MX2010012542A - Methods for assessing colorectal cancer and compositions for use therein. - Google Patents

Abstract

Disclosed in this specification is a method for determining the stage of colorectal cancer by observing regulatory changes in select miRNA sequences. These sequences may include hsa-miR-143, hsa-miR-145, their respective precursors and combinations of these sequences.

Description

METHODS TO EVALUATE COLORECTAL CANCER AND COMPOSITIONS TO USE IN IT REFERENCE TO A LIST OF SEQUENCES, A TABLE OR A LIST OF PROGRAMS The present application refers to a "sequence listing" which is given below, which is provided as an electronic document entitled "Sequence3035191.txt" (name in English and with 9 kb, created on October 29, 2008), which is incorporated in the present description in its entirety as reference FIELD OF THE INVENTION The present invention relates, in one embodiment, to a method for detecting and / or monitoring colorectal cancer (CRC) by observing regulatory changes in the production of selected microRNA (miRNA) sequences. By observing regulatory changes by increasing or decreasing specified sequences, both the presence of cancer cells and the cancer stage could be determined.

BACKGROUND OF THE INVENTION i i ! by descriptive stages that use the morphology and histopathology of the tumor. However, even morphologically similar tumors may differ in Its underlying molecular changes and its tumorigenic potential. The development of CRC from normal epithelial cells to malignant carcinomas involves a multi-stage process with accumulation of both genetic and epigenetic changes, leading to a temporary activation of oncogenes and deactivation of tumor suppressor genes that confer a selective advantage to the cells that contain these alterations. j There have been several studies of profiling of expression of i CCR in genes that encode proteins to better resolve the underlying molecular routes and to further dissect the different stages of the CCR. More recently, a newly discovered class of short, non-coding RNAs, of 22 nucleotides (nt), called microRNAs (miRNAs), has been identified and implicated in the initiation and progression of cancer. The biogenesis of these small RNAs includes transcription by RNA polymerase II and the processing of the primary transcript by the Drosha lendonuclease to produce 60-70-nt (pre-miRNA) precursor miRNAs with imperfect hairpin structures. The pre-miRNA is transported through the cytoplasm through exportin 5, where the enzyme RNAse II Dicer processes it to produce mature miRNAs, which are then incorporated into a multiprotein complex. It has been shown that these miRNA-containing complexes bind to the 3 'untranslated region (UTR) of multiple mRNAs through the complementarity between the resident miRNA chain and the target sequence and, based on the degree of homology , direct translational inhibition or mRNA degradation. To date, 678 human miRNAs have been identified (Database of miRBase sequences - Version 1 1) and, through computational models, it has been suggested that there could be more than 1000 miRNA genes, comprising approximately 3% of the genes currently known in the genome human. In addition, bioinformatic analyzes estimate that miRNAs could regulate as much as 30% of human genes that encode proteins, suggesting that these small RNAs could act to coordinate the interaction between complex signal transduction pathways.

Several miRNAs were identified as differentially expressed between normal and tumorous tissues or cancer cell lines. (Calin, GA and Croce, CM MicroRNA signatures in human cancers, Nat Rev Cancer, 6: 857-666, 2006; Bandres, E., Cubedo, E., Agirre, X., Malumbres, R., Zarate, R. , Ramírez, N., Abajo, A., Navarro, A., Moreno, I., Monzo, M. and Garcia-Foncillas, J. Identification by Real-time PCR of 13 mature microRNAs differentially Expressed in colorréctal cancer and non-tumor tissues. Mol Cancer, 5: 29, I 2006; Cummins, J.M., He, Y., Leary, R.J., Pagliarini, R., Diaz, L.A., Jr., jSjoblom, T., Barad, O., Bentwich, Z., Szafranska, A.E., Labourier, E., Raymond, C.K., Roberts, B.S., Juhl, H., Kinzler, K.W., Vogelstein, B. and jVelculescu, V. e. The colorréctal microRNAome. Proc Nati Acad Sci U S A, 103: | 3687-3692, 2006; Michael, M. Z., SM, O. C, van Holst Pellekaan, N. G., Young, G. P. and James, R. J. Reduced accumulation of specific microRNAs in colorréctal neoplasia Mol Cancer Res, 1: 882-891, 2003; Lanza, G., Ferracin, M., Gafa, R., Veronese, A., Spizzo, R., Pichiorri, F., Liu, C.G., Calin, G.A., Croce, C.M.

Negrini, M. mRNA / microRNA gene expression profile in microsatellite unstable colorectal cancer. Mol Cancer, 6: 54, 2007).

Limited studies have been conducted through the evaluation of the expression patterns of miRNA in CCR. The first study that showed deregulation of miRNA registered regulation by decreasing miR- 143 and miR-145 in the adenomatous pre-polyp stage, suggesting a possible activity for these miRNAs in the early stages of the RCC.

Subsequently, a group of 13 miRNAs were identified that show differential expression in CRC tumors with the expression level of miR- 31 in correlation with the tumor stage of CCR.

BRIEF DESCRIPTION OF THE INVENTION The invention comprises, in one form, a method for detect the presence of colorectal cancer in a sample of cells. In another way, the invention is a method to diagnose the stage of cancer colorectal in a sample of cells. The applicants discovered certain miRNA that are differentially regulated in colorectal cancers compared with wild cells. By determining the degree of Regulatory changes in miRNAs can be determined if a sample of tissue includes colorectal cancer cells. The applicants discovered certain different miRNAs that are differentially regulated in cancers Late-stage colorectal cancers (stage III and IV) compared to cancers Early-stage colorectal cancers (stage I and II). By monitoring These miRNAs can differentiate a sample of late-stage tumors of a sample of early stage tumors without the need to use less reliable identifiers, such as the morphology of the cells.

BRIEF DESCRIPTION OF THE FIGURES I Figure 1. Bidirectional hierarchical clustering of tissue i Normal colorectal and CCR by using 41 expressed miRNAs i differentially. The geometric mean of the Log2 signal intensity was calculated among all the samples, by using a Euclidean distance metric with full link. Red and blue indicate miRNAs expressed at i a relatively high or low level, respectively. Groups miR-143-145 and miR-17-92 are indicated by blue and red vertical bars, i respectively. The samples are grouped into three main groups: Group I represents mainly normal colorectal tissue and Groups II and III represent samples of CCR. Duplicate samples are indicated with the suffix I I - Figure 2. Correlation of miRNA expression comparing ! Figures 3A-3B. Expression of miRNA in samples of CCR i Fresh frozen in comparison to formalin fixed and paraffin embedded samples (FFPE). (Figure | 3A) TaqMan® miRNA expression assays were performed on 26 miRNA of 4 fresh frozen samples and matching FFPE. (Figure 3B) Comparison of the expression of 18 miRNA from 2 fresh frozen samples and matching FFPEs using the mirVana ™ i test Bioarray Figures 4A-4B. Expression of specific miRNA levels by stage of disease. (Figure 4A) The dot plots of mR-1, miR-133a, miR-143 and miR-145 show a reduced expression from tissue i normal colorectal in early stage CRC (I and II) and late stage (III and IV).

(Figure 4B) The analysis of the miR-31 point transfer membrane, I imR-21, miR-20a and miR-106a show increased expression from normal colorectal tissue in early stage CRC (I and II) and late stage (III and IV).

I Figure 5. Expression of 22 miRNA in 8 CCR cell lines and normal total colon RNA. Northern membrane analysis was performed using U6 nRNA as a normalization control.

Figures 6A-6D. The overexpression of miR-145 in the SW620 cell line affects the morphology and cell proliferation. (Figure 6A) The i genomic region surrounding the miR-145 gene was amplified by PCR and cloned into i pSilencer ™ 4.1 under the control of the CMV promoter. Mature miR-145 was detected by Northern analysis in a pooled population of SW620 cells after transfection. U6 nRNA was used as charge control. (Figure 6B) An important distinguishing feature of the overexpressing cell population imiR-145 was the change in the morphology of single rounded cells of jsW620 to elongated cells with extensive processes typical of similar cells «I ja fibroblasts. (Figure 6C) The miR-145 expressing population of SW620 cells showed a two-fold increase in anchor-independent growth when cultured in the presence of serum, and an increase of more than 50% in the metabolic / cell proliferation activity when cultured in the presence (solid bars) or absence (open bars) of serum, p < 0.001. (Figure 6D) Western analysis of SW620 / miR-145 cells and control cells shows that steady state levels of E-cadherin were 50% lower in the SW620 cell expressing mature miR-145.

Figures 7A-7B. Antisense mediated reversion of proliferation induced by miR-145. (Figure 7A) Total RNA from the treated samples showed a reduction of miR-145 in the cells receiving the miRNA-specific 2'Ome antisense RNA, but not in the miR-145 controls treated with sense or with sham treatment . (Figure 7B) As expected, pools expressing SW620 / miR-145 showed increased proliferation compared to vector controls in the presence (solid bars) or absence (open bars) of serum. When treated with miR-145 antisense RNA, a reduction in proliferation was seen in the SW620 / vector and SW620miR-145 pools. Three independent experiments were performed, p < 0.05; p < 0.01; p < 0.001.

Figures 8A-8D. The overexpression of miR-143 in the SW620 cell line affects the morphology and proliferation of the cells. (Figure 8A) Genomic DNA from miR-143 was cloned under the control of the U6 promoter (in ipSilencer ™ 2.1) and transfected into SW620 cells. Seven stable clones of SW620 expressing miR-143 (A4, B3, B5, B6, C1, C5 and D2) were identified. U6 nRNA was used as charge control. (Figure 8B) The morphology of the cells of the clones of SW620 / miR-143 was analyzed in comparison to vector control. (Figure 8C) Western analysis of the clones of SW620 / miR-143 and the control cells shows steady-state levels of E-cadherin. The indices of E-cadherin were calculated using β-actin as a i j normalization control. (Figure 8D) Trials were conducted on seven clones of SW620 / mR-143 to analyze the metabolic / proliferation activity in 'comparison with vector control, when grown in the absence (bars) I open) or presence of serum (solid bars). (E) The same were analyzed Jolones to evaluate cell growth independent of the anchor in the assay Rapid soft agar in the presence of serum. Two experiments were carried out I ! independent, p < 0.01, p < 0.001.

'Figure 9. Correlation between the expression of miR-143 and miR-145.

