WO2017014532A1 - 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 - Google Patents
퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 Download PDFInfo
- Publication number
- WO2017014532A1 WO2017014532A1 PCT/KR2016/007841 KR2016007841W WO2017014532A1 WO 2017014532 A1 WO2017014532 A1 WO 2017014532A1 KR 2016007841 W KR2016007841 W KR 2016007841W WO 2017014532 A1 WO2017014532 A1 WO 2017014532A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- microorganism
- ornithine
- putrescine
- lyscp1
- activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1018—Carboxy- and carbamoyl transferases (2.1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1217—Phosphotransferases with a carboxyl group as acceptor (2.7.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
- C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/001—Amines; Imines
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/10—Citrulline; Arginine; Ornithine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y201/00—Transferases transferring one-carbon groups (2.1)
- C12Y201/03—Carboxy- and carbamoyltransferases (2.1.3)
- C12Y201/03003—Ornithine carbamoyltransferase (2.1.3.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01001—Amino-acid N-acetyltransferase (2.3.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01008—Phosphate acetyltransferase (2.3.1.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01035—Glutamate N-acetyltransferase (2.3.1.35)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/02—Phosphotransferases with a carboxy group as acceptor (2.7.2)
- C12Y207/02001—Acetate kinase (2.7.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
- C12Y305/01016—Acetylornithine deacetylase (3.5.1.16)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01017—Ornithine decarboxylase (4.1.1.17)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y602/00—Ligases forming carbon-sulfur bonds (6.2)
- C12Y602/01—Acid-Thiol Ligases (6.2.1)
- C12Y602/01001—Acetate-CoA ligase (6.2.1.1)
Definitions
- the present invention relates to a recombinant microorganism for producing putrescine or ornithine and a method for producing putrescine or ornithine using the same.
- Biogenic amines are nitrogen compounds produced mainly by decarboxylation of amino acids, amination of aldehydes and ketones, and amino group transfer reactions. Such biogenic amines are low molecular weight and are synthesized during the metabolism of microorganisms, plants and animals, and thus are known as components commonly found in these cells.
- putrescine is found in gram-negative bacteria and fungi and is present in high concentrations in various species, and is expected to play an important role in the metabolism of microorganisms.
- putrescine is an important raw material for synthesizing polyamine nylon-4,6, and is mainly produced by chemical synthesis.
- the chemical synthesis method comprises a three-step process including a catalytic oxidation step, a cyanide compound and a hydrogenation step using high pressure hydrogen. Therefore, there is a demand for a method using biomass that is more environmentally friendly and can reduce energy consumption for the production of putrescine.
- Ornithine is a precursor widely used in plants, animals, and microorganisms, and is a precursor used for biosynthesis of arginine, proline, and polyamines. It also plays an important role in the pathway of the production of urea from amino acids or ammonia through the ornithine cycle in the metabolism of higher animals in vitro. Ornithine is used as a nutritional supplement because it is effective in reducing muscle mass and body fat, and is also used as a medicine to improve cirrhosis and liver dysfunction.
- a method for producing ornithine a method of treating milk casein with a digestive enzyme and a method using transformed E. coli or Corynebacterium microorganisms are known (Korea Registration No. 10-1372635; T Gotoh et al., Bioprocess Biosyst.Eng., 33: 773-777, 2010).
- microorganisms of the genus Corynebacterium are glutamic acid by N-acetyl-L-glutamic acid by argJ (bifunctional ornithine acetyltransferase / N-acetylglutamate synthase, EC 2.3.1.35).
- argJ bifunctional ornithine acetyltransferase / N-acetylglutamate synthase, EC 2.3.1.35.
- N-acetylglutamate synthase (EC 2.3.1.1) and argE (Acetylornithine deacetylase, EC 3.5.1.16) replace putrescine, or "linear pathways," replacing argJ in microorganisms of the genus Corynebacterium. Biosynthesize ornithine.
- ArgJ is recycled by an acetyl group between ornithine and glutamic acid, but in Escherichia coli, ArgA converts the acetyl group of acetyl-CoA to glutamic acid.
- ArgE decomposes N-acetyl-ornithine to produce ornithine and acetic acid.
- pta-ackA pta, phosphotransacetylase; ackA, Acetate kinase
- acs Alcohol-coenzyme A synthetase
- the present inventors have continuously studied for the purpose of improving the production of ornithine and putrescine, and when the introduction of E. coli-derived argA and argE into the microorganisms of Corynebacterium, the production capacity of putrescine and ornithine is improved.
- the present invention was completed by confirming.
- Another object of the present invention is to provide a method for producing putrescine or ornithine using the microorganism.
- E. coli-derived ArgA and E. coli-derived ArgE were introduced into the microorganism of the genus Corynebacterium producing putrescine or ornithine of the present invention. It was confirmed that the yield increased. Accordingly, the microorganisms of the present invention can be widely used to produce putrescine or ornithine, and can be widely used as an effective and desirable means for providing raw materials in terms of economic and environmental aspects in the production of various polymer products used as raw materials. Can be.
- Figure 1 A is a schematic diagram showing the putrescine and ornithine biosynthetic pathway of the microorganisms of Corynebacterium (pure environment), B is a putrescine and ornithine biosynthetic pathway (linear path) of E. coli.
- Figure 2 is a schematic diagram showing the biosynthetic pathway to improve the production capacity of putrescine and ornithine by introducing E. coli-derived argA and E. coli-derived argE in the state where the argJ of the genus Corynebacterium is expressed.
- One aspect of the present invention is a coli having the ability to produce putrescine or ornithine, introduced with the activity of E. coli-derived N-acetylglutamate synthase and E. coli-derived acetylornithine deacetylase Provides microorganisms in the genus Nebacterium.
- One embodiment of the present invention provides a microorganism of the genus Corynebacterium having E. coli-derived N-acetyl glutamate synthase is composed of the amino acid sequence of SEQ ID NO: 1, putrescine or ornithine.
- Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having E. coli-derived acetylornithine deacetylase is composed of the amino acid sequence of SEQ ID NO: 3 putrescine or ornithine .
- Corynebacterium genus microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum), Corynebacterium ammoniagenes's Ness (Corynebacterium ammoniagenes), Corynebacterium Thermo Amino's Ness (Corynebacterium thermoaminogenes), Brevibacterium Playa boom (Brevibacterium flavum) and Brevibacterium lactofermentum (Brevibacterium It provides a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine, which is selected from the group consisting of lactofermentum ).
- the Corynebacterium spp. Further enhances the activity of phosphotransacetylase and acetate kinase operon (pta-ackA operon) compared to the intrinsic activity.
- pta-ackA operon acetate kinase operon
- Another embodiment of the present invention is that the phosphotransacetylase and acetic acid kinase operon consisting of the amino acid sequence of SEQ ID NO: 5 or 7, Corynebacterium having a putrescine or ornithine production capacity Provides microorganisms of the genus.
- the microorganism of the genus Corynebacterium is additionally introduced into the activity of E. coli-derived acetyl-CoA synthetase (acetyl-CoA synthetase, acs), has the ability to produce putrescine or ornithine Provides microorganisms of the genus Corynebacterium.
- Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having acetyl-CoA synthase is putrescine or ornithine, which is composed of the amino acid sequence of SEQ ID NO: 9.
- Corynebacterium genus microorganisms are introduced to the activity of ornithine decarboxylase (ornithine decarboxylase, ODC), Coryne having a putrescine or ornithine production capacity Provides microorganisms of the genus Bacteria.
- ornithine decarboxylase ornithine decarboxylase, ODC
- Coryne having a putrescine or ornithine production capacity Provides microorganisms of the genus Bacteria.
- Another embodiment of the present invention is a microorganism of the genus Corynebacterium additionally i) ornithine carbamoyl transferase (ArgF), ii) glutamate exporter or iii) ornithine carbamoyl transferase and It provides a microorganism of the genus Corynebacterium having a putrescine or ornithine production capacity, the activity of the glutamate exporter is weakened compared to the intrinsic activity.
- ArgF ornithine carbamoyl transferase
- Corynebacterium genus microorganisms are additionally acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase ( ArgB), and at least one activity selected from the group consisting of acetyl ornithine amino transferase (ArgD), a microorganism of the genus Corynebacterium, having putrescine or ornithine production, which is enhanced relative to intrinsic activity. to provide.
- ArgC acetyl gamma glutamyl phosphate reductase
- ArgJ acetyl glutamate synthase or ornithine acetyl transferase
- ArgB acetyl glutamate kinase
- Another embodiment of the present invention provides a microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine, the activity of the acetyl transferase is further weakened than the intrinsic activity do.
- Another embodiment of the present invention provides the microorganism of the genus Corynebacterium having an ability to produce putrescine or ornithine, wherein the acetyl transferase is a protein consisting of the amino acid sequence of SEQ ID NO: 30 or 31 do.
- Another embodiment of the present invention is a microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine, the activity of putrescine exporter is further enhanced than the intrinsic activity to provide.
- the putrescine exporter is a protein consisting of the amino acid sequence of SEQ ID NO: 26 or SEQ ID NO: 28, a microorganism of the genus Corynebacterium having putrescine or ornithine production capacity To provide.
