WO2015163592A1 - 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법 - Google Patents

다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법 Download PDF

Info

Publication number
WO2015163592A1
WO2015163592A1 PCT/KR2015/003066 KR2015003066W WO2015163592A1 WO 2015163592 A1 WO2015163592 A1 WO 2015163592A1 KR 2015003066 W KR2015003066 W KR 2015003066W WO 2015163592 A1 WO2015163592 A1 WO 2015163592A1
Authority
WO
WIPO (PCT)
Prior art keywords
diamine
microorganism
protein
seq
amino acid
Prior art date
Application number
PCT/KR2015/003066
Other languages
English (en)
French (fr)
Inventor
이경민
박수진
정희경
양영렬
리홍선
엄혜원
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to JP2017507656A priority Critical patent/JP6526791B2/ja
Priority to CN201580034465.1A priority patent/CN106574234B/zh
Priority to RU2016141403A priority patent/RU2696504C2/ru
Priority to EP15783109.0A priority patent/EP3135758B1/en
Priority to BR112016024970A priority patent/BR112016024970A2/pt
Priority to US15/306,758 priority patent/US10640797B2/en
Priority to AU2015250514A priority patent/AU2015250514B2/en
Publication of WO2015163592A1 publication Critical patent/WO2015163592A1/ko
Priority to US16/000,619 priority patent/US10640798B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/001—Amines; Imines
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01057—Diamine N-acetyltransferase (2.3.1.57)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts

Definitions

  • the present invention relates to a microorganism having a diamine production capacity and a method for producing a diamine using the same.
  • Biogenic amines are nitrogen compounds produced mainly by decarboxylation of amino acids, amination of aldehydes and ketones, and amino group transfer reactions. Such biogenic amines are low molecular weight and are synthesized during the metabolism of microorganisms, plants and animals, and thus are known as components commonly found in these cells.
  • polyamines such as spermidine, spermine, putrescine or putrescine or 1,4-butanediamine and cadaverine are representative examples.
  • putrescine is an important raw material for synthesizing polyamine nylon-4,6 by reacting with adipic acid, mainly acrylonitrile and succinonitrile from propylene.
  • the fermentation is mainly produced by chemical synthesis.
  • cadaverine is a odorless diamine compound produced by hydrolysis of proteins during rot of animal tissues.
  • Cadaverine has a chemical formula of NH 2 (CH 2 ) 5 NH 2 and is similar to putrescine.
  • the cadaverine may be used as a component of a polymer such as polyamide or polyurethane, a chelating agent or other additives.
  • polyamide-5,4 which has a global market of 3.5 million tons per year, is known to be produced by the condensation of cadaverine or succinic acid, and has attracted great attention as an industrial base compound.
  • This cadaverine is a diamine found in several microorganisms (Tabor and Tabor, Microbiol Rev., 49: 81-99,1985), and L-lysine decarboxylase from L-lysine in the Gram-negative bacterium Escherichia coli. Direct biosynthesis using Cardaberine concentrations in E. coli are regulated by biosynthesis, degradation, absorption and release of cardaberine (Soksawatmaekhin et al., Mol Microbiol., 51: 1401-1412,2004).
  • the inventors of the present invention sought to increase the production capacity of diamines in microorganisms having diamine production ability by identifying proteins having the ability to release diamines such as putrescine or cadaverine, resulting in alkanobacterium hamorityum Derived proteins or proteins having high amino acid sequence homology with diamine have a diamine-releasing ability, which is introduced into a microorganism having a diamine-producing ability to enhance its activity, thereby reducing the diamine-like ability of diamines such as putrescine and cadaverine. It was confirmed that it can increase significantly, and completed the present invention.
  • One object of the present invention is to provide a microorganism having a diamine production capacity.
  • Another object of the present invention is to obtain a culture by (i) culturing the microorganism having the diamine production capacity; And (ii) recovering the diamine from the cultured microorganism or culture.
  • ARCH_0271 protein derived from alkanobacterium hamoriticum is a protein having a diamine excretion capacity, and the activity of the protein is introduced into a strain of Corynebacterium sp. It was confirmed that the putrescine can be enhanced. In addition, when the activity of the protein is introduced into E. coli, which has a production route of putrescine and cadaverine, it was confirmed that the production of putrescine and cadaverine increases simultaneously. Therefore, by applying ARCH_0271 protein derived from alkanobacterium haemoritumum to a microorganism having a diamine production ability, it will be possible to bring about an effective production of diamine.
  • the present invention provides a diamine production, wherein the activity of the protein comprising the amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having a sequence homology of 42% or more To provide a microorganism having the ability.
  • diamine refers to a compound having two amine groups, and specific examples thereof include putrescine and cadaverine. Putrescine can be produced by using ornithine as tetramethylenediamine. Cadaverine is named 1,5-pentanediamine or pentamethylenediamine and can be produced using lysine as a precursor. Such diamine is a base compound having industrial applicability, which has important value as a raw material that can be synthesized into a polymer such as polyamine nylon, polyamide or polyurethane.
  • the term "protein comprising the amino acid sequence set forth in SEQ ID NO: 6” refers to alkanobacterium hamoriticum ( Arcanobacterium) haemolyticum ), a protein present also named ARCH_0271.
  • the protein was found to have high homology with NCgl2522, a membrane protein of Corynebacterium.
  • the ARCH_0271 protein is estimated to be involved in the release of diamine in a strain having a diamine production ability, it was found that the production capacity of the diamine can be significantly increased.
  • the ARCH_0271 protein having the amino acid sequence set forth in SEQ ID NO: 6 may be a protein that is typically encoded by the nucleotide sequence set forth in SEQ ID NO: 5 or 7.
  • the polynucleotide encoding the ARCH_0271 protein does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codon or in consideration of the codon preferred in the organism to express the protein.
  • Various modifications may be made to the coding region within a range, and may be encoded by various nucleotide sequences in addition to the nucleotide sequence set forth in SEQ ID NO: 5 or 7.
  • nucleotide sequence described in SEQ ID NO: 7 is a codon optimized sequence for the codon use frequency of Corynebacterium glutamicum with respect to the ARCH_0271 gene (SEQ ID NO: 5), but is not limited thereto.
  • the ARCH_0271 protein as well as the amino acid sequence of SEQ ID NO: 6, 40% or more, preferably 60% or more, more preferably 80% or more, even more preferably 90% or more with the sequence; Even more preferably, an amino acid sequence exhibiting at least 95% homology, most preferably at least 99% homology, and any protein that is substantially involved in diamine excretion, including, without limitation, SEQ ID NO: 6 If it is an amino acid sequence having the same or corresponding biological activity as the protein of, it is obvious that some of the sequences have an amino acid sequence deleted, modified, substituted or added to the scope of the present invention.
  • a protein comprising an amino acid sequence having at least 42% sequence homology with an amino acid sequence as set out in SEQ ID NO: 6 refers to an amino acid sequence having at least 42% homology with an amino acid sequence as set out in SEQ ID NO: 6.
  • a protein having substantially diamine releasing ability including, it is meant to be included without limitation.
  • it may include a protein including the amino acid sequence of SEQ ID NO: 23, or 26, but is not limited thereto.
  • the protein comprising the amino acid sequence set forth in SEQ ID NO: 23 may be alkali genes Packalis subsp. Alcaligenes faecalis subsp. faecalis), also referred to as QWA_00075.
  • the protein was found to have 41% homology with NCgl2522, a membrane protein of Corynebacterium, and 42% homology with ARCH_0271 of Alkanobacterium haemolyticum.
  • the QWA_00075 protein has a diamine-releasing ability in a strain having a diamine-producing ability, thereby significantly increasing the diamine-producing ability.
  • the QWA_00075 protein comprising the amino acid sequence set forth in SEQ ID NO: 23 may be a protein typically encoded by the nucleotide sequence set forth in SEQ ID NO: 22 or 24.
  • the polynucleotide encoding the protein does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codon or in consideration of the codons preferred in the organism to express the protein.
  • Various modifications may be made to the coding region within, and may be encoded by various nucleotide sequences in addition to the nucleotide sequence set forth in SEQ ID NO: 22 or 24.
  • nucleotide sequence described in SEQ ID NO: 24 is a codon optimized sequence for codon use frequency of Corynebacterium glutamicum with respect to the QWA_00075 gene (SEQ ID NO: 22), but is not limited thereto.
  • the protein comprising the amino acid sequence set forth in SEQ ID NO: 26 is Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia ), also known as SMD_2351.
  • Stenotrophomonas maltophilia also known as SMD_2351.
  • the protein was identified to have 52% homology with NCgl2522, a membrane protein of Corynebacterium, and 47% homology with ARCH_0271 of Alkanobacterium haemolyticum.
  • the SMD_2351 protein has a diamine-producing ability in a strain having a diamine-producing ability, thereby significantly increasing the diamine-producing ability.
  • the SMD_2351 protein comprising the amino acid sequence set forth in SEQ ID NO: 26 may be a protein that is typically encoded by the nucleotide sequence set forth in SEQ ID NO: 25 or 27.
  • the polynucleotide encoding the protein does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codon or in consideration of the codons preferred in the organism to express the protein.
  • Various modifications may be made to the coding region within, and may be encoded by various nucleotide sequences in addition to the nucleotide sequence set forth in SEQ ID NO: 25 or 27.
  • nucleotide sequence described in SEQ ID NO: 27 is a codon optimized sequence for the codon use frequency of Corynebacterium glutamicum with respect to the SMD_2351 gene (SEQ ID NO: 25), but is not limited thereto.
  • homologous sequences thereof having the same or similar activity as a given amino acid sequence or base sequence are designated as "% homology".
  • % homology For example, using standard software that calculates parameters such as score, identity and similarity, in particular BLAST 2.0, or by hybridization experiments used under defined stringent conditions Can be identified by comparison and the appropriate hybridization conditions defined are within the scope of the art (see for example Sambrook et al., 1989, infra) and can be determined by methods well known to those skilled in the art.
  • microorganism having a diamine producing ability may mean a microorganism having a diamine producing ability imparted to a parent strain having no diamine producing ability, or a microorganism having an intrinsic diamine producing ability.
  • the microorganism having a diamine producing ability may be a microorganism having a producing ability of putrescine or cadaverine.
  • the "microorganism having the putrescine production ability" is not particularly limited, but acetylglutamate synthase or acetylornithine that converts glutamate to acetylglutamate to enhance the biosynthetic pathway from glutamate to ornithine Ornithine acetyltransferase (ArgJ), which converts to ornithine, acetylglutamate kinase (ArgB), which converts acetylglutamate to acetylglutamyl phosphate, and acetylglutamate semialdehyde (N acetyl gamma glutamyl phosphate reductase (ArgC) to convert to -acetylglutamate semialdehyde, or acetylornithine aminotransferase (ArgD) to convert acetylglutamate semialdehyde to acetylornith
  • the microorganism having the putrescine-producing ability is ornithine carbamoyltransfrase (ArgF) involved in arginine synthesis in ornithine, a protein involved in the release of glutamate (NCgl1221), and / or purine It may be mutated to attenuate the activity of the protein that acetylates tresine (NCgl469) relative to the intrinsic activity, and / or modified to introduce the activity of ornithine decarboxylase (ODC).
  • ArgF ornithine carbamoyltransfrase
  • the acetyl gamma glutamyl phosphate reductase may include an amino acid sequence set forth in SEQ ID NO: 15.
  • Acetylglutamate synthase or ornithine acetyltransferase may comprise an amino acid sequence set forth in SEQ ID NO: 16.
  • Acetyl glutamate kinase (ArgB) may comprise an amino acid sequence set forth in SEQ ID NO: 17.
  • Acetylornithine aminotransferase (ArgD) may be one comprising the amino acid sequence set forth in SEQ ID NO: 18.
  • the amino acid sequence of each enzyme protein is not particularly limited thereto, and includes amino acid sequences having at least 80%, preferably at least 90%, more preferably at least 95% homology therewith, as long as they have the activity of each enzyme. can do.
  • the ornithine carbamoyl transferase may include an amino acid sequence set forth in SEQ ID NO: 19.
  • the protein involved in glutamate release may include an amino acid sequence set forth in SEQ ID NO: 20.
  • Ornithine decarboxylase may comprise an amino acid sequence set forth in SEQ ID NO: 21.
  • the amino acid sequence of each enzyme protein is not particularly limited thereto, and at least 80%, preferably at least 90%, more preferably at least 95%, particularly preferably at least 97% And amino acid sequences with identity.
  • the "microorganisms having the cadaverine production ability" is not particularly limited, but means a microorganism that introduces or enhances the activity of lysine decarboxylase (LDC) additionally in the microorganisms having lysine production capacity can do.
  • LDC lysine decarboxylase
  • it may be a microorganism having improved lysine production ability to increase the production of cadaverine.
  • Methods for improving lysine production capacity can be sufficiently predicted and utilized by those skilled in the art using methods known in the art.
  • the lysine decarboxylase is an enzyme having an activity of converting lysine to cadaverine, and can effectively produce cadaverine by introducing or enhancing its activity.
  • the lysine decarboxylase may include an amino acid sequence as set forth in SEQ ID NO: 33, but is not particularly limited thereto, and as long as it has the above activity, at least 80%, preferably at least 90%, more preferably For example, amino acid sequences having at least 95% homology.
  • production is a concept that includes not only producing diamine in a strain, but also discharging the diamine out of a cell, such as a culture solution.
  • the term "introduction of the activity of the protein” in the present invention means that the microorganisms do not have an endogenous protein to impart the activity of the protein from the outside, for example, can be performed by introducing a gene from the outside.
  • "enhancing protein activity” may mean enhancing the active state of a protein possessed or introduced by a microorganism over an intrinsic active state.
  • the introduction or enhancement of the activity of the protein by increasing the activity of the protein itself present in the strain by mutations or the like to derive effects beyond the original function, and / or increase the intrinsic gene activity of the protein present in the strain , but is not limited thereto, the activity of which is increased by intrinsic gene amplification from internal or external factors, increase in gene copy number, additional introduction of genes from outside, promoter replacement or modification, and the like.
  • the gene copy number increase in the above is not particularly limited, but may be performed in a form operably linked to a vector or by inserting into a chromosome in a host cell.
  • a host capable of being cloned and functioning independently of a host, to which a polynucleotide encoding a protein of the present invention is operably linked may be performed by introducing into a host cell, or the host is operably linked to the polynucleotide.
  • a vector capable of inserting the polynucleotide into the chromosome in the cell may be introduced into the host cell to increase the copy number of the polynucleotide in the chromosome of the host cell.
  • modification of the expression control sequence to increase the expression of the polynucleotide is not particularly limited, but deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence to further enhance the activity of the expression control sequence. Or by inducing a variation in the sequence by a combination thereof, or by replacing with a nucleic acid sequence having stronger activity.
  • the expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, a sequence for controlling termination of transcription and translation, and the like.
  • a promoter As used herein, the replacement or modification of a promoter is not particularly limited, but may be replaced or modified with a promoter that is stronger than the original promoter.
  • a strong heterologous promoter may be linked to the top of the polynucleotide expression unit, but examples of the strong promoter include a CJ7 promoter, a lysCP1 promoter, an EF-Tu promoter, a groEL promoter, an aceA or aceB promoter, and the like. May be operably linked to the Corynebacterium-derived promoter lysCP1 promoter or CJ7 promoter to improve the expression rate of the polynucleotide encoding the enzyme.
  • the lysCP1 promoter is an improved promoter through promoter site sequencing of polynucleotides encoding aspartate kinase and aspartate semialdehyde dehydrogenase (WO 2009/096689).
  • the CJ7 promoter is a potent promoter derived from Corynebacterium ammonia genes (Korean Patent No. 0620092 and WO 2006/065095).
  • modification of the polynucleotide sequence on the chromosome is not particularly limited, but the mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the polynucleotide sequence. Or by replacing with a polynucleotide sequence that has been modified to have stronger activity.
  • the term “vector” may refer to a DNA preparation containing a nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable regulatory sequence to allow expression of the target protein in a suitable host.
  • the regulatory sequence may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. After being transformed into a suitable host cell, the vector can be replicated or function independent of the host genome and integrated into the genome itself.
  • the vector to be used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, ⁇ MBL3, ⁇ MBL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, and Charon21A can be used as the phage vector or cosmid vector
  • pBR, pUC, and pBluescriptII systems are used as plasmid vectors.
  • pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • the vector usable in the present invention is not particularly limited and known expression vectors can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector and the like can be used.
  • a vector for inserting a chromosome in a bacterium may replace a polynucleotide encoding an endogenous target protein in a chromosome with a mutated polynucleotide. Insertion of the polynucleotide into the chromosome can be by any method known in the art, for example by homologous recombination. Since the vector of the present invention may be inserted into a chromosome by causing homologous recombination, the vector may further include a selection marker for confirming whether the chromosome is inserted.
  • Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a polynucleotide of interest, and confer a selectable phenotype such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers can be used. In an environment in which a selective agent is treated, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.
  • the term “transformation” may mean introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide may be expressed in the host cell.
  • the transformed polynucleotide can include both, as long as it can be expressed in the host cell, whether it is inserted into or located outside the chromosome of the host cell.
  • the polynucleotide may comprise DNA and RNA encoding a target protein.
  • the polynucleotide may be introduced in any form as long as it can be expressed by being introduced into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self expression.
  • the expression cassette may include a promoter, a transcription termination signal, a ribosomal binding site, and a translation termination signal, which are typically operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell.
  • operably linked may mean that the gene sequence and the promoter sequence for initiating and mediating the transcription of the polynucleotide encoding the target protein of the present invention.
  • the microorganism having the diamine production ability may be a diamine acetyltransferase activity is weakened compared to the intrinsic activity in order to increase the amount of diamine production.
  • diamine acetyltransferase is an enzyme that mediates the reaction of transferring an acetyl group from acetyl-CoA to diamine, and may be, for example, Corynebacterium glutamicum NCgl1469 or E. coli SpeG, but The name may vary depending on the type of microorganism having a low production capacity.
  • the NCgl1469 may include an amino acid sequence as set forth in SEQ ID NO: 12 or 13
  • SpeG may include an amino acid sequence as set forth in SEQ ID NO: 14, but such a sequence may vary depending on the type of microorganism, and the diamine acetyltransfer.
  • it may include an amino acid sequence having at least 80%, preferably at least 90%, more preferably at least 95%, particularly preferably at least 97% homology with the amino acid sequence of the above SEQ ID NO. .
  • the diamine acetyltransferase converts the diamine to acetyl-diamine (e.g., N-Ac-putrescine or N-Ac-cadaverine), thus producing diamines when their activity is weakened relative to the intrinsic activity. Can increase performance.
  • acetyl-diamine e.g., N-Ac-putrescine or N-Ac-cadaverine
  • intrinsic activity refers to the active state of a protein originally possessed by the microorganism in its natural or unmodified state
  • modified to be weaker than intrinsic activity refers to the natural state or Compared to protein activity exhibited in an unmodified state, it may mean that the activity is weaker.
  • Such weakening of protein activity may mean that the activity of the protein is reduced compared to the unmodified strain, and may include a case in which the activity is removed.
  • the method of weakening the activity of the protein can be applied to various methods well known in the art.