The linear regression analysis was performed comparing the intensity of normalized expression (log2) for the miR-143 and miR-145 genes. The I Correlation between miRNAs was 0.95.

Figure 10. Shows the interaction map for miR-17-92.

Figures 1 1A-1 1 D. Overexpression of the miR-17-92 group and the miR-20a alone in the SW620 cell line affects the morphology and proliferation of cells. The genomic regions were amplified by PCR that contain the miR-17-92 group based on chromosome 13 and the region genomic sample containing the miR-20a pre-miRNA, were cloned under the control of the CMV promoter in the retroviral vector pQCXIN and were supplied to the colon cancer cell line HCT1 16. (Figure 1A) the clones of the group HCT1 16 / miR-17-92 (4-1 and 4-17) were analyzed in search of the overexpression of miR-20a, miR-92, miR-18a and miR-19a using the analysis i of the Northern membrane. We also analyzed the clones that overexpress miR-20a alone (9-3,9-9,9-12 and 9-13) in search of the I I . 0 I I expression of these group components. (Figure 11 B) Histogram of the miRNA expression levels of the miR-17-92 component calculated from the Northern membrane. Expression levels were normalized to snRNA U6. (Figure 11 C) Several HCT116 clones expressing miR-20a (9-3, 9-9, 9-12, 9-13) or miR-17-92 (4-1, 4-7) were analyzed. in search of metabolic / proliferation activity in presence (solid bar) i The absence of serum (open bar). (Figure 11 D) The same clones were analyzed in search of cell growth independent of the anchor in the 'rapid test of soft agar (in the presence of serum), p < 0.05, p < 0.01, | p < 0.001.

| DETAILED DESCRIPTION OF THE INVENTION i j The mircroRNA (miRNA) are short, non-coding RNAs that control the expression of proteins through various mechanisms. It has been ^ showed that its altered expression is associated with several cancers. In the present description, a method is described that outlines the expression of MiRNA in CCR and analyzes the function of specific mrRNAs in CCR cells. i MiRNA mirVana ™ Bioarrays were used to determine the expression profile of miRNA in eight models of CCR cell lines, 45 human samples of CCR in different stages and four samples of normal colon tissue. We identified 11 common miRNAs that were differentially expressed between normal colon and CRC in both cell line models and clinical samples. Now it has been shown that many of these miRNAs are related to different stages of tumor progression of CCRs that include miR-145, which is significantly reduced in CCR.

In vitro information indicated that miR-143 and miR-145 work oppositely to inhibit or increase cell proliferation depending on the context jcelular Several miRNAs were also overexpressed in CCR, which include jmR-31 and the miR-17-92 group. The increase of mR-17-92 in CCR cells ^ SW620 reduced cell proliferation but increased growth independent of anchorage. The dissection of the miRNA group suggested that miR- | 20A was an active component. Therefore, miRNAs can be targets of CRC therapies and prognostic and diagnostic analytes.

The characteristics of miRNA expression were compared in 45 clinical samples of CRC, four normal colorectal tissues coincident and eight models of cell lines. 11 miRNA were identified i That they commonly changed in expression levels between normal colon and cell lines and clinical samples. Some of the miRNAs are restricted in patterns of expression at different stages of CCR and could provide Potential markers of prognosis and diagnosis for this cancer. The re-expression of miR-143 or miR-145 in a cell line of CCR model i It affects the differentiation and proliferation of cells in opposite ways.

I In addition, the increase in the expression of the miR-17-92 group reduced the i proliferation of cells, but increased anchorage independent growth. The dissection of this group shows that miR-20a is a component í active of these effects dependent on the cellular context.

A biomarker is any distinguishing mark of the expression level of an indicated marker gene. The distinguishing marks can be direct or indirect and measure the envelope or subexpression of the gene given the physiological parameters and in comparison with an internal control, normal tissue or Another carcinoma. Biomarkers include, but are not limited to, acids Nucleic acids and proteins (both overexpression and subexpression and direct and indirect). The use of nucleic acids as biomarkers can include any method known in the art that includes, but is not limited to, measuring DNA amplification, RNA, microRNA, loss of heterozygosity (LOH), polymorphisms of simple nucleotides (SNP, for its jsiglas in English), microsatellite DNA, hypo or hypermethylation of DNA. The use of proteins as biomarkers comprises any method known in the art that includes, but is not limited to, measured amount, activity, modifications such as glycosylation, phosphorylation, ADP ribosylation, (ubiquitination, etc., or immunohistochemistry (IHC). Other biomarkers include imaging, cell counts, and markers of apoptosis.

The miRNAs or indicated genes that are provided herein are those associated with a particular tissue or tumor type. A large number of genes associated with one or more cancers is known in the subject. The present invention provides the preferred marker genes and even more preferred marker gene combinations. These are described in detail in the present description.

A marker gene corresponds to the sequence designated by a sec. with no. ident: when it contains said sequence or its complement. A segment or gene fragment corresponds to the sequence of said gene when it contains a portion of the reference sequence or its Complement enough to distinguish it as the gene sequence. i A gene expression product corresponds to such a sequence when its RNA, MRNA, miRNA or hybrid cDNA with the composition having that sequence (eg, a probe) or, in the case of a peptide or a protein, is encoded by the mRNA. A segment or fragment of gene expression product corresponds to the sequence of the gene or gene expression product when it contains a portion of the expression product of the reference gene or its complement sufficient to distinguish it as the Sequence of the gene or gene expression product. The novel methods, compositions, articles and kits described and claimed in this specification include one or more marker genes. The term "marker" or "marker gene" is used in this description to refer to genes and gene expression products that match any gene whose envelope or subexpresion is associated with a type of tissue or tumor. Preferred marker genes are described in more detail in the present description. All sequences discussed herein are described herein and are provided in the sequence listing. The present invention also provides kits for conducting an assay in accordance with the methods provided in the present disclosure and also contains reagents for detection of biomarkers. The present invention also provides microarrays or gene chips to carry out the methods described in the present disclosure. The present invention additionally provides diagnostic / prognostic portfolios containing isolated nucleic acid sequences, their complements or parts thereof of a combination of genes as described in the present disclosure, wherein the combination is sufficient to measure or characterize the expression of genes in a biological sample that has metastatic cells compared to Cells of different carcinomas or normal tissue.

Any method described in the present invention may also include measuring the expression of at least one gene constitutively expressed in the sample.

The invention also provides a method for providing the direction of therapy by determining the state of a CCR according to the methods described in the present disclosure, and .identification of the right treatment for him.

The invention also provides a method for providing a prognosis by determining the state of a CCR in accordance with the methods described in the present description, and the prognosis suitable for it. invention also provides compositions comprising at least one isolated sequence selected from sec. with no. Ident .: 1-34 The invention also provides kits, articles, microarrays or gene chips, diagnostic / prognostic portfolios for carrying out the assays described in the present disclosure, and patient reports to notify the results obtained by the present methods.

I Only rarely, the mere presence or absence of 'Particular nucleic acid sequences in tissue samples proved to have diagnostic or prognostic value. On the other hand, information about the expression of different proteins, peptides, miRNA or mRNA is considered increasingly important. The mere presence of nucleic acid sequences with the potential for expression of proteins, peptides or mRNA (these sequences are referred to as "genes") within the genome does not determine whether a protein, a peptide or mRNA is expressed in a given cell. The expression or lack of expression of a particular gene that is capable of expressing those products and the degree to which said expression occurs, in case of Occur, is determined by a wide variety of factors ! Complex. Regardless of the difficulties in understanding and evaluating these factors, the analysis of gene expression can provide useful information about the frequency of important events such as tumorigenesis, metastasis, apoptosis and other phenomena! clinically relevant It is possible to find relative indications of the jgrado in which the genes are active or inactive in gene expression profiles. The gene expression profiles of the present invention are used to provide a diagnosis and to treat patients with CRC.

The preparation of the samples requires the collection of the Samples of patients. The patient samples used in the method novel are those suspected of containing diseased cells, such as cells removed from a nodule in a fine needle aspiration (FNA, for its Knitting in English). Tissue preparations can also be used in jvolumen obtained from a biopsy or a surgical specimen and the (microd section by laser capture (LCM, for its acronym in English).

LCM is a method to select the cells that you want to analyze, which I It allows to minimize the variability caused by the heterogeneity of the type of j cell. As a result, small changes can easily be detected or | moderate in the expression of the marker gene between normal or benign and cancerous J cells. The samples can also comprise cells Epithelial cells extracted from peripheral blood. These can be obtained from i Compliance with numerous methods, but the most preferred method is the Magnetic separation technique described in the United States patent I No. 6.136, 182. Once the sample containing the cells was obtained, Interest, you get a gene expression profile using a biomarker, for | the genes of the appropriate portfolios. i The preferred methods for creating gene expression profiles include the determination of the amount of RNA produced by the mRNA or miRNA of a gene. This is achieved by PCR with reverse transcription (RT- PCR), competitive RT-PCR, real-time RT-PCR, visualization RT-PCR differential, Northern membrane analysis and other related tests.

I 17 While it is possible to apply these techniques by using individual reactions of 3CR, it is better to extend complementary DNA (cDNA) or complementary RNA (cRNA) produced from mRNA or miRNA and analyze it using a microarray or other suitable method. Those with experience i in the matter they know several configurations of matrices and different methods for their production, as described, for example, in publications nos. 5445934; 5532128; 5556752; 5242974; 5384261; 5405783; 5412087; 5424186; 5429807; 5436327; 5472672; 5527681; 5529756; 5545531; 5554501; 5561071; 5571639; 5593839; 5599695; 5624711; 5658734; and 5700637. j Microarray technology allows the measurement of the level of MRNA in steady state of thousands of genes simultaneously, which provides a powerful tool for the identification of such effects i as the appearance, arrest or modulation of cell proliferation does not controlled Currently several microarray technologies, mirVana ™ Bioarray, cDNA arrays and oligonucleotide arrays are used. Although there are differences in the construction of these chips, virtually all downstream data analysis and results are the same. The product of these analyzes are, typically, measurements of the intensity of the received signal of a labeled probe that is used to detect a cDNA sequence of I the sample that hybridizes with a nucleic acid sequence at a known location in the microarray. Typically, the intensity of the signal is proportional to the amount of cDNA and, consequently, of mRNA or miRNA that is expressed in the sample cells. A lot of such techniques i they are available and they are useful. Preferred methods for determining gene expression can be found in publications nos. 6.27, 002; J.B., 218.122; 6,218,114; and 6,004,755.

