WO2017014532A1 - 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 - Google Patents

퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 Download PDF

Info

Publication number
WO2017014532A1
WO2017014532A1 PCT/KR2016/007841 KR2016007841W WO2017014532A1 WO 2017014532 A1 WO2017014532 A1 WO 2017014532A1 KR 2016007841 W KR2016007841 W KR 2016007841W WO 2017014532 A1 WO2017014532 A1 WO 2017014532A1
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
ornithine
putrescine
lyscp1
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/007841
Other languages
English (en)
French (fr)
Inventor
박수진
양영렬
엄혜원
리홍선
이경민
이백석
이효형
정희경
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CJ CheilJedang Corp
Original Assignee
CJ CheilJedang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to NZ73865816A priority Critical patent/NZ738658A/en
Priority to AU2016297226A priority patent/AU2016297226B2/en
Priority to CA2992970A priority patent/CA2992970C/en
Priority to US15/746,300 priority patent/US10640753B2/en
Priority to MYPI2018000053A priority patent/MY184142A/en
Priority to JP2018502763A priority patent/JP6543758B2/ja
Priority to RU2018104512A priority patent/RU2708165C2/ru
Priority to PH1/2018/500150A priority patent/PH12018500150B1/en
Priority to CN201680042463.1A priority patent/CN107922955B/zh
Application filed by CJ CheilJedang Corp filed Critical CJ CheilJedang Corp
Priority to BR112018001231-9A priority patent/BR112018001231B1/pt
Priority to MX2018000337A priority patent/MX386980B/es
Priority to SG11201800254SA priority patent/SG11201800254SA/en
Publication of WO2017014532A1 publication Critical patent/WO2017014532A1/ko
Anticipated expiration legal-status Critical
Priority to US16/507,676 priority patent/US10815464B2/en
Priority to US16/805,040 priority patent/US11268074B2/en
Priority to US17/074,203 priority patent/US11365400B2/en
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1018Carboxy- and carbamoyl transferases (2.1.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1217Phosphotransferases with a carboxyl group as acceptor (2.7.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/001Amines; Imines
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/10Citrulline; Arginine; Ornithine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y201/00Transferases transferring one-carbon groups (2.1)
    • C12Y201/03Carboxy- and carbamoyltransferases (2.1.3)
    • C12Y201/03003Ornithine carbamoyltransferase (2.1.3.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01001Amino-acid N-acetyltransferase (2.3.1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01008Phosphate acetyltransferase (2.3.1.8)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01035Glutamate N-acetyltransferase (2.3.1.35)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/02Phosphotransferases with a carboxy group as acceptor (2.7.2)
    • C12Y207/02001Acetate kinase (2.7.2.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01016Acetylornithine deacetylase (3.5.1.16)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y401/00Carbon-carbon lyases (4.1)
    • C12Y401/01Carboxy-lyases (4.1.1)
    • C12Y401/01017Ornithine decarboxylase (4.1.1.17)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y602/00Ligases forming carbon-sulfur bonds (6.2)
    • C12Y602/01Acid-Thiol Ligases (6.2.1)
    • C12Y602/01001Acetate-CoA ligase (6.2.1.1)

