WO2011076143A1

WO2011076143A1 - Compositions and methods for microrna expression profiling of lung cancer

Info

Publication number: WO2011076143A1
Application number: PCT/CN2010/080237
Authority: WO
Inventors: Jian Li; Ying Wu; Shaohua Lu; Hongguang Zhu; Wei Huang; Yiping Ren; Zhaoyong Li
Original assignee: Fudan University
Priority date: 2009-12-24
Filing date: 2010-12-24
Publication date: 2011-06-30

Abstract

The invention provides diagnostic kits comprising a plurality of nucleic acid molecules encoding microRNA sequences for identifying one or more mammalian target cells exhibiting or having a predisposition to develop lung cancer. The nucleic acid molecules encoding microRNA sequences are differentially expressed in target cells and in control cells. The invention further provides methods for identifying mammalian target cells exhibiting or having a predisposition to develop lung cancer using said microRNAs, and methods and pharmaceutical compositions for preventing or treating lung cancer.

Description

COMPOSITIONS AND METHODS FOR MICRORNA EXPESSION PROFILING OF LUNG CANCER

FIELD OF THE INVENTION

The present invention relates to compositions and methods for microRNA expression profiling of lung cancer, particularly for adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer. BACKGROUND OF THE INVENTION

Lung cancer remains the most common cause of cancer-related deaths among man and woman worldwide. There estimated to 1.4 million new cases in 2009 with average annual increase for 2.51% (Frost & Sullivan estimates) and the majority of patients diagnosed with lung cancer in 2009 will die of their disease (Higgins, M.J. et al. (2009) Expert Rev Anticancer Ther 9, 1365-1378). Despite some improvements in surgical techniques and combined therapies over the last several decades, the five-year survival rate for all stages combined is about 15% in the United States and Europe.

Lung cancers are classified as either small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC). The predominant (>80%) histological form of lung cancer is NSCLC including adenocarcinoma and squamous-cell carcinoma. Cigarette smoking is the most important risk factor for lung cancer, accounting for about 80% of lung cancer cases in men and 50% in women worldwide.

Treatment for lung cancer differs according to the subtype of cancer. The treatment of choice for early stage NSCLC is surgery with a 5 year overall survival of 40%. However, a majority of patients are at an advanced disease stage at the time of diagnosis, which limits first-line therapy to multi-agent chemotherapy and an expected survival is less than 8 months. Recent advances in targeted therapies require greater accuracy in the subclassification of non-small-cell lung cancer (NSCLC). Inhibitors of tumor angiogenesis pose higher risk for adverse response in cases of squamous cell carcinoma (Lebanoy, D. (2009) / Clin Oncol 27, 2030-2037). Small cell lung cancer (SCLC) is the most deadly form of the disease, with a case-fatality rate greater than 90%. Despite often observed high, initial response rates, patients with limited-stage disease have a median survival of approximately 20 months. There is rarely a role for surgery in the management of SCLC and chemotherapy alone or combined with radiation is the choice of treatment.

Besides the different treatments on the different subtypes and etiologies of lung cancer, the inter- observer variability and the lack of specific, standardized assays also limit the current abilities to adequately stratify patients for suitable treatments. Treatment decisions for an individual patient with lung cancer will soon be based on detailed tumor and host characteristics. Specific molecular biomarkers to differentiate subtypes of lung cancers are definitely needed.

Many diagnostic assays are also hampered by the fact that they are typically based on the analysis of only a single molecular marker, which might affect detection reliability and/or accuracy. In addition, a single marker normally does not enable detailed predictions concerning latency stages, tumor progression, and the like. Thus, there is still a continuing need for the identification of alternative molecular markers and assay formats overcoming these limitations.

One approach to address this issue might be based on small regulatory RNA molecules, in particular on microRNAs (miRNAs) which, constitute an evolutionary conserved class of endogenously expressed small non-coding RNAs of 20-25 nucleotides (nt) in size that can mediate the expression of target mRNAs and thus - since their discovery about ten years ago - have been implicated with critical functions in cellular development, differentiation, proliferation, and apoptosis (Bartel, D.P. (2004) Cell 116, 281-297, Ambros, V. (2004) Nature 431, 350-355; He, L. et al. (2004) Nat Rev Genet 5, 522-531). Furthermore, miRNAs have advantages over mRNAs as cancer biomarkers, since they are very stable in vitro and long-lived in vivo (Lu, J. et al., (2005) Nature 435, 834-838; Lim, L.P. et al., (2005) Nature 433, 769-773).

MiRNAs are produced from primary transcripts that are processed to stem-loop structured precursors (pre-miRNAs) by the RNase III Drosha. After transport to the cytoplasm, another RNase III termed Dicer cleaves of the loop of the pre-miRNA hairpin to form a short double-stranded (ds) RNA, one strand of which is incorporated as mature miRNA into a miRNA-protein (miRNP). The miRNA guides the miRNPs to their target mRNAs where they exert their function (Bartel, D.P. (2004) Cell 23, 281- 292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531). Depending on the degree of complementarity between the miRNA and its target, miRNAs can guide different regulatory processes. Target mRNAs that are highly complementary to miRNAs are specifically cleaved by mechanisms identical to RNA interference (RNAi). Thus, in such scenario, the miRNAs function as short interfering RNAs (siRNAs). Target mRNAs with less complementarity to miRNAs are either directed to cellular degradation pathways or are translationally repressed without affecting the mRNA level. However, the mechanism of how miRNAs repress translation of their target mRNAs is still a matter of controversy.

High-throughput miRNA quantification technologies, such as miRNA microarray, real-time RT-PCR-based TaqMan miRNA assays, have provided powerful tools to study the global miRNA profile in whole cancer genome. Emerging data available indicate that dysregulation of miRNA expression may inter alia be associated with the development and/or progression of certain types of cancer. For example, two miRNAs, miR-15 and miR-16-1, were shown to map to a genetic locus that is deleted in chronic lymphatic leukemia (CLL) and it was found that in about 70% of the CLL patients, both miRNA genes are deleted or down-regulated. Furthermore, down- regulation of miR-143 and miR-145 was observed in colorectal neoplasia, whereas expression of the miRNA let-7 is frequently reduced in lung cancers (Michael, M.Z. et al. (2003) Mol Cancer Res 1, 882-891; Mayr, C. et al. (2007) Science 315, 1576-1579). In fact, it has been speculated based on cancer-associated alterations in miRNA expression and the observation that miRNAs are frequently located at genomic regions involved in cancers that miRNAs may act both as tumor suppressors and as oncogenes (Esquela-Kerscher, A. and Slack, F.J (2006) Nat Rev Cancer 6, 259-269; Calin, G.A. and Croce, CM. (2007) / Clin Invest 117, 2059-2066; Blenkiron, C. and Miska, E.A. (2007) Hum Mol Genet 16, R106-R113). Demonstrated abnormal expression patterns of miRNAs in human cancers highlight their potential use as diagnostic and prognostic biomarkers.

Several studies have reported miRNA expression profiling in human lung cancer (Johnson, S.M. et al. (2005) Cell 120, 635-647; Liang, Y. et al. (2008) BMC Med Genomics 1, 61; Kumar, M.S. et al. (2008) Proc Natl Acad Sci USA 105, 3903-3908; Miko, E. et al. (2009) Exp Lung Res 35, 646-664; Xie, Y et al. (2009 ) Lung Cancer May 13; Lebanony, D. et al. (2009) / Clin Oncol 27, 2030-2037; Kauppinen, S. et al. (2009) Clin Cancer Res 15, 1177-1183; Mascaux, C. et al. (2009) Eur Respir J 33, 352-359). Consistently, these studies have shown that specific miRNAs are aberrantly expressed in malignant tissues as compared to nonmalignant lung tissue. Moreover, studies found that some miRNAs may be related to prognosis (Yu, S.L. et al. (2008) Cancer Cell 13, 48-57; Raponi, M. et al (2009) Cancer Res 69, 5776-5783). Thus, such miRNAs may provide insights into cellular processes involved in the malignant transformation and progression.

Thus, there still remains a need for (a set of) diagnostic markers, particularly in form of a "expression signature" or a "molecular footprint", that enable the rapid, reliable and cost-saving identification and/or treatment of cells exhibiting or having a predisposition to develop different types of lung cancer. In addition, there is also a continuing need for corresponding methods both for the identification and for the treatment of target cells displaying such a cancerous phenotype. OBJECT AND SUMMARY OF THE INVENTION

It is an objective of the present invention to provide novel approaches for diagnosing and/or treating lung cancer and/or the predisposition for developing such a condition by determining a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA (miRNA) sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells analyzed as compared to healthy control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of or the predisposition to develop lung cancer.

More specifically, it is an object of the invention to provide nucleic acid expression signatures and/or compositions for identifying one or more mammalian target cells exhibiting or having the predisposition to develop lung cancer and/or discriminating different types of lung cancer. The different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.

Furthermore, it is an object of the invention to provide corresponding methods for identifying one or more mammalian target cells exhibiting or having a predisposition to develop lung cancer, discriminating different types of lung cancer as well as for preventing or treating such a condition.

These objectives as well as others, which will become apparent from the ensuing description, are attained by the subject matter of the independent claims. Some of the preferred embodiments of the present invention are defined by the subject matter of the dependent claims.

In a first aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting or having a predisposition to develop lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of lung cancer and/or the predisposition to develop lung cancer.

The nucleic acid expression signature, as defined herein, may comprises at least eighty-two nucleic acid molecules, preferably at least thirteen nucleic acid molecules, and particularly preferably at least seven nucleic acid molecules.

In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.

In preferred embodiments, the nucleic acid expression signature comprises nucleic acid molecules encoding hsa-miR-183, hsa-miR-451, hsa-miR-126, hsa-miR- 126*, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa- miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-218, hsa-miR-139-5p, hsa- miR-130b, hsa-miR-30a*, hsa-miR-144*, hsa-miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR-187*, hsa-miR-30b, hsa-miR-93, hsa-miR-145*, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-625, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR- 98, hsa-miR-1, hsa-miR-106b, hsa-miR-150*, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b*, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa- miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-100, hsa-miR-223, hsa- miR-196b, hsa-miR-196a, hsa-miR-1226*, hsa-miR-424, hsa-miR-21*, hsa-miR-572, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-224, hsa- miR-125a-3p, hsa-miR-9, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa- miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150, hsa- miR-205, hsa-miR-192, hsa-miR-215 and hsa-miR- 106a.

Particular preferably, the expression of the nucleic acid molecules encoding hsa- miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa- miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR-98, hsa-miR-106b, hsa- miR-25, hsa-miR-200b*, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-196b, hsa-miR-196a, hsa-miR-424, hsa-miR-21*, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa- miR-192, hsa-miR-215, hsa-miR-106a is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-145, hsa-miR- 140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR- 338-3p, hsa-miR-218, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-133b, hsa-miR-497, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa- miR-1226*, hsa-miR-572, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR- 199b-5p, hsa-miR- 125a-3p, hsa-miR-195, hsa-miR-142-5p and hsa-miR-150 is down-regulated in the in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises nucleic acid molecules encoding hsa-miR- 183, hsa-miR-451, hsa-miR-126, hsa-miR- 126*, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa- miR-200c, hsa-miR-486-5p, hsa-miR-338-3p and hsa-miR-218.

Particular preferably, the expression of the nucleic acid molecules encoding hsa- miR-183, hsa-miR-96 and hsa-miR-200c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-126, hsa-miR- 126*, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR-338-3p and hsa-miR-218 is down-regulated in the in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-451, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-145 and hsa-miR-140-3p.

Particular preferably, the expression of hsa-miR-183 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-145 and hsa-miR-140-3p is down- regulated in the one or more target cells compared to the one or more normal control cells.

In a second aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting or having a predisposition to develop non-small cell lung cancer, including squamous cell lung cancer and adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of or the predisposition to develop non-small cell lung cancer, including squamous cell lung cancer and adenocarcinoma lung cancer.

The nucleic acid expression signature, as defined herein, may comprise at least seventy nucleic acid molecules, preferably at least fourteen nucleic acid molecules, and particularly preferably at least nine nucleic acid molecules.

In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells. In preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-451, hsa- miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa- miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-139- 5p, hsa-miR-338-3p, hsa-miR-130b, hsa-miR-144*, hsa-miR-425, hsa-miR-133b, hsa- miR-182, hsa-miR-187*, hsa-miR-30b, hsa-miR-93, hsa-miR-145*, hsa-miR-429, hsa- miR-498, hsa-miR-200a, hsa-miR-625, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-98, hsa-miR-1, hsa-miR-150*, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa- miR-200b*, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-135b, hsa- miR-100, hsa-miR-424, hsa-miR-21*, hsa-miR-30a*, hsa-miR-494, hsa-miR-193b, hsa- miR-99a, hsa-miR-335, hsa-miR-106b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, hsa-miR-29c, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150, hsa-miR-205, hsa-miR-192 and hsa-miR-215.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR- 425, hsa-miR-182, hsa-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR- 98, hsa-miR-25, hsa-miR-200b*, hsa-miR-135b, hsa-miR-424, hsa-miR-21*, hsa-miR- 494, hsa-miR-193b, hsa-miR-106b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR- 210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa-miR-192, hsa-miR-215 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa- miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p and hsa-miR-139-5p, hsa-miR-338-3p, hsa-miR-144*, hsa-miR-133b, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR- 1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-30a*, hsa-miR-99a, hsa-miR-335, hsa- miR-140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 is down-regulated in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p and hsa- miR-139-5p.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-96, hsa-miR-200c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p and hsa-miR-139-5p is down-regulated in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145 and hsa-miR-140-3p.

Particular preferably, the expression of hsa-miR-183 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145 and hsa-miR-140-3p is down-regulated in the one or more target cells compared to the one or more normal control cells.

In a third aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting or having a predisposition to develop adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of or the predisposition to develop adenocarcinoma lung cancer.

The nucleic acid expression signature, as defined herein, may comprises at least fifty-seven nucleic acid molecules, preferably at least thirteen nucleic acid molecules, and particularly preferably at least five nucleic acid molecules. In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.

In preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-126, hsa- miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-21, hsa-miR-183, hsa-miR-144, hsa- miR-451, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-130b, hsa-miR-30a*, hsa-miR-144*, hsa- miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR-187*, hsa-miR-30b, hsa- miR-145*, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-134, hsa-miR-638, hsa-miR-200b*, hsa-miR-1225-5p, hsa-miR-557, hsa-miR- 100, hsa-miR-223, hsa-miR-424, hsa-miR-21*, hsa-miR-99a, hsa-miR-34a, hsa-miR- 542-3p, hsa-miR-200a*, hsa-miR-375, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-224, hsa-miR-200b, hsa-miR-195, hsa-miR- 210, hsa-miR-7, hsa-miR-141 and hsa-miR-192.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR- 135b, hsa-miR-148a, hsa-miR-625, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa- miR-429, hsa-miR-200a, hsa-miR-200b*, hsa-miR-424, hsa-miR-21*, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a*, hsa-miR-375, hsa-miR-224, hsa-miR-200b, hsa-miR- 210, hsa-miR-7, hsa-miR-141, hsa-miR-192 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-126, hsa-miR-126*, hsa- miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-133b, hsa-miR-497, hsa-miR- 187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa- miR-134, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-99a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR- 140-5p, hsa-miR-195 is down-regulated in the one or more target cells compared to the one or more normal control cells. In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-126, hsa- miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-21, hsa-miR-183, hsa-miR-144, hsa- miR-451, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a and hsa-miR-625.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR- 135b, hsa-miR-148a, hsa-miR-625 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding sa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451 is down-regulated in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-126, hsa- miR-126*, hsa-miR-30a and hsa-miR-218.

Particular preferably, the expression of hsa-miR-96 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218 is down-regulated in the one or more target cells compared to the one or more normal control cells.

In a fourth aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting or having a predisposition to develop squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of or the predisposition to develop squamous cell lung cancer.

The nucleic acid expression signature, as defined herein, may comprises at least hundred- twelve nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least one nine nucleic acid molecules.

In preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa- miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-93, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-143, hsa-miR-103, hsa-miR-183, hsa-miR-96, hsa-miR-139-5p, hsa-miR-130b, hsa-miR-30a*, hsa-miR-144*, hsa-miR-425, hsa-miR-133b, hsa-miR-182, hsa-miR- 187*, hsa-miR-145*, hsa-miR-429, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-98, hsa-miR-1, hsa-miR-106b, hsa-miR-150*, hsa-miR-25, hsa-miR-134, hsa- miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR- 15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, hsa-miR-1226*, hsa-miR-424, hsa- miR-21*, hsa-miR-572, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa- miR-29c*, hsa-miR-494, hsa-miR-193b, hsa-miR-375, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-151-3p, hsa-miR-149, hsa-miR-768-5p, hsa-miR-181a, hsa-miR-20a, hsa- miR-181c, hsa-miR-29a, hsa-miR-29b, hsa-miR-505, hsa-miR-939, hsa-miR-769-5p, hsa-miR-30c, hsa-miR-590-5p, hsa-miR-590-5p, hsa-miR-671-5p, hsa-miR-625, hsa- miR-652, hsa-miR-139-3p, hsa-miR-28-5p, hsa-miR-623, hsa-miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-335, hsa-miR-125a-5p, hsa-miR-551b, hsa-let-7d*, hsa-miR- 31*, hsa-miR-362-5p, hsa-miR-18 la*, hsa-miR-940, hsa-miR-30b*, hsa-miR-601, hsa- miR-20b, hsa-miR-202, hsa-miR-101, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa- miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150 and hsa-miR-205

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-200c, hsa-miR-93, hsa-miR-103, hsa-miR-183, hsa-miR- 96, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-98, hsa-miR- 106b, hsa-miR-25, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, hsa- miR-424, hsa-miR-21*, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa- miR-494, hsa-miR-193b, hsa-miR-151-3p, hsa-miR-149, hsa-miR-20a, hsa-miR-505, hsa-miR-769-5p, hsa-miR-590-5p, hsa-miR-590-5p, hsa-miR-625, hsa-miR-28-5p, hsa- miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-31*, hsa-miR-362-5p, hsa-miR-20b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa- miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR- 140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-143, hsa- miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-133b, hsa-miR-187*, hsa-miR- 145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa- miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR- 557, hsa-miR-1226*, hsa-miR-572, hsa-miR-29c*, hsa-miR-375, hsa-miR-26a, hsa- miR-574-3p, hsa-miR-768-5p, hsa-miR-181a, hsa-miR-181c, hsa-miR-29a, hsa-miR- 29b, hsa-miR-939, hsa-miR-30c, hsa-miR-671-5p, hsa-miR-652, hsa-miR-139-3p, hsa- miR-623, hsa-miR-335, hsa-miR-125a-5p, hsa-miR-551b, hsa-let-7d*, hsa-miR-18 la*, hsa-miR-940, hsa-miR-30b*, hsa-miR-601, hsa-miR-202, hsa-miR-101, hsa-miR-140- 5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 is down- regulated in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa- miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-93, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-143 and hsa-miR-103.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-200c, hsa-miR-93, hsa-miR-103 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR- 145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa- miR-143 is down-regulated in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa- miR-145 and hsa-miR-140-3p.

Particular preferably, the expression of hsa-miR-200c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR- 145 and hsa-miR-140-3p is down-regulated in the one or more target cells compared to the one or more normal control cells.

In a fifth aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting or having a predisposition to develop small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of or the predisposition to develop small cell lung cancer.

The nucleic acid expression signature, as defined herein, may comprises at least hundred- sixteen nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least one one eleven nucleic acid molecules.

In preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-144, hsa- miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa-miR-375, hsa- miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-451, hsa-miR-130b, hsa-miR-454, hsa- miR-30a, hsa-miR-17, hsa-miR-183, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139- 5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR- 182, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-429, hsa-miR-498, hsa-miR- 200a, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-98, hsa-miR-1, hsa-miR-150*, hsa- miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b*, hsa-miR-1225-5p, hsa-miR- 1224-5p, hsa-miR-557, hsa-miR-152, hsa-miR-301a, hsa-miR-100, hsa-miR-223, hsa- miR-196b, hsa-miR-1226*, hsa-miR-572, hsa-miR-18b, hsa-miR-9*, hsa-miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a*, hsa-miR-26a, hsa-miR-574-3p, hsa- miR-768-5p, hsa-miR-29a, hsa-miR-29b, hsa-miR-505, hsa-miR-939, hsa-miR-769-5p, hsa-miR-625, hsa-miR-139-3p, hsa-miR-19a, hsa-miR-551b, hsa-miR-362-5p, hsa- miR-181a*, hsa-miR-940, hsa-miR-601, hsa-miR-20b, hsa-miR-23a, hsa-miR-27a, hsa- miR-199a-5p, hsa-let-7i, hsa-miR-19b, hsa-miR-20a*, hsa-miR-17*, hsa-miR-22, hsa- miR-340*, hsa-miR-214, hsa-miR-592, hsa-miR-335*, hsa-miR-29c*, hsa-miR-421, hsa-miR-886-3p, hsa-miR-16-2*, hsa-miR-135a, hsa-miR-183*, hsa-miR-7-1*, hsa- miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR-95, hsa-miR-564, hsa-miR-636, hsa- miR-34b*, hsa-miR-18a, hsa-miR-126, hsa-miR-126*, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p, hsa- miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-128 and hsa-miR-106a.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR-454, hsa-miR-17, hsa-miR-183, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-200a, hsa-miR-98, hsa-miR-200b*, hsa-miR-301a, hsa-miR-196b, hsa-miR-505, hsa-miR- 769-5p, hsa-miR-625, hsa-miR-19a, hsa-miR-362-5p, hsa-miR-20b, hsa-let-7i, hsa- miR-19b, hsa-miR-20a*, hsa-miR-17*, hsa-miR-340*, hsa-miR-592, hsa-miR-335*, hsa-miR-421, hsa-miR-16-2*, hsa-miR-135a, hsa-miR-183*, hsa-miR-7-1*, hsa-miR- 95, hsa-miR-18a, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-128 and hsa-miR-106a is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-145, hsa-miR-451, hsa-miR-30a, hsa- miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144, hsa-miR- 133b, hsa-miR-497, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa- miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-152, hsa- miR-100, hsa-miR-223, hsa-miR-1226*, hsa-miR-572, hsa-miR-18b, hsa-miR-9*, hsa- miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a*, hsa-miR-26a, hsa-miR- 574-3p, hsa-miR-768-5p, hsa-miR-29a, hsa-miR-29b, hsa-miR-939, hsa-miR-139-3p, hsa-miR-551b, hsa-miR-181a*, hsa-miR-940, hsa-miR-601, hsa-miR-23a, hsa-miR-27a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-214, hsa-miR-29c*, hsa-miR-886-3p, hsa- miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR-564, hsa-miR-636, hsa-miR-34b*, hsa-miR-126, hsa-miR-126*, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR- 140-5p, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p is down-regulated in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-144, hsa- miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa-miR-375, hsa- miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-451, hsa-miR-130b, hsa-miR-454, hsa- miR-30a, hsa-miR-17.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR-454, hsa-miR-17 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-145, hsa-miR-451, hsa-miR-30a is down- regulated in the one or more target cells compared to the one or more normal control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-144, hsa- miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa-miR-375, hsa- miR-103, hsa-miR-20a and hsa-miR-107.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-93, hsa-miR-106b , hsa-miR-25, hsa- miR-15b , hsa-miR-375, hsa-miR-103, hsa-miR-20a and hsa-miR-107 is up- regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-145 is down-regulated in the one or more target cells compared to the one or more normal control cells.

In a sixth aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating non- small cell lung cancer from small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of small lung cancer or non- small cell lung cancer.

The nucleic acid expression signature, as defined herein, may comprises at least seventeen nucleic acid molecules, preferably at least eight nucleic acid molecules.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-335, hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-592, hsa-miR-135a, hsa-miR-24,hsa- miR-454, hsa-miR-301a, hsa-miR-199b-5p, hsa-miR-9, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-335*, hsa-miR-152 and hsa-miR-216b.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-135a, hsa-miR- 199b-5p, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-152 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-335, hsa-miR-592, hsa-miR-24, hsa-miR-454, hsa-miR-301a, hsa-miR-9, hsa- miR-335*, hsa-miR-216b is down-regulated in the one or more target cells compared to the one or more control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-335, hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-592, hsa-miR-135a and hsa-miR-24.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-135a is up- regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-335, hsa-miR-592, hsa-miR-24 is down-regulated in the one or more target cells compared to the one or more control cells.

In a seventh aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer from the other two, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer.