- One embodiment of the present invention provides a method for producing putrescine or ornithine, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
- One aspect of the present invention is a coli having the ability to produce putrescine or ornithine, introduced with the activity of E. coli-derived N-acetylglutamate synthase and E. coli-derived acetylornithine deacetylase For microorganisms in the genus Nebacterium.
- N-acetylglutamate synthase refers to an enzyme that mediates the reaction of N-acetylglutamate from glutamate and acetyl-CoA, and the resulting N-acetylglutamate is ornithine. It can be used as a precursor of and arginine.
- N-acetylglutamate synthase is, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1, or 70% or more, specifically 80% or more, more specifically 90% or more, even more Specifically, a protein having an activity of substantially N-acetylglutamate synthase as an amino acid sequence showing at least 95%, even more specifically at least 98% and most specifically at least 99% may be included without limitation.
- the N-acetylglutamate synthase in the present invention is not limited to the origin, for example, may be derived from E. coli have.
- the sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 1, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is also provided. It is obvious that it is included in the category.
- the polynucleotide encoding the N-acetylglutamate synthase of the present invention has a similar activity to that of the N-acetylglutamate synthase protein, 70% or more, specifically 80% or more of the amino acid sequence of SEQ ID NO: 1 , More specifically at least 90%, even more specifically at least 95%, even more specifically at least 98%, most specifically at least 99% and may include a polynucleotide encoding a protein that exhibits homology.
- the polynucleotide sequence of SEQ ID NO: 2 may be included.
- cetylornithine deacetylase used in the present invention is an enzyme that mediates the reaction of acetic acid and ornithine by mediating the hydrolysis of acetylornithine.
- Acetylornithine deacetylase in the present invention is a protein comprising the amino acid sequence of SEQ ID NO: 3, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically 95 Any amino acid sequence having at least%, even more specifically at least 98% and most specifically at least 99% homology may be included without limitation as long as the protein has an activity of substantially separating acetyl ornithine from acetylornithine.
- acetylornithine deacetylase in the present invention is not limited to the origin, for example, may be derived from E. coli have.
- sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 3, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is also provided. It is obvious that it is included in the category.
- the polynucleotide encoding the acetylornithine deacetylase of the present invention is at least 70%, specifically 80% or more of the amino acid sequence of SEQ ID NO: 3 or the sequence as long as it has similar activity to the acetylornithine deacetylase protein. , More specifically at least 90%, even more specifically at least 95%, even more specifically at least 98%, most specifically at least 99% and may include a polynucleotide encoding a protein that exhibits homology.
- the polynucleotide sequence of SEQ ID NO: 4 may be included.
- the polynucleotide encoding the N-acetylglutamate synthase or acetylornithine deacetylase of the present invention is stringent with the polynucleotide sequence of SEQ ID NO: 2 or 4 or with a probe derived from the polynucleotide sequence.
- conditions can be hybridized, and may be variants encoding normal functioning N-acetylglutamate synthase or acetylornithine deacetylase.
- stringent conditions means conditions that enable specific hybridization between polynucleotides. For example, such stringent conditions are described specifically in the literature (eg, J. Sambrook et al., Homology).
- homology means a degree of agreement with a given amino acid sequence or polynucleotide sequence and may be expressed as a percentage.
- homologous sequences thereof having the same or similar activity as a given amino acid sequence or polynucleotide sequence are denoted as "% homology”.
- % homology For example, using standard software that calculates parameters such as score, identity and similarity, in particular BLAST 2.0, or by hybridization experiments used under defined stringent conditions Appropriate hybridization conditions, which are defined within the scope of the art, are well known to those skilled in the art, and are well known to those skilled in the art (e.g., J.
- the microorganism of the present invention includes both natural and mutant forms, examples of which include the genus Escherichia sp., Shigella sp., Citrobacter sp. And Salmonella. in (Salmonella sp.), Enterobacter genus (Enterobacter sp.) yeosi California in (Yersinia sp.), keurep when Ella in (Klebsiella sp.), air Winiah in (Erwinia sp.), the genus Corynebacterium (Corynebacterium sp.), Genus Brevibacterium sp., Genus Lactobacillus sp., Genus Selenomanas sp., Genus Vibrio sp., Genus Pseudomonas sp., It may be a microorganism belonging to the genus Streptomyces sp., Arcanobacterium
- the microorganism of the present invention may be a microorganism belonging to the genus Corynebacterium, more specifically Corynebacterium glutamicum ( Corynebacterium glutamicum), Corynebacterium ammoniagenes's Ness (Corynebacterium ammoniagenes), Corynebacterium Thermo Amino's Ness (Corynebacterium thermoaminogenes), Brevibacterium Playa boom (Brevibacterium flavum) and Brevibacterium lactofermentum (Brevibacterium lactofermentum ) may be selected from the group consisting of, and more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), but is not limited thereto.
- Corynebacterium glutamicum Corynebacterium glutamicum
- Corynebacterium ammoniagenes'ss Corynebacterium ammoniagenes
- microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine is a microorganism of the genus Corynebacterium, which has a production capacity of putrescine or ornithine naturally or It means a microorganism to which putrescine or ornithine is produced in a parent strain having no ornithine production capacity.
- the microorganism to which the putrescine or ornithine producing ability is imparted or produced is not particularly limited, but the acetyl glutamate synthase converting glutamate to acetylglutamate to enhance the biosynthetic pathway from glutamate to ornithine.
- Or ornithine acetyltransferase for converting acetylornithine to ornithine, acetylglutamate kinase (ArgB) for converting acetylglutamate to acetylglutamyl phosphate (ArgB), acetylglutamyl phosphate Acetyl gamma glutamyl phosphate reductase (ArgC) to convert to N-acetylglutamate semialdehyde, acetyl ornithine aminotransferase (ArgD to convert from acetylglutamate semialdehyde to N-acetylornithine)
- the productivity of ornithine which is modified to increase the activity of) relative to the intrinsic activity and is used as a biosynthetic raw material of putrescine, may be improved.
- the microorganism has an intrinsic activity of ornithine carbamoyltransfrase (ArgF) involved in arginine synthesis in ornithine, a protein involved in the release of glutamate, and / or a protein acetylating putrescine. And may be modified to weaken and / or modified to introduce the activity of ornithine decarboxylase (ODC).
- ArgF ornithine carbamoyltransfrase
- ODC ornithine decarboxylase
- the term "activity introduced" of the present invention may mean that the activity of a protein that is not present or is insufficient in a microorganism is newly introduced or increased in the microorganism, and specifically, expresses a gene encoding a protein that was not present in the microorganism. Possibly including, but not limited to, inserting or delivering into a microorganism or inducing a mutation that enhances expression for a protein that is rarely or rarely expressed in the microorganism.
- transformation refers to a polynucleotide or activity encoding a specific protein.
- a vector containing a strong or weak promoter sequence is introduced into the host cell to allow the protein encoded by the polynucleotide to be expressed in the host cell or to induce a mutation in the chromosome of the host cell.
- the polynucleotide also includes DNA and RNA encoding the target protein.
- the polynucleotide may be introduced in any form as long as it can be introduced into a host cell to induce expression or mutation.
- the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all the elements necessary for its expression.
- the expression cassette may include a promoter, a transcription termination signal, a ribosomal binding site, and a translation termination signal, which are typically operably linked to the polynucleotide.
- the expression cassette may be in the form of an expression vector capable of self replication.
- the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell, but is not limited thereto.
- operably linked means that the gene sequence is functionally linked with a promoter sequence for initiating and mediating the transcription of a polynucleotide encoding a particular protein of the invention.
- the term "vector” refers to a DNA preparation containing the nucleotide sequence of the polynucleotide encoding said target protein operably linked to a suitable regulatory sequence so that it can express the target protein in a suitable host.
- the regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. After being transformed into a suitable host cell, the vector can be replicated or function independent of the host genome and integrated into the genome itself.
- the vector to be used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used.
- Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
- pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and pBR-based, pUC-based, pBluescriptII-based, etc. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
- the vector usable in the present invention is not particularly limited and known expression vectors can be used. Specifically, pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector and the like can be used.
- the bacterial chromosome insertion vector can replace the polynucleotide encoding the target protein in the chromosome with the mutated polynucleotide. Insertion of the polynucleotide into the chromosome can be made by any method known in the art, such as, but not limited to, homologous recombination. Since the vector of the present invention may be inserted into a chromosome by causing homologous recombination, the vector may further include a selection marker for confirming whether the chromosome is inserted.
- Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a polynucleotide of interest, and to give selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers can be used. In an environment in which a selective agent is treated, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.
- the microorganism of the genus Corynebacterium of the present invention is additionally potentin or ornithine, the activity of phosphotransacetylase and acetate kinase (pta-ackA operon) is enhanced compared to the intrinsic activity It may be a microorganism of the genus Corynebacterium having a production capacity.
- phosphotransacetylase and acetic acid kinase operon are metabolic pathways in which acetyl-CoA generated from glucose or pyruvate is converted to acetic acid via acetyl phosphorus and its It is an operon that contains genes that reversibly mediate opposite metabolic pathways.