Definitions

  • the present invention relates to a recombinant microorganism for producing putrescine or ornithine and a method for producing putrescine or ornithine using the same.
  • Biogenic amines are nitrogen compounds produced mainly by decarboxylation of amino acids, amination of aldehydes and ketones, and amino group transfer reactions. Such biogenic amines are low molecular weight and are synthesized during the metabolism of microorganisms, plants and animals, and thus are known as components commonly found in these cells.
  • putrescine is found in gram-negative bacteria and fungi and is present in high concentrations in various species, and is expected to play an important role in the metabolism of microorganisms.
  • putrescine is an important raw material for synthesizing polyamine nylon-4,6, and is mainly produced by chemical synthesis.
  • the chemical synthesis method comprises a three-step process including a catalytic oxidation step, a cyanide compound and a hydrogenation step using high pressure hydrogen. Therefore, there is a demand for a method using biomass that is more environmentally friendly and can reduce energy consumption for the production of putrescine.
  • Ornithine is a precursor widely used in plants, animals, and microorganisms, and is a precursor used for biosynthesis of arginine, proline, and polyamines. It also plays an important role in the pathway of the production of urea from amino acids or ammonia through the ornithine cycle in the metabolism of higher animals in vitro. Ornithine is used as a nutritional supplement because it is effective in reducing muscle mass and body fat, and is also used as a medicine to improve cirrhosis and liver dysfunction.
  • a method for producing ornithine a method of treating milk casein with a digestive enzyme and a method using transformed E. coli or Corynebacterium microorganisms are known (Korea Registration No. 10-1372635; T Gotoh et al., Bioprocess Biosyst.Eng., 33: 773-777, 2010).
  • microorganisms of the genus Corynebacterium are glutamic acid by N-acetyl-L-glutamic acid by argJ (bifunctional ornithine acetyltransferase / N-acetylglutamate synthase, EC 2.3.1.35).
  • argJ bifunctional ornithine acetyltransferase / N-acetylglutamate synthase, EC 2.3.1.35.
  • N-acetylglutamate synthase (EC 2.3.1.1) and argE (Acetylornithine deacetylase, EC 3.5.1.16) replace putrescine, or "linear pathways," replacing argJ in microorganisms of the genus Corynebacterium. Biosynthesize ornithine.
  • ArgJ is recycled by an acetyl group between ornithine and glutamic acid, but in Escherichia coli, ArgA converts the acetyl group of acetyl-CoA to glutamic acid.
  • ArgE decomposes N-acetyl-ornithine to produce ornithine and acetic acid.
  • pta-ackA pta, phosphotransacetylase; ackA, Acetate kinase
  • acs Alcohol-coenzyme A synthetase
  • the present inventors have continuously studied for the purpose of improving the production of ornithine and putrescine, and when the introduction of E. coli-derived argA and argE into the microorganisms of Corynebacterium, the production capacity of putrescine and ornithine is improved.
  • the present invention was completed by confirming.
  • Another object of the present invention is to provide a method for producing putrescine or ornithine using the microorganism.
  • E. coli-derived ArgA and E. coli-derived ArgE were introduced into the microorganism of the genus Corynebacterium producing putrescine or ornithine of the present invention. It was confirmed that the yield increased. Accordingly, the microorganisms of the present invention can be widely used to produce putrescine or ornithine, and can be widely used as an effective and desirable means for providing raw materials in terms of economic and environmental aspects in the production of various polymer products used as raw materials. Can be.
  • Figure 1 A is a schematic diagram showing the putrescine and ornithine biosynthetic pathway of the microorganisms of Corynebacterium (pure environment), B is a putrescine and ornithine biosynthetic pathway (linear path) of E. coli.
  • Figure 2 is a schematic diagram showing the biosynthetic pathway to improve the production capacity of putrescine and ornithine by introducing E. coli-derived argA and E. coli-derived argE in the state where the argJ of the genus Corynebacterium is expressed.
  • One aspect of the present invention is a coli having the ability to produce putrescine or ornithine, introduced with the activity of E. coli-derived N-acetylglutamate synthase and E. coli-derived acetylornithine deacetylase Provides microorganisms in the genus Nebacterium.
  • One embodiment of the present invention provides a microorganism of the genus Corynebacterium having E. coli-derived N-acetyl glutamate synthase is composed of the amino acid sequence of SEQ ID NO: 1, putrescine or ornithine.
  • Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having E. coli-derived acetylornithine deacetylase is composed of the amino acid sequence of SEQ ID NO: 3 putrescine or ornithine .
  • Corynebacterium genus microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum), Corynebacterium ammoniagenes's Ness (Corynebacterium ammoniagenes), Corynebacterium Thermo Amino's Ness (Corynebacterium thermoaminogenes), Brevibacterium Playa boom (Brevibacterium flavum) and Brevibacterium lactofermentum (Brevibacterium It provides a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine, which is selected from the group consisting of lactofermentum ).
  • the Corynebacterium spp. Further enhances the activity of phosphotransacetylase and acetate kinase operon (pta-ackA operon) compared to the intrinsic activity.
  • pta-ackA operon acetate kinase operon
  • Another embodiment of the present invention is that the phosphotransacetylase and acetic acid kinase operon consisting of the amino acid sequence of SEQ ID NO: 5 or 7, Corynebacterium having a putrescine or ornithine production capacity Provides microorganisms of the genus.
  • the microorganism of the genus Corynebacterium is additionally introduced into the activity of E. coli-derived acetyl-CoA synthetase (acetyl-CoA synthetase, acs), has the ability to produce putrescine or ornithine Provides microorganisms of the genus Corynebacterium.
  • Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having acetyl-CoA synthase is putrescine or ornithine, which is composed of the amino acid sequence of SEQ ID NO: 9.
  • Corynebacterium genus microorganisms are introduced to the activity of ornithine decarboxylase (ornithine decarboxylase, ODC), Coryne having a putrescine or ornithine production capacity Provides microorganisms of the genus Bacteria.
  • ornithine decarboxylase ornithine decarboxylase, ODC
  • Coryne having a putrescine or ornithine production capacity Provides microorganisms of the genus Bacteria.
  • Another embodiment of the present invention is a microorganism of the genus Corynebacterium additionally i) ornithine carbamoyl transferase (ArgF), ii) glutamate exporter or iii) ornithine carbamoyl transferase and It provides a microorganism of the genus Corynebacterium having a putrescine or ornithine production capacity, the activity of the glutamate exporter is weakened compared to the intrinsic activity.
  • ArgF ornithine carbamoyl transferase
  • Corynebacterium genus microorganisms are additionally acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase ( ArgB), and at least one activity selected from the group consisting of acetyl ornithine amino transferase (ArgD), a microorganism of the genus Corynebacterium, having putrescine or ornithine production, which is enhanced relative to intrinsic activity. to provide.
  • ArgC acetyl gamma glutamyl phosphate reductase
  • ArgJ acetyl glutamate synthase or ornithine acetyl transferase
  • ArgB acetyl glutamate kinase
  • Another embodiment of the present invention provides a microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine, the activity of the acetyl transferase is further weakened than the intrinsic activity do.
  • Another embodiment of the present invention provides the microorganism of the genus Corynebacterium having an ability to produce putrescine or ornithine, wherein the acetyl transferase is a protein consisting of the amino acid sequence of SEQ ID NO: 30 or 31 do.
  • Another embodiment of the present invention is a microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine, the activity of putrescine exporter is further enhanced than the intrinsic activity to provide.
  • the putrescine exporter is a protein consisting of the amino acid sequence of SEQ ID NO: 26 or SEQ ID NO: 28, a microorganism of the genus Corynebacterium having putrescine or ornithine production capacity To provide.
  • One embodiment of the present invention provides a method for producing putrescine or ornithine, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
  • One aspect of the present invention is a coli having the ability to produce putrescine or ornithine, introduced with the activity of E. coli-derived N-acetylglutamate synthase and E. coli-derived acetylornithine deacetylase For microorganisms in the genus Nebacterium.
  • N-acetylglutamate synthase refers to an enzyme that mediates the reaction of N-acetylglutamate from glutamate and acetyl-CoA, and the resulting N-acetylglutamate is ornithine. It can be used as a precursor of and arginine.
  • N-acetylglutamate synthase is, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1, or 70% or more, specifically 80% or more, more specifically 90% or more, even more Specifically, a protein having an activity of substantially N-acetylglutamate synthase as an amino acid sequence showing at least 95%, even more specifically at least 98% and most specifically at least 99% may be included without limitation.
  • the N-acetylglutamate synthase in the present invention is not limited to the origin, for example, may be derived from E. coli have.
  • the sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 1, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is also provided. It is obvious that it is included in the category.
  • the polynucleotide encoding the N-acetylglutamate synthase of the present invention has a similar activity to that of the N-acetylglutamate synthase protein, 70% or more, specifically 80% or more of the amino acid sequence of SEQ ID NO: 1 , More specifically at least 90%, even more specifically at least 95%, even more specifically at least 98%, most specifically at least 99% and may include a polynucleotide encoding a protein that exhibits homology.
  • the polynucleotide sequence of SEQ ID NO: 2 may be included.
  • cetylornithine deacetylase used in the present invention is an enzyme that mediates the reaction of acetic acid and ornithine by mediating the hydrolysis of acetylornithine.
  • Acetylornithine deacetylase in the present invention is a protein comprising the amino acid sequence of SEQ ID NO: 3, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically 95 Any amino acid sequence having at least%, even more specifically at least 98% and most specifically at least 99% homology may be included without limitation as long as the protein has an activity of substantially separating acetyl ornithine from acetylornithine.
  • acetylornithine deacetylase in the present invention is not limited to the origin, for example, may be derived from E. coli have.
  • sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 3, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is also provided. It is obvious that it is included in the category.
  • the polynucleotide encoding the acetylornithine deacetylase of the present invention is at least 70%, specifically 80% or more of the amino acid sequence of SEQ ID NO: 3 or the sequence as long as it has similar activity to the acetylornithine deacetylase protein. , More specifically at least 90%, even more specifically at least 95%, even more specifically at least 98%, most specifically at least 99% and may include a polynucleotide encoding a protein that exhibits homology.
  • the polynucleotide sequence of SEQ ID NO: 4 may be included.
  • the polynucleotide encoding the N-acetylglutamate synthase or acetylornithine deacetylase of the present invention is stringent with the polynucleotide sequence of SEQ ID NO: 2 or 4 or with a probe derived from the polynucleotide sequence.
  • conditions can be hybridized, and may be variants encoding normal functioning N-acetylglutamate synthase or acetylornithine deacetylase.
  • stringent conditions means conditions that enable specific hybridization between polynucleotides. For example, such stringent conditions are described specifically in the literature (eg, J. Sambrook et al., Homology).
  • homology means a degree of agreement with a given amino acid sequence or polynucleotide sequence and may be expressed as a percentage.
  • homologous sequences thereof having the same or similar activity as a given amino acid sequence or polynucleotide sequence are denoted as "% homology”.
  • % homology For example, using standard software that calculates parameters such as score, identity and similarity, in particular BLAST 2.0, or by hybridization experiments used under defined stringent conditions Appropriate hybridization conditions, which are defined within the scope of the art, are well known to those skilled in the art, and are well known to those skilled in the art (e.g., J.
  • the microorganism of the present invention includes both natural and mutant forms, examples of which include the genus Escherichia sp., Shigella sp., Citrobacter sp. And Salmonella. in (Salmonella sp.), Enterobacter genus (Enterobacter sp.) yeosi California in (Yersinia sp.), keurep when Ella in (Klebsiella sp.), air Winiah in (Erwinia sp.), the genus Corynebacterium (Corynebacterium sp.), Genus Brevibacterium sp., Genus Lactobacillus sp., Genus Selenomanas sp., Genus Vibrio sp., Genus Pseudomonas sp., It may be a microorganism belonging to the genus Streptomyces sp., Arcanobacterium
  • the microorganism of the present invention may be a microorganism belonging to the genus Corynebacterium, more specifically Corynebacterium glutamicum ( Corynebacterium glutamicum), Corynebacterium ammoniagenes's Ness (Corynebacterium ammoniagenes), Corynebacterium Thermo Amino's Ness (Corynebacterium thermoaminogenes), Brevibacterium Playa boom (Brevibacterium flavum) and Brevibacterium lactofermentum (Brevibacterium lactofermentum ) may be selected from the group consisting of, and more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), but is not limited thereto.
  • Corynebacterium glutamicum Corynebacterium glutamicum
  • Corynebacterium ammoniagenes'ss Corynebacterium ammoniagenes
  • microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine is a microorganism of the genus Corynebacterium, which has a production capacity of putrescine or ornithine naturally or It means a microorganism to which putrescine or ornithine is produced in a parent strain having no ornithine production capacity.
  • the microorganism to which the putrescine or ornithine producing ability is imparted or produced is not particularly limited, but the acetyl glutamate synthase converting glutamate to acetylglutamate to enhance the biosynthetic pathway from glutamate to ornithine.
  • Or ornithine acetyltransferase for converting acetylornithine to ornithine, acetylglutamate kinase (ArgB) for converting acetylglutamate to acetylglutamyl phosphate (ArgB), acetylglutamyl phosphate Acetyl gamma glutamyl phosphate reductase (ArgC) to convert to N-acetylglutamate semialdehyde, acetyl ornithine aminotransferase (ArgD to convert from acetylglutamate semialdehyde to N-acetylornithine)
  • the productivity of ornithine which is modified to increase the activity of) relative to the intrinsic activity and is used as a biosynthetic raw material of putrescine, may be improved.
  • the microorganism has an intrinsic activity of ornithine carbamoyltransfrase (ArgF) involved in arginine synthesis in ornithine, a protein involved in the release of glutamate, and / or a protein acetylating putrescine. And may be modified to weaken and / or modified to introduce the activity of ornithine decarboxylase (ODC).
  • ArgF ornithine carbamoyltransfrase
  • ODC ornithine decarboxylase
  • the term "activity introduced" of the present invention may mean that the activity of a protein that is not present or is insufficient in a microorganism is newly introduced or increased in the microorganism, and specifically, expresses a gene encoding a protein that was not present in the microorganism. Possibly including, but not limited to, inserting or delivering into a microorganism or inducing a mutation that enhances expression for a protein that is rarely or rarely expressed in the microorganism.
  • transformation refers to a polynucleotide or activity encoding a specific protein.
  • a vector containing a strong or weak promoter sequence is introduced into the host cell to allow the protein encoded by the polynucleotide to be expressed in the host cell or to induce a mutation in the chromosome of the host cell.
  • the polynucleotide also includes DNA and RNA encoding the target protein.
  • the polynucleotide may be introduced in any form as long as it can be introduced into a host cell to induce expression or mutation.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all the elements necessary for its expression.
  • the expression cassette may include a promoter, a transcription termination signal, a ribosomal binding site, and a translation termination signal, which are typically operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that the gene sequence is functionally linked with a promoter sequence for initiating and mediating the transcription of a polynucleotide encoding a particular protein of the invention.
  • the term "vector” refers to a DNA preparation containing the nucleotide sequence of the polynucleotide encoding said target protein operably linked to a suitable regulatory sequence so that it can express the target protein in a suitable host.
  • the regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. After being transformed into a suitable host cell, the vector can be replicated or function independent of the host genome and integrated into the genome itself.
  • the vector to be used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and pBR-based, pUC-based, pBluescriptII-based, etc. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • the vector usable in the present invention is not particularly limited and known expression vectors can be used. Specifically, pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector and the like can be used.
  • the bacterial chromosome insertion vector can replace the polynucleotide encoding the target protein in the chromosome with the mutated polynucleotide. Insertion of the polynucleotide into the chromosome can be made by any method known in the art, such as, but not limited to, homologous recombination. Since the vector of the present invention may be inserted into a chromosome by causing homologous recombination, the vector may further include a selection marker for confirming whether the chromosome is inserted.
  • Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a polynucleotide of interest, and to give selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers can be used. In an environment in which a selective agent is treated, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.
  • the microorganism of the genus Corynebacterium of the present invention is additionally potentin or ornithine, the activity of phosphotransacetylase and acetate kinase (pta-ackA operon) is enhanced compared to the intrinsic activity It may be a microorganism of the genus Corynebacterium having a production capacity.
  • phosphotransacetylase and acetic acid kinase operon are metabolic pathways in which acetyl-CoA generated from glucose or pyruvate is converted to acetic acid via acetyl phosphorus and its It is an operon that contains genes that reversibly mediate opposite metabolic pathways.
  • phosphotransacetylase and acetic acid kinase operon are proteins comprising the amino acid sequence of SEQ ID NO: 5 or 7, or 70% or more, specifically 80% or more, more specifically 90% or more of the sequence, More specifically, at least 95%, even more specifically at least 98%, most specifically at least 99% homology, the amino acid sequence exhibits a protein that substantially mediates the reaction of the production of acetyl-CoA from acetic acid, including without limitation Can be.
  • phosphotransacetylase and acetic acid kinase operon in this invention are not limited to the origin.
  • sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 5 or 7, the present invention also applies when some sequences have an amino acid sequence deleted, modified, substituted or added. It is obvious that it is included in the scope of the invention.
  • the polynucleotides encoding phosphotransacetylase and acetic acid kinase operon of the present invention are 70% or more, specifically 80% or more, more specifically 90% or more of the amino acid sequence of SEQ ID NO: 5 or 7, or the above sequence, More specifically, at least 95%, even more specifically at least 98%, most specifically at least 99% may comprise a polynucleotide encoding a protein, and most specifically of SEQ ID NO: 6 or Polynucleotide sequences.
  • enhancing activity of the present invention not only includes the introduction of new or increased activity of the protein itself, resulting in an effect beyond the original function, but also an increase in endogenous gene activity, endogenous gene amplification from internal or external factors, Its activity is increased by deletion of inhibitory regulatory factors of gene expression, increase in gene copy number, introduction of genes from outside, modification of expression control sequences, in particular promoter replacement or modification, and increased enzyme activity by intragenic mutations. do.
  • the copy number increase of the polynucleotide is not particularly limited, but may be performed in a form operably linked to a vector or by inserting into a chromosome in a host cell.
  • a host capable of being cloned and functioning independently of a host, in which a polynucleotide encoding an enzyme of the present invention is operably linked may be performed by introducing into a host cell, or the host is operably linked.
  • a vector capable of inserting the polynucleotide into the chromosome in the cell may be introduced into the host cell to increase the copy number of the polynucleotide in the chromosome of the host cell.
  • 2) modification of the expression control sequence to increase the expression of the polynucleotide is not particularly limited thereto, but the deletion, insertion, non-conservative or conservative substitution of the polynucleotide sequence to further enhance the activity of the expression control sequence or Combinations can be made by inducing variations in the sequence or by replacing with polynucleotide sequences having stronger activity.
  • the expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, a sequence that controls the termination of transcription and translation, and the like.
  • the heterologous promoter may be linked to the top of the polynucleotide expression unit instead of the original promoter.
  • the strong promoter include a CJ7 promoter, a lysCP1 promoter, an EF-Tu promoter, a groEL promoter, an aceA or aceB promoter, and the like.
  • the lysCP1 promoter (WO2009 / 096689) or the CJ7 promoter (Korean Patent No. 0620092 and WO2006 / 065095), which are corynebacterium-derived promoters, may be operably linked to improve the expression rate of the polynucleotide encoding the enzyme.
  • the present invention is not limited thereto.
  • 3) modification of the polynucleotide sequence on the chromosome is not particularly limited, and expression control is performed by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the polynucleotide sequence. This can be done by inducing variations in the sequence or by replacing with a polynucleotide sequence that has been improved to have stronger activity.
  • the activity of the phosphotransacetylase and acetic acid phosphatase operon is enhanced compared to the intrinsic activity of the increase in the number of copies of the operon cell, the mutation in the expression control sequence of the operon
  • a method of introducing, a method of replacing an expression control sequence of a gene on the operon with a highly active sequence, a method of replacing a gene encoding the enzyme on a chromosome with a mutated gene to increase the activity of the enzyme constituting the operon and It may be made by any one or more methods selected from the group consisting of a method for introducing a mutation in the gene on the chromosome encoding the enzyme so that the activity of the enzyme constituting the operon is enhanced.
  • the method of replacing the expression control sequence of the genes on the phosphotransacetylacetylase and acetic acid kinase operon with a highly active sequence may be used instead of the intrinsic promoters of the acetylase and acetic acid kinase operon, for example, the CJ7 promoter, the lysCP1 promoter. , EF-Tu promoter, groEL promoter, aceA or aceB promoter can be replaced, but is not limited thereto.
  • intrinsic activity refers to an active state of an enzyme that is intact in a state in which an original microorganism is not modified
  • "enhanced” compared to an intrinsic activity means that a gene exhibiting activity is introduced or the gene Increase in the number of copies, deletion of the inhibitory regulatory factors of gene expression or alteration of expression control sequences, e.g. the use of microorganisms prior to manipulation, such as the use of an improved promoter. It means a state of increased activity.
  • the microorganism of the genus Corynebacterium of the present invention may be a microorganism of the genus Corynebacterium having an activity of putrescine or ornithine, to which the activity of E. coli-derived acetyl-CoA synthetase (acs) is introduced. have.
  • Acetyl-CoA synthetase (acs) in the present invention is an enzyme that mediates the reaction of the production of acetyl-CoA from ATP, acetic acid and CoA.
  • Acetyl-CoA synthetase in the present invention is a protein comprising the amino acid sequence of SEQ ID NO: 9, or 70% or more, specifically 80% or more, more specifically 90% or more, 95% or more with the sequence As described above, even more specifically, any protein having an activity that substantially mediates acetyl-CoA synthesis as an amino acid sequence having at least 98% and most specifically at least 99% homology may be included without limitation.
  • acetyl-CoA synthase in the present invention is not limited to the origin, for example, may be derived from E. coli .
  • sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 9, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is also provided. It is obvious that it is included in the category.
  • the polynucleotide encoding the acetyl-CoA synthetase of the present invention is at least 70%, specifically at least 80%, more specifically at least 90%, even more specifically at 95% with the amino acid sequence of SEQ ID NO: 9 or the sequence As described above, more specifically, it may include a polynucleotide encoding a protein exhibiting homology of 98% or more, most specifically 99% or more, and most specifically, may include the polynucleotide sequence of SEQ ID NO: 10.
  • the microorganism of the genus Corynebacterium of the present invention may be a microorganism of the genus Corynebacterium having an activity of putrescine or ornithine, in which the activity of ornithine decarboxylase (ODC) is introduced.
  • ODC ornithine decarboxylase
  • ornithine decarboxylase means an enzyme that produces putrescine by mediating the decarboxylation of ornithine.
  • the microorganism of the genus Corynebacterium does not have the putrescine biosynthesis enzyme, but when ornithine decarboxylase (ODC) is introduced from the outside, putrescine is synthesized while putrescine is released into the cell.
  • ODC ornithine decarboxylase
  • Ornithine decarboxylase that can be introduced from the outside can be utilized in the present invention irrespective of the microorganism, so long as it has the above activity, specifically, E. coli derived can be introduced.
  • the microorganisms of the genus Corynebacterium additionally have the intrinsic activity of i) ornithine carbamoyl transferase (ArgF), ii) glutamate exporter or iii) ornithine carbamoyl transferase and glutamate exporter. It may be a microorganism of the genus Corynebacterium having weakened, compared to putrescine or ornithine production capacity.
  • the glutamate exporter in Corynebacterium may be NCgl1221.
  • the microorganisms of the genus Corynebacterium further include acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase (ArgB), and acetyl ornithine.
  • the at least one activity selected from the group consisting of tin amino transferases (ArgD) may be microorganisms of the genus Corynebacterium having potrecin or ornithine production, enhanced relative to intrinsic activity.