The nucleic acid expression signature, as defined herein, may comprises at least twenty-three nucleic acid molecules, preferably at least seven nucleic acid molecules.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa-miR-205, hsa- miR-34a, hsa-miR-375, hsa-miR-29a, hsa-miR-27a, hsa-miR-29b, hsa-miR-93, hsa- miR-106b, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-145, hsa-miR-29c, hsa- miR-221, hsa-miR-335, hsa-miR-23a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-592, hsa-miR-95, hsa-miR-24 andhsa-miR-92a.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-34a, hsa-miR-29a, hsa-miR-29b, hsa-miR-145, hsa-miR- 29c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa-miR-93, hsa-miR-301a, hsa-miR-106b, hsa-miR-15b, hsa- miR-92a is down-regulated in adenocarcinoma lung cancer compared to small cell lung cancer and squamous cell lung cancer; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa-miR-27a, hsa-miR-221 is up-regulated in adenocarcinoma lung cancer compared to small cell lung but is down-regulated compared to squamous cell lung cancer; the expression of hsa-miR-375 is up-regulated in adenocarcinoma lung cancer compared to squamous cell lung cancer but is down- regulated compared to small cell lung; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-24, hsa-miR-23a, hsa-miR-22, hsa-miR-199a-5p is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-592, hsa-miR-335, hsa-miR-95, hsa-miR-454 is down-regulated in adenocarcinoma lung cancer compared to small cell lung.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa-miR-205, hsa- miR-34a, hsa-miR-375, hsa-miR-29a, hsa-miR-27a, hsa-miR-29b.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-34a, hsa-miR-29a, hsa-miR-29b is up-regulated and the expression of hsa-miR-25 is down-regulated in adenocarcinoma lung cancer compared to small cell lung cancer and squamous cell lung cancer; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa-miR-27a is up-regulated in adenocarcinoma lung cancer compared to small cell lung but is down-regulated compared to squamous cell lung cancer; the expression of hsa-miR-375 is up-regulated in adenocarcinoma lung cancer compared to squamous cell lung cancer but is down- regulated compared to small cell lung.

In a eighth aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating adenocarcinoma lung cancer from squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of adenocarcinoma lung cancer or squamous cell lung cancer.

The nucleic acid expression signature, as defined herein, may comprises at least fourteen nucleic acid molecules, preferably at least eight nucleic acid molecules.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-497, hsa-miR-93, hsa- miR-25, hsa-miR-29c, hsa-miR-205, hsa-miR-375, hsa-miR-149, hsa-miR-29a, hsa- miR-1, hsa-miR-15b, hsa-miR-181c, hsa-miR-29b, hsa-miR-769-5p and hsa-miR-221.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-497, hsa-miR-29c, hsa-miR-375, hsa-miR-29a, hsa-miR-1, hsa-miR-181c, hsa-miR-29b is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-93, hsa-miR-25, hsa-miR-205, hsa-miR- 149, hsa-miR-15b, hsa-miR-769-5p, hsa-miR-221 is down-regulated in the one or more target cells compared to the one or more control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-497, hsa-miR-93, hsa- miR-25, hsa-miR-29c, hsa-miR-205, hsa-miR-375, hsa-miR-149 and hsa-miR-29a.

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-497, hsa-miR-29c, hsa-miR-375, hsa-miR-29a is up- regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-93, hsa-miR-25, hsa-miR-205, hsa-miR-149 is down-regulated in the one or more target cells compared to the one or more control cells.

In a ninth aspect, the present invention relates to a method for identifying one or more target cells exhibiting or having a predisposition to develop lung cancer, the method comprising: (a) determining in the one or more target cells the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (b) determining the expression levels of the plurality of nucleic acid molecules in one or more healthy control cells; and (c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature, as defined herein, that is indicative for the presence of or the predisposition to develop lung cancer.

In more preferred embodiments of the invention, the method is for the further use of discriminating lung cancer selected from the group consisting of adenocarcinoma lung cancer, squamous cell lung cancer and small-cell lung cancer.

In a tenth aspect, the present invention relates to a method for preventing or treating lung cancer, the method comprising: (a) identifying a nucleic acid expression signature by using a method, as defined herein; and (b) modifying the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression is up-regulated is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated is up-regulated.

In an eleventh aspect, the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated from lung cancer patients, as defined herein.

Finally, in a twelfth aspect, the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.

Other embodiments of the present invention will become apparent from the detailed description hereinafter.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 depicts a flow chart schematically illustrating the essential method steps for determining an expression signature according to the present invention for identifying one or more target cells exhibiting or having a predisposition to develop lung cancer. Figure 2 illustrates an unsupervised hierarchical clustering of the differentially expressed miRNAs on normal lung tissues and different types of lung cancer. The clustering placed most normal samples in one group and most lung cancer samples in another group. The different types of lung cancer, including small cell lung cancer, squamous cell lung cancer and adenocarcinoma lung cancer, also separated from each other clearly,

illustrates the top 7 miRNA signatures in the first aspect according to the present invention for identifying one or more target cells exhibiting lung cancer. Also indicates the cross- validated classification accuracy and regulation (i.e. an up- regulation or a down-regulation) of these miRNAs as classifiers in the lung cancer tissue as compared to normal lung tissues, illustrates the top 9 miRNA signatures in the second aspect according to the present invention for identifying one or more target cells exhibiting non- small cell lung cancer, including squamous cell lung cancer and adenocarcinoma lung cancer. Also indicates the cross-validated classification accuracy and regulation (i.e. an up-regulation or a down-regulation) of these miRNAs as classifiers in the non-small cell lung cancer compared to normal lung tissues.

illustrates the top 5 miRNA signatures in the third aspect according to the present invention for identifying one or more target cells exhibiting adenocarcinoma lung cancer. Also indicates the cross-validated classification accuracy and regulation (i.e. an up-regulation or a down-regulation) of these miRNAs as classifiers in the adenocarcinoma lung cancer compared to normal lung tissues.

illustrates the top 9 miRNA signatures in the fourth aspect according to the present invention for identifying one or more target cells exhibiting squamous cell lung cancer. Also indicates the cross- validated classification accuracy and regulation (i.e. an up-regulation or a down-regulation) of these miRNAs as classifiers in the squamous cell lung cancer compared to normal lung tissues.

Figure 7 illustrates the top 11 miRNA signatures in the fifth aspect according to the present invention for identifying one or more target cells exhibiting small lung cancer. Also indicates the cross- validated classification accuracy and regulation (i.e. an up- regulation or a down-regulation) of these miRNAs as classifiers in the small cell lung cancer compared to normal lung tissues,

Figure 8 illustrates the top 8 miRNA signatures in the sixth aspect according to the present invention for discriminating non-small lung cancer (NSCLC) from small cell lung cancer (SCLC). Also indicates the cross-validated classification accuracy and regulation (i.e. an up-regulation or a down-regulation) of these miRNAs as classifiers in the non-small cell lung cancer compared to small cell lung cancer.

Figure 9 illustrates an supervised hierarchical clustering based on the differentially expressed miRNAs between different lung cancers and shows small-cell lung cancer, squamous cell lung cancer and lung adenocarcinoma separated from each other clearly.

Figure 10 illustrates the top 8 miRNA signatures in the eighth aspect according to the present invention for discriminating adenocarcinoma lung cancer (AC) from squamous cell lung cancer (SQ). Also indicates the cross-validated classification accuracy and regulation (i.e. an up-regulation or a down- regulation) of these miRNAs as classifiers in the adenocarcinoma lung cancer compared to squamous cell lung.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is based on the unexpected finding that lung cancer can be reliably identified and different types of lung cancer can be discriminated based on particular miRNA expression profiles with high sensitivity and specificity, wherein the expression signatures as defined herein typically comprises both up- and down- regulated human miRNAs. More specifically, said miRNA expression signatures - by analyzing the overall miRNA expression pattern and/or the respective individual miRNA expression level(s) - allow the detection of lung cancer at an early disease state and discriminating the different types of lung cancer.

The present invention illustratively described in the following may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein.

The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. The drawings described are only schematic and are to be considered non- limiting.

Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. For the purposes of the present invention, the term "consisting of" is considered to be a preferred embodiment of the term "comprising of". If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also to be understood to disclose a group, which preferably consists only of these embodiments.

Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated.

The term "about" in the context of the present invention denotes an interval of accuracy that the person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates deviation from the indicated numerical value of + 10%, and preferably + 5%.

Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

Further definitions of term will be given in the following in the context of which the terms are used. The following terms or definitions are provided solely to aid in the understanding of the invention. These definitions should not be construed to have a scope less than understood by a person of ordinary skill in the art.

The term "cancer" (also referred to as "carcinoma"), as used herein, generally denotes any type of malignant neoplasm, that is, any morphological and/or physiological alterations (based on genetic re -programming) of special tissue exhibiting or having a predisposition to develop characteristics of a carcinoma as compared to unaffected (healthy) wild-type control tissues. Examples of such alterations may relate inter alia to cell size and shape (enlargement or reduction), cell proliferation (increase in cell number), cell differentiation (change in physiological state), apoptosis (programmed cell death) or cell survival.

The term "lung cancer", as used herein, refers to uncontrolled cell growth in the tissue of lung, or cancerous growths in the lung.

The term "different types of lung cancer", as used herein, include adenocarcinoma lung cancer, squamous cell lung cancer and small-cell lung cancer.

"Adenocarcinoma lung cancer" or "adenocarcinoma lung carcinoma" is a form of non- small cell lung cancer. Eighty percent of lung cancers are non- small cell cancers (NSCLC), and of these, about 50% are adenocarcinomas. Adenocarcinoma of the lung begins in the outer parts of the lung, and it can be present for a long time before it is diagnosed. It is the type of lung cancer most commonly seen in women and is often seen in non-smokers.

"Squamous cell lung cancer" or "squamous cell lung carcinoma" is a form of non-small cell lung cancer. About 30% of NSCLC are squamous cell lung cancer. Squamous cell lung carcinomas usually begin in the bronchial tubes (large airways) in the central part of the lungs. Many people have symptoms early on, commonly hemoptysis (coughing up blood).

"Small cell lung cancer", or "small cell lung carcinoma" (SCLC), is thought to arise from neuroendocrine cells which form part of the epithelium (lining) of the bronchi (airways). SCLC accounts for about 18% of all cases of lung cancer. SCLCs are very aggressive. They grow quickly and spread via the bloodstream to the liver, lung, bones and brain. It is quite common for tumour deposits to be found in these organs at the time of diagnosis.

The term "patient", as used herein, refers to a human being at least supposed to have lung cancer, or certain types of lung cancer; whereas the term "healthy individual" or "healthy control" typically denotes a healthy person not having characteristics of such a cancerous phenotype. However, in some applications, for example, when comparing different types of lung cancer, the individual having the other types of lung cancer is typically considered the "control".

The sample used for detection in the in vitro methods of the present invention should generally be collected in a clinically acceptable manner, preferably in a way that nucleic acids (in particular RNA) or proteins are preserved. The samples to be analyzed are typically from tissue. Furthermore, blood and other types of sample can be used as well. Samples, in particular after initial processing may be pooled. However, also non- pooled samples may be used.

The term "microRNA" (or "miRNA"), as used herein, is given its ordinary meaning in the art (Bartel, D.P. (2004) Cell 23, 281-292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531). Accordingly, a "microRNA" denotes an RNA molecule derived from a genomic locus that is processed from transcripts that can form local RNA precursor miRNA structures. The mature miRNA is usually 20, 21, 22, 23, 24, or 25 nucleotides in length, although other numbers of nucleotides may be present as well, for example 18, 19, 26 or 27 nucleotides.

The miRNA encoding sequence has the potential to pair with flanking genomic sequences, placing the mature miRNA within an imperfect RNA duplex (herein also referred to as stem-loop or hairpin structure or as pre-miRNA), which serves as an intermediate for miRNA processing from a longer precursor transcript. This processing typically occurs through the consecutive action of two specific endonucleases termed Drosha and Dicer, respectively. Drosha generates from the primary transcript (herein also denoted "pri-miRNA") a miRNA precursor (herein also denoted "pre-miRNA") that typically folds into a hairpin or stem-loop structure. From this miRNA precursor a miRNA duplex is excised by means of Dicer that comprises the mature miRNA at one arm of the hairpin or stem-loop structure and a similar- sized segment (commonly referred to miRNA*) at the other arm. The miRNA is then guided to its target mRNA to exert its function, whereas the miRNA* is degraded. In addition, miRNAs are typically derived from a segment of the genome that is distinct from predicted protein-coding regions.

The term "miRNA precursor" (or "precursor miRNA" or "pre-miRNA"), as used herein, refers to the portion of a miRNA primary transcript from which the mature miRNA is processed. Typically, the pre-miRNA folds into a stable hairpin (i.e. a duplex) or a stem-loop structure. The hairpin structures typically range from 50 to 80 nucleotides in length, preferably from 60 to 70 nucleotides (counting the miRNA residues, those pairing to the miRNA, and any intervening segment(s) but excluding more distal sequences).

The term "nucleic acid molecule encoding a microRNA sequence", as used herein, denotes any nucleic acid molecule coding for a microRNA (miRNA). Thus, the term does not only refer to mature miRNAs but also to the respective precursor miRNAs and primary miRNA transcripts as defined above. Furthermore, the present invention is not restricted to RNA molecules but also includes corresponding DNA molecules encoding a microRNA, e.g. DNA molecules generated by reverse transcribing a miRNA sequence. A nucleic acid molecule encoding a microRNA sequence according to the invention typically encodes a single miRNA sequence (i.e. an individual miRNA). However, it is also possible that such nucleic acid molecule encodes two or more miRNA sequences (i.e. two or more miRNAs), for example a transcriptional unit comprising two or more miRNA sequences under the control of common regulatory sequences such as a promoter or a transcriptional terminator.

The term "nucleic acid molecule encoding a microRNA sequence", as used herein, is also to be understood to include "sense nucleic acid molecules" (i.e. molecules whose nucleic acid sequence (5'— > 3') matches or corresponds to the encoded miRNA (5'— > 3') sequence) and "anti-sense nucleic acid molecules" (i.e. molecules whose nucleic acid sequence is complementary to the encoded miRNA (5'— > 3') sequence or, in other words, matches the reverse complement (3'— > 5') of the encoded miRNA sequence). The term "complementary", as used herein, refers to the capability of an "anti-sense" nucleic acid molecule sequence of forming base pairs, preferably Watson-Crick base pairs, with the corresponding "sense" nucleic acid molecule sequence (having a sequence complementary to the anti- sense sequence).

Within the scope of the present invention, two nucleic acid molecules (i.e. the "sense" and the "anti-sense" molecule) may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides. Alternatively, the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions). Preferably, the "complementary" nucleic acid molecule comprises at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in corresponding "sense" nucleic acid molecule.

Accordingly, the plurality of nucleic acid molecules encoding a miRNA sequence that are comprised in a diagnostic kit of the present invention may include one or more "sense nucleic acid molecules" and/or one or more "anti-sense nucleic acid molecules". In case, the diagnostic kit includes one or more "sense nucleic acid molecules" (i.e. the miRNA sequences as such), said molecules are to be considered to constitute the totality or at least a subset of differentially expressed miRNAs (i.e. molecular markers) being indicative for the presence of or the disposition to develop a particular condition, here lung cancer. On the other hand, in case a diagnostic kit includes one or more "anti-sense nucleic acid molecules" (i.e. sequences complementary to the miRNA sequences), said molecules may comprise mter alia probe molecules (for performing hybridization assays) and/or oligonucleotide primers (e.g., for reverse transcription or PCR applications) that are suitable for detecting and/or quantifying one or more particular (complementary) miRNA sequences in a given sample.

A plurality of nucleic acid molecules as defined within the present invention may comprise at least two, at least ten, at least 50, at least 100, at least 200, at least 500, at least 1.000, at least 10.000 or at least 100.000 nucleic acid molecules, each molecule encoding a miRNA sequence.

The term "differentially expressed", as used herein, denotes an altered expression level of a particular miRNA in the disease cells as compared to the healthy controls, or as compared to other types of disease samples, which may be an up- regulation (i.e. an increased miRNA concentration) or a down-regulation (i.e. a reduced or abolished miRNA concentration). In other words, the nucleic acid molecule is activated to a higher or lower level in the disease cells than in the control cells.

Within the scope of the present invention, a nucleic acid molecule is to considered differentially expressed if the respective expression levels of this nucleic acid molecule in disease samples and control samples typically differ by at least 5% or at least 10%, preferably by at least 20% or at least 25%, and most preferably by at least 30% or at least 50%. Thus, the latter values correspond to an at least 1.3-fold or at least 1.5-fold up-regulation of the expression level of a given nucleic acid molecule in the disease samples compared to the control samples or vice versa an at least 0.7-fold or at least 0.5-fold down-regulation of the expression level in the disease samples, respectively.

The term "expression level", as used herein, refers to extent to which a particular miRNA sequence is transcribed from its genomic locus, that is, the concentration of a miRNA in the sample to be analyzed.

As outlined above, the term "control cells" typically denotes a cell sample collected from (healthy) individual not having characteristics of a lung cancer phenotype. However, in some applications, for example, when comparing different types of lung cancers, the cells collected from other types of lung cancer is typically considered the "control cells".

The determining of expression levels typically follows established standard procedures well known in the art (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F.M. et al. (2001) Current Protocols in Molecular Biology. Wiley & Sons, Hoboken, NJ). Determination may occur at the RNA level, for example by Northern blot analysis using miRN A- specific probes, or at the DNA level following reverse transcription (and cloning) of the RNA population, for example by quantitative PCR or real-time PCR techniques. The term "determining", as used herein, includes the analysis of any nucleic acid molecules encoding a microRNA sequence as described above. However, due to the short half-life of pri-miRNAs and pre-mRNAs typically the concentration of only the mature miRNA is measured.

In specific embodiments, the standard value of the expression levels obtained in several independent measurements of a given sample (for example, two, three, five or ten measurements) and/or several measurements within several samples or control samples are used for analysis. The standard value may be obtained by any method known in the art. For example, a range of mean + 2 SD (standard deviation) or mean + 3 SD may be used as standard value.

The difference between the expression levels obtained for disease and control cells may be normalized to the expression level of further control nucleic acids, e.g. housekeeping genes whose expression levels are known not to differ depending on the disease states of the individual from whom the sample was collected. Exemplary housekeeping genes include inter alia β-actin, glycerinaldehyde 3-phosphate dehydrogenase, and ribosomal protein PI. In preferred embodiments, the control nucleic acid is another miRNA known to be stably expressed during the various noncancerous and (pre-)cancerous states of the individual from whom the sample was collected.

However, instead of determining in any experiment the expression levels for cell sample it may also be possible to define based on experimental evidence and/or prior art data on or more cut-off values for a particular disease phenotype (i.e. a disease state). In such scenario, the respective expression levels for the cell sample can be determined by using a stably expressed control miRNA for normalization. If the "normalized" expression levels calculated are higher than the respective cutoff value defined, then this finding would be indicative for an up-regulation of gene expression. Vice versa, if the "normalized" expression levels calculated are lower than the respective cutoff value defined, then this finding would be indicative for a down-regulation of gene expression.

In the context of the present invention, the term "identifying lung cancer and/or discriminating different types of lung cancer" is intended to also encompass predictions and likelihood analysis (in the sense of "diagnosing"). The compositions and methods disclosed herein are intended to be used clinically in making decisions concerning treatment modalities, including therapeutic intervention, diagnostic criteria such as disease stages, and disease monitoring and surveillance for the disease. According to the present invention, an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease. Alternatively, the invention may be used to detect cancerous changes through cell sample, and provide a doctor with useful information for diagnosis. Furthermore, the invention may also be used to discriminate between different types of lung cancers.

Within the present invention, one or more differentially expressed nucleic acid molecules identified together represent a nucleic acid expression signature that is indicative for lung cancer. The term "expression signature", as used herein, denotes a set of nucleic acid molecules (e.g., miRNAs), wherein the expression level of the individual nucleic acid molecules differs between the cells collected from lung cancer patient and the healthy control. Herein, a nucleic acid expression signature is also referred to as a set of markers and represents a minimum number of (different) nucleic acid molecules, each encoding a miRNA sequence that is capable for identifying a phenotypic state of an individual.

In a first aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting or having a predisposition to develop lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of lung cancer and/or the predisposition to develop lung cancer. The nucleic acid expression signature, as defined herein, may comprises at least eighty-two nucleic acid molecules, preferably at least thirteen nucleic acid molecules, and particularly preferably at least seven nucleic acid molecules.

In more preferred embodiments, the nucleic acid expression signature comprises nucleic acid molecules encoding hsa-miR-183 (SEQ ID NO:l), hsa-miR-451 (SEQ ID NO:4), hsa-miR-126 (SEQ ID NO:54), hsa-miR-126* (SEQ ID NO:55), hsa-miR-30a (SEQ ID NO:56), hsa-miR-145 (SEQ ID NO:58), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-96 (SEQ ID NO:2), hsa-miR-144 (SEQ ID NO:3), hsa-miR-200c (SEQ ID NO:5), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR- 218 (SEQ ID NO:57), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR-130b (SEQ ID NO:9), hsa-miR-30a* (SEQ ID NO:10), hsa-miR-144* (SEQ ID NO:l l), hsa-miR-425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-497 (SEQ ID NO:14), hsa-miR- 182 (SEQ ID NO:15), hsa-miR-187* (SEQ ID NO:16), hsa-miR-30b (SEQ ID NO:17), hsa-miR-93 (SEQ ID NO:18), hsa-miR-145*(SEQ ID NO:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID NO:21), hsa-miR-200a (SEQ ID NO:22), hsa-miR-625 (SEQ ID NO:23), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c-2* (SEQ ID NO:25), hsa-miR-98 (SEQ ID NO:26), hsa-miR-1 (SEQ ID NO:27), hsa-miR-106b (SEQ ID NO:28), hsa-miR-150* (SEQ ID NO:29), hsa-miR-25 (SEQ ID NO:30), hsa-miR-134 (SEQ ID NO:31), hsa-miR-328 (SEQ ID NO:32), hsa-miR-638 (SEQ ID NO:33), hsa- miR-200b* (SEQ ID NO:34), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-1224-5p (SEQ ID NO:36), hsa-miR-557 (SEQ ID NO:37), hsa-miR-15b (SEQ ID NO:38), hsa- miR-454 (SEQ ID NO:39), hsa-miR-301a (SEQ ID NO:40), hsa-miR-135b (SEQ ID NO:41), hsa-miR-100 (SEQ ID NO:42), hsa-miR-223 (SEQ ID NO:43), hsa-miR-196b (SEQ ID NO:44), hsa-miR-196a (SEQ ID NO:45), hsa-miR-1226* (SEQ ID NO:46), hsa-miR-424 (SEQ ID NO:47), hsa-miR-21* (SEQ ID NO:48), hsa-miR-572 (SEQ ID NO:49), hsa-miR-18b (SEQ ID NO:50), hsa-miR-18a (SEQ ID NO:51), hsa-miR-9* (SEQ ID NO:52), hsa-miR-301b (SEQ ID NO:53), hsa-miR-101 (SEQ ID NO:63), hsa- miR-143 (SEQ ID N0:61), hsa-miR-140-5p (SEQ ID NO:62), hsa-miR-30d (SEQ ID NO:63), hsa-miR-29c (SEQ ID NO:64), hsa-miR-199b-5p (SEQ ID NO:65), hsa-miR- 224 (SEQ ID NO:66), hsa-miR-125a-3p (SEQ ID NO:67), hsa-miR-9 (SEQ ID NO:68), hsa-miR-200b (SEQ ID NO:69), hsa-miR-195 (SEQ ID NO:70), hsa-miR-210 (SEQ ID N0:71), hsa-miR-7 (SEQ ID NO:72), hsa-miR-21 (SEQ ID NO:73), hsa-miR-17 (SEQ ID NO:74), hsa-miR-128 (SEQ ID NO:75), hsa-miR-141 (SEQ ID NO:76), hsa-miR- 142-5p (SEQ ID NO:77), hsa-miR-150 (SEQ ID NO:78), hsa-miR-205 (SEQ ID NO:79), hsa-miR-192 (SEQ ID NO:80), hsa-miR-215(SEQ ID N0:81) and hsa-miR- 106a (SEQ ID NO:82).

Particular preferably, the expression of the nucleic acid molecules encoding hsa- miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa- miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR-98, hsa-miR-106b, hsa- miR-25, hsa-miR-200b*, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-196b, hsa-miR-196a, hsa-miR-424, hsa-miR-21*, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa- miR-192, hsa-miR-215, hsa-miR-106a is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR- 338-3p, hsa-miR-218, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-133b, hsa-miR-497, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa- miR-1226*, hsa-miR-572, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p, hsa-miR-195, hsa-miR-142-5p and hsa-miR-150 is down-regulated in the in the one or more target cells compared to the one or more normal control cells.