  • An example of the method is a gene mutated to reduce the activity of the enzyme, including when the activity of the protein is removed, a method of replacing a gene encoding the protein on a chromosome, a gene on the chromosome encoding the protein
  • a method of introducing a mutation into an expression control sequence of a protein a method of replacing an expression control sequence of a gene encoding a protein with a sequence of weak activity, a method of deleting a part or all of a gene on a chromosome encoding the protein, and A method of introducing an antisense oligonucleotide that complementarily binds to a transcript of a gene and inhibits translation from the mRNA to a protein, by artificially adding a complementary sequence to the SD sequence before the SD sequence of the gene encoding the protein.
  • RTE reverse transcription engineering
  • a method of deleting part or all of a gene encoding a protein replaces a polynucleotide encoding an endogenous target protein in a chromosome with a polynucleotide or marker gene in which a part of a nucleic acid sequence is deleted through a bacterial chromosome insertion vector.
  • This can be done by.
  • the term "some” differs depending on the kind of polynucleotide, but is specifically 1 to 300, preferably 1 to 100, more preferably 1 to 50.
  • the microorganism of the present invention is a microorganism having a diamine-producing ability, and includes a prokaryotic microorganism in which a protein including the amino acid sequence described in SEQ ID NO: 6 is expressed, and examples thereof include Escherichia sp., Shigella sp., Citrobacter sp., Salmonella sp., Enterobacter sp. Yersinia sp., Klebsiella.
  • the microorganism of the present invention is a microorganism belonging to the genus Corynebacterium or microorganism of the genus Escherichia, more specifically Corynebacterium glutamicum or Escherichia coli , but is not limited thereto.
  • KCCM11240P Korean Patent No. 2013-00824708
  • NCgl2522 a protein having a putrescine releasing ability in the strain, was deleted.
  • microorganisms that introduce ARCH_0271 into the transposon gene Accordingly, the microorganism named KCCM11240P ⁇ NCgl2522 Tn: P (cj7) -ARCH_0271 as CC01-0758 and deposited it on November 15, 2013 at the Korea Microorganism Conservation Center, an international depository organization under the Budapest Treaty, and received accession number KCCM11476P. .
  • the present invention provides a method for producing diamine, comprising (i) introducing or enhancing the activity of a protein comprising the amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having at least 42% sequence homology therewith. Culturing the microorganism having a to obtain a culture; And (ii) recovering diamine from the cultured microorganism or culture.
  • the diamine a protein comprising the amino acid sequence of SEQ ID NO: 6, a protein comprising an amino acid sequence having more than 42% sequence homology therewith, introduction of protein activity, enhancement of protein activity, diamine, and diamine production
  • the microorganism having the capability is as described above.
  • the step of culturing the microorganism is not particularly limited thereto, but is preferably performed by a known batch culture method, continuous culture method, fed-batch culture method or the like.
  • the culture conditions are not particularly limited, but using a basic compound (e.g. sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (e.g. phosphoric acid or sulfuric acid) to an appropriate pH (e.g. pH 5 to 9, preferably pH 6 to 8, most preferably pH 6.8) can be adjusted, and the aerobic conditions can be maintained by introducing oxygen or oxygen-containing gas mixture into the culture, the culture temperature is 20 to 45 °C, preferably 25 to 40 ° C. may be maintained and incubated for about 10 to 160 hours.
  • a basic compound e.g. sodium hydroxide, potassium hydroxide or ammonia
  • an acidic compound e.g. phosphoric acid or sulfuric acid
  • pH e.g. pH 5 to 9, preferably pH 6 to 8, most preferably pH 6.8
  • the medium used for the culture may include sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), fats and oils (e.g., soybean oil, Sunflower seed oil, peanut oil and coconut oil), fatty acids such as palmitic acid, stearic acid and linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid It can be used as or mixed.
  • sugars and carbohydrates e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose
  • fats and oils e.g., soybean oil, Sunflower seed oil, peanut oil and coconut oil
  • fatty acids such as palmitic acid, stearic acid and linoleic acid
  • alcohols such as glycerol and ethanol
  • organic acids such as acetic acid It can be used as or mixed.
  • Nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and Ammonium nitrate) and the like, and the like, but may be used individually or in mixture.
  • Phosphorus sources include, but are not limited to, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, the corresponding sodium containing salts, and the like, and may be used individually or in combination.
  • Other metal salts such as magnesium sulfate or iron sulfate, and essential growth-promoting substances such as amino acids and vitamins.
  • the medium may be used in the same sense as the culture solution.
  • the term "culture” is a material obtained as a result of culturing microorganisms, and may include all of the medium, the microorganisms to be cultured, and the material secreted from the microorganisms to be cultured.
  • mineral ingredients, amino acids, vitamins, nucleic acids, and / or other components that may be contained in the culture medium (or culture) in addition to the nutritional sources required to culture the cells, such as carbon sources, nitrogen sources, etc., are included. There may be. Also, for example, a target substance or an enzyme produced or secreted by the cells may be contained.
  • the culture may include the diamine produced by the microbial culture.
  • the method for recovering putrescine produced in the culturing step of the present invention collects the desired amino acid from the culture medium using a suitable method known in the art according to a culture method, for example, a batch, continuous or fed-batch culture method. can do.
  • the putrescine producing strain KCCM11240P (Korean Patent Publication No. 2013-0082478) based on Corynebacterium glutamicum ATCC13032, based on Corynebacterium glutamicum ATCC13869 MFS (major facilitator) in putrescine-producing strain DAB12-a ⁇ NCgl1469 (argF deletion, NCgl1221 deletion, E. coli speC introduction, arg operon promoter substitution, NCgl1469 deletion; designated DAB12-b, Korean Patent Publication No. 2013-0082478) Deletion of NCgl2522, a permease belonging to the superfamily, reduced the production of putrescine.
  • the Corynebacterium glutamicum strain which enhanced NCgl2522 activity, produced putrescine in high yield by additionally introducing the NCgl2522 gene into KCCM11240P or DAB12-b in the transposon, or by replacing the promoter of the chromosomal NCgl2522 with the cj7 promoter. .
  • the putrescine content in the strain enhanced NCgl2522 expression, it was confirmed that the amount of putrescine is lower than the control group, NCgl2522 has a function to discharge the putrescine out of the cell.
  • primer pairs of SEQ ID NO: 1 and 2 for obtaining homologous recombinant fragments of the N-terminal region of NCgl2522, and C- of NCgl2522 were used as shown in Table 1 below.
  • NCgl2522-del-F1_BamHI SEQ ID NO: 1
  • CGGGATCCCACGCCTGTCTGGTCGC NCgl2522-del-R1_SalI
  • ACGCGTCGACGGATCGTAACTGTAACGAATGG NCgl2522-del-F2_SalI SEQ ID NO: 2
  • ACGCGTCGACCGCGTGCATCTTTGGACAC NCgl2522-del-R2_XbaI
  • PCR was performed using two pairs of primers to obtain PCR fragments of the N-terminal site and the C-terminal site, respectively, followed by electrophoresis. The desired fragment was obtained. At this time, the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C.
  • the fragments obtained from the N-terminal region were treated with restriction enzymes BamH I and Sal I, and the fragments of the C-terminal region with restriction enzymes Sal I and Xba I, and the treated fragments were restriction enzymes BamH I and Xba I.
  • the plasmid pDZ-1'NCgl2522 (K / O) was prepared by cloning into a pDZ vector treated with.
  • the plasmid pDZ-1'NCgl2522 (K / O) was introduced into Corynebacterium glutamicum KCCM11240P by electroporation to obtain a transformant, and the transformant was kanamycin (25 ⁇ g / ml) and X-. by plating on BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, 2% agar) containing gal (5-bromo-4-chloro-3-indolin- ⁇ -D-galactoside) Colonies were formed. A strain in which the plasmid pDZ-1'NCgl2522 (K / O) was introduced was selected by selecting a blue colony from the colonies formed therefrom.
  • the selected strain was added to CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8). Inoculation was incubated for 8 hours at 30 °C shaking culture, each diluted 10 -4 to 10 -10 sequentially and then plated and cultured in X-gal-containing solid medium to form colonies. From the colonies formed, white colonies appearing at a relatively low rate were selected to produce a Corynebacterium glutamicum strain having a loss of putrescine productivity due to the deletion of the gene encoding NCgl2522.
  • genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template, and PCR using each of the two pairs of primers shown in Table 1 above was carried out to carry out plasmid pDZ-2'NCgl2522 (K / O) according to the method described above.
  • plasmid pDZ-2'NCgl2522 K / O
  • a Corynebacterium glutamicum strain was produced in which the gene encoding NCgl2522 of the DAB12-b strain was deleted according to the method described above, thereby reducing putrescine productivity.
  • the membrane protein encoded by NCgl2522 showed a function of releasing putrescine out of cells. Therefore, the inventors of the genome of the genus Corynebacterium et al., Homologous through the BlastP program of the National Institute of Biological Information (NCBI, www.ncbi.nlm.noj.gov ) based on the amino acid sequence of NCgl2522.
  • the ARCH_0271 nucleotide sequence (SEQ ID NO: 5) and amino acid sequence (SEQ ID NO: 6) of the alkanobacterium hamoriticum DSM 20595 having the same sex were obtained.
  • the ARCH_0271 amino acid sequence is systematically closest to the NCgl2522 amino acid sequence among the membrane proteins of the genus Corynebacterium homologous to the NCgl2522 amino acid sequence.
  • alkaligenes faecalis subsp. Alcaligenes faecalis subsp. faecalis Base sequence of SMD_2351 from Stenotrophomonas maltophilia D457 showing 52% homology with QWA_00075 base sequence (SEQ ID NO: 22) and amino acid sequence (SEQ ID NO: 23) derived from NCIB 8687 Number 25) and amino acid sequence (SEQ ID NO: 26).
  • the amino acid sequence of QWA_00075 and the amino acid sequence of SMD_2351 show 42% and 47% homology with ARCH_0271 amino acid sequence as shown in Table 2, respectively.
  • microorganisms having genes showing homology with NCgl2522 and their homology are shown in Table 3 below.
  • PDZTn (disclosed in WO 2009/125992) was used as a transforming vector that enables transduction of genes in a chromosome using a transposon gene region of a microorganism of Corynebacterium, and the promoter was cj7 (disclosed in WO 2006/65095). Was used.
  • ARCH_0271 gene was synthesized according to the codon usage of Corynebacterium glutamicum based on the base sequence of Alkanobacterium hamoriticum DSM 20595. Similarly alkaligenes facalis subsp. SMD_2351, derived from Callis NCIB 8687-derived QWA_00075 and Stenotropomonas maltophilia D457, was also aligned with the base sequence (SEQ ID NO: 24, SEQ ID NO: 27) according to the codon usage of Corynebacterium glutamicum. Synthesized. Gene synthesis was obtained in cloned form in pGEM B1.
  • the plasmids obtained above were named pGEM B1-ARCH_0271, pGEM B1-QWA_00075, and pGEM B1-SMD_2351, respectively.
  • the pcj7 promoter region was obtained by repeating 30 cycles of denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and 30 seconds at 72 ° C.
  • the cj7 promoter gene fragment was electrophoresed on 0.8% agarose gel and then purified by eluting a band of desired size.
  • Each of the three plasmids pDZTn-P (cj7) -ARCH_0271, pDZTn-P (cj7) -QWA_00075, and pDZTn-P (cj7) -SMD_2351 were each reduced in Corynebacterium glue as described in Reference Example 1. Tamicum KCCM11240P ⁇ NCgl2522 was introduced by electroporation, respectively, to obtain a transformant.
  • the transformant was CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) was shaken (30 ° C., 8 hours), diluted sequentially from 10 ⁇ 4 to 10 ⁇ 10 , respectively, and plated and cultured in an X-gal-containing solid medium to form colonies.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • PDZTn-P (cj7) -ARCH_0271, pDZTn prepared above to confirm the effect of putrescine excretion through chromosomal insertion of the ARCH_0271 gene in DAB12-b ⁇ NCgl2522 with reduced putrescine excretion capacity prepared in Reference Example 1 -P (cj7) -QWA_00075, pDZTn-P (cj7) -SMD_2351 were transformed into Corynebacterium glutamicum DAB12-b ⁇ NCgl2522 in the same manner as in Example ⁇ 2-1> to convert ARCH_0271, It was confirmed that QWA_00075 or SMD_2351 was introduced.
  • Corynebacterium glutamicum mutants selected therefrom were selected as DAB12-b ⁇ NCgl2522 Tn: P (cj7) -ARCH_0271, DAB12-b ⁇ NCgl2522 Tn: P (cj7) -QWA_00075, DAB12-b ⁇ NCgl2522 Tn: P ( cj7) -SMD_2351.
  • ARCH_0271, QWA _00075 or SMD_2351 introduced Corynebacterium Putrescine Production strains Putrescine Productivity evaluation
  • Trecine production capacity was compared.
  • Each strain cultured therefrom was 25 ml of titer medium (Glucose 8%, soy protein 0.25%, corn solid 0.50%, (NH 4 ) 2 SO 4 4%, KH 2 PO 4 0.1%, MgSO 4 ⁇ H 2 O 0.05%, urea 0.15%, biotin 100 ⁇ g, thiamine hydrochloride 3 mg, calcium-pantothenic acid 3 mg, nicotinamide 3 mg, CaCO 3 5%, based on 1 L), inoculated at about platinum at 200 rpm at 30 rpm Shake incubation for 98 hours. In culture of all strains 1 mM arginine was added to the medium. The putrescine concentration produced from each culture was measured and the results are shown in Table 5 below.
  • Example 3 In the Corynebacterium origin Lysine Introduction of ARCH_0271 based on production strain Lysine Decarboxylase Cadaverine Fermentation through Expression
  • ARCH_0271 In order to confirm the ability of cadaverine release through the insertion of the gene, the lysine producing strain KCCM11016P (the microorganism was deposited with the accession no. Deposited and given accession number with KCCM11016P, Korean Patent No. 10-0159812) based on the ARCH_0271 gene was inserted into the chromosome.
  • PDZTn-P (cj7) -ARCH_0271 created earlier was transformed into Corynebacterium glutamicum KCCM11016P in the same manner as in Example ⁇ 2-1> to give ARCH_0271 in the transposon It was confirmed that it was introduced.
  • Corynebacterium glutamicum mutants selected therefrom were named KCCM11016P Tn: P (cj7) -ARCH_0271.
  • the lysine decarboxylase gene derived from Escherichia coli for producing cadaverine was introduced into L-lysine producing strain KCCM11016P Tn: P (cj7) -ARCH_0271 prepared in Example ⁇ 3-1> in plasmid form. .
  • the base sequence (SEQ ID NO: 32) and amino acid sequence (SEQ ID NO: 33) for lysine decarboxylase ldcC derived from E. coli were obtained from the NCBI data base.
  • the ldcC gene is a chromosome of E. coli W3110 strain using PCR primers and primer pairs of SEQ ID NO: 36 and SEQ ID NO: 37 (see Table 6) for 30 seconds denaturation at 95 ° C, annealing for 30 seconds at 52 ° C, and 72 ° C. The 2 min process was repeated 30 times to obtain 2.1 kb of gene fragment each. After treatment with HindIII and XbaI, after electrophoresis on a 0.8% agarose gel was purified by eluting a band of the desired size.
  • the cj7 promoter region was denatured at 95 ° C for 30 seconds, annealed at 55 ° C for 30 seconds, and at 30 ° C at 30 ° C using primer pairs (see Table 6) of SEQ ID NO: 34 and SEQ ID NO: 35 using p117-Pcj7-gfp as a template. A second procedure was obtained by repeating 30 times.
  • the cj7 promoter gene fragment was purified by treatment with KpnI and HindII, followed by electrophoresis on a 0.8% agarose gel, and eluting a band of the desired size.
  • PECCG117 Biotechnology letters vol 13, No. 10, p. 721-726 (1991) vector treated with KpnI and XbaI were subjected to electrophoresis on 0.8% agarose gel and then purified by eluting bands of desired size,
  • the cj7 promoter gene fragment treated with KpnI and HindIII, or the lysine decarboxylase ldcC gene fragment treated with HindIII and XbaI was cloned using T4 DNA lligase (NEB).
  • the plasmid encoding E. coli ldcC obtained in the above experiment was named pECCG117-Pcj7-ldcC.
  • the prepared pECCG117-Pcj7-ldcC vector or pECCG117 vector was introduced into KCCM11016P and KCCM11016P Tn: P (cj7) -ARCH_0271 using electroporation.
  • the introduced strains were plated in BHIS plate medium containing 25 ⁇ g / ml kanamycin to select transformants.
  • the selected strains were named KCCM11016P pECCG117, KCCM11016P pECCG117-Pcj7-ldcC, KCCM11016P Tn: P (cj7) -ARCH_0271 pECCG117, KCCM11016P Tn: P (cj7) -ARCH_0271 pECCG117-Pcj7 (total 4 species).
  • ARCH_0271 is introduced into the chromosome Lysine Decarboxylase Introduced into the plasmid In the Corynebacterium origin Lysine Production strain Cadaverine Productivity evaluation
  • Corynebacterium glutamicum mutants (KCCM11016P pECCG117; KCCM11016P pECCG117-Pcj7-ldcC; KCCM11016P Tn: P (cj7) -ARCH_0271 pECCG117; KCCM11016P Tn: P (cj027) pARCcj-P7CH-C7CH-C7CH- ) was cultured in the following manner to compare the cadaverine production capacity.
  • CM plate medium glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ⁇ l, agar 2%, pH 6.8, 1 L
  • the plate was incubated at 30 ° C. for 24 hours.
  • strain cultured therefrom was seed medium (glucose 2%, peptone 1%, yeast extract 0.5%, urea 0.15%, KH 2 PO 4 0.4%, K 2 HPO 4 0.8%, MgSO 4 7H 2 O 0.05%, Inoculate a 250 ml corner-baffle flask containing 100 ⁇ g biotin, 1000 ⁇ g thiamine HCl, 2000 ⁇ g calcium-pantothenic acid, 2000 ⁇ g nicotinamide, pH 7.0, 1 L) and 200 ml at 30 ° C. for 20 hours, 200 Shake culture was performed at rpm.
  • Production medium (glucose 4%, (NH 4 ) 2 SO 4 2%, soy protein 2.5%, corn steep solids 5%, urea 0.3%, KH 2 PO 4 0.1%, MgSO 4 7H 2 O 0.05%, biotin 100 ⁇ g, thiamine hydrochloride 1000 ⁇ g, calcium-pantothenic acid 2000 ⁇ g, nicotinamide 3000 ⁇ g, leucine 0.2 g, threonine 0.1 g, methionine 0.1 g, CaCO 3 5%, pH 7.0, 1 L
  • a 250 ml corner-baffle flask containing 24 ml was inoculated with 1 ml of the seed culture and shaken at 200 rpm for 72 hours at 30 ° C.
  • L-lysine and cadaverine concentration in the culture for each strain tested is shown in Table 7 below.
  • E. coli wild type strain W3110 having putrescine production ability and cadaverine biosynthesis pathway expresses ARCH_0271 of Alkanobacterium haemolyticum DSM 20595, QWA_00075 from Alkogen genes faecalis, or SMD_2351 from Stenotropomonas maltophilia PDZTn-P (cj7) -ARCH_0271, pDZTn-P (cj7) -QWA_00075, or Corynebacterium and Escherichia coli shuttle vectors based on W3110 to see if they can increase the production of putrescine and cadaverine when pDZTn-P (cj7) -SMD_2351 was introduced respectively.
  • E. coli transformation was performed using 2X TSS solution (Epicentre) and smeared in LB plate medium (Tryptone 10g, Yeast extract 5g, Nacl 10g, 2% agar, 1L) containing kanamycin (50 ⁇ g / ml). Colonies were formed by culturing. The colonies formed therefrom were named W3110 pDZTn-P (cj7) -ARCH_0271, W3110 pDZTn-P (cj7) -QWA_00075, and W3110 pDZTn-P (cj7) -SMD_2351, respectively.
  • W3110 and W3110 pDZTn-P (cj7) -ARCH_0271, W3110 pDZTn-P (cj7) -QWA_00075, and W3110 pDZTn-P (cj7) -SMD_2351 were incubated for 24 hours at 37 ° C in LB solid medium.
  • 25 mL titer medium ((NH 4 ) 2 PO 4 2 g, KH 2 PO 4 6.75 g, citric acid 0.85 g, MgSO 4 7H 2 O 0.7 g, trace element 0.5% (v / v) , glucose 10g, AMS 3g, CaCO 3 30 g, 1 L) at 37 ° C. for 24 hours.
  • Trace metal solution is 5 M HCl per liter: 10 g FeSO 4 7H 2 O 10 g, ZnSO 4 7H 2 O 2.25 g, CuSO 4 5H 2 O 1 g, MnSO 4 5H 2 O 0.5 g, Na 0.23 g of 2 B 4 O 7 10H 2 O, CaCl 2 2H 2 O 2g, and (NH 4 ) 6 Mo 7 O 2 4H 2 O 0.1 g.
  • the present inventors introduced the Corynebacterium glutamicum strain which enhanced ARCH_0271 activity by introducing ARCH_0271 in the transposon from the microorganism KCCM11240P ⁇ NCgl2522 of Corynebacterium, which has a pathogenic production path but reduced emission. It was confirmed that putrescine can be produced in high yield through putrescine releasing ability.
  • strain KCCM11240P ⁇ NCgl2522 Tn: P (cj7) -ARCH_0271 was named CC01-0758, and was deposited with the Korea Microbiological Conservation Center (KCCM) on November 15, 2013 under the Budapest Treaty to receive the accession number KCCM11476P. .
  • ARCH_0271 protein derived from alkanobacterium hamoriticum is a protein having a diamine excretion capacity, and the activity of the protein is introduced into a strain of Corynebacterium sp. It was confirmed that the putrescine can be enhanced. In addition, when the activity of the protein is introduced into E. coli, which has a production route of putrescine and cadaverine, it was confirmed that the production of putrescine and cadaverine increases simultaneously. Therefore, by applying ARCH_0271 protein derived from alkanobacterium haemoritumum to a microorganism having a diamine production ability, it will be possible to bring about an effective production of diamine.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 서열번호 6으로 기재되는 아미노산 서열 또는 이와 42% 이상의 서열 상동성을 가지는 아미노산 서열을 포함하는 단백질의 활성이 도입 또는 강화된, 다이아민 생산능을 갖는 미생물 및 이를 이용하여 다이아민을 생산하는 방법에 관한 것이다.