  • the microorganism of the genus Corynebacterium may be a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine, in particular, the activity of acetyltransferase, specifically, the activity of NCgl1469 is weaker than the intrinsic activity. have.
  • Microorganism of the present invention is a microorganism of the genus Corynebacterium, which has putrescine or ornithine production ability, in which the activity of putrescine exporter, specifically NCgl2522, is enhanced than the intrinsic activity. Can be.
  • active weakening includes not only the activity of the protein itself is reduced or inactivated, resulting in sub-functional effects, but also the reduction of intrinsic gene activity, activation of inhibitory regulatory factors of the gene expression, genes Its activity is impaired by decreased copy number, alteration of expression control sequences, in particular promoter replacement or modification, and inactivation or reduction of enzyme activity by intragenic mutations.
  • active weakening in the present invention is, for example,
  • a method of deleting part or all of a polynucleotide encoding a protein may include a polynucleotide or a marker gene in which a polynucleotide encoding an intrinsic target protein in a chromosome through a bacterial chromosome insertion vector is deleted from a polynucleotide sequence.
  • a marker gene in which a polynucleotide encoding an intrinsic target protein in a chromosome through a bacterial chromosome insertion vector is deleted from a polynucleotide sequence.
  • the method of modifying the expression control sequence is carried out by inducing a mutation on the expression control sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof to further weaken the activity of the expression control sequence, or By replacing with a polynucleotide sequence with weaker activity.
  • the expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence that controls the termination of transcription and translation.
  • a method of modifying a polynucleotide sequence on a chromosome is carried out by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further weaken the activity of the enzyme, or weaker. By replacing with a polynucleotide sequence that has been improved to have activity.
  • the method of deleting a regulator that inhibits the expression of the polynucleotide of the enzyme may be performed by replacing the polynucleotide of the expression inhibitory factor with a polynucleotide or a marker gene that is missing some polynucleotide sequence.
  • the term "some" differs depending on the kind of polynucleotide, but is specifically 1 to 300, specifically 1 to 100, and more specifically 1 to 50.
  • the acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase (ArgB), acetyl ornithine aminotransferase (ArgD), ornithine Carbamoyl transferase (ArgF), proteins involved in the release of glutamate and ornithine decarboxylase (ODC) are not particularly limited, but are specifically SEQ ID NOs: 32, 33, 34, 35, Amino acid sequence 36, 37 or 38 or an amino acid sequence having at least 70%, more specifically at least 80%, more specifically at least 90% homology thereof.
  • the protein for acetylating putrescine is not particularly limited, but specifically, the amino acid sequence of SEQ ID NO: 30 or 31 or 70% or more thereof, more specifically 80% or more, more specifically 90% or more homology It may include an amino acid sequence having a.
  • putrescine exporter in the present invention may include an amino acid sequence of SEQ ID NO: 26 or 28 or an amino acid sequence having a homology of 70% or more, more specifically 80% or more, more specifically 90% or more. .
  • acetyl gamma glutamyl phosphate reductase (ArgC), acetylglutamate synthase or ornithine acetyltransferase (ArgJ), acetylglutamate kinase (ArgB), acetylornithine aminotransferase (ArgD), ornithine Enhancing the activity of the decarboxylase (ODC) and putrescine exporters may, for example, increase the number of copies of the polynucleotide encoding the protein, modify the expression control sequence to increase the expression of the polynucleotide, the enzyme Alteration of the polynucleotide sequence on a chromosome to enhance its activity, deletion of a regulator that inhibits expression of the polynucleotide of the enzyme, and combinations thereof.
  • the active weakening of proteins involved in the release of ornithine carbamoyl transferase (ArgF) and glutamate, and proteins that acetylate putrescine may result in the deletion of some or all of the polynucleotides encoding the protein, the poly Modification of expression control sequences to reduce expression of nucleotides, modification of the polynucleotide sequence on a chromosome to attenuate the activity of the protein, and combinations thereof.
  • the step of culturing the microorganisms in the medium is not particularly limited thereto, and may be performed by a known batch culture method, continuous culture method, fed-batch culture method, or the like.
  • the culture conditions are not particularly limited, but using a basic compound (eg sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg phosphoric acid or sulfuric acid) to an appropriate pH (eg pH 5 to 9, specifically PH 6 to 8, most specifically pH 6.8) can be adjusted, the aerobic conditions can be maintained by introducing an oxygen or oxygen-containing gas mixture into the culture, the culture temperature is 20 to 45 °C, specifically 25 It can be maintained at 40 to 40 °C, it is preferred to incubate for about 10 to 160 hours. Putrescine or ornithine produced by the culture may be secreted into the medium or remain in the cells.
  • a basic compound eg sodium hydroxide, potassium hydroxide or ammonia
  • an acidic compound eg phosphoric acid or sulfuric acid
  • the carbon sources of the culture medium used are sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), fats and oils (e.g. soybean oil, sunflower seeds). Oils, peanut oils and coconut oils), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (e.g. glycerol and ethanol) and organic acids (e.g. acetic acid) may be used individually or in combination. This is not restrictive.
  • the nitrogen source of the culture medium used may include nitrogen-containing organic compounds (e.g.
  • Ammonium, ammonium phosphate, ammonium carbonate and ammonium nitrate) and the like can be used individually or in combination, but is not limited thereto.
  • potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, etc. may be used individually or in combination, but is not limited thereto.
  • the culture medium used may further include, but is not limited to, essential growth-promoting substances such as other metal salts (eg magnesium sulfate or iron sulfate), amino acids and vitamins.
  • the method for recovering putrescine or ornithine produced in the culturing step of the present invention may be carried out using a suitable method known in the art according to a culture method, for example, a batch, continuous or fed-batch culture method. Amino acids can be collected.
  • Example 1 E. coli derived argA And E. coli derived of argE Putrescine Introduction into Production Strains and Confirmation of Putrescine Production Capacity
  • argA and argE were introduced into the transposon gene of the strain.
  • PDZTn (WO 2009/125992) was used as a transformation vector that enables the introduction of genes in the chromosome by using the transposon gene region of a microorganism of Corynebacterium, and the promoter was a lysCP1 promoter (International Patent Publication WO 2009 / 096689, SEQ ID NO: 39).
  • a gene fragment of about 1.6 kb was amplified using a primer pair of SEQ ID NOs: 11 and 12 as a template using the chromosome of E. coli W3110 strain.
  • the PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 1 minute 30 seconds at 72 °C.
  • This PCR result was then electrophoresed on a 0.8% agarose gel and then purified by eluting a band of the desired size.
  • the pDZTn vector was treated with XhoI and fusion cloned each PCR product obtained above. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). The resulting plasmid was named pDZTn-lysCP1-argA.
  • the PCR product was obtained by amplifying a gene fragment of about 1.4 kb by using a primer pair of SEQ ID NOs: 15 and 16 as a template using the chromosome of E. coli W3110 strain as described above, and the lysCP1 promoter. Region and fusion cloning.
  • the resulting plasmid was named pDZTn-lysCP1-argE.
  • the plasmid pDZTn-lysCP1-argA was introduced into KCCM11240P (Korean Patent Publication No. 10-2013-0082478) by electroporation to obtain a transformant, and the transformant was kanamycin (25 ⁇ g). / Ml) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) in BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%) Colonies were formed by smearing and incubating. Transgenic strains into which the plasmid pDZTn-lysCP1-argA was introduced were selected by selecting blue colonies from the colonies formed therefrom.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • Shake culture (30 °C, 8 hours)
  • 10 -4 to 10 -10 were finally selected by secondary crossover by selecting white colonies appearing at a relatively low rate among the colonies formed.
  • PCR was performed on the final selected strains using primer pairs of SEQ ID NOs: 12 and 13 to confirm that the gene encoding argA was introduced, and the Corynebacterium glutamicum mutant was designated as KCCM11240P Tn: lysCP1-argA. It was.
  • pDZTn-lysCP1-argE prepared above was transformed to KCCM11240P Tn: lysCP1-argA in the same manner as described above, and SEQ ID NOs. 13 and 16 were used for the final selected strains. PCR was performed using the primer pair to confirm that argE in the transposon was introduced.
  • Corynebacterium glutamicum mutants selected therefrom were named KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE.
  • DAB12-a ⁇ NCgl1469 (Korean Patent Publication No. 10-2013-0082478), which is a putrescine-producing strain based on Corynebacterium glutamicum ATCC13869, was named DAB12-b, and argA derived from E. coli and argE derived from E. coli In order to confirm whether or not involved in improving putrescine production capacity, argA and argE were introduced into the transposon gene.
  • pDZTn-lysCP1-argA prepared above was transformed into Corynebacterium glutamicum DAB12-b in the same manner as in Example 1-1, and it was confirmed that argA was introduced into the transposon.
  • Corynebacterium glutamicum mutants selected from which argA was introduced were named DAB12-b Tn: lysCP1-argA.
  • the two Corynebacterium glutamicum mutants prepared in Examples 1-1 and 1-2 (KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) and two parent strains (KCCM11240P; DAB12-b) were each prepared with 1 mM arginine-containing CM flat media (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea) 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, based on 1 L) and incubated for 24 hours at 30 °C.
  • Example 2 E. coli derived argA And E. coli derived argE is Introduced Putrescine Enhancement of pta-ackA and Production of Putrescine in Production Strains
  • a promoter of the pta-ackA operon in the chromosome was introduced with a promoter that is more active than the intrinsic promoter, specifically the lysCP1 promoter (International Patent Publication WO 2009/096689) before the start codon.
  • a homologous recombination fragment comprising a lysCP1 promoter, wherein both ends of the promoter had the original sequence of pta-ackA on the chromosome.
  • the 5'-terminal portion of the lysCP1 promoter was obtained by performing PCR using primer pairs of SEQ ID NOs: 17 and 18 as a template using genomic DNA of Corynebacterium glutamicum ATCC13032. At this time, the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C.
  • the lysCP1 promoter region was obtained by PCR under the same conditions using the primer pairs of SEQ ID NOs: 14 and 19, and the 3'-terminal region of the lysCP1 promoter was the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template. Obtained by PCR under the same conditions using primer pairs of SEQ ID NOs: 20 and 21. Primers used to obtain the promoter are as shown in Table 1 and Table 3 below.
  • Each PCR product obtained above was fusion cloned into a pDZ vector treated with XbaI. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). The resulting plasmid was named pDZ-lysCP1-1'pta-ackA.
  • the plasmid pDZ-lysCP1-1'pta-ackA prepared above was subjected to electroporation to KCCM11240P and Corynebacterium glutamicum mutant KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE, respectively, prepared in Example 1-1. electroporation) to obtain transformants, which were transformed into BHIS plates containing kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside).
  • Colonies were formed by plating and incubating in medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%). Strains into which the plasmid pDZ-lysCP1-1'pta-ackA was introduced were selected by selecting blue colonies from the colonies formed therefrom.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • Shake culture (30 °C, 8 hours)
  • 10 -4 to 10 -10 plated and cultured in X-gal-containing solid medium to form colonies. From the colonies formed, the colonies of white color appearing at a relatively low rate were selected to select strains in which the pta-ackA promoter was finally replaced by lysCP1 by secondary crossover.
  • PCR was performed using primer pairs of SEQ ID NOs: 19 and 21 for the final selected strains to confirm that the lysCP1 promoter was introduced before the pta-ackA start codon in the chromosome. In this case, the PCR reaction was repeated 30 times with 30 seconds of denaturation at 95 ° C, 30 seconds of annealing at 55 ° C, and 1 minute extension at 72 ° C.
  • Corynebacterium glutamicum mutants selected therefrom were named KCCM11240P lysCP1-1'pta-ackA and KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA, respectively.
  • ATCC13869 base Putrescine production Corynebacterium Pta- in strains ackA Preparation of promoter substituted strains
  • DNA was used as a template and PCR was performed using primer pairs of SEQ ID NOs: 17 and 22 (Table 3, Table 4). At this time, the PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 3 minutes at 72 °C.
  • genes encoding pta-ackA derived from Corynebacterium glutamicum ATCC13869 include the polynucleotide sequence set forth in SEQ ID NO: 8.
  • the protein encoded therefrom was confirmed to include the amino acid sequence set forth in SEQ ID NO: 7.
  • a homologous recombination fragment comprising a lysCP1 promoter, the terminal end of which had the original sequence of pta-ackA on the chromosome.
  • the 5'-terminal portion of the lysCP1 promoter was obtained by PCR using primer pairs of SEQ ID NOs: 17 and 23 as a template using genomic DNA of Corynebacterium glutamicum ATCC13869. At this time, the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C.
  • the lysCP1 promoter region was obtained by PCR under the same conditions using the primer pairs of SEQ ID NOs: 14 and 19, and the 3'-terminal region of the lysCP1 promoter was the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template. Obtained by PCR under the same conditions using primer pairs of SEQ ID NOs: 20 and 21. Primers used for promoter substitution are as shown in Table 1, Table 3 and Table 4 above.
  • Each PCR product obtained above was fusion cloned into a pDZ vector treated with XbaI. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). The resulting plasmid was named pDZ-lysCP1-2'pta-ackA.
  • the plasmid pDZ-lysCP1-2'pta-ackA prepared above was treated with DAB12-b and Corynebacterium glutamicum mutant DAB12-b Tn prepared in the same manner as in Example 2-1.
  • lysCP1-argA Tn lysCP1-argE was transformed to confirm that the lysCP1 promoter was introduced before the pta-ackA start codon in the chromosome.
  • the Corynebacterium glutamicum mutants were named DAB12-b lysCP1-2'pta-ackA and DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-2'pta-ackA, respectively.
  • Corynebacterium glutamicum mutants (KCCM11240P lysCP1-1'pta-ackA; KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA; DAB12-b lysCP1-2 'pta-ackA; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-2'pta-ackA) and four parent strains (KCCM11240P; KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE; DAB12-b; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) was respectively used in CM flat medium containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, Na
  • the present inventors introduced the activities of E. coli-derived argA and E. coli-derived argE in putrescine-producing strain Corynebacterium glutamicum KCCM 11240P and enhanced the activity of putrescine which enhanced the activity of pta-ackA.
  • the genus microorganism (Corynebacterium glutamicum KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE: lysCP1-1'pta-ackA) was named CC01-1145 and under the Treaty of Budapest on 21 November 2014 Center of Microorganisms (KCCM) was assigned accession number KCCM11606P.
  • Example 3 derived from E. coli argA And E. coli derived argE is Introduced Putrescine Producing bacteria Introduction of E. coli-derived acs and its production of putrescine
  • ATCC13032 base Putrescine Production strains Transposon Construction of Escherichia coli-derived acs introduction strain into gene
  • acs E. coli-derived acetyl-CoA synthetase
  • a gene fragment of about 2 kb was amplified using primer pairs of SEQ ID NOs: 24 and 25 as a template using the chromosome of E. coli W3110 strain.
  • the PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 1 minute 30 seconds at 72 °C.
  • This PCR result was then electrophoresed on a 0.8% agarose gel and then purified by eluting a band of the desired size.
  • the lysCP1 promoter region was denatured at 95 ° C. for 30 seconds, annealed at 55 ° C. for 30 seconds, and at 72 ° C. using a primer pair of SEQ ID NOs: 13 and 14, using the chromosome of the KCCM10919P strain.
  • the 30 second procedure was obtained by repeating 30 times.
  • the pDZTn vector was treated with XhoI and fusion cloned each PCR product obtained above. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). The resulting plasmid was named pDZTn-lysCP1-acs.
  • the plasmid pDZTn-lysCP1-acs was introduced into KCCM11240P and Corynebacterium glutamicum mutant KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE prepared in Example 1-1 by electroporation, respectively.
  • the transformant was BHIS plate medium containing kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside). Colonies were formed by incubating in 37 g / l of infusion, 91 g / l of sorbitol, 2% agar). Strains into which the plasmid pDZTn-lysCP1-acs was introduced were selected by selecting blue colonies from the colonies formed therefrom.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • Shake culture (30 °C, 8 hours)
  • 10 -4 to 10 -10 were finally selected by secondary crossover by selecting white colonies appearing at a relatively low rate among the colonies formed.
  • PCR was carried out using the primer pairs of SEQ ID NOs: 13 and 25 in the final selected strains to confirm that the gene encoding the acs was introduced, and the Corynebacterium glutamicum mutants were respectively identified by KCCM11240P Tn: lysCP1-acs and KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs.
  • Example 3-1 the prepared pDZTn-lysCP1-acs was prepared in the same manner as in Example 3-1, using DAB12-b and Example 1-2 corynebacterium glutamicum mutant DAB12- b Tn: lysCP1-argA Tn: lysCP1-argE was transformed, respectively, it was confirmed that acs in the transposon was introduced.
  • Corynebacterium glutamicum mutants selected therefrom were named DAB12-b Tn: lysCP1-acs and DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs, respectively.
  • KCCM11240P Tn lysCP1-acs
  • KCCM11240P Tn lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs
  • DAB12-b Tn lysCP1-acs
  • DAB12- b Tn lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs
  • KCCM11240P KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE
  • CM flat medium containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl
  • Example 4 Putrescine Discharge capacity Increased Putrescine E. coli-derived argA, argE introduction, pta-ackA promoter substitution and production of putrescine
  • the production of putrescine is improved by introducing argA and E. coli-derived argE derived from E. coli and enhancing the activity of coryne pta-ackA. In order to check whether the strain was produced.
  • Example 1-1 pDZTn-lysCP1-argA prepared in Example 1-1 was transformed into KCCM11401P in the same manner as in Example 1-1 to confirm that argA in the transposon was introduced and selected from Corynebacterium
  • the glutamicum mutant was named KCCM11401P Tn: lysCP1-argA.
  • KCCM11401P Tn lysCP1-argA Tn: lysCP1-argE.
  • Example 2-1 pDZ-lysCP1-1'pta-ackA prepared in Example 2-1 was transformed into KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE in the same manner as in Example 2-1, and then pta- It was confirmed that the lysCP1 promoter was introduced before the ackA start codon.
  • the Corynebacterium glutamicum mutant was named KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA.
  • Example 4-1 Cory prepared in Example 4-1 to confirm the effects of E. coli-derived argA and E. coli-derived argE and enhanced activity of pta-ackA on Corynebacterium glutamicum-producing strains with increased putrescine excretion capacity Putrescine production was compared in Nebacterium glutamicum mutants.
  • Corynebacterium glutamicum mutants (KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE, KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA) and the parent strain (KCCM11401P) CM plate containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L, respectively) Plate) and incubated for 24 hours at 30 °C.
  • 1 mM arginine glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L, respectively
  • Example 5 E. coli derived from ornithine producing strains argA And E. coli derived argE Introduction and confirmation of its ornithine production capacity
  • Corynebacterium glutamicum ATCC13032-based ornithine-producing strain KCCM11137P (Republic of Korea Patent No. 10-1372635) E. coli-derived argA and E. coli-derived argE gene insertion to determine whether ornithine production capacity is improved, the Example ArgA and argE were introduced into the transposon gene using the vector constructed in 1-1.
  • the plasmid pDZTn-lysCP1-argA prepared in Example 1-1 was introduced into KCCM11137P by electroporation to obtain a transformant, and the transformant was kanamycin (25 ⁇ g / ml) and X-gal.
  • Colonies were cultured by smearing and incubating on BHIS plate medium containing (5-bromo-4-chloro-3-indolin--D-galactoside) (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%). Formed.
  • Strains into which the plasmid pDZTn-lysCP1-argA was introduced were selected by selecting blue colonies from the colonies formed therefrom.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • Shake culture (30 °C, 8 hours)
  • 10 -4 to 10 -10 were finally selected by secondary crossover by selecting white colonies appearing at a relatively low rate among the colonies formed.
  • PCR was performed on the final selected strains using primer pairs of SEQ ID NOs: 12 and 13 to confirm that a gene encoding argA was introduced, and the Corynebacterium glutamicum mutant was designated as KCCM11137P Tn: lysCP1-argA. It was.
  • pDZTn-lysCP1-argE prepared in Example 1-1 was transformed into KCCM11137P Tn: lysCP1-argA in the same manner to confirm that argE in the transposon was introduced.
  • Corynebacterium glutamicum mutants selected therefrom were named KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE.
  • Corynebacterium glutamicum mutant (KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE) and one parent strain (KCCM11137P) were each 1 mM arginine-containing CM flat medium (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L basis) and incubated for 24 hours at 30 °C .
  • CM flat medium glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L basis
  • Example 6 Escherichia coli derived argA And E. coli derived argE is Enhancement of pta-ackA and its Ornithine Production in Introduced Ornithine Strains
  • the plasmid pDZ-lysCP1-1'pta-ackA prepared in Example 2-1 was introduced into KCCM11137P and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE by electroporation to obtain a transformant.
  • the transformant was BHIS plate medium (Braine heart infusion 37 g / l) containing kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin--D-galactoside).
  • Colonies were formed by smearing and culturing in sorbitol 91 g / l, agar 2%). Strains into which the plasmid pDZ-lysCP1-1'pta-ackA was introduced were selected by selecting blue colonies from the colonies formed therefrom.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • Shake culture (30 °C, 8 hours)
  • 10 -4 to 10 -10 plated and cultured in X-gal-containing solid medium to form colonies. From the colonies formed, the colonies of white color appearing at a relatively low rate were selected to select strains in which the pta-ackA promoter was finally replaced by lysCP1 by secondary crossover.
  • PCR was performed using primer pairs of SEQ ID NOs: 19 and 21 for the final selected strains to confirm that the lysCP1 promoter was introduced before the pta-ackA start codon in the chromosome. In this case, the PCR reaction was repeated 30 times with 30 seconds of denaturation at 95 ° C, 30 seconds of annealing at 55 ° C, and 1 minute extension at 72 ° C.
  • Corynebacterium glutamicum mutants selected therefrom were named KCCM11137P lysCP1-1'pta-ackA and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA, respectively.
  • KCCM11137P Corynebacterium glutamicum mutants
  • KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA
  • KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE
  • CM flat media containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 100 ⁇ l of 50% NaOH, 2% agar, pH 6.8, 1 L) was incubated at 30 ° C.
  • KCCM11137P 7.8 KCCM11137P lysCP1-1'pta-ackA 7.7 KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE 8.9 KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA 9.4
  • ornithine production was not increased when pta-ackA was enhanced in KCCM11137P, but the Corynebacterium glutamicum mutant KCCM11137P Tn: lysCP1- introduced with E. coli-derived argA and E. coli-derived argE genes simultaneously.
  • pta-ackA was strengthened in argA Tn: lysCP1-argE
  • ornithine production increased by 20.5% compared to KCCM11137P and 5.6% compared to KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE.
  • Example 7 derived from E. coli argA And E. coli derived argE is Introduced Ornithine Producing bacteria Introduction of acs from Escherichia coli and Confirmation of Ornithine Production
  • E. coli-derived acs gene in KCCM11137P (Korean Patent No. 10-1372635), an ATCC13032-based ornithine-producing strain in which E. coli-derived argA and E. coli-derived argE are introduced, an lysCP1 promoter is used. Acs was then introduced into the transposon gene.
  • the plasmid pDZTn-lysCP1-acs prepared in Example 3-1 was introduced into KCCM11137P and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE, respectively, by electroporation to obtain a transformant.
  • the transformants were BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g) containing kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin--D-galactoside). / l, agar 2%) to form a colony by incubation.
  • Strains into which the plasmid pDZTn-lysCP1-acs was introduced were selected by selecting blue colonies from the colonies formed therefrom.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • Shake culture (30 °C, 8 hours)
  • 10 -4 to 10 -10 were finally selected by secondary crossover by selecting white colonies appearing at a relatively low rate among the colonies formed.
  • PCR was carried out using the primer pairs of SEQ ID NOs: 13 and 25 for the final selected strains to confirm that the gene encoding the acs was introduced, and the Corynebacterium glutamicum mutant strains KCCM11137P Tn: lysCP1-acs and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs.
  • KCCM11137P Tn lysCP1-acs
  • KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs
  • KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE
  • KCCM11137P KCCM11137P Tn
  • KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE
  • CM flat medium containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 1 ⁇ l, agar 2%, pH 6.8, 1 L basis) and incubated for 24 hours at 30 °C.
  • KCCM11137P 7.8 KCCM11137P Tn: lysCP1-acs 7.8 KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE 8.9 KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs 9.2
  • KCCM11137P Tn lysCP1-argA Tn, which was introduced with argA and Escherichia coli-derived argE genes, simultaneously.
  • KCCM11137P Tn lysCP1-argA Tn: lysCP1-argE compared with the 3.4% increase.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 퓨트레신 또는 오르니틴을 생산하기 위한 재조합 미생물 및 이를 이용하여 퓨트레신 또는 오르니틴을 생산하는 방법에 관한 것이다.

