pg; 0.3 to 12.0μg; 0.3 to 8.0μg; 0.3 to 3.0 pg; 0.3 to l.0μg; 1.0 to 12.0μg; 1.0 to 8.0μg; 1.0 to 3.0μg; 3.0 to 12.0μg; 3.0 to 8.0μg; and 8.0 to 12.0pg.

3. The method of claim 1, wherein the dose of the mRNA therapeutic agent is from 1.0 to 8.0μg.

4. The method of claim 1, wherein the dose of the mRNA therapeutic agent is 0.10μg.

5. The method of claim 1, wherein the dose of the mRNA therapeutic agent is 0.30pg.

6. The method of claim 1, wherein the dose of the mRNA therapeutic agent is l.0μg.

7. The method of claim 1, wherein the dose of the mRNA therapeutic agent is 3.0μg.

8. The method of claim 1, wherein the dose of the mRNA therapeutic agent is 8.0μg.

9. The method of claim 1, wherein the dose of the mRNA therapeutic agent is 12.0μg.

10. The method of any one of claims 1-9, further comprising administering to the patient at least one additional dose of 0.1 -12.0μg of the mRNA therapeutic agent.

11. The method of claim 10, wherein the at least one additional dose is administered to the patient 7-28 days, 7-21 days, 7-14 days, 14-28 days, 14-21 days, 21-28 days, 28 days, 21 days, 14 days or 7 days after the dose of the mRNA therapeutic.

12. The method of any one of claims 1-9, wherein the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent.

13. The method of claim 12, wherein the patient receives the PD-L1 antagonist 21 days after the dose of the mRNA therapeutic agent.

14. The method of any one of claims 10-11, wherein the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the additional dose of the mRNA therapeutic agent.

15. The method of claim 14, wherein the patient receives the PD-L1 antagonist 21 days after the additional dose of the mRNA therapeutic agent.

16. The method of any one of claims 12-15, wherein the patient receives the PD-L1 antagonist once every four weeks.

17. The method of any one of claims 1-9, wherein the patient receives the PD-L1 antagonist on the same day as receiving the dose of the mRNA therapeutic agent.

18. The method of claim 10 or 11, wherein the patient receives the PD-L1 antagonist on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose.

19. The method of claim 18, wherein the at least one additional dose of the mRNA therapeutic agent is administered to the patient in a dosing cycle of every 28 days for 8 weeks.

20. The method of claim 19, wherein the at least one additional dose of the mRNA therapeutic agent is administered to the patient every 8 weeks after the dosing cycle, and the patient receives the PD-L1 antagonist every 4 weeks after the dosing cycle.

21. The method of any one of claims 1-20, wherein the dose achieves a human plasma IL- 12p70 maximum peak of about 3-5 pg/mL in the patient.

22. The method of any one of claims 1-21, wherein the dose achieves a human plasma IL- 12p70 maximum peak of about 3-450 pg/mL.

23. The method of any one of claims 1-22, wherein the dose achieves a human plasma IFNy maximum peak of about 3-3100 pg/mL.

24. The method of any one of claims 1-23, wherein the patient comprises at least two malignant lesions, wherein one malignant lesion is an injected malignant lesion and one malignant lesion is anon-injected malignant lesion.

25. The method of claim 24, wherein treatment results in a reduction in malignant lesion size.

26. The method of claim 25, wherein the size of a malignant lesion is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.

27. The method of claim 26, wherein the malignant lesion is reduced by at least 30%.

28. The method of claim 24, wherein treatment results in a reduction in size of the noninjected malignant lesion.

29. The method of claim 28, wherein the size of the non-injected malignant lesion is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.

30. The method of any one of claims 25-29, wherein malignant lesion size is determined by imaging or visual inspection.

31. The method of any one of claims 25-30, wherein malignant lesion size is determined by RECIST v 1.1.

32. The method of any one of claims 25-31, wherein the malignant lesion is a cutaneous, a subcutaneous, or a deep-seated malignant lesion.

33. The method of claim 32, wherein the malignant lesion is a deep-seated tumor lesion, and wherein the dose, and optionally at least one additional dose, is administered to the deep- seated malignant lesion via image guided-injection.

34. The method of any one of claims 1-33, wherein the PD-L1 antagonist is an anti-PD-1 antibody or an anti-PD-Ll antibody.