Description

다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법
본 발명은 다이아민 생산능을 갖는 미생물 및 이를 이용하여 다이아민을 생산하는 방법에 관한 것이다.
바이오제닉 아민(biogenic amines, BAs)은 아미노산의 탈탄산 작용, 알데하이드와 케톤의 아미노화와 아미노기 전이 반응에 의해 주로 생성되는 질소 화합물이다. 이러한 바이오제닉 아민은 저분자량이며 미생물, 식물과 동물의 대사 과정에서 합성되므로 이들 세포에서 흔히 발견되는 구성요소로 알려져 있다. 특히, 스퍼미딘(spermidine), 스퍼민(spermine), 퓨트레신(putrescine 또는 1,4-butanediamine) 및 카다베린(cadaverine) 등과 같은 폴리아민(polyamine)은 대표적 예가 되는 물질이다.
일반적으로, 퓨트레신은 아디프산(adipic acid)과 반응하여 폴리아민 나일론-4,6을 합성하는 중요한 원료물질로서, 주로 프로필렌(propylene)으로부터 아크릴로니트릴(acrylonitrile) 및 숙시노니트릴(succinonitrile)을 거치는 화학 합성법으로 주로 생산된다.
한편, 미생물을 이용해 퓨트레신을 생산하는 방법으로는 대장균과 코리네박테리움을 형질전환하여 퓨트레신을 고농도로 생산하는 방법이 공개되었다(국제특허공개 WO06/005603; 국제특허공개 WO09/125924; Qian ZD et al., Biotechnol . Bioeng. 104: 4, 651-662, 2009; Schneider et al., Appl . Microbiol . Biotechnol . 88: 4, 859-868, 2010; Schneider et al., Appl . Microbiol . Biotechnol . 95, 169-178., 2012). 나아가, 퓨트레신 트랜스포터(transporter)에 관한 연구가 대장균, 효모, 식물 및 동물 세포를 대상으로 활발히 수행되고 있다(K Igarashi, Plant Physiol. Biochem. 48: 506-512, 2010).
한편, 카다베린은 동물 조직의 부패 중 단백질의 가수분해에 의해 생산되는 냄새가 좋지 않은 다이아민 화합물이다. 카다베린은 NH2(CH2)5NH2의 화학식을 가져 퓨트레신과 유사한 면이 있다.
상기 카다베린은 폴리아마이드나 폴리우레탄과 같은 고분자의 구성요소, 킬레이팅제 또는 다른 첨가제로 사용될 수 있다. 특히, 연간 350만 톤의 세계 시장을 가진 폴리아마이드-5,4는 카다베린이나 숙신산의 증축합함으로써 제조되는 것으로 알려져 있어, 산업적 기반 화합물로서 큰 주목을 받고 있다.
이러한 카다베린은 몇몇 미생물로부터 발견되는 다이아민으로(Tabor and Tabor, MicrobiolRev.,49:81-99,1985), 그람음성 박테리아인 대장균에서 L-라이신으로부터 L-라이신 디카르복실라아제(decarboxylase)를 이용하여 직접 생합성된다. 대장균 내의 카다베린 농도는 카다베린의 생합성과 분해, 흡수와 방출에 의해 조절된다(Soksawatmaekhin etal.,MolMicrobiol.,51:1401-1412,2004).
본 발명자들은, 퓨트레신 또는 카다베린과 같은 다이아민의 배출능을 가지고 있는 단백질을 규명하여 다이아민 생산능을 갖는 미생물에서 다이아민의 생산능을 증가시키고자 예의 노력한 결과, 알카노박테리움 해모리티쿰 유래의 단백질 또는 이와 아미노산 서열 상동성이 높은 단백질이 다이아민 배출능을 가지며, 이를 다이아민 생산능을 갖는 미생물에 도입하여 이의 활성을 강화시킨 결과 퓨트레신 및 카다베린과 같은 다이아민의 배출능을 현저히 증가시킬 수 있음을 확인하고, 본 발명을 완성하였다.
본 발명의 하나의 목적은 다이아민 생산능을 갖는 미생물을 제공하는 것이다.
본 발명의 다른 목적은 (i) 상기 다이아민 생산능을 갖는 미생물을 배양하여 배양물을 수득하는 단계; 및 (ii) 상기 배양된 미생물 또는 배양물로부터 다이아민을 회수하는 단계를 포함하는, 다이아민의 생산 방법을 제공하는 것이다.
본 발명에서는 알카노박테리움 해모리티쿰 유래의 ARCH_0271 단백질이 다이아민 배출능을 가지는 단백질임을 규명하고, 퓨트레신 생산경로를 가지고 있지만 배출능이 낮은 코리네박테리움 속 균주에 상기 단백질의 활성을 도입하여 퓨트레신 배출능을 강화시킬 수 있음을 확인하였다. 또한, 퓨트레신과 카다베린 생산경로를 가지고 있는 대장균에도 상기 단백질의 활성을 도입하는 경우, 퓨트레신과 카다베린의 생산이 동시에 증가됨을 확인하였다. 따라서, 알카노박테리움 해모리티쿰 유래의 ARCH_0271 단백질을 다이아민 생산능을 갖는 미생물에 적용함으로써 다이아민의 효과적인 생산을 가져올 수 있을 것이다.
상기의 목적을 달성하기 위한 하나의 양태로서, 본 발명은 서열번호 6으로 기재되는 아미노산 서열 또는 이와 42% 이상의 서열 상동성을 가지는 아미노산 서열을 포함하는 단백질의 활성이 도입 또는 강화된, 다이아민 생산능을 갖는 미생물을 제공한다.
본 발명에서 용어, "다이아민"은 아민기를 두 개 지니는 화합물을 총칭하며, 구체적인 예로 퓨트레신과 카다베린을 들 수 있다. 퓨트레신은 테트라메틸렌다이아민(tetramethylenediamine)으로 오르니틴을 전구체로 하여 생성될 수 있다. 카다베린은 1,5-펜테인다이아민(1,5-pentanediamine) 또는 펜타메틸렌다이아민(pentamethylenediamine)으로 명명되며 라이신을 전구체로 하여 생성될 수 있다. 상기와 같은 다이아민은 폴리아민 나일론, 폴리아마이드나 폴리우레탄과 같은 고분자로 합성될 수 있는 원료 물질로서 중요한 가치를 가지는, 산업적 응용성을 가지는 기반 화합물이다.
본 발명에서 용어, "서열번호 6으로 기재된 아미노산 서열을 포함하는 단백질"은 알카노박테리움 해모리티쿰(Arcanobacterium haemolyticum)에 존재하는 단백질로서, ARCH_0271로도 명명된다. 상기 단백질은 코리네박테리움의 막 단백질인 NCgl2522와 높은 상동성을 보유한 것으로 규명되었다. 본 발명의 일 실시예에서는 상기 ARCH_0271 단백질이 다이아민 생산능을 갖는 균주에서 다이아민의 배출에 관여하는 것으로 추정되어, 다이아민의 생산능을 현저히 증가시킬 수 있음을 규명하였다.
여기서, 상기 서열번호 6으로 기재된 아미노산 서열을 가지는 ARCH_0271 단백질은, 대표적으로 서열번호 5 또는 7로 기재된 뉴클레오티드 서열로 인코딩되는 단백질일 수 있다. 다만, 상기 ARCH_0271 단백질을 코딩하는 폴리뉴클레오타이드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있어, 상기 서열번호 5 또는 7로 기재된 뉴클레오티드 서열 외에도 다양한 뉴클레오티드 서열에 의하여 코딩될 수 있다. 이 중 상기 서열번호 7로 기재된 뉴클레오티드 서열은, ARCH_0271 유전자(서열번호 5)에 대하여 코리네박테리움 글루타미쿰의 코돈 사용 빈도에 맞게 코돈 최적화한 서열이며, 이에 한정되지 않는다.
또한, 본 발명에서 상기 ARCH_0271 단백질은, 서열번호 6의 아미노산 서열뿐만 아니라, 상기 서열과 40% 이상, 바람직하게는 60% 이상, 더욱 바람직하게는 80% 이상, 보다 더욱 바람직하게는 90% 이상, 더욱 더 바람직하게는 95% 이상, 가장 바람직하게는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 다이아민 배출에 관여하는 단백질이라면 제한없이 포함하며, 이러한 상동성을 갖는 서열로서 실질적으로 서열번호 6의 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 본 발명의 범주에 포함됨은 자명하다.
본 발명에서 용어, "서열번호 6으로 기재되는 아미노산 서열과 42% 이상의 서열 상동성을 가지는 아미노산 서열을 포함하는 단백질"은 서열번호 6으로 기재되는 아미노산 서열과 42% 이상의 상동성을 가지는 아미노산 서열을 포함하면서 실질적으로 다이아민 배출능을 갖는 단백질인 경우 제한없이 포함되는 것을 의미한다. 일 예로 서열번호 23, 또는 26의 아미노산 서열을 포함하는 단백질을 포함할 수 있으나, 이에 한정되는 것은 아니다.
예를 들어, 상기 서열번호 23으로 기재된 아미노산 서열을 포함하는 단백질은 알칼리게네스 패칼리스 subsp. 칼리스(Alcaligenes faecalis subsp. faecalis) 에 존재하는 단백질로서, QWA_00075 로도 명명된다. 상기 단백질은 코리네박테리움의 막 단백질인 NCgl2522와는 41%의 상동성을 보유하며, 알카노박테리움 해모리티쿰의 ARCH_0271과는 42%의 상동성을 보유한 것으로 규명되었다. 본 발명의 일 실시예에서는 상기 QWA_00075 단백질이 다이아민 생산능을 갖는 균주에서 다이아민의 배출능을 가져, 다이아민의 생산능을 현저히 증가시킬 수 있음을 규명하였다.
서열번호 23으로 기재된 아미노산 서열을 포함하는 QWA_00075 단백질은, 대표적으로 서열번호 22 또는 24로 기재된 뉴클레오티드 서열로 인코딩되는 단백질일 수 있다. 다만, 상기 단백질을 코딩하는 폴리뉴클레오타이드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있어, 상기 서열번호 22 또는 24로 기재된 뉴클레오티드 서열 외에도 다양한 뉴클레오티드 서열에 의하여 코딩될 수 있다. 이 중 상기 서열번호 24로 기재된 뉴클레오티드 서열은, QWA_00075 유전자(서열번호 22)에 대하여 코리네박테리움 글루타미쿰의 코돈 사용 빈도에 맞게 코돈 최적화한 서열이며, 이에 한정되지 않는다.
또한, 상기 서열번호 26으로 기재된 아미노산 서열을 포함하는 단백질은 스테노트로포모나스 말토필리아 (Stenotrophomonas maltophilia)에 존재하는 단백질로서, SMD_2351 로도 명명된다. 상기 단백질은 코리네박테리움의 막 단백질인 NCgl2522와는 52%의 상동성을 보유하며, 알카노박테리움 해모리티쿰의 ARCH_0271과는 47%의 상동성을 보유한 것으로 규명되었다. 본 발명의 일 실시예에서는 상기 SMD_2351 단백질이 다이아민 생산능을 갖는 균주에서 다이아민의 배출능을 가져, 다이아민의 생산능을 현저히 증가시킬 수 있음을 규명하였다.
서열번호 26으로 기재된 아미노산 서열을 포함하는 SMD_2351 단백질은, 대표적으로 서열번호 25 또는 27로 기재된 뉴클레오티드 서열로 인코딩되는 단백질일 수 있다. 다만, 상기 단백질을 코딩하는 폴리뉴클레오타이드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있어, 상기 서열번호 25 또는 27로 기재된 뉴클레오티드 서열 외에도 다양한 뉴클레오티드 서열에 의하여 코딩될 수 있다. 이 중 상기 서열번호 27로 기재된 뉴클레오티드 서열은, SMD_2351 유전자(서열번호 25)에 대하여 코리네박테리움 글루타미쿰의 코돈 사용 빈도에 맞게 코돈 최적화한 서열이며, 이에 한정되지 않는다.
본 명세서에서 서열과 관련하여 사용된 용어 "상동성"은 주어진 아미노산 서열 또는 염기 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 아미노산 서열 또는 염기 서열과 동일하거나 유사한 활성을 갖는 그의 상동성 서열이 "% 상동성"으로 표시된다. 예를 들면, 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)들을 계산하는 표준 소프트웨어, 구체적으로 BLAST 2.0를 이용하거나, 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고(예. Sambrook et al., 1989, infra 참고), 당업자에게 잘 알려진 방법으로 결정될 수 있다.
본 발명에서 용어, "다이아민 생산능을 갖는 미생물"은 다이아민의 생산능이 없는 모균주에 다이아민의 생산능이 부여된 미생물, 또는 내재적으로 다이아민 생산능을 갖는 미생물을 의미할 수 있다. 구체적으로 다이아민 생산능을 갖는 미생물은 퓨트레신 또는 카다베린의 생산능을 갖는 미생물일 수 있다.
상기 "퓨트레신 생산능을 갖는 미생물"은 특별히 이에 제한되지 않으나, 글루타메이트에서 오르니틴까지의 생합성 경로를 강화하기 위해 글루타메이트를 아세틸글루타메이트(N-acetylglutamate)로 전환하는 아세틸글루타메이트 신타아제 또는 아세틸오르니틴을 오르니틴으로 전환하는 오르니틴 아세틸트랜스퍼라아제(ArgJ), 아세틸글루타메이트를 아세틸글루타밀 포스페이트(N-acetylglutamyl phosphate)로 전환하는 아세틸글루타메이트 키나아제(ArgB), 아세틸글루타밀 포스페이트를 아세틸글루타메이트 세미알데히드(N-acetylglutamate semialdehyde)로 전환하는 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 또는 아세틸글루타메이트 세미알데히드를 아세틸오르니틴(N-acetylornithine)으로 전환하는 아세틸오르니틴 아미노트랜스퍼라아제(ArgD)의 활성을 내재적 활성에 비하여 증가시키도록 변형될 수 있으며, 퓨트레신의 생합성 전구체로서 사용되는 오르니틴의 생산성을 향상시키도록 변형된 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 퓨트레신 생산능을 갖는 미생물은 오르니틴에서 아르기닌 합성에 관여하는 오르니틴 카르바모일 트랜스퍼라아제(ornithine carbamoyltransfrase, ArgF), 글루타메이트의 배출에 관여하는 단백질(NCgl1221), 및/또는 퓨트레신을 아세틸화시키는 단백질(NCgl469)의 활성을 내재적 활성에 비하여 약화시키도록 변이되고/되거나, 오르니틴 디카르복실라아제(ornithine decarboxylase, ODC)의 활성을 도입하도록 변형된 것일 수 있다.
여기서, 비제한적인 일 예로, 상기 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC)는 서열번호 15로 기재되는 아미노산 서열을 포함하는 것일 수 있다. 아세틸글루타메이트 신타아제 또는 오르니틴 아세틸트랜스퍼라아제(ArgJ)는 서열번호 16로 기재되는 아미노산 서열을 포함하는 것일 수 있다. 아세틸 글루타메이트 키나아제(ArgB)는 서열번호 17로 기재되는 아미노산 서열을 포함하는 것일 수 있다. 아세틸오르니틴 아미노트랜스퍼라아제(ArgD)는 서열번호 18로 기재되는 아미노산 서열을 포함하는 것일 수 있다. 그러나 각 효소 단백질의 아미노산 서열은 특별히 이에 제한되는 것은 아니며, 각 효소의 활성을 가지는 한, 이와 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 95% 이상의 상동성을 갖는 아미노산 서열을 포함할 수 있다.
또한, 비제한적인 일 예로, 상기 오르니틴 카르바모일 트렌스퍼라아제(ArgF)는 서열번호 19로 기재되는 아미노산 서열을 포함하는 것일 수 있다. 상기 글루타메이트 배출에 관여하는 단백질은 서열번호 20으로 기재되는 아미노산 서열을 포함하는 것일 수 있다. 오르니틴 디카르복실라아제(ODC)는 서열번호 21로 기재되는 아미노산 서열을 포함하는 것일 수 있다. 그러나 각 효소 단백질의 아미노산 서열은 특별히 이에 제한되는 것은 아니며, 각 효소의 활성을 가지는 한 이와 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 95% 이상, 특히 바람직하게는 97% 이상의 상동성을 갖는 아미노산 서열을 포함할 수 있다.
한편, 상기 "카다베린 생산능을 갖는 미생물"은 특별히 이에 제한되지는 않으나, 라이신 생산능을 갖는 미생물에서 추가적으로 라이신 디카르복실라아제(lysine decarboxylase, LDC)의 활성을 도입 또는 강화시킨 미생물을 의미할 수 있다. 일 예로 카다베린의 생산을 높이기 위하여 라이신 생산능을 향상시킨 미생물일 수 있다. 라이신 생산능을 향상시키기 위한 방법은 종래에 공지된 방법을 활용하여 당업자가 충분히 예상가능하고 활용할 수 있다.
상기 라이신 디카르복실라아제는 라이신을 카다베린으로 전환시키는 활성을 가지는 효소로, 그 활성을 도입 또는 강화함으로써 효과적으로 카다베린을 생산할 수 있다.
상기 라이신 디카르복실라아제는 서열번호 33으로 기재되는 아미노산 서열을 포함하는 것일 수 있으나, 특별히 이에 제한되는 것은 아니며, 상기 활성을 가지는 한, 이와 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 95% 이상의 상동성을 갖는 아미노산 서열을 포함할 수 있다.
본 발명에서 용어, "생산"이란 다이아민을 균주 내에서 만들어내는 것뿐만 아니라, 다이아민을 세포 밖, 예컨대 배양액으로 배출하는 것 역시 포함하는 개념이다.