Description

퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
본 발명은 퓨트레신 또는 오르니틴을 생산하기 위한 재조합 미생물 및 이를 이용하여 퓨트레신 또는 오르니틴을 생산하는 방법에 관한 것이다.
바이오제닉 아민(biogenic amines, BAs)은 아미노산의 탈탄산 작용, 알데하이드와 케톤의 아미노화와 아미노기 전이 반응에 의해 주로 생성되는 질소 화합물이다. 이러한 바이오제닉 아민은 저분자량이며 미생물, 식물과 동물의 대사 과정에서 합성되므로 이들 세포에서 흔히 발견되는 구성요소로 알려져 있다.
이 중 퓨트레신은 그람 음성 박테리아나 곰팡이에서 발견되며 다양한 종에서 고농도로 존재하기 때문에 미생물의 대사에 중요한 역할을 수행할 것으로 예측되고 있다. 일반적으로, 퓨트레신은 폴리아민나일론-4,6을 합성하는 중요한 원료물질로서, 주로 화학 합성법으로 생산된다. 상기 화학 합성법은 촉매적 산화반응 단계, 시아나이드(cyanide) 화합물을 사용하는 단계와 고압 수소를 사용하는 수소화 반응 단계 등을 포함하는 3 단계 공정으로 이루어진다. 따라서, 퓨트레신의 생산을 위해 보다 환경 친화적이고 에너지 소비를 절감할 수 있는 바이오매스를 활용한 방법이 요구되고 있는 실정이다.
이러한 배경 하에, 미생물을 이용해 퓨트레신을 생산하는 방법으로는 대장균과 코리네박테리움 속 미생물을 형질전환하여 퓨트레신을 고농도로 생산하는 다양한 방법이 공개되었다 (국제특허공개 WO06/005603; 국제특허공개 WO09/125924; Qian ZD et al., Biotechnol. Bioeng. 104(4): 651-662, 2009; Schneider et al., Appl. Microbiol. Biotechnol. 88(4): 859-868, 2010; Schneider et al., Appl. Microbiol. Biotechnol. 95: 169-178., 2012).
한편, 오르니틴(ornithine)은 식물, 동물, 미생물에서 널리 발견되는 물질로 아르기닌, 프롤린 및 폴리아민의 생합성에 사용되는 전구체이다. 또한, 고등동물의 생체 내 대사에서 오르니틴 회로를 통해 아미노산 또는 암모니아로부터 요소를 생성하여 체외로 배출하는 경로에서 중요한 역할을 한다. 오르니틴은 근육 생성과 체지방 감소에 효과가 있기 때문에, 영양보충제로 사용되고 있고, 간경화와 간기능 장애를 개선하는 의약품으로도 이용되고 있다. 이러한 오르니틴을 생산하는 방법으로는 우유 카제인(casein)을 소화 효소로 처리하는 방법 및 형질전환된 대장균 또는 코리네박테리움 속 미생물을 이용한 방법이 알려져 있다 (대한민국 등록번호 제10-1372635호; T. Gotoh et al., Bioprocess Biosyst. Eng., 33:773-777, 2010).
대장균과 코리네박테리움 속 미생물에서 퓨트레신 또는 오르니틴을 생합성하는 경로는 유사하지만 다른 점이 있다. 먼저, 코리네박테리움 속 미생물은 argJ((bifunctional ornithine acetyltransferase/N-acetylglutamate synthase, EC 2.3.1.35)에 의해 글루탐산(glutamic acid)이 N-아세틸-L-글루탐산(N-acetyl-L-glutamic acid)으로 N-아세틸-L-오르니틴(N-acetyl-L-ornithine)이 L-오르니틴(L-ornithine)으로 전환이 되는 "순환경로(cyclic pathway)"를 가지고 있다. 그에 비하여, 대장균은 argA(N-acetylglutamate synthase, EC 2.3.1.1)와 argE(Acetylornithine deacetylase, EC 3.5.1.16)가 코리네박테리움 속 미생물의 argJ를 대신하는 "선형경로(linear pathway)"를 이용하여 퓨트레신 또는 오르니틴을 생합성 한다.
코리네박테리움 속 미생물에서 ArgJ는 오르니틴(ornithine)과 글루탐산(glutamic acid) 사이에서 아세틸 그룹이 recycle하지만, 대장균에선 ArgA가 아세틸-CoA(Acetyl-CoA)의 아세틸기(acetyl)를 글루탐산(glutamate)에 붙여주어 N-아세틸-글루탐산(N-acetyl-glutamate)을 생성하고 ArgE는 N-아세틸-오르니틴(N-acetyl-ornithine)을 분해하여 오르니틴(ornithine)과 아세트산(acetate)을 생성하는 것으로 알려져 있다 (Schneider et al., Appl. Microbiol. Biotechnol. 91, 17-30., 2011).
한편, pta-ackA (pta, phosphotransacetylase; ackA, Acetate kinase) 오페론 및 acs (Acetyl-coenzyme A synthetase)는 아세테이트를 이용하여 아세틸-CoA를 합성하는 유전자로 알려져 있다.
본 발명자들은 오르니틴 및 퓨트레신 생산능 향상을 목적으로 지속적으로 연구한 결과, 대장균 유래의 argA 및 argE를 코리네박테리움 속 미생물에 도입하는 경우에 퓨트레신과 오르니틴의 생산능이 향상되는 것을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 퓨트레신 또는 오르니틴을 고수율로 생산할 수 있는 재조합 미생물을 제공하는 것이다.
본 발명의 다른 목적은 상기 미생물을 이용하여 퓨트레신 또는 오르니틴을 생산하는 방법을 제공하는 것이다.
본 발명의 퓨트레신 또는 오르니틴을 생산하는 코리네박테리움 속 미생물에 대장균 유래 ArgA와 대장균 유래 ArgE를 도입시킨 경우와 상기와 함께 추가로 아세테이트 이용 경로를 강화한 경우에 퓨트레신 및 오르니틴의 생산량이 증가함을 확인하였다. 이에 따라 본 발명의 미생물은 퓨트레신 또는 오르니틴을 생산하는데 널리 활용될 수 있으며, 이들이 원료로 사용되는 여러 고분자 제품 생산에도 경제적인 측면 및 환경적인 측면에서 효과적이고 바람직한 원료 제공 수단으로 널리 활용될 수 있다.
도 1의 A는 코리네박테리움 속 미생물의 퓨트레신 및 오르니틴 생합성 경로(순환경로)를 B는 대장균의 퓨트레신 및 오르니틴 생합성 경로(선형경로)를 나타내는 개략도이다.
도 2는 코리네박테리움 속 미생물의 argJ가 발현되는 상태에서 대장균 유래 argA 및 대장균 유래 argE를 도입하여 퓨트레신 및 오르니틴의 생산능을 향상시킨 생합성 경로를 나타내는 개략도이다.
본 발명의 일 양태는 대장균 유래 N-아세틸글루타메이트 신타아제(N-acetylglutamate synthase) 및 대장균 유래 아세틸오르니틴 디아세틸라제(Acetylornithine deacetylase)의 활성이 도입된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 하나의 구체예는 상기 대장균 유래 N-아세틸글루타메이트 신타아제는 서열번호 1의 아미노산 서열로 구성되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 다른 하나의 구체예는 상기 대장균 유래 아세틸오르니틴 디아세틸라제는 서열번호 3의 아미노산 서열로 구성되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 써모아미노게네스(Corynebacterium thermoaminogenes), 브레비박테리움 플라붐(Brevibacterium flavum) 및 브레비박테리움 락토페르멘툼(Brevibacterium lactofermentum)으로 이루어진 군으로부터 선택되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 포스포트랜스아세틸라제(phosphotransacetylase) 및 아세트산 인산화효소(acetate kinase) 오페론(pta-ackA operon)의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 포스포트랜스아세틸라제 및 아세트산 인산화효소 오페론은 서열번호 5 또는 7의 아미노산 서열로 구성되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 대장균 유래 아세틸-CoA 합성효소(acetyl-CoA synthetase, acs)의 활성이 도입된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 아세틸-CoA 합성효소는 서열번호 9의 아미노산 서열로 구성되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 오르니틴 디카복실라제(ornithine decarboxylase, ODC)의 활성이 도입되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 i) 오르니틴 카르바모일 트랜스퍼라아제(ArgF), ii) 글루타메이트 엑스포터 또는 iii) 오르니틴 카르바모일 트랜스퍼라아제 및 글루타메이트 엑스포터의 활성이 내재적 활성에 비해 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제(ArgJ), 아세틸 글루타메이트 키나아제(ArgB), 및 아세틸 오르니틴 아미노 트랜스퍼라아제(ArgD)로 구성되는 군으로부터 선택되는 1종 이상의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 아세틸 트랜스퍼라아제의 활성이 내재적 활성보다 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 아세틸 트랜스퍼라아제는 서열번호 30 또는 31의 아미노산 서열로 구성되는 단백질인 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 퓨트레신 엑스포터의 활성이 내재적 활성보다 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 퓨트레신 엑스포터는 서열번호 26 또는 서열번호 28의 아미노산 서열로 구성되는 단백질인 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 다른 양태는
(i) 상기 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
(ii) 상기 배양된 미생물 또는 배지로부터 퓨트레신 또는 오르니틴을 회수하는 단계를 포함하는, 퓨트레신 또는 오르니틴의 생산방법을 제공한다.
본 발명의 하나의 구체예는 상기 코리네박테리움 속 미생물이 코리네박테리움 글루타미쿰인 것인, 퓨트레신 또는 오르니틴의 생산방법을 제공한다.
이하, 본 발명을 상세히 설명한다.
본 발명의 일 양태는 대장균 유래 N-아세틸글루타메이트 신타아제(N-acetylglutamate synthase) 및 대장균 유래 아세틸오르니틴 디아세틸라제(Acetylornithine deacetylase)의 활성이 도입된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물에 대한 것이다.
본 발명에서 사용되는 용어 "N-아세틸글루타메이트 신타아제(N-acetylglutamate synthase)"는 글루타메이트와 아세틸-CoA로부터 N-아세틸글루타메이트가 생성되는 반응을 매개하는 효소로, 생성되는 N-아세틸글루타메이트는 오르니틴과 아르기닌의 전구체로 사용될 수 있다.
본 발명에서 N-아세틸글루타메이트 신타아제는 예를 들어, 서열번호 1의 아미노산 서열을 포함하는 단백질, 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 N-아세틸글루타메이트 신타아제로서의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 미생물의 종 또는 균주에 따라 상기 활성을 나타내는 단백질의 아미노산 서열에 차이가 존재하는 경우가 있기 때문에, 본 발명에서 N-아세틸글루타메이트 신타아제는 유래에 한정되지 않으나 예를 들어, 대장균 유래일 수 있다. 상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 1의 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 발명의 범주에 포함됨은 자명하다.
본 발명의 N-아세틸글루타메이트 신타아제를 코딩하는 폴리뉴클레오티드는 상기 N-아세틸글루타메이트 신타아제 단백질과 유사한 활성을 가지는 한, 서열번호 1의 아미노산 서열 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 단백질을 코딩하는 폴리뉴클레오티드를 포함할 수 있고, 예시적으로는 서열번호 2의 폴리뉴클레오티드 서열을 포함할 수 있다.
본 발명에서 사용되는 용어 "아세틸오르니틴 디아세틸라제(Acetylornithine deacetylase)"는 아세틸오르니틴의 가수분해를 매개하여 아세트산과 오르니틴이 생성되는 반응을 매개하는 효소이다.
본 발명에서 아세틸오르니틴 디아세틸라제는 서열번호 3의 아미노산 서열을 포함하는 단백질, 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세틸오르니틴으로부터 아세틸기와 오르니틴을 분리시키는 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 미생물의 종 또는 균주에 따라 상기 활성을 나타내는 단백질의 아미노산 서열에 차이가 존재하는 경우가 있기 때문에, 본 발명에서 아세틸오르니틴 디아세틸라제는 유래에 한정되지 않으나 예를 들어, 대장균 유래일 수 있다. 상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 3의 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 발명의 범주에 포함됨은 자명하다.
본 발명의 아세틸오르니틴 디아세틸라제를 코딩하는 폴리뉴클레오티드는 상기 아세틸오르니틴 디아세틸라제 단백질과 유사한 활성을 가지는 한, 서열번호 3의 아미노산 서열 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 단백질을 코딩하는 폴리뉴클레오티드를 포함할 수 있고, 예시적으로는 서열번호 4의 폴리뉴클레오티드 서열을 포함할 수 있다.
또한, 본 발명의 N-아세틸글루타메이트 신타아제 또는 아세틸오르니틴 디아세틸라제를 코딩하는 폴리뉴클레오티드는 서열번호 2 또는 4의 폴리뉴클레오티드 서열 또는 상기 폴리뉴클레오티드 서열로부터 유래된 프로브(probe)와 엄격한 조건(stringent conditions)에서 혼성화될 수 있고, 정상적으로 기능하는 N-아세틸글루타메이트 신타아제 또는 아세틸오르니틴 디아세틸라제를 코딩하는 변이형일 수 있다. 상기에서 용어 "엄격한 조건"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 예를 들어, 이러한 엄격한 조건은 문헌(예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다.
상기에서 용어 "상동성"은 주어진 아미노산 서열 또는 폴리뉴클레오티드 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 아미노산 서열 또는 폴리뉴클레오티드 서열과 동일하거나 유사한 활성을 갖는 그의 상동성 서열이 "% 상동성"으로 표시된다. 예를 들면, 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)들을 계산하는 표준 소프트웨어, 구체적으로 BLAST 2.0을 이용하거나, 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
한편, 본 발명의 미생물은 천연형 또는 변이형을 모두 포함하며, 이의 예로는 에스케리치아 속(Escherichia sp.), 시겔라 속(Shigella sp.), 시트로박터 속(Citrobacter sp.), 살모넬라 속(Salmonella sp.), 엔테로박터 속(Enterobacter sp.) 여시니아 속(Yersinia sp.), 크렙시엘라 속(Klebsiella sp.), 어위니아 속(Erwinia sp.), 코리네박테리움 속(Corynebacterium sp.), 브레비박테리움 속(Brevibacterium sp.), 락토바실러스 속(Lactobacillus sp.), 셀레노모나스 속(Selenomanas sp.), 비브리오 속(Vibrio sp.), 슈도모나스 속(Pseudomonas sp.), 스트렙토마이시스 속(Streptomyces sp.), 아카노박테리아 속(Arcanobacterium sp.), 알칼리젠 속(Alcaligenes sp) 등에 속하는 미생물일 수 있다. 구체적으로 본 발명의 미생물은 코리네박테리움 속에 속하는 미생물일 수 있으며, 더욱 구체적으로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 써모아미노게네스(Corynebacterium thermoaminogenes), 브레비박테리움 플라붐(Brevibacterium flavum) 및 브레비박테리움 락토페르멘툼(Brevibacterium lactofermentum)으로 이루어진 군으로부터 선택되는 것일 수 있고, 더욱 더 구체적으로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있으나, 이에 한정되지 않는다.
특히, 본 발명의 용어 "퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물"은 코리네박테리움 속 미생물로서, 퓨트레신 또는 오르니틴의 생산능이 천연적으로 있거나 퓨트레신 또는 오르니틴의 생산능이 없는 모균주에 퓨트레신 또는 오르니틴의 생산능이 부여된 미생물을 의미한다.
상기 퓨트레신 또는 오르니틴 생산능이 부여되거나 생산하는 미생물은, 특별히 이에 제한되지 않으나, 글루타메이트에서 오르니틴까지의 생합성 경로를 강화하기 위해 글루타메이트를 아세틸글루타메이트(N-acetylglutamate)로 전환하는 아세틸 글루타메이트 신타아제 또는 아세틸오르니틴을 오르니틴으로 전환하는 오르니틴 아세틸트랜스퍼라아제(ArgJ), 아세틸글루타메이트를 아세틸글루타밀 포스페이트(N-acetylglutamyl phosphate)로 전환하는 아세틸글루타메이트 키나아제(ArgB), 아세틸글루타밀 포스페이트를 아세틸글루타메이트 세미알데히드(N-acetylglutamate semialdehyde)로 전환하는 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸글루타메이트 세미알데히드를 아세틸오르니틴(N-acetylornithine)으로 전환하는 아세틸 오르니틴 아미노트랜스퍼라아제(ArgD)의 활성을 내재적 활성에 비하여 증가시키도록 변형되어 퓨트레신의 생합성 원료로서 사용되는 오르니틴의 생산성이 향상된 것일 수 있다.
또한, 상기 미생물은 오르니틴에서 아르기닌 합성에 관여하는 오르니틴 카르바모일 트랜스퍼라아제(ornithine carbamoyltransfrase, ArgF), 글루타메이트의 배출에 관여하는 단백질, 및/또는 퓨트레신을 아세틸화시키는 단백질의 활성을 내재적 활성에 비하여 약화시키도록 변이되고/되거나, 오르니틴 디카르복실라아제(ornithine decarboxylase, ODC)의 활성을 도입하도록 변형된 것일 수 있다.
본 발명의 용어 "활성이 도입"되는 것은 미생물 내에 존재하지 않거나 미비했던 단백질의 활성이 해당 미생물에 새로 도입되거나 증대되는 것을 의미할 수 있으며, 구체적으로 미생물에 존재하지 않던 단백질을 코딩하는 유전자를 발현 가능하게 미생물 내로 삽입 또는 전달하거나, 미생물 내에서 발현이 안되거나 거의 되지 않던 단백질에 대하여 발현을 강화하는 변이를 유도하는 것을 포함하나, 상기 예에 제한되지 않는다.
한편, 본 발명에서 활성이 도입되거나 활성이 강화되거나 활성이 약화되는 등의 변이는 형질전환이라는 과정을 통해서 일어날 수 있으며, 본 발명에서 용어 "형질전환"은 특정 단백질을 코딩하는 폴리뉴클레오티드나 활성이 강하거나 약한 프로모터 서열 등을 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하거나 숙주세포의 염색체의 변이를 유도하는 것을 의미한다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현 또는 변이를 유도할 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 발명의 특정 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 발명에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 발명에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 본 발명에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다. 구체적으로는 pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
이처럼 세균 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 본 발명의 벡터는 상동재조합을 일으켜서 염색체 내로 삽입될 수 있으므로 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 폴리뉴클레오티드의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택 가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 발명의 코리네박테리움 속 미생물은 추가적으로 포스포트랜스아세틸라제(phosphotransacetylase) 및 아세트산 인산화효소(acetate kinase) 오페론(pta-ackA operon)의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명에서 포스포트랜스아세틸라제(phosphotransacetylase) 및 아세트산 인산화효소(acetate kinase) 오페론(pta-ackA operon)은 글루코즈나 피루베이트로부터 생성된 아세틸-CoA가 아세틸 인을 거쳐 아세트산으로 전환되는 대사경로와 이의 반대방향의 대사경로를 가역적으로 매개하는 유전자들을 포함하는 오페론이다.