The nucleic acid sequences of the above -referenced miRNAs are listed in Table 1. TABLE 1

miRNA Sequence (5' 3') hsa-miR-183 uauggcacugguagaauucacu hsa-miR-96 uuuggcacuagcacauuuuugcu hsa-miR-144 uacaguauagaugauguacu hsa-miR-451 aaaccguuaccauuacugaguu hsa-miR-200c uaauacugccggguaaugaugga hsa-miR-486-5p uccuguacugagcugccccgag hsa-miR-338-3p uccagcaucagugauuuuguug hsa-miR-139-5p ucuacagugcacgugucuccag hsa-miR-130b cagugcaaugaugaaagggcau hsa-miR-30a* cuuucagucggauguuugcagc hsa-miR-144* ggauaucaucauauacuguaag hsa-miR-425 aaugacacgaucacucccguuga hsa-miR-133b uuugguccccuucaaccagcua hsa-miR-497 cagcagcacacugugguuugu hsa-miR-182 uuuggcaaugguagaacucacacu hsa-miR-187* ggcuacaacacaggacccgggc hsa-miR-30b uguaaacauccuacacucagcu hsa-miR-93 caaagugcuguucgugcagguag hsa-miR-145* ggauuccuggaaauacuguucu hsa-miR-429 uaauacugucugguaaaaccgu hsa-miR-498 uuucaagccagggggcguuuuuc hsa-miR-200a uaacacugucugguaacgaugu hsa-miR-625 agggggaaaguucuauagucc hsa-miR-130a cagugcaauguuaaaagggcau hsa-miR-30c-2* cugggagaaggcuguuuacuc hsa-miR-98 ugagguaguaaguuguauuguu hsa-miR-1 uggaauguaaagaaguauguau hsa-miR-106b uaaagugcugacagugcagau hsa-miR-150* cugguacaggccugggggacag hsa-miR-25 cauugcacuugucucggucuga hsa-miR-134 ugugacugguugaccagagggg hsa-miR-328 cuggcccucucugcccuuccgu hsa-miR-638 agggaucgcgggcggguggcggccu hsa-miR-200b* caucuuacugggcagcauugga hsa-miR-1225 -5p guggguacggcccagugggggg hsa-miR-1224-5p gugaggacucgggaggugg hsa-miR-557 guuugcacgggugggccuugucu hsa-miR-15b uagcagcacaucaugguuuaca hsa-miR-454 uagugcaauauugcuuauagggu hsa-miR-301a cagugcaauaguauugucaaagc hsa-miR-135b uauggcuuuucauuccuauguga hsa-miR-100 aacccguagauccgaacuugug hsa-miR-223 ugucaguuugucaaauacccca hsa-miR-196b uagguaguuuccuguuguuggg hsa-miR-196a uagguaguuucauguuguuggg hsa-miR-1226* gugagggcaugcaggccuggaugggg hsa-miR-424 cagcagcaauucauguuuugaa hsa-miR-21* caacaccagucgaugggcugu hsa-miR-572 guccgcucggcgguggccca hsa-miR-18b uaaggugcaucuagugcaguuag hsa-miR-18a uaaggugcaucuagugcagauag hsa-miR-9* auaaagcuagauaaccgaaagu hsa-miR-301b cagugcaaugauauugucaaagc hsa-miR-126 ucguaccgugaguaauaaugcg hsa-miR-126* cauuauuacuuuugguacgcg hsa-miR-30a uguaaacauccucgacuggaag hsa-miR-218 uugugcuugaucuaaccaugu hsa-miR-145 guccaguuuucccaggaaucccu hsa-miR-140-3p uaccacaggguagaaccacgg hsa-miR-101 uacaguacugugauaacugaa hsa-miR-143 ugagaugaagcacuguagcuc hsa-miR-140-5p cagugguuuuacccuaugguag hsa-miR-30d uguaaacauccccgacuggaag hsa-miR-29c uagcaccauuugaaaucgguua hsa-miR-199b-5p cccaguguuuagacuaucuguuc hsa-miR-224 caagucacuagugguuccguu hsa-miR-125a-3p acaggugagguucuugggagcc hsa-miR-9 ucuuugguuaucuagcuguauga hsa-miR-200b uaauacugccugguaaugauga hsa-miR-195 uagcagcacagaaauauuggc hsa-miR-210 cugugcgugugacagcggcuga hsa-miR-7 uggaagacuagugauuuuguugu hsa-miR-21 uagcuuaucagacugauguuga hsa-miR-17 caaagugcuuacagugcagguag hsa-miR-128 ucacagugaaccggucucuuu hsa-miR-141 uaacacugucugguaaagaugg hsa-miR-142-5p cauaaaguagaaagcacuacu hsa-miR-150 ucucccaacccuuguaccagug hsa-miR-205 uccuucauuccaccggagucug

hsa-miR-192 cugaccuaugaauugacagcc hsa-miR-215 augaccuaugaauugacagac hsa-miR-106a aaaagugcuuacagugcagguag

All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).

The terms " at least one nucleic acid " as used herein, may relate to any subgroup of the plurality of nucleic acid molecules, e.g., any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, and so forth nucleic acid molecules, each encoding a microRNA sequence that are comprised in the nucleic acid expression signature, as defined herein.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183 (SEQ ID NO: 1), hsa-miR-451, (SEQ ID NO: 4), hsa-miR-497 (SEQ ID NO: 14), hsa-miR-126 (SEQ ID NO: 54), hsa-miR-126* (SEQ ID NO:55), hsa-miR-30a (SEQ ID NO:56), hsa-miR-218 (SEQ ID NO:57), hsa-miR-145 (SEQ ID NO:58), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-96 (SEQ ID NO:2), hsa-miR-144 (SEQ ID NO: 3), hsa-miR-200c (SEQ ID NO:5), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR- 338-3p (SEQ ID NO:7), hsa-miR-130b (SEQ ID NO:9), hsa-miR-144* (SEQ ID N0:11), hsa-miR-425 (SEQ ID N0:12), hsa-miR-133b (SEQ ID N0:13), hsa-miR-182 (SEQ ID N0:15), hsa-miR-187* (SEQ ID N0:16), hsa-miR-30b (SEQ ID N0:17), hsa- miR-93 (SEQ ID N0:18), hsa-miR-145* (SEQ ID N0:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID N0:21), hsa-miR-200a (SEQ ID NO:22), hsa-miR-625 (SEQ ID NO:23), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c-2* (SEQ ID NO:25), hsa-miR-98 (SEQ ID NO:26), hsa-miR-1 (SEQ ID NO:27), hsa-miR-150* (SEQ ID NO:29), hsa-miR-25 (SEQ ID NO:30), hsa-miR-134 (SEQ ID N0:31), hsa-miR-328 (SEQ ID NO:32), hsa-miR-638 (SEQ ID NO:33), hsa-miR-200b* (SEQ ID NO:34), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-1224-5p (SEQ ID NO:36), hsa-miR-557 (SEQ ID NO:37), hsa-miR-135b (SEQ ID N0:41), hsa-miR-100 (SEQ ID NO:42), hsa- miR-424 (SEQ ID NO:47), hsa-miR-21* (SEQ ID NO:48), hsa-miR-30a* (SEQ ID NO:10), hsa-miR-494 (SEQ ID NO:83), hsa-miR-193b (SEQ ID NO:84), hsa-miR-99a (SEQ ID NO:85), hsa-miR-335 (SEQ ID NO:86), hsa-miR-106b (SEQ ID NO:28), hsa- miR-140-5p (SEQ ID NO:59), hsa-miR-101 (SEQ ID NO:60), hsa-miR-143 (SEQ ID N0:61), hsa-miR-30d (SEQ ID NO:63), hsa-miR-29c (SEQ ID NO:64), hsa-miR-224 (SEQ ID NO:66), hsa-miR-9 (SEQ ID NO:68), hsa-miR-200b (SEQ ID NO:69), hsa- miR-195 (SEQ ID NO:70), hsa-miR-210 (SEQ ID N0:71), hsa-miR-7 (SEQ ID NO:72), hsa-miR-21 (SEQ ID NO:83), hsa-miR-128 (SEQ ID NO:75), hsa-miR-141 (SEQ ID NO:76), hsa-miR-142-5p (SEQ ID NO:77), hsa-miR-150 (SEQ ID NO:78), hsa-miR- 205 (SEQ ID NO:79), hsa-miR-192 (SEQ ID NO:80) and hsa-miR-215 (SEQ ID NO:215).

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR- 425, hsa-miR-182, hsa-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR- 98, hsa-miR-25, hsa-miR-200b*, hsa-miR-135b, hsa-miR-424, hsa-miR-21*, hsa-miR- 494, hsa-miR-193b, hsa-miR-106b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR- 210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa-miR-192, hsa-miR-215 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa- miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p and hsa-miR-139-5p, hsa-miR-338-3p, hsa-miR-144*, hsa-miR-133b, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR- 1225-5p, hsa-miR- 1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-30a*, hsa-miR-99a, hsa-miR-335, hsa- miR-140-5p, hsa-miR- 101, hsa-miR-143, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR- 142-5p, hsa-miR-150 is down-regulated in the one or more target cells compared to the one or more normal control cells.

The nucleic acid sequences of the above-referenced miRNAs are listed in Table

2.

TAB LE 2

miRNA Sequence (5'→ 3')

hsa-miR- 183 uauggcacugguagaauucacu

hsa-miR-96 uuuggcacuagcacauuuuugcu

hsa-miR- 144 uacaguauagaugauguacu

hsa-miR-451 aaaccguuaccauuacugaguu

hsa-miR-200c uaauacugccggguaaugaugga

hsa-miR-486-5p uccuguacugagcugccccgag

hsa-miR- 139-5p ucuacagugcacgugucuccag

hsa-miR-497 cagcagcacacugugguuugu

hsa-miR-338-3p uccagcaucagugauuuuguug

hsa-miR- 130b cagugcaaugaugaaagggcau

hsa-miR- 144* ggauaucaucauauacuguaag

hsa-miR-425 aaugacacgaucacucccguuga

hsa-miR-133b uuugguccccuucaaccagcua

hsa-miR- 182 uuuggcaaugguagaacucacacu

hsa-miR- 187* ggcuacaacacaggacccgggc

hsa-miR-30b uguaaacauccuacacucagcu

hsa-miR-93 caaagugcuguucgugcagguag

hsa-miR-145* ggauuccuggaaauacuguucu

hsa-miR-429 uaauacugucugguaaaaccgu

hsa-miR-498 uuucaagccagggggcguuuuuc

hsa-miR-200a uaacacugucugguaacgaugu

hsa-miR-572 guccgcucggcgguggccca

hsa-miR- 130a cagugcaauguuaaaagggcau

hsa-miR-30c-2* cugggagaaggcuguuuacuc

hsa-miR-98 ugagguaguaaguuguauuguu

hsa-miR-1 uggaauguaaagaaguauguau

hsa-miR-150* cugguacaggccugggggacag

hsa-miR-25 cauugcacuugucucggucuga

hsa-miR-134 ugugacugguugaccagagggg

hsa-miR-328 cuggcccucucugcccuuccgu hsa-miR-638 agggaucgcgggcggguggcggccu hsa-miR-200b* caucuuacugggcagcauugga hsa-miR-1225-5p guggguacggcccagugggggg hsa-miR-1224-5p gugaggacucgggaggugg hsa-miR-557 guuugcacgggugggccuugucu hsa-miR-135b uauggcuuuucauuccuauguga hsa-miR-100 aacccguagauccgaacuugug hsa-miR-424 cagcagcaauucauguuuugaa hsa-miR-21* caacaccagucgaugggcugu hsa-miR-30a* cuuucagucggauguuugcagc hsa-miR-494 ugaaacauacacgggaaaccuc hsa-miR-193b aacuggcccucaaagucccgcu hsa-miR-99a aacccguagauccgaucuugug hsa-miR-335 ucaagagcaauaacgaaaaaugu hsa-miR-126 ucguaccgugaguaauaaugcg hsa-miR-126* cauuauuacuuuugguacgcg hsa-miR-30a uguaaacauccucgacuggaag hsa-miR-218 uugugcuugaucuaaccaugu hsa-miR-145 guccaguuuucccaggaaucccu hsa-miR-140-3p uaccacaggguagaaccacgg hsa-miR-106b uaaagugcugacagugcagau hsa-miR-140-5p cagugguuuuacccuaugguag hsa-miR-101 uacaguacugugauaacugaa hsa-miR-143 ugagaugaagcacuguagcuc hsa-miR-30d uguaaacauccccgacuggaag hsa-miR-29c uagcaccauuugaaaucgguua hsa-miR-224 caagucacuagugguuccguu hsa-miR-9 ucuuugguuaucuagcuguauga hsa-miR-200b uaauacugccugguaaugauga hsa-miR-195 uagcagcacagaaauauuggc hsa-miR-210 cugugcgugugacagcggcuga hsa-miR-7 uggaagacuagugauuuuguugu hsa-miR-21 uagcuuaucagacugauguuga hsa-miR-128 ucacagugaaccggucucuuu hsa-miR-141 uaacacugucugguaaagaugg hsa-miR-142-5p cauaaaguagaaagcacuacu hsa-miR-150 ucucccaacccuuguaccagug hsa-miR-205 uccuucauuccaccggagucug hsa-miR-192 cugaccuaugaauugacagcc hsa-miR-215 augaccuaugaauugacagac All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).

The nucleic acid expression signature, as defined herein, may comprises at least fifty-seven nucleic acid molecules, preferably at least thirteen nucleic acid molecules, and particularly preferably at least five nucleic acid molecules.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96 (SEQ ID NO:2) , hsa-miR-126 (SEQ ID NO:54), hsa-miR-126*(SEQ ID NO:55), hsa-miR-30a (SEQ ID NO:56), hsa-miR-218 (SEQ ID NO:57), hsa-miR-21 (SEQ ID NO:73), hsa-miR-183 (SEQ ID NO:l), hsa-miR-144 (SEQ ID NO:3), hsa-miR-451 (SEQ ID NO:4), hsa-miR- 200c (SEQ ID NO:5), hsa-miR-135b (SEQ ID NO:41), hsa-miR-148a (SEQ ID NO:86), hsa-miR-625 (SEQ ID NO: 108), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR-130b (SEQ ID NO:9), hsa- miR-30a* (SEQ ID NO:10), hsa-miR-144* (SEQ ID NO:l l), hsa-miR-425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-497 (SEQ ID NO:14), hsa-miR-182 (SEQ ID NO:15), hsa-miR-187* (SEQ ID NO:16), hsa-miR-30b (SEQ ID NO:17), hsa- miR-145* (SEQ ID NO: 19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID NO:21), hsa-miR-200a (SEQ ID NO:22), hsa-miR-130a (SEQ ID NO:24), hsa-miR- 30c-2* (SEQ ID NO:25), hsa-miR-134 (SEQ ID NO:31), hsa-miR-638 (SEQ ID NO:33), hsa-miR-200b* (SEQ ID NO:34), hsa-miR-1225-5p (SEQ ID NO:35), hsa- miR-557 (SEQ ID NO:37), hsa-miR-100 (SEQ ID NO:42), hsa-miR-223 (SEQ ID NO:43), hsa-miR-424 (SEQ ID NO:47), hsa-miR-21* (SEQ ID NO:48), hsa-miR-99a (SEQ ID NO:85), hsa-miR-34a (SEQ ID NO:87), hsa-miR-542-3p (SEQ ID NO:88), hsa-miR-200a* (SEQ ID NO:89), hsa-miR-375 (SEQ ID NO:90), hsa-miR-145 (SEQ ID NO:58), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-101 (SEQ ID NO:60), hsa- miR-143 (SEQ ID NO:61), hsa-miR-140-5p (SEQ ID NO:62), hsa-miR-224 (SEQ ID NO:66), hsa-miR-200b (SEQ ID NO:69), hsa-miR-195 (SEQ ID NO:70), hsa-miR-210 (SEQ ID NO:71), hsa-miR-7 (SEQ ID NO:72), hsa-miR-141 (SEQ ID NO:76) and hsa- miR-192 (SEQ ID NO:80).

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR- 135b, hsa-miR-148a, hsa-miR-625, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa- miR-429, hsa-miR-200a, hsa-miR-200b*, hsa-miR-424, hsa-miR-21*, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a*, hsa-miR-375, hsa-miR-224, hsa-miR-200b, hsa-miR- 210, hsa-miR-7, hsa-miR-141, hsa-miR-192 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-126, hsa-miR-126*, hsa- miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-133b, hsa-miR-497, hsa-miR- 187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa- miR-134, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-99a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR- 140-5p, hsa-miR-195 is down-regulated in the one or more target cells compared to the one or more normal control

The nucleic acid sequences of the above -referenced miRNAs are listed in Table

3. TAB LE 3

miRNA Sequence (5'→ 3') hsa-miR-183 uauggcacugguagaauucacu hsa-miR-96 uuuggcacuagcacauuuuugcu hsa-miR-144 uacaguauagaugauguacu hsa-miR-451 aaaccguuaccauuacugaguu hsa-miR-200c uaauacugccggguaaugaugga hsa-miR-135b uauggcuuuucauuccuauguga hsa-miR-486-5p uccuguacugagcugccccgag hsa-miR-338-3p uccagcaucagugauuuuguug hsa-miR-139-5p ucuacagugcacgugucuccag hsa-miR-130b cagugcaaugaugaaagggcau hsa-miR-30a* cuuucagucggauguuugcagc hsa-miR-144* ggauaucaucauauacuguaag hsa-miR-425 aaugacacgaucacucccguuga hsa-miR-133b uuugguccccuucaaccagcua hsa-miR-497 cagcagcacacugugguuugu hsa-miR-182 uuuggcaaugguagaacucacacu hsa-miR-187* ggcuacaacacaggacccgggc hsa-miR-30b uguaaacauccuacacucagcu hsa-miR-145* ggauuccuggaaauacuguucu hsa-miR-429 uaauacugucugguaaaaccgu hsa-miR-498 uuucaagccagggggcguuuuuc hsa-miR-200a uaacacugucugguaacgaugu hsa-miR-625 agggggaaaguucuauagucc hsa-miR-130a cagugcaauguuaaaagggcau hsa-miR-30c-2* cugggagaaggcuguuuacuc hsa-miR-134 ugugacugguugaccagagggg hsa-miR-638 agggaucgcgggcggguggcggccu hsa-miR-200b* caucuuacugggcagcauugga hsa-miR-1225-5p guggguacggcccagugggggg hsa-miR-557 guuugcacgggugggccuugucu hsa-miR-100 aacccguagauccgaacuugug hsa-miR-223 ugucaguuugucaaauacccca hsa-miR-424 cagcagcaauucauguuuugaa hsa-miR-21* caacaccagucgaugggcugu hsa-miR-99a aacccguagauccgaucuugug hsa-miR-148a ucagugcacuacagaacuuugu hsa-miR-34a uggcagugucuuagcugguugu hsa-miR-542-3p ugugacagauugauaacugaaa hsa-miR-200a* caucuuaccggacagugcugga

hsa-miR-375 uuuguucguucggcucgcguga

hsa-miR-126 ucguaccgugaguaauaaugcg

hsa-miR-126* cauuauuacuuuugguacgcg

hsa-miR-30a uguaaacauccucgacuggaag

hsa-miR-218 uugugcuugaucuaaccaugu

hsa-miR-21 uagcuuaucagacugauguuga

hsa-miR-145 guccaguuuucccaggaaucccu

hsa-miR-140-3p uaccacaggguagaaccacgg

hsa-miR-101 uacaguacugugauaacugaa

hsa-miR-143 ugagaugaagcacuguagcuc

hsa-miR-140-5p cagugguuuuacccuaugguag

hsa-miR-224 caagucacuagugguuccguu

hsa-miR-200b uaauacugccugguaaugauga

hsa-miR-195 uagcagcacagaaauauuggc

hsa-miR-210 cugugcgugugacagcggcuga

hsa-miR-7 uggaagacuagugauuuuguugu

hsa-miR-141 uaacacugucugguaaagaugg

hsa-miR-192 cugaccuaugaauugacagcc

The nucleic acid expression signature, as defined herein, may comprises at least hundred- twelve nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least nine nucleic acid molecules. In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-144 (SEQ ID NO:3), hsa-miR-451(SEQ ID NO:4), hsa-miR-200c (SEQ ID NO:5), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR-497 (SEQ ID NO:14), hsa-miR-218 (SEQ ID NO:57), hsa-miR-145 (SEQ ID NO:58), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-30b (SEQ ID NO: 17), hsa-miR-93 (SEQ ID NO: 18), hsa-miR-126 (SEQ ID NO:54), hsa-miR-126* (SEQ ID NO:55), hsa-miR-30a (SEQ ID NO:56), hsa-miR-143 (SEQ ID NO:61), hsa-miR-103 (SEQ ID NO:91), hsa-miR-183 (SEQ ID NO:l), hsa- miR-96 (SEQ ID NO:2), hsa-miR-139-5p (SEQ ID NO: 8), hsa-miR-130b (SEQ ID NO:9), hsa-miR-30a* (SEQ ID NO:10), hsa-miR-144* (SEQ ID NO:l l), hsa-miR-425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-182 (SEQ ID NO:15), hsa- miR-187* (SEQ ID NO:16), hsa-miR-145* (SEQ ID NO:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID NO:21), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c- 2* (SEQ ID NO:25), hsa-miR-98 (SEQ ID NO:26), hsa-miR-1 (SEQ ID NO:27), hsa- miR-106b (SEQ ID NO:28), hsa-miR-150* (SEQ ID NO:29), hsa-miR-25 (SEQ ID NO:30), hsa-miR-134 (SEQ ID NO:31), hsa-miR-328 (SEQ ID NO:32), hsa-miR-638 (SEQ ID NO:33), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-1224-5p (SEQ ID NO:36), hsa-miR-557 (SEQ ID NO:37), hsa-miR-15b (SEQ ID NO:38), hsa-miR-301a (SEQ ID NO:40), hsa-miR-196b (SEQ ID NO:44), hsa-miR-196a (SEQ ID NO:45), hsa-miR-1226* (SEQ ID NO:46), hsa-miR-424 (SEQ ID NO:47), hsa-miR-21* (SEQ ID NO:48), hsa-miR-572 (SEQ ID NO:49), hsa-miR-18b (SEQ ID NO:50), hsa-miR- 18a (SEQ ID NO:51), hsa-miR-9* (SEQ ID NO:52), hsa-miR-301b (SEQ ID NO:53), hsa-miR-29c* (SEQ ID NO:64), hsa-miR-494 (SEQ ID NO:83), hsa-miR-193b (SEQ ID NO:84), hsa-miR-375 (SEQ ID NO:90), hsa-miR-26a (SEQ ID NO:92), hsa-miR- 574-3p (SEQ ID NO:93), hsa-miR-151-3p (SEQ ID NO:94), hsa-miR-149 (SEQ ID NO:95), hsa-miR-768-5p (SEQ ID NO:96), hsa-miR-181a (SEQ ID NO:97), hsa-miR- 20a (SEQ ID NO:98), hsa-miR-181c (SEQ ID NO:99), hsa-miR-29a (SEQ ID NO:100), hsa-miR-29b (SEQ ID NO: 101), hsa-miR-505 (SEQ ID NO: 102), hsa-miR-939 (SEQ ID NO: 103), hsa-miR-769-5p (SEQ ID NO: 104), hsa-miR-30c (SEQ ID NO: 105), hsa- miR-590-5p (SEQ ID NO:106), hsa-miR-671-5p (SEQ ID NO:107), hsa-miR-625 (SEQ ID NO:108), hsa-miR-652 (SEQ ID NO:109), hsa-miR-139-3p (SEQ ID NO:110), hsa- miR-28-5p (SEQ ID NO: 111), hsa-miR-623 (SEQ ID NO: 112), hsa-miR-221 (SEQ ID NO:113), hsa-miR-19a (SEQ ID NO:114), hsa-miR-944 (SEQ ID NO:115), hsa-miR- 335 (SEQ ID NO:116), hsa-miR-125a-5p (SEQ ID NO:117), hsa-miR-551b (SEQ ID NO:118), hsa-let-7d* (SEQ ID NO:119), hsa-miR-31* (SEQ ID NO:120), hsa-miR- 362-5p (SEQ ID NO:121), hsa-miR-181a* (SEQ ID NO:122), hsa-miR-940 (SEQ ID NO: 123), hsa-miR-30b* (SEQ ID NO: 124), hsa-miR-601 (SEQ ID NO: 125), hsa-miR- 20b (SEQ ID NO:126), hsa-miR-202 (SEQ ID NO:127), hsa-miR-101 (SEQ ID NO:60), hsa-miR-140-5p (SEQ ID NO:62), hsa-miR-30d (SEQ ID NO:6)3, hsa-miR-29c (SEQ ID NO:64), hsa-miR-224 (SEQ ID NO:66), hsa-miR-9 (SEQ ID NO:68), hsa-miR-200b (SEQ ID NO:69), hsa-miR-195 (SEQ ID NO:70), hsa-miR-210 (SEQ ID NO:71), hsa- miR-7 (SEQ ID NO:72), hsa-miR-21 (SEQ ID NO:73), hsa-miR-17 (SEQ ID NO:74), hsa-miR-128 (SEQ ID NO:75), hsa-miR-141 (SEQ ID NO:76), hsa-miR-142-5p (SEQ ID NO:77), hsa-miR-150 (SEQ ID NO:78) and hsa-miR-205 (SEQ ID NO:79).

Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-200c, hsa-miR-93, hsa-miR-103, hsa-miR-183, hsa-miR- 96, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-98, hsa-miR- 106b, hsa-miR-25, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, hsa- miR-424, hsa-miR-21*, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa- miR-494, hsa-miR-193b, hsa-miR-151-3p, hsa-miR-149, hsa-miR-20a, hsa-miR-505, hsa-miR-769-5p, hsa-miR-590-5p, hsa-miR-590-5p, hsa-miR-625, hsa-miR-28-5p, hsa- miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-31*, hsa-miR-362-5p, hsa-miR-20b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa- miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR- 140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-143, hsa- miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-133b, hsa-miR-187*, hsa-miR- 145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa- miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR- 1224-5p, hsa-miR- 557, hsa-miR-1226*, hsa-miR-572, hsa-miR-29c*, hsa-miR-375, hsa-miR-26a, hsa- miR-574-3p, hsa-miR-768-5p, hsa-miR-181a, hsa-miR-181c, hsa-miR-29a, hsa-miR- 29b, hsa-miR-939, hsa-miR-30c, hsa-miR-671-5p, hsa-miR-652, hsa-miR- 139-3p, hsa- miR-623, hsa-miR-335, hsa-miR- 125a-5p, hsa-miR-551b, hsa-let-7d*, hsa-miR- 18 la*, hsa-miR-940, hsa-miR-30b*, hsa-miR-601, hsa-miR-202, hsa-miR-101, hsa-miR-140- 5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 is down- regulated in the one or more target cells compared to the one or more normal control cells.

The nucleic acid sequences of the above -referenced miRNAs are listed in Table

4.

TAB LE 4

miRNA Sequence (5'→ 3')

hsa-miR-144 uacaguauagaugauguacu

hsa-miR-451 aaaccguuaccauuacugaguu

hsa-miR-200c uaauacugccggguaaugaugga

hsa-miR-486-5p uccuguacugagcugccccgag

hsa-miR-338-3p uccagcaucagugauuuuguug

hsa-miR-497 cagcagcacacugugguuugu

hsa-miR-30b uguaaacauccuacacucagcu

hsa-miR-93 caaagugcuguucgugcagguag

hsa-miR- 103 agcagcauuguacagggcuauga

hsa-miR-183 uauggcacugguagaauucacu

hsa-miR-96 uuuggcacuagcacauuuuugcu

hsa-miR- 139-5p ucuacagugcacgugucuccag

hsa-miR- 130b cagugcaaugaugaaagggcau

hsa-miR-30a* cuuucagucggauguuugcagc

hsa-miR-144* ggauaucaucauauacuguaag

hsa-miR-425 aaugacacgaucacucccguuga

hsa-miR- 133b uuugguccccuucaaccagcua

hsa-miR- 182 uuuggcaaugguagaacucacacu

hsa-miR- 187* ggcuacaacacaggacccgggc

hsa-miR- 145* ggauuccuggaaauacuguucu

hsa-miR-429 uaauacugucugguaaaaccgu

hsa-miR-498 uuucaagccagggggcguuuuuc

hsa-miR- 130a cagugcaauguuaaaagggcau

hsa-miR-30c-2* cugggagaaggcuguuuacuc hsa-miR-98 ugagguaguaaguuguauuguu hsa-miR-1 uggaauguaaagaaguauguau hsa-miR-106b uaaagugcugacagugcagau hsa-miR-150* cugguacaggccugggggacag hsa-miR-25 cauugcacuugucucggucuga hsa-miR-134 ugugacugguugaccagagggg hsa-miR-328 cuggcccucucugcccuuccgu hsa-miR-638 agggaucgcgggcggguggcggccu hsa-miR-1225-5p guggguacggcccagugggggg hsa-miR-1224-5p gugaggacucgggaggugg hsa-miR-557 guuugcacgggugggccuugucu hsa-miR-15b uagcagcacaucaugguuuaca hsa-miR-301a cagugcaauaguauugucaaagc hsa-miR-196b uagguaguuuccuguuguuggg hsa-miR-196a uagguaguuucauguuguuggg hsa-miR-1226* gugagggcaugcaggccuggaugggg hsa-miR-424 cagcagcaauucauguuuugaa hsa-miR-21* caacaccagucgaugggcugu hsa-miR-572 guccgcucggcgguggccca hsa-miR-18b uaaggugcaucuagugcaguuag hsa-miR-18a uaaggugcaucuagugcagauag hsa-miR-9* auaaagcuagauaaccgaaagu hsa-miR-301b cagugcaaugauauugucaaagc hsa-miR-29c uagcaccauuugaaaucgguua hsa-miR-494 ugaaacauacacgggaaaccuc hsa-miR-193b aacuggcccucaaagucccgcu hsa-miR-375 uuuguucguucggcucgcguga hsa-miR-26a uucaaguaauccaggauaggcu hsa-miR-574-3p cacgcucaugcacacacccaca hsa-miR-151-3p cuagacugaagcuccuugagg hsa-miR-149 ucuggcuccgugucuucacuccc hsa-miR-768-5p Bad entry!

hsa-miR-18 la aacauucaacgcugucggugagu hsa-miR-20a uaaagugcuuauagugcagguag hsa-miR-181c aacauucaaccugucggugagu hsa-miR-29a uagcaccaucugaaaucgguua hsa-miR-29b uagcaccauuugaaaucaguguu hsa-miR-505 cgucaacacuugcugguuuccu hsa-miR-939 uggggagcugaggcucugggggug hsa-miR-769-5p ugagaccucuggguucugagcu hsa-miR-30c uguaaacauccuacacucucagc hsa-miR-590-5p gagcuuauucauaaaagugcag hsa-miR-671-5p aggaagcccuggaggggcuggag hsa-miR-625 agggggaaaguucuauagucc hsa-miR-652 aauggcgccacuaggguugug hsa-miR-139-3p ggagacgcggcccuguuggagu hsa-miR-28-5p aaggagcucacagucuauugag hsa-miR-623 aucccuugcaggggcuguugggu hsa-miR-221 agcuacauugucugcuggguuuc hsa-miR-19a ugugcaaaucuaugcaaaacuga hsa-miR-944 aaauuauuguacaucggaugag hsa-miR-335 ucaagagcaauaacgaaaaaugu hsa-miR-125a-5p ucccugagacccuuuaaccuguga hsa-miR-551b gcgacccauacuugguuucag hsa-let-7d* cuauacgaccugcugccuuucu hsa-miR-31* ugcuaugccaacauauugccau hsa-miR-362-5p aauccuuggaaccuaggugugagu hsa-miR-181a* accaucgaccguugauuguacc hsa-miR-940 aaggcagggcccccgcucccc hsa-miR-30b* cugggagguggauguuuacuuc hsa-miR-601 uggucuaggauuguuggaggag hsa-miR-20b caaagugcucauagugcagguag hsa-miR-202 agagguauagggcaugggaa hsa-miR-218 uugugcuugaucuaaccaugu hsa-miR-145 guccaguuuucccaggaaucccu hsa-miR-140-3p uaccacaggguagaaccacgg hsa-miR-126 ucguaccgugaguaauaaugcg hsa-miR-126* cauuauuacuuuugguacgcg hsa-miR-30a uguaaacauccucgacuggaag hsa-miR-143 ugagaugaagcacuguagcuc hsa-miR-101 uacaguacugugauaacugaa hsa-miR-140-5p cagugguuuuacccuaugguag hsa-miR-30d uguaaacauccccgacuggaag hsa-miR-224 caagucacuagugguuccguu hsa-miR-9 ucuuugguuaucuagcuguauga hsa-miR-200b uaauacugccugguaaugauga hsa-miR-195 uagcagcacagaaauauuggc hsa-miR-210 cugugcgugugacagcggcuga hsa-miR-7 uggaagacuagugauuuuguugu hsa-miR-21 uagcuuaucagacugauguuga hsa-miR-17 caaagugcuuacagugcagguag hsa-miR-128 ucacagugaaccggucucuuu hsa-miR-141 uaacacugucugguaaagaugg hsa-miR-142-5p cauaaaguagaaagcacuacu hsa-miR-150 ucucccaacccuuguaccagug

hsa-miR-205 uccuucauuccaccggagucug

The nucleic acid expression signature, as defined herein, may comprises at least hundred- sixteen nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least eleven nucleic acid molecules.

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96 (SEQ ID NO:2), hsa-miR-144 (SEQ ID NO:3), hsa-miR-93 (SEQ ID NO:18), hsa-miR-106b (SEQ ID NO:28), hsa-miR-25 (SEQ ID NO:30), hsa-miR-15b (SEQ ID NO:38), hsa-miR-145 (SEQ ID NO:58), hsa-miR-375 (SEQ ID NO:90), hsa-miR-103 (SEQ ID NO:91), hsa- miR-20a (SEQ ID NO:98), hsa-miR-107 (SEQ ID NO:129), hsa-miR-451 (SEQ ID NO:4), hsa-miR-130b (SEQ ID NO:7), hsa-miR-454 (SEQ ID NO:39), hsa-miR-30a (SEQ ID NO:56), hsa-miR-17 (SEQ ID NO:74), hsa-miR-183 (SEQ ID NO:l), hsa- miR-486-5p (SEQ ID NO:6), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR-30a* (SEQ ID NO:10), hsa-miR-144* (SEQ ID NO:l l), hsa-miR- 425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-497 (SEQ ID N0:14), hsa-miR-182 (SEQ ID N0:15), hsa-miR-187* (SEQ ID N0:16), hsa-miR-30b (SEQ ID N0:17), hsa-miR-145* (SEQ ID N0:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID N0:21), hsa-miR-200a (SEQ ID NO:22), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c-2* (SEQ ID NO:25), hsa-miR-98 (SEQ ID NO:26), hsa-miR-1 (SEQ ID NO:27), hsa-miR-150* (SEQ ID NO:29), hsa-miR-134 (SEQ ID N0:31), hsa-miR-328 (SEQ ID NO:32), hsa-miR-638 (SEQ ID NO:33), hsa-miR-200b* (SEQ ID NO:34), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-1224-5p (SEQ ID NO:36), hsa-miR-557 (SEQ ID NO:37), hsa-miR-152 (SEQ ID NO:38), hsa-miR-301a , (SEQ ID NO:40), hsa-miR-lOO (SEQ ID NO:42), hsa-miR-223 (SEQ ID NO:43), hsa-miR-196b (SEQ ID NO:44), hsa-miR-1226* (SEQ ID NO:46), hsa-miR-572 (SEQ ID NO:49), hsa-miR- 18b (SEQ ID NO:50), hsa-miR-9* (SEQ ID NO:52), hsa-miR-301b (SEQ ID NO:53), hsa-miR-199b-3p (SEQ ID NO:65), hsa-miR-34a (SEQ ID NO:87), hsa-miR-200a* (SEQ ID NO:89), hsa-miR-26a (SEQ ID NO:92), hsa-miR-574-3p (SEQ ID NO:93), hsa-miR-768-5p (SEQ ID NO:96), hsa-miR-29a (SEQ ID NO: 100), hsa-miR-29b (SEQ ID NO: 101), hsa-miR-505 (SEQ ID NO: 102), hsa-miR-939 (SEQ ID NO: 103), hsa- miR-769-5p (SEQ ID NO:104), hsa-miR-625 (SEQ ID NO:108), hsa-miR-139-3p (SEQ ID NO:110), hsa-miR-19a (SEQ ID NO: 114), hsa-miR-551b (SEQ ID NO:118), hsa- miR-362-5p (SEQ ID NO:121), hsa-miR-181a* (SEQ ID NO:122), hsa-miR-940 (SEQ ID NO: 123), hsa-miR-601 (SEQ ID NO: 125), hsa-miR-20b (SEQ ID NO: 126), hsa- miR-23a (SEQ ID NO:130), hsa-miR-27a (SEQ ID NO:131), hsa-miR-199a-5p (SEQ ID NO: 132), hsa-let-7i (SEQ ID NO: 133), hsa-miR-19b (SEQ ID NO: 134), hsa-miR- 20a* (SEQ ID NO:135), hsa-miR-17* (SEQ ID NO:136), hsa-miR-22 (SEQ ID NO: 137), hsa-miR-340* (SEQ ID NO: 138), hsa-miR-214 (SEQ ID NO: 139), hsa-miR- 592 (SEQ ID NO: 140), hsa-miR-335* (SEQ ID NO: 141), hsa-miR-29c* (SEQ ID NO: 142), hsa-miR-421 (SEQ ID NO: 143), hsa-miR-886-3p (SEQ ID NO: 144), hsa- miR-16-2* (SEQ ID NO:145), hsa-miR-135a (SEQ ID NO:146), hsa-miR-183* (SEQ ID NO: 147), hsa-miR-7-1* (SEQ ID NO: 148), hsa-miR-26b (SEQ ID NO: 149), hsa- miR-455-3p (SEQ ID NO: 150), hsa-miR-222 (SEQ ID NO: 151), hsa-miR-95 (SEQ ID NO:152), hsa-miR-564 (SEQ ID NO:153), hsa-miR-636 (SEQ ID NO:154), hsa-miR- 34b*(SEQ ID NO:155), hsa-miR-18a (SEQ ID NO:51), hsa-miR-126 (SEQ ID NO:54), hsa-miR-126* (SEQ ID NO:55), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-101 (SEQ ID NO:60), hsa-miR-143 (SEQ ID N0:61), hsa-miR-140-5p (SEQ ID NO:62), hsa- miR-29c (SEQ ID NO:64), hsa-miR-199b-5p (SEQ ID NO:65), hsa-miR-125a-3p (SEQ ID NO:67), hsa-miR-9 (SEQ ID NO:68), hsa-miR-200b (SEQ ID NO:69), hsa-miR-210 (SEQ ID N0:71), hsa-miR-7 (SEQ ID NO:72), hsa-miR-128 (SEQ ID NO:75) and hsa-miR-106a (SEQ ID NO: 82).

The nucleic acid sequences of the above -referenced miRNAs are listed in Table

5. TAB LE 5

miRNA Sequence (5'→ 3') hsa-miR-96 uuuggcacuagcacauuuuugcu hsa-miR-144 uacaguauagaugauguacu hsa-miR-451 aaaccguuaccauuacugaguu hsa-miR-130b cagugcaaugaugaaagggcau hsa-miR-93 caaagugcuguucgugcagguag hsa-miR-25 cauugcacuugucucggucuga hsa-miR-15b uagcagcacaucaugguuuaca hsa-miR-454 uagugcaauauugcuuauagggu hsa-miR-375 uuuguucguucggcucgcguga hsa-miR-103 agcagcauuguacagggcuauga hsa-miR-107 agcagcauuguacagggcuauca hsa-miR-183 uauggcacugguagaauucacu hsa-miR-486-5p uccuguacugagcugccccgag hsa-miR-338-3p uccagcaucagugauuuuguug hsa-miR-139-5p ucuacagugcacgugucuccag hsa-miR-30a* cuuucagucggauguuugcagc hsa-miR-144* ggauaucaucauauacuguaag hsa-miR-425 aaugacacgaucacucccguuga hsa-miR-133b uuugguccccuucaaccagcua hsa-miR-497 cagcagcacacugugguuugu hsa-miR-182 uuuggcaaugguagaacucacacu hsa-miR-187* ggcuacaacacaggacccgggc hsa-miR-30b uguaaacauccuacacucagcu hsa-miR-145* ggauuccuggaaauacuguucu hsa-miR-429 uaauacugucugguaaaaccgu hsa-miR-498 uuucaagccagggggcguuuuuc hsa-miR-200a uaacacugucugguaacgaugu hsa-miR-130a cagugcaauguuaaaagggcau hsa-miR-30c-2* cugggagaaggcuguuuacuc hsa-miR-98 ugagguaguaaguuguauuguu hsa-miR-1 uggaauguaaagaaguauguau hsa-miR-150* cugguacaggccugggggacag hsa-miR-134 ugugacugguugaccagagggg hsa-miR-328 cuggcccucucugcccuuccgu hsa-miR-638 agggaucgcgggcggguggcggccu hsa-miR-200b* caucuuacugggcagcauugga hsa-miR-1225-5p guggguacggcccagugggggg hsa-miR-1224-5p gugaggacucgggaggugg hsa-miR-557 guuugcacgggugggccuugucu hsa-miR-152 ucagugcaugacagaacuugg hsa-miR-301a cagugcaauaguauugucaaagc hsa-miR-100 aacccguagauccgaacuugug hsa-miR-223 ugucaguuugucaaauacccca hsa-miR-196b uagguaguuuccuguuguuggg hsa-miR-1226* gugagggcaugcaggccuggaugggg hsa-miR-572 guccgcucggcgguggccca hsa-miR-18b uaaggugcaucuagugcaguuag hsa-miR-9* auaaagcuagauaaccgaaagu hsa-miR-301b cagugcaaugauauugucaaagc hsa-miR-199b-3p cccaguguuuagacuaucuguuc hsa-miR-34a uggcagugucuuagcugguugu hsa-miR-200a* caucuuaccggacagugcugga hsa-miR-26a uucaaguaauccaggauaggcu hsa-miR-574-3p cacgcucaugcacacacccaca hsa-miR-768-5p Bad entry

hsa-miR-29a uagcaccaucugaaaucgguua hsa-miR-29b uagcaccauuugaaaucaguguu hsa-miR-505 cgucaacacuugcugguuuccu hsa-miR-939 uggggagcugaggcucugggggug hsa-miR-769-5p ugagaccucuggguucugagcu hsa-miR-625 agggggaaaguucuauagucc hsa-miR-139-3p ggagacgcggcccuguuggagu hsa-miR-19a ugugcaaaucuaugcaaaacuga hsa-miR-551b gcgacccauacuugguuucag hsa-miR-362-5p aauccuuggaaccuaggugugagu hsa-miR-181a* accaucgaccguugauuguacc hsa-miR-940 aaggcagggcccccgcucccc hsa-miR-601 uggucuaggauuguuggaggag hsa-miR-20b caaagugcucauagugcagguag hsa-miR-23a aucacauugccagggauuucc hsa-miR-27a uucacaguggcuaaguuccgc hsa-miR-199a-5p cccaguguucagacuaccuguuc hsa-let-7i ugagguaguaguuugugcuguu hsa-miR-19b ugugcaaauccaugcaaaacuga hsa-miR-20a* acugcauuaugagcacuuaaag hsa-miR-17* acugcagugaaggcacuuguag hsa-miR-22 aagcugccaguugaagaacugu hsa-miR-340* uccgucucaguuacuuuauagc hsa-miR-214 acagcaggcacagacaggcagu hsa-miR-592 uugugucaauaugcgaugaugu hsa-miR-335* uuuuucauuauugcuccugacc hsa-miR-29c* ugaccgauuucuccugguguuc hsa-miR-421 aucaacagacauuaauugggcgc hsa-miR-886-3p cgcgggugcuuacugacccuu hsa-miR-16-2* ccaauauuacugugcugcuuua hsa-miR-135a uauggcuuuuuauuccuauguga hsa-miR-183* gugaauuaccgaagggccauaa hsa-miR-7-1* caacaaaucacagucugccaua hsa-miR-26b uucaaguaauucaggauaggu hsa-miR-455-3p gcaguccaugggcauauacac hsa-miR-222 agcuacaucuggcuacugggu hsa-miR-95 uucaacggguauuuauugagca hsa-miR-564 aggcacggugucagcaggc hsa-miR-636 ugugcuugcucgucccgcccgca hsa-miR-34b* uaggcagugucauuagcugauug hsa-miR-106b uaaagugcugacagugcagau hsa-miR-30a uguaaacauccucgacuggaag hsa-miR-145 guccaguuuucccaggaaucccu hsa-miR-17 caaagugcuuacagugcagguag hsa-miR-20a uaaagugcuuauagugcagguag hsa-miR-18a uaaggugcaucuagugcagauag hsa-miR-126 ucguaccgugaguaauaaugcg hsa-miR-126* cauuauuacuuuugguacgcg hsa-miR-140-3p uaccacaggguagaaccacgg hsa-miR-101 uacaguacugugauaacugaa hsa-miR-143 ugagaugaagcacuguagcuc hsa-miR-140-5p cagugguuuuacccuaugguag hsa-miR-29c uagcaccauuugaaaucgguua hsa-miR-199b-5p cccaguguuuagacuaucuguuc

hsa-miR-125a-3p acaggugagguucuugggagcc

hsa-miR-9 ucuuugguuaucuagcuguauga

hsa-miR-200b uaauacugccugguaaugauga

hsa-miR-210 cugugcgugugacagcggcuga

hsa-miR-7 uggaagacuagugauuuuguugu

hsa-miR-128 ucacagugaaccggucucuuu

hsa-miR-106a aaaagugcuuacagugcagguag

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-375 (SEQ ID NO:90), hsa-miR-335 (SEQ ID NO: 116), hsa-miR-23a (SEQ ID NO: 130), hsa-miR-27a (SEQ ID NO:131), hsa-miR-22 (SEQ ID NO:137), hsa-miR-592 (SEQ ID NO:140), hsa-miR- 135a (SEQ ID NO: 146), hsa-miR-24 (SEQ ID NO: 156), hsa-miR-454 (SEQ ID NO:39), hsa-miR-301a (SEQ ID NO:40), hsa-miR-199b-5p (SEQ ID NO:65), hsa-miR-9 (SEQ ID NO:68), hsa-miR-34a (SEQ ID NO:87), hsa-miR-199a-5p (SEQ ID NO:132), hsa- miR-335* (SEQ ID N0:141), hsa-miR-152 (SEQ ID NO:157) and hsa-miR-216b (SEQ ID NO:158).

The nucleic acid sequences of the above -referenced miRNAs are listed in Table

6.

TAB LE 6

miRNA Sequence (5'→ 3')

hsa-miR-375 uuuguucguucggcucgcguga

hsa-miR-335 ucaagagcaauaacgaaaaaugu

hsa-miR-23a aucacauugccagggauuucc

hsa-miR-27a uucacaguggcuaaguuccgc

hsa-miR-22 aagcugccaguugaagaacugu

hsa-miR-592 uugugucaauaugcgaugaugu

hsa-miR-135a uauggcuuuuuauuccuauguga

hsa-miR-24 uggcucaguucagcaggaacag

hsa-miR-454 uagugcaauauugcuuauagggu

hsa-miR-301a cagugcaauaguauugucaaagc

hsa-miR-199b-5p cccaguguuuagacuaucuguuc

hsa-miR-9 ucuuugguuaucuagcuguauga

hsa-miR-34a uggcagugucuuagcugguugu

hsa-miR-199a-5p cccaguguucagacuaccuguuc

hsa-miR-335* uuuuucauuauugcuccugacc

hsa-miR-152 ucagugcaugacagaacuugg

hsa-miR-216b aaaucucugcaggcaaauguga All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-25 (SEQ ID NO:30), hsa-miR-205 (SEQ ID NO:79), hsa-miR-34a (SEQ ID NO:87), hsa-miR-375 (SEQ ID NO:90), hsa-miR-29a (SEQ ID NO:100), hsa-miR-27a (SEQ ID NO:131), hsa-miR-29b (SEQ ID NO:101), hsa-miR-93 (SEQ ID NO:18), hsa-miR-106b (SEQ ID NO:28), hsa- miR-15b (SEQ ID NO:38), hsa-miR-454 (SEQ ID NO:39), hsa-miR-301a (SEQ ID NO:40), hsa-miR-145 (SEQ ID NO:58), hsa-miR-29c (SEQ ID NO:64), hsa-miR-221 (SEQ ID NO:113), hsa-miR-335 (SEQ ID NO:116), hsa-miR-23a (SEQ ID NO:130), hsa-miR-199a-5p (SEQ ID NO: 132), hsa-miR-22 (SEQ ID NO: 137), hsa-miR-592 (SEQ ID NO:140), hsa-miR-95 (SEQ ID NO:152), hsa-miR-24 (SEQ ID NO:7156) andhsa-miR-92a (SEQ ID NO: 160). Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-34a, hsa-miR-29a, hsa-miR-29b, hsa-miR-145, hsa-miR- 29c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa-miR-93, hsa-miR-301a, hsa-miR-106b, hsa-miR-15b, hsa- miR-92a is down-regulated in adenocarcinoma lung cancer compared to small cell lung cancer and squamous cell lung cancer; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa-miR-27a, hsa-miR-221 is up-regulated in adenocarcinoma lung cancer compared to small cell lung but is down-regulated compared to squamous cell lung cancer; the expression of hsa-miR-375 is up-regulated in adenocarcinoma lung cancer compared to squamous cell lung cancer but is down- regulated compared to small cell lung; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-24, hsa-miR-23a, hsa-miR-22, hsa-miR-199a-5p is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-592, hsa-miR-335, hsa-miR-95, hsa-miR-454 is down-regulated in adenocarcinoma lung cancer compared to small cell lung.

The nucleic acid sequences of the above -referenced miRNAs are listed in Table

7.