한편, 본 발명에서 용어, "단백질의 활성의 도입"은, 내재적 단백질이 없는 미생물에, 그 단백질이 갖는 활성을 외부로부터 부여하는 것을 의미하며, 예컨대 외부로부터 유전자를 도입하여 수행될 수 있다. 또한, "단백질 활성의 강화"는, 미생물이 보유하고 있거나 도입된 단백질의 활성 상태를 내재적 활성 상태에 비하여 향상시키는 것을 의미할 수 있다.
상기 단백질의 활성의 도입 또는 강화의 비제한적인 예로서, 돌연변이 등에 의해 균주 내에 존재하는 단백질 자체의 활성을 증대시켜 본래 기능 이상의 효과를 도출하고/하거나, 균주 내에 존재하는 단백질의 내재적 유전자 활성의 증가, 내부 또는 외부 요인으로부터 내재적 유전자 증폭, 유전자 카피수 증가, 외부로부터의 유전자를 추가적으로 도입, 프로모터 교체 또는 변형 등에 의해 그 활성이 증가되는 것을 포함하나, 이에 제한되는 것은 아니다.
상기에서 유전자 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 본 발명의 단백질을 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있거나, 상기 폴리뉴클레오티드가 작동가능하게 연결된, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 상기 숙주세포의 염색체 내 상기 폴리뉴클레오티드의 카피수를 증가하는 방법으로 수행될 수 있다.
본 발명에서 사용된, 폴리뉴클레오티드의 발현이 증가하도록 발현 조절서열을 변형하는 것은, 특별히 이에 제한되지 않으나, 상기 발현 조절서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현 조절서열은, 특별히 이에 제한되지 않으나, 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
본 발명에서 사용된, 프로모터의 교체 또는 변형하는 것은, 특별히 이에 제한되지 않으나, 본래의 프로모터보다 강력한 프로모터로 교체 또는 변형될 수 있다. 상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 이종 프로모터가 연결될 수 있는데, 상기 강력한 프로모터의 예로는 CJ7 프로모터, lysCP1 프로모터, EF-Tu 프로모터, groEL 프로모터, aceA 혹은 aceB 프로모터 등이 있으며, 구체적으로는 코리네박테리움 유래 프로모터인 lysCP1 프로모터 혹은 CJ7 프로모터와 작동가능하게 연결되어 상기 효소를 코딩하는 폴리뉴클레오티드의 발현율을 향상시킬 수 있다. 여기서 lysCP1 프로모터는 아스파테이트 키나제 및 아스파테이트 세미알데히드 디히드로게나제를 코딩하는 폴리뉴클레오티드의 프로모터 부위 염기서열 치환을 통해 개량한 프로모터이다(WO 2009/096689). 또한, CJ7 프로모터는 코리네박테리움 암모니아게네스로부터 유래한 강력한 프로모터이다(대한민국 등록특허 제0620092호 및 WO 2006/065095).
아울러, 염색체상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
본 발명에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미할 수 있다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 발명에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 본 발명에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
또한, 세균 내 염색체 삽입용 벡터를 통해 염색체 내에 내재적 목적 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다. 본 발명의 벡터는 상동재조합을 일으켜서 염색체 내로 삽입될 수 있으므로 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 폴리뉴클레오티드의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 명세서에서 사용된 용어, "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미할 수 있다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함할 수 있다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어, 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 발명의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미할 수 있다.
또한, 상기 다이아민 생산능을 갖는 미생물은 다이아민의 생산량을 증가시키기 위하여, 다이아민 아세틸트랜스퍼라아제(diamine acetyltransferase) 활성이 내재적 활성에 비하여 약화된 것일 수 있다.
본 발명에서 용어, "다이아민 아세틸트랜스퍼라아제"는 아세틸-CoA로부터 아세틸기를 다이아민으로 전달하는 반응을 매개하는 효소로서, 그 예로 코리네박테리움 글루타미쿰 NCgl1469 또는 대장균 SpeG일 수 있으나, 다이아민 생산능을 갖는 미생물의 종류에 따라 그 명칭은 달라질 수 있다. 상기 NCgl1469는 서열번호 12 또는 13으로 기재된 아미노산 서열을 포함하는 것이고, SpeG는 서열번호 14로 기재된 아미노산 서열을 포함할 수 있으나, 이러한 서열은 미생물의 종류에 따라 달라질 수 있으며, 상기 다이아민 아세틸트랜스퍼라아제의 활성을 가지는 한 상기 서열번호의 아미노산 서열과 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 95% 이상, 특히 바람직하게는 97% 이상의 상동성을 갖는 아미노산 서열을 포함할 수 있다.
상기 다이아민 아세틸트랜스퍼라아제는 다이아민을 아세틸-다이아민(예, N-Ac-퓨트레신 또는 N-Ac-카다베린)으로 전환시키므로, 이의 활성을 내재적 활성에 비하여 약화시키는 경우 다이아민의 생산능을 증가시킬 수 있다.
본 발명에서 용어, "내재적 활성"이란, 본래 미생물이 천연의 상태 또는 비변형 상태에서 가지고 있는 단백질의 활성 상태를 의미하고, "내재적 활성에 비해 약화되도록 변형"된다는 의미는 본래 미생물의 천연 상태 또는 비변형 상태에서 나타내는 단백질 활성과 비교할 때 활성이 더 약화된 것을 의미할 수 있다.
이러한 단백질 활성의 약화는, 변형되지 않은 균주에 비하여 단백질의 활성이 감소된 것을 의미하고, 활성이 제거된 경우도 포함할 수 있다. 상기 단백질의 활성을 약화시키는 방법은 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하다.
상기 방법의 예는, 상기 단백질의 활성이 제거된 경우를 포함하여 상기 효소의 활성이 감소되도록 돌연변이된 유전자로, 염색체상의 상기 단백질을 암호화하는 유전자를 대체하는 방법, 상기 단백질을 암호화하는 염색체상의 유전자의 발현 조절 서열에 변이를 도입하는 방법, 상기 단백질을 암호화하는 유전자의 발현 조절 서열을 활성이 약한 서열로 교체하는 방법, 상기 단백질을 암호화하는 염색체상의 유전자 일부 또는 전체를 결손시키는 방법 및 상기 염색체상의 유전자의 전사체에 상보적으로 결합하여 상기 mRNA로부터 단백질로의 번역을 저해하는 안티센스 올리고뉴클레오티드를 도입하는 방법, 상기 단백질을 암호화하는 유전자의 SD 서열 앞단에 SD 서열과 상보적인 서열을 인위적으로 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착이 불가능하게 만드는 법 및 해당 서열의 ORF(open reading frame)의 3' 말단에 역전사되도록 프로모터를 부가하는 RTE(Reverse transcription engineering) 방법 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 상기 예에 의해 특별히 제한되는 것은 아니다.
구체적으로, 단백질을 암호화하는 유전자의 일부 또는 전체를 결실하는 방법은, 세균 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 폴리뉴클레오티드를 일부 핵산 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 상기 "일부"란 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 바람직하게는 1 내지 100개, 더욱 바람직하게는 1 내지 50개이다.
한편, 본 발명의 미생물은 다이아민 생산능을 갖는 미생물로서, 상기 서열번호 6으로 기재된 아미노산 서열을 포함하는 단백질이 발현되는 원핵 미생물을 포함하며, 이의 예로는 에스케리치아 속(Escherichia sp.), 시겔라 속(Shigella sp.), 시트로박터 속(Citrobacter sp.), 살모넬라 속(Salmonella sp.), 엔테로박터 속(Enterobacter sp.) 여시니아 속(Yersinia sp.), 크렙시엘라 속(Klebsiella sp.), 어위니아 속(Erwinia sp.), 코리네박테리움 속(Corynebacterium sp.), 브레비박테리움 속(Brevibacterium sp.), 락토바실러스 속(Lactobacillus sp.), 셀레노모나스 속(Selenomanas sp.), 비브리오 속(Vibrio sp.), 슈도모나스 속 (Pseudomonas sp.), 스트렙토마이시스 속 (Streptomyces sp.), 아카노박테리아 속 (Arcanobacterium sp.), 알칼리젠 속(Alcaligenes sp) 등에 속하는 미생물일 수 있으나, 이에 제한되지는 않는다. 구체적으로 본 발명의 미생물은 코리네박테리움 속에 속하는 미생물 또는 에스케리치아 속 미생물이며, 보다 구체적으로 코리네박테리움 글루타미쿰 또는 대장균(Escherichia coli)이나, 이에 제한되지 않는다.
구체적인 예로, 코리네박테리움 글루타미쿰 ATCC13032 기반의 퓨트레신 생산균주 KCCM11240P(대한민국 공개특허 제2013-0082478호) 균주를 이용하여, 상기 균주에서 퓨트레신 배출능을 가지는 단백질인 NCgl2522를 결실시킨 후 ARCH_0271를 트랜스포존 유전자 내에 도입하는 미생물을 들 수 있다. 이에 상기 미생물은 KCCM11240P △NCgl2522 Tn:P(cj7)-ARCH_0271를 CC01-0758로 명명하고, 부다페스트 조약하의 국제기탁기관인 한국미생물보존센터에 2013년 11월 15일자로 기탁하고, 수탁번호 KCCM11476P를 부여받았다.
또 하나의 양태로서, 본 발명은 (i) 상기 서열번호 6으로 기재되는 아미노산 서열 또는 이와 42% 이상의 서열 상동성을 가지는 아미노산 서열을 포함하는 단백질의 활성이 도입 또는 강화된, 다이아민 생산능을 갖는 미생물을 배양하여 배양물을 수득하는 단계; 및 (ii) 상기 배양된 미생물 또는 배양물로부터 다이아민을 회수하는 단계를 포함하는, 다이아민의 생산 방법을 제공한다.
상기 다이아민, 서열번호 6의 아미노산 서열을 포함하는 단백질, 이와 42% 이상의 서열 상동성을 가지는 아미노산 서열을 포함하는 단백질, 단백질의 활성의 도입, 단백질의 활성의 강화, 다이아민, 및 다이아민 생산능을 갖는 미생물에 대해서는 앞서 설명한 바와 같다.
상기 방법에 있어서, 상기 미생물을 배양하는 단계는, 특별히 이에 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행됨이 바람직하다. 이때, 배양조건은 특별히 이에 제한되지 않으나, 염기성 화합물(예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물(예: 인산 또는 황산)을 사용하여 적정 pH(예컨대, pH 5 내지 9, 바람직하게는 pH 6 내지 8, 가장 바람직하게는 pH 6.8)를 조절할 수 있고, 산소 또는 산소-함유 가스 혼합물을 배양물에 도입시켜 호기성 조건을 유지할 수 있으며, 배양온도는 20 내지 45℃, 바람직하게는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있다.
아울러, 상기 배양을 위하여 사용되는 배지는 탄소 공급원으로는 당 및 탄수화물(예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방(예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산(예: 팔미트산, 스테아르산 및 리놀레산), 알코올(예: 글리세롤 및 에탄올) 및 유기산(예: 아세트산) 등을 포함하나 이에 제한되지 않으며, 개별적으로 사용하거나 또는 혼합하여 사용할 수 있다. 질소 공급원으로는 질소-함유 유기 화합물(예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 또는 무기 화합물(예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등을 포함하나 이에 제한되지 않으며, 개별적으로 사용하거나 또는 혼합하여 사용할 수 있다. 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등을 포함하나 이에 제한되지 않으며, 개별적으로 사용하거나 또는 혼합하여 사용할 수 있다. 기타 금속염(예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 포함할 수 있다. 본 명세서에서 상기 배지는 배양액과 동일한 의미로 사용될 수 있다.
본 발명에서 용어, "배양물"은 미생물의 배양 결과 얻어지는 물질로, 상기 배지, 배양되는 미생물, 및 배양되는 미생물로부터 분비되는 물질을 모두 포함하는 것일 수 있다. 예를 들어 균체를 배양하기 위해 필요한 영양 공급원, 예를 들어 탄소원, 질소원 등 이외에 무기염 성분, 아미노산, 비타민, 핵산 및/또는 기타 일반적으로 배양 배지(또는 배양액)에 함유될 수 있는 성분들이 포함되어 있을 수 있다. 또한 예를 들어 균체가 생산ㆍ분비한 목적 물질 또는 효소 등이 포함되어 있을 수 있다.
배양에 의하여 생산된 다이아민은 배지 중으로 분비되거나 세포 내에 잔류할 수 있으므로, 상기 배양물은 미생물 배양에 의하여 생산된 다이아민을 포함할 수 있다.
본 발명의 상기 배양 단계에서 생산된 퓨트레신을 회수하는 방법은 배양방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 아미노산을 수집할 수 있다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
참조예 1. 퓨트레신 생성능을 갖는 코리네박테리움 속 미생물의 제작
퓨트레신 생성능을 갖는 코리네박테리움 속 미생물로서, 코리네박테리움 글루타미쿰 ATCC13032 기반의 퓨트레신 생산균주 KCCM11240P(대한민국 특허공개 제2013-0082478호), 코리네박테리움 글루타미쿰 ATCC13869 기반의 퓨트레신 생산균주 DAB12-a △NCgl1469 (argF 결손, NCgl1221 결손, 대장균 speC 도입, arg 오페론 프로모터 치환, NCgl1469 결손; DAB12-b로 명명, 대한민국 특허공개 제2013-0082478호)에서 MFS(major facilitator superfamily)에 속하는 permease인 NCgl2522를 결실시켰을 때 퓨트레신 생산량이 감소됨을 확인하였다.
또한 마찬가지로 KCCM11240P 또는 DAB12-b에 NCgl2522 유전자를 트랜스포존 내 추가 도입, 또는 염색체상 NCgl2522의 프로모터를 cj7프로모터로 치환하여 NCgl2522 활성을 강화시킨 코리네박테리움 글루타미쿰 균주가 고수율로 퓨트레신을 생산하였다. 또한 NCgl2522 발현을 강화시킨 균주 내 퓨트레신 함량을 측정한 결과 대조군 대비 퓨트레신 양이 적게 있음을 확인함으로 NCgl2522가 퓨트레신을 세포 밖으로 배출하는 기능이 있음을 확인하였다.
구체적으로, 코리네박테리움 글루타미쿰 ATCC13032의 NCgl2522를 암호화하는 유전자의 염기서열을 근간으로 NCgl2522의 N-말단 부위의 상동 재조합 단편을 얻기 위한 서열번호 1 및 2의 프라이머 쌍과, NCgl2522의 C-말단 부위의 상동재조합 단편을 얻기 위한 서열번호 3 및 4의 프라이머 쌍을 하기 표 1과 같이 사용하였다.
프라이머 서열(5'->3 ')
NCgl2522-del-F1_BamHI(서열번호 1) CGGGATCCCACGCCTGTCTGGTCGC
NCgl2522-del-R1_SalI(서열번호 2) ACGCGTCGACGGATCGTAACTGTAACGAATGG
NCgl2522-del-F2_SalI(서열번호 3) ACGCGTCGACCGCGTGCATCTTTGGACAC
NCgl2522-del-R2_XbaI(서열번호 4) CTAGTCTAGAGAGCTGCACCAGGTAGACG