- phosphotransacetylase and acetic acid kinase operon are proteins comprising the amino acid sequence of SEQ ID NO: 5 or 7, or 70% or more, specifically 80% or more, more specifically 90% or more of the sequence, More specifically, at least 95%, even more specifically at least 98%, most specifically at least 99% homology, the amino acid sequence exhibits a protein that substantially mediates the reaction of the production of acetyl-CoA from acetic acid, including without limitation Can be.
- phosphotransacetylase and acetic acid kinase operon in this invention are not limited to the origin.
- sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 5 or 7, the present invention also applies when some sequences have an amino acid sequence deleted, modified, substituted or added. It is obvious that it is included in the scope of the invention.
- the polynucleotides encoding phosphotransacetylase and acetic acid kinase operon of the present invention are 70% or more, specifically 80% or more, more specifically 90% or more of the amino acid sequence of SEQ ID NO: 5 or 7, or the above sequence, More specifically, at least 95%, even more specifically at least 98%, most specifically at least 99% may comprise a polynucleotide encoding a protein, and most specifically of SEQ ID NO: 6 or Polynucleotide sequences.
- enhancing activity of the present invention not only includes the introduction of new or increased activity of the protein itself, resulting in an effect beyond the original function, but also an increase in endogenous gene activity, endogenous gene amplification from internal or external factors, Its activity is increased by deletion of inhibitory regulatory factors of gene expression, increase in gene copy number, introduction of genes from outside, modification of expression control sequences, in particular promoter replacement or modification, and increased enzyme activity by intragenic mutations. do.
- the copy number increase of the polynucleotide is not particularly limited, but may be performed in a form operably linked to a vector or by inserting into a chromosome in a host cell.
- a host capable of being cloned and functioning independently of a host, in which a polynucleotide encoding an enzyme of the present invention is operably linked may be performed by introducing into a host cell, or the host is operably linked.
- a vector capable of inserting the polynucleotide into the chromosome in the cell may be introduced into the host cell to increase the copy number of the polynucleotide in the chromosome of the host cell.
- 2) modification of the expression control sequence to increase the expression of the polynucleotide is not particularly limited thereto, but the deletion, insertion, non-conservative or conservative substitution of the polynucleotide sequence to further enhance the activity of the expression control sequence or Combinations can be made by inducing variations in the sequence or by replacing with polynucleotide sequences having stronger activity.
- the expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, a sequence that controls the termination of transcription and translation, and the like.
- the heterologous promoter may be linked to the top of the polynucleotide expression unit instead of the original promoter.
- the strong promoter include a CJ7 promoter, a lysCP1 promoter, an EF-Tu promoter, a groEL promoter, an aceA or aceB promoter, and the like.
- the lysCP1 promoter (WO2009 / 096689) or the CJ7 promoter (Korean Patent No. 0620092 and WO2006 / 065095), which are corynebacterium-derived promoters, may be operably linked to improve the expression rate of the polynucleotide encoding the enzyme.
- the present invention is not limited thereto.
- 3) modification of the polynucleotide sequence on the chromosome is not particularly limited, and expression control is performed by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the polynucleotide sequence. This can be done by inducing variations in the sequence or by replacing with a polynucleotide sequence that has been improved to have stronger activity.
- the activity of the phosphotransacetylase and acetic acid phosphatase operon is enhanced compared to the intrinsic activity of the increase in the number of copies of the operon cell, the mutation in the expression control sequence of the operon
- a method of introducing, a method of replacing an expression control sequence of a gene on the operon with a highly active sequence, a method of replacing a gene encoding the enzyme on a chromosome with a mutated gene to increase the activity of the enzyme constituting the operon and It may be made by any one or more methods selected from the group consisting of a method for introducing a mutation in the gene on the chromosome encoding the enzyme so that the activity of the enzyme constituting the operon is enhanced.
- the method of replacing the expression control sequence of the genes on the phosphotransacetylacetylase and acetic acid kinase operon with a highly active sequence may be used instead of the intrinsic promoters of the acetylase and acetic acid kinase operon, for example, the CJ7 promoter, the lysCP1 promoter. , EF-Tu promoter, groEL promoter, aceA or aceB promoter can be replaced, but is not limited thereto.
- intrinsic activity refers to an active state of an enzyme that is intact in a state in which an original microorganism is not modified
- "enhanced” compared to an intrinsic activity means that a gene exhibiting activity is introduced or the gene Increase in the number of copies, deletion of the inhibitory regulatory factors of gene expression or alteration of expression control sequences, e.g. the use of microorganisms prior to manipulation, such as the use of an improved promoter. It means a state of increased activity.
- the microorganism of the genus Corynebacterium of the present invention may be a microorganism of the genus Corynebacterium having an activity of putrescine or ornithine, to which the activity of E. coli-derived acetyl-CoA synthetase (acs) is introduced. have.
- Acetyl-CoA synthetase (acs) in the present invention is an enzyme that mediates the reaction of the production of acetyl-CoA from ATP, acetic acid and CoA.
- Acetyl-CoA synthetase in the present invention is a protein comprising the amino acid sequence of SEQ ID NO: 9, or 70% or more, specifically 80% or more, more specifically 90% or more, 95% or more with the sequence As described above, even more specifically, any protein having an activity that substantially mediates acetyl-CoA synthesis as an amino acid sequence having at least 98% and most specifically at least 99% homology may be included without limitation.
- acetyl-CoA synthase in the present invention is not limited to the origin, for example, may be derived from E. coli .
- sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 9, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is also provided. It is obvious that it is included in the category.
- the polynucleotide encoding the acetyl-CoA synthetase of the present invention is at least 70%, specifically at least 80%, more specifically at least 90%, even more specifically at 95% with the amino acid sequence of SEQ ID NO: 9 or the sequence As described above, more specifically, it may include a polynucleotide encoding a protein exhibiting homology of 98% or more, most specifically 99% or more, and most specifically, may include the polynucleotide sequence of SEQ ID NO: 10.
- the microorganism of the genus Corynebacterium of the present invention may be a microorganism of the genus Corynebacterium having an activity of putrescine or ornithine, in which the activity of ornithine decarboxylase (ODC) is introduced.
- ODC ornithine decarboxylase
- ornithine decarboxylase means an enzyme that produces putrescine by mediating the decarboxylation of ornithine.
- the microorganism of the genus Corynebacterium does not have the putrescine biosynthesis enzyme, but when ornithine decarboxylase (ODC) is introduced from the outside, putrescine is synthesized while putrescine is released into the cell.
- ODC ornithine decarboxylase
- Ornithine decarboxylase that can be introduced from the outside can be utilized in the present invention irrespective of the microorganism, so long as it has the above activity, specifically, E. coli derived can be introduced.
- the microorganisms of the genus Corynebacterium additionally have the intrinsic activity of i) ornithine carbamoyl transferase (ArgF), ii) glutamate exporter or iii) ornithine carbamoyl transferase and glutamate exporter. It may be a microorganism of the genus Corynebacterium having weakened, compared to putrescine or ornithine production capacity.
- the glutamate exporter in Corynebacterium may be NCgl1221.
- the microorganisms of the genus Corynebacterium further include acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase (ArgB), and acetyl ornithine.
- the at least one activity selected from the group consisting of tin amino transferases (ArgD) may be microorganisms of the genus Corynebacterium having potrecin or ornithine production, enhanced relative to intrinsic activity.
- the microorganism of the genus Corynebacterium may be a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine, in particular, the activity of acetyltransferase, specifically, the activity of NCgl1469 is weaker than the intrinsic activity. have.
- Microorganism of the present invention is a microorganism of the genus Corynebacterium, which has putrescine or ornithine production ability, in which the activity of putrescine exporter, specifically NCgl2522, is enhanced than the intrinsic activity. Can be.
- active weakening includes not only the activity of the protein itself is reduced or inactivated, resulting in sub-functional effects, but also the reduction of intrinsic gene activity, activation of inhibitory regulatory factors of the gene expression, genes Its activity is impaired by decreased copy number, alteration of expression control sequences, in particular promoter replacement or modification, and inactivation or reduction of enzyme activity by intragenic mutations.
- active weakening in the present invention is, for example,
- a method of deleting part or all of a polynucleotide encoding a protein may include a polynucleotide or a marker gene in which a polynucleotide encoding an intrinsic target protein in a chromosome through a bacterial chromosome insertion vector is deleted from a polynucleotide sequence.
- a marker gene in which a polynucleotide encoding an intrinsic target protein in a chromosome through a bacterial chromosome insertion vector is deleted from a polynucleotide sequence.
- the method of modifying the expression control sequence is carried out by inducing a mutation on the expression control sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof to further weaken the activity of the expression control sequence, or By replacing with a polynucleotide sequence with weaker activity.
- the expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence that controls the termination of transcription and translation.
- a method of modifying a polynucleotide sequence on a chromosome is carried out by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further weaken the activity of the enzyme, or weaker. By replacing with a polynucleotide sequence that has been improved to have activity.
- the method of deleting a regulator that inhibits the expression of the polynucleotide of the enzyme may be performed by replacing the polynucleotide of the expression inhibitory factor with a polynucleotide or a marker gene that is missing some polynucleotide sequence.