본 발명에서 포스포트랜스아세틸라제 및 아세트산 인산화효소 오페론은 서열번호 5 또는 7의 아미노산 서열을 포함하는 단백질, 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세트산으로부터 아세틸-CoA가 생성되는 반응을 매개하는 단백질이라면 제한없이 포함될 수 있다.
또한, 미생물의 종 또는 균주에 따라 상기 활성을 나타내는 단백질의 아미노산 서열에 차이가 존재하는 경우가 있기 때문에, 본 발명에서 포스포트랜스아세틸라제 및 아세트산 인산화효소 오페론은 유래에 한정되지 않는다. 상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 5 또는 7의 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 발명의 범주에 포함됨은 자명하다.
본 발명의 포스포트랜스아세틸라제 및 아세트산 인산화효소 오페론을 코딩하는 폴리뉴클레오티드는 서열번호 5 또는 7의 아미노산 서열 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 단백질을 코딩하는 폴리뉴클레오티드를 포함할 수 있고, 가장 구체적으로는 서열번호 6 또는 8의 폴리뉴클레오티드 서열을 포함할 수 있다.
본 발명의 용어 "활성이 강화"되는 것은 단백질 자체의 활성이 새로 도입되거나 증대되어 본래 기능 이상의 효과를 도출하는 것을 포함할 뿐만 아니라, 내재적 유전자 활성의 증가, 내부 또는 외부 요인으로부터 내재적 유전자 증폭, 상기 유전자 발현의 억제 조절 인자의 결실, 유전자 카피수 증가, 외부로부터의 유전자 도입, 발현조절 서열의 변형, 특히 프로모터 교체 또는 변형 및 유전자내 돌연변이에 의한 효소 활성의 증가 등에 의해 그 활성이 증가되는 것을 포함한다.
구체적으로, 본 발명에서 활성 증가는,
1) 상기 효소를 암호화하는 폴리뉴클레오티드의 카피수 증가,
2) 상기 폴리뉴클레오티드의 발현이 증가하도록 발현조절 서열의 변형,
3) 상기 효소의 활성이 강화되도록 염색체 상의 폴리뉴클레오티드 서열의 변형, 또는
4) 이의 조합에 의해 강화되도록 변형하는 방법 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 1) 폴리뉴클레오티드의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 본 발명의 효소를 암호화하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있거나, 상기 폴리뉴클레오티드가 작동가능 하게 연결된, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 상기 숙주세포의 염색체 내 상기 폴리뉴클레오티드의 카피수를 증가하는 방법으로 수행될 수 있다.
다음으로, 2) 폴리뉴클레오티드의 발현이 증가하도록 발현조절 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 발현조절 서열의 활성을 더욱 강화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다. 상기 발현조절 서열은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 이종 프로모터가 연결될 수 있는데, 상기 강력한 프로모터의 예로는 CJ7 프로모터, lysCP1 프로모터, EF-Tu 프로모터, groEL 프로모터, aceA 혹은 aceB 프로모터 등이 있으며, 더욱 구체적으로는 코리네박테리움 유래 프로모터인 lysCP1 프로모터(WO2009/096689) 혹은 CJ7 프로모터(대한민국 등록특허 제0620092호 및 WO2006/065095)와 작동가능하게 연결되어 상기 효소를 코딩하는 폴리뉴클레오티드의 발현율을 향상시킬 수 있으나, 이에 한정되지 않는다.
아울러, 3) 염색체 상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
특히, 본 발명에서 상기 포스포트랜스아세틸라제 및 아세트산 인산화효소 오페론(pta-ackA operon)의 활성이 내재적 활성에 비해 강화되는 것은 상기 오페론의 세포 내 카피수 증가, 상기 오페론의 발현 조절 서열에 변이를 도입하는 방법, 상기 오페론 상의 유전자의 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법, 상기 오페론을 구성하는 효소의 활성이 증가하도록 돌연변이된 유전자로 염색체 상의 상기 효소를 암호화하는 유전자를 대체하는 방법 및 상기 오페론을 구성하는 효소의 활성이 강화되도록 상기 효소를 암호화하는 염색체상의 유전자에 변이를 도입시키는 방법으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법을 통해 이루어지는 것일 수 있다. 구체적으로는 상기 포스포트랜스아세틸라제 및 아세트산 인산화효소 오페론 상의 유전자의 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법은 상기 아세틸라제 및 아세트산 인산화효소 오페론의 내재적 프로모터 대신 예를 들어 CJ7 프로모터, lysCP1 프로모터, EF-Tu 프로모터, groEL 프로모터, aceA 혹은 aceB 프로모터 등으로 교체할 수 있으나, 이에 한정되지 않는다.
본 발명에서 사용되는 용어 "내재적 활성"이란, 본래 미생물이 변형되지 않은 상태에서 가지고 있는 효소의 활성 상태를 의미하고, "내재적 활성에 비해 강화"되었다는 것은, 활성을 나타내는 유전자가 도입되거나 또는 당해 유전자의 카피수 증가, 상기 유전자 발현의 억제 조절 인자의 결실 또는 발현조절서열의 변형, 예를 들어 개량된 프로모터의 사용 등과 같은 조작이 이루어지기 전의 미생물이 가지는 활성에 비하여 조작이 이루어진 이후의 미생물이 가지고 있는 활성이 증가된 상태를 의미한다.
본 발명의 코리네박테리움 속 미생물은 추가적으로 대장균 유래 아세틸-CoA 합성효소(acetyl-CoA synthetase, acs)의 활성이 도입된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명에서 아세틸-CoA 합성효소(acetyl-CoA synthetase, acs)는 ATP, 아세트산 및 CoA로부터 아세틸-CoA가 생성되는 반응을 매개하는 효소이다.
본 발명에서 아세틸-CoA 합성효소는 서열번호 9의 아미노산 서열을 포함하는 단백질, 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세틸-CoA 합성을 매개하는 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 미생물의 종 또는 균주에 따라 상기 활성을 나타내는 단백질의 아미노산 서열에 차이가 존재하는 경우가 있기 때문에, 본 발명에서 아세틸-CoA 합성효소는 유래에 한정되지 않으나 예를 들어, 대장균 유래일 수 있다. 상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 9의 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 발명의 범주에 포함됨은 자명하다.
본 발명의 아세틸-CoA 합성효소를 코딩하는 폴리뉴클레오티드는 서열번호 9의 아미노산 서열 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 단백질을 코딩하는 폴리뉴클레오티드를 포함할 수 있고, 가장 구체적으로는 서열번호 10의 폴리뉴클레오티드 서열을 포함할 수 있다.
본 발명의 코리네박테리움 속 미생물은 추가적으로 오르니틴 디카복실라제(ornithine decarboxylase, ODC)의 활성이 도입되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명에서 "오르니틴 디카복실라제"는 오르니틴의 디카복실화(decarboxylation)를 매개하여 퓨트레신을 생산하는 효소를 의미한다. 코리네박테리움 속 미생물에는 상기 퓨트레신 생합성 효소가 없지만 외부로부터 오르니틴 디카르복실라아제(ornithine decarboxylase, ODC)를 도입하면 퓨트레신이 합성되면서 세포 외로 퓨트레신이 배출된다. 외부로부터 도입될 수 있는 오르니틴 디카르복실라아제는 상기 활성만 가지면 미생물 유래에 무관하게 본 발명에서 활용될 수 있으나, 구체적으로 대장균 유래가 도입될 수 있다.
본 발명의 코리네박테리움 속 미생물은 추가적으로 i) 오르니틴 카르바모일 트랜스퍼라아제(ArgF), ii) 글루타메이트 엑스포터 또는 iii) 오르니틴 카르바모일 트랜스퍼라아제 및 글루타메이트 엑스포터의 활성이 내재적 활성에 비해 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다. 코리네박테리움 속에서 글루타메이트 엑스포터는 NCgl1221일 수 있다.
또한, 본 발명의 코리네박테리움 속 미생물은 추가적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제(ArgJ), 아세틸 글루타메이트 키나아제(ArgB), 및 아세틸 오르니틴 아미노 트랜스퍼라아제(ArgD)로 구성되는 군으로부터 선택되는 1종 이상의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
아울러, 본 발명의 코리네박테리움 속 미생물은 추가적으로 아세틸트랜스퍼라아제의 활성, 구체적으로 NCgl1469의 활성이 내재적 활성보다 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
마지막으로, 본 발명의 코리네박테리움 속 미생물은 추가적으로 퓨트레신 엑스포터의 활성, 구체적으로 NCgl2522의 활성이 내재적 활성보다 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명의 용어 "활성 약화"되는 것은 단백질 자체의 활성이 감소되거나 불활성되어 본래 기능 이하의 효과를 도출하는 것을 포함할 뿐만 아니라, 내재적 유전자 활성의 감소, 상기 유전자 발현의 억제 조절 인자의 활성화, 유전자 카피수 감소, 발현조절 서열의 변형, 특히 프로모터 교체 또는 변형 및 유전자내 돌연변이에 의한 효소 활성의 불활성화 또는 감소 등에 의해 그 활성이 약화되는 것을 포함한다.
구체적으로, 본 발명에서 활성 약화는, 예를 들어
1) 상기 단백질을 코딩하는 폴리뉴클레오티드의 일부 또는 전체의 결실,
2) 상기 폴리뉴클레오티드의 발현이 감소하도록 발현 조절서열의 변형,
3) 상기 단백질의 활성이 약화되도록 염색체 상의 상기 폴리뉴클레오티드 서열의 변형, 및
4) 이들의 조합으로부터 선택된 방법에 의해 달성될 수 있으며, 이에 한정되지 않는다.
구체적으로, 단백질을 암호화하는 폴리뉴클레오티드의 일부 또는 전체를 결실하는 방법은, 세균 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 폴리뉴클레오티드를 일부 폴리뉴클레오티드 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 상기 "일부"란 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 더욱 구체적으로는 1 내지 100개, 더욱더 구체적으로는 1 내지 50개이다.
또한, 발현 조절서열을 변형하는 방법은 상기 발현 조절서열의 활성을 더욱 약화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절서열 상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 폴리뉴클레오티드 서열로 교체함으로써 수행할 수 있다. 상기 발현 조절서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함한다.
아울러, 염색체상의 폴리뉴클레오티드 서열을 변형하는 방법은 상기 효소의 활성을 더욱 약화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함으로써 수행할 수 있다.
뿐만 아니라, 상기 효소의 폴리뉴클레오티드의 발현을 억제하는 조절인자를 결실하는 방법은 발현 억제 인자의 폴리뉴클레오티드를 일부 폴리뉴클레오티드 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 상기 "일부"란 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 구체적으로는 1 내지 100개, 더욱 구체적으로는 1 내지 50개이다.
이때, 상기 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸글루타메이트 신타아제 또는 오르니틴 아세틸트랜스퍼라아제(ArgJ), 아세틸글루타메이트 키나아제(ArgB), 아세틸오르니틴 아미노트랜스퍼라아제(ArgD), 오르니틴 카르바모일 트랜스퍼라아제(ArgF), 글루타메이트의 배출에 관여하는 단백질 및 오르니틴 디카르복실라아제(ODC)는, 특별히 이에 제한되지 않으나, 구체적으로는 각각 서열번호 32, 33, 34, 35, 36, 37 또는 38의 아미노산 서열 또는 이와 70% 이상, 더욱 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상의 상동성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 퓨트레신을 아세틸화시키는 단백질은, 특별히 이에 제한되지 않으나, 구체적으로는 서열번호 30 또는 31의 아미노산 서열 또는 이와 70% 이상, 더욱 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상의 상동성을 가지는 아미노산 서열을 포함할 수 있다.
아울러, 본 발명에서 퓨트레신 엑스포터는 서열번호 26 또는 28의 아미노산 서열 또는 이와 70% 이상, 더욱 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상의 상동성을 가지는 아미노산 서열을 포함할 수 있다.
상기 단백질 중에서 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸글루타메이트 신타아제 또는 오르니틴아세틸트랜스퍼라아제(ArgJ), 아세틸글루타메이트 키나아제(ArgB), 아세틸오르니틴 아미노트랜스퍼라아제(ArgD), 오르니틴 디카르복실라아제(ODC) 및 퓨트레신 엑스포터의 활성 강화는, 예를 들어 상기 단백질을 코딩하는 폴리뉴클레오티드의 카피수 증가, 상기 폴리뉴클레오티드의 발현이 증가하도록 발현 조절서열의 변형, 상기 효소의 활성이 강화되도록 염색체상의 상기 폴리뉴클레오티드 서열의 변형, 상기 효소의 폴리뉴클레오티드의 발현을 억제하는 조절인자의 결실 및 이들의 조합으로부터 선택된 방법에 의해 달성될 수 있다.
또한, 오르니틴 카르바모일 트랜스퍼라아제(ArgF) 및 글루타메이트의 배출에 관여하는 단백질, 및 퓨트레신을 아세틸화시키는 단백질의 활성 약화는, 상기 단백질을 코딩하는 폴리뉴클레오티드의 일부 또는 전체의 결실, 상기 폴리뉴클레오티드의 발현이 감소하도록 발현 조절서열의 변형, 상기 단백질의 활성이 약화되도록 염색체상의 상기 폴리뉴클레오티드 서열의 변형, 및 이들의 조합으로부터 선택된 방법에 의해 달성될 수 있다.
또 하나의 양태로서, 본 발명은
(i) 상기 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
(ii) 상기 배양된 미생물 또는 배지로부터 퓨트레신 또는 오르니틴을 회수하는 단계를 포함하는, 퓨트레신 또는 오르니틴의 생산방법을 제공한다.
상기 방법에 있어서, 상기 미생물을 배지에서 배양하는 단계는, 특별히 이에 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물(예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물(예: 인산 또는 황산)을 사용하여 적정 pH(예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8, 가장 구체적으로는 pH 6.8)를 조절할 수 있고, 산소 또는 산소-함유 가스 혼합물을 배양물에 도입시켜 호기성 조건을 유지할 수 있으며, 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160시간 동안 배양함이 바람직하다. 상기 배양에 의하여 생산된 퓨트레신 또는 오르니틴은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
아울러, 사용되는 배양용 배지의 탄소 공급원으로는 당 및 탄수화물(예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방(예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산(예: 팔미트산, 스테아르산 및 리놀레산), 알코올(예: 글리세롤 및 에탄올) 및 유기산(예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 또한, 사용되는 배양용 배지의 질소 공급원으로는 질소-함유 유기 화합물(예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 또는 무기 화합물(예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 사용되는 배양용 배지의 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 아울러, 사용되는 배양용 배지는 기타 금속염(예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 추가로 포함할 수 있으나, 이에 제한되지 않는다.
본 발명의 상기 배양 단계에서 생산된 퓨트레신 또는 오르니틴을 회수하는 방법은 배양방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 아미노산을 수집할 수 있다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 대장균 유래 argA 및 대장균 유래 argE의 퓨트레신 생산 균주 내 도입 및 이의 퓨트레신 생산능 확인
1-1. ATCC13032 기반 퓨트레신 생산 균주의 트랜스포존 유전자 내로의 대장균 유래 argA 및 대장균 유래 argE 동시 도입한 균주의 제작
코리네박테리움 글루타미쿰 ATCC13032 기반의 퓨트레신 생산 균주에 대장균 유래 argA와 대장균 유래 argE 유전자 삽입하여 퓨트레신 생산능이 향상하는지를 확인하기 위해, argA와 argE를 상기 균주의 트랜스포존 유전자 내로 도입하였다.
코리네박테리움 속 미생물의 트렌스포존 유전자 부위를 이용하여 염색체 내 유전자 도입을 가능하게 하는 형질전환용 벡터로는 pDZTn(WO 2009/125992)를 사용하였으며, 프로모터는 lysCP1 프로모터(국제 공개특허 WO 2009/096689, 서열번호 39)를 이용하였다.
구체적으로, 상기 N-아세틸글루타메이트 신타아제(N-acetylglutamate synthase)를 코딩하는 대장균 유래 유전자 argA의 폴리뉴클레오티드 서열(서열번호 2)을 근간으로 argA ORF 부위의 상동재조합 단편을 얻기 위한 서열번호 11 및 12의 프라이머쌍을 제작하였다. 또한, 아세틸오르니틴 디아세틸라제(Acetylornithine deacetylase)를 코딩하는 대장균 유래 유전자 argE 폴리뉴클레오티드 서열(서열번호 4)을 근간으로 argE ORF 부위의 상동재조합 단편을 얻기 위한 서열번호 15 및 16의 프라이머쌍을 제작하였으며, lysCP1(국제 공개특허 WO 2009-096689)의 폴리뉴클레오티드 서열(서열번호 39)을 근간으로 lysCP1 부위의 상동재조합 단편을 얻기 위한 서열번호 13 및 14의 프라이머쌍을 제작하였다(표 1).
프라이머 서열 (5' -> 3')
PlysC-argA-F(서열번호11) GAAAGGTGCACAAAGATGGTAAAGGAACGTAAAACCG
Tn-argA-RXh(서열번호12) GCCCACTAGTCTCGAGCATGCGGCGTTGATTTTG
Tn-PlysC-FXh(서열번호13) GAATGAGTTCCTCGAGCCGATGCTAGGGCGAAAA
PlysC-R(서열번호14) CTTTGTGCACCTTTCGATCTACGTGCTGACAGTTAC
PlysC-argE-F(서열번호15) GAAAGGTGCACAAAGATGAAAAACAAATTACCGCC
Tn-argE-RXh(서열번호16) GCCCACTAGTCTCGAGGTTTGAGTCACTGTCGGTCG
먼저, argA 유전자를 얻기 위하여, 대장균 W3110 균주의 염색체를 주형으로 서열번호 11 및 12인 프라이머쌍을 이용하여 약 1.6kb의 유전자 단편을 증폭하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 1분 30초의 신장 과정을 30회 반복하였다. 그 다음, 이 PCR 결과물을 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
또한, KCCM10919P(국제공개특허 WO 2009-096689) 균주의 염색체를 주형으로 서열번호 13 및 14인 프라이머 쌍을 이용하여 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초 과정을 30회 반복하여 lysCP1 프로모터 부위를 수득하였다.
pDZTn 벡터는 XhoI을 처리하고 상기에서 수득한 각 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD Cloning Kit(Clontech)를 사용하였다. 그 결과로 얻은 플라스미드를 pDZTn-lysCP1-argA라 명명하였다.