TAB LE 7

miRNA Sequence (5'→ 3')

hsa-miR-25 cauugcacuugucucggucuga

hsa-miR-205 uccuucauuccaccggagucug

hsa-miR-34a uggcagugucuuagcugguugu

hsa-miR-375 uuuguucguucggcucgcguga

hsa-miR-29a uagcaccaucugaaaucgguua

hsa-miR-29b uagcaccauuugaaaucaguguu

hsa-miR-27a uucacaguggcuaaguuccgc

hsa-miR-93 caaagugcuguucgugcagguag

hsa-miR-106b uaaagugcugacagugcagau

hsa-miR-15b uagcagcacaucaugguuuaca

hsa-miR-454 uagugcaauauugcuuauagggu

hsa-miR-301a cagugcaauaguauugucaaagc

hsa-miR-145 guccaguuuucccaggaaucccu

hsa-miR-29c uagcaccauuugaaaucgguua

hsa-miR-221 agcuacauugucugcuggguuuc hsa-miR-335 ucaagagcaauaacgaaaaaugu

hsa-miR-23a aucacauugccagggauuucc

hsa-miR-199a-5p cccaguguucagacuaccuguuc

hsa-miR-22 aagcugccaguugaagaacugu

hsa-miR-592 uugugucaauaugcgaugaugu

hsa-miR-95 uucaacggguauuuauugagca

hsa-miR-24 uggcucaguucagcaggaacag

hsa-miR-92a uauugcacuugucccggccugu

In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-497 (SEQ ID NO: 14), hsa-miR-93 (SEQ ID NO: 18), hsa-miR-25 (SEQ ID NO:30), hsa-miR-29c (SEQ ID NO:64), hsa-miR-205 (SEQ ID NO:79), hsa-miR-375 (SEQ ID NO:90), hsa-miR-149 (SEQ ID NO:95), hsa-miR-29a (SEQ ID NO:100), hsa-miR-1 (SEQ ID NO:27), hsa- miR-15b (SEQ ID NO:38), hsa-miR-181c (SEQ ID NO:99), hsa-miR-29b (SEQ ID NO: 101), hsa-miR-769-5p (SEQ ID NO: 104) and hsa-miR-221 (SEQ ID NO: 113).

The nucleic acid sequences of the above -referenced miRNAs are listed in Table 8.

TAB LE 8

The term "modifying the expression of a nucleic acid molecule encoding a miRNA sequence", as used herein, denotes any manipulation of a particular nucleic acid molecule resulting in an altered expression level of said molecule, that is, the production of a different amount of corresponding miRNA as compared to the expression of the "wild-type" (i.e. the unmodified control). The term "different amount", as used herein, includes both a higher amount and a lower amount than determined in the unmodified control. In other words, a manipulation, as defined herein, may either up-regulate (i.e. activate) or down-regulate (i.e. inhibit) the expression (i.e. particularly transcription) of a nucleic acid molecule.

Within the present invention, expression of one or more nucleic acid molecules encoding a microRNA sequence comprised in the nucleic acid expression signature is modified in such way that the expression of a nucleic acid molecule whose expression is up-regulated in cells is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in cells is up-regulated. In other words, the modification of expression of a particular nucleic acid molecule encoding a miRNA sequence occurs in an anti-cyclical pattern to the regulation of said molecule in cells of cancer patients in order to interfere with the "excess activity" of an up-regulated molecule and/or to restore the "deficient activity" of a down-regulated molecule in cells.

In a preferred embodiment of the inventive method, down-regulating the expression of a nucleic acid molecule comprises introducing into the patient a nucleic acid molecule encoding a sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated.

The term "complementary sequence", as used herein, is to be understood that the "complementary" nucleic acid molecule (herein also referred to as an "anti-sense nucleic acid molecule") introduced into blood is capable of forming base pairs, preferably Watson-Crick base pairs, with the up-regulated endogenous "sense" nucleic acid molecule.

Two nucleic acid molecules (i.e. the "sense" and the "anti-sense" molecule) may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides. In other embodiments, the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions). In further embodiments, the "complementary" nucleic acid molecule comprises a stretch of at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in the up-regulated "sense" nucleic acid molecule.

The "complementary" nucleic acid molecule (i.e. the nucleic acid molecule encoding a nucleic acid sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated) may be a naturally occurring DNA- or RNA molecule or a synthetic nucleic acid molecule comprising in its sequence one or more modified nucleotides which may be of the same type or of one or more different types.

For example, it may be possible that such a nucleic acid molecule comprises at least one ribonucleotide backbone unit and at least one deoxyribonucleotide backbone unit. Furthermore, the nucleic acid molecule may contain one or more modifications of the RNA backbone into 2'-O-methyl group or 2'-O-methoxyethyl group (also referred to as "2'-O-methylation"), which prevented nuclease degradation in the culture media and, importantly, also prevented endonucleolytic cleavage by the RNA-induced silencing complex nuclease, leading to irreversible inhibition of the miRNA. Another possible modification - which is functionally equivalent to 2'-O-methylation - involves locked nucleic acids (LNAs) representing nucleic acid analogs containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA-mimicking sugar conformation (Orom, U.A. et al. (2006) Gene 372, 137-141).

Another class of silencers of miRNA expression was recently developed. These chemically engineered oligonucleotides, named "antagomirs", represent single- stranded 23-nucleotide RNA molecules conjugated to cholesterol (Krutzfeldt, J. et al. (2005) Nature 438, 685-689). As an alternative to such chemically modified oligonucleotides, microRNA inhibitors that can be expressed in cells, as RNAs produced from transgenes, were generated as well. Termed "microRNA sponges", these competitive inhibitors are transcripts expressed from strong promoters, containing multiple, tandem binding sites to a microRNA of interest (Ebert, M.S. et al. (2007) Nat. Methods 4, 721-726).

In order to unravel any potential implication of the miRNAs identified in the cancerous or pre-cancerous samples preliminary functional analyses may be performed with respect to the identification of mRNA target sequences to which the miRNAs may bind. Based on the finding that miRNAs may be involved in both tumor suppression and tumorigenesis (Esquela-Kerscher, A. and Slack, F.J (2006) supra; Calin, G.A. and Croce, CM. (2007) supra; Blenkiron, C. and Miska, E.A. (2007) supra) it is likely to speculate that mRNA target sites for such miRNAs include tumor suppressor genes as well as oncogenes.

A nucleic acid molecule is referred to as "capable of expressing a nucleic acid molecule" or capable "to allow expression of a nucleotide sequence" if it comprises sequence elements which contain information regarding to transcriptional and/or translational regulation, and such sequences are "operably linked" to the nucleotide sequence encoding the polypeptide. An operable linkage is a linkage in which the regulatory sequence elements and the sequence to be expressed (and/or the sequences to be expressed among each other) are connected in a way that enables gene expression.

The precise nature of the regulatory regions necessary for gene expression may vary among species, but in general these regions comprise a promoter which, in prokaryotes, contains both the promoter per se, i.e. DNA elements directing the initiation of transcription, as well as DNA elements which, when transcribed into RNA, will signal the initiation of translation. Such promoter regions normally include 5' non- coding sequences involved in initiation of transcription and translation, such as the -35/- 10 boxes and the Shine-Dalgarno element in prokaryotes or the TATA box, CAAT sequences, and 5'-capping elements in eukaryotes. These regions can also include enhancer or repressor elements as well as translated signal and leader sequences for targeting the native polypeptide to a specific compartment of a host cell. In addition, the 3' non-coding sequences may contain regulatory elements involved in transcriptional termination, polyadenylation or the like. If, however, these termination sequences are not satisfactory functional in a particular host environment, then they may be substituted with signals functional in that environment.

Furthermore, the expression of the nucleic molecules, as defined herein, may also be influenced by the presence, e.g., of modified nucleotides (cf. the discussion above). For example, locked nucleic acid (LNA) monomers are thought to increase the functional half-life of miRNAs in vivo by enhancing the resistance to degradation and by stabilizing the miRNA-target duplex structure that is crucial for silencing activity (Naguibneva, I. et al. (2006) Biomed Pharmacother 60, 633-638).

Therefore, a nucleic acid molecule of the invention to be introduced into patient provided may include a regulatory sequence, preferably a promoter sequence, and optionally also a transcriptional termination sequence. The promoters may allow for either a constitutive or an inducible gene expression. Suitable promoters include inter alia the E. coli /acUV5 and tet (tetracycline-responsive) promoters, the T7 promoter as well as the SV40 promoter or the CMV promoter.

The nucleic acid molecules of the invention may also be comprised in a vector or other cloning vehicles, such as plasmids, phagemids, phages, cosmids or artificial chromosomes. In a preferred embodiment, the nucleic acid molecule is comprised in a vector, particularly in an expression vector. Such an expression vector can include, aside from the regulatory sequences described above and a nucleic acid sequence encoding a genetic construct as defined in the invention, replication and control sequences derived from a species compatible with the host that is used for expression as well as selection markers conferring a selectable phenotype on host. Large numbers of suitable vectors such as pSUPER and pSUPERIOR are known in the art, and are commercially available.

In a eleventh aspect, the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated from lung cancer patients, as defined herein.

Finally, in an twelfth aspect, the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.

Within the scope of the present invention, suitable pharmaceutical compositions include inter alia those compositions suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), peritoneal and parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation. Administration may be local or systemic. Preferably, administration is accomplished via the oral or intravenous routes. The formulations may also be packaged in discrete dosage units.

Pharmaceutical compositions according to the present invention include any pharmaceutical dosage forms established in the art, such as inter alia capsules, microcapsules, cachets, pills, tablets, powders, pellets, multi-particulate formulations (e.g., beads, granules or crystals), aerosols, sprays, foams, solutions, dispersions, tinctures, syrups, elixirs, suspensions, water-in-oil emulsions such as ointments, and oil- in water emulsions such as creams, lotions, and balms.

The ("sense" and "anti-sense") nucleic acid molecules described above can be formulated into pharmaceutical compositions using pharmacologically acceptable ingredients as well as established methods of preparation (Gennaro, A.L. and Gennaro, A.R. (2000) Remington: The Science and Practice of Pharmacy, 20th Ed., Lippincott Williams & Wilkins, Philadelphia, PA; Crowder, T.M. et al. (2003 ) A Guide to Pharmaceutical Particulate Science. Interpharm/CRC, Boca Raton, FL; Niazi, S.K. (2004) Handbook of Pharmaceutical Manufacturing Formulations, CRC Press, Boca Raton, FL).

In order to prepare the pharmaceutical compositions, pharmaceutically inert inorganic or organic excipients (i.e. carriers) can be used. To prepare e.g. pills, tablets, capsules or granules, for example, lactose, talc, stearic acid and its salts, fats, waxes, solid or liquid polyols, natural and hardened oils may be used. Suitable excipients for the production of solutions, suspensions, emulsions, aerosol mixtures or powders for reconstitution into solutions or aerosol mixtures prior to use include water, alcohols, glycerol, polyols, and suitable mixtures thereof as well as vegetable oils.

The pharmaceutical composition may also contain additives, such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect. The latter is to be understood that the nucleic acid molecules may be incorporated into slow or sustained release or targeted delivery systems, such as liposomes, nanoparticles, and microcapsules.

To target most tissues within the body, clinically feasible noninvasive strategies are required for directing such pharmaceutical compositions, as defined herein, into cells. In the past years, several approaches have achieved impressive therapeutic benefit following intravenous injection into mice and primates using reasonable doses of siRNAs without apparent limiting toxicities.

One approach involves covalently coupling the passenger strand (miRNA* strand) of the miRNA to cholesterol or derivatives/conjugates thereof to facilitate uptake through ubiquitously expressed cell-surface LDL receptors (Soutschek, J. et al. (2004) Nature 432, 173-178). Alternatively, unconjugated, PBS-formulated locked- nucleic-acid-modified oligonucleotides (LNA-antimiR) may be used for systemic delivery (Elmen, J. et al. (2008) Nature 452, 896-899). Another strategy for delivering miRNAs involves encapsulating the miRNAs into specialized liposomes formed using polyethylene glycol to reduce uptake by scavenger cells and enhance time spent in the circulation. These specialized nucleic acid particles (stable nucleic acid-lipid particles or SNALPs) delivered miRNAs effectively to the liver (and not to other organs (Zimmermann, T.S. et al. (2006) Nature 441, 111-114). Recently, a new class of lipid- like delivery molecules, termed lipidoids (synthesis scheme based upon the conjugate addition of alkylacrylates or alkyl-acrylamides to primary or secondary amines) has been described as delivery agents for RNAi therapeutics (Akinc, A. et al. (2008) Nat Biotechnol 26, 561-569).

A further targeting strategy involves the mixing of miRNAs with a fusion protein composed of a targeting antibody fragment linked to protamine, the basic protein that nucleates DNA in sperm and binds miRNAs by charge (Song, E. et al. (2005) Nat. Biotechnol. 23, 709-717). Multiple modifications or variations of the above basic delivery approaches have recently been developed. These techniques are known in the art and reviewed, e.g., in de Fougerolles, A. et al. (2007) Nat. Rev. Drug Discov 6, 443-453; Kim, D.H. and Rossi, J.J. (2007) Nat Genet 8, 173-184).

The invention is further described by the figures and the following examples, which are solely for the purpose of illustrating specific embodiments of this invention, and are not to be construed as limiting the scope of the invention in any way.

EXAMPLES

Example 1: Tissue sample collection and preparation

The principal method steps for identifying lung cancer in the target cells are shown in Figure 1.

One hundred twenty-six tissue specimens from lung cancer patients were surgically resected at Zhongshan Hospital in Shanghai between 2007 and 2009. The tissues were procured immediately after surgery, embedded in optimum cutting temperature (OCT) compound, fast-frozen in liquid nitrogen and stored at -80°C. The adjacent morphology normal tissues (at least 10 cm from tumor loci) were from the same patients with lung cancer. Baseline characteristics of the tumor specimens are shown in Table 9.

Table 9

Baseline characteristics of the tissue specimens in the invention

Tissue specimens Number

Normal lung tissue 44

Lung cancer

Adenocarcinoma 36

Squamous cell carcinoma 30 Small cell carcinoma 16

Total number 126

Patient data (age, sex, imaging data, therapy, other medical conditions, family history, and the like) were derived from the hospital databases for matching the various samples collected. Pathologic follow-up (for example, histological analysis via hematoxylin and eosin (H&E) staining) was used for evidently determining the disease state of a given sample as well as to ensure a consistent classification of the specimens.

Laser-capture micro-dissection was optionally performed for each cancerous sample in order to specifically isolate tumor cell populations (about 200.000 cells). In brief, a transparent transfer film is applied to the surface of a tissue section or specimen. Under a microscope, the thin tissue section is viewed through the glass slide on which it is mounted and clusters of cells are identified for isolation. When the cells of choice are in the center of the field of view, a near IR laser diode integral with the microscope optics is activated. The pulsed laser beam activates a spot on the transfer film, fusing the film with the underlying cells of choice. The transfer film with the bonded cells is then lifted off the thin tissue section (Emmert-Buck, M.R. et al. (1996) Science 274, 998-1001; Espina, V. et al. (2007) Expert Rev Mol Diagn 7, 647-657). The preparation of the cryostat sections and the capturing step using a laser capture microspope (Arcturus Veritas™ Laser Capture Microdissection Instrument (Molecular Devices, Inc., Sunnyvale, CA, USA) were performed essentially according to the instructions of the manufacturer.

Total RNA was extracted from the tissue sections by using mirVana miRNA isolation kit according to the instructions from the manufacturer (Ambion, Austin, TX). The concentration was quantified by NanoDrop 1000 Spectrophotometer (NanoDrop Technologies, Waltham, MA). The quality control of RNA was performed by a 2100 Bioanalyzer using the RNA 6000 Pico LabChip kit (Agilent Technologies, Santa Clara, CA). Example 2: Genome-wide miRNA analysis in the tissue specimens

A qualitative analysis of the miRNAs (differentially) expressed in a particular sample may optionally be performed using the Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA). The microarray contains probes for 723 human miRNAs from the Sanger database v.10.1. Total RNA (100 ng) derived from each of 136 LCM-selected lung tissues were used as inputs for labeling via Cy3 incorporation. Microarray slides were scanned by XDR Scan (PMT100, PMT5). The labeling and hybridization were performed according to the protocols in the Agilent miRNA microarray system.

Independent experiments on 126 tissue specimens were performed for each measurement and the miRNA expression level determined represents the mean value of the respective individual data obtained.

Example 3: Data analysis of the microarray data

The raw data obtained for single-color (CY3) hybridization were

normalized by applying a Quantile method and using GeneSpring GX10 software (Agilent Technologies, Santa Clara, CA, USA) known in the art. Of the 723 miRNAs in the Agilent miRNA microarray, 296 miRNAs were selected as positive signals for all subsequent analysis.

Differential miRNA expression analysis, unpaired t-test after Fisher test (F-test) with Bonferroni correction was used to identify differentially expressed miRNAs between normal lung tissue vs. lung cancer, or between different types of lung cancer, respectively. The fold changes of expression signals between normal and tumor samples were calculated from the normalized values.

One-way analysis of variance (ANOVA) with a p value < 0.00001 was performed to determine differentially expressed miRNAs amongst normal and different types of lung carcinoma tissues. Hierarchical clustering was performed with Pearson correlation using the differentially expressed miRNAs.

For the specificity and sensitivity of the individual miRNA as diagnostic biomarkers, MedCalc software was used to perform receiver operating characteristic (ROC) curve analysis of the individual miRNA in the normal tissues vs. carcinoma tissues, respectively. 95% confidence interval was used to determine the significance. For assessing whether a particular miRNA is differentially expressed in cancerogenous target cells as compared to healthy control cells the following criteria were used:

(i) q-value (q value = p value x 296) of < 0.05 with fold change >=2 the factor 296 is due to a Bonferroni correction, since 296 human miRNAs revealed a positive signal on the microarray

(ii) AUC (accuracy as a diagnostic biomarker) of > 0.800

In case, the two criteria were fulfilled, the miRNA was considered to be differentially expressed in the target and control cells, respectively.

Classification/prediction analysis: Prediction Analysis of Microarray

(Tibshirani et al. (2002). Proc Natl Acad Sci USA. 99, 6567-6572; http://www- stat.stanford.edu/~tibs/PAM) was performed to classify normal and lung cancer or different lung cancer types. The threshold (and hence subset of genes) is chosen by 10- fold cross-validation accuracy in the data set. In WEKA software environment (http://www.cs.waikato.ac.nz/~ml/weka/), InfoGain method was performed to select miRNA features, and then run multiple classification algorithms with 10-fold cross- validation on these features to obtain the classification accuracies. The PAM predictors with those features identified from WEKA were combined and multiple classification algorithms were run on these miRNAs.

Example 4: Verification of the microarray data

For verifying (and/or quantifying) the miRNA expression data acquired on microarrays, an established quantitative RT-PCR employing a TaqMan MicroRNA assay (Applied Biosystems, Foster City, CA, USA) was used according to the manufacturer's instructions. Briefly, reverse transcription (RT) was performed with Taqman microRNA RT Kits according to the instruction from Applied Biosystem. lOng total RNA was reverse-transcripted in 15ul RT solution mix that contains IX Reverse Transcription Buffer, IX RT primer, InM dNTP, 4U RNase Inhibitor and 50U MultiScribe Reverse Transcriptase. Then the RT solutions were performed by using the thermal program of 16°C, 30min; 42°C, 30min; 85°C, 5min on the PCR machine (Thermal cycler alpha engine, Bio-rad). Quantitative PCR was performed with TaqMan Universal PCR Master Mix kit and and Taqman microRNA assays kits according to the instruction from Applied Biosystem. 2ul RT products were PCR amplified in IX TaqMan Universal PCR Master Mix, No AmpErase UNG, IX TaqMan MicroRNA Assay mix. Each reaction was duplicated in triple. The real-time PCR was performed in Roch Light Cycling 480 machine with the program of 96°C, 5min initial heating; then 45 or 50 cycles of 95°C, 15s; 60°C, 60s. Cp value was calculated with 2nd derivative method in LC480 software. Then miRNAs were absolutely quantified with the standard samples Cp values. The experimental data on platform comparion with 17 miRNAs are shown in Figure 11. The quantitative correlation (R) of fold change between Agilent miRNA microarrays and quantitative RT-PCR was 0.90. The results demonstrate that the miRNA signatures discovered using Agilent miRNA microarrays are highly reliable.

Figure 11

Platform correlation

q PCR vs . Array

Example 5: Expression data in the first aspect for identifying lung cancer

The expression data on the differential miRNA expression analysis in the first aspect for identifying lung cancer from normal lung tissue are summarized in Table 10- 11 below. Table 10 lists the newly identified miRNAs exhibiting a differential expression between lung cancer and normal lung tissue, whereas Table 11 shows the literature documented miRNA signatures in lung cancer. Of 29 known miRNAs in lung cancer, 24 (82%) were in the agreement related to the regulations between the invention and the published data. In the column "t" denotes lung cancer tissue, whereas "n" denotes normal lung tissue. Particularly preferred miRNAs (SEQ ID NO: 1 to SEQ ID NO: 7 in Table 10, SEQ ID NO: 54 to SEQ ID NO: 59 in Table 11, respectively) are shown in bold. TABLE 10

Newly identified miRNA signatures in lung cancer

Name t-test fold ROC analysis

p -value q -value t/n Sensitivity Specificity AUC 95% CI hsa-miR-183 2E-34 6E-32 15.0 100 93 0.987 0.948 to 0.999 hsa-miR-96 1E-35 3E-33 11.8 99 93 0.987 0.948 to 0.999 hsa-miR-144 1E-43 4E-41 0.0 95 100 0.987 0.948 to 0.999 hsa-miR-451 9E-36 3E-33 0.0 93 100 0.985 0.945 to 0.998 hsa-miR-200c 2E-22 7E-20 3.9 95 96 0.980 0.937 to 0.997 hsa-miR-338-3p 4E-27 1E-24 0.1 89 98 0.951 0.897 to 0.981 hsa-miR-486-5p 3E-32 8E-30 0.1 83 100 0.972 0.926 to 0.993 hsa-miR-139-5p 1E-30 4E-28 0.2 92 96 0.961 0.911 to 0.987 hsa-miR-130b 3E-25 7E-23 7.7 94 91 0.960 0.910 to 0.987 hsa-miR-30a* 6E-28 2E-25 0.2 90 93 0.950 0.896 to 0.981 hsa-miR-144* 9E-18 3E-15 0.2 88 91 0.943 0.887 to 0.976 hsa-miR-425 3E-18 9E-16 2.9 82 93 0.941 0.885 to 0.975 hsa-miR-133b 3E-27 9E-25 0.2 93 86 0.937 0.880 to 0.973 hsa-miR-497 2E-25 6E-23 0.3 74 100 0.935 0.877 to 0.971 hsa-miR-182 3E-23 1E-20 5.7 88 84 0.933 0.874 to 0.970 hsa-miR-187* 9E-26 2E-23 0.2 89 96 0.929 0.869 to 0.967 hsa-miR-30b 6E-24 2E-21 0.3 85 98 0.929 0.869 to 0.967 hsa-miR-93 2E-23 5E-21 3.1 84 96 0.925 0.864 to 0.964 hsa-miR-145* 1E-20 3E-18 0.2 83 91 0.917 0.855 to 0.959 hsa-miR-429 5E-18 1E-15 3.8 87 91 0.912 0.848 to 0.955 hsa-miR-498 6E-20 2E-17 0.3 81 89 0.91 0.846 to 0.954 hsa-miR-200a 1E-16 4E-14 3.1 85 93 0.909 0.844 to 0.953 hsa-miR-625 7E-16 2E-13 3.0 83 89 0.901 0.835 to 0.947 hsa-miR-130a 2E-17 5E-15 0.5 78 96 0.9 0.834 to 0.946 hsa-miR-30c-2* 6E-14 2E-11 0.4 90 80 0.897 0.830 to 0.944 hsa-miR-98 1E-17 3E-15 2.3 84 86 0.895 0.828 to 0.943 hsa-miR-1 IE- 18 3E-16 0.2 85 84 0.892 0.825 to 0.941 hsa-miR-106b 5E-20 1E-17 2.3 82 86 0.89 0.822 to 0.939 hsa-miR-150* 4E-15 1E-12 0.4 62 96 0.874 0.804 to 0.927 hsa-miR-25 IE- 18 3E-16 2.5 74 96 0.87 0.798 to 0.923 hsa-miR-134 7E-16 2E-13 0.3 74 89 0.869 0.798 to 0.923 hsa-miR-328 4E-15 1E-12 0.4 66 96 0.864 0.792 to 0.919 hsa-miR-638 8E-16 2E-13 0.3 62 98 0.861 0.789 to 0.916 hsa-miR-200b* 3E-15 7E-13 3.3 81 86 0.859 0.786 to 0.915 hsa-miR-1225-5p 3E-13 9E-11 0.4 72 86 0.851 0.777 to 0.908 hsa-miR-1224-5p 1E-13 4E-11 0.5 72 86 0.851 0.776 to 0.908 hsa-miR-557 3E-12 9E-10 0.4 73 86 0.846 0.771 to 0.904 hsa-miR-15b 6E-15 2E-12 2.0 63 98 0.84 0.764 to 0.899 hsa-miR-454 5E-10 2E-07 2.3 83 73 0.838 0.762 to 0.898 hsa-miR-301a 4E-14 lE-11 3.0 76 89 0.837 0.760 to 0.896 hsa-miR-135b 4E-15 1E-12 4.5 78 93 0.836 0.760 to 0.896 hsa-miR-100 4E-10 1E-07 0.4 73 98 0.836 0.759 to 0.896 hsa-miR-223 4E-13 lE-10 0.4 61 100 0.833 0.756 to 0.893 hsa-miR-196b 1E-13 3E-11 4.9 65 91 0.823 0.745 to 0.886 hsa-miR-196a 3E-14 8E-12 5.9 70 93 0.816 0.737 to 0.879 hsa-miR-1226* 2E-09 4E-07 0.4 88 61 0.815 0.736 to 0.878 hsa-miR-424 2E-12 6E-10 2.2 71 93 0.815 0.736 to 0.878 hsa-miR-21* lE-10 4E-08 2.6 63 96 0.815 0.736 to 0.878 hsa-miR-572 4E-11 1E-08 0.3 60 96 0.808 0.728 to 0.872 hsa-miR-18b 7E-14 2E-11 3.0 70 93 0.806 0.726 to 0.871 hsa-miR-18a 1E-12 3E-10 3.4 65 98 0.803 0.723 to 0.869 hsa-miR-9* 5E-10 2E-07 3.7 61 93 0.803 0.723 to 0.869 hsa-miR-301b 2E-11 6E-09 2.8 63 89 0.800 0.720 to 0.866

TABLE 11

Literature documented miRNA signatures in lung cancer

Name t-test fold Reported regulation p -value q -value t/n

hsa-miR-126 7E-45 2E-42 0.1 down hsa-miR-126* 2E-36 7E-34 0.1 down hsa-miR-30a 1E-35 3E-33 0.2 down hsa-miR-218 5E-33 2E-30 0.2 down hsa-miR-145 3E-27 9E-25 0.2 down hsa-miR-140-3p 2E-26 6E-24 0.3 down hsa-miR-101 2E-21 5E-19 0.4 down hsa-miR-143 2E-21 5E-19 0.2 down hsa-miR-140-5p 8E-17 2E-14 0.4 down hsa-miR-30d 5E-15 1E-12 0.5 down hsa-miR-29c 6E-14 2E-11 0.4 down hsa-miR-199b-5p 1E-07 4E-05 0.5 down hsa-miR-224 1E-06 3E-04 2.8 down hsa-miR-125a-3p 4E-06 1E-03 0.5 down hsa-miR-9 1E-12 3E-10 4.7 down hsa-miR-200b 5E-27 1E-24 5.5 up

hsa-miR-195 1E-23 4E-21 0.4 up

hsa-miR-210 2E-21 6E-19 4.2 up

hsa-miR-7 4E-16 1E-13 6.8 up hsa-miR-21 3E-15 9E-13 3.1 up hsa-miR-17 1E-13 3E-11 2.3 up hsa-miR-128 8E-12 2E-09 2.7 up hsa-miR-141 2E-10 7E-08 2.3 up hsa-miR-142-5p 1E-08 3E-06 0.4 up hsa-miR-150 7E-08 2E-05 0.4 up hsa-miR-205 1E-07 4E-05 8.3 up hsa-miR-192 2E-06 7E-04 2.5 up hsa-miR-215 6E-06 2E-03 2.3 up hsa-miR-106a 8E-06 2E-03 2.0 up

The expression data on the prediction analysis of microarray in the first aspect for predicting lung cancer from normal lung tissue are summarized in Table 12-15 below. Table 12 shows PAM classifiers along with 10-fold cross-validation accuracy, 5 Table 13 lists the top miRNAs from feature selection by WEKA algorithm, Table 14 displays the comparison of components in the classifiers identified by the two employed classification algorithms, whereas Table 15 shows classification performance of identified miRNA predictors in multiple algorithms. Particularly preferred the top 7 identified miRNAs (SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 54 to SEQ ID NO: 56, 10 SEQ ID NO: 58 and SEQ ID NO: 59 in Table 14) are shown in bold.