상기 코리네박테리움 글루타미쿰 ATCC13032의 게놈 DNA를 주형으로 하고, 2쌍의 프라이머 각각을 이용한 PCR을 수행하여 N-말단 부위와 C-말단 부위의 PCR 단편을 각각 수득한 후, 이를 전기영동하여 목적하는 단편을 수득하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초의 신장 과정을 30회 반복하였다. 이로부터 수득된 N-말단 부위의 단편을 제한효소 BamHI 및 SalI으로, C-말단 부위의 단편을 제한효소 SalI 및 XbaI으로 처리하였으며, 처리된 단편을 제한효소인 BamHI과 XbaI으로 처리된 pDZ 벡터에 클로닝하여 플라스미드 pDZ-1'NCgl2522(K/O)를 제작하였다.
상기 플라스미드 pDZ-1'NCgl2522(K/O)를 전기천공법으로 코리네박테리움 글루타미쿰 KCCM11240P에 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin-β-D-galactoside)이 함유된 BHIS 평판배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZ-1'NCgl2522(K/O)가 도입된 균주를 선발하였다.
상기 선발된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에 접종하여 30℃에서 8시간 동안 진탕 배양하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다. 형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택하여, NCgl2522을 코딩하는 유전자가 결실되어 퓨트레신 생산성이 약화된 코리네박테리움 글루타미쿰 균주를 제작하였다. 이와 같이 제작된 퓨트레신 배출능이 약화된 코리네박테리움 글루타미쿰 균주를 KCCM11240P △NCgl2522로 명명하였다.
마찬가지로 코리네박테리움 글루타미쿰 ATCC13869의 게놈 DNA를 주형으로 하고, 상기 표 1에 기재된 2쌍의 프라이머 각각을 이용한 PCR을 수행하여 상기에 기재된 방법에 따라 플라스미드 pDZ-2'NCgl2522(K/O)를 제작하였다. 상기 벡터를 이용하여 상기에 명기된 방법에 따라 DAB12-b 균주의 NCgl2522를 코딩하는 유전자가 결실되어 퓨트레신 생산성이 약화된 코리네박테리움 글루타미쿰 균주를 제작하였다. 이와 같이 제작된 퓨트레신 배출능이 약화된 코리네박테리움 글루타미쿰 균주를 DAB12-b △NCgl2522로 명명하였다.
실시예 1. 알카노박테리움 해모리티쿰 ( Arcanobacterium haemolyticum )의 ARCH_0271 선별
참조예 1에서 확인한 바에 따르면 NCgl2522가 코딩하는 막단백질이 퓨트레신을 세포 밖으로 배출하는 기능이 있음을 나타내었다. 이에 본 발명자는 NCgl2522의 아미노산 서열을 바탕으로 미국 국립생물정보센터(NCBI, www.ncbi.nlm.noj.gov)의 BlastP 프로그램을 통해, 상동성이 있는 코리네박테리움외 속의 유전자 중 56% 상동성을 보유한 알카노박테리움 해모리티쿰 DSM 20595의 ARCH_0271 염기서열(서열번호 5) 및 아미노산 서열(서열번호 6)을 확보하였다. ARCH_0271 아미노산 서열은 NCgl2522 아미노산 서열과 상동성 있는 코리네박테리움 외 속의 막 단백질 중 계통학적으로 NCgl2522 아미노산 서열과 가장 가깝게 있다.
또한 상기와 동일한 방법으로 NCgl2522 아미노산 서열과 41% 상동성을 보이는 알칼리게네스 패칼리스 subsp. 칼리스(Alcaligenes faecalis subsp. faecalis) NCIB 8687유래의 QWA_00075 염기서열 (서열번호 22) 및 아미노산 서열 (서열번호 23)과 52%의 상동성을 보이는 스테노트로포모나스 말토필리아 (Stenotrophomonas maltophilia) D457 유래의 SMD_2351의 염기서열 (서열번호 25) 및 아미노산 서열 (서열번호 26)을 확보하였다. 상기 QWA_00075의 아미노산 서열과 SMD_2351의 아미노산 서열은 ARCH_0271 아미노산 서열과는 표 2와 같이 각각 42%, 47%의 상동성을 보인다.
아미노산 서열 상동성 비교
　 ARCH_0271 QWA_00075 SMD_2351
NCgl2522 56% 41% 52%
ARCH_0271 　 42% 47%
한편, NCgl2522과와 상동성을 보이는 유전자를 보유한 미생물 및 그 상동성을 하기 표 3에 나타내었다.
species 상동성
Acidovorax citrulli AAC00-1 47%
Actinomyces sp. oral taxon 181 53%
Actinomyces sp. ph3 54%
Actinomyces sp. S6-Spd3 53%
Actinosynnema mirum 53%
Actinosynnema mirum DSM 43827 53%
Alcaligenes faecalis subsp. faecalis NCIB 8687 41%
alpha proteobacterium LLX12A 52%
Arcanobacterium haemolyticum 56%
Arcanobacterium haemolyticum DSM 20595 56%
Arsenophonus nasoniae 44%
Brachybacterium paraconglomeratum 52%
Brachybacterium paraconglomeratum LC44 52%
Bradyrhizobium sp. BTAi1 43%
Citricoccus sp. CH26A 50%
Citrobacter freundii 4_7_47CFAA 53%
Dermabacter hominis 1368 50%
Dermabacter sp. HFH0086 51%
Dietzia sp. UCD-THP 52%
Enterobacteriaceae bacterium 9_2_54FAA 41%
Erwinia amylovora ATCC 49946 47%
Granulicoccus phenolivorans 55%
Hafnia alvei ATCC 51873 41%
Klebsiella pneumoniae 53%
Micrococcus luteus 52%
Micromonospora sp. ATCC 39149 53%
Mycobacterium chubuense 39%
Mycobacterium gilvum 38%
Mycobacterium neoaurum 39%
Mycobacterium rufum 39%
Nesterenkonia alba 48%
Nesterenkonia sp. F 51%
Nocardia rhamnosiphila 40%
Nocardiopsis dassonvillei 58%
Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 57%
Nocardiopsis kunsanensis 52%
Nocardiopsis sp. CNS639 57%
Nocardiopsis synnemataformans 57%
Ochrobactrum anthropi ATCC 49188 46%
Pectobacterium atrosepticum SCRI1043 46%
Providencia alcalifaciens DSM 30120 40%
Pseudomonas aeruginosa 53%
Pseudomonas aeruginosa C3719 46%
Pseudomonas geniculata 53%
Rahnella aquatilis HX2 40%
Rhodococcus 40%
Rhodococcus fascians 55%
Rhodococcus sp. AW25M09 42%
Rhodococcus sp. JVH1 40%
Rhodococcus triatomae 37%
Rhodococcus wratislaviensis NBRC 100605 40%
Salinispora 52%
Salinispora arenicola 52%
Salinispora pacifica 53%
Salinispora tropica CNB-440 51%
Sanguibacter keddieii DSM 10542 52%
Serratia marcescens 44%
Sphingobium chinhatense 53%
Stenotrophomonas maltophilia 54%
Stenotrophomonas maltophilia D457 52%
Stenotrophomonas sp. RIT309 52%
Stenotrophomonas sp. SKA14 53%
Streptococcus anginosus 52%
Streptococcus anginosus CCUG 39159 51%
Streptomyces 52%
Streptomyces albidoflavus 54%
Streptomyces alboviridis 52%
Streptomyces albus 55%
Streptomyces albus J1074] 57%
Streptomyces atroolivaceus 53%
Streptomyces baarnensis 51%
Streptomyces californicus 52%
Streptomyces cyaneofuscatus 53%
Streptomyces floridae 52%
Streptomyces fulvissimus 51%
Streptomyces globisporus 52%
Streptomyces griseus 57%
Streptomyces mediolani 55%
Streptomyces sp. AA0539 48%
Streptomyces sp. CcalMP-8W 52%
Streptomyces sp. CNB091 55%
Streptomyces sp. NRRL B-1381 52%
Streptomyces sp. NRRL B-3253 57%
Streptomyces sp. NRRL F-2890 49%
Streptomyces sp. NRRL F-5527 52%
Streptomyces sp. NRRL F-5702 52%
Streptomyces sp. NRRL S-623 52%
Streptomyces sp. PVA 94-07 57%
Streptomyces sp. S4 54%
Streptomyces sp. ScaeMP-e10 51%
Streptomyces sp. SM8 54%
Streptomyces sp. W007 54%
Streptomyces wadayamensis 54%
Tsukamurella paurometabola 38%
Turicella otitidis 56%
Turicella otitidis ATCC 51513 56%
Xenorhabdus nematophila ATCC 19061 42%
Yaniella halotolerans 61%
Yersinia enterocolitica 41%
실시예 2. 코리네박테리움 속 유래 퓨트레신 생산균주에 퓨트레신 배출능을 가지는 단백질 도입을 통한 퓨트레신 발효
<2-1> ATCC13032 기반 퓨트레신 생산 균주의 염색체 내 트렌스포존 유전자 내 ARCH_0271, QWA _00075, SMD_2351 도입
참조예 1에서 제작한 퓨트레신 배출능이 감소된 KCCM11240P △NCgl2522에서 ARCH_0271, QWA_00075 또는 SMD_2351 유전자의 염색체 내 삽입을 통한 퓨트레신 배출 효과를 확인하기 위해, ARCH_0271, QWA_00075, 또는 SMD_2351를 하기와 같은 과정으로 트랜스포존 유전자 내에 도입하였다.
코리네박테리움 속 미생물의 트랜스포존 유전자 부위를 이용하여 염색체 내 유전자 도입을 가능하게 하는 형질전환용 벡터로서 pDZTn(WO 2009/125992에 개시)를 사용하였으며, 프로모터는 cj7 (WO 2006/65095에 개시)을 이용하였다.
ARCH_0271 유전자는 알카노박테리움 해모리티쿰 DSM 20595의 염기서열을 바탕으로 코리네박테리움 글루타미쿰의 코돈 사용빈도(codon usage)에 맞게 염기서열(서열번호 7)을 맞추어 합성하였다. 마찬가지로 알칼리게네스 패칼리스 subsp. 칼리스 NCIB 8687유래의 QWA_00075와 스테노트로포모나스 말토필리아 D457 유래의 SMD_2351도 각각 코리네박테리움 글루타미쿰의 코돈 사용빈도(codon usage)에 맞게 염기서열(서열번호 24, 서열번호 27)을 맞추어 합성하였다. 유전자 합성은 pGEM B1에 클로닝된 형태로 수득하였다.
상기에서 얻은 플라스미드를 각각 pGEM B1-ARCH_0271, pGEM B1-QWA_00075, pGEM B1-SMD_2351라 명명하였다.
pGEM B1-ARCH_0271, pGEM B1-QWA_00075, pGEM B1-SMD_2351 플라스미드를 주형으로 각각 서열번호 10 및 11, 서열번호 28 및 29, 또는 서열번호 30 및 31의 프라이머 쌍(표 4 참조)을 이용하여 약 1.51 kb, 1.53 kb, 또는 1.53 kb의 각 유전자 단편을 증폭하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 1분 30초의 신장 과정을 30회 반복하였다. 이 PCR 결과물을 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
또한, pcj7 프로모터 부위는 이용하여 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초 과정을 30회 반복하여 수득하였다. cj7 프로모터 유전자단편은 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
프라이머 서열(5'->3 ')
CJ7-F(서열번호 8) TGTCGGGCCCACTAGT AGAAACATCCCAGCGCTACTAATA
CJ7-R(서열번호 9) AGTGTTTCCTTTCGTTGGGTACG
ARCH_0271-F(서열번호 10) CAACGAAAGGAAACACT ATGCCAGACGTGTCCTCC
ARCH_0271-R(서열번호 11) GAATGAGTTCCTCGAG TTATTCGTGTGCATATGC
QWA_00075-F(서열번호 28) CAACGAAAGGAAACACT ATGTTGCACTCCCCCACCC
QWA_00075-R(서열번호 29) GAATGAGTTCCTCGAG TTAATCAGCATGGGAGCGGCC
SMD_2351-F(서열번호 30) CAACGAAAGGAAACACT ATGCCAGCAGCGCATTCAAATAG
SMD_2351-R(서열번호 31) GAATGAGTTCCTCGAG TTAGTGCTGAGTTGGATAGGCAG
pDZTn 벡터는 XhoI을 처리하고 상기에서 수득한 각 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion◎HD Cloning Kit(Clontech)를 사용하였다. 결과로 얻은 플라스미드를 각각 pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-QWA_00075, pDZTn-P(cj7)-SMD_2351라 명명하였다.
상기 3개의 플라스미드 pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-QWA_00075, pDZTn-P(cj7)-SMD_2351 각각을, 참조예 1에 기재된 퓨트레신 배출능이 감소된 코리네박테리움 글루타미쿰 KCCM11240P △NCgl2522에 전기천공법(electroporation)으로 각각 도입하여 형질전환체를 수득하였다. 그 후, 상기 형질전환체를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다.
형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 ARCH_0271, QWA_00075 또는 SMD_2351를 코딩하는 유전자가 도입된 균주를 최종 선발하였다. 최종 선발된 균주를 대상으로 서열번호 8 및 서열번호 11, 서열번호 8 및 서열번호 29 또는 서열번호 8 및 서열번호 31의 각 프라이머 쌍을 이용해 PCR을 수행하여 ARCH_0271, QWA_00075 또는 SMD_2351를 코딩하는 유전자가 도입되었음을 확인하고, 상기 코리네박테리움 글루타미쿰 변이주를 KCCM11240P △NCgl2522 Tn:P(cj7)-ARCH_0271, KCCM11240P △NCgl2522 Tn:P(cj7)-QWA_00075, KCCM11240P △NCgl2522 Tn:P(cj7)-SMD_2351라 명명하였다.
<2-2> ATCC13869 기반 퓨트레신 생산 균주의 염색체 내 트렌스포존 유전자 내 ARCH_0271, QWA _00075, SMD_2351 도입
참조예 1에서 제작한 퓨트레신 배출능이 감소된 DAB12-b △NCgl2522에서 ARCH_0271 유전자의 염색체 내 삽입을 통한 퓨트레신 배출 효과를 확인하기 위해, 앞에서 제작한 pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-QWA_00075, pDZTn-P(cj7)-SMD_2351를 실시예 <2-1>과 동일한 방법으로 코리네박테리움 글루타미쿰 DAB12-b △NCgl2522에 형질전환하여 트렌스포존 내 ARCH_0271, QWA_00075 또는 SMD_2351가 도입되었음을 확인하였다.