다음으로 argE 유전자를 얻기 위하여, 상기와 동일한 방법으로 대장균 W3110 균주의 염색체를 주형으로 서열번호 15 및 16인 프라이머쌍을 이용하여 약1.4kb의 유전자 단편을 증폭하여 PCR 산물을 수득하였으며, 상기 lysCP1 프로모터 부위와 퓨전 클로닝하였다. 그 결과로 얻은 플라스미드를 pDZTn-lysCP1-argE라 명명하였다.
다음으로, 상기 플라스미드 pDZTn-lysCP1-argA를 KCCM11240P (대한민국 공개특허 제10-2013-0082478호)에 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin-D-galactoside)이 함유된 BHIS 평판 배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZTn-lysCP1-argA가 도입된 형질전환 균주를 선별하였다.
상기 선별된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다. 형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 argA를 코딩하는 유전자가 도입된 균주를 최종 선별하였다. 최종 선별된 균주를 대상으로 서열번호 12 및 13인 프라이머 쌍을 이용해 PCR을 수행하여 argA를 코딩하는 유전자가 도입되었음을 확인하고, 상기 코리네박테리움 글루타미쿰 변이주를 KCCM11240P Tn:lysCP1-argA 로 명명하였다.
상기 제작된 argA 도입 균주에 argE를 도입하기 위해, 앞에서 제작한 pDZTn-lysCP1-argE를 상기와 동일한 방법으로 KCCM11240P Tn:lysCP1-argA에 형질전환하였으며, 최종 선별된 균주를 대상으로 서열번호 13 및 16인 프라이머 쌍을 이용해 PCR을 수행하여 트랜스포존내 argE가 도입되었음을 확인하였다.
이로부터 선별된 코리네박테리움 글루타미쿰 변이주를 KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE라 명명하였다.
1-2. ATCC13869 기반 퓨트레신 생산 균주의 트랜스포존 유전자 내로의 대장균 유래 argA 및 대장균 유래 argE 동시 도입한 균주의 제작
코리네박테리움 글루타미쿰 ATCC13869 기반의 퓨트레신 생산 균주인 DAB12-a ΔNCgl1469 (대한민국 공개특허 제10-2013-0082478호)를 DAB12-b라 명명하고, 대장균 유래 argA와 대장균 유래 argE 유전자 삽입이 퓨트레신 생산능 향상에 관여하는지 여부를 확인하기 위해, argA와 argE를 트랜스포존 유전자 내에 도입하였다.
먼저 앞에서 제작한 pDZTn-lysCP1-argA를 상기 실시예 1-1과 동일한 방법으로 코리네박테리움 글루타미쿰 DAB12-b에 형질전환하였고, 트랜스포존내 argA가 도입되었음을 확인하였다. 이로부터 argA가 도입된 것으로 선별된 코리네박테리움 글루타미쿰 변이주를 DAB12-b Tn:lysCP1-argA라 명명하였다.
그 다음으로 상기 제작된 argA 도입 균주에 argE를 도입하기 위해, 앞에서 제작한 pDZTn-lysCP1-argE를 상기 실시예 1-1과 동일한 방법으로 DAB12-b Tn:lysCP1-argA에 형질전환하였고, 트랜스포존내 argE가 도입되었음을 확인하였다. 이로부터 선별된 코리네박테리움 글루타미쿰 변이주를 DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE라 명명하였다.
1-3. 대장균 유래 argA 및 대장균 유래 argE 유전자가 도입된 퓨트레신 생산 코리네박테리움 균주의 퓨트레신 생산능 평가
퓨트레신 생산 균주에 대장균 유래 argA와 대장균 유래 argE 도입이 퓨트레신 생산에 미치는 효과를 확인하기 위하여, 상기 실시예 1-1 및 1-2에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 퓨트레신 생산능을 비교하였다.
구체적으로, 상기 실시예 1-1 및 1-2에서 제작한 2종의 코리네박테리움 글루타미쿰 변이주(KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE; DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE)와 2종의 모균주(KCCM11240P; DAB12-b)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다.
이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수고형 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4·7H2O 0.05%, urea 0.15%, 바이오틴 100 μg, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5%, 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 98시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 각 배양물로부터 생산된 퓨트레신 농도를 측정하고 그 결과를 하기 표 2에 나타내었다.
균주명 퓨트레신 (g/L)
KCCM 11240P 12.2
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE 13.4
DAB12-b 13.3
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE 14.6
상기 표 2에 나타난 바와 같이, 대장균 유래 argA와 대장균 유래 argE 유전자가 동시에 도입된 2종의 코리네박테리움 글루타미쿰 변이주 모두에서 퓨트레신 생산량이 9.8%이상 증가하였음을 확인하였다.
실시예 2: 대장균 유래 argA 및 대장균 유래 argE가 도입된 퓨트레신 생산 균주의 pta-ackA 강화 및 이의 퓨트레신 생산능 확인
2-1. ATCC13032 기반 퓨트레신 생산균주에서 pta- ackA 프로모터 치환 균주의 제작
상기 실시예 1에서 제작된 대장균 유래 argA 및 대장균 유래 argE 유전자가 도입된 퓨트레신 생산 균주에 추가적으로 포스포트랜스아세틸라제(phosphotransacetylase) 및 아세트산 인산화효소(acetate kinase) (pta-ackA) 활성을 강화하여 이의 퓨트레신 생산능에 미치는 영향을 확인하고자 하였다.
이를 위해, 염색체 내 pta-ackA 오페론의 프로모터를 내재적 프로모터보다 활성이 강한 프로모터, 구체적으로 개시코돈 앞에 lysCP1 프로모터(국제 공개특허 WO 2009/096689)를 도입하였다.
우선, lysCP1 프로모터를 포함하고, 상기 프로모터의 양끝 말단 부위는 염색체상의 pta-ackA 원래의 서열을 갖는 상동재조합 단편을 수득하였다. 구체적으로, lysCP1 프로모터의 5'-말단 부위는 코리네박테리움 글루타미쿰 ATCC13032의 게놈 DNA를 주형으로 서열번호 17 및 18의 프라이머 쌍을 이용한 PCR을 수행하여 수득하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초의 신장 과정을 30회 반복하였다.
또한, lysCP1 프로모터 부위는 서열번호 14 및 19의 프라이머 쌍을 이용하여 동일한 조건에서 PCR을 수행하여 수득하였으며, lysCP1 프로모터의 3'-말단 부위는 코리네박테리움 글루타미쿰 ATCC13032의 게놈 DNA를 주형으로 서열번호 20 및 21의 프라이머쌍을 이용하여 동일한 조건에서 PCR을 수행하여 수득하였다. 상기 프로모터 수득에 사용된 프라이머는 상기 표 1 및 하기 표 3에 나타난 바와 같다.
프라이머 서열 (5' -> 3')
Pro-pta-FX(서열번호 17) CCGGGGATCCTCTAGAGGGGTTCTAAAAAATGTGGAGT
pta-PlysC-R(서열번호 18) GCCGTGCTTTTCGCCCTAGCATCGGACATCGCCTTTCTAATTT
PlysC-F(서열번호 19) CCGATGCTAGGGCGAAAAGCACGGC
PlysC-pta-ackA-F(서열번호 20) GAAAGGTGCACAAAGATGTCTGACACACCGACCTCAGCTC
Pro-pta-RX(서열번호 21) GCAGGTCGACTCTAGATTATCCGGCATTGGCTCT
상기에서 수득한 각 PCR 산물을 XbaI으로 처리된 pDZ벡터에 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD Cloning Kit(Clontech)를 사용하였다. 그 결과로 얻은 플라스미드를 pDZ-lysCP1-1'pta-ackA라 명명하였다.
상기에서 제조된 플라스미드 pDZ-lysCP1-1'pta-ackA를 KCCM11240P 및 실시예 1-1에서 제작한 코리네박테리움 글루타미쿰 변이주 KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE에 각각 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin-D-galactoside)이 함유된 BHIS 평판 배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZ-lysCP1-1'pta-ackA가 도입된 균주를 선별하였다.
상기 선별된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다. 형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 최종적으로 pta-ackA 프로모터가 lysCP1으로 치환된 균주를 선별하였다.
최종 선별된 균주를 대상으로 서열번호 19 및 21인 프라이머 쌍을 이용해 PCR을 수행하여 염색체 내 pta-ackA 개시코돈 앞에 lysCP1 프로모터가 도입되었음을 확인하였다. 이때 PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 1분의 신장 과정을 30회 반복하였다.
이로부터 선별된 코리네박테리움 글루타미쿰 변이주를 각각 KCCM11240P lysCP1-1'pta-ackA 및 KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA로 명명하였다.
2-2. ATCC13869 기반 퓨트레신 생산 코리네박테리움 균주에서 pta- ackA 프로모터 치환 균주의 제작
상기 실시예 2-1에 개시된 방법을 이용하여, 코리네박테리움 글루타미쿰 ATCC13869 유래 pta-ackA를 코딩하는 유전자 및 그로부터 발현되는 단백질 서열을 확인하기 위해, 코리네박테리움 글루타미쿰 ATCC13869의 게놈 DNA를 주형으로 하고 서열번호 17 및 22의 프라이머 쌍을 이용하여 PCR을 수행하였다(표 3, 표 4). 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 3분의 신장 과정을 30회 반복하였다.
이로부터 수득된 PCR 산물을 전기영동으로 분리한 후 서열분석을 수행한 결과, 코리네박테리움 글루타미쿰 ATCC13869 유래의 pta-ackA를 코딩하는 유전자는 서열번호 8로 기재되는 폴리뉴클레오티드 서열을 포함하며, 이로부터 코딩되는 단백질은 서열번호 7로 기재되는 아미노산 서열을 포함하는 것을 확인하였다.
한편, 코리네박테리움 글루타미쿰 ATCC13032 유래의 pta-ackA의 아미노산 서열(서열번호 5)과 코리네박테리움 글루타미쿰 ATCC13869 유래의 pta-ackA 아미노산 서열을 비교한 결과, 이들은 99.4%의 서열 상동성을 갖는 것을 확인하였다.
프라이머 서열 (5' -> 3')
Pta-ackA-R(서열번호 22) TGCAGTTTCACCCCTTAA
13869_pta-PlysC-R(서열번호 23) GCCGTGCTTTTCGCCCTAGCATCGGACATCGCCTTTCTAGTTT
우선, lysCP1 프로모터를 포함하고, 상기 프로모터의 양끝 말단 부위는 염색체상의 pta-ackA 원래의 서열을 갖는 상동재조합 단편을 수득하였다. 구체적으로, lysCP1 프로모터의 5'-말단 부위는 코리네박테리움 글루타미쿰 ATCC13869의 게놈 DNA를 주형으로 서열번호 17 및 23의 프라이머 쌍을 이용한 PCR을 수행하여 수득하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초의 신장 과정을 30회 반복하였다. 또한, lysCP1 프로모터 부위는 서열번호 14 및 19의 프라이머 쌍을 이용하여 동일한 조건에서 PCR을 수행하여 수득하였으며, lysCP1 프로모터의 3'-말단 부위는 코리네박테리움 글루타미쿰 ATCC13869의 게놈 DNA를 주형으로 서열번호 20 및 21의 프라이머쌍을 이용하여 동일한 조건에서 PCR을 수행하여 수득하였다. 프로모터 치환에 사용된 프라이머는 상기 표 1, 표 3 및 표 4에 나타난 바와 같다.
상기에서 수득한 각 PCR 산물을 XbaI으로 처리된 pDZ벡터에 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion®HD Cloning Kit(Clontech)를 사용하였다. 그 결과로 얻은 플라스미드를 pDZ-lysCP1-2'pta-ackA라 명명하였다.
상기에서 제조된 플라스미드 pDZ-lysCP1-2'pta-ackA를 상기 실시예 2-1과 동일한 방법으로 DAB12-b 및 상기 실시예 1-2에서 제작한 코리네박테리움 글루타미쿰 변이주 DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE에 각각 형질전환하여 염색체 내 pta-ackA 개시코돈 앞에 lysCP1 프로모터가 도입되었음을 확인하였다. 상기 코리네박테리움 글루타미쿰 변이주를 각각 DAB12-b lysCP1-2'pta-ackA 및 DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-2'pta-ackA 로 명명하였다.
2-3. pta-ackA 강화 균주의 퓨트레신 생산능 평가
대장균 유래 argA와 대장균 유래 argE 도입된 퓨트레신 생산균주에서 pta-ackA 강화가 미치는 효과를 확인하기 위하여, 상기 실시예 2-1 및 2-2에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 퓨트레신 생산능을 비교하였다.
구체적으로, 4종의 코리네박테리움 글루타미쿰 변이주(KCCM11240P lysCP1-1'pta-ackA; KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA; DAB12-b lysCP1-2'pta-ackA; DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-2'pta-ackA)와 4종의 모균주(KCCM11240P; KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE; DAB12-b; DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다. 이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수고형 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4·7H2O 0.05%, urea 0.15%, 바이오틴 100 μg, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5%, 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 98시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 각 배양물로부터 생산된 퓨트레신 농도를 측정하고 그 결과를 하기 표 5에 나타내었다.
균주명 퓨트레신 (g/L)
KCCM 11240P 12.2
KCCM 11240P lysCP1-1'pta-ackA 12.3
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE 13.4
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA 14.1
DAB12-b 13.3
DAB12-b lysCP1-2'pta-ackA 13.4
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE 14.6
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-2'pta-ackA 15.2
상기 표 5에 나타난 바와 같이, KCCM 11240P 및 DAB12-b 에 각각 pta-ackA를 강화시켰을 때 퓨트레신 생산량은 동등 수준이었다. 그러나, 대장균 유래 argA와 대장균 유래 argE 유전자가 동시에 도입된 2종(KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE; DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE)의 코리네박테리움 글루타미쿰 변이주에 각각 pta-ackA를 강화시켰을 때 퓨트레신 생산량은 모균주 대비 14.3%이상 증가하였음을 확인하였다. 또한, 상기 변이주 기준으로는 4%이상 증가하였음을 확인하였다.
이에, 본 발명자는 퓨트레신 생산 균주 코리네박테리움 글루타미쿰 KCCM 11240P에서 대장균 유래 argA 및 대장균 유래 argE의 활성을 도입하고 pta-ackA의 활성을 강화한 퓨트레신 생산성이 향상된 상기 코리네박테리움 속 미생물(Corynebacterium glutamicum KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE :lysCP1-1'pta-ackA)을 CC01-1145로 명명하고, 부다페스트 조약 하에 2014년 11월 21일자로 한국미생물보존센터(Korean Culture Center of Microorganisms, KCCM)에 기탁하여 기탁번호 KCCM11606P를 부여받았다.
실시예 3: 대장균 유래 argA 및 대장균 유래 argE가 도입된 퓨트레신 생산균 주의 대장균 유래 acs 도입 및 이의 퓨트레신 생산능 확인
3-1. ATCC13032 기반 퓨트레신 생산 균주의 트랜스포존 유전자 내로의 대장균 유래 acs 도입 균주의 제작
대장균 유래 argA 및 대장균 유래 argE가 도입된 ATCC13032 기반 퓨트레신 생산균주에서 대장균 유래 아세틸-CoA 합성효소(acetyl-CoA synthetase, acs) 유전자를 도입하여 퓨트레신 생산능이 향상하는지 여부를 확인하기 위해, lysCP1 프로모터를 이용하여 acs를 트랜스포존 유전자 내에 도입하였다.
구체적으로, 상기 acs를 코딩하는 유전자의 서열번호 10으로 기재되는 폴리뉴클레오티드 서열을 근간으로 acs ORF 부위의 상동재조합 단편을 얻기 위한 서열번호 24 및 25의 프라이머쌍과 lysCP1 부위의 상동재조합 단편을 얻기 위한 서열번호 13 및 14의 프라이머쌍을 상기 표 1 및 하기 표 6과 같이 제작하였다.
프라이머 서열 (5' -> 3')
PlysC-acs-F(서열번호 24) GAAAGGTGCACAAAGATGAGCCAAATTCACAAA
Tn-acs-RXh(서열번호 25) GCCCACTAGTCTCGAGAAGGCGTTTACGCCGCATCC
구체적으로 acs 유전자를 수득하기 위하여, 대장균 W3110 균주의 염색체를 주형으로 서열번호 24 및 25인 프라이머쌍을 이용하여 약 2kb의 유전자 단편을 증폭하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 1분 30초의 신장 과정을 30회 반복하였다. 그 다음, 이 PCR 결과물을 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
또한, lysCP1 프로모터 부위는 KCCM10919P(국제공개특허 WO 2009/096689) 균주의 염색체를 주형으로 서열번호 13 및 14인 프라이머 쌍을 이용하여 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초 과정을 30회 반복하여 수득하였다.
pDZTn 벡터는 XhoI을 처리하고 상기에서 수득한 각 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion®HD Cloning Kit(Clontech)를 사용하였다. 그 결과로 얻은 플라스미드를 pDZTn-lysCP1-acs라 명명하였다.
다음으로, 상기 플라스미드 pDZTn-lysCP1-acs를 KCCM11240P 및 실시예 1-1에서 제작한 코리네박테리움 글루타미쿰 변이주 KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE에 각각 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin-D-galactoside)이 함유된 BHIS 평판 배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZTn-lysCP1-acs가 도입된 균주를 선별하였다.
상기 선별된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다. 형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 acs를 코딩하는 유전자가 도입된 균주를 최종 선별하였다. 최종 선별된 균주를 대상으로 서열번호 13 및 25인 프라이머 쌍을 이용해 PCR을 수행하여 acs를 코딩하는 유전자가 도입되었음을 확인하고, 상기 코리네박테리움 글루타미쿰 변이주를 각각 KCCM11240P Tn:lysCP1-acs 및 KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs로 명명하였다.
3-2. ATCC13869 기반 퓨트레신 생산 균주의 트랜스포존 유전자 내로의 대장균 유래 acs 도입 균주의 제작