35. The method of claim 34, wherein the anti-PD-1 antibody is selected from nivolumab, pembrolizumab, and cemiplimab.

36. The method of claim 34, wherein the anti-PD-Ll antibody is selected from atezolizumab, avelumab, durvalumab, and envafolimab

37. The method of any one of claims 1-34, wherein the PD-L1 antagonist is durvalumab.

38. The method of any one of claims 34-37, wherein the patient receives the PD-L1 antagonist intravenously.

39. The method of any one of claims 34-38, wherein the patient receives the PD-L1 antagonist at a dose of 1500mg.

40. The method of any one of claims 1-33, wherein the PD-L1 antagonist is durvalumab, and wherein the patient receives durvalumab at a dose of 1500mg every 4-8 weeks.

41. The method of any one of claims 1-9, further comprising administering to the patient an additional dose of 0. 1 - 12.0pg of the mRNA therapeutic agent, wherein the at least one additional dose is administered 21 days after the dose, wherein the PD-L1 antagonist is durvalumab, and wherein the patient receives durvalumab intravenously at a dose of 1500mg every 4 weeks after administration of the additional dose of the mRNA therapeutic agent.

42. The method of claim 41, wherein the patient receives durvalumab 21 days after the additional dose of the mRNA therapeutic agent is administered.

43. The method of any one of claims 1-9, further comprising administering to the patient:

(i) at least one additional dose of 0. 1 - 12.0pg of the mRNA therapeutic agent in a first dosing cycle comprising administering the at least one additional dose every 28 days for 8 weeks, and

(ii) at least one additional dose of 0. l-12.0pg of the mRNA therapeutic agent in a second dosing cycle comprising administering the at least one additional dose every 8 weeks for a specified period of time, wherein the additional doses of the mRNA therapeutic agent are the same or different, wherein the PD-L1 antagonist is durvalumab, and wherein the patient receives durvalumab intravenously at a dose of 1500mg every 4 weeks starting on the same day as the dose of the mRNA therapeutic agent.

44. The method of any one of claims 1-43, wherein the advanced or metastatic solid tumor malignancy is selected from melanoma, breast cancer, head and neck cancer, non- small-cell lung cancer, colorectal cancer, gastric cancer, and bladder cancer.

45. The method of claim 44, wherein the advanced or metastatic solid tumor malignancy is head and neck cancer.

46. The method of any one of claims 1-45, wherein the advanced or metastatic solid tumor malignancy is refractory to immune checkpoint inhibitor (CPI) therapy.

47. The method of claim 46, wherein the advanced or metastatic solid tumor malignancy is CPI-refractory melanoma.

48. The method of claim 46 or 47, wherein immune CPI therapy is PD-1 inhibition, PD- L1 inhibitor, or CTLA-4 inhibition.

49. A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered an initial dose of 0. 1 - 12.0pg of the mRNA therapeutic agent, and optionally an additional dose of 0.1-12.0pg of the mRNA therapeutic agent, wherein the patient receives a PD-L1 antagonist every 4 weeks after administration of the initial dose, or optional additional dose, of the mRNA therapeutic agent, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

50. The method of claim 49, wherein the patient is administered an initial dose of 0. 1 pg of the mRNA therapeutic agent.

51. The method of claim 49 or 50, wherein the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after administration of the initial dose.

52. The method of claim 51, wherein the patient receives the PD-L1 antagonist 21 days after administration of the initial dose.

53. The method of claim 49 or 50, wherein the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after administration of the additional dose.

54. The method of claim 53, wherein the patient receives the PD-L1 antagonist 21 days after administration of the additional dose

55. The method of any one of claims 49-54, wherein the patient is administered the additional dose 28 days, 21 days, 14 days, or 7 days after the initial dose.

56. The method of claim 55, wherein the patient is administered the additional dose 21 days after the initial dose.

57. The method of any one of claims 49-56, wherein the PD-L1 antagonist is durvalumab.

58. The method of claim 57, wherein the patient receives durvalumab at a dose of 1500mg every four weeks.

59. The method of claim 57 or 58, wherein the patient receives durvalumab intravenously.

60. The method of any one of claims 49-59, wherein the advanced or metastatic solid tumor malignancy is head and neck cancer.