- the term "some" differs depending on the kind of polynucleotide, but is specifically 1 to 300, specifically 1 to 100, and more specifically 1 to 50.
- the acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase (ArgB), acetyl ornithine aminotransferase (ArgD), ornithine Carbamoyl transferase (ArgF), proteins involved in the release of glutamate and ornithine decarboxylase (ODC) are not particularly limited, but are specifically SEQ ID NOs: 32, 33, 34, 35, Amino acid sequence 36, 37 or 38 or an amino acid sequence having at least 70%, more specifically at least 80%, more specifically at least 90% homology thereof.
- the protein for acetylating putrescine is not particularly limited, but specifically, the amino acid sequence of SEQ ID NO: 30 or 31 or 70% or more thereof, more specifically 80% or more, more specifically 90% or more homology It may include an amino acid sequence having a.
- putrescine exporter in the present invention may include an amino acid sequence of SEQ ID NO: 26 or 28 or an amino acid sequence having a homology of 70% or more, more specifically 80% or more, more specifically 90% or more. .
- acetyl gamma glutamyl phosphate reductase (ArgC), acetylglutamate synthase or ornithine acetyltransferase (ArgJ), acetylglutamate kinase (ArgB), acetylornithine aminotransferase (ArgD), ornithine Enhancing the activity of the decarboxylase (ODC) and putrescine exporters may, for example, increase the number of copies of the polynucleotide encoding the protein, modify the expression control sequence to increase the expression of the polynucleotide, the enzyme Alteration of the polynucleotide sequence on a chromosome to enhance its activity, deletion of a regulator that inhibits expression of the polynucleotide of the enzyme, and combinations thereof.
- the active weakening of proteins involved in the release of ornithine carbamoyl transferase (ArgF) and glutamate, and proteins that acetylate putrescine may result in the deletion of some or all of the polynucleotides encoding the protein, the poly Modification of expression control sequences to reduce expression of nucleotides, modification of the polynucleotide sequence on a chromosome to attenuate the activity of the protein, and combinations thereof.
- the step of culturing the microorganisms in the medium is not particularly limited thereto, and may be performed by a known batch culture method, continuous culture method, fed-batch culture method, or the like.
- the culture conditions are not particularly limited, but using a basic compound (eg sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg phosphoric acid or sulfuric acid) to an appropriate pH (eg pH 5 to 9, specifically PH 6 to 8, most specifically pH 6.8) can be adjusted, the aerobic conditions can be maintained by introducing an oxygen or oxygen-containing gas mixture into the culture, the culture temperature is 20 to 45 °C, specifically 25 It can be maintained at 40 to 40 °C, it is preferred to incubate for about 10 to 160 hours. Putrescine or ornithine produced by the culture may be secreted into the medium or remain in the cells.
- a basic compound eg sodium hydroxide, potassium hydroxide or ammonia
- an acidic compound eg phosphoric acid or sulfuric acid
- the carbon sources of the culture medium used are sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), fats and oils (e.g. soybean oil, sunflower seeds). Oils, peanut oils and coconut oils), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (e.g. glycerol and ethanol) and organic acids (e.g. acetic acid) may be used individually or in combination. This is not restrictive.
- the nitrogen source of the culture medium used may include nitrogen-containing organic compounds (e.g.
- Ammonium, ammonium phosphate, ammonium carbonate and ammonium nitrate) and the like can be used individually or in combination, but is not limited thereto.
- potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, etc. may be used individually or in combination, but is not limited thereto.
- the culture medium used may further include, but is not limited to, essential growth-promoting substances such as other metal salts (eg magnesium sulfate or iron sulfate), amino acids and vitamins.
- the method for recovering putrescine or ornithine produced in the culturing step of the present invention may be carried out using a suitable method known in the art according to a culture method, for example, a batch, continuous or fed-batch culture method. Amino acids can be collected.
- Example 1 E. coli derived argA And E. coli derived of argE Putrescine Introduction into Production Strains and Confirmation of Putrescine Production Capacity
- argA and argE were introduced into the transposon gene of the strain.
- PDZTn (WO 2009/125992) was used as a transformation vector that enables the introduction of genes in the chromosome by using the transposon gene region of a microorganism of Corynebacterium, and the promoter was a lysCP1 promoter (International Patent Publication WO 2009 / 096689, SEQ ID NO: 39).
- a gene fragment of about 1.6 kb was amplified using a primer pair of SEQ ID NOs: 11 and 12 as a template using the chromosome of E. coli W3110 strain.
- the PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 1 minute 30 seconds at 72 °C.
- This PCR result was then electrophoresed on a 0.8% agarose gel and then purified by eluting a band of the desired size.
- the pDZTn vector was treated with XhoI and fusion cloned each PCR product obtained above. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). The resulting plasmid was named pDZTn-lysCP1-argA.
- the PCR product was obtained by amplifying a gene fragment of about 1.4 kb by using a primer pair of SEQ ID NOs: 15 and 16 as a template using the chromosome of E. coli W3110 strain as described above, and the lysCP1 promoter. Region and fusion cloning.
- the resulting plasmid was named pDZTn-lysCP1-argE.
- the plasmid pDZTn-lysCP1-argA was introduced into KCCM11240P (Korean Patent Publication No. 10-2013-0082478) by electroporation to obtain a transformant, and the transformant was kanamycin (25 ⁇ g). / Ml) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) in BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%) Colonies were formed by smearing and incubating. Transgenic strains into which the plasmid pDZTn-lysCP1-argA was introduced were selected by selecting blue colonies from the colonies formed therefrom.
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- Shake culture (30 °C, 8 hours)
- 10 -4 to 10 -10 were finally selected by secondary crossover by selecting white colonies appearing at a relatively low rate among the colonies formed.
- PCR was performed on the final selected strains using primer pairs of SEQ ID NOs: 12 and 13 to confirm that the gene encoding argA was introduced, and the Corynebacterium glutamicum mutant was designated as KCCM11240P Tn: lysCP1-argA. It was.
- pDZTn-lysCP1-argE prepared above was transformed to KCCM11240P Tn: lysCP1-argA in the same manner as described above, and SEQ ID NOs. 13 and 16 were used for the final selected strains. PCR was performed using the primer pair to confirm that argE in the transposon was introduced.
- Corynebacterium glutamicum mutants selected therefrom were named KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE.
- DAB12-a ⁇ NCgl1469 (Korean Patent Publication No. 10-2013-0082478), which is a putrescine-producing strain based on Corynebacterium glutamicum ATCC13869, was named DAB12-b, and argA derived from E. coli and argE derived from E. coli In order to confirm whether or not involved in improving putrescine production capacity, argA and argE were introduced into the transposon gene.
- pDZTn-lysCP1-argA prepared above was transformed into Corynebacterium glutamicum DAB12-b in the same manner as in Example 1-1, and it was confirmed that argA was introduced into the transposon.
- Corynebacterium glutamicum mutants selected from which argA was introduced were named DAB12-b Tn: lysCP1-argA.
- the two Corynebacterium glutamicum mutants prepared in Examples 1-1 and 1-2 (KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) and two parent strains (KCCM11240P; DAB12-b) were each prepared with 1 mM arginine-containing CM flat media (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea) 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, based on 1 L) and incubated for 24 hours at 30 °C.
- Example 2 E. coli derived argA And E. coli derived argE is Introduced Putrescine Enhancement of pta-ackA and Production of Putrescine in Production Strains
- a promoter of the pta-ackA operon in the chromosome was introduced with a promoter that is more active than the intrinsic promoter, specifically the lysCP1 promoter (International Patent Publication WO 2009/096689) before the start codon.
- a homologous recombination fragment comprising a lysCP1 promoter, wherein both ends of the promoter had the original sequence of pta-ackA on the chromosome.
- the 5'-terminal portion of the lysCP1 promoter was obtained by performing PCR using primer pairs of SEQ ID NOs: 17 and 18 as a template using genomic DNA of Corynebacterium glutamicum ATCC13032. At this time, the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C.
- the lysCP1 promoter region was obtained by PCR under the same conditions using the primer pairs of SEQ ID NOs: 14 and 19, and the 3'-terminal region of the lysCP1 promoter was the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template. Obtained by PCR under the same conditions using primer pairs of SEQ ID NOs: 20 and 21. Primers used to obtain the promoter are as shown in Table 1 and Table 3 below.
- Each PCR product obtained above was fusion cloned into a pDZ vector treated with XbaI. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). The resulting plasmid was named pDZ-lysCP1-1'pta-ackA.
- the plasmid pDZ-lysCP1-1'pta-ackA prepared above was subjected to electroporation to KCCM11240P and Corynebacterium glutamicum mutant KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE, respectively, prepared in Example 1-1. electroporation) to obtain transformants, which were transformed into BHIS plates containing kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside).
- Colonies were formed by plating and incubating in medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%). Strains into which the plasmid pDZ-lysCP1-1'pta-ackA was introduced were selected by selecting blue colonies from the colonies formed therefrom.