TABLE 12

PAM scores for predicting lung cancer from normal lung tissue

CV Confusion Matrix (Threshold=12.73968)

True\Predicted Lung carcinoma Normal Class Error rate

Lung carcinoma 77 5 0.06097561

Normal 0 44 0

10-fold cross-validation accuracy: 96.03% TABLE 13

Top miRNAs from feature selection in WEKA

Evaluator: weka.attributeSelection.InfoGainAttributeEval

Evaluation mode: 10-fold cross-validation

TABLE 14

Classifier comparison and shared miRNAs in the classifiers for predicting lung

cancer from normal lung tissue

TABLE 15

Classification performance of identified miRNA predictors in multiple algorithms

5

Example 6: Expression data in the second aspect for identifying non-small cell lung cancer

The expression data on the differential miRNA expression analysis in the second aspect for identifying non-small cell lung cancer (NSCLC) from normal lung

10 tissue are summarized in Table 16-17 below. Table 16 lists the newly identified miRNAs exhibiting a differential expression between non-small cell lung cancer tissue and normal lung tissue, whereas Table 17 shows the literature documented miRNA signatures in non-small cell lung cancer. Of 26 known miRNAs in non-small cell lung cancer, 21 (81%) were in the agreement related to the regulations between the invention

15 and the published data. In the column "t" denotes none-small cell lung carcinoma including squamous cell lung cancer and adenocarcinoma lung cancer, whereas "n" denotes normal lung tissue. Particularly preferred miRNAs (SEQ ID NO: 1 to SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 14 in Table 16, SEQ ID NO: 54 to SEQ ID NO: 59 in Table 17, respectively) are shown in bold. TABLE 16

Newly identified miRNA signatures in non-small cell lung cancer

Name t-test fold ROC analysis

p -value q -value t/n Sensitivity Specificity AUC 95% CI hsa-miR-183 1E-30 3E-28 12.1 100 93 0.983 0.938 to 0.998 hsa-miR-96 1E-30 4E-28 10.2 99 93 0.984 0.939 to 0.998 hsa-miR-144 2E-35 7E-33 0.0 94 100 0.983 0.937 to 0.998 hsa-miR -451 2E-31 5E-29 0.0 91 100 0.981 0.934 to 0.998 hsa-miR -200c 3E-30 8E-28 4.2 97 96 0.991 0.951 to 1.000 hsa-miR -486-5p 5E-31 1E-28 0.1 88 100 0.974 0.924 to 0.995 hsa-miR-139-5p 8E-29 2E-26 0.2 92 96 0.969 0.916 to 0.992 hsa-miR -497 6E-22 2E-19 0.3 75 100 0.946 0.886 to 0.980 hsa-miR-338-3p 6E-20 2E-17 0.1 88 98 0.940 0.877 to 0.976 hsa-miR- 130b 1E-21 3E-19 6.2 92 91 0.950 0.890 to 0.982 hsa-miR-144* 8E-18 2E-15 0.2 88 91 0.943 0.882 to 0.979 hsa-miR-425 5E-17 1E-14 2.8 82 93 0.938 0.875 to 0.975 hsa-miR- 133b 1E-21 4E-19 0.2 91 86 0.923 0.856 to 0.965 hsa-miR- 182 2E-17 5E-15 4.5 85 84 0.918 0.849 to 0.962 hsa-miR- 187* 9E-21 3E-18 0.2 86 96 0.916 0.847 to 0.960 hsa-miR-30b 4E-19 1E-16 0.4 85 98 0.923 0.855 to 0.965 hsa-miR-93 9E-17 3E-14 2.7 80 96 0.905 0.834 to 0.953 hsa-miR-145* 2E-17 7E-15 0.3 91 80 0.908 0.837 to 0.955 hsa-miR-429 5E-14 lE-11 3.3 83 91 0.892 0.818 to 0.943 hsa-miR-498 2E-17 7E-15 0.3 80 89 0.906 0.835 to 0.954 hsa-miR-200a 2E-11 5E-09 2.7 82 93 0.887 0.812 to 0.940 hsa-miR-625 3E-16 8E-14 3.2 85 93 0.919 0.851 to 0.962 hsa-miR- 130a 5E-14 lE-11 0.5 80 96 0.906 0.835 to 0.953 hsa-miR-30c-2* 2E-13 7E-11 0.4 89 80 0.891 0.817 to 0.943 hsa-miR-98 3E-14 lE-11 2.2 82 89 0.879 0.802 to 0.933 hsa-miR- 1 3E-15 9E-13 0.2 83 84 0.878 0.801 to 0.933 hsa-miR- 150* 2E-12 5E-10 0.4 89 66 0.865 0.786 to 0.923 hsa-miR-25 2E-12 5E-10 2.1 68 96 0.836 0.753 to 0.900 hsa-miR- 134 2E-12 7E-10 0.4 75 84 0.849 0.768 to 0.911 hsa-miR-328 6E-13 2E-10 0.4 65 96 0.849 0.767 to 0.910 hsa-miR-638 1E-12 4E-10 0.3 72 84 0.840 0.758 to 0.904 hsa-miR-200b* 3E-11 7E-09 2.8 74 89 0.830 0.746 to 0.895 hsa-miR- 1225-5p 2E-10 7E-08 0.5 69 86 0.840 0.757 to 0.903 hsa-miR- 1224-5p 7E-11 2E-08 0.5 80 77 0.846 0.764 to 0.908 hsa-miR-557 2E-11 5E-09 0.4 72 86 0.849 0.767 to 0.910 hsa-miR- 135b 2E-15 5E-13 5.4 82 93 0.860 0.780 to 0.919 hsa-miR- 100 1E-06 4E-04 0.5 71 98 0.813 0.728 to 0.882 hsa-miR-424 4E-14 lE-11 2.4 75 93 0.858 0.778 to 0.917 hsa-miR-21* 6E-15 2E-12 3.4 79 96 0.905 0.833 to 0.953 hsa-miR-30a* 7E-22 2E-19 0.2 91 93 0.944 0.883 to 0.979 hsa-miR-494 9E-09 3E-06 2.3 66 86 0.816 0.730 to 0.883 hsa-miR-193b 3E-08 8E-06 2.2 63 96 0.802 0.715 to 0.872 hsa-miR-99a 3E-07 8E-05 0.4 79 75 0.804 0.717 to 0.874 hsa-miR-335 5E-06 1E-03 0.5 72 86 0.825 0.740 to 0.891

TABLE 17

Literature documented miRNA signatures in lung carcinoma

5 The expression data on the prediction analysis of microarray in the second aspect for predicting non-small cell lung cancer from normal lung tissue are summarized in Table 18-21 below. Table 18 shows PAM classifiers along with 10-fold cross-validation accuracy, Table 19 lists the top miRNAs from feature selection by WEKA algorithm, Table 20 displays the comparison of components in the classifiers identified by the two employed classification algorithms, whereas Table 21 shows classification performance of identified miRNA predictors in multiple algorithms. Particularly preferred the top 9 identified miRNAs (SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 14, SEQ ID NO: 54 to SEQ ID NO: 59 in Table 20 are shown in bold.

TABLE 18

PAM scores for predicting non-small cell lung cancer from normal lung tissue

TABLE 19

Top miRNAs from feature selection in WEKA for predicting non-small cell lung cancer from normal lung tissue

Name Average merit Average rank Attribute hsa-miR-126 0.971 +- 0.003 1 +- 0 60 hsa-miR-218 0.864 +- 0.021 2.3 +- 0.64 212 hsa-miR-126* 0.843 +- 0.028 3 +- 0.63 61 hsa-miR-183 0.81 +- 0.023 4.8 +- 1.47 141 hsa-miR-451 0.8 +- 0.029 5.5 +- 1.5 390 hsa-miR-144 0.791 +- 0.018 6.3 +- 1.27 97 hsa-miR-96 0.775 +- 0.031 7 +- 1.73 717 hsa-miR-200c 0.755 +- 0.035 8.1 +- 1.58 187 hsa-miR-30a 0.738 +- 0.04 8.9 +- 1.97 274 hsa-miR-140-3p 0.703 +- 0.044 10.8 +- 2.14 89 hsa-miR-497 0.693 +- 0.048 11.4 +- 2.11 420 hsa-miR-486-5p 0.69 +- 0.042 11.5 +- 2.01 404 hsa-miR-139-5p 0.647 +- 0.03 14.3 +- 2.53 88

TABLE 20

Classifier comparison and shared miRNAs in the classifiers for predicting non- small cell lung cancer from normal lung tissue

TABLE 21

10 Example 7: Expression data in the third aspect for identifying adenocarcinoma lung cancer

The expression data on the differential miRNA expression analysis in the third aspect for identifying adenocarcinoma lung cancer (AC) from normal lung tissue are 5 summarized in Table 22-23 below. Table 22 lists the newly identified miRNAs exhibiting a differential expression between adenocarcinoma lung cancer and normal lung tissue, whereas Table 23 shows the literature documented miRNA signatures in adenocarcinoma lung cancer. Of 17 known miRNAs in adenocarcinoma lung cancer, 16 (94%) were in the agreement related to the regulations between the invention and the 10 published data. In the column "t" denotes adenocarcinoma lung cancer, whereas "n" denotes normal lung tissue. Particularly preferred miRNAs (SEQ ID NO: 1 to SEQ ID NO: 5, SEQ ID NO: 41in Table 22, SEQ ID NO: 54 to SEQ ID NO: 57, SEQ ID NO: 73 in Table 23, respectively) are shown in bold.

15 TABLE 22

Newly identified miRNA signatures in adenocarcinoma lung cancer

Name t-test fold ROC analysis

p -value q -value t/n Sensitivity Specificity AUC 95% CI hsa-miR-183 2E-21 6E-19 10.3 100 93 0.980 0.920 to 0.998 hsa-miR-96 3E-22 1E-19 9.0 100 93 0.980 0.921 to 0.998 hsa-miR-144 4E-15 1E-12 0.1 89 100 0.969 0.904 to 0.995 hsa-miR-451 5E-16 2E-13 0.1 86 98 0.966 0.899 to 0.994 hsa-miR-200c 9E-15 3E-12 3.3 97 93 0.987 0.932 to 1.000 hsa-miR-135b 5E-21 2E-18 9.8 97 96 0.974 0.911 to 0.997 hsa-miR-486-5p 5E-15 2E-12 0.1 78 100 0.953 0.881 to 0.988 hsa-miR-338-3p 2E-08 6E-06 0.2 89 89 0.891 0.802 to 0.950 hsa-miR-139-5p IE- 18 3E-16 0.2 89 96 0.954 0.883 to 0.988 hsa-miR-130b 3E-13 8E-11 4.5 86 91 0.920 0.837 to 0.969 hsa-miR-30a* lE-10 4E-08 0.2 86 93 0.921 0.839 to 0.970 hsa-miR-144* 6E-14 2E-11 0.2 83 93 0.917 0.834 to 0.967 hsa-miR-425 lE-10 4E-08 2.4 75 91 0.908 0.822 to 0.961 hsa-miR-133b 8E-11 2E-08 0.3 86 86 0.890 0.801 to 0.949 hsa-miR-497 8E-10 2E-07 0.5 94 75 0.910 0.825 to 0.962 hsa-miR-182 5E-11 1E-08 4.0 89 84 0.932 0.854 to 0.976 hsa-miR-187* 3E-10 1E-07 0.3 75 96 0.865 0.770 to 0.931 hsa-miR-30b 1E-07 4E-05 0.5 72 98 0.863 0.768 to 0.929 hsa-miR-145* 2E-09 5E-07 0.4 83 80 0.867 0.772 to 0.932 hsa-miR-429 3E-12 9E-10 3.3 86 91 0.906 0.820 to 0.960 hsa-miR-498 8E-10 2E-07 0.4 72 69 0.861 0.766 to 0.929 hsa-miR-200a lE-10 3E-08 3.3 86 93 0.928 0.848 to 0.974 hsa-miR-625 3E-17 8E-15 3.6 92 96 0.957 0.886 to 0.990 hsa-miR-130a 2E-08 6E-06 0.5 86 91 0.910 0.825 to 0.963 hsa-miR-30c-2* 3E-09 8E-07 0.5 83 80 0.863 0.768 to 0.930 hsa-miR-134 1E-07 4E-05 0.4 72 89 0.835 0.736 to 0.909 hsa-miR-638 5E-07 1E-04 0.4 81 75 0.806 0.703 to 0.886 hsa-miR-200b* 1E-08 3E-06 3.2 78 89 0.874 0.781 to 0.938 hsa-miR-1225-5p 2E-08 5E-06 0.5 69 86 0.840 0.741 to 0.912 hsa-miR-557 2E-07 5E-05 0.5 86 66 0.811 0.708 to 0.890 hsa-miR-100 2E-04 5E-02 0.5 64 98 0.809 0.706 to 0.888 hsa-miR-223 3E-11 7E-09 0.4 67 100 0.893 0.804 to 0.951 hsa-miR-424 2E-11 5E-09 2.8 78 96 0.896 0.807 to 0.953 hsa-miR-21* lE-10 4E-08 3.3 78 96 0.892 0.803 to 0.950 hsa-miR-99a 3E-05 8E-03 0.5 72 84 0.818 0.716 to 0.895 hsa-miR-34a 2E-08 7E-06 2.0 75 98 0.830 0.730 to 0.905 hsa-miR-148a 4E-07 1E-04 2.5 81 98 0.882 0.790 to 0.943 hsa-miR-542-3p 2E-06 6E-04 2.3 53 100 0.801 0.697 to 0.882 hsa-miR-200a* 5E-06 1E-03 2.3 69 89 0.809 0.706 to 0.888 hsa-miR-375 2E-05 5E-03 2.6 78 89 0.820 0.718 to 0.897

TABLE 23

Literature documented miRNA signatures in adenocarcinoma lung cancer

t-test fold Reported regulation

p -value q -value t/n

hsa-miR-126 1E-29 3E-27 0.2 down

hsa-miR-126* 3E-24 8E-22 0.2 down

hsa-miR-30a 5E-15 1E-12 0.2 down

hsa-miR-218 1E-18 4E-16 0.2 down

hsa-miR-21 1E-14 4E-12 4.5 up

hsa-miR-145 3E-10 8E-08 0.4 down

hsa-miR-140-3p 1E-14 3E-12 0.4 down

hsa-miR-101 6E-10 2E-07 0.5 down

hsa-miR-143 3E-07 8E-05 0.4 down

hsa-miR-140-5p 1E-07 3E-05 0.5 down

hsa-miR-224 8E-05 2E-02 2.9 down

hsa-miR-200b 6E-13 2E-10 4.0 up

hsa-miR-195 3E-09 1E-06 0.5 up

hsa-miR-210 8E-07 2E-04 3.1 up

hsa-miR-7 2E-06 6E-04 2.9 up hsa-miR-141 3E-09 1E-06 2.4 up

hsa-miR-192 8E-05 2E-02 3.4 up

The expression data on the prediction analysis of microarray in the third aspect for predicting adenocarcinoma lung cancer from normal lung tissue are summarized in Table 24-27 below. Table 24 shows PAM classifiers along with 10-fold cross-validation accuracy, Table 25 lists the top miRNAs from feature selection by WEKA algorithm, Table 26 displays the comparison of components in the classifiers identified by the two employed classification algorithms, whereas Table 27 shows classification performance of identified miRNA predictors in multiple algorithms. Particularly preferred the top 5 identified miRNAs (SEQ ID NO: 2, SEQ ID NO: 54 to SEQ ID NO: 57 in Table 26 are shown in bold.

TABLE 24

PAM scores for predicting adenocarcinoma lung cancer from normal lung tissue

TABLE 25

Top miRNAs from feature selection in WEKA for predicting adenocarcinoma lung cancer from normal lung tissue

Name Average merit Average rank Attribute hsa-miR-126 0.993 +- 0.002 1 +- 0 60 hsa-miR-218 0.845 +- 0.027 3.3 +- 1.27 212 hsa-miR-126* 0.828 +- 0.037 4.2 +- 1.54 61 hsa-miR-96 0.804 +- 0.036 5 +- 1.26 717 hsa-miR-30a 0.813 +- 0.052 5.1 +- 2.84 274 hsa-miR-183 0.804 +- 0.036 5.8 +- 1.47 141 hsa-miR-135b 0.778 +- 0.038 6.6 +- 2.58 79 hsa-miR-200c 0.738 +- 0.046 8.6 +- 2.8 187 hsa-miR-144 0.746 +- 0.035 8.7 +- 2.19 97 hsa-miR-451 0.732 +- 0.054 9.2 +- 3.09 390 hsa-miR-148a 0.682 +- 0.063 12.5 +- 3.04 107 hsa-miR-625 0.657 +- 0.038 13 +- 1.41 601 hsa-miR-21 0.633 +- 0.049 14.2 +- 2.4 201

TABLE 26

Classifier comparison and shared miRNAs in the classifiers for predicting adenocarcinoma lung cancer from normal lung tissue

TABLE 27

10 Example 8: Expression data in the fourth aspect for identifying squamous cell

lung cancer

The expression data on the differential miRNA expression analysis in the third aspect for identifying squamous cell lung cancer (SQ) from normal lung tissue are 5 summarized in Table 28-29 below. Table 28 lists the newly identified miRNAs

exhibiting a differential expression between squamous cell lung cancer and normal lung tissue, whereas Table 29 shows the literature documented miRNA signatures in squamous cell lung cancer. Of 24 known miRNAs in squamous cell lung cancer, 19 (79%) were in the agreement related to the regulations between the invention and the 10 published data. In the column "t" denotes squamous cell lung cancer, whereas "n"

denotes normal lung tissue. Particularly preferred miRNAs (SEQ ID NO: 3 to SEQ ID NO: 7 SEQ ID NO: 14 in Table 28, SEQ ID NO: 57 to SEQ ID NO: 59 in Table 29, respectively) are shown in bold.