61. A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 poly peptide, wherein the patient is administered an initial dose of 1.0-8.0μg of the mRNA therapeutic, and optionally (i) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose ever}' 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

62. A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 poly peptide, wherein the patient is administered an initial dose of 1.0- 12.0μg of the mRNA therapeutic, and optionally (i) at least one additional dose of 1.0-12.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-12.0 ,g of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

63. The method of claim 61 or 62, wherein the initial and optional additional doses are 3 ug of the mRNA therapeutic agent.

64. The method of any one of claims 61-63, comprising administering to the patient (i) the at least one additional dose every 28 days in the first dosing cycle for 8 weeks, and (ii) the least one additional dose every 8 weeks in the second dosing cycle for the specified period of time.

65. The method of claim 64, wherein the first dosing cycle comprises three doses 28 days apart.

66. The method of any one of claims 61-65, wherein the PD-L1 antagonist is durvalumab.

67. The method of claim 66, wherein the patient receives durvalumab at a dose of 1500mg every four weeks.

68. The method of claim 66 or 67, wherein the patient receives durvalumab intravenously.

69. The method of any one of claims 61-68, wherein the advanced or metastatic solid tumor malignancy CPI-refractory melanoma.

70. The method of any one of claims 49-64, wherein the patient comprises two or more malignant lesions, and wherein the size of at least one non-injected malignant lesion is reduced by at least 30%.

71. The method of any one of claims 1-70, wherein the patient has received at least one treatment prior to administering the mRNA therapeutic.

72. The method of claim 71, wherein the at least one treatment is selected from surgery', chemotherapy, radiation, and immunotherapy.

73. The method of any one of claims 1-72, wherein administering the mRNA therapeutic agent does not result in an adverse event to discontinue treatment.

74. The method of any one of claims 1-73, wherein administering the mRNA therapeutic agent is tolerated in a patient.

75. The method of any one of claims 1-74, wherein treatment results in stable disease, a partial response, or a complete response in the patient.

76. The method of claim 75, wherein treatment results in stable disease for at least 12 weeks in the patient.

77. The method of any one of claims 1-76, wherein treatment results in increased survival of the patient.

78. The method of any one of claims 1-77, wherein the mRNA therapeutic agent increases IL-12 and/or IFNy protein expression in the serum or plasma of the patient.

79. The method of any one of claims 1-78, wherein the mRNA therapeutic agent increases expression of one or more IFNy-inducible chemokines in the serum or plasma of the patient.

80. The method of claim 79, wherein the one or more IFNy-inducible chemokines is elected from CXCL9, CXCL10, CXCL11 and a combination thereof.

81. The method of any one of claims 1-80, wherein the mRNA therapeutic agent increases expression of one or more mediators of CD8+ T cell activity in the serum or plasma of the patient.

82. The method of claim 81, wherein the one or more mediators are selected from granzyme B, perforin, IFNy, IL 12 receptor, CD38, and a combination thereof.

83. The method of claim 81 or 82, wherein the increase positively correlates with expression of CD8a in the serum or plasma of the patient.

84. The method of any one of claims 1-83, wherein the mRNA therapeutic agent increases intratumoral CD8+ T cell levels in the patient.

85. The method of any one of claims 1-84, wherein the mRNA therapeutic agent increases PD-L1 expression in tumor epithelium of the patient.

86. The method of any one of claims 1-85, wherein the mRNA therapeutic agent increases intratumoral T cell proliferation in the patient.

87. The method of any one of claims 1-86, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of CD8+ T cell activity.

88. The method of claim 87, wherein the one or more mediators are selected from granzyme B, perforin, IFNy, IL 12 receptor, CD38, and a combination thereof.

89. The method of claim 87 or 88, wherein the increase positively correlates with intratumoral expression of CD8a.

90. The method of any one of claims 1-89, wherein the mRNA therapeutic agent increases intratumoral expression of one or more IFNy-inducible chemokines.

91. The method of claim 90, wherein the one or more IFNy-inducible chemokines are selected from CXCL9, CXCL10, CXCL11, and a combination thereof.

92. The method of claim 1-91, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of a Thl response.

93. The method of claim 92, wherein the one or more mediators of a Thl response are selected from T-Box Transcription Factor 21 (TBX21), Signal Transducer And Activator Of Transcription 4 (STAT4), CXCR3, and a combination thereof.

94. The method of any one of claims 1-93, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of dendritic cell activation.

95. The method of claim 94, wherein the one or more mediators are selected from CD80, CD83, CD86, and a combination thereof.

96. The method of any one of claims 1-95, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of natural killer (NK) cell activation.