The analysis of the expression levels is performed when comparing said signal intensities. Greater efficiency is achieved by generating matrix moon ratio of the expression intensities of the genes in a test sample compared to those in a control sample. By example, the intensities of the gene expression of a diseased tissue can be Compare with the expression intensities generated from the benign or normal tissue of the same type. A relationship of these expression intensities indicates the multiple change in gene expression between the test and control samples.

The selection can be based on statistical tests that produce classified lists related to tests of importance j for the differential expression of each gene, among factors related to the tumorigenesis Examples of these tests include ANOVA and Kruskal-IWallis. Classifications can be used as weights in a model designed to interpret the sum of these weights, up to a value limit, such as the preponderance of evidence in favor of a class on the other. As described in the literature, the previous evidence is also You can use it to adjust the weights.

! The gene expression profiles can be visualized from I various ways. The most common is to order the raw fluorescence intensities or the ratio matrix in a graphical dendogram, in I where the columns indicate the test samples and the rows indicate the I genes. The data is sorted in such a way that the genes that have profiles of similar expression are proximal to each other. The expression index for each gene is displayed as a color. For example, an index smaller than one (down regulation) appears in the blue portion of the spectrum, while an index greater than one (up regulation) appears in the red portion of the spectrum. Computer programs are available commercially to display that information, which include "GeneSpring" (Silicon Genetics, Inc.), "Discovery" and "Infer ™" (Partek, Inc.) Measurements of the abundance of unique RNA species are obtained from primary tumors or metastatic tumors from samples biological These readings along with clinical records that include, but are not limited to, a patient's age, gender, place of origin of the tumor primary and the place of metastasis (if applicable) are used to generate a relational database. The database is used to select transcripts miRNA and clinical factors that can be used as marker variables to determine the presence, prognosis or status of the CCR.

I i In the case of the measurement of protein levels for I determine gene expression, any method known in the art it is adequate, provided that its results have adequate specificity and sensitivity. For example, protein levels can be measured by binding an antibody or antibody fragment specific for the protein and measuring the amount of protein bound to the antibody.

Antibodies can be labeled by radioactive reagents, fluorescents or other detectable reagents to facilitate detection. Detection methods include, but are not limited to, enzyme-linked immunosorbent assay (ELISA) and immunoblotting techniques.

The modulated genes that are used in the methods of the invention i they are described in the examples. The genes that are differentially expressed are they regulate by increase or decrease in patients with CRC compared with ^ those without CRC or in different state or progression of CRC. The regulation by Jaumento and by decrease are relative terms that mean that there is a detectable difference (beyond the contribution of noise in the system used for its measurement) in the amount of expression of genes in relation to certain initial values. The genes of interest in the diseased cells are regulated, subsequently, by increase or decrease in relation to the level of I initial values by the same measurement method. Sick, in this context, refers to an alteration in the state of a body that interrupts or It alters, or has the potential to alter, the proper performance of bodily functions, such as the case of uncontrolled cell proliferation. To a A person is diagnosed with a disease when some aspect of that person's genotype or phenotype matches the presence of the disease.

The realization of a diagnosis or prognosis could include the determination of the problems related to the disease or the state, i such as determining the likelihood of a relapse, the type of treatment I i and its follow-up In the follow-up of the treatment, the clinical judgments perform with respect to the effect of a given course of treatment I By comparing the expression of genes over time, in order To determine if the gene expression profiles have changed or are Changing to patterns more consistent with normal tissue.

You can group the genes so that the information obtained about the set of genes in the group provides a solid basis for making a clinically relevant judgment, such as a diagnosis, a prognosis or the choice of a treatment. These sets of genes make up the portfolios of the invention. As with most diagnostic markers, it is often advisable to use as few markers as possible as long as they are sufficient perform a correct medical judgment. This avoids a delay in the treatment due to the performance of additional analyzes, as well as the unproductive use of time and resources.

The process of selecting a portfolio can also include the i application of heuristic rules. Preferably, these rules are formulated based on biology and a compression of the technology used to produce clinical results. More preferably, they apply for one! exit of the optimization method. For example, the average variance method The selection of the portfolio can be applied to the microarray data for a number of genes differentially expressed in subjects with cancer. The result of the method would be an optimized set of genes that could include some genes expressed in peripheral blood, as well as in diseased tissue. If the samples used in the test method are obtained from peripheral blood and certain genes differentially I ^ Expressed in instances of cancer could also be differentially expressed in the peripheral blood, a heuristic rule can be applied, in Where a portfolio is selected from the effective border without including Genes differentially expressed in peripheral blood. In addition, the rule It can be applied before the formation of the effective frontier by, for 'example, the application of this rule during the preselection of data. i A method to establish gene expression portfolios is I through the use of optimization algorithms, such as the algorithm of average variance, widely used to establish the portfolios of actions. This method is described in detail in the publication nurn. 20030194734. Practically, the method is related to the establishment of a set of entries (actions in financial applications, and expression calculated according to the intensity in the present) that will optimize the return (for example, the j generated signal) that is received as a result of its use, at the same time | that minimizes the variability of this. In the market there are numerous Computer programs available to perform these operations. The "Wagner Associates Mean-Variance Optimization Application," is preferred. called "Wagner Software" throughout this specification. The use of this program is preferred, which includes functions of the "Wagner Associates | Mean-Variance Optimization Library" to determine an effective frontier and optimal portfolios in the sense presented by Markowitz. Markowitz (1952). i The use of this type of programs requires converting the data of the microarrays so that they can be treated as inputs, from the same How return is used on actions and risk measurements when the program is applied for your financial analysis purposes.

The process of selecting a portfolio can also include the application of heuristic rules. Preferably, these rules are formulated based on biology and a compression of the technology used to I produce clinical results More preferably, they are applied for a exit of the optimization method. For example, the average variance method I of the selection of the portfolio can be applied to the microarray data for a number of genes differentially expressed in subjects with Cancer. The result of the method would be an optimized set of genes that could include some genes expressed in the peripheral blood, as well as also in diseased tissue. If the samples used in the test method are obtained from peripheral blood and certain genes differentially expressed in instances of cancer could also be differentially expressed in the peripheral blood, a heuristic rule can be applied in where a portfolio is selected from the effective border, not including differentially expressed genes in the peripheral blood. Also, the rule can be applied before the effective frontier formation, by example, the application of this rule during the preselection of data. j Other heuristic rules may be applied that are not necessarily related to the biology in question. For example, it is It is possible to apply a rule so that only a specific percentage of the portfolio can be represented by a particular gene or group of genes. The programs available in the market, such as the Wagner Software, adjust immediately to these types of heuristics. For example, this may be useful when factors other than accuracy and precision (for example, anticipated licensing fees) have an impact on the convenience of including one or several genes.

The gene expression profiles of this invention can also be used in conjunction with other non-genetic diagnostic methods useful for the diagnosis, prognosis or follow-up of cancer treatment. For example, in certcircumstances it is beneficial to combine the diagnostic power of the gene expression-based methods described above with data obtd from conventional markers, such as serum protein markers (eg, cancer antigen 27.29 ("CA 27.29")). There is a wide variety of such markers, which include analytes such as CA 27.29. In a method of these characteristics, blood is periodically drawn to a treated patient and then subjected to an enzyme immunoassay for one of the serum markers described above. When the Concentration of the marker suggests the return of the tumor or the failure of the treatment, a sample source is taken subject to the analysis of gene expression. When a suspicious mass exists, a fine needle aspiration (FNA) is performed and the gene expression profiles of the cells extracted from the mass are analyzed, as described above. i i Alternatively, tissue samples can be taken from the areas adjacent to the Tissue from which the tumor was previously excised. This approach can be especially useful when other tests produce ambiguous results.

Kits made in accordance with the invention include adapted tests to determine gene expression profiles. These may include all or some of the materials needed to perform the Assays, such as reagents and instructions and a medium in which the assay of biomarkers is performed.

The articles of this invention include representations of gene expression profiles useful for treatment, diagnosis, prognosis and any other form of disease evaluation. These profiling representations are reduced to a medium that can be read automatically by a machine, such as in computer media. (magnetic, optical and similar). The articles may also include instructions for evaluating gene expression profiles in said medium.

For example, articles may include a CD-ROM with instructions for I computer for the comparison of the gene expression profiles of the i portfolios of genes described above. The articles can also I have gene expression profiles registered digitally in them, so that they can be compared with the gene expression data of the patient samples. As an alternative, the profiles can be registered in Different representation formats. A graphic record is one of these I formats. The grouping algorithms, such as those incorporated In the "DISCOVERY" and "INFER" programs of Partek, Inc. mentioned [above, they can provide a better visualization of said data.

The kits manufactured in accordance with the invention include jays adapted to determine the gene expression profiles. These May include all or some of the materials needed to complete the I tests, such as reagents and instructions and a medium in which performs the assay of biomarkers.

I The articles of this invention include representations of Gene expression profiles useful for the treatment, diagnosis, prognosis and any other form of disease evaluation. These profiling representations are reduced to a medium that can be read automatically by means of a machine, as for example in computer means (magnetic, optical and similar). Articles can also | Include instructions to evaluate the gene expression profiles in said medium. For example, articles may include a CD-ROM with computer instructions for comparing the gene expression profiles of the gene portfolios described above. The articles can also have gene expression profiles registered digitally in them, so that they can be compared with the gene expression data of the patient samples. As an alternative, the profiles can be registered in different representation formats. A graphic record is one of these formats. The grouping algorithms, such as those incorporated in the "DISCOVERY" and "INFER" programs of Partek, Inc. mentioned above, they can provide a better visualization of said data.

The different types of articles of conformity manufacture with the Invention are means or tests adapted in their form that are used to reveal the gene expression profiles. They can understand, for example, microarrays where the complements or sequence probes are Linked to a matrix in which the Indicative sequences of the genes of interest, which creates a readable determinant of their presence. OR well, the articles according to the invention can be modeled as Reagent kits for hybridization, expansion and generation of a I Signal indicative of the expression level of the genes of interest. i The following examples are intended to illustrate, but not limit, the present invention. All references cited herein are I incorporate as a reference.