상기 실시예 3-1과 같이, 상기 제작한 pDZTn-lysCP1-acs를 상기 실시예 3-1과 동일한 방법으로 DAB12-b 및 실시예 1-2에서 제작한 코리네박테리움 글루타미쿰 변이주 DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE에 각각 형질전환하였고, 트랜스포존내 acs가 도입되었음을 확인하였다.
이로부터 선별된 코리네박테리움 글루타미쿰 변이주를 각각 DAB12-b Tn:lysCP1-acs 및 DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs로 명명하였다.
3-3. 대장균 유래 acs 도입 균주의 퓨트레신 생산능 평가
대장균 유래 argA와 대장균 유래 argE 도입된 퓨트레신 생산균주에서 acs 도입이 미치는 효과를 확인하기 위하여, 상기 실시예 3-1 및 3-2에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 퓨트레신 생산능을 비교하였다.
구체적으로, 4종의 코리네박테리움 글루타미쿰 변이주(KCCM11240P Tn:lysCP1-acs; KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs; DAB12-b Tn:lysCP1-acs; DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs)와 4종의 모균주(KCCM11240P; KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE; DAB12-b; DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다. 이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수고형 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4·7H2O 0.05%, urea 0.15%, 바이오틴 100 μg, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5%, 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 98시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 각 배양물로부터 생산된 퓨트레신 농도를 측정하고 그 결과를 하기 표 7에 나타내었다.
균주명 퓨트레신 (g/L)
KCCM 11240P 12.2
KCCM 11240P Tn:lysCP1-acs 12.2
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE 13.4
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs 13.9
DAB12-b 13.3
DAB12-b Tn:lysCP1-acs 13.2
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE 14.6
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs 15.1
상기 표 7에 나타난 바와 같이, KCCM 11240P 및 DAB12-b 에 각각 acs를 도입시켰을 때 퓨트레신 생산량은 동등수준이었다. 그러나, 대장균 유래 argA와 대장균 유래 argE 유전자가 동시에 도입된 2종(KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE; DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE)의 코리네박테리움 글루타미쿰 변이주에 각각 acs를 도입시켰을 때 퓨트레신 생산량은 모균주에 비하여 13.5%이상 증가하였음을 확인하였다. 또한, 상기 변이주보다는 3.4%이상 증가하였음을 확인하였다.
실시예 4: 퓨트레신 배출능이 증가된 퓨트레신 생산 균주에서 대장균 유래 argA, argE 도입, pta-ackA 프로모터 치환 및 이의 퓨트레신 생산능 확인
4-1. 퓨트레신 배출능이 증가된 균주에서 대장균 유래 argA , argE 도입 및 pta-ackA 프로모터 치환 균주의 제작
퓨트레신 배출능이 증가된 KCCM11401P(대한민국 공개특허 제10-2014-0115244호) 균주를 기반으로 대장균 유래의 argA 및 대장균 유래 argE 도입과 코리네 pta-ackA의 활성 강화에 의하여 퓨트레신 생산능이 향상되는지를 확인하기 위해, 균주를 제작하였다.
구체적으로, 상기 실시예 1-1에서 제작한 pDZTn-lysCP1-argA를 상기 실시예 1-1과 동일한 방법으로 KCCM11401P에 형질전환하여 트랜스포존내 argA가 도입되었음을 확인하고, 이로부터 선별된 코리네박테리움 글루타미쿰 변이주를 KCCM11401P Tn:lysCP1-argA로 명명하였다.
아울러 상기 실시예 1-1에서 제작된 argA 도입 균주에 argE를 도입하기 위해, 실시예 1-1에서 제작한 pDZTn-lysCP1-argE를 동일한 방법으로 KCCM11401P Tn:lysCP1-argA에 형질전환하여 트랜스포존내 argE가 도입되었음을 확인하고, 이로부터 선별된 코리네박테리움 글루타미쿰 변이주를 KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE라 명명하였다.
다음으로 상기 실시예 2-1에서 제작한 pDZ-lysCP1-1'pta-ackA를 상기 실시예 2-1과 동일한 방법으로 KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE에 형질전환하여 염색체 내 pta-ackA 개시코돈 앞에 lysCP1 프로모터가 도입되었음을 확인하였다. 상기 코리네박테리움 글루타미쿰 변이주를 KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA라 명명하였다.
4-2. 퓨트레신 배출능이 증가된 균주에서 대장균 유래 argA , argE 도입 및 pta-ackA 프로모터 치환 균주의 퓨트레신 생산능 평가
퓨트레신 배출능이 증가된 코리네박테리움 글루타미쿰 생산균주에 대장균 유래 argA와 대장균 유래 argE 도입 및 pta-ackA의 활성 강화가 미치는 효과를 확인하기 위하여, 상기 실시예 4-1에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 퓨트레신 생산능을 비교하였다.
구체적으로, 코리네박테리움 글루타미쿰 변이주(KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE, KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA)와 모균주(KCCM11401P)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다. 이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수고형 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4·7H2O 0.05%, urea 0.15%, 바이오틴 100 μg, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5%, 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 98시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 각 배양물로부터 생산된 퓨트레신 농도를 측정하고 그 결과를 하기 표 8에 나타내었다.
균주명 퓨트레신 (g/L)
KCCM11401P 11.8
KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE 13.2
KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA 13.7
상기 표 8에 나타난 바와 같이, 퓨트레신 배출능이 강화된 KCCM11401P에 대장균 유래 argA와 대장균 유래 argE 유전자를 도입하였을 때, 모균주 대비 생산량이 11.9% 증가하고, 추가적으로 pta-ackA를 강화시켰을 때는 모균주 대비 생산량이 16.1% 증가하였음을 확인하였다.
실시예 5: 오르니틴 생산 균주에서 대장균 유래 argA 및 대장균 유래 argE 도입 및 이의 오르니틴 생산능 확인
5-1. KCCM11137P 기반 오르니틴 생산 균주의 트랜스포존 유전자 내로의 대장균 유래 argA 및 대장균 유래 argE 동시 도입 균주의 제작
코리네박테리움 글루타미쿰 ATCC13032 기반의 오르니틴 생산 균주인 KCCM11137P (대한민국 등록특허 제10-1372635호)에 대장균 유래 argA와 대장균 유래 argE 유전자 삽입하여 오르니틴 생산능이 향상하는지를 확인하기 위해, 상기 실시예 1-1에서 제작한 벡터를 이용하여 argA와 argE를 트랜스포존 유전자 내에 도입하였다.
먼저 실시예 1-1에서 제작한 플라스미드 pDZTn-lysCP1-argA를 KCCM11137P 에 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin--D-galactoside)이 함유된 BHIS 평판 배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZTn-lysCP1-argA가 도입된 균주를 선별하였다.
상기 선별된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다. 형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 argA를 코딩하는 유전자가 도입된 균주를 최종 선별하였다. 최종 선별된 균주를 대상으로 서열번호 12 및 13인 프라이머 쌍을 이용해 PCR을 수행하여 argA를 코딩하는 유전자가 도입되었음을 확인하고, 상기 코리네박테리움 글루타미쿰 변이주를 KCCM11137P Tn:lysCP1-argA 로 명명하였다.
상기 제작된 argA 도입 균주에 argE를 도입하기 위해, 상기 실시예 1-1에서 제작한 pDZTn-lysCP1-argE를 동일한 방법으로 KCCM11137P Tn:lysCP1-argA에 형질전환하여 트랜스포존내 argE가 도입되었음을 확인하였다.
이로부터 선별된 코리네박테리움 글루타미쿰 변이주를 KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE라 명명하였다.
5-2. 대장균 유래 argA 및 대장균 유래 argE 유전자가 도입된 코리네 오르니틴 생산 균주의 오르니틴 생산능 평가
오르니틴 생산 균주에서 argA와 argE 도입시 오르니틴 생산에 미치는 효과를 확인하기 위하여, 상기 실시예 5-1에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 오르니틴 생산능을 비교하였다.
구체적으로, 1종의 코리네박테리움 글루타미쿰 변이주(KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE)와 1종의 모균주(KCCM11137P)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다. 이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수고형 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4·7H2O 0.05%, urea 0.15%, 바이오틴 100 μg, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5%, 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 98시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 각 배양물로부터 생산된 오르니틴 농도를 측정하고 그 결과를 하기 표 9에 나타내었다.
균주명 오르니틴 (g/L)
KCCM11137P 7.8
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE 8.9
상기 표 9에 나타난 바와 같이, 대장균 유래 argA와 대장균 유래 argE 유전자가 동시에 도입된 코리네박테리움 글루타미쿰 변이주는 오르니틴 생산량이 모균주 대비 14.1% 증가하였음을 확인하였다.
실시예 6: 대장균 유래 argA 및 대장균 유래 argE가 도입된 오르니틴 생산 균주에서 pta-ackA 강화 및 이의 오르니틴 생산능 확인
6-1. ATCC13032 기반 오르니틴 생산균주에서 pta- ackA 프로모터 치환 균주의 제작
대장균 유래 argA 및 대장균 유래 argE가 도입된 ATCC13032 기반 오르니틴 생산균주에서 pta-ackA 활성 강화로 오르니틴 생산능이 향상하는지를 확인하기 위해, 염색체 내 pta-ackA 오페론의 개시코돈 앞에 lysCP1 프로모터(국제공개특허 WO 2009/096689)를 도입하였다.
먼저 상기 실시예 2-1에서 제작한 플라스미드 pDZ-lysCP1-1'pta-ackA를 KCCM11137P 및 KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE에 각각 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin--D-galactoside)이 함유된 BHIS 평판 배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZ-lysCP1-1'pta-ackA가 도입된 균주를 선별하였다.
상기 선별된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다. 형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 최종적으로 pta-ackA 프로모터가 lysCP1으로 치환된 균주를 선별하였다. 최종 선별된 균주를 대상으로 서열번호 19 및 21인 프라이머 쌍을 이용해 PCR을 수행하여 염색체 내 pta-ackA 개시코돈 앞에 lysCP1 프로모터가 도입되었음을 확인하였다. 이때 PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 1분의 신장 과정을 30회 반복하였다.
이로부터 선별된 코리네박테리움 글루타미쿰 변이주를 각각 KCCM11137P lysCP1-1'pta-ackA 및 KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA라 명명하였다.
6-2. pta-ackA 강화 균주의 오르니틴 생산능 평가
대장균 유래 argA와 대장균 유래 argE 도입된 오르니틴 생산균주에서 pta-ackA 강화가 미치는 효과를 확인하기 위하여, 상기 실시예 6-1에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 오르니틴 생산능을 비교하였다.
구체적으로, 2종의 코리네박테리움 글루타미쿰 변이주(KCCM11137P lysCP1-1'pta-ackA; KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA)와 2종의 모균주(KCCM11137P; KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다. 이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수고형 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4·7H2O 0.05%, urea 0.15%, 바이오틴 100 μg, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5%, 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 98시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 각 배양물로부터 생산된 오르니틴 농도를 측정하고 그 결과를 하기 표 10에 나타내었다.
균주명 오르니틴 (g/L)
KCCM11137P 7.8
KCCM11137P lysCP1-1'pta-ackA 7.7
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE 8.9
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA 9.4
상기 표 10에 나타난 바와 같이, KCCM11137P에 pta-ackA를 강화시켰을 때 오르니틴 생산량은 증가하지 않았으나, 대장균 유래 argA와 대장균 유래 argE 유전자가 동시에 도입된 코리네박테리움 글루타미쿰 변이주 KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE에 pta-ackA를 강화시켰을 때 오르니틴 생산량이 KCCM11137P 대비 20.5%증가하고, KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE에 대비하여서는 5.6% 증가함을 확인하였다.
실시예 7: 대장균 유래 argA 및 대장균 유래 argE가 도입된 오르니틴 생산균 주의 대장균 유래 acs 도입 및 이의 오르니틴 생산능 확인
7-1. KCCM11137P 기반 오르니틴 생산 균주의 트랜스포존 유전자 내로의 대장균 유래 acs 도입 균주의 제작
대장균 유래 argA 및 대장균 유래 argE가 도입된 ATCC13032 기반의 오르니틴 생산 균주인 KCCM11137P (대한민국 등록특허 제10-1372635호)에서 대장균 유래 acs 유전자 도입으로 오르니틴 생산능이 향상하는지를 확인하기 위해, lysCP1 프로모터를 이용하여 acs를 트랜스포존 유전자 내에 도입하였다.
먼저 상기 실시예 3-1에서 제작한 플라스미드 pDZTn-lysCP1-acs를 KCCM11137P 및 KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE에 각각 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin--D-galactoside)이 함유된 BHIS 평판 배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZTn-lysCP1-acs가 도입된 균주를 선별하였다.
상기 선별된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다. 형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 acs를 코딩하는 유전자가 도입된 균주를 최종 선별하였다.
최종 선별된 균주를 대상으로 서열번호 13 및 25인 프라이머 쌍을 이용해 PCR을 수행하여 acs를 코딩하는 유전자가 도입되었음을 확인하고, 상기 코리네박테리움 글루타미쿰 변이주를 각각 KCCM11137P Tn:lysCP1-acs 및 KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs라 명명하였다.
7-2. 대장균 유래 acs 유전자 도입 균주의 오르니틴 생산능 평가
대장균 유래 argA와 대장균 유래 argE 도입된 오르니틴 생산 균주에서 acs 도입이 미치는 효과를 확인하기 위하여, 상기 실시예 7-1에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 오르니틴 생산능을 비교하였다.
구체적으로, 2종의 코리네박테리움 글루타미쿰 변이주(KCCM11137P Tn:lysCP1-acs; KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs)와 2종의 모균주(KCCM11137P; KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다. 이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수고형 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4·7H2O 0.05%, urea 0.15%, 바이오틴 100 μg, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5%, 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 98시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 각 배양물로부터 생산된 오르니틴 농도를 측정하고 그 결과를 하기 표 11에 나타내었다.
균주명 오르니틴 (g/L)
KCCM11137P 7.8
KCCM11137P Tn:lysCP1-acs 7.8
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE 8.9
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs 9.2
상기 표 11에 나타난 바와 같이, KCCM11137P에 acs를 도입시켰을 때 오르니틴 생산량은 증가하지 않았으나, 대장균 유래 argA와 대장균 유래 argE 유전자가 동시에 도입된 코리네박테리움 글루타미쿰 변이주 KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE에 acs를 도입시켰을 때는 오르니틴 생산량이 KCCM11137P 대비하여 17.9% 증가하였음을 확인하였다. 또한, KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE에 대비하여서는 3.4% 증가하였음을 확인하였다.
상기 내용을 종합하면, 퓨트레신 또는 오르니틴을 생산하는 코리네박테리움 균주에 있어서, 대장균 유래 argA 및 대장균 유래 argE를 도입하는 것을 통해 퓨트레신과 오르니틴의 생산량이 증가하는 것을 확인하였으며, 추가적으로 코리네박테리움 내부의 pta-ackA 유전자 활성을 강화시키거나 대장균 유래 acs를 도입하는 경우, 퓨트레신과 오르니틴의 생산량이 더욱 증가하는 것을 확인하였다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당 업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2016007841-appb-I000001