15 TABLE 28

Newly identified miRNA signatures in squamous cell lung cancer

Name t-test fold ROC analysis

p -value q -value t/n Sensitivity Specificity AUC 95% CI hsa-miR-144 3E-46 9E-44 0.02 100 100 1.000 0.951 to 1.000 hsa-miR-451 1E-30 3E-28 0.02 100 100 1.000 0.951 to 1.000 hsa-miR-200c 2E-21 6E-19 5.57 100 96 0.997 0.945 to 1.000 hsa-miR-486-5p 2E-31 5E-29 0.05 100 100 1.000 0.951 to 1.000 hsa-miR-338-3p 4E-16 1E-13 0.06 100 100 1.000 0.951 to 1.000 hsa-miR-497 1E-23 4E-21 0.17 97 100 0.992 0.936 to 1.000 hsa-miR-30b 1E-15 3E-13 0.25 100 98 0.997 0.945 to 1.000 hsa-miR-93 3E-17 9E-15 4.49 100 98 0.999 0.949 to 1.000 hsa-miR-103 4E-18 1E-15 2.12 100 98 0.997 0.945 to 1.000 hsa-miR-183 3E-23 8E-21 14.62 100 93 0.987 0.928 to 1.000 hsa-miR-96 4E-23 1E-20 11.99 100 91 0.988 0.929 to 1.000 hsa-miR-139-5p 1E-25 3E-23 0.16 97 96 0.987 0.927 to 1.000 hsa-miR-130b 9E-23 3E-20 9.84 100 91 0.987 0.929 to 1.000 hsa-miR-30a* 7E-14 2E-11 0.15 90 100 0.973 0.905 to 0.997 hsa-miR-144* 8E-19 2E-16 0.15 93 91 0.977 0.911 to 0.998 hsa-miR-425 2E-15 5E-13 3.40 90 93 0.970 0.901 to 0.996 hsa-miR-133b 2E-22 7E-20 0.17 93 98 0.964 0.893 to 0.994 hsa-miR-182 4E-09 1E-06 5.11 77 91 0.900 0.809 to 0.958 hsa-miR-187* 5E-28 2E-25 0.16 100 96 0.979 0.915 to 0.998 hsa-miR-145* 1E-21 4E-19 0.18 100 89 0.960 0.887 to 0.992 hsa-miR-429 6E-07 2E-04 3.20 80 93 0.877 0.780 to 0.942 hsa-miR-498 2E-19 6E-17 0.24 97 84 0.963 0.891 to 0.993 hsa-miR-130a 1E-06 4E-04 0.51 77 96 0.872 0.774 to 0.938 hsa-miR-30c-2* 3E-15 8E-13 0.38 90 86 0.926 0.841 to 0.974 hsa-miR-98 5E-10 1E-07 2.52 93 86 0.934 0.852 to 0.979 hsa-miR-1 5E-24 2E-21 0.11 97 96 0.978 0.913 to 0.998 hsa-miR-106b 7E-11 2E-08 2.93 83 100 0.915 0.827 to 0.967 hsa-miR-150* 3E-15 8E-13 0.33 97 77 0.953 0.877 to 0.989 hsa-miR-25 8E-18 2E-15 3.75 97 98 0.993 0.938 to 1.000 hsa-miR-134 6E-10 2E-07 0.38 77 84 0.869 0.770 to 0.936 hsa-miR-328 7E-16 2E-13 0.30 83 100 0.937 0.855 to 0.980 hsa-miR-638 1E-09 4E-07 0.27 73 98 0.887 0.792 to 0.949 hsa-miR-1225-5p 5E-08 1E-05 0.48 70 86 0.844 0.740 to 0.918 hsa-miR-1224-5p 6E-13 2E-10 0.41 90 86 0.925 0.840 to 0.974 hsa-miR-557 IE- 11 3E-09 0.34 87 86 0.899 0.807 to 0.957 hsa-miR-15b 2E-19 6E-17 2.49 90 98 0.969 0.899 to 0.995 hsa-miR-301a 2E-08 5E-06 3.48 83 91 0.889 0.794 to 0.950 hsa-miR-196b 3E-11 1E-08 10.86 83 98 0.930 0.846 to 0.976 hsa-miR-196a 1E-09 3E-07 10.92 90 93 0.930 0.846 to 0.976 hsa-miR-1226* 4E-10 1E-07 0.35 73 87 0.881 0.784 to 0.944 hsa-miR-424 4E-06 1E-03 2.01 73 93 0.816 0.708 to 0.896 hsa-miR^l* IE- 11 3E-09 3.44 77 98 0.906 0.816 to 0.962 hsa-miR-572 1E-05 3E-03 0.30 80 84 0.806 0.698 to 0.889 hsa-miR-18b 8E-09 2E-06 4.09 87 93 0.904 0.813 to 0.960 hsa-miR-18a 2E-09 6E-07 5.21 80 100 0.906 0.815 to 0.961 hsa-miR^* 1E-06 4E-04 4.28 67 98 0.866 0.767 to 0.934 hsa-miR-301b 2E-07 5E-05 3.69 70 96 0.874 0.777 to 0.940 hsa-miR-29c* 4E-09 1E-06 0.34 80 93 0.920 0.833 to 0.970 hsa-miR-494 7E-11 2E-08 3.10 83 89 0.909 0.819 to 0.963 hsa-miR-193b 5E-08 1E-05 3.22 70 98 0.887 0.792 to 0.949 hsa-miR-375 7E-09 2E-06 0.12 90 98 0.936 0.854 to 0.980 hsa-miR-26a 6E-19 2E-16 0.48 93 91 0.978 0.913 to 0.998 hsa-miR-574-3p 1E-13 4E-11 0.46 93 93 0.963 0.890 to 0.993 hsa-miR-151-3p 4E-12 1E-09 2.50 87 96 0.936 0.854 to 0.979 hsa-miR-149 5E-09 2E-06 4.69 87 93 0.922 0.835 to 0.971 hsa-miR-768-5p 3E-12 8E-10 0.31 73 96 0.916 0.828 to 0.968 hsa-miR-18 la 2E-09 6E-07 0.46 80 91 0.916 0.828 to 0.968 hsa-miR-20a 2E-08 6E-06 2.34 83 98 0.913 0.824 to 0.966 hsa-miR-181c 2E-10 7E-08 0.35 87 82 0.904 0.813 to 0.960 hsa-miR-29a 7E-08 2E-05 0.42 83 96 0.902 0.810 to 0.959 hsa-miR-29b 3E-07 9E-05 0.39 87 93 0.898 0.805 to 0.956 hsa-miR-505 1E-09 4E-07 2.33 83 89 0.896 0.803 to 0.955 hsa-miR-939 2E-10 6E-08 0.44 87 80 0.891 0.797 to 0.952 hsa-miR-769-5p 4E-10 1E-07 2.63 87 86 0.884 0.788 to 0.947 hsa-miR-30c 4E-08 1E-05 0.54 80 91 0.882 0.786 to 0.946 hsa-miR-590-5p 5E-07 2E-04 2.11 83 82 0.877 0.780 to 0.942 hsa-miR-671-5p 1E-09 3E-07 0.49 73 96 0.877 0.780 to 0.942 hsa-miR-625 2E-08 5E-06 2.60 83 89 0.873 0.776 to 0.939 hsa-miR-652 9E-07 3E-04 0.40 77 86 0.870 0.772 to 0.937 hsa-miR-139-3p 1E-08 4E-06 0.33 83 80 0.869 0.770 to 0.936 hsa-miR-28-5p 3E-07 8E-05 2.0 83 80 0.869 0.770 to 0.936 hsa-miR-623 1E-09 4E-07 0.38 97 71 0.867 0.768 to 0.935 hsa-miR-221 2E-07 7E-05 3.02 80 98 0.866 0.767 to 0.934 hsa-miR-19a 3E-06 9E-04 2.21 83 86 0.865 0.766 to 0.933 hsa-miR-944 1E-06 4E-04 2.96 63 98 0.864 0.765 to 0.933 hsa-miR-335 2E-06 5E-04 0.37 80 86 0.863 0.764 to 0.932 hsa-miR-125a-5p 2E-05 5E-03 0.47 83 89 0.859 0.759 to 0.929 hsa-miR-551b 3E-08 7E-06 0.22 77 100 0.858 0.757 to 0.928 hsa-let-7d* 9E-08 3E-05 0.45 80 77 0.856 0.755 to 0.927 hsa-miR-31* 9E-05 3E-02 3.65 57 96 0.842 0.739 to 0.916 hsa-miR-362-5p 2E-05 5E-03 2.19 73 93 0.842 0.739 to 0.916 hsa-miR-181a* 2E-07 6E-05 0.48 80 82 0.839 0.735 to 0.914 hsa-miR-940 2E-07 6E-05 0.5 90 68 0.835 0.730 to 0.911 hsa-miR-30b* 5E-07 1E-04 0.49 87 71 0.830 0.725 to 0.907 hsa-miR-601 2E-06 7E-04 0.43 87 68 0.825 0.719 to 0.903 hsa-miR-20b 1E-05 3E-03 2.05 63 98 0.810 0.702 to 0.892 hsa-miR-202 6E-09 2E-06 0.42 93 68 0.806 0.697 to 0.889 hsa-miR-378 6E-05 2E-02 2.47 67 93 0.805 0.696 to 0.888

TABLE 29

Literature documented miRNA signatures in squamous cell lung cancer

t-test fold Reported regulation

p -value q -value t/n

hsa-miR-218 5E-16 2E-13 0.2 down

hsa-miR-145 7E-18 2E-15 0.1 down

hsa-miR-140-3p 4E-15 1E-12 0.2 down

hsa-miR-126 7E-32 2E-29 0.1 down

hsa-miR-126* 1E-19 3E-17 0.1 down

hsa-miR-30a 4E-15 1E-12 0.1 down

hsa-miR-143 9E-14 3E-11 0.1 down

hsa-miR-101 lE-11 4E-09 0.3 down

hsa-miR-140-5p 2E-14 6E-12 0.4 down hsa-miR-30d 2E-10 6E-08 0.4 down hsa-miR-29c 4E-13 lE-10 0.2 down hsa-miR-224 4E-08 1E-05 6.9 down hsa-miR-9 6E-09 2E-06 6.2 down hsa-miR-200b lE-10 3E-08 4.9 up hsa-miR-195 6E-21 2E-18 0.2 up hsa-miR-210 6E-15 2E-12 7.0 up hsa-miR-7 5E-14 2E-11 8.0 up hsa-miR-21 3E-12 8E-10 3.7 up hsa-miR-17 4E-10 1E-07 2.9 up hsa-miR-128 2E-15 6E-13 4.5 up hsa-miR-141 1E-08 3E-06 3.0 up hsa-miR-142-5p 2E-06 7E-04 0.3 up hsa-miR-150 3E-06 9E-04 0.2 up hsa-miR-205 6E-15 2E-12 149.2 up

The expression data on the prediction analysis of microarray in the fourth aspect for predicting squamous cell lung cancer from normal lung tissue are summarized in Table 30-33 below. Table 30 shows PAM classifiers along with 10-fold cross-validation 5 accuracy, Table 31 lists the top miRNAs from feature selection by WEKA algorithm, Table 32 displays the comparison of components in the classifiers identified by the two employed classification algorithms, whereas Table 33 shows classification performance of identified miRNA predictors in multiple algorithms. Particularly preferred the top 9 identified miRNAs (SEQ ID NO: 3 to SEQ ID NO: 6, SEQ ID NO: 14, SEQ ID NO: 57 10 to SEQ ID NO: 59 in Table 32 are shown in bold.

TABLE 30

PAM scores for predicting squamous cell lung cancer from normal lung tissue

CV Confusion Matrix (Threshold=14.08994)

True\Predicted Normal Squamous cell Class Error rate carcinoma

Normal 44 0 0

Squamous cell

carcinoma 2 28 0.066666667

10-fold cross-validation accuracy: 97.30%

TABLE 31

Top miRNAs from feature selection in WEKA for predicting squamous cell lung cancer from normal lung tissue

TABLE 32

Classifier comparison and shared miRNAs in the classifiers for predicting squamous cell lung cancer from normal lung tissue

hsa-miR-93 X

hsa-miR-126 X

hsa-miR-126* X

hsa-miR-30a X

hsa-miR-143 X

hsa-miR-103 X

TABLE 33

5

Example 9: Expression data in the fifth aspect for identifying small cell lung

cancer

The expression data on the differential miRNA expression analysis in the fifth aspect for identifying small cell lung cancer (SLCL) from normal lung tissue are

10 summarized in Table 34-35 below. Table 34 lists the newly identified miRNAs exhibiting a differential expression between small cell lung cancer and normal lung tissue, whereas Table 35 shows the literature documented miRNA signatures in small cell lung cancer. Of 21 known miRNAs in small cell lung cancer, 20 (95%) were in the agreement related to the regulations between the invention and the published data. In

15 the column "t" denotes small cell lung cancer, whereas "n" denotes normal lung tissue.

Particularly preferred miRNAs (SEQ ID NO: 2 to SEQ ID NO: 4, SEQ ID NO: 9, SEQ ID NO: 18, SEQ ID NO: 30, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 90, SEQ ID NO: 91 and SEQ ID NO: 129 in Table 34, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 74 and SEQ ID NO: 98 in Table 35, respectively) are shown

20 in bold. TABLE 34

Newly identified miRNA signatures in small cell lung cancer

Name t-test fold ROC analysis

p-value q -value t/n Sensitivity Specificity AUC 95% CI hsa-miR-96 2E-23 7E-21 22.0 100 98 0.999 0.938 to 1.000 hsa-miR-144 6E-23 2E-20 0.0 100 100 1.000 0.940 to 1.000 hsa-miR -451 2E-17 6E-15 0.0 100 100 1.000 0.940 to 1.000 hsa-miR-130b 2E-20 7E-18 17.1 100 100 1.000 0.940 to 1.000 hsa-miR-93 4E-11 1E-08 5.8 100 98 0.999 0.939 to 1.000 hsa-miR -25 3E-24 9E-22 4.6 100 100 1.000 0.940 to 1.000 hsa-miR-15b 2E-21 6E-19 3.5 100 100 1.000 0.940 to 1.000 hsa-miR -454 4E-15 1E-12 5.4 100 100 1.000 0.940 to 1.000 hsa-miR-375 6E-26 2E-23 31.4 100 100 1.000 0.940 to 1.000 hsa-miR-103 3E-22 9E-20 2.4 100 100 1.000 0.940 to 1.000 hsa-miR-107 3E-11 9E-09 2.2 100 98 0.999 0.938 to 1.000 hsa-miR- 183 2E-24 6E-22 39.0 100 100 1.000 0.940 to 1.000 hsa-miR-486-5p 2E-11 7E-09 0.2 100 84 0.960 0.875 to 0.994 hsa-miR-338-3p 4E-08 1E-05 0.1 94 100 0.994 0.928 to 1.000 hsa-miR- 139-5p 5E-12 1E-09 0.2 88 96 0.928 0.831 to 0.979 hsa-miR-30a* 6E-07 2E-04 0.1 88 96 0.972 0.893 to 0.998 hsa-miR-144* 2E-09 5E-07 0.2 88 93 0.937 0.843 to 0.983 hsa-miR-425 3E-10 9E-08 3.5 88 98 0.964 0.880 to 0.995 hsa-miR- 133b 7E-20 2E-17 0.2 94 100 0.991 0.924 to 1.000 hsa-miR-497 8E-05 2E-02 0.3 81 93 0.887 0.779 to 0.954 hsa-miR- 182 IE- 10 4E-08 15.7 100 96 0.994 0.930 to 1.000 hsa-miR- 187* 2E-23 7E-21 0.2 100 96 0.977 0.901 to 0.999 hsa-miR-30b 4E-08 1E-05 0.3 88 100 0.949 0.859 to 0.989 hsa-miR-145* 6E-12 2E-09 0.2 100 91 0.952 0.863 to 0.990 hsa-miR-429 1E-14 4E-12 6.6 100 96 0.991 0.924 to 1.000 hsa-miR-498 2E-09 4E-07 0.3 81 96 0.923 0.824 to 0.976 hsa-miR-200a 8E-08 2E-05 5.0 100 96 0.991 0.924 to 1.000 hsa-miR- 130a 1E-05 4E-03 0.5 81 91 0.930 0.833 to 0.980 hsa-miR-30c-2* 5E-11 1E-08 0.4 94 82 0.919 0.819 to 0.974 hsa-miR-98 2E-07 6E-05 3.1 81 98 0.964 0.880 to 0.995 hsa-miR- 1 8E-13 2E-10 0.1 94 91 0.947 0.856 to 0.988 hsa-miR- 150* 4E-05 1E-02 0.2 81 96 0.906 0.802 to 0.966 hsa-miR- 134 IE- 13 4E-11 0.2 88 100 0.947 0.856 to 0.988 hsa-miR-328 4E-08 1E-05 0.4 75 93 0.918 0.818 to 0.973 hsa-miR-638 IE- 11 3E-09 0.2 88 98 0.938 0.845 to 0.984 hsa-miR-200b* 2E-06 5E-04 6.0 100 86 0.968 0.887 to 0.996 hsa-miR- 1225-5p 4E-05 1E-02 0.3 75 98 0.891 0.784 to 0.957 hsa-miR- 1224-5p 8E-05 2E-02 0.4 81 93 0.862 0.748 to 0.937 hsa-miR-557 5E-06 1E-03 0.4 75 86 0.826 0.706 to 0.912 hsa-miR-152 2E-09 5E-07 0.4 100 75 0.890 0.782 to 0.956 hsa-miR-301a 1E-08 3E-06 8.7 100 91 0.991 0.923 to 1.000 hsa-miR-100 5E-06 2E-03 0.2 88 98 0.938 0.845 to 0.984 hsa-miR-223 4E-07 1E-04 0.1 94 100 0.984 0.911 to 1.000 hsa-miR-196b 2E-06 6E-04 11.1 88 93 0.948 0.858 to 0.989 hsa-miR-1226* 5E-09 2E-06 0.3 81 89 0.901 0.797 to 0.963 hsa-miR-572 3E-05 1E-02 0.2 69 98 0.874 0.762 to 0.945 hsa-miR-18b 4E-08 1E-05 6.6 100 93 0.990 0.922 to 1.000 hsa-miR^* 3E-05 9E-03 22.7 88 98 0.971 0.891 to 0.997 hsa-miR-301b 5E-08 2E-05 8.0 100 93 0.978 0.902 to 0.999 hsa-miR-199b-3p 3E-05 8E-03 0.4 94 89 0.952 0.864 to 0.991 hsa-miR-34a 2E-05 5E-03 0.4 100 93 0.991 0.923 to 1.000 hsa-miR-200a* 8E-05 2E-02 3.9 75 96 0.891 0.783 to 0.957 hsa-miR-26a 3E-15 9E-13 0.4 88 100 0.975 0.898 to 0.998 hsa-miR-574-3p 8E-13 2E-10 0.4 100 93 0.987 0.917 to 1.000 hsa-miR-768-5p 2E-07 5E-05 0.3 75 96 0.875 0.764 to 0.946 hsa-miR-29a 2E-06 7E-04 0.2 88 100 0.907 0.804 to 0.967 hsa-miR-29b 3E-07 8E-05 0.2 94 98 0.982 0.909 to 0.999 hsa-miR-505 1E-08 4E-06 2.9 94 89 0.932 0.836 to 0.981 hsa-miR-939 7E-05 2E-02 0.4 88 84 0.869 0.756 to 0.942 hsa-miR-769-5p 1E-07 4E-05 2.4 94 86 0.908 0.805 to 0.967 hsa-miR-625 2E-05 5E-03 2.2 63 89 0.825 0.705 to 0.911 hsa-miR-139-3p 2E-07 5E-05 0.3 81 91 0.905 0.801 to 0.965 hsa-miR-19a 1E-08 4E-06 3.7 94 98 0.992 0.926 to 1.000 hsa-miR-551b 2E-12 6E-10 0.2 88 98 0.938 0.845 to 0.984 hsa-miR-362-5p 2E-04 5E-02 2.5 69 98 0.856 0.741 to 0.933 hsa-miR-181a* 1E-08 3E-06 0.4 88 82 0.906 0.803 to 0.966 hsa-miR-940 6E-09 2E-06 0.4 75 96 0.918 0.818 to 0.973 hsa-miR-601 2E-05 6E-03 0.4 88 71 0.823 0.703 to 0.910 hsa-miR-20b 2E-07 5E-05 4.2 94 100 0.977 0.900 to 0.999 hsa-miR-23a 8E-10 2E-07 0.3 100 98 0.996 0.932 to 1.000 hsa-miR-27a 3E-09 9E-07 0.2 94 100 0.993 0.927 to 1.000 hsa-miR-199a-5p 9E-09 3E-06 0.2 94 100 0.991 0.924 to 1.000 hsa-let-7i 3E-07 8E-05 2.8 100 89 0.987 0.916 to 1.000 hsa-miR-19b 2E-08 7E-06 2.6 94 98 0.987 0.917 to 1.000 hsa-miR-20a* 4E-08 1E-05 5.6 94 96 0.986 0.915 to 1.000 hsa-miR-17* 2E-07 5E-05 5.7 100 91 0.984 0.911 to 1.000 hsa-miR-22 2E-07 5E-05 0.3 94 98 0.979 0.903 to 0.999 hsa-miR-340* 1E-12 4E-10 3.4 94 91 0.977 0.900 to 0.999 hsa-miR-214 8E-07 2E-04 0.3 100 86 0.971 0.891 to 0.997 hsa-miR-592 5E-06 1E-03 5.5 88 98 0.955 0.867 to 0.992 hsa-miR-335* 3E-11 1E-08 4.6 100 82 0.955 0.868 to 0.992 hsa-miR-29c* 2E-06 6E-04 0.3 88 89 0.940 0.846 to 0.985 hsa-miR-421 2E-05 6E-03 3.0 75 98 0.929 0.832 to 0.979 hsa-miR-886-3p 2E-06 7E-04 0.2 94 91 0.924 0.826 to 0.977 hsa-miR-16-2* 2E-08 5E-06 2.6 100 80 0.919 0.819 to 0.974 hsa-miR-135a 2E-05 5E-03 7.5 81 93 0.913 0.812 to 0.970 hsa-miR-183* 1E-04 3E-02 2.7 81 91 0.912 0.810 to 0.970 hsa-miR-7-1* 2E-05 7E-03 3.2 75 98 0.899 0.794 to 0.962 hsa-miR-26b 2E-05 5E-03 0.5 81 100 0.894 0.788 to 0.959 hsa-miR-455-3p 4E-05 1E-02 0.2 81 98 0.885 0.776 to 0.953 hsa-miR-222 7E-05 2E-02 0.2 88 93 0.880 0.770 to 0.950 hsa-miR-95 5E-05 1E-02 6.8 88 93 0.875 0.764 to 0.946 hsa-miR-564 4E-06 1E-03 0.5 75 86 0.853 0.738 to 0.931 hsa-miR-636 4E-05 1E-02 0.5 69 86 0.839 0.721 to 0.921 hsa-miR-34b* 9E-05 2E-02 0.2 69 91 0.836 0.718 to 0.919

TABLE 35

Literature documented miRNA signatures in small cell lung cancer

t-test fold Reported regulation

p-value q -value t/n

hsa-miR-106b 6E-25 2E-22 3.80 up

hsa-miR-30a 4E-09 1E-06 0.13 down

hsa-miR-145 2E-08 6E-06 0.09 down

hsa-miR-17 1E-09 3E-07 5.36 up

hsa-miR-20a 3E-10 1E-07 4.36 up

hsa-miR-18a 3E-09 9E-07 8.97 up

hsa-miR-126 5E-10 1E-07 0.11 down

hsa-miR-126* 6E-19 2E-16 0.12 down

hsa-miR-140-3p 4E-05 1E-02 0.24 down

hsa-miR-101 5E-06 2E-03 0.42 down

hsa-miR-143 7E-07 2E-04 0.11 down

hsa-miR-140-5p 4E-05 1E-02 0.41 down

hsa-miR-29c 5E-08 2E-05 0.19 down

hsa-miR-199b-5p 2E-07 6E-05 0.12 down

hsa-miR-125a-3p 5E-05 1E-02 0.32 down

hsa-miR-9 6E-07 2E-04 31.37 down

hsa-miR-200b 1E-09 3E-07 12.45 up

hsa-miR-210 3E-07 1E-04 3.45 up

hsa-miR-7 9E-09 3E-06 29.94 up

hsa-miR-128 3E-12 8E-10 4.66 down

hsa-miR-106a 6E-07 2E-04 5.82 up The expression data on the prediction analysis of microarray in the fifth aspect for predicting small cell lung cancer from normal lung tissue are summarized in Table 36-39 below. Table 36 shows PAM classifiers along with 10-fold cross-validation accuracy, Table 37 lists the top miRNAs from feature selection by WEKA algorithm, Table 38 displays the comparison of components in the classifiers identified by the two employed classification algorithms, whereas Table 39 shows classification performance of identified miRNA predictors in multiple algorithms. Particularly preferred the top 11 identified miRNAs (SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 18, SEQ ID NO: 28, SEQ ID NO: 38, SEQ ID NO: 58, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 98 and SEQ ID NO: 129 in Table 38 are shown in bold.

TABLE 36

PAM scores for predicting small cell lung cancer from normal lung tissue

TABLE 37

Top miRNAs from feature selection in WEKA for predicting small cell lung cancer from normal lung tissue

Name Average merit Average rank Attribute hsa-miR-145 0.836 +- 0.013 5 +- 3.41 99

hsa-miR-144 0.836 +- 0.013 5.2 +- 3.92 97

hsa-miR-103 0.836 +- 0.013 6 +- 3.13 23

hsa-miR-375 0.836 +- 0.013 6.3 +- 3.69 347

hsa-miR-20a 0.836 +- 0.013 7.1 +- 4.13 197 hsa-miR-130b 0.836 +- 0.013 7.7 +- 4.2 70

hsa-miR-30a 0.836 +- 0.013 8.6 +- 4.65 274

hsa-miR-454 0.836 +- 0.013 9.6 +- 4.43 394

hsa-miR-106b 0.836 +- 0.013 9.9 +- 4.37 28

hsa-miR-25 0.836 +- 0.013 10.3 +- 4.2 237

hsa-miR-15b 0.836 +- 0.013 10.3 +- 4.98 125

hsa-miR-451 0.836 +- 0.013 10.4 +- 4.43 390

hsa-miR-17 0.836 +- 0.013 10.6 +- 3.69 130

TABLE 38

Classifier comparison and shared miRNAs in the classifiers for predicting small cell lung cancer from normal lung tissue

TABLE 39

Top 13 miRNA from WEKA

NaiveBayes SMO SimpleLogistic RandomForest

Classification accuracy 100 % 100 % 100 % 100%

PAM predictor + Top5 miRNAs from WEKA (11 miRNAs) NaiveBayes SMO SimpleLogistic RandomForest

Classification accuracy 100% 100% 100 % 100 %

Example 10: Expression data in the sixth aspect for discriminating non-small cell lung cancer from small cell lung cancer

The expression data on the prediction analysis of microarray in the sixth aspect 5 for discriminating non- small cell lung cancer from small cell lung cancer are summarized in Table 40-43 below. Table 40 shows PAM classifiers along with 10-fold cross-validation accuracy, Table 41 lists the top miRNAs from feature selection by WEKA algorithm, Table 42 displays the comparison of components in the classifiers identified by the two employed classification algorithms, whereas Table 43 shows 10 classification performance of identified miRNA predictors in multiple algorithms.

Particularly preferred the top 8 identified miRNAs (SEQ ID NO: 90, SEQ ID NO: 116, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 137, SEQ ID NO: 140, SEQ ID NO: 146 and SEQ ID NO: 156 in Table 42 are shown in bold.