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- Shake culture (30 °C, 8 hours)
- 10 -4 to 10 -10 plated and cultured in X-gal-containing solid medium to form colonies. From the colonies formed, the colonies of white color appearing at a relatively low rate were selected to select strains in which the pta-ackA promoter was finally replaced by lysCP1 by secondary crossover.
- PCR was performed using primer pairs of SEQ ID NOs: 19 and 21 for the final selected strains to confirm that the lysCP1 promoter was introduced before the pta-ackA start codon in the chromosome. In this case, the PCR reaction was repeated 30 times with 30 seconds of denaturation at 95 ° C, 30 seconds of annealing at 55 ° C, and 1 minute extension at 72 ° C.
- Corynebacterium glutamicum mutants selected therefrom were named KCCM11240P lysCP1-1'pta-ackA and KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA, respectively.
- ATCC13869 base Putrescine production Corynebacterium Pta- in strains ackA Preparation of promoter substituted strains
- DNA was used as a template and PCR was performed using primer pairs of SEQ ID NOs: 17 and 22 (Table 3, Table 4). At this time, the PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 3 minutes at 72 °C.
- genes encoding pta-ackA derived from Corynebacterium glutamicum ATCC13869 include the polynucleotide sequence set forth in SEQ ID NO: 8.
- the protein encoded therefrom was confirmed to include the amino acid sequence set forth in SEQ ID NO: 7.
- a homologous recombination fragment comprising a lysCP1 promoter, the terminal end of which had the original sequence of pta-ackA on the chromosome.
- the 5'-terminal portion of the lysCP1 promoter was obtained by PCR using primer pairs of SEQ ID NOs: 17 and 23 as a template using genomic DNA of Corynebacterium glutamicum ATCC13869. At this time, the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C.
- the lysCP1 promoter region was obtained by PCR under the same conditions using the primer pairs of SEQ ID NOs: 14 and 19, and the 3'-terminal region of the lysCP1 promoter was the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template. Obtained by PCR under the same conditions using primer pairs of SEQ ID NOs: 20 and 21. Primers used for promoter substitution are as shown in Table 1, Table 3 and Table 4 above.
- Each PCR product obtained above was fusion cloned into a pDZ vector treated with XbaI. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). The resulting plasmid was named pDZ-lysCP1-2'pta-ackA.
- the plasmid pDZ-lysCP1-2'pta-ackA prepared above was treated with DAB12-b and Corynebacterium glutamicum mutant DAB12-b Tn prepared in the same manner as in Example 2-1.
- lysCP1-argA Tn lysCP1-argE was transformed to confirm that the lysCP1 promoter was introduced before the pta-ackA start codon in the chromosome.
- the Corynebacterium glutamicum mutants were named DAB12-b lysCP1-2'pta-ackA and DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-2'pta-ackA, respectively.
- Corynebacterium glutamicum mutants (KCCM11240P lysCP1-1'pta-ackA; KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA; DAB12-b lysCP1-2 'pta-ackA; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-2'pta-ackA) and four parent strains (KCCM11240P; KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE; DAB12-b; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) was respectively used in CM flat medium containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, Na
- the present inventors introduced the activities of E. coli-derived argA and E. coli-derived argE in putrescine-producing strain Corynebacterium glutamicum KCCM 11240P and enhanced the activity of putrescine which enhanced the activity of pta-ackA.
- the genus microorganism (Corynebacterium glutamicum KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE: lysCP1-1'pta-ackA) was named CC01-1145 and under the Treaty of Budapest on 21 November 2014 Center of Microorganisms (KCCM) was assigned accession number KCCM11606P.
- Example 3 derived from E. coli argA And E. coli derived argE is Introduced Putrescine Producing bacteria Introduction of E. coli-derived acs and its production of putrescine
- ATCC13032 base Putrescine Production strains Transposon Construction of Escherichia coli-derived acs introduction strain into gene
- acs E. coli-derived acetyl-CoA synthetase
- a gene fragment of about 2 kb was amplified using primer pairs of SEQ ID NOs: 24 and 25 as a template using the chromosome of E. coli W3110 strain.
- the PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 1 minute 30 seconds at 72 °C.
- This PCR result was then electrophoresed on a 0.8% agarose gel and then purified by eluting a band of the desired size.
- the lysCP1 promoter region was denatured at 95 ° C. for 30 seconds, annealed at 55 ° C. for 30 seconds, and at 72 ° C. using a primer pair of SEQ ID NOs: 13 and 14, using the chromosome of the KCCM10919P strain.
- the 30 second procedure was obtained by repeating 30 times.
- the pDZTn vector was treated with XhoI and fusion cloned each PCR product obtained above. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). The resulting plasmid was named pDZTn-lysCP1-acs.
- the plasmid pDZTn-lysCP1-acs was introduced into KCCM11240P and Corynebacterium glutamicum mutant KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE prepared in Example 1-1 by electroporation, respectively.
- the transformant was BHIS plate medium containing kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside). Colonies were formed by incubating in 37 g / l of infusion, 91 g / l of sorbitol, 2% agar). Strains into which the plasmid pDZTn-lysCP1-acs was introduced were selected by selecting blue colonies from the colonies formed therefrom.
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- Shake culture (30 °C, 8 hours)
- 10 -4 to 10 -10 were finally selected by secondary crossover by selecting white colonies appearing at a relatively low rate among the colonies formed.
- PCR was carried out using the primer pairs of SEQ ID NOs: 13 and 25 in the final selected strains to confirm that the gene encoding the acs was introduced, and the Corynebacterium glutamicum mutants were respectively identified by KCCM11240P Tn: lysCP1-acs and KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs.
- Example 3-1 the prepared pDZTn-lysCP1-acs was prepared in the same manner as in Example 3-1, using DAB12-b and Example 1-2 corynebacterium glutamicum mutant DAB12- b Tn: lysCP1-argA Tn: lysCP1-argE was transformed, respectively, it was confirmed that acs in the transposon was introduced.
- Corynebacterium glutamicum mutants selected therefrom were named DAB12-b Tn: lysCP1-acs and DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs, respectively.
- KCCM11240P Tn lysCP1-acs
- KCCM11240P Tn lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs
- DAB12-b Tn lysCP1-acs
- DAB12- b Tn lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs
- KCCM11240P KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE
- CM flat medium containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl
- Example 4 Putrescine Discharge capacity Increased Putrescine E. coli-derived argA, argE introduction, pta-ackA promoter substitution and production of putrescine
- the production of putrescine is improved by introducing argA and E. coli-derived argE derived from E. coli and enhancing the activity of coryne pta-ackA. In order to check whether the strain was produced.
- Example 1-1 pDZTn-lysCP1-argA prepared in Example 1-1 was transformed into KCCM11401P in the same manner as in Example 1-1 to confirm that argA in the transposon was introduced and selected from Corynebacterium
- the glutamicum mutant was named KCCM11401P Tn: lysCP1-argA.
- KCCM11401P Tn lysCP1-argA Tn: lysCP1-argE.
- Example 2-1 pDZ-lysCP1-1'pta-ackA prepared in Example 2-1 was transformed into KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE in the same manner as in Example 2-1, and then pta- It was confirmed that the lysCP1 promoter was introduced before the ackA start codon.
- the Corynebacterium glutamicum mutant was named KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA.
- Example 4-1 Cory prepared in Example 4-1 to confirm the effects of E. coli-derived argA and E. coli-derived argE and enhanced activity of pta-ackA on Corynebacterium glutamicum-producing strains with increased putrescine excretion capacity Putrescine production was compared in Nebacterium glutamicum mutants.
- Corynebacterium glutamicum mutants (KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE, KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA) and the parent strain (KCCM11401P) CM plate containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L, respectively) Plate) and incubated for 24 hours at 30 °C.
- 1 mM arginine glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L, respectively
- Example 5 E. coli derived from ornithine producing strains argA And E. coli derived argE Introduction and confirmation of its ornithine production capacity
- Corynebacterium glutamicum ATCC13032-based ornithine-producing strain KCCM11137P (Republic of Korea Patent No. 10-1372635) E. coli-derived argA and E. coli-derived argE gene insertion to determine whether ornithine production capacity is improved, the Example ArgA and argE were introduced into the transposon gene using the vector constructed in 1-1.
- the plasmid pDZTn-lysCP1-argA prepared in Example 1-1 was introduced into KCCM11137P by electroporation to obtain a transformant, and the transformant was kanamycin (25 ⁇ g / ml) and X-gal.
- Colonies were cultured by smearing and incubating on BHIS plate medium containing (5-bromo-4-chloro-3-indolin--D-galactoside) (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%). Formed.
- Strains into which the plasmid pDZTn-lysCP1-argA was introduced were selected by selecting blue colonies from the colonies formed therefrom.
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- Shake culture (30 °C, 8 hours)
- 10 -4 to 10 -10 were finally selected by secondary crossover by selecting white colonies appearing at a relatively low rate among the colonies formed.
- PCR was performed on the final selected strains using primer pairs of SEQ ID NOs: 12 and 13 to confirm that a gene encoding argA was introduced, and the Corynebacterium glutamicum mutant was designated as KCCM11137P Tn: lysCP1-argA. It was.