EXAMPLE 1 Methods Cell lines The cell lines SW620, SW480, HCT1 16 and HT29 are i obtained from the ATCC. The M20L2 and M12C were provided by the NCI- rederick Cancer DCT Tumor Repository, while cell lines < M20 and KM12SM were provided by Dr. Isaiah J. Fidier (The University of Texas MD Anderson Cancer Center). SW620 and SW480 cells were cultured in Dulbecco's modified Eagle's medium (D-MEM) (Gibco). HCT116 cells were grown in McCoy 5A media (Gibco) and KM20 cells, KM20L2, KM12C, KM12SM and HT29 were cultured in RPMI 1640 media (Gibco). All media supplemented with 10% fetal bovine serum (JRH Biosciences), 2 mm L-glutamine (Gibco) and penicillin-i solution [streptomycin (0.1 U / ml penicillin and 0.1 pg / ml streptomycin) (Gibco), except for HT29 cells that were cultured in 0.72 mm L-glutamine.

Clinical samples In total, 49 instantaneously frozen CCR samples were obtained from Genomics Collaborative Inc. (GCI, Cambridge MA) or Clinomics Bioscience, Inc. (Pittsfield, MA), which include 4 normal colon, 4 stage I, 19 stage II, 20 stage III and 2 stage IV (table 1). In addition, 8 matching samples fixed with formalin and Infiltrated in paraffin (FFPE) (3 of stage II, 4 of stage III and 1 of stage IV).

The mean tumor content of all the CCR samples was 70% and not There was a significant difference in the tumor content between the early stage disease (I and II) and late stage disease (III and IV).

Table 1. Characteristics of clinical samples jídéht de Íímúestrá.¾. Stage:. . ',' MAC ¾ ·· uke Sex 'Race' Source 1YRNPAB I A A 73 F African GCI CI09 1 A A NA NA NA Clinomics CI IO I A NA NA NA Clinomics Cl 13 1 A A NA NA NA Clinomics EIBU9AM5 1 Bl A 61 F Caucasian GCI IHDNLAK.U I Bl A 75 F Caucasian GCI 5CYDKA5B II B B 44 M Caucasian GCI 9S9RNAI4 HA B2 B 81 F Caucasian GCI ACGL2AN4 HA B2 B 65 M Asian GCI ARA7PAQE 11 B B 63 F Caucasian GCI B7AYIA8V HA B2 B 36 M Caucasian GCI Cl 15 II B NA NA NA Clinomics Cl 18 II B NA NA NA Clinomics FNJUHAU3 IIA B2 B 74 M Caucasian GCI KDSZBAN1 HA B2 B 86 F Caucasian GCI KF YAJU HA B2 B 45 M Asian GCI K.SH3JALQ HA B2 B 73 F Caucasian GCI LAQA6A8Q II B B 75 Caucasian GCI N8KVIA3S II B B 71 M Caucasian GCI QLKH5A50 HA B2 B 78 M Caucasian GCI S6TRKAX6 IIA B2 B 37 M Asian GCI TUUKWA2Q HA B2 B 67 F Asian GCI ZYKTYATN HA B2 B 74 F Caucasian GCI 7NUSVAH3 ?? c c 80 F Caucasian GCI 8Q9TRAEE III c c 69 Caucasian GCI 9VMYRAAB IHB C2 c 28 F | Asian GCI AJOJHAGP III c c 50 F Asian GCI B8TM AN5 ??? C2 c 72 F Asian GCI BDGFCA A IIIA Cl c 60 Asian GCI BLUW6AJB IHB C2 c 64 F Caucasian GCI DFVJAACX IHB C2 c 54 M Caucasian GCI EL C6A62 III c c 52 F Caucasian GCI FQFE7A5W II IB C2 c 69 F Asian GCI HIKQCAAS IIIA Cl c 72 M Caucasian GCI HQIU5AYO ??? 3 C2 c 64 M Caucasian GCI MIL04AF8 III c c 48 F Asian GCI NLKEIAE3 uro C2 c 48 F Asian GCI NN29GABN IIIB C2 c 61 M Africana GCI 03PJ AU4 [(I c c 78 F Caucasian GCI POELPAF3 III c c 48 F Asian GCI VYAE AJF III C C 64 F Asian GCI ZEROIAZP III C C 42 F Asian GCI ZIPBBA2E [IIB C2 C 60 Caucasian GCI IJNQZAQZ IV D D 62 F Caucasian GCI ZWM3AK.E IV D D 32 F Caucasian GCI i MAC = modified Astier-Coller classification, NA = miRNA profile not available i i j MirVana ™ Bioarray (Ambion, version 1) containing (287 probes of human miRNA to identify CCR miRNA patterns was used.) Shingara et al. (2005). MiRNA was isolated from 5 pg of total RNA from colorectal samples using the mirVana ™ isolation kit (Ambion) for instantaneously frozen samples and the RcoverAII ™ total nucleic acid isolation kit for FFPE (Ambion) samples.

! All samples were fractionated by polyacrylamide gel electrophoresis (flashPAGE ™, Ambion) and small RNAs were recovered (< 40 nt) by ethanol precipitation with linear acriiamide. RT-PCR Quantitative (QPCR) of miR-16 was used to confirm enrichment of miRNA before analysis of the miRNA matrix.

The small RNAs of all the samples were subjected to poly (A) polymerase reaction, where modified amine uridines (Ambion) were incorporated. Then, the samples were fluorescently labeled using the Cy3 or Cy5 reactive amine (Invitrogen). Hybridizations were made with juno or two colors for the profiling experiments of clinical or line CCR jde cells, respectively. For the 2-color experiments, the miRNA of the i Cell line was compared directly with normal colon RNA (Ambion). The RNA labeled fluorescently were purified by using filter ! fiberglass and eluted (Ambion). Afterwards, each sample was hybridized with the Bioarray sheets for 14 hours at 42 ° C (Ambion). Afterwards, the matrices and were explored through the use of a microarray scanner confocal laser (Agilent), and information was obtained through the use of the computer for expression analysis (Codelink, version 4.2).

! The analysis of the Northern membrane of specific miRNAs was performed as described in Example 2.

Statistic analysis The information was analyzed by using the package of computer programs R. The information was normalized by quantile before I / ' determine the differential gene expression. Duplicate samples and values of the probe were averaged and the Student's t test was performed to find the genes that vary significantly between the sample groups. HE selected the genes if the median of the normalized signal strength was greater than 100 (75th percentiles of median signal) for at least one group, with a change of the mean > 1.5 times and a value p < 0.05. A I Unidirectional ANOVA to evaluate the expression level of miRNA. It was made i QPCR by using ABI TaqMan® miRNA reagents to verify the expression profiles of miRNA. Chen and others (2005). Ten (10) ng of total RNA was converted to cDNA by using the high DNA file kit capacity and 3 μ? of RT 5x primer, in accordance with the manufacturer's instructions (Ambion). The reactions of 15 μ? they were incubated in a thermal cycler for 30 minutes at 16 ° C, 30 minutes at 42 ° C, 5 minutes at 85 ° C and maintained at 4 ° C. None of the reverse transcriptase (RT) reactions included template controls. QPCR was performed through the use of a protocol of a TaqMan® PCR kit on a sequence detection system 7900HT from Applied Biosystems The PCR reaction of 10 pl included 0.66 pl of RT product, 1 μ? of TaqMan® microRNA assay primer and probe mixture, 5 μ? TaqMan® 2x universal PCR master mix (without UNG amperase) and 3.34 μ? of water. The reactions were incubated in a plate of 384 | wells at 95 ° C for 10 minutes, followed by 40 cycles of 95 ° C for 15 seconds and 60 ° C for 2 minutes. All QPCR reactions included I | a control without cDNA and all reactions were carried out in triplicate.

! Constructs of plasmids I Plasmid pSilencer ™ 2.1 (Ambion) was modified within the multiple cloning site to introduce single restriction sites and a transcriptional RNA polymerase III terminator (l i l i l í). The following oligonucleotides (Sigma) were synthesized, annealed and ligated to pSilencer ™ 2. 1, were predicted with BamHI and Hindlll, to produce pSilencer ™ 2.1Term: pSilU6upper 5'GATCCCTCGAGTCTAGA I I I GGAAA (sec. With ident. No .: 1) and pSilU6lower S'AGCTTTTCCAAAAAATCTAGACTCGAGG (sec. ium Ident .: 2). The pre-miR-143 or pre-miR-45 encoding DNA was PCR-amplified from human genomic DNA by using the I Primers 143F (5'CGGGATCCCGGAGAGGTGGAGCCCAGGTC (sec. 'no. Ident: 3)) and 143R (5'GCTCTAGACAGCATCACAAGTGGCTGA (sec. | with ident #: 4)), digested with BamHI and XbaI and ligated to pSilencer ™ II.1Term to produce plasmid ae miR expression -143. For miR-145, genomic DNA was recovered as a PCR amplicon by using primers 145F (5'CGGGATCCCAGAGCAATAAGCCACATCC (sec. With ident. No .: 5)) and 145R (5'GCTCTAGACTCTTACCTCCAGGGACAGC (sec. Ident. no .: 6), was digested with BamHI and Xbal, and ligated into pSilencer ™ 4.1 under the control of the CMV promoter. To construct the retroviral expression vectors encoding miR-20a or the miR-17-92 group, regions of genomic DNA were amplified by PCR, digested with BamHI and EcoRI and cloned into pQCXIN (BD Biosciences). The PCR primers | that were used for miR-20a were miR-20F I j (5'CGGGATCCCGATGGTGGCCTGCTATTTCC (sec. with ident .. 7)) and miR-20aR (5'CGGAATTCTCACACAGCTGGATGCAAA (sec. with ID no .: 8)), while those used for the group miR-17-92 were ! miRcF (5'CGGGATCCCGTCCCCATTAGGGATTATGC (sec. with ID number: 9)) and miRcR (5'CGGAATTCCCAAATCTGACACGCAACC (sec. with! ID no .: 10)). Generation of stable cell lines to generate stable clones by using plasmids pSilencer ™ 2.1 (miR-143) and IpSilencer ™ 4.1 (miR145), were plated 1-5x106 cells (HCT116, SW480, | SW620) in a single well of a 6-well plate. Upon reaching 80-90% confluence, the cells were transfected with 4 plasmid DNA by the use of Lipofectamine ™ 2000 (Invitrogen), in accordance with the manufacturer's instructions. The cells were diluted and placed in fresh jen plates with 500 pg / ml of hygromycin. After 14 days of selection, the independent clones were harvested, expanded and screened for the expression of the specific miRNA / s encoded by the transfected plasmid (Example 2).