97. The method of claim 96, wherein the one or more mediators are selected from KLRBl, KLRK1, and a combination thereof.

98. The method of any one of claims 1 -97, wherein the mRNA therapeutic agent increases intratumoral expression of one or more mediators of antigen presenting cells.

99. The method of claim 98, wherein the one or more mediators is selected from IFNy Receptor 1 (IFNGR1), IFNGR2, and a combination thereof.

100. A kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at a dose of 0. 1 - 12.0pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives a PD-L1 antagonist, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a linked monomeric human IL-12p70 polypeptide.

101. The kit of claim 100, wherein the container comprises a vial comprising 0.8mL of a dispersion comprising the LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable buffer.

102. The kit of claim 100 or 101, wherein the dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0pg; 0.1 to 3.0pg; 0.1-1.0pg; 0.1-0.3pg; 0.3 to 12.0pg; 0.3 to 8.0pg; 0.3 to 3.0pg; 0.3 to l.0μg; 1.0 to 12.0pg; 1.0 to 8.0pg; 1.0 to 3.0pg; 3.0 to 12.0pg; 3.0 to 8.0pg; and 8.0 to 12.0pg.

103. The kit of claim 100 or 101, wherein the dose of the mRNA therapeutic agent is O. l0μg, 0.30pg, l.0μg, 3.0pg, 8.0pg, or 12.0pg.

104. The kit of any one of claims 100-103, wherein treatment further comprises administering at least one additional dose of the mRNA therapeutic agent to the patient.

105. The kit of claim 104, wherein treatment comprises administering the at least one additional dose 7-28 days, 7-21 days, 7-14 days, 14-28 days, 14-21 days, 21-28 days, 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent.

106. The kit of any one of claims 100-103, wherein the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent.

107. The kit of any one of claims 104-105, wherein the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the dose or the at least one additional dose of the mRNA therapeutic agent.

108. The kit of claim 106 or 107, wherein the patient receives the PD-L1 antagonist once every four weeks.

109. The kit of any one of claims 100-103, wherein the patient receives the PD-L1 antagonist on the same day as receiving the dose of the mRNA therapeutic agent.

110. The kit of any one of claims 104-105, wherein the patient receives the PD-L1 antagonist on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose.

111. The kit of claim 110, wherein treatment comprises administering the at least one additional dose of the mRNA therapeutic agent is administered to the patient in a dosing cycle of every 28 days for 8 weeks.

112. The kit of claim 111, wherein treatment comprises administering the at least one additional dose of the mRNA therapeutic agent is administered to the patient every 8 weeks after the dosing cycle, and the patient receives the PD-L1 antagonist every 4 weeks after the dosing cycle.

113. A kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 0. 1 - 12. dug of the mRNA therapeutic agent, and optionally at least one additional dose of 0. 1 - I2,()pg of the mRNA therapeutic agent, wherein the patient subsequently receives a PD-L1 antagonist every 4 weeks after administration of the initial dose, or optional additional dose, of the mRNA therapeutic agent, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a linked monomeric human IL-12p70 polypeptide.

114. A kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 1.0-8.0pg of the mRNA therapeutic agent, and optionally (i) at least one additional dose of 1.0-8.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 1.0-8.0pg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a linked monomeric human IL-12p70 polypeptide.

115. A kit comprising a container comprising a pharmaceutical composition comprising: an LNP encapsulated mRNA therapeutic agent, and a pharmaceutically acceptable carrier, and instructions for use in treating advanced or metastatic solid tumor malignancy in a human patient, wherein the treatment comprises administration of the pharmaceutical composition by intratumoral injection at an initial dose of 0. 1- 12.0ug of the mRNA therapeutic agent, and optionally (i) at least one additional dose of 0. 1-12.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administration of the at least one additional dose every 28 days for a specified period of time, and (ii) at least one additional dose of 0. l-12.0pg of the mRNA therapeutic agent in a second dosing cycle comprising administration of the at least one additional dose every 8 weeks for a specified period of time, wherein the patient receives a PD-L1 antagonist on the same day as the initial dose of the mRNA therapeutic agent and every 4 weeks thereafter, and wherein the LNP encapsulated mRNA therapeutic agent comprising an mRNA encoding a linked monomeric human IL-12p70 polypeptide.