- pDZTn-lysCP1-argE prepared in Example 1-1 was transformed into KCCM11137P Tn: lysCP1-argA in the same manner to confirm that argE in the transposon was introduced.
- Corynebacterium glutamicum mutants selected therefrom were named KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE.
- Corynebacterium glutamicum mutant (KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE) and one parent strain (KCCM11137P) were each 1 mM arginine-containing CM flat medium (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L basis) and incubated for 24 hours at 30 °C .
- CM flat medium glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L basis
- Example 6 Escherichia coli derived argA And E. coli derived argE is Enhancement of pta-ackA and its Ornithine Production in Introduced Ornithine Strains
- the plasmid pDZ-lysCP1-1'pta-ackA prepared in Example 2-1 was introduced into KCCM11137P and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE by electroporation to obtain a transformant.
- the transformant was BHIS plate medium (Braine heart infusion 37 g / l) containing kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin--D-galactoside).
- Colonies were formed by smearing and culturing in sorbitol 91 g / l, agar 2%). Strains into which the plasmid pDZ-lysCP1-1'pta-ackA was introduced were selected by selecting blue colonies from the colonies formed therefrom.
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- Shake culture (30 °C, 8 hours)
- 10 -4 to 10 -10 plated and cultured in X-gal-containing solid medium to form colonies. From the colonies formed, the colonies of white color appearing at a relatively low rate were selected to select strains in which the pta-ackA promoter was finally replaced by lysCP1 by secondary crossover.
- PCR was performed using primer pairs of SEQ ID NOs: 19 and 21 for the final selected strains to confirm that the lysCP1 promoter was introduced before the pta-ackA start codon in the chromosome. In this case, the PCR reaction was repeated 30 times with 30 seconds of denaturation at 95 ° C, 30 seconds of annealing at 55 ° C, and 1 minute extension at 72 ° C.
- Corynebacterium glutamicum mutants selected therefrom were named KCCM11137P lysCP1-1'pta-ackA and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA, respectively.
- KCCM11137P Corynebacterium glutamicum mutants
- KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA
- KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE
- CM flat media containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 100 ⁇ l of 50% NaOH, 2% agar, pH 6.8, 1 L) was incubated at 30 ° C.
- KCCM11137P 7.8 KCCM11137P lysCP1-1'pta-ackA 7.7 KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE 8.9 KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA 9.4
- ornithine production was not increased when pta-ackA was enhanced in KCCM11137P, but the Corynebacterium glutamicum mutant KCCM11137P Tn: lysCP1- introduced with E. coli-derived argA and E. coli-derived argE genes simultaneously.
- pta-ackA was strengthened in argA Tn: lysCP1-argE
- ornithine production increased by 20.5% compared to KCCM11137P and 5.6% compared to KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE.
- Example 7 derived from E. coli argA And E. coli derived argE is Introduced Ornithine Producing bacteria Introduction of acs from Escherichia coli and Confirmation of Ornithine Production
- E. coli-derived acs gene in KCCM11137P (Korean Patent No. 10-1372635), an ATCC13032-based ornithine-producing strain in which E. coli-derived argA and E. coli-derived argE are introduced, an lysCP1 promoter is used. Acs was then introduced into the transposon gene.
- the plasmid pDZTn-lysCP1-acs prepared in Example 3-1 was introduced into KCCM11137P and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE, respectively, by electroporation to obtain a transformant.
- the transformants were BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g) containing kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin--D-galactoside). / l, agar 2%) to form a colony by incubation.
- Strains into which the plasmid pDZTn-lysCP1-acs was introduced were selected by selecting blue colonies from the colonies formed therefrom.
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- Shake culture (30 °C, 8 hours)
- 10 -4 to 10 -10 were finally selected by secondary crossover by selecting white colonies appearing at a relatively low rate among the colonies formed.
- PCR was carried out using the primer pairs of SEQ ID NOs: 13 and 25 for the final selected strains to confirm that the gene encoding the acs was introduced, and the Corynebacterium glutamicum mutant strains KCCM11137P Tn: lysCP1-acs and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs.
- KCCM11137P Tn lysCP1-acs
- KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs
- KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE
- KCCM11137P KCCM11137P Tn
- KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE
- CM flat medium containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 1 ⁇ l, agar 2%, pH 6.8, 1 L basis) and incubated for 24 hours at 30 °C.
- KCCM11137P 7.8 KCCM11137P Tn: lysCP1-acs 7.8 KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE 8.9 KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs 9.2
- KCCM11137P Tn lysCP1-argA Tn, which was introduced with argA and Escherichia coli-derived argE genes, simultaneously.
- KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE compared with the 3.4% increase.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
| 프라이머 | 서열 (5' -> 3') |
| PlysC-argA-F(서열번호11) | GAAAGGTGCACAAAGATGGTAAAGGAACGTAAAACCG |
| Tn-argA-RXh(서열번호12) | GCCCACTAGTCTCGAGCATGCGGCGTTGATTTTG |
| Tn-PlysC-FXh(서열번호13) | GAATGAGTTCCTCGAGCCGATGCTAGGGCGAAAA |
| PlysC-R(서열번호14) | CTTTGTGCACCTTTCGATCTACGTGCTGACAGTTAC |
| PlysC-argE-F(서열번호15) | GAAAGGTGCACAAAGATGAAAAACAAATTACCGCC |
| Tn-argE-RXh(서열번호16) | GCCCACTAGTCTCGAGGTTTGAGTCACTGTCGGTCG |
| 균주명 | 퓨트레신 (g/L) |
| KCCM 11240P | 12.2 |
| KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE | 13.4 |
| DAB12-b | 13.3 |
| DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE | 14.6 |
| 프라이머 | 서열 (5' -> 3') |
| Pro-pta-FX(서열번호 17) | CCGGGGATCCTCTAGAGGGGTTCTAAAAAATGTGGAGT |
| pta-PlysC-R(서열번호 18) | GCCGTGCTTTTCGCCCTAGCATCGGACATCGCCTTTCTAATTT |
| PlysC-F(서열번호 19) | CCGATGCTAGGGCGAAAAGCACGGC |
| PlysC-pta-ackA-F(서열번호 20) | GAAAGGTGCACAAAGATGTCTGACACACCGACCTCAGCTC |
| Pro-pta-RX(서열번호 21) | GCAGGTCGACTCTAGATTATCCGGCATTGGCTCT |
| 프라이머 | 서열 (5' -> 3') |
| Pta-ackA-R(서열번호 22) | TGCAGTTTCACCCCTTAA |
| 13869_pta-PlysC-R(서열번호 23) | GCCGTGCTTTTCGCCCTAGCATCGGACATCGCCTTTCTAGTTT |
| 균주명 | 퓨트레신 (g/L) |
| KCCM 11240P | 12.2 |
| KCCM 11240P lysCP1-1'pta-ackA | 12.3 |
| KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE | 13.4 |
| KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA | 14.1 |
| DAB12-b | 13.3 |
| DAB12-b lysCP1-2'pta-ackA | 13.4 |
| DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE | 14.6 |
| DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-2'pta-ackA | 15.2 |
| 프라이머 | 서열 (5' -> 3') |
| PlysC-acs-F(서열번호 24) | GAAAGGTGCACAAAGATGAGCCAAATTCACAAA |
| Tn-acs-RXh(서열번호 25) | GCCCACTAGTCTCGAGAAGGCGTTTACGCCGCATCC |
| 균주명 | 퓨트레신 (g/L) |
| KCCM 11240P | 12.2 |
| KCCM 11240P Tn:lysCP1-acs | 12.2 |
| KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE | 13.4 |
| KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs | 13.9 |
| DAB12-b | 13.3 |
| DAB12-b Tn:lysCP1-acs | 13.2 |
| DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE | 14.6 |
| DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs | 15.1 |
| 균주명 | 퓨트레신 (g/L) |
| KCCM11401P | 11.8 |
| KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE | 13.2 |
| KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA | 13.7 |
| 균주명 | 오르니틴 (g/L) |
| KCCM11137P | 7.8 |
| KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE | 8.9 |
| 균주명 | 오르니틴 (g/L) |
| KCCM11137P | 7.8 |
| KCCM11137P lysCP1-1'pta-ackA | 7.7 |
| KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE | 8.9 |
| KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA | 9.4 |
| 균주명 | 오르니틴 (g/L) |
| KCCM11137P | 7.8 |
| KCCM11137P Tn:lysCP1-acs | 7.8 |
| KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE | 8.9 |
| KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs | 9.2 |
Claims (17)
- 대장균 유래 N-아세틸글루타메이트 신타아제(N-acetylglutamate synthase) 및 대장균 유래 아세틸오르니틴 디아세틸라제(Acetylornithine deacetylase)의 활성이 도입된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 대장균 유래 N-아세틸글루타메이트 신타아제는 서열번호 1의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 대장균 유래 아세틸오르니틴 디아세틸라제는 서열번호 3의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 포스포트랜스아세틸라제(phosphotransacetylase) 및 아세트산 인산화효소(acetate kinase) 오페론(pta-ackA operon)의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제5항에 있어서, 상기 포스포트랜스아세틸라제 및 아세트산 인산화효소 오페론은 서열번호 5 또는 서열번호 7의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 대장균 유래 아세틸-CoA 합성효소(acetyl-CoA synthetase, acs)의 활성이 도입된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제7항에 있어서, 상기 아세틸-CoA 합성효소는 서열번호 9의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 오르니틴 디카복실라제(ornithine decarboxylase, ODC)의 활성이 도입되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 i) 오르니틴 카르바모일 트랜스퍼라아제(ArgF), ii) 글루타메이트 엑스포터 또는 iii) 오르니틴 카르바모일 트랜스퍼라아제 및 글루타메이트 엑스포터의 활성이 내재적 활성에 비해 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제(ArgJ), 아세틸 글루타메이트 키나아제(ArgB), 및 아세틸 오르니틴 아미노 트랜스퍼라아제(ArgD)로 구성되는 군으로부터 선택되는 1종 이상의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아세틸트랜스퍼라아제의 활성이 내재적 활성보다 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제12항에 있어서, 상기 아세틸트랜스퍼라아제는 서열번호 30 또는 31의 아미노산 서열로 구성되는 단백질인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 퓨트레신 엑스포터의 활성이 내재적 활성보다 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제14항에 있어서, 상기 퓨트레신 엑스포터는 서열번호 26 또는 서열번호 28의 아미노산 서열로 구성되는 단백질인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- (i) 제1항 내지 제15항 중 어느 한 항에 따른 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및(ii) 상기 배양된 미생물 또는 배지로부터 퓨트레신 또는 오르니틴을 회수하는 단계를 포함하는, 퓨트레신 또는 오르니틴의 생산방법.