15 TABLE 40

PAM scores for discriminating non-small cell lung cancer from small cell lung cancer

CV Confusion Matrix (Threshold=5.50774)

True\Predicted NSCLC SCLC Class Error rate NSCLC 63 3 0.045455

SCLC 3 13 0.1875

10-fold cross-validation accuracy: 92.68%

TABLE 41

Top miRNAs from feature selection in WEKA for discriminating non-small cell lung cancer from small cell lung cancer

TABLE 42

Classifier comparison and shared miRNAs in the classifiers for discriminating non-small cell lung cancer from small cell lung cancer

TABLE 43

5

Example 11: Expression data in the seventh aspect for discriminating

adenocarcinoma, squamous cell or small cell lung cancer

The expression data on the prediction analysis of microarray in the seventh aspect for discriminating adenocarcinoma (AC), squamous cell (SQ) or small cell lung

10 cancer (SCLC) from the other two in Table 44-47 below. Table 44 shows PAM classifiers along with 10-fold cross-validation accuracy, Table 45 lists the top miRNAs from feature selection by WEKA algorithm, Table 46 displays the comparison of components in the classifiers identified by the two employed classification algorithms, whereas Table 47 shows classification performance of identified miRNA predictors in

15 multiple algorithms. Particularly preferred the top 7 identified miRNAs (SEQ ID NO:

30, SEQ ID NO: 79, SEQ ID NO: 87, SEQ ID NO: 90, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 131 in Table 46) are shown in bold. TABLE 44

PAM scores for discriminating adenocarcinoma, squamous cell or small cell lung cancer

TABLE 45

Top 13 miRNAs from feature selection in WEKA for discriminating

adenocarcinoma, squamous cell or small cell lung cancer

Name Average merit Average rank Attribute hsa-miR-375 1.099 +- 0.046 1 +- 0 347 hsa-miR-34a 0.84 +- 0.036 2.2 +- 0.4 320 hsa-miR-27a 0.76 +- 0.056 2.9 +- 0.54 244 hsa-miR-29a 0.687 +- 0.065 5.1 +- 2.02 256 hsa-miR-29b 0.669 +- 0.06 5.6 +- 2.65 258 hsa-miR-221 0.64 +- 0.047 6.3 +- 1.35 223 hsa-miR-205 0.592 +- 0.033 7.5 +- 1.5 193 hsa-miR-592 0.536 +- 0.062 11.3 +- 3.74 565 hsa-miR-25 0.538 +- 0.079 11.5 +- 3.61 237 hsa-miR-95 0.509 +- 0.042 13 +- 3.82 716 hsa-miR-22 0.495 +- 0.041 14.4 +- 5 218 hsa-miR-15b 0.492 +- 0.026 14.5 +- 3.23 125 hsa-miR-199a-5p 0.506 +- 0.072 14.9 +- 6.09 175

TABLE 46

Classifier comparison and shared miRNAs in the classifiers for discriminating adenocarcinoma, squamous cell or small cell lung cancer

TABLE 47

5 Example 12: Expression data in the seventh aspect for discriminating

adenocarcinoma from squamous cell

The expression data on the prediction analysis of microarray in the eighth aspect for discriminating adenocarcinoma (AC) from squamous cell (SQ) in Table 49-52 below. Table 49 shows PAM classifiers along with 10-fold cross-validation accuracy, 10 Table 50 lists the top miRNAs from feature selection by WEKA algorithm, Table 51 displays the comparison of components in the classifiers identified by the two employed classification algorithms, whereas Table 52 shows classification performance of identified miRNA predictors in multiple algorithms. Particularly preferred the top 8 identified miRNAs (SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 30, SEQ ID NO: 15 79, SEQ ID NO: 90, SEQ ID NO: 95 and SEQ ID NO: 100 in Table 51) are shown in bold.

TABLE 49

PAM scores for discriminating adenocarcinoma from squamous cell lung cancer name AC score SQ score

hsa-miR-205 -0.2566 0.3079 hsa-miR-25 -0.1618 0.1942 hsa-miR-93 -0.0677 0.0812 hsa-miR-29c 0.0174 -0.0209

- o cross-va at on accuracy: .

TABLE 50

Top 13 miRNAs from feature selection in WEKA for discriminating adenocarcinoma from squamous cell

TABLE 51

Classifier comparison and shared miRNAs in the classifiers for discriminating adenocarcinoma from squamous cell lung cancer

Name PAM WEKA hsa-miR-497 X

hsa-miR-93 X

hsa-miR-25 X X

hsa-miR-29c X

hsa-miR-205 X X

hsa-miR-375 X

hsa-miR-149 X

hsa-miR-29a X

hsa-miR-1 X

TABLE 52

Classification performance of identified miRNA predictors in multiple

algorithms

5

The results obtained demonstrate a global highly specific regulation of miRNA expression in lung cancer. Thus, the respective subsets of miRNAs specified herein represent unique miRNA expression signatures for expression profiling of lung cancer that do not only allow the identification of a cancerogenous state as such but also 10 enables the discrimination between different types of lung tumors.

Hence, the miRNA expression signatures defined herein do not run out in the mere identification of lung cancer but also enable a reliably risk assessment of patients exhibiting or being supposed to have a pre-cancerous state whether or not the precancerous state will progress in a carcinoma. In other words, the miRNA expression 15 signatures as defined herein enable a prediction of disease progression for patients having a predisposition to develop lung cancer

Such a risk assessment of cancer progression is of significant clinical importance in several respects. The identification of the miRNA expression signatures of the present invention provides a unique molecular marker that allows the detection of lung at an early disease stage (that is, at a stage where the presence of malignant cells is not yet detectable by in situ techniques or microscopic analysis of biopsy or resection material), where lung cancer still can be efficiently treated markedly. Furthermore, the prediction of cancer progression may be used to guide the therapy decision in patients exhibiting a pre-cancerous state of lung cancer.

The present invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by embodiments and optional features, modifications and variations of the inventions embodied therein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

Claims

Diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting or having a predisposition to develop lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence,

wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and

wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of or the predisposition to develop lung cancer, and/or different types of lung cancer, and wherein the different lung cancers consist of adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.

The kit of claim 1, wherein the nucleic acid expression signature may comprises at least eighty-two nucleic acid molecules, preferably at least thirteen nucleic acid molecules, and particularly preferably at least seven nucleic acid molecules.

The kit of claim 1 to 2, wherein the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.

The kit of any of claims 1 to 3, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding the nucleic acid expression signature comprises nucleic acid molecules encoding hsa-miR-183, hsa- miR-451, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa- miR-218, hsa-miR-139-5p, hsa-miR-130b, hsa-miR-30a*, hsa-miR-144*, hsa-miR- 425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR-187*, hsa-miR-30b, hsa- miR-93, hsa-miR-145*, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-625, hsa- miR-130a, hsa-miR-30c-2*, hsa-miR-98, hsa-miR-1, hsa-miR-106b, hsa-miR-150*, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b*, hsa-miR- 1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-100, hsa-miR-223, hsa-miR-196b, hsa-miR-196a, hsa-miR- 1226*, hsa-miR-424, hsa-miR-21*, hsa-miR-572, hsa-miR-18b, hsa-miR-18a, hsa- miR-9*, hsa-miR-301b, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-224, hsa-miR-125a-3p, hsa-miR-9, hsa- miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa- miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150, hsa-miR-205, hsa-miR-192, hsa-miR-215 and hsa-miR-106a.

The kit of claim 4, wherein the expression of the nucleic acid molecules encoding hsa- miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa- miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR-98, hsa-miR-106b, hsa- miR-25, hsa-miR-200b*, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-196b, hsa-miR-196a, hsa-miR-424, hsa-miR-21*, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa- miR-192, hsa-miR-215, hsa-miR-106a is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-126, hsa-miR- 126*, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-218, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa- miR-133b, hsa-miR-497, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR- 328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-1226*, hsa-miR-572, hsa-miR-101, hsa-miR-143, hsa-miR- 140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p, hsa-miR- 195, hsa-miR-142-5p and hsa-miR-150 is down-regulated in the in the one or more target cells compared to the one or more normal control cells. The kit of any of claims 1 to 3, wherein the nucleic acid expression signature comprises nucleic acid molecules encoding hsa-miR-183, hsa-miR-451, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR- 144, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p and hsa-miR-218.

The kit of claim 6, wherein the expression of the nucleic acid molecules encoding hsa- miR-183, hsa-miR-96 and hsa-miR-200c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-126, hsa-miR- 126*, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR-338-3p and hsa-miR-218 is down-regulated in the in the one or more target cells compared to the one or more normal control cells.

The kit of any of claims 1 to 3, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa- miR-451, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-145 and hsa-miR-140- 3p.

The kit of claim 8, wherein the expression of hsa-miR-183 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-145 and hsa-miR-140-3p is down-regulated in the one or more target cells compared to the one or more normal control cells.

The kit of claim 1, wherein the lung cancer is non- small cell lung cancer, including squamous cell lung cancer and adenocarcinoma lung cancer.

The kit of claim lor 10, wherein the nucleic acid expression signature may comprise at least seventy nucleic acid molecules, preferably at least fourteen nucleic acid molecules, and particularly preferably at least nine nucleic acid molecules. The kit of claim 1, 10 or 11, wherein the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.

The kit of any of claims 1 or 10 to 12, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa- miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR- 486-5p, hsa-miR-139-5p, hsa-miR-338-3p, hsa-miR-130b, hsa-miR-144*, hsa-miR- 425, hsa-miR-133b, hsa-miR-182, hsa-miR-187*, hsa-miR-30b, hsa-miR-93, hsa- miR-145*, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-625, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-98, hsa-miR-1, hsa-miR-150*, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b*, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-135b, hsa-miR-100, hsa-miR-424, hsa-miR-21*, hsa-miR-30a*, hsa-miR-494, hsa-miR-193b, hsa-miR-99a, hsa-miR-335, hsa-miR-106b, hsa-miR- 140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, hsa-miR-29c, hsa-miR-224, hsa- miR-9, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR- 128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150, hsa-miR-205, hsa-miR-192 and hsa-miR-215.

The kit of claim 13, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa- miR-425, hsa-miR-182, hsa-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa- miR-98, hsa-miR-25, hsa-miR-200b*, hsa-miR-135b, hsa-miR-424, hsa-miR-21*, hsa-miR-494, hsa-miR-193b, hsa-miR-106b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa- miR-192, hsa-miR-215 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR- 126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa- miR-486-5p and hsa-miR-139-5p, hsa-miR-338-3p, hsa-miR-144*, hsa-miR-133b, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR- 30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa- miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-30a*, hsa-miR- 99a, hsa-miR-335, hsa-miR-140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, hsa- miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 is down-regulated in the one or more target cells compared to the one or more normal control cells.

The kit of any of claims 1 or 10 to 12, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa- miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR- 486-5p and hsa-miR-139-5p.

The kit of claim 15, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa-miR-96, hsa-miR-200c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p and hsa-miR-139-5p is down- regulated in the one or more target cells compared to the one or more normal control cells.

The kit of any of claims 1 or 10 to 12, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-183, hsa- miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145 and hsa-miR-140-3p.

The kit of claim 17, wherein the expression of hsa-miR-183 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-145 and hsa-miR-140-3p is down-regulated in the one or more target cells compared to the one or more normal control cells. The kit of claim 1, wherein the lung cancer is adenocarcinoma lung cancer.

The kit of claim lor 19, wherein the nucleic acid expression signature may comprises at least fifty-seven nucleic acid molecules, preferably at least thirteen nucleic acid molecules, and particularly preferably at least five nucleic acid molecules.

The kit of claim 1 or 19 to 20, wherein the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.

The kit of any of claims 1 or 19 to 21, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa- miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-21, hsa-miR-183, hsa- miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-130b, hsa-miR-30a*, hsa-miR-144*, hsa-miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR- 187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa- miR-130a, hsa-miR-30c-2*, hsa-miR-134, hsa-miR-638, hsa-miR-200b*, hsa-miR- 1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-424, hsa-miR-21*, hsa- miR-99a, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a*, hsa-miR-375, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-224, hsa- miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-141 and hsa-miR-192.

The kit of claim 22, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR- 135b, hsa-miR-148a, hsa-miR-625, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa- miR-429, hsa-miR-200a, hsa-miR-200b*, hsa-miR-424, hsa-miR-21*, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a*, hsa-miR-375, hsa-miR-224, hsa-miR-200b, hsa- miR-210, hsa-miR-7, hsa-miR-141, hsa-miR-192 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-126, hsa-miR-126*, - I l l - hsa-miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR- 338-3p, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-133b, hsa-miR-497, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR- 30c-2*, hsa-miR-134, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-99a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR- 143, hsa-miR-140-5p, hsa-miR-195 is down-regulated in the one or more target cells compared to the one or more normal control cells.

The kit of any of claims 1 or 19 to 21, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa- miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218, hsa-miR-21, hsa-miR-183, hsa- miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a and hsa-miR- 625.

The kit of claim 24, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR- 135b, hsa-miR-148a, hsa-miR-625 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding sa-miR-126, hsa-miR-126*, hsa-miR- 30a, hsa-miR-218, hsa-miR-144, hsa-miR-451 is down-regulated in the one or more target cells compared to the one or more normal control cells.

The kit of any of claims 1 or 19 to 21, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa- miR-126, hsa-miR-126*, hsa-miR-30a and hsa-miR-218.

The kit of claim 26, wherein the expression of hsa-miR-96 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-218 is down-regulated in the one or more target cells compared to the one or more normal control cells.

220 28. The kit of claim 1, wherein the lung cancer is squamous cell lung cancer.

The kit of claim 1 or 28, wherein the nucleic acid expression signature may comprises at least one hundred- twelve nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least nine nucleic acid molecules.

The kit of claim 1, 28 or 29, wherein the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.

The kit of any of claims 1 or 28 to 30, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa- miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR- 218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-93, hsa-miR-126, hsa- miR-126*, hsa-miR-30a, hsa-miR-143, hsa-miR-103, hsa-miR-183, hsa-miR-96, hsa- miR-139-5p, hsa-miR-130b, hsa-miR-30a*, hsa-miR-144*, hsa-miR-425, hsa-miR- 133b, hsa-miR-182, hsa-miR-187*, hsa-miR-145*, hsa-miR-429, hsa-miR-498, hsa- miR-130a, hsa-miR-30c-2*, hsa-miR-98, hsa-miR-1, hsa-miR-106b, hsa-miR-150*, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR- 1224-5p, hsa-miR-557, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, hsa-miR-1226*, hsa-miR-424, hsa-miR-21*, hsa-miR-572, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa-miR-29c*, hsa-miR-494, hsa-miR-193b, hsa-miR-375, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-151-3p, hsa-miR-149, hsa-miR-768-5p, hsa- miR-181a, hsa-miR-20a, hsa-miR-181c, hsa-miR-29a, hsa-miR-29b, hsa-miR-505, hsa-miR-939, hsa-miR-769-5p, hsa-miR-30c, hsa-miR-590-5p, hsa-miR-590-5p, hsa- miR-671-5p, hsa-miR-625, hsa-miR-652, hsa-miR-139-3p, hsa-miR-28-5p, hsa-miR- 623, hsa-miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-335, hsa-miR-125a-5p, hsa- miR-551b, hsa-let-7d*, hsa-miR-31*, hsa-miR-362-5p, hsa-miR-18 la*, hsa-miR-940, hsa-miR-30b*, hsa-miR-601, hsa-miR-20b, hsa-miR-202, hsa-miR-101, hsa-miR-140- 5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR- 195, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150 and hsa-miR-205

The kit of claim 31, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-200c, hsa-miR-93, hsa-miR-103, hsa-miR-183, hsa-miR- 96, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-98, hsa-miR- 106b, hsa-miR-25, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, hsa- miR-424, hsa-miR-21*, hsa-miR-18b, hsa-miR-18a, hsa-miR-9*, hsa-miR-301b, hsa- miR-494, hsa-miR-193b, hsa-miR-151-3p, hsa-miR-149, hsa-miR-20a, hsa-miR-505, hsa-miR-769-5p, hsa-miR-590-5p, hsa-miR-590-5p, hsa-miR-625, hsa-miR-28-5p, hsa-miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-31*, hsa-miR-362-5p, hsa-miR- 20b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa- miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-143, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-133b, hsa- miR-187*, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR- 1224-5p, hsa-miR-557, hsa-miR-1226*, hsa-miR-572, hsa-miR-29c*, hsa-miR-375, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-181a, hsa-miR-181c, hsa- miR-29a, hsa-miR-29b, hsa-miR-939, hsa-miR-30c, hsa-miR-671-5p, hsa-miR-652, hsa-miR-139-3p, hsa-miR-623, hsa-miR-335, hsa-miR-125a-5p, hsa-miR-551b, hsa- let-7d*, hsa-miR-18 la*, hsa-miR-940, hsa-miR-30b*, hsa-miR-601, hsa-miR-202, hsa-miR-101, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR- 142-5p, hsa-miR-150 is down-regulated in the one or more target cells compared to the one or more normal control cells.

The kit of any of claims 1 or 28 to 30, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa- miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR- 218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-93, hsa-miR-126, hsa- miR-126*, hsa-miR-30a, hsa-miR-143 and hsa-miR-103.

34. The kit of claim 35, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-200c, hsa-miR-93, hsa-miR-103 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa- miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126*, hsa-miR-30a, hsa-miR-143 is down-regulated in the one or more target cells compared to the one or more normal control cells.

35. The kit of any of claims 1 or 28 to 30, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa- miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR- 218, hsa-miR-145 and hsa-miR-140-3p.

36. The kit of claim 35, wherein the expression of hsa-miR-200c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa- miR-145 and hsa-miR-140-3p is down-regulated in the one or more target cells compared to the one or more normal control cells.

37. The kit of claim 1, wherein the lung cancer is small cell lung cancer.

38. The kit of claim 1 or 37, wherein the nucleic acid expression signature may comprises at least one hundred-sixteen nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least eleven nucleic acid molecules.

39. The kit of claim 1, 37 or 38, wherein the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells. The kit of any of claims 1 or 37 to 39, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa- miR-144, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa- miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-451, hsa-miR-130b, hsa- miR-454, hsa-miR-30a, hsa-miR-17, hsa-miR-183, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a*, hsa-miR-144*, hsa-miR-425, hsa-miR-133b, hsa- miR-497, hsa-miR-182, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-98, hsa-miR-1, hsa-miR-150*, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b*, hsa-miR- 1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-152, hsa-miR-301a, hsa-miR-100, hsa-miR-223, hsa-miR-196b, hsa-miR-1226*, hsa-miR-572, hsa-miR-18b, hsa-miR- 9*, hsa-miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a*, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-29a, hsa-miR-29b, hsa-miR-505, hsa- miR-939, hsa-miR-769-5p, hsa-miR-625, hsa-miR-139-3p, hsa-miR-19a, hsa-miR- 551b, hsa-miR-362-5p, hsa-miR-181a*, hsa-miR-940, hsa-miR-601, hsa-miR-20b, hsa-miR-23a, hsa-miR-27a, hsa-miR-199a-5p, hsa-let-7i, hsa-miR-19b, hsa-miR-20a*, hsa-miR-17*, hsa-miR-22, hsa-miR-340*, hsa-miR-214, hsa-miR-592, hsa-miR-335*, hsa-miR-29c*, hsa-miR-421, hsa-miR-886-3p, hsa-miR-16-2*, hsa-miR-135a, hsa- miR-183*, hsa-miR-7-1*, hsa-miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR-95, hsa-miR-564, hsa-miR-636, hsa-miR-34b*, hsa-miR-18a, hsa-miR-126, hsa-miR-126*, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-29c, hsa- miR-199b-5p, hsa-miR-125a-3p, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-128 and hsa-miR-106a.

The kit of claim 40, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR- 15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR- 454, hsa-miR-17, hsa-miR-183, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR- 200a, hsa-miR-98, hsa-miR-200b*, hsa-miR-301a, hsa-miR-196b, hsa-miR-505, hsa- miR-769-5p, hsa-miR-625, hsa-miR-19a, hsa-miR-362-5p, hsa-miR-20b, hsa-let-7i, hsa-miR-19b, hsa-miR-20a*, hsa-miR-17*, hsa-miR-340*, hsa-miR-592, hsa-miR- 335*, hsa-miR-421, hsa-miR-16-2*, hsa-miR-135a, hsa-miR-183*, hsa-miR-7-1*, hsa-miR-95, hsa-miR-18a, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa- miR-128 and hsa-miR-106a is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-145, hsa-miR-451, hsa- miR-30a, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a*, hsa- miR-144, hsa-miR-133b, hsa-miR-497, hsa-miR-187*, hsa-miR-30b, hsa-miR-145*, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2*, hsa-miR-1, hsa-miR-150*, hsa-miR- 134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-152, hsa-miR-100, hsa-miR-223, hsa-miR-1226*, hsa-miR-572, hsa-miR- 18b, hsa-miR-9*, hsa-miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a*, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-29a, hsa-miR-29b, hsa- miR-939, hsa-miR-139-3p, hsa-miR-551b, hsa-miR-18 la*, hsa-miR-940, hsa-miR- 601, hsa-miR-23a, hsa-miR-27a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-214, hsa- miR-29c*, hsa-miR-886-3p, hsa-miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR- 564, hsa-miR-636, hsa-miR-34b*, hsa-miR-126, hsa-miR-126*, hsa-miR-140-3p, hsa- miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR- 125a-3p is down-regulated in the one or more target cells compared to the one or more normal control cells.

The kit of any of claims 1 or 37 to 39, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa- miR-144, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa- miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-451, hsa-miR-130b, hsa- miR-454, hsa-miR-30a and hsa-miR-17.

The kit of claim 42, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR- 15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR- 454, hsa-miR-17 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-144, hsa-miR-145, hsa-miR-451, hsa-miR-30a is down-regulated in the one or more target cells compared to the one or more normal control cells.

The kit of any of claims 1 or 37 to 39, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa- miR-144, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa- miR-375, hsa-miR-103, hsa-miR-20a and hsa-miR-107.

The kit of claim 44, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR- 15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a and hsa-miR-107 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR- 144, hsa-miR-145 is down-regulated in the one or more target cells compared to the one or more normal control cells.

The kit of claim 1 to 45, for the further use of discriminating non- small cell lung cancer from small cell lung cancer, and

wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-335, hsa-miR-23a, hsa-miR- 27a, hsa-miR-22, hsa-miR-592, hsa-miR-135a, hsa-miR-24,hsa-miR-454, hsa-miR- 301a, hsa-miR-199b-5p, hsa-miR-9, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-335*, hsa-miR-152 and hsa-miR-216b.

The kit of claim 46, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-135a, hsa-miR- 199b-5p, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-152 is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-335, hsa-miR-592, hsa-miR-24, hsa-miR-454, hsa-miR-301a, hsa-miR-9, hsa-miR-335*, hsa-miR-216b is down-regulated in the one or more target cells compared to the one or more control cells.

The kit of claim 1 to 47, for the further use of discriminating adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer from the other two, and wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa-miR-205, hsa-miR-34a, hsa-miR- 375, hsa-miR-29a, hsa-miR-27a, hsa-miR-29b, hsa-miR-93, hsa-miR-106b, hsa-miR- 15b, hsa-miR-454, hsa-miR-301a, hsa-miR-145, hsa-miR-29c, hsa-miR-221, hsa-miR- 335, hsa-miR-23a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-592, hsa-miR-95, hsa- miR-24 andhsa-miR-92a.

The kit of claim 48, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-34a, hsa-miR-29a, hsa-miR-29b, hsa-miR-145, hsa-miR- 29c is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa-miR-93, hsa-miR-301a, hsa-miR-106b, hsa- miR-15b, hsa-miR-92a is down-regulated in adenocarcinoma lung cancer compared to small cell lung cancer and squamous cell lung cancer; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa-miR-27a, hsa-miR-221 is up-regulated in adenocarcinoma lung cancer compared to small cell lung but is down-regulated compared to squamous cell lung cancer; the expression of hsa-miR- 375 is up-regulated in adenocarcinoma lung cancer compared to squamous cell lung cancer but is down-regulated compared to small cell lung; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-24, hsa-miR-23a, hsa-miR-22, hsa-miR-199a-5p is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-592, hsa-miR-335, hsa-miR-95, hsa-miR- 454 is down-regulated in adenocarcinoma lung cancer compared to small cell lung.

The kit of claim 1 to 49, for the further use of discriminating adenocarcinoma lung cancer from squamous cell lung cancer, and

wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-497, hsa-miR-93, hsa-miR-25, hsa-miR-29c, hsa-miR-205, hsa-miR-375, hsa-miR-149, hsa-miR-29a, hsa-miR-1, hsa-miR-15b, hsa-miR-181c, hsa-miR-29b, hsa-miR-769-5p and hsa-miR-221.

The kit of claim 50, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-497, hsa-miR-29c, hsa-miR-375, hsa-miR-29a, hsa-miR- 1, hsa-miR-181c, hsa-miR-29b is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-93, hsa-miR-25, hsa-miR-205, hsa- miR-149, hsa-miR-15b, hsa-miR-769-5p, hsa-miR-221 is down-regulated in the one or more target cells compared to the one or more control cells. Method for identifying one or more mammalian target cells exhibiting or having a predisposition to develop lung cancer, the method comprising:

(a) determining in the one or more target cells the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence;

(b) determining the expression levels of the plurality of nucleic acid molecules in one or more control cells; and

(c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature, as defined in any of claims 1 to 51, that is indicative for the presence of or the predisposition to develop lung cancer.

The method of claim 52, for the further use of discriminating lung cancer selected from the group consisting of adenocarcinoma lung cancer, squamous cell lung cancer and small-cell lung cancer.

Method for preventing or treating lung cancer in one or more mammalian target cells, the method comprising:

(a) identifying in one or more target cells a nucleic acid expression signature by using a method as defined in claim 52 to 53 and

(b) modifying in the one or more cells the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression is up-regulated in the one or more target cells is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in the one or more target cells is up-regulated.

Pharmaceutical composition for the prevention and/or treatment of lung cancer in one or more mammalian target cells, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in the one or more target cells, as defined in any of claims 1 to 54, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated in the one or more target cells, as defined in any of claims 1 to 54.

Use of the pharmaceutical composition of claim 55 for the manufacture of a medicament for the prevention and/or treatment of lung cancer.