To produce stable clones of HCT116 cells by the use of retroviral transduction, cell lines of Retroviral packaging Amphopack ™ HEK 293 (BD Biosciences) and PG13 i \ a ratio of 10: 1 before transfection with 10 g of vectors based on ! in pQCXIN, through the use of calcium phosphate. 24 hours after transduction, media containing viruses were harvested and used to transduce HCT116 cells. After dilution and recovery of cells, 400 g / ml of G418 was added to the culture medium and selected Í clones for two weeks. The characterization of the independent clones was as described above for transfection of plasmids.

! Antisense experiments MiR-145 antisense 2'-0-methyl biotinylated RNA or controls were delivered to SW620 by the use of Lipofectamine ™ 2000 (Invitrogen) as detailed in Example 2. The efficiency of the transfection was at least 80% in i | all the experiments. All the experiments were performed in triplicate. HE i hours. Fluorescence was measured by using the microplate reader FLUOstar OPTIMA (BMG Labtech). To perform serum free analysis, the day I j1 the medium was changed to a serum-free medium. The modified Dulbecco medium Jde Iscove 2X (IMDM) (Gibco) Rapid Agar Test Soft was supplemented with 0.6% sodium bicarbonate, 20% fetal serum ! bovine (JRH Biosciences), 4 mm L-glutamine (Gibco), Solution i Non-essential amino acids 2X, 2% sodium pyruvate (Gibco) and solution penicillin-streptomycin (0.1 U / ml penicillin and 0.1 g / ml streptomycin) (Gibco) The 2X IMDM was mixed at a ratio of 1: 1 with 1.2% bacto agar (55 ° C) and 50 μ? per well to a 96-well plate to produce a pre-layer for the essay. 10 μ? of cell suspension that Contains SW620 cells (3x103) or HCT116 cells (2x103), 20 μ? of IMDM 2X and 30 μ? of 0.8% bacto agar (55 ° C) and transferred to the solidified precoat in jcada pocilio. The semisolid feeder layer was prepared by mixing 25 μ? from IMDM 2X and 25 μ? of agar bacto to 1.2% (55 ° C) and was placed in layers in the top of the solidified precoat. The cells were allowed to grow in a CO2 incubator at 37 ° C for 7 days. The proliferation and viability of cells using the CelITiter-Blue ™ reagent (Promega). Treatment of images of living cells j Nikon's Diaphot biological microscope and digital camera i Nikon's E995 were used to capture images of cell morphology. RESULTS of miRNA profiling in clinical CRC samples Initially, 49 human colorectal samples were profiled (4 of normal colon, 4 of CCR of Stage I, 19 of Stage II and 2 of Stage IV) to study the expression of differential miRNA between normal tissues and humoral, and also between early and late stage disease (Table 1). A total of 37 miRNAs differentially expressed between CCR and normal colon tissue were identified (Table 2).

I Table 2. miRNAs differentially expressed between CCR and colon tissue Change miRNA Normal '..CRC, Value p: Location1 Fragile site of CCRd * multiple hsa-mR-20a 9.2 10.3 2.0E-03 2.1 13q31.3 Increase hsa-mR-i 8 a. 7.6. ei. "2.9? -03 i, 2.0 13q31.3 Increase hsa-m¡R-19a 7.7 8.7 2.3E-03 1.9 13q31.3 Increase hsa-rp¡R-Í7r- > p? 0.5; 11. 1.5E-03 T 1.9 13q31.3 Increase hsa-mR-19b 11.0 11.8 3.4E-03 1.8 13q31.3 Increase 2; 6, '~ \ 14q32.33"'. 'Loss hsa-mR-21 13.0 14.5 6.0E-06 2.9 17q23.2 Increase hsaTmiR-34a .. 10.3 ¾E-02 1p36.22 Sa-miR loss -181 b 8.5 9.2 2.2E-04 1.7 1q31.1 or 9q33.3 Increase (1 q) hsa-m¡R-29b: .. '¡. ??. 5 · '9E ÷ 03"1.8 1q32.2 or 7q32.3 Increase hsa-m¡R-130b 7.1 7.8 1.2E-03 1.7 22q11.21 Loss 6 8; ¾? 1JE, 02 :,, 1.6 4p16.1 Loss hsa-m¡R-106b 9 ^ 5 10.3 1 OE-04 1.7 7q22.1 Increase ' '"" |:. 7q22.1 Increase j a. Median intensity of the normalized signal (log2) j b. Cancer: normal c. The chromosomal location of some miRNAs is doubtful since mirVana ™ Bioarray does not discriminate between pre-miRNA precursors. Losses or frequent chromosomal increases in CRC as summarized by Staub et al. (2006).

I. The majority of these miRNAs are associated with chromosomal regions that are known to have frequent increases or losses in CRC. iStaub and others (2006). The hierarchical grouping showed that many of these MiRNA were expressed in a coordinated manner, including groups miR-1 3-145 and miR-17-92, which were regulated by decreasing or increasing j (respectively) consistently in CCR (Fig. 1). Interestingly, the miR-1-133a group demonstrated close transcriptional coordination with the group ! IMR-1 3-145, even though these two groups reside in different chromosomes. for diagnostic tests. The expression of miRNA is associated with the CCR stage. We identified 22 miRNAs that were differentially expressed between normal and early-stage CRC (Stage I and II) (Table 3) and 6 miRNA that showed significant differential expression between early and late stage disease (Stage III and IV) (Table 4). The expression jde miR-31 increased in the late stages while the miR133a was reduced I Significantly (Fig.4A and 4B). Therefore, these miRNAs are associated with progression of the CRC and could act as potential biomarkers for ! Classification of the CCR by stages. i I i Table 3. miRNAs differentially expressed in normal colon and CCR of early stage (Stages I and II) miRNA Normal Stage l / ll Fold change Value p hsa-mR-224 6.89 8.67 ^ 3.45 1.80E-02 hsa-miR-21 1302 r 14 * 49 * '"" 278 152E-04 hsa-miR-34a 9.48 ^ t 10.43 ¿.92 1.92E-02 hsa-miR-106a 1068 J_11 ~ 57 r "185 2-88E-02 hsa-miR-18a 7.5Í 8.3 ¿T ..Jl 3_ .... 332E: 02 hsa-mR-19 b 10.84 11.69 l or 2.77E-02 hsa-miR-1,06¿ 345, 02¿ 6 137E-02 hsa-miR-20a 9.28 10.06 _ 1.72 * 3J5E-02 hsá-rriiR-29Í, .J¾ l ¾89l "? 68 * '984E-04 hsaJmiR_J81b? 911 163 - _9-47E- ° 2 i hg-mÍR-ík, > 78 ^? 45 ^ "160T." 2 ~ 58E-02 Hsa-miR-95 6.12 6.79 1.59 3.33E-02 hsa-miR-516-3p4.87. 5 * 5 ?; 157 320E-02 hsa-miR-378 * 7.53 6.85 0.62 1.87E-03 hsa miR-422b_10"88 10,021. 055 k 491ET03 hsa-miR-422a 10.05 9.19 0.55 _ .57E-03 ¾§Sr¾Í ^ Í ^ I¾ ^ ¾ ^^^ ¾¾ ^^ '' f¾¾g¾Í Table 4. miRNA differentially expressed in early stage disease (I and II) against late stage disease (III and IV). a Stage 1 / I Stage lll / l V Change c le pliegii le Value p hsa-miR-31 9.97 7.22 1 53E-03 hsa-miR-7 7.77 8.85 2.l 1.96E-02 hsa-miR-99b 8.74 8.12 0.65 3.64E-03 hsa-miR-378 * | 6:85 3:02 Er02 hsa-miR-133a 7.64 6.96 0.63 í .64E-02 r: ;r¾ÍR¾Í¾Í | i¾? 10.64 '9.76 2; 69É-0 Multiple change = Stage III / IV: Stage I / II Obtaining miRNA profiles in CCR cell lines I In order to identify a CCR cell line for the analysis, differential functionally expressed miRNAs and in order to examine the Relationship between the expression of miRNA in clinical samples and lines of Cells, we compared miRNA expression between normal jcolonic epithelial cells and four models of CCR cell lines (SW480, i | SW620, KM12C, KM12SM) by using the mirVana ™ Bioarrays. TO i I 'Table 5. miRNAs differentially expressed in four cell lines i Ide CCR against normal colorectal tissue. hsa-m; R 55¾ 2.14 5.46 1.B9 1.46 increase s ^ m: R-18a 0.5S 2.22 2.18 1 79 increase f! S8-ra: fM92 0.O2 Q.08 0.18 0.28 decrease -miR-193 0.59 2.43 1.76 1.2S increase hsa-mlRZOOe 0.2¾ 0.97 1.58 1.83 increase dismonution miRNA in bold were validated by Northern analysis In order to validate the microarray information and expand the number of lines of CCR explored, membrane analyzes were performed I of Northern on 22 of these miRNAs in eight CCR cell lines (Fig. 5). Of those miRNAs that were identified in the clinical samples, 11 were in I common with the 43 deregulated in the cell line models, which include miR-31, members of the miR-17-92 group, miR-1, miR-143 and miR 145 (table 6). Therefore, functional studies were conducted in a subgroup Of these miRNAs to determine if the elevation of the expression of these miRNAs affected the cellular phenotype of the CCR. box 6. miRNA Commonly deregulated in clinical samples of CRC and cell lines Table 6. miRNAs commonly deregulated in clinical samples of CRC and CTC cell lines.

! * Summarized by Tsafrir et al. (2006); Paredes-Zaglul et al. (1998); and Rooney and others (2001). The increase of miR-145 in CCR cells alters cell morphology and proliferation.

In order to examine the functional role of miR-145 in CCR, it was expressed Ectopically the mature miR-145 in SW620 cells. After the Stable grouped is miR-145. The population grouped expressed high steady-state levels of mature miR-145 I (designated SW620 / miR-145) (Fig. 6A), but none of the 12 clones isolated expressed detectable levels of this miRNA. Several attempts to isolate clones independents failed to produce any that would express mature mR-146.