116. The kit of any one of claims 100-115, wherein the PD-L1 antagonist is durvalumab.

117. The kit of claim 116, wherein the patient receives durvalumab at a dose of 1500mg.

118. The kit of any one of claims 100-117, wherein the advanced or metastatic solid tumor malignancy is selected from melanoma, breast cancer, head and neck cancer, non-small-cell lung cancer, colorectal cancer, gastric cancer, and bladder cancer.

119. The kit of claim 118, wherein the advanced or metastatic solid tumor malignancy is refractory to CPI therapy.

120. The method or kit of any one of claims 1-119, wherein the linked monomeric human IL-12p70 polypeptide comprises an IL-12A polypeptide operably linked, with or without a linker, to an IL-12B polypeptide.

121. The method or kit of claim 120, wherein the IL-12A polypeptide is operably linked to the IL-12A polypeptide without a linker.

122. The method or kit of claim 120, wherein the IL-12A polypeptide is operably linked to the IL-12A polypeptide with a linker.

123. The method or kit of any one of claims 120-122, wherein the linked monomeric human IL-12p70 polypeptide comprises a heterologous signal peptide.

124. The method or kit of any one of claims 120-122, wherein the linked monomeric human IL-12p70 polypeptide comprises a human IL-12B signal peptide.

125. The method or kit of claim 124, wherein the human IL-12B signal peptide comprises the amino acid sequence of SEQ ID NO: 8.

126. The method or kit of any one of claims 1-120, wherein the ORF comprises from 5’ to 3' a nucleotide sequence selected from the group consisting of:

127. The method of kit of claim 126, wherein the ORF comprises a nucleotide sequence encoding a signal peptide located at the 5’ terminus of the ORF.

128. The method or kit of claim 126 or 127, wherein the peptide linker is a Gly/Ser linker.

129. The method or kit of any one of claims 1-128, wherein the linked monomeric human IL-12p70 polypeptide comprises the amino acid sequence of SEQ ID NO: 5.

130. The method or kit of any one of claims 1-129, wherein the mRNA comprises (i) a 3’ untranslated region (UTR); (ii) a 5’ UTR; and (iii) a polyA tail.

131. The method or kit of claim 130, wherein the 3’ UTR comprises a miR-122-5p binding site.

132. The method or kit of claim 131, wherein the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 4.

133. The method or kit of any one of claims 130-132, wherein the 5’ UTR comprises the nucleotide sequence of SEQ ID NO: 3.

134. The method or kit of any one of claims 1-133, wherein the ORF comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 2, or wherein the ORF comprises the nucleotide sequence of SEQ ID NO: 2.

135. The method or kit of any one of claims 1-134, wherein the mRNA comprises a nucleotide sequence at least 90% identical to SEQ ID NO: 1, or wherein the mRNA comprises the nucleotide sequence of SEQ ID NO: 1.

136. The method or kit of any one of claims 1-135, wherein the mRNA comprises a modified nucleotide.

137. The method or kit of any one of claims 1-136, wherein the mRNA is fully modified with chemically-modified uridines.

138. The method or kit of any one of claims 1-136, wherein 100% of the uridines of the mRNA are chemically-modified uridines.

139. The method or kit of claim 137 or 138, wherein the chemically-modified uridines are N1 -methylpseudouridines (ml ).

140. The method or kit of any one of claims 1-139, wherein the LNP comprises an ionizable amino lipid, a phospholipid, a sterol, and a PEG-modified lipid.

141. The method or kit of claim 140, wherein the LNP comprises a molar ratio of about 20-60% ionizable amino lipid; 5-25% phospholipid; 25-55% sterol; and 0.5-15% PEG- modified lipid.

142. The method or kit of claim 141, wherein the LNP comprises (i) a molar ratio of about 40-60% ionizable amino lipid; 8-16% phospholipid; 30-45% sterol; and 1-5% PEG-modified lipid; or (ii) a molar ratio of about 45-65% ionizable amino lipid; 5-10% phospholipid; 25- 40% sterol; and 0.5-5% PEG-modified lipid.

143. The method or kit of any one of claims 140-142, wherein the ionizable lipid is Compound II, the phospholipid is DSPC, the sterol is cholesterol, and the PEG-modified lipid is PEG DMG.

144. The method of any one of claims 1 -43, 46, 48-68, 70-99 and 120-143 or the kit of any one of claims 100-117, and 119-143, wherein the advanced or metastatic solid tumor malignancy is selected from melanoma, head and neck cancer, colorectal cancer, breast cancer, pancreatic cancer, non-small-cell lung cancer, vulvar cancer, bladder cancer, gastric cancer, squamous cell carcinoma, anal cancer, pancreatic cancer, and cervical cancer.