이로부터 선발된 코리네박테리움 글루타미쿰 변이주를 DAB12-b △NCgl2522 Tn:P(cj7)-ARCH_0271, DAB12-b △NCgl2522 Tn:P(cj7)-QWA_00075, DAB12-b △NCgl2522 Tn:P(cj7)-SMD_2351이라 명명하였다.
<2-3> ARCH_0271, QWA _00075 또는 SMD_2351 도입된 코리네박테리움 퓨트레신 생산 균주의 퓨트레신 생산능 평가
퓨트레신 생산 균주에서 ARCH_0271 도입 시 퓨트레신 생산에 미치는 효과를 확인하기 위하여, 상기 실시예 <2-1> 및 <2-2>에서 제작된 코리네박테리움 글루타미쿰 변이주를 대상으로 퓨트레신 생산능을 비교하였다.
구체적으로, 10종의 코리네박테리움 글루타미쿰 변이주(KCCM11240P; KCCM11240P △NCgl2522; KCCM11240P △NCgl2522 Tn:P(cj7)-ARCH_0271; KCCM11240P △NCgl2522 Tn:P(cj7)-QWA_00075; KCCM11240P △NCgl2522 Tn:P(cj7)-SMD_2351; DAB12-b; DAB12-b △NCgl2522; DAB12-b △NCgl2522 Tn:P(cj7)-ARCH_0271; DAB12-b △NCgl2522 Tn:P(cj7)-QWA_00075, DAB12-b △NCgl2522 Tn:P(cj7)-SMD_2351)를, 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다. 이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수고형 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4·H2O 0.05%, urea 0.15%, 바이오틴 100μg, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5%, 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 98시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 각 배양물로부터 생산된 퓨트레신 농도를 측정하고 그 결과를 하기 표 5에 나타내었다.
　 균주명 퓨트레신 (g/L)
KCCM 11240P 12.4
KCCM 11240P △NCgl2522 1.9
KCCM 11240P △NCgl2522 Tn:P(cj7)-ARCH_0271 17.7
KCCM 11240P ΔNCgl2522 Tn:P(cj7)-QWA_00075 4.1
KCCM 11240P ΔNCgl2522 Tn:P(cj7)-SMD_2351 3.5
DAB12-b 13.1
DAB12-b △NCgl2522 0.5
DAB12-b △NCgl2522 Tn:P(cj7)-ARCH_0271 17.5
DAB12-b ΔNCgl2522 Tn:P(cj7)-QWA_00075 5
DAB12-b ΔNCgl2522 Tn:P(cj7)-SMD_2351 4.1
상기 표 5에 나타난 바와 같이, ARCH_0271가 도입된 2종의 코리네박테리움 글루타미쿰 변이주 모두에서 퓨트레신 생산량이 증가하였음을 확인하였다. 또한, QWA_00075 또는 SMD_2351를 도입한균주들 모두 모균주 KCCM 11240P △NCgl2522 또는 DAB12-b △NCgl2522 대비 퓨트레신이 증가하는 것으로 나타났다. 이러한 결과는 QWA_00075 또는 SMD_2351 이 퓨트레신 배출능을 가지고 있음을 보여주는 것이다.
실시예 3. 코리네박테리움 속 유래 라이신 생산 균주기반의 ARCH_0271 도입 및 라이신 디카르복실레이즈 발현을 통한 카다베린 발효
<3-1> L- 라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM11016P 의 염색체 내 트랜스포존 유전자 내 ARCH_0271 5 도입
ARCH_0271 유전자의 삽입을 통한 카다베린 배출능을 확인하기 위해, 라이신 생산균주 KCCM11016P(상기 미생물은 한국미생물보존센터에 1995년 12월 18일자로 수탁번호 KFCC10881로 기탁된 후, 부다페스트 조약하인 국제기탁기관에 재기탁되어 KCCM11016P로 기탁번호를 부여받음, 한국 등록특허 제10-0159812호) 를 기반으로 ARCH_0271 유전자를 염색체 내 삽입하였다. 앞에서 제작한 pDZTn-P(cj7)-ARCH_0271 를 실시예 <2-1>과 동일한 방법으로 코리네박테리움 글루타미쿰 KCCM11016P에 형질전환하여 트랜스포존 내 ARCH_0271가 도입되었음을 확인하였다.
이로부터 선발된 코리네박테리움 글루타미쿰 변이주를 KCCM11016P Tn:P(cj7)-ARCH_0271라 명명하였다.
<3-2> ARCH_0271가 도입된 L- 라이신 생산 균주에 대장균 유래의 라이신 디카르복실레이즈 유전자 도입
실시예 <3-1>에서 제작된 ARCH_0271가 도입된 L-라이신 생산 균주 KCCM11016P Tn:P(cj7)-ARCH_0271에 카다베린을 생산하기 위한 대장균 유래의 라이신 디카르복실레이즈 유전자를 플라스미드 형태로 도입하였다. 대장균 유래의 라이신 디카르복실레이즈 ldcC에 대한 염기서열(서열번호 32) 및 아미노산 서열(서열번호 33)을 NCBI data base에서 확보하였다.
ldcC 유전자는 대장균 W3110 균주의 염색체를 주형으로 PCR법을 통하여 서열번호 36과 서열번호 37의 프라이머 쌍(표 6 참조)을 이용하여 95℃에서 30초의 변성, 52℃에서 30초의 어닐링 및 72℃에서 2분 과정을 30회 반복하여 각각 2.1 kb 의 유전자 단편을 수득하였다. 이후 HindIII와 XbaI을 처리한 후, 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
또한, cj7 프로모터 부위는 p117-Pcj7-gfp를 주형으로 서열번호 34와 서열번호 35의 프라이머 쌍(표 6 참조)을 이용하여 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초 과정을 30회 반복하여 수득하였다. cj7 프로모터 유전자단편은 KpnI과 HindII를 처리한 후, 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
프로모터 cj7 유전자를 얻기 위한 프라이머
CJ7-F_KpnI (서열번호 34) CGGGGTACC AGAAACATCCCAGCGCTACTAATA
CJ7-R-HindIII (서열번호 35) CCCAAGCTT AGTGTTTCCTTTCGTTGGGTACG
대장균 ldcC유전자를 얻기 위한 프라이머
ldcC-F_HindIII (서열번호 36) CCCAAGCTT AAGCTT ATGAACATCATTGCCATTATGGG (52)
ldcC-R_XbaI (서열번호 37) TGCTCTAGA TTATCCCGCCATTTTTAGGACTC (53)
KpnI 과 XbaI 을 처리한 pECCG117 (Biotechnology letters vol 13, No. 10, p. 721-726 (1991)) 벡터를 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제한 유전자 단편, KpnI 과 HindIII를 처리한 cj7 프로모터 유전자 단편, 또는 HindIII 과 XbaI 처리한 라이신 디카르복실레이즈 ldcC 유전자 단편을 T4 DNA lligase(NEB)를 이용하여 클로닝하였다. 위 실험으로 수득한 대장균 ldcC를 코딩하고 있는 플라스미드를 pECCG117-Pcj7-ldcC 라 명명하였다.
상기 제작한 pECCG117-Pcj7-ldcC 벡터 또는 pECCG117 벡터를 KCCM11016P, KCCM11016P Tn:P(cj7)-ARCH_0271에 전기 천공법을 이용하여 도입하였다. 도입된 균주를 25 ㎍/㎖ 카나마이신이 함유된 BHIS 평판 배지에 도말하여 형질 전환체를 선별하였다. 선별된 균주를 각각 KCCM11016P pECCG117, KCCM11016P pECCG117-Pcj7-ldcC, KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117, KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117-Pcj7-ldcC 라 명명하였다(총 4종).
<3-3> ARCH_0271가 염색체에 도입되고 라이신 디카르복실레이즈가 플라스미드로 도입된 코리네박테리움 속 유래 라이신 생산균주의 카다베린 생산능 평가
카다베린 생산 균주에서 ARCH_0271 도입 시 카다베린 생산에 미치는 효과를 확인하기 위하여, 상기 실시예 <3-2>에서 제작된 코리네박테리움 글루타미쿰 변이주를 대상으로 카다베린 생산능을 비교하였다.
구체적으로, 4종의 코리네박테리움 글루타미쿰 변이주(KCCM11016P pECCG117; KCCM11016P pECCG117-Pcj7-ldcC; KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117; KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117-Pcj7-ldcC)를 아래와 같은 방법으로 배양하여 카다베린 생산능을 비교하였다.
각각을 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다. 이로부터 배양된 각 균주를 종 배지(glucose 2%, peptone 1%, yeast extract 0.5%, urea 0.15 %, KH2PO4 0.4%, K2HPO4 0.8%, MgSO4·7H2O 0.05%, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ , pH 7.0 , 1 L 기준) 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다.
그 후, 생산 배지(glucose 4%, (NH4)2SO4 2%, 대두 단백질 2.5%, 옥수수 침지 고형분(Corn Steep Solids) 5%, urea 0.3%, KH2PO4 0.1%, MgSO4·7H2O 0.05%, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, 루이신 0.2 g, 트레오닌 0.1 g, 메티오닌 0.1 g, CaCO3 5%, pH 7.0, 1 L 기준) 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 72시간 동안, 200 rpm에서 진탕 배양하였다.
배양이 종료된 후 HPLC로 L-라이신과 카다베린의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 L-라이신과 카다베린 농도는 하기 표 7과 같다.
균주명 플라스미드 명 카다베린 (g/L)
KCCM11016P pECCG117 0
pECCG117-Pcj7-ldcC 2.3
KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117 0
pECCG117-Pcj7-ldcC 2.7
상기 표 7에 나타난 바와 같이, ARCH_0271가 도입된 코리네박테리움 글루타미쿰 변이주에서 카다베린 생산량이 17% 이상 증가하였음을 확인하였다.
실시예 3. 대장균에 다이아민 배출능을 가지는 단백질 도입을 통한 다이아민 발효
<3-1> W3110에 ARCH_0271, QWA _00075, 또는 SMD_2351 도입한 균주 제작
퓨트레신 생성능과 카다베린 생합성 경로를 갖는 대장균 야생형 균주 W3110에서, 알카노박테리움 해모리티쿰 DSM 20595의 ARCH_0271, 알칼리게네스 패칼리스 유래의 QWA_00075 또는 스테노트로포모나스 말토필리아 유래의 SMD_2351를 발현시키는 경우 퓨트레신과 카다베린의 생산을 증가시킬 수 있는지를 확인하기 위하여, W3110에 코리네박테리움과 대장균 셔틀벡터 기반의 pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-QWA_00075, 또는 pDZTn-P(cj7)-SMD_2351를 각각 도입하였다.
대장균 내 형질전환은 2X TSS 용액(Epicentre)를 사용하였고, 이를 카나마이신(50 ㎍/㎖)이 함유된 LB 평판배지(Tryptone 10g, Yeast extract 5g, Nacl 10g, agar 2%, 1 L 기준)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니를 각각 W3110 pDZTn-P(cj7)-ARCH_0271, W3110 pDZTn-P(cj7)-QWA_00075, W3110 pDZTn-P(cj7)-SMD_2351라 명명하였다.
<4-2> ARCH_0271, QWA _00075, SMD_2351 도입된 대장균의 다이아민 생산능 비교
상기에서 수득한 균주를 대상으로 퓨트레신과 카다베린 생산능을 확인하였다.
구체적으로, W3110과 W3110 pDZTn-P(cj7)-ARCH_0271, W3110 pDZTn-P(cj7)-QWA_00075, W3110 pDZTn-P(cj7)-SMD_2351를 LB 고체 배지에서 37℃에서 24시간 배양하였다.
그 후, 이를 각각 25 mL 역가 배지((NH4)2PO4 2 g, KH2PO4 6.75g, citric acid 0.85g, MgSO4ㆍ7H2O 0.7g, 미량 원소 0.5% (v/v), glucose 10g, AMS 3g, CaCO3 30g, 1L 기준)에서 37℃로 24시간 동안 배양하였다. 미량 금속 용액(Trace metal solution)은 1리터당 5M HCl: FeSO4ㆍ7H2O 10 g, ZnSO4ㆍ7H2O 2.25g, CuSO4ㆍ5H2O 1g, MnSO4ㆍ5H2O 0.5g, Na2B4O7ㆍ10H2O 0.23g, CaCl2ㆍ2H2O 2g, (NH4)6Mo7O2ㆍ4H2O 0.1g을 포함한다.
각 배양물로부터 생산된 퓨트레신과 카다베린 농도를 측정하였고, 그 결과를 하기 표 8에 나타내었다.
모균주 플라스미드명 퓨트레신 (mg/L) 카다베린(mg/L)
W3110 (-) 13 5
pDZTn-P(cj7)-ARCH_0271 51 23
pDZTn-P(cj7)-QWA_00075 72 30
pDZTn-P(cj7)-SMD_2351 37 15
상기 표 8에 나타난 바와 같이, 모균주 W3110에 비해, ARCH_0271, QWA_00075 또는 SMD_2351가 도입된 W3110 pDZTn-P(cj7)-ARCH_0271, W3110 pDZTn-P(cj7)-QWA_00075, W3110 pDZTn-P(cj7)-SMD_2351 균주에서 퓨트레신과 카다베린 생산량이 현저히 증가하였다.
즉, NCgl2522 아미노산 서열과의 상동성이 각각 56%, 41%, 52%인 ARCH_0271, QWA_00075 또는 SMD_2351 아미노산 서열을 가지는 단백질의 활성 강화로 인하여 배양액에 다이아민의 생산량이 현저히 증가한 것을 확인하였다. 이러한 결과는 CE2495 아미노산 서열, 또는 이와 서열 상동성이 42% 이상인 아미노산 서열을 가지는 단백질의 활성 강화에 의하여, 퓨트레신 및 카다베린과 같은 다이아민 배출능이 향상됨을 시사하는 것이다.
이와 같이, 본 발명자는 퓨트레신 생성경로는 있지만 배출기능이 감소된 코리네박테리움 속 미생물 KCCM11240P △NCgl2522에서 트랜스포존 내 ARCH_0271를 도입하여 ARCH_0271활성을 강화시킨 코리네박테리움 글루타미쿰 균주가 증가된 퓨트레신 배출능을 통해 고수율로 퓨트레신을 생산할 수 있음을 확인하였다.
이에 따라, 상기 균주 KCCM11240P △NCgl2522 Tn:P(cj7)-ARCH_0271를 CC01-0758로 명명한 후 부다페스트 조약 하에 2013년 11월 15일자로 한국미생물보존센터(KCCM)에 기탁하여 기탁번호 KCCM11476P를 부여받았다.
기탁기관명 : 한국미생물보존센터(국외)
수탁번호 : KCCM11476P
수탁일자 : 20131115
본 발명에서는 알카노박테리움 해모리티쿰 유래의 ARCH_0271 단백질이 다이아민 배출능을 가지는 단백질임을 규명하고, 퓨트레신 생산경로를 가지고 있지만 배출능이 낮은 코리네박테리움 속 균주에 상기 단백질의 활성을 도입하여 퓨트레신 배출능을 강화시킬 수 있음을 확인하였다. 또한, 퓨트레신과 카다베린 생산경로를 가지고 있는 대장균에도 상기 단백질의 활성을 도입하는 경우, 퓨트레신과 카다베린의 생산이 동시에 증가됨을 확인하였다. 따라서, 알카노박테리움 해모리티쿰 유래의 ARCH_0271 단백질을 다이아민 생산능을 갖는 미생물에 적용함으로써 다이아민의 효과적인 생산을 가져올 수 있을 것이다.
Figure PCTKR2015003066-appb-I000001