An important distinguishing characteristic of the cell population SW620 / miR-145 was the switch from single rounded cells of SW620 to elongated cells with extended processes typical of cells similar to fibroblasts (Fig. 6B). The SW620 / miR-145 cells also showed a 50% to 95% increase in metabolic activity / cell proliferation, when they were cultured in the presence or absence of serum, respectively (Fig. 6C). A two-fold increase in growth was also observed . independent of anchorage, when cultured in the presence of serum (Figure ' 6C). The epithelial cell marker E-cadherin was also reduced by 50% in SW620 / miR-145 cells compared to control cells (Fig. 6D), which is consistent with the morphology of cells similar to mesenchymal cells and the increased proliferation that was observed for cells SW620 / miR-145. However, unlike the increase in growth in observed, the overexpression of miR-145 in SW620 cells did not alter the growth profile of tumors in an in vivo mouse model.

In order to confirm that the changes in the SW620 / miR- cells 145 were due to the expression of miR-145, experiments were performed 2'0-methyl (2'Ome) antisense RNA specific silencing I miR-145. The miR-145 was removed in SW620 / miR-145 cells that received the i 2'0me specific antisense RNA of miR-145, but not in the sense control (Fig. 7A). As seen in the previous experiment (Fig. 6C), overexpression of miR-145 in the presence of sense RNA control resulted in an increase in the proliferation of cells in serum and, more markedly, in free medium ! serum (Fig. 7B). However, when the antisense miR-145 was coexpressed in SW620 / miR-145, there was a reversal of the high proliferative potential of the cells (Fig. 7B). These results indicated that the ectopic expression Specificity of miR-145 induced changes in cell differentiation with a associated increase in proliferative potential. The expression of miR-143 in CCR cells change the morphology and cell proliferation.

Since the miR-145 is expressed from the same locus genomic than miR-143 and that the last miRNA was also regulated by j decrease in CCR, the phenotype of CCR SW620 cells was investigated overexpressing miR-143 (Figures 8A-8D). Seven clones were isolated Stable expressing miR-143 and each showed altered morphology, the which was associated with the increased expression of the E-cadherin protein (Figures 8A-8C). No differences in the proliferation rate were observed i i cellular, however, an independent anchorage growth was demonstrated reduced in all clones (Fig. 8D). This information suggests that the ! overexpression of miR-143 has the opposite effect on growth cell independent of the anchor than that of cells expressing miR-145 ectopically. It is suggested that the coordinated expression is important for avoid inhibition of potential growth mediated by miR-143.

Clearly, the correlation between the expression of miR-143 and miR-145 in the 49 Clinical profiled CCR samples were 0.95, which is consistent with their genomic proximity (Fig. 1, Fig. 9). It was not possible to generate stable cells that i They will express the genomic locus of miR-143-145 and, therefore, will not Was able to investigate the cellular phenotype of CCR when both miRNAs were ! They overexpressed in coordination. The overexpression of the mR-17-92 group affects the miRNA of the CCR growth profiles of the miR-17-92 group and their paralogs located on chromosomes X and 7 were expressed at a higher steady-state level in CCR , compared to normal colon tissue (Fig. 1, tables 2, 5 and 6). The differential expression of miR- 7-92 and the members of the paralog group provided the basis for analyzing a possible role of these miRNAs in the transition from normal to tumorigenic colon cancer cells. Figure 10 shows an interaction map for miR-17-92. Blenkiron et al. (2007). j The genomic region containing the group was amplified by PCR ! miR-17-92 based on chromosome 13 and was cloned under the control of the CMV promoter in the retroviral vector pQCXIN and was supplied to the HCTI 16 colon cancer cells. HCTI 16 was chosen as it showed low endogenous levels of members of the miR-17-92 group compared to other cell lines screened (Fig. 5). Two clones of HCTI 16 / miR-17-92, 4-1 and 4-7 were isolated and showed a concomitant increase of 4 to | 5 times in miR-20a, miR-18a, miR-19a and miR-92 matures (Figures 11A and | 1 1 B).

The clones overexpressing mR-17-92, 4-1 and 4-7, Showed 50% to 60% reduction in metabolic activity / cell proliferation when cultured in serum-free medium (Fig. 1 1 C). Without However, when they were cultured in the presence of serum, a ! Less significant reduction in proliferation. No i found j alteration in the cellular morphology of the clones that overexpress the group MiR-17-92. Unlike other studies, the results shown 'previously suggest that the greatest increases in the expression of the group miR-17-92 can reduce the metabolic activity / cell proliferation in the i cells, when they are grown in the absence of serum. 1 MiR-20a is an active component of the miR-17-92 group In order to further characterize the component (s) of the miR-I group ! 17-92 conferring the disadvantage in growth or metabolic activity Reduced by overexpression of the group, we analyzed the effect of overexpression of miR-20a alone. We generate 4 clones of HCT116 / mR-20a which showed an increase in miR-20a and three of these showed increases in ! 10 to 12 times reproducible, compared to vector control (9-3, 9-9 and 9- I 12). No alteration of expression of three other members of j miRNA from the endogenous miR-17-92 group (Fig. 1A and 1B). None of the clones j of HCT1 16 / miR-20a showed altered cell morphology. However, as i in the HCT116 / miR-17-92 clones, all the miR-20a clones showed | a significant reduction in metabolic activity / cell proliferation in I I serum free medium (Fig. 11C). This phenotype was less marked (reaching ! I significance only in two clones) when the clones were cultured in presence j of serum-based growth factors. i I ! Two of the clones expressing mR-20a and one of the clones of the group miR-17-92 showed significant increases in growth independent of anchoring, indicating that the effect of miR-17-j 92 expression on cell growth depends on the cellular context (Fig. 1 1 D). These Results also suggest that the modulation of the 'Proliferation of HCT116 has been directed through the miR-20a. Nevertheless, ! given the sequence affinity of the seeds in other members of the group, ! We can rule out a role for these other miRNAs in the CCR phenotype. j ANALYSIS I Profiling the expression of miRNA in the lines of cells and samples of patients with CRC and a series of miRNA was found that showed differential expression between normal colon and different CCR stages. It was also shown that the re-expression of miR-143 or mR-145 in a CCR cell line, representative of metastatic disease of | late stage, it modified the differentiation status of the cells of different ways and impacted on cell proliferation in opposite ways. TO Unlike most previous reports on cancer, the expression increased of miR-17-92 in these advanced CCR cells was associated with a | increased anchor-independent growth and reduced cell proliferation j. A larger dissection of the group revealed that miR-20a is at least one active component of miR-17-92 that confers these changes.

I Among the clinical CCR samples, 37 miRNAs suffered I j alteration of expression compared to normal colon and 1 1 of these miRNA i showed the same pattern of expression in the CCR cell lines. This indicated that the cell lines retain some of the miRNA expression patterns observed in primary tumors and can act as models for the functional analysis of specific miRNAs. Our observation that miR-143 and miR-145 were regulated by 'decrease in CCR confirmed previous reports. Akao et al. (2006); Bandres et al. (2006); Cummins and others (2006); Michael and others. (2003); and Lanza et al. (2007). We also verified the decrease regulation of miR-30a-3p previously reported (Bandres et al. (2006)), miR-10b, mR-30c, miR-125a, miR-1, mR-133a and miR- 195. Lu and others (2005).

| Interestingly, muscle-specific miRNAs, miR-1 and mR-133a, were highly expressed in the normal colon mucosa, but were regulated.

Significantly by decrease in CCR. Although contamination from the muscle layer of the mucosa in normal samples can not be ruled out completely, our observations are believed to be authentic for the following reasons. First, the proportion of mucosal muscle layer in the normal colon is minimal and is unlikely to account for the high level of expression of miR-I-133a in these samples. Second, there was higher expression in early-stage disease compared to late-stage disease, and third, this group was expressed in coordination with the miRNA-specific group of CRC mR-143-145. Furthermore, to our knowledge, there has been no direct comparison between the expression of miR-1-133a in muscle and epithelium of the normal colon mucosa and, therefore, these miR i They may not be completely muscle specific. Chen and others (2006).

It was shown that mR-31, miR-21 and members of the miR-17-92 group and their paralogs were regulated by increase in CCR. The increase in miR-31 was previously reported, but was not found in many other studies of i expression of miRNA in CCR. Bandres et al. (2006); Cummins and others (2006); ? Lu and others (2005); and Volinia and others (2006). A total of 22 miRNA was deregulated between early stage clinical samples (Stages I and II) and the normal colon, while 6 miRNAs showed different levels of expression between early stage and late stage samples. These miRNAs can be novel Diomarkers to classify the CCR by stages. To this end, reproducible detection of miRNA in CCR samples was also demonstrated I FFPE, which indicates that miRNAs are stable in this little preserved material. The ability to detect miRNA reproducibly in CCR FFPE samples confirms the recent results of Xi et al. (2007).

In our study, the re-expression of miR-143 reduced the formation of colonies and increased E-cadherin (a marker of epithelial cell differentiation), suggesting that miR-143 showed tumor suppressor effects in CCR cells under these conditions. Consistent with our observations, Akao et al. (2006) reported a dose-dependent reduction in cell viability after delivering synthetic miR-143 'to CCR SW480 or DLDI cell lines. Similarly, Borralho | et al. (2007) reported that overexpression of miR-143 in HCTI 16, LoVo, SW480 and SW620 cells resulted in reduced cell viability and apoptosis I I Increased, suggesting that miR-143 plays a proapoptotic role in the normal mucosa. This last study included the expression of the precursor most of the miR-143 gene and is more comparable with the reexpression strategy used in this work. In contrast, miR-145 increased cell proliferation and The independent growth of the anchor, and reduced the levels of E-cadherin.

These effects were increased when the cells were cultured in a serum-free medium, suggesting that cell growth factors could halt the activity of these miRNAs. These results suggest that the expression 'of the miR-145 in a late-stage CCR cell line promotes | Cell proliferation and / or acts to block the normal signs of apoptosis. Interestingly, our observations about the reexpression of miR-145 differ from the only study that analyzes a functional role for this miRNA, which reported loss of cell viability in DLDI or SW480 cells after the introduction of synthetic pre-mR-145 . Akao and others (2006). In addition to the i method of introduction of miR-145, our study also differs in that they used late-stage CRC cells and were unable to achieve high levels of stable expression of miR-145.