145. The method or kit of claim 144, wherein the advanced or metastatic solid tumor malignancy comprises one or more metastases.

146. The method or kit of claim 145, wherein the one or more metastases are of the brain and/or liver.

147. An mRNA therapeutic agent for use in a method of treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human TL-12p70 polypeptide, wherein the patient is administered a dose of 0. 1 -12.0 pg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives a PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

148. A PD-L1 antagonist for use in a method of treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient an effective amount of the PD-L1 antagonist, wherein the patient is receiving, has received, or subsequently receives by intratumoral injection an effective amount of an LNP encapsulated mRNA therapeutic agent, wherein the mRNA therapeutic agent comprises an ORF encoding a linked monomeric human IL-12p70 polypeptide, wherein the patient is administered a dose of 0. 1-12.0 pg of the mRNA therapeutic agent, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

149. A method for treating an advanced or metastatic solid tumor malignancy in a human patient, comprising administering to the patient by intratumoral injection an effective amount of a lipid nanoparticle (LNP) encapsulated messenger RNA (mRNA) therapeutic agent, wherein the mRNA therapeutic agent comprises an open reading frame (ORF) encoding a human IL-12 polypeptide, wherein the patient is administered a dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the patient is receiving, has received, or subsequently receives a PD-L1 antagonist, thereby treating the advanced or metastatic solid tumor malignancy in the patient.

150. The method of claim 149, wherein the dose of the mRNA therapeutic agent is selected from: 0.1 to 8.0μg; 0.1 to 3.0μg; 0.1-1.0μg; 0.1-0.3pg; 0.3 to 12.0μg; 0.3 to 8.0μg; 0.3 to

3.0 pg; 0.3 to L0μg; 1.0 to 12.0μg; 1.0 to 8.0μg; 1.0 to 3.0μg; 3.0 to 12.0μg; 3.0 to 8.0μg; and 8.0 to 12.0pg.

151. The method of claim 149, wherein the dose of the mRNA therapeutic agent is from 1.0 to 8.0μg.

152. The method of claim 149, wherein the dose of the mRNA therapeutic agent is 0. 10pg.

153. The method of claim 149, wherein the dose of the mRNA therapeutic agent is 0.30pg.

154. The method of claim 149, wherein the dose of the mRNA therapeutic agent is l.0μg.

155. The method of claim 149, wherein the dose of the mRNA therapeutic agent is 3.0μg.

156. The method of claim 149, wherein the dose of the mRNA therapeutic agent is 8.0 g.

157. The method of claim 149, wherein the dose of the mRNA therapeutic agent is 12.0pg.

158. The method of any one of claims 149-157, further comprising administering to the patient at least one additional dose of 0. 1 - 12.0μg of the mRNA therapeutic agent.

159. The method of claim 158, wherein the at least one additional dose is administered to the patient 7-28 days, 7-21 days, 7-14 days, 14-28 days, 14-21 days, 21-28 days, 28 days, 21 days, 14 days or 7 days after the dose of the mRNA therapeutic.

160. The method of any one of claims 149-157, wherein the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the dose of the mRNA therapeutic agent.

161. The method of claim 1 0, wherein the patient receives the PD-L1 antagonist 21 days after the dose of the mRNA therapeutic agent.

162. The method of any one of claims 158-159, wherein the patient receives the PD-L1 antagonist 28 days, 21 days, 14 days, or 7 days after the additional dose of the mRNA therapeutic agent.

163. The method of claim 162, wherein the patient receives the PD-L1 antagonist 21 days after the additional dose of the mRNA therapeutic agent.

164. The method of any one of claims 160-163, wherein the patient receives the PD-L1 antagonist once every four weeks.

165. The method of any one of claims 149-157. wherein the patient receives the PD-L1 antagonist on the same day as receiving the dose of the mRNA therapeutic agent.

166. The method of claim 158 or 159, wherein the patient receives the PD-L1 antagonist on the same day as receiving the dose, the at least one additional dose, or the dose and the at least one additional dose.

167. The method of claim 166, wherein the at least one additional dose of the mRNA therapeutic agent is administered to the patient in a dosing cycle of every 28 days for 8 weeks.