- 제16항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, 퓨트레신 또는 오르니틴의 생산 방법.
Priority Applications (15)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201680042463.1A CN107922955B (zh) | 2015-07-20 | 2016-07-19 | 用于产生腐胺或鸟氨酸的微生物和使用其产生腐胺或鸟氨酸的方法 |
| CA2992970A CA2992970C (en) | 2015-07-20 | 2016-07-19 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| BR112018001231-9A BR112018001231B1 (pt) | 2015-07-20 | 2016-07-19 | Microrganismo modificado corynebacterium glutamicum que produz putrescina ou ornitina e método para produzir putrescina ou ornitina cultivando o dito microrganismo |
| MYPI2018000053A MY184142A (en) | 2015-07-20 | 2016-07-19 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| JP2018502763A JP6543758B2 (ja) | 2015-07-20 | 2016-07-19 | プトレシンまたはオルニチンの生産微生物及びそれを用いたプトレシンまたはオルニチンの生産方法 |
| RU2018104512A RU2708165C2 (ru) | 2015-07-20 | 2016-07-19 | Микроорганизмы для получения путресцина или орнитина и способ получения путресцина или орнитина с использованием указанных микроорганизмов |
| PH1/2018/500150A PH12018500150B1 (en) | 2015-07-20 | 2016-07-19 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| NZ73865816A NZ738658A (en) | 2015-07-20 | 2016-07-19 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| US15/746,300 US10640753B2 (en) | 2015-07-20 | 2016-07-19 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| AU2016297226A AU2016297226B2 (en) | 2015-07-20 | 2016-07-19 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| MX2018000337A MX386980B (es) | 2015-07-20 | 2016-07-19 | Microorganismos para la producción de putrescina u ornitina y procedimiento para la producción de putrescina u ornitina usando los mismos. |
| SG11201800254SA SG11201800254SA (en) | 2015-07-20 | 2016-07-19 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| US16/507,676 US10815464B2 (en) | 2015-07-20 | 2019-07-10 | Microorganisms for producing putrescine and process for producing putrescine using them |
| US16/805,040 US11268074B2 (en) | 2015-07-20 | 2020-02-28 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| US17/074,203 US11365400B2 (en) | 2015-07-20 | 2020-10-19 | Microorganism for producing ornithine and process for producing ornithine using them |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2015-0102624 | 2015-07-20 | ||
| KR1020150102624A KR101735935B1 (ko) | 2015-07-20 | 2015-07-20 | 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/746,300 A-371-Of-International US10640753B2 (en) | 2015-07-20 | 2016-07-19 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| US16/507,676 Division US10815464B2 (en) | 2015-07-20 | 2019-07-10 | Microorganisms for producing putrescine and process for producing putrescine using them |
| US16/805,040 Continuation US11268074B2 (en) | 2015-07-20 | 2020-02-28 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017014532A1 true WO2017014532A1 (ko) | 2017-01-26 |
Family
ID=57326155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/007841 Ceased WO2017014532A1 (ko) | 2015-07-20 | 2016-07-19 | 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 |
Country Status (16)
| Country | Link |
|---|---|
| US (4) | US10640753B2 (ko) |
| EP (1) | EP3141598B1 (ko) |
| JP (1) | JP6543758B2 (ko) |
| KR (1) | KR101735935B1 (ko) |
| CN (1) | CN107922955B (ko) |
| AU (1) | AU2016297226B2 (ko) |
| CA (1) | CA2992970C (ko) |
| CL (1) | CL2018000111A1 (ko) |
| MX (2) | MX386980B (ko) |
| MY (1) | MY184142A (ko) |
| NZ (1) | NZ738658A (ko) |
| PH (1) | PH12018500150B1 (ko) |
| RU (2) | RU2708165C2 (ko) |
| SG (1) | SG11201800254SA (ko) |
| TW (1) | TWI635176B (ko) |
| WO (1) | WO2017014532A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2817284C1 (ru) * | 2020-08-13 | 2024-04-12 | СиДжей ЧеилДжеданг Корпорейшн | Микроорганизм для продуцирования путресцина и способ получения путресцина с его применением |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101937569B1 (ko) * | 2017-06-14 | 2019-01-11 | 씨제이제일제당 (주) | 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법 |
| KR101941775B1 (ko) * | 2017-06-14 | 2019-01-24 | 씨제이제일제당 (주) | 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법 |
| KR102011394B1 (ko) * | 2017-07-19 | 2019-10-22 | 씨제이제일제당 주식회사 | 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산방법 |
| CN108642100B (zh) * | 2018-05-16 | 2020-12-29 | 江南大学 | 一种在钝齿棒杆菌中合成l-鸟氨酸的方法 |
| AU2020299358A1 (en) * | 2019-07-02 | 2021-12-23 | Codexis, Inc. | Engineered acetate kinase variant enzymes |
| KR102246288B1 (ko) * | 2020-08-13 | 2021-04-29 | 씨제이제일제당 주식회사 | 퓨트레신 생산 미생물 및 이를 이용한 퓨트레신 생산방법 |
| EP4239070A4 (en) * | 2020-10-28 | 2025-09-10 | Ajinomoto Kk | PROCESS FOR THE PRODUCTION OF L-AMINO ACID |
| KR102734703B1 (ko) * | 2021-10-15 | 2024-11-26 | 씨제이제일제당 주식회사 | L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법 |
| KR20250156921A (ko) * | 2024-04-25 | 2025-11-04 | 씨제이제일제당 (주) | 글루타메이트 계열 아미노산 생산 미생물 및 이를 이용한 글루타메이트 계열 아미노산 생산 방법 |
| KR102919411B1 (ko) * | 2024-04-25 | 2026-01-28 | 씨제이제일제당 (주) | 신규한 이중 기능성 글루타메이트 n-아세틸트랜스퍼라제/아미노산 아세틸트랜스퍼라제 변이체 및 이를 이용한 글루타메이트 계열 아미노산 생산 방법 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130082478A (ko) * | 2012-01-11 | 2013-07-19 | 씨제이제일제당 (주) | 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법 |
| KR20140115244A (ko) * | 2013-03-20 | 2014-09-30 | 씨제이제일제당 (주) | 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법 |
Family Cites Families (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE1642678A1 (de) * | 1966-02-19 | 1971-06-03 | Ajinomoto Kk | Verfahren zur Herstellung von L-Ornithin und gegebenenfalls L-Isoleucin auf biologischem Wege |
| JPS6066989A (ja) | 1983-09-24 | 1985-04-17 | Kyowa Hakko Kogyo Co Ltd | L−アルギニンの製造法 |
| JPH0755155B2 (ja) | 1986-09-10 | 1995-06-14 | 協和醗酵工業株式会社 | アミノ酸の製造法 |
| JP4682454B2 (ja) * | 2000-06-28 | 2011-05-11 | 味の素株式会社 | 新規変異型n−アセチルグルタミン酸合成酵素及びl−アルギニンの製造法 |
| EP1201758B1 (en) | 2000-10-27 | 2008-04-09 | Ajinomoto Co., Inc. | Microorganisms and method for L-arginine production by fermentation |
| CN103146593B (zh) * | 2004-01-30 | 2015-07-15 | 味之素株式会社 | 生产l-氨基酸的微生物和生产l-氨基酸的方法 |
| US8497098B2 (en) | 2004-07-15 | 2013-07-30 | Dsm Ip Assets B.V. | Biochemical synthesis of 1,4-butanediamine |
| KR100620092B1 (ko) | 2004-12-16 | 2006-09-08 | 씨제이 주식회사 | 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법 |
| DE102005020538A1 (de) * | 2005-05-03 | 2006-11-23 | Degussa Ag | Verfahren zur Herstellung von L-Aminosäuren unter Verwendung von verbesserten Stämmen der Familie Enterobacteriaceae |
| WO2007086608A1 (en) * | 2006-01-27 | 2007-08-02 | Ajinomoto Co., Inc. | Method for producing l-amino acid |
| JP5180060B2 (ja) * | 2006-02-24 | 2013-04-10 | 三菱化学株式会社 | 有機酸生産菌及び有機酸の製造法 |
| JP2009060791A (ja) * | 2006-03-30 | 2009-03-26 | Ajinomoto Co Inc | L−アミノ酸生産菌及びl−アミノ酸の製造法 |
| US8133714B2 (en) | 2007-09-27 | 2012-03-13 | Evonik Degussa Gmbh | Process for the fermentative preparation of organic chemical compounds using coryneform bacteria in which the SugR gene is present in attenuated form |
| KR100930203B1 (ko) | 2008-01-28 | 2009-12-07 | 씨제이제일제당 (주) | 개량된 프로모터 및 이를 이용한 l-라이신의 생산 방법 |
| KR101126041B1 (ko) | 2008-04-10 | 2012-03-19 | 씨제이제일제당 (주) | 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 l-라이신 생산방법 |