Our inability to generate simple clones expressing high levels of mature miR-145 suggested that cell growth can not be maintained when miR-145 is expressed beyond a specific threshold, j However, a pooled population of cells expressing miR -145 consistently showed increased proliferation in iCCR cell lines. Information from our laboratory and others indicates that mR-143 reduces the growth of CCR cells when overexpressed. independently of miR-145. Since both miRNA occupy the same genomic ocus (5q23), we hypothesize that miR-143 and miR-145 act in a oppositely coordinated way as potential tumor suppressors and oncogenes, respectively. When they are expressed independently, then each of these miRNAs exhibits its respective role as an oncogene and tumor suppressor. It could happen that miR-143 can be expressed at levels high in simple clones, but achieve physiological expression levels of mR- ! l 45 requires coexpression with miR-143. Importantly, our I results also highlight that the supply of miR-143, alone, can be a potential therapeutic strategy for CRC. i j A particularly interesting observation in this study It was that the additional overexpression of the policistron miR-17-92 or miR-20a alone resulted in a reduction in cell proliferation in the absence of factors of serum growth. These results suggest that miR-17-92 and miR-20a I can act as a tumor suppressor when they are overexpressed in HCT1 16 rapid division cells. On the contrary, there was an increase in the independent anchorage growth in some clones of miR-17-92 and íri¡R-20a. These discordant observations are consistent with the roles Informed for miR- 17-92 in cancer. j Several studies have implicated miR-17-92 as an oncogene. This I group is associated with a genomic region (13q) amplified frequently in different classes of lymphoma and CRC. Ota and others (2004); and Tsafrir et al. (2006). The miRNAs encoded by this group are also highly expressed in I I lymphoma and cancers of the colon, lung, pancreas and prostate. Volinia and others (2006); i Hayashita and others (2005); and He and others (2005). Wang and others (2006) identified the miR-17-92 as a potential oncogene by the use of retroviral mutagenesis in mice, which resulted in the formation of lymphoma. In addition, it was shown that the overexpression of the miR-17-92 group accelerates B-cell lymphoma in a model Of mouse and increases the proliferation of cells in vitro in a cell line of lung cancer. Hayashita and others (2005); and He and others (2005). Also í there is evidence that the miR-17-92 group can act as a tumor suppressor since the loss of heterozygosity in 13q31-32 in i Different types of cancer can lead to a poor prognosis. Eiriksdottir and others (1998); Lin and others (1999); and Tsang and others (1999). In addition, Hossain and others (2006) showed that the reintroduction of miR-17-5p in cell lines of breast cancer decreases cell proliferation and independent growth Of the anchor, which confirms that the members of this group can show tumor suppressor-like qualities. It is likely that the different effects biologicals for any specific miRNA are dependent on the context and ! controlled by the repertoire of target genes expressed in different types of | cells Our results show that the tumor suppressor effect in absence of serum, and associated growth factors, could reflect | complicated regulatory mechanisms of negative and positive feedback I on miR-17-92, and particularly miR-20a, on CCR.

| In summary, we have explored a large set of samples of ! I I Clinical pCR and normal colorectal tissue coincident for miRNA expression. They discovered thirty-seven miRNAs expressed differentially between I normal and early or late stage CRC and the deregulation of 11 of these miRNA was confirmed in a panel of CCR cell line models. By Therefore, these miRNA candidates are potential therapeutic targets in this disease. Specifically, the addition of miR-143, but not of miR-145, ! It can be considered as a therapeutic application in CRC. i A total of 100 nm of miR-145 2'-0-methyl antisense RNA biotinylated (5AAGGGAUUCCUGGGAAAACUGGAC3 '(sec. with ID no .: 1)) (IDT) or the inverse control (5'CAGGUCAAAAGGGUCCUUAGGGAAS '(sec.

I con no. Ident .: 12)) (IDT) were transfected with Lipofectamine ™ 2000 (Invitrogen) in 2x106 of SW620 / miR-145 cells. 48 hours after the After transfection, the cells were harvested and the total RNA was extracted by the use I of TRIzol® (Invitrogen) in accordance with the manufacturer's instructions. HE | they subjected 100 pg of total RNA to three sequential reductions by using 250 pg of Streptavidin-coated magnetic beads Dynabeads M-1 280 (Invitrogen). Each reduction involved washing the balls twice with j 0.1 M NaOH, 0.05 M NaCl solution, and then once with 0.1 M j NaCI. The balls were resuspended in 0.1 M NaCl and added ! 250 pg of pellets to the RNA sample. The sample was stirred for 20 minutes at 4 ° C. The beads were separated from the RNA solution by the use of a magnetic separation apparatus (Promega) and the solution (containing the reduced RNA) was removed from the beads. The reduced RNA was precipitated with ethanol and analyzed for expression of miR-145 and RNAp U6 by Northern analysis. The transfection efficiency of miR-145 2? -methyl antisense RNA oligonucleotide labeled FAM was conducted in parallel with the reduction experiments. A total of 100 nM of 2'0-methyl antisense RNA of miR-145 labeled FAM (IDT) was transfected with Lipofectamine ™ 2000 (Invitrogen) into 1.2x105 of SW620 cells expressing miR-145. 48 hours after transfection, the cells were harvested and subjected to FACS analysis.

Northern for miRNA The TRIzol® extraction of the total RNA was carried out in accordance with the manufacturer's specifications (Invitrogen). Briefly, more cells were washed with PBS and 5 ml of TRIzol® reagent was added, and the cells were incubated for 5 minutes at room temperature. After adding 1 ml of chloroform, the cells were vigorously shaken for 15 | seconds by hand. The samples were centrifuged and the aqueous layer was transferred to a 15 ml falcon tube with 2.5 ml of isopropanol. The samples were incubated! at room temperature for 20 minutes, they were centrifuged as above to pellet the RNA and resuspended with 1 ml of 75% EtOH. The RNA was pelleted by centrifugation, dried with air and resuspended in 50 μ? of water DEPC (Ambion).

Northern analysis was conducted using 15% gels I I F AGE-Urea, prepared by using the sequencing system SequaGel® (National Diagnostics), and electrophoresis was carried out by Use of the MimProtean® II gel electrophoresis device (BioRad). An i was added tjotal of 40 pg of RNA to 10 pl of RNA loading dye (2X solution of 95% of fprmamide, 18 mM EDTA and 0 025% sodium dodecyl sulfate, xylene cyanol and bromophenol blue) and incubated at 65 ° C for 10 minutes. The samples are they loaded on the PAGE-Urea / TBE gel at 15% and they were electrophoresed in 1X TBE at 100 V until the blue bromophenol dye reached the bottom of the gel. He RNA was transferred to the Hybond-N + membrane (GE Healthcare) by using to electrophoretic transfer cell Mini Trans-Blot (BioRad) in shock absorber TBE 0 5X with 80 V for 1 hour. The RNA is cross-linked to the membrane by the use of UV Stratahnker® 1800 (1200 joule) (Stratagene) I The membranes were previously hybridized in 10 ml of solution I Express hybridization (Clontech) at 37 ° C. The oligonucleotide probe Starfire® was boiled for 1 minute and then added to the solution hybridization. After hybridization overnight at 37 ° C, the membrane was rinsed three times with 2X SSC / 0 1% sodium dodecyl sulfate and i i It was further washed with 2X SSC / 0 1% sodium dodecyl sulfate solution at 37 ° C, during 15 minutes. The membrane was exposed to a screen of Phosphorus storage (GE Healthcare) overnight and they were created images by using the Typhoon Trio machine (GE Healthcare). The membrane was removed from the attached probe by pouring 0 1% sodium dodecyl sulfate, boiling, directly on the membrane and then allowing the I Solution will cool slowly over a period of 30 minutes.

Customized oligonucleotide probes were synthesized Starfire® using integrated DNA technologies (IDT). The lyophilized oligonucleotide probes were dissolved at 100 μ? from stock solution in IX TE pH 8.0 The labeling reaction included exo reaction buffer (NEB), 1 μ? of olígonucleotide of plantillé Universal Starfire® (IDT) and 0.5 pmol of Starfire® oligonucleotide probe. The reaction mixture was boiled for 1 minute and allowed to cool to room temperature for 5 minutes before adding 50 μ? a-32P-dATP (10 mCi / ml, i 6000 Ci / mmol) (Perkin-Elmer) and 5 U of exo DNA polymerase Klenow (NEB), and of incubating at room temperature for 90 minutes. The reaction was stopped by the addition of 40 μ? of EDTA 10 mM. The unincorporated a-32P-dATP was removed from the reaction mixture by using MicroSpin G-25 columns (GE Healthcare) in accordance with the manufacturer's instructions. Before I ie used, the probe was boiled for 1 minute.

Sequences of used Starfire® probes íníR-l 'TACATACTTCTTTACATTCCA 3 * (Sec. with ident. no .: 13) miR-126 5' OCATTATTA TCAOGOTACGA 3 '(Sec. with ident. no .: 14) jmR1 to 5 'TCAGTTTTGCATAGATTTGCACA 3' (Sec. with ID number: 15) rtu'R-22! 5 'GAAACCCAGCAO ACAÁTGTAQCT 3' (Sec. With ID No.:16) iniR-% J 5"GCAAAAATGTGCTAüTGCCAAA 3 '(Sec. With ident. No .: 17) rt.iR-182 5" imOAG'nCTA CATTrOCCAAA 3 '(Sec. With ident. No .: 18) raiR-145 5' AA jGArrOTGGOAAAACTGGAC 3 * (Sec. With ident. No .: 19) miR-30b 5"GCTGAG GTAGGATGTTTACA 3 '(Sec. With no. ident 20) niR-194 5 'TCCACATGGAGTTGC GTTACA 3' (Sec. with ID No.:21) miR-t «ta 5 * ACTCÁ < XXJACA < XJTTGAATGTT 3 '(Sec. With ID No.:22) mR-1 3 5 »TGAGCTACAÚTGCTTCATCTCA 3' (Sec. With ID No.:23) jnÍR-26 * 5 * AC ^ CTATOCTGGATT ACTTG AA 3 * (Sec with ID number: 24) miR-27 * 5 * GG (X3GAACTTA <K * CÁACTG GAA 3 '(Sec. with ID number: 25) «OR-I03 and TCATAGCCCTGTACAATGCTGCT 3 '(Sec. With ID No.:26) icriR-7 5 * AACAAAATCACTAGTCT CXA 3' (Sec. With ID No.:27) td-7a 5 'AACTATACAACCTACTACCTCA 3' (Sec. with ID No.:28) lnfl¾.-2ík 51 C ACC GCA 'ATAAGCA.CTrTA 3 * (Sec. with ID No.:29) raíR * 25 5 * TCAGA (X; GAGACAAGTGCAATG 3 '(Sec. With ident.30) miR ^ 125b 5 * TCACAAGTTAGGGTCrrCAGGGA 3' (Sec. With ident. No .: 31) I miR- 155 5 * CCCCTATCACGATTAGCATTAA '(Sec. with ID No.:32) miR-l 00 5' CACAAGTTCGGATCTACGCGTT 3 '(Sec. with ID No.:33) Terminal labeling of the oligonucleotide probe was performed RNAp U6 (5 'AACGCTTCACGAATTTGCGT 3' (sec. With ident. No .: 34)) by using 20 pmole of oligonucleotide probe, buffer of polynucleotide IX T4 (NEB), 50 pCi Y-32P-dATP (10 mCi / ml, 6000 Ci / mmol) (Perkin Elmer) and 10 U of T4 polynucleotide kinase (NEB), in one volume end of 20 μ ?. The probe was incubated for 30 minutes at 37 ° C. The reaction was stopped by the addition of 40 μ? of EDTA 10 mm. The y- 32P-dATP was removed! unincorporated of the reaction mixture by using columns ! MicroSpin G-25 (GE Healthcare), in accordance with the instructions of the I manufacturer. Before use, the probe was boiled for 5 minutes.