Claims (8)

  1. 서열번호 6으로 기재되는 아미노산 서열 또는 이와 42% 이상의 서열 상동성을 가지는 아미노산 서열을 포함하는 단백질의 활성이 도입 또는 강화된, 다이아민 생산능을 갖는 미생물.
  2. 제1항에 있어서, 상기 서열번호 6으로 기재되는 아미노산 서열과 42% 이상의 서열 상동성을 가지는 아미노산 서열은 서열번호 23 또는 26을 포함하는 그룹에서 선택되는 어느 하나인, 미생물.
  3. 제1항에 있어서, 상기 미생물은 추가적으로 다이아민 아세틸트랜스퍼라아제 활성이 내재적 활성에 비하여 약화된 것인, 미생물.
  4. 제3항에 있어서, 상기 다이아민 아세틸트랜스퍼라아제는 서열번호 12, 13, 및 14로 이루어진 그룹 중에서 선택된 아미노산 서열을 포함하는 것인, 미생물.
  5. 제1항에 있어서, 상기 다이아민은 퓨트레신 또는 카다베린인 것인, 미생물.
  6. 제1항에 있어서, 상기 미생물은 코리네박테리움(Corynebacteirum) 속 미생물 또는 에스케리치아(Escherichia) 속 미생물인, 미생물.
  7. (i) 제1항 내지 제6항 중 어느 한 항의 미생물을 배양하여 배양물을 수득하는 단계; 및
    (ii) 상기 배양된 미생물 또는 배양물로부터 다이아민을 회수하는 단계를 포함하는, 다이아민의 생산 방법.
  8. 제7항에 있어서, 상기 다이아민은 퓨트레신 또는 카다베린인 것인 생산 방법.
PCT/KR2015/003066 2014-04-25 2015-03-27 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법 WO2015163592A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
JP2017507656A JP6526791B2 (ja) 2014-04-25 2015-03-27 ジアミンを生産する微生物及びそれらを用いてジアミンを生産する方法
CN201580034465.1A CN106574234B (zh) 2014-04-25 2015-03-27 产生二胺的微生物和使用该微生物产生二胺的方法
RU2016141403A RU2696504C2 (ru) 2014-04-25 2015-03-27 Микроорганизм для продуцирования диамина и способ получения диамина с его использованием
EP15783109.0A EP3135758B1 (en) 2014-04-25 2015-03-27 Diamine-producing microorganism and method for producing diamine using same
BR112016024970A BR112016024970A2 (pt) 2014-04-25 2015-03-27 microorganismos para produzir diamina e processo para produzir diamina usando os mesmos
US15/306,758 US10640797B2 (en) 2014-04-25 2015-03-27 Microorganisms for producing diamine and process for producing diamine using them
AU2015250514A AU2015250514B2 (en) 2014-04-25 2015-03-27 Microorganisms for Producing Diamine and Process for Producing Diamine Using Them
US16/000,619 US10640798B2 (en) 2014-04-25 2018-06-05 Microorganisms for producing diamine and process for producing diamine using them

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20140049871 2014-04-25
KR10-2014-0049871 2014-04-25

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/306,758 A-371-Of-International US10640797B2 (en) 2014-04-25 2015-03-27 Microorganisms for producing diamine and process for producing diamine using them
US16/000,619 Continuation US10640798B2 (en) 2014-04-25 2018-06-05 Microorganisms for producing diamine and process for producing diamine using them

Publications (1)

Publication Number Publication Date
WO2015163592A1 true WO2015163592A1 (ko) 2015-10-29

Family

ID=54332717

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/003066 WO2015163592A1 (ko) 2014-04-25 2015-03-27 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법

Country Status (11)

Country Link
US (2) US10640797B2 (ko)
EP (1) EP3135758B1 (ko)
JP (2) JP6526791B2 (ko)
KR (1) KR101735178B1 (ko)
CN (1) CN106574234B (ko)
AU (1) AU2015250514B2 (ko)
BR (1) BR112016024970A2 (ko)
MY (1) MY181148A (ko)
RU (1) RU2696504C2 (ko)
TW (5) TW201638331A (ko)
WO (1) WO2015163592A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015163592A1 (ko) * 2014-04-25 2015-10-29 씨제이제일제당 (주) 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법
KR101937569B1 (ko) * 2017-06-14 2019-01-11 씨제이제일제당 (주) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2022244809A1 (ja) * 2021-05-19 2022-11-24 旭化成株式会社 ジアミン生産能を有する組換え微生物およびジアミンの製造方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120064046A (ko) * 2010-12-08 2012-06-18 씨제이제일제당 (주) 퓨트레신을 생산하는 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
EP2949755B1 (en) 2004-07-15 2018-03-28 DSM IP Assets B.V. Biochemical synthesis of 1,4-butanediamine
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
CN101389765B (zh) * 2006-03-30 2012-08-22 巴斯夫欧洲公司 生产尸胺的方法
KR100930203B1 (ko) 2008-01-28 2009-12-07 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
AU2009234625B2 (en) * 2008-04-10 2012-07-19 Korea Advanced Institute Of Science And Technology Mutant microorganisms having high ability to produce putrescine and method for producing putrescine using the same
KR101126041B1 (ko) 2008-04-10 2012-03-19 씨제이제일제당 (주) 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 ｌ-라이신 생산방법
KR101922742B1 (ko) 2011-02-22 2019-02-20 바스프 에스이 카다베린의 생산을 위한 방법 및 재조합 미생물
US9644220B2 (en) 2011-12-22 2017-05-09 Basf Se Processes and recombinant microorganisms for the production of fine chemicals
US9677099B2 (en) 2012-01-11 2017-06-13 Cj Cheiledang Corporation Recombinant microorganisms with an improved productivity of putrescine and method for producing putrescine using the same
DE102013100849A1 (de) * 2013-01-29 2014-07-31 Newfrey Llc Verfahren zum Spritzgießen eines Befestigungselements und Befestigungselement
KR101607741B1 (ko) * 2013-03-20 2016-03-31 씨제이제일제당 (주) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
EP3126512B1 (en) * 2014-02-26 2019-04-17 Ventana Medical Systems, Inc. Photo-selective method for biological sample analysis field
WO2015163592A1 (ko) * 2014-04-25 2015-10-29 씨제이제일제당 (주) 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120064046A (ko) * 2010-12-08 2012-06-18 씨제이제일제당 (주) 퓨트레신을 생산하는 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE Gen Bank [O] 28 January 2014 (2014-01-28), YASAWONG,M.: "major facilitator superfamily MFS_1 [Arcanobacterium haemolyticum DSM 20595]", XP055233623, retrieved from ncbi Database accession no. ADH92029 *
HIDEYUKI TOMITORY ET AL., BIOCHEM. J., vol. 353, 2001, pages 681 - 688, XP055233462 *
See also references of EP3135758A4 *
STEFANIE KIDN ET AL., METABOLIC ENGINEERING, vol. 13, 2011, pages 617 - 627, XP028274829 *

Also Published As

Publication number Publication date
US10640797B2 (en) 2020-05-05
JP2017513529A (ja) 2017-06-01
TW201704465A (zh) 2017-02-01
RU2016141403A (ru) 2018-05-25
RU2016141403A3 (ko) 2018-05-25
JP7011622B2 (ja) 2022-01-26
TW201638331A (zh) 2016-11-01
TW201546277A (zh) 2015-12-16
MY181148A (en) 2020-12-19
TWI675914B (zh) 2019-11-01
JP2019170385A (ja) 2019-10-10
JP6526791B2 (ja) 2019-06-05
CN106574234A (zh) 2017-04-19
AU2015250514A1 (en) 2016-12-08
AU2015250514B2 (en) 2018-05-17
BR112016024970A2 (pt) 2017-10-24
RU2696504C2 (ru) 2019-08-02
US10640798B2 (en) 2020-05-05
TWI674319B (zh) 2019-10-11
EP3135758A1 (en) 2017-03-01
TWI657140B (zh) 2019-04-21
US20170159085A1 (en) 2017-06-08
US20180273992A1 (en) 2018-09-27
EP3135758A4 (en) 2017-10-18
TW201720921A (zh) 2017-06-16
KR20150124385A (ko) 2015-11-05
CN106574234B (zh) 2020-06-09
EP3135758B1 (en) 2021-12-29
KR101735178B1 (ko) 2017-05-15
TW201936918A (zh) 2019-09-16

Similar Documents

Publication Publication Date Title
WO2012077995A2 (ko) 퓨트레신을 생산하는 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2013105827A2 (ko) 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법
WO2019147078A1 (ko) 퓨린 뉴클레오티드를 생산하는 코리네박테리움 속 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019231159A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2019004778A2 (ko) 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법
WO2020130236A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2015199396A1 (ko) O-아세틸 호모세린을 생산하는 미생물 및 상기 미생물을 이용하여 o-아세틸 호모세린을 생산하는 방법
WO2017014532A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2016208854A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2019147059A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2015163592A1 (ko) 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법
WO2018230977A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2015163591A1 (ko) 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법
WO2015156583A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2019004779A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2022035011A1 (ko) 퓨트레신 생산 미생물 및 이를 이용한 퓨트레신 생산방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2019004780A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15783109

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017507656

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15306758

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: IDP00201607299

Country of ref document: ID

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016024970

Country of ref document: BR

REEP Request for entry into the european phase

Ref document number: 2015783109

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015783109

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016141403

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2015250514

Country of ref document: AU

Date of ref document: 20150327

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112016024970

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20161025