| BRPI0903495B1 (pt) | 2008-04-10 | 2019-01-29 | Korea Advanced Institute Of Science And Technology | microorganismos mutantes com capacidade de produzir putrescina e método para produção de putrescina utilizando os mesmos |
| JP2012223091A (ja) | 2009-08-25 | 2012-11-15 | Ajinomoto Co Inc | L−アミノ酸の製造法 |
| KR101174267B1 (ko) * | 2010-01-06 | 2012-08-14 | 씨제이제일제당 (주) | L-오르니틴 또는 l-아르기닌 생산 변이주 및 이의 제조방법 |
| RU2010101135A (ru) * | 2010-01-15 | 2011-07-20 | Закрытое акционерное общество "Научно-исследовательский институт "Аджиномото-Генетика" (ЗАО АГРИ) (RU) | Бактерия семейства enterobacteriaceae - продуцент l-аспартата или метаболитов, производных l-аспартата, и способ получения l-аспартата или метаболитов, производных l-аспартата |
| KR101381048B1 (ko) * | 2010-10-20 | 2014-04-14 | 씨제이제일제당 (주) | O-포스포세린 생산 균주 및 이로부터 생산된 o-포스포세린으로부터 l-시스테인 또는 이의 유도체의 생산방법 |
| KR101372635B1 (ko) | 2010-12-08 | 2014-03-13 | 씨제이제일제당 (주) | 오르니틴 생산능이 향상된 미생물 및 이를 이용하여 오르니틴을 생산하는 방법 |
| CN102191291B (zh) * | 2011-04-25 | 2013-05-08 | 武汉远大弘元股份有限公司 | 一种利用基因工程菌生产l-鸟氨酸盐酸盐的方法 |
| RU2550269C2 (ru) * | 2012-08-17 | 2015-05-10 | Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО "АГРИ") | СПОСОБ ПОЛУЧЕНИЯ L-АРГИНИНА С ИСПОЛЬЗОВАНИЕМ БАКТЕРИИ СЕМЕЙСТВА Enterobacteriaceae, СОДЕРЖАЩЕЙ N-АЦЕТИЛОРНИТИНДЕАЦЕТИЛАЗУ С НАРУШЕННОЙ АКТИВНОСТЬЮ |
| WO2017127567A1 (en) * | 2016-01-19 | 2017-07-27 | Genebiologics, Llc | Production of arginine-rich proteins and use as a fertilizer and germination enhancer |
| CN108642100B (zh) * | 2018-05-16 | 2020-12-29 | 江南大学 | 一种在钝齿棒杆菌中合成l-鸟氨酸的方法 |
-
2015
- 2015-07-20 KR KR1020150102624A patent/KR101735935B1/ko active Active
-
2016
- 2016-07-19 CN CN201680042463.1A patent/CN107922955B/zh active Active
- 2016-07-19 PH PH1/2018/500150A patent/PH12018500150B1/en unknown
- 2016-07-19 NZ NZ73865816A patent/NZ738658A/en unknown
- 2016-07-19 CA CA2992970A patent/CA2992970C/en active Active
- 2016-07-19 US US15/746,300 patent/US10640753B2/en active Active
- 2016-07-19 JP JP2018502763A patent/JP6543758B2/ja active Active
- 2016-07-19 MX MX2018000337A patent/MX386980B/es unknown
- 2016-07-19 EP EP16180193.1A patent/EP3141598B1/en active Active
- 2016-07-19 RU RU2018104512A patent/RU2708165C2/ru active
- 2016-07-19 MY MYPI2018000053A patent/MY184142A/en unknown
- 2016-07-19 WO PCT/KR2016/007841 patent/WO2017014532A1/ko not_active Ceased
- 2016-07-19 SG SG11201800254SA patent/SG11201800254SA/en unknown
- 2016-07-19 AU AU2016297226A patent/AU2016297226B2/en active Active
- 2016-07-19 RU RU2019126098A patent/RU2721852C1/ru active
- 2016-07-20 TW TW105122855A patent/TWI635176B/zh active
-
2018
- 2018-01-09 MX MX2021007245A patent/MX2021007245A/es unknown
- 2018-01-12 CL CL2018000111A patent/CL2018000111A1/es unknown
-
2019
- 2019-07-10 US US16/507,676 patent/US10815464B2/en active Active
-
2020
- 2020-02-28 US US16/805,040 patent/US11268074B2/en active Active
- 2020-10-19 US US17/074,203 patent/US11365400B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130082478A (ko) * | 2012-01-11 | 2013-07-19 | 씨제이제일제당 (주) | 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법 |
| KR20140115244A (ko) * | 2013-03-20 | 2014-09-30 | 씨제이제일제당 (주) | 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법 |
Non-Patent Citations (4)
| Title |
|---|
| DATABASE GenBank 9 April 2014 (2014-04-09), Database accession no. EZG54 138.1 * |
| DATABASE NCBI 26 June 2015 (2015-06-26), Database accession no. WP_003862331.1 * |
| DATABASE NCBI 28 May 2014 (2014-05-28), Database accession no. WP_000359434.1 * |
| DOU, WENFANG ET AL.: "Improvement of L-arginine Production by Overexpression of a Bifunctional Ornithine Acetyltransferase in Corynebacterium Crenatum", APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY, vol. 165, 2011, pages 845 - 855 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2817284C1 (ru) * | 2020-08-13 | 2024-04-12 | СиДжей ЧеилДжеданг Корпорейшн | Микроорганизм для продуцирования путресцина и способ получения путресцина с его применением |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017069578A1 (ko) | L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법 | |
| WO2016208854A1 (ko) | 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 | |
| WO2021049866A1 (ko) | L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법 | |
| WO2019164348A1 (ko) | 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법 | |
| WO2021150029A1 (ko) | Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 l-아미노산을 생산하는 방법 | |
| WO2021261733A1 (ko) | L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법 | |
| WO2019190192A1 (ko) | 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법 | |
| WO2014148743A1 (ko) | 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법 | |
| WO2020226341A1 (ko) | L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법 | |
| WO2021167414A1 (ko) | 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법 | |
| WO2021060696A1 (ko) | 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법 | |
| WO2022050671A1 (ko) | L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법 | |
| WO2018230978A1 (ko) | 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법 | |
| WO2019017706A2 (ko) | 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산방법 | |
| WO2022244932A1 (ko) | 신규 프로모터 및 이의 용도 | |
| WO2018230977A1 (ko) | 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법 | |
| CN107922955B (zh) | 用于产生腐胺或鸟氨酸的微生物和使用其产生腐胺或鸟氨酸的方法 | |
| WO2022124708A1 (ko) | 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법 | |
| WO2021045472A1 (ko) | 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법 | |
| WO2023054881A1 (ko) | 신규한 아세토하이드록시산 신테아제 변이체 및 이를 이용한 l-이소류신 생산방법 | |
| WO2022164118A1 (ko) | 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법 | |
| WO2023277307A1 (ko) | 고농도 l-글루탐산을 생산하기 위한 균주 및 이를 이용한 l-글루탐산 생산방법 | |
| WO2021153866A1 (ko) | 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법 | |
| WO2015163591A1 (ko) | 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법 | |
| WO2015163592A1 (ko) | 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16828036 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2018/000337 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11201800254S Country of ref document: SG |
|
| ENP | Entry into the national phase |
Ref document number: 2992970 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12018500150 Country of ref document: PH |
|
| ENP | Entry into the national phase |
Ref document number: 2018502763 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15746300 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2016297226 Country of ref document: AU Date of ref document: 20160719 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2018104512 Country of ref document: RU |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112018001231 Country of ref document: BR |
|
| 32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 07/05/2018) |
|
| ENP | Entry into the national phase |
Ref document number: 112018001231 Country of ref document: BR Kind code of ref document: A2 Effective date: 20180119 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16828036 Country of ref document: EP Kind code of ref document: A1 |