First name ! Sequence 1 pSilU6upper jGATCCCTCGAGTCT AG ATTTTTT GGAAA 2 pSilUeiower AGCTTTTCCAAAAAATCTAGACTCGAGG 3 143F jCGGGATCCCGGAGAGGTGGAGCCCAGGTC 4 43R jGCTCTAGACAGCATCACAAGTGGCTGA 5 145F ICGGGATCCCAGAGCAATAAGCCACATCC 6 145 R iGCTCTAGACTCTTACCTCCAGGGACAGC 7 miR-20F ICGGGATCCCGATGGTGGCCTGCTATTTCC 8 miR-20aR sCGGAATTCTCACACAGCTGGATGCAAA 9 miRcF jCGGGATCCCGTCCCCATTAGGGATTATGC 10 miRcR iCGGAATTCCCAAATCTGACACGCAACC 11 mtR-145 iAAGGGAUÜCCUGGGAAAACUGGAC antisense 12 miR-1 5 AGGUCAAAAGGGUCCUUAGGGAA Inverse Control 13 miR-1 iTACATACTTCTTTACATTCCA 14 mtR-126 ÍGCATTATTACTCACGGTACGA 15 miR19a il CAG I \ I I GCA I AGA I I I GCACA 16 miR-221 ÍGAAACCCAGCAGACAATGTAGCT 17 miR-96 ÍGCAAAAATGTGCTAGTGCCAAA 18 miR-182! TGTGAGTTCTACCATTGCCAAA 19 miR-145 ÍAAGGGATTCCTGGGAAAACTGGAC 20 miR-30b ÍGCTGAGTGTAGGATGTTTACA 21 miR-194 jTCCACATGGAGTTGCTGTTACA 22 mtR- 81a CTCACCGACAGCGTTGAATGTT 23 miR-143 iTGAGCTACAGTGCTTCATCTCA 24 miR-26a GCCTATCCTGGATTACTTGAA 25 miR-27a IGGC GG AACTTAGCC ACTGTG AA 26 miR- 03 iTCATAGCCCTGTACAATGCTGCT 27 miR-7 iAACAAAATCACTAGTCTTCCA 28 iet-7a ÍACACTATACAACCTACTACCTCA i 29 miR-20a PTACCTGCACTATAAGCACTTTA 30 miR-25 TCAGACCGAGACAAGTGCAATG 31 mR-25b rrCACAAGTTAGGGTCTCAGGGA 32 miR-155 CCCCTATC AC GATT AGC ATT AA 33 miR-100 jCACAAGTTCGGATCTACGGGTT 34 U6 snR To ÍAACGCTTCACGAATTTGCGT 35 hsa-leí ~ 7a iUGAGGÜAGUAGGUUGUAUAGUU 36 hsa-let-7e PGAGGUAGGAGGUUGUAUAGUU 37 hsa-let-7f-1 jUGAGGÜAGUAGAUUGUAUAGUU 38 hsa-let-7f-2 lUGAGGUAGUAGAUUGUAUAGUU 39 hsa-miR- iUGGAAUGUAAAGAAGUAUGUAU 40 hsa-m¡R-100 ÍAACCCGUAGAUCCGAACUUGUG 41 hsa-m¡R-103 AGCAGCAUÜGUACAGGGCUAUGA hsa-miR-106a lAAAAGUGCUUACAGÜGCAGGUAG hsa-miR-06b hsa-miR UAAAGUGCUGACAGUGCAGAU-107 AGCAGCAUUGUACAGGGCUAUCA hsa-m¡R-10a [hsa-miR UACCCUGUAGAUCCGAAUUUGUG ~ hsa-miR 10b lUACCCÜGUAGAACCGAAUUUGUG-1223 lUGGAGUGUGACAAUGGUGUÜUG hsa-m¡R-125a IUCCCUGAGACCCUUUAACCUGUGA HSA miR-125b hsa-miR-luCCCUGAGACCCUAACUUGUGA 126 luCGUACCGUGAGUAAUAAUGCG hsa-miR-130b CAG U hsa-miR GCAAUGAU GAAAGGGCAU hsa-miR 333 lUUUGGUCCCCUUCAACCAGCUG-139 jUCUACAGUGCACGUGUCUCCAG jhsa-miR-140 AGUGGUUUUACCCUAUGGUAG jhsa-miR-141 jUAACACUGUCUGGUAAAGAUGG Hsa-miR-143 lUGAGAUGAAGCACUGUAGCUC jhsa-rniR-1 5 IGUCCAGUUUUCCCAGGAAUCCCU ihsa-miR-150 lUCUCCCAACCCUUGUACCAGUG jhsa-miR-151 -3p | CU AGACUGAAGCUCCUÜGAGG jhsa-miR-155 iUUAAUGCUAAUCGUGAUAGGGGU | hsa-rniR-15b lUAGCAGCACAUCAUGGUUUACA ! hsa-miR-17-5p | C AAAGUGCU UACAGU GC AGGU AG | hsa-miR-181a jAACAUUCAACGCUGUCGGUGAGU Hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU ihsa-mÍR-182 iU UGGAGAUGGU AGAACUCAC ACU hsa-miR-183 lUAUGGCACUGGUAGMUUCACU ihsa-miR-186 iCAAAGAAUUCUCCUUUUGGGCU hsa-miR-188! CAUCCCU UGCAU GGUGGAGGG | hsa-miR- 8a jUAAGGUGCAUCUAGUGCAGAUAG | hsa-m¡R-192 CUGACCUAUGAAUUGACAGCC | hsa-m¡R-194 DGU AAC AGCAACUCCAU G UGGA | sa-mR-195 IJAGCAGCACAGAAAU AU UGGC Hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA jhsa-miR- 9b UGUGCAAAUCCAUGCAAAACUGA | hsa-miR-200a UAACACUGUCUGGÜAACGAUGU Hsa-m¡R-200b UAAUACUGCCUGGUAAUGAUGA Jhsa-miR-203 GUGAAAUGUUUAGGACCACUAG hsa-miR-20a JUAAAGUGCUUAUAGUGCAGGUAG jhsa-miR-21 (UAGCUUAUCAGACUGAUGUUGA hsa-miR-215 lAUGACCUAUGAAUUGACAGAC hsa-miR-22 | AAGCUGCCAGUUGAAGAACUGU hsa-miR-221 ÍAGCUACAUUGUCUGCUGGGUUUC hsa-miR-224 ICAAGUCACUAGUGGUUCCGUU hsa-miR-25 CAUUGCACUUUUUCUCGGUCUGA hsa-miR-26a IUUCAAGUAAUCCAGGAUAGGCÜ hsa-miR-27a [UUCACAGUGGCUMGUUCCGC jhsa-miR-298 IAGCAGAAGCAGGGAGGU UCUCCCA ihsa-miR-29a IUAGCACCAUCUGAAAUCGGUUA

Claims (9)

NOVELTY OF THE INVENTION ! CLAIMS j

1.- A process to determine the stage of colorectal cancer in humans; the process comprises the steps of: observing a regulation change of an RNA microRNA extracted in relation to the same microRNA in a sample of wild colorectal tissue, wherein the microRNA I it is selected from the group consisting of sec. with no. Ident. 56, sec. with no. Ident .: 57, and combinations thereof; determine the stage of colorectal cancer based on the observed change in regulation.

2. - The process according to claim 1, further characterized in that it also comprises the step of extracting RNA from a tissue sample before the step of observing a regulation change.

3. The process according to claim 1, further characterized by the step of observing a regulation change i observe a regulation for increase in sec. with no. Ident. 56

4. - The process according to claim 1, further characterized in that the step of observing a change in regulation j observes a down regulation in a selected microRNA of the group consisting of sec. with no. Ident. 56, sec. with no. of ident .:, 57, and combinations thereof.

5. - The process according to claim 1, further characterized in that the microRNA includes sec. with no. of ident .: 109 and the stage of observing a change of regulation observes a regulation by increase in sec. with no. Ident .: 109 and sec. with no. Ident. 56

6. - The process according to claim 1, further characterized in that the microRNA includes sec. with no. Ident .: 57 and it is determined that the stage of colorectal cancer is stage III or later if there is an increase regulation of two times or more of sec. with no. Ident .: 57 j 7.- A process to diagnose the stage of colorectal cancer

In humans, the process includes the steps of: extracting RNA from a cell | colorectal; observe a regulation change of at least two microRNAs of the RNA extracted in relation to the same microRNAs in a sample of colorectal tissue, characterized in that the microRNA is selected from the group consisting of sec. with no. Ident. 56, sec. with no. Ident .: 57, and combinations thereof; determine the stage of colorectal cancer based on the observed change in regulation.

8. - The process according to claim 7, 1 further characterized in that the at least two of the microRNAs include sec. with no. Ident .: 109 and sec. with no. Ident. 110

9. - A process to diagnose the stage of colorectal cancer in humans; the process comprises the steps of: observing a regulation change of at least two microRNAs that include sec. with no. from ident .: 56 and sec. with no. Ident .: 57; determine the stage of cancer Colorectal on the basis of the observed regulation change.