168. The method of claim 167, wherein the at least one additional dose of the mRNA therapeutic agent is administered to the patient every 8 weeks after the dosing cycle, and the patient receives the PD-L1 antagonist every 4 weeks after the dosing cycle.

169. The method of any one of claims 149-168, wherein the dose achieves a human plasma IL-12p70 maximum peak of about 3-5 pg/mL in the patient.

170. The method of any one of claims 149-169, wherein the dose achieves a human plasma !L-12p70 maximum peak of about 3-450 pg/mL.

171. The method of any one of claims 149-170, wherein the dose achieves a human plasma IFNy maximum peak of about 3-3100 pg/mL.

172. The method of any one of claims 149-171, wherein the patient comprises at least two malignant lesions, wherein one malignant lesion is an injected malignant lesion and one malignant lesion is anon-injected malignant lesion.

173. The method of claim 172, wherein treatment results in a reduction in malignant lesion size.

174. The method of claim 173, wherein the size of a malignant lesion is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.

175. The method of claim 175, wherein the malignant lesion is reduced by at least 30%.

176. The method of claim 172, wherein treatment results in a reduction in size of the noninjected malignant lesion.

177. The method of claim 176, wherein the size of the non-injected malignant lesion is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.

178. The method of any one of claims 173-177, wherein malignant lesion size is determined by imaging or visual inspection.

179. The method of any one of claims 173-178, wherein malignant lesion size is determined by RECIST vl. l.

180. The method of any one of claims 173-179, wherein the malignant lesion is a cutaneous, a subcutaneous, or a deep-seated malignant lesion.

181. The method of claim 180, wherein the malignant lesion is a deep-seated tumor lesion, and wherein the dose, and optionally at least one additional dose, is administered to the deep- seated malignant lesion via image guided-injection.

182. The method of any one of claims 149-181, wherein the PD-L1 antagonist is an anti- PD-1 antibody or an anti-PD-Ll antibody.

183. The method of claim 182, wherein the anti-PD-1 antibody is selected from nivolumab, pembrolizumab, and cemiplimab.

184. The method of claim 182, wherein the anti-PD-Ll antibody is selected from atezolizumab, avelumab, durvalumab, and envafolimab.

185. The method of any one of claims 149-182, wherein the PD-L1 antagonist is durvalumab.

186. The method of any one of claims 182-185. wherein the patient receives the PD-L1 antagonist intravenously.

187. The method of any one of claims 182-186. wherein the patient receives the PD-L1 antagonist at a dose of 1500mg.

188. The method of any one of claims 149-181. wherein the PD-L1 antagonist is durvalumab, and wherein the patient receives durvalumab at a dose of 1500mg every 4-8 weeks.

189. The method of any one of claims 149-1 7. further comprising administering to the patient an additional dose of 0. 1-12.0μg of the mRNA therapeutic agent, wherein the at least one additional dose is administered 21 days after the dose, wherein the PD-L1 antagonist is durvalumab, and wherein the patient receives durvalumab intravenously at a dose of 1500mg every 4 weeks after administration of the additional dose of the mRNA therapeutic agent.

190. The method of claim 189, wherein the patient receives durvalumab 21 days after the additional dose of the mRNA therapeutic agent is administered.

191. The method of any one of claims 149-157, further comprising administering to the patient:

(i) at least one additional dose of 0. 1 - 12.0μg of the mRNA therapeutic agent in a first dosing cycle comprising administering the at least one additional dose every 28 days for 8 weeks, and

192. The method of any one of claims 149-191. wherein the advanced or metastatic solid tumor malignancy is selected from melanoma, head and neck cancer, colorectal cancer, breast cancer, pancreatic cancer, non-small-cell lung cancer, vulvar cancer, bladder cancer, gastric cancer, squamous cell carcinoma, anal cancer, pancreatic cancer, and cervical cancer.

193. The method of claim 192, wherein the advanced or metastatic solid tumor malignancy is head and neck cancer.

194. The method of any one of claims 149-193, wherein the advanced or metastatic solid tumor malignancy is refractory to immune checkpoint inhibitor (CPI) therapy.

195. The method of claim 194, wherein the advanced or metastatic solid tumor malignancy is CPI-refractory melanoma.

196. The method of claim 194 or 195, wherein immune CPI therapy is PD-1 inhibition, PD-L1 inhibitor, or CTLA-4 inhibition.