Claims (17)

  1. 대장균 유래 N-아세틸글루타메이트 신타아제(N-acetylglutamate synthase) 및 대장균 유래 아세틸오르니틴 디아세틸라제(Acetylornithine deacetylase)의 활성이 도입된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  2. 제1항에 있어서, 상기 대장균 유래 N-아세틸글루타메이트 신타아제는 서열번호 1의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  3. 제1항에 있어서, 상기 대장균 유래 아세틸오르니틴 디아세틸라제는 서열번호 3의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  4. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  5. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 포스포트랜스아세틸라제(phosphotransacetylase) 및 아세트산 인산화효소(acetate kinase) 오페론(pta-ackA operon)의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  6. 제5항에 있어서, 상기 포스포트랜스아세틸라제 및 아세트산 인산화효소 오페론은 서열번호 5 또는 서열번호 7의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  7. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 대장균 유래 아세틸-CoA 합성효소(acetyl-CoA synthetase, acs)의 활성이 도입된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  8. 제7항에 있어서, 상기 아세틸-CoA 합성효소는 서열번호 9의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  9. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 오르니틴 디카복실라제(ornithine decarboxylase, ODC)의 활성이 도입되는 것인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  10. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 i) 오르니틴 카르바모일 트랜스퍼라아제(ArgF), ii) 글루타메이트 엑스포터 또는 iii) 오르니틴 카르바모일 트랜스퍼라아제 및 글루타메이트 엑스포터의 활성이 내재적 활성에 비해 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  11. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제(ArgJ), 아세틸 글루타메이트 키나아제(ArgB), 및 아세틸 오르니틴 아미노 트랜스퍼라아제(ArgD)로 구성되는 군으로부터 선택되는 1종 이상의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  12. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아세틸트랜스퍼라아제의 활성이 내재적 활성보다 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  13. 제12항에 있어서, 상기 아세틸트랜스퍼라아제는 서열번호 30 또는 31의 아미노산 서열로 구성되는 단백질인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  14. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 퓨트레신 엑스포터의 활성이 내재적 활성보다 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  15. 제14항에 있어서, 상기 퓨트레신 엑스포터는 서열번호 26 또는 서열번호 28의 아미노산 서열로 구성되는 단백질인, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  16. (i) 제1항 내지 제15항 중 어느 한 항에 따른 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
    (ii) 상기 배양된 미생물 또는 배지로부터 퓨트레신 또는 오르니틴을 회수하는 단계를 포함하는, 퓨트레신 또는 오르니틴의 생산방법.
  17. 제16항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, 퓨트레신 또는 오르니틴의 생산 방법.
PCT/KR2016/007841 2015-07-20 2016-07-19 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 Ceased WO2017014532A1 (ko)

Priority Applications (15)

Application Number Priority Date Filing Date Title
CN201680042463.1A CN107922955B (zh) 2015-07-20 2016-07-19 用于产生腐胺或鸟氨酸的微生物和使用其产生腐胺或鸟氨酸的方法
CA2992970A CA2992970C (en) 2015-07-20 2016-07-19 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
BR112018001231-9A BR112018001231B1 (pt) 2015-07-20 2016-07-19 Microrganismo modificado corynebacterium glutamicum que produz putrescina ou ornitina e método para produzir putrescina ou ornitina cultivando o dito microrganismo
MYPI2018000053A MY184142A (en) 2015-07-20 2016-07-19 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
JP2018502763A JP6543758B2 (ja) 2015-07-20 2016-07-19 プトレシンまたはオルニチンの生産微生物及びそれを用いたプトレシンまたはオルニチンの生産方法
RU2018104512A RU2708165C2 (ru) 2015-07-20 2016-07-19 Микроорганизмы для получения путресцина или орнитина и способ получения путресцина или орнитина с использованием указанных микроорганизмов
PH1/2018/500150A PH12018500150B1 (en) 2015-07-20 2016-07-19 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
NZ73865816A NZ738658A (en) 2015-07-20 2016-07-19 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
US15/746,300 US10640753B2 (en) 2015-07-20 2016-07-19 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
AU2016297226A AU2016297226B2 (en) 2015-07-20 2016-07-19 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
MX2018000337A MX386980B (es) 2015-07-20 2016-07-19 Microorganismos para la producción de putrescina u ornitina y procedimiento para la producción de putrescina u ornitina usando los mismos.
SG11201800254SA SG11201800254SA (en) 2015-07-20 2016-07-19 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
US16/507,676 US10815464B2 (en) 2015-07-20 2019-07-10 Microorganisms for producing putrescine and process for producing putrescine using them
US16/805,040 US11268074B2 (en) 2015-07-20 2020-02-28 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
US17/074,203 US11365400B2 (en) 2015-07-20 2020-10-19 Microorganism for producing ornithine and process for producing ornithine using them

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0102624 2015-07-20
KR1020150102624A KR101735935B1 (ko) 2015-07-20 2015-07-20 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US15/746,300 A-371-Of-International US10640753B2 (en) 2015-07-20 2016-07-19 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
US16/507,676 Division US10815464B2 (en) 2015-07-20 2019-07-10 Microorganisms for producing putrescine and process for producing putrescine using them
US16/805,040 Continuation US11268074B2 (en) 2015-07-20 2020-02-28 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them

Publications (1)

Publication Number Publication Date
WO2017014532A1 true WO2017014532A1 (ko) 2017-01-26

Family

ID=57326155

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/007841 Ceased WO2017014532A1 (ko) 2015-07-20 2016-07-19 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법

Country Status (16)

Country Link
US (4) US10640753B2 (ko)
EP (1) EP3141598B1 (ko)
JP (1) JP6543758B2 (ko)
KR (1) KR101735935B1 (ko)
CN (1) CN107922955B (ko)
AU (1) AU2016297226B2 (ko)
CA (1) CA2992970C (ko)
CL (1) CL2018000111A1 (ko)
MX (2) MX386980B (ko)
MY (1) MY184142A (ko)
NZ (1) NZ738658A (ko)
PH (1) PH12018500150B1 (ko)
RU (2) RU2708165C2 (ko)
SG (1) SG11201800254SA (ko)
TW (1) TWI635176B (ko)
WO (1) WO2017014532A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2817284C1 (ru) * 2020-08-13 2024-04-12 СиДжей ЧеилДжеданг Корпорейшн Микроорганизм для продуцирования путресцина и способ получения путресцина с его применением

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101937569B1 (ko) * 2017-06-14 2019-01-11 씨제이제일제당 (주) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
KR101941775B1 (ko) * 2017-06-14 2019-01-24 씨제이제일제당 (주) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
KR102011394B1 (ko) * 2017-07-19 2019-10-22 씨제이제일제당 주식회사 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산방법
CN108642100B (zh) * 2018-05-16 2020-12-29 江南大学 一种在钝齿棒杆菌中合成l-鸟氨酸的方法
AU2020299358A1 (en) * 2019-07-02 2021-12-23 Codexis, Inc. Engineered acetate kinase variant enzymes
KR102246288B1 (ko) * 2020-08-13 2021-04-29 씨제이제일제당 주식회사 퓨트레신 생산 미생물 및 이를 이용한 퓨트레신 생산방법
EP4239070A4 (en) * 2020-10-28 2025-09-10 Ajinomoto Kk PROCESS FOR THE PRODUCTION OF L-AMINO ACID
KR102734703B1 (ko) * 2021-10-15 2024-11-26 씨제이제일제당 주식회사 L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
KR20250156921A (ko) * 2024-04-25 2025-11-04 씨제이제일제당 (주) 글루타메이트 계열 아미노산 생산 미생물 및 이를 이용한 글루타메이트 계열 아미노산 생산 방법
KR102919411B1 (ko) * 2024-04-25 2026-01-28 씨제이제일제당 (주) 신규한 이중 기능성 글루타메이트 n-아세틸트랜스퍼라제/아미노산 아세틸트랜스퍼라제 변이체 및 이를 이용한 글루타메이트 계열 아미노산 생산 방법

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130082478A (ko) * 2012-01-11 2013-07-19 씨제이제일제당 (주) 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법
KR20140115244A (ko) * 2013-03-20 2014-09-30 씨제이제일제당 (주) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법

Family Cites Families (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE1642678A1 (de) * 1966-02-19 1971-06-03 Ajinomoto Kk Verfahren zur Herstellung von L-Ornithin und gegebenenfalls L-Isoleucin auf biologischem Wege
JPS6066989A (ja) 1983-09-24 1985-04-17 Kyowa Hakko Kogyo Co Ltd L−アルギニンの製造法
JPH0755155B2 (ja) 1986-09-10 1995-06-14 協和醗酵工業株式会社 アミノ酸の製造法
JP4682454B2 (ja) * 2000-06-28 2011-05-11 味の素株式会社 新規変異型n−アセチルグルタミン酸合成酵素及びl−アルギニンの製造法
EP1201758B1 (en) 2000-10-27 2008-04-09 Ajinomoto Co., Inc. Microorganisms and method for L-arginine production by fermentation
CN103146593B (zh) * 2004-01-30 2015-07-15 味之素株式会社 生产l-氨基酸的微生物和生产l-氨基酸的方法
US8497098B2 (en) 2004-07-15 2013-07-30 Dsm Ip Assets B.V. Biochemical synthesis of 1,4-butanediamine
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
DE102005020538A1 (de) * 2005-05-03 2006-11-23 Degussa Ag Verfahren zur Herstellung von L-Aminosäuren unter Verwendung von verbesserten Stämmen der Familie Enterobacteriaceae
WO2007086608A1 (en) * 2006-01-27 2007-08-02 Ajinomoto Co., Inc. Method for producing l-amino acid
JP5180060B2 (ja) * 2006-02-24 2013-04-10 三菱化学株式会社 有機酸生産菌及び有機酸の製造法
JP2009060791A (ja) * 2006-03-30 2009-03-26 Ajinomoto Co Inc L−アミノ酸生産菌及びl−アミノ酸の製造法
US8133714B2 (en) 2007-09-27 2012-03-13 Evonik Degussa Gmbh Process for the fermentative preparation of organic chemical compounds using coryneform bacteria in which the SugR gene is present in attenuated form
KR100930203B1 (ko) 2008-01-28 2009-12-07 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 l-라이신의 생산 방법
KR101126041B1 (ko) 2008-04-10 2012-03-19 씨제이제일제당 (주) 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 l-라이신 생산방법
BRPI0903495B1 (pt) 2008-04-10 2019-01-29 Korea Advanced Institute Of Science And Technology microorganismos mutantes com capacidade de produzir putrescina e método para produção de putrescina utilizando os mesmos
JP2012223091A (ja) 2009-08-25 2012-11-15 Ajinomoto Co Inc L−アミノ酸の製造法
KR101174267B1 (ko) * 2010-01-06 2012-08-14 씨제이제일제당 (주) L-오르니틴 또는 l-아르기닌 생산 변이주 및 이의 제조방법
RU2010101135A (ru) * 2010-01-15 2011-07-20 Закрытое акционерное общество "Научно-исследовательский институт "Аджиномото-Генетика" (ЗАО АГРИ) (RU) Бактерия семейства enterobacteriaceae - продуцент l-аспартата или метаболитов, производных l-аспартата, и способ получения l-аспартата или метаболитов, производных l-аспартата
KR101381048B1 (ko) * 2010-10-20 2014-04-14 씨제이제일제당 (주) O-포스포세린 생산 균주 및 이로부터 생산된 o-포스포세린으로부터 l-시스테인 또는 이의 유도체의 생산방법
KR101372635B1 (ko) 2010-12-08 2014-03-13 씨제이제일제당 (주) 오르니틴 생산능이 향상된 미생물 및 이를 이용하여 오르니틴을 생산하는 방법
CN102191291B (zh) * 2011-04-25 2013-05-08 武汉远大弘元股份有限公司 一种利用基因工程菌生产l-鸟氨酸盐酸盐的方法
RU2550269C2 (ru) * 2012-08-17 2015-05-10 Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО "АГРИ") СПОСОБ ПОЛУЧЕНИЯ L-АРГИНИНА С ИСПОЛЬЗОВАНИЕМ БАКТЕРИИ СЕМЕЙСТВА Enterobacteriaceae, СОДЕРЖАЩЕЙ N-АЦЕТИЛОРНИТИНДЕАЦЕТИЛАЗУ С НАРУШЕННОЙ АКТИВНОСТЬЮ
WO2017127567A1 (en) * 2016-01-19 2017-07-27 Genebiologics, Llc Production of arginine-rich proteins and use as a fertilizer and germination enhancer
CN108642100B (zh) * 2018-05-16 2020-12-29 江南大学 一种在钝齿棒杆菌中合成l-鸟氨酸的方法

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130082478A (ko) * 2012-01-11 2013-07-19 씨제이제일제당 (주) 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법
KR20140115244A (ko) * 2013-03-20 2014-09-30 씨제이제일제당 (주) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank 9 April 2014 (2014-04-09), Database accession no. EZG54 138.1 *
DATABASE NCBI 26 June 2015 (2015-06-26), Database accession no. WP_003862331.1 *
DATABASE NCBI 28 May 2014 (2014-05-28), Database accession no. WP_000359434.1 *
DOU, WENFANG ET AL.: "Improvement of L-arginine Production by Overexpression of a Bifunctional Ornithine Acetyltransferase in Corynebacterium Crenatum", APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY, vol. 165, 2011, pages 845 - 855 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2817284C1 (ru) * 2020-08-13 2024-04-12 СиДжей ЧеилДжеданг Корпорейшн Микроорганизм для продуцирования путресцина и способ получения путресцина с его применением

Also Published As

Publication number Publication date
RU2018104512A3 (ko) 2019-08-20
NZ738658A (en) 2019-09-27
KR101735935B1 (ko) 2017-05-16
SG11201800254SA (en) 2018-02-27
MX2018000337A (es) 2018-03-14
US20180208909A1 (en) 2018-07-26
EP3141598A2 (en) 2017-03-15
RU2721852C1 (ru) 2020-05-25
CN107922955B (zh) 2021-04-27
PH12018500150B1 (en) 2023-08-18
JP2018520687A (ja) 2018-08-02
US20210054347A1 (en) 2021-02-25
EP3141598A3 (en) 2017-06-21
TWI635176B (zh) 2018-09-11
RU2708165C2 (ru) 2019-12-04
EP3141598B1 (en) 2018-10-31
TW201718863A (zh) 2017-06-01
RU2018104512A (ru) 2019-08-20
US10815464B2 (en) 2020-10-27
MY184142A (en) 2021-03-22
US11365400B2 (en) 2022-06-21
CA2992970A1 (en) 2017-01-26
CL2018000111A1 (es) 2018-05-11
BR112018001231A2 (pt) 2018-09-25
AU2016297226A1 (en) 2018-01-25
AU2016297226B2 (en) 2019-06-27
US20200002686A1 (en) 2020-01-02
MX2021007245A (es) 2021-07-15
US11268074B2 (en) 2022-03-08
PH12018500150A1 (en) 2018-07-23
CA2992970C (en) 2019-12-03
KR20170010960A (ko) 2017-02-02
US10640753B2 (en) 2020-05-05
JP6543758B2 (ja) 2019-07-10
US20200190486A1 (en) 2020-06-18
MX386980B (es) 2025-03-19
CN107922955A (zh) 2018-04-17

Similar Documents

Publication Publication Date Title
WO2017069578A1 (ko) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
WO2016208854A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2021049866A1 (ko) L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법
WO2019164348A1 (ko) 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021150029A1 (ko) Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 l-아미노산을 생산하는 방법
WO2021261733A1 (ko) L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2020226341A1 (ko) L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2021060696A1 (ko) 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2018230978A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2019017706A2 (ko) 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산방법
WO2022244932A1 (ko) 신규 프로모터 및 이의 용도
WO2018230977A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
CN107922955B (zh) 用于产生腐胺或鸟氨酸的微生物和使用其产生腐胺或鸟氨酸的方法
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2023054881A1 (ko) 신규한 아세토하이드록시산 신테아제 변이체 및 이를 이용한 l-이소류신 생산방법
WO2022164118A1 (ko) 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
WO2023277307A1 (ko) 고농도 l-글루탐산을 생산하기 위한 균주 및 이를 이용한 l-글루탐산 생산방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2015163591A1 (ko) 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법
WO2015163592A1 (ko) 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16828036

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: MX/A/2018/000337

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 11201800254S

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 2992970

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 12018500150

Country of ref document: PH

ENP Entry into the national phase

Ref document number: 2018502763

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15746300

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016297226

Country of ref document: AU

Date of ref document: 20160719

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2018104512

Country of ref document: RU

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018001231

Country of ref document: BR

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 07/05/2018)

ENP Entry into the national phase

Ref document number: 112018001231

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20180119

122 Ep: pct application non-entry in european phase

Ref document number: 16828036

Country of ref document: EP

Kind code of ref document: A1