WO2019004779A2 - 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법 - Google Patents

신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법 Download PDF

Info

Publication number
WO2019004779A2
WO2019004779A2 PCT/KR2018/007408 KR2018007408W WO2019004779A2 WO 2019004779 A2 WO2019004779 A2 WO 2019004779A2 KR 2018007408 W KR2018007408 W KR 2018007408W WO 2019004779 A2 WO2019004779 A2 WO 2019004779A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
succinyl homoserine
microorganism
homoserine
activity
Prior art date
Application number
PCT/KR2018/007408
Other languages
English (en)
French (fr)
Other versions
WO2019004779A3 (ko
Inventor
김경림
심지현
김현아
신용욱
이베드로
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to EP18823952.9A priority Critical patent/EP3647416A4/en
Priority to SG11201913889WA priority patent/SG11201913889WA/en
Priority to CN201880053427.4A priority patent/CN111315877B/zh
Priority to BR112019027949-0A priority patent/BR112019027949B1/pt
Priority to US16/627,655 priority patent/US11142779B2/en
Priority to RU2020100467A priority patent/RU2747493C1/ru
Priority to JP2019571996A priority patent/JP6980819B2/ja
Publication of WO2019004779A2 publication Critical patent/WO2019004779A2/ko
Publication of WO2019004779A3 publication Critical patent/WO2019004779A3/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C319/00—Preparation of thiols, sulfides, hydropolysulfides or polysulfides
    • C07C319/02—Preparation of thiols, sulfides, hydropolysulfides or polysulfides of thiols
    • C07C319/08—Preparation of thiols, sulfides, hydropolysulfides or polysulfides of thiols by replacement of hydroxy groups or etherified or esterified hydroxy groups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1217—Phosphotransferases with a carboxyl group as acceptor (2.7.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/02—Phosphotransferases with a carboxy group as acceptor (2.7.2)
    • C12Y207/02004—Aspartate kinase (2.7.2.4)

Definitions

  • the present invention relates to an O-succinyl homoserine transferase mutant, a polynucleotide encoding the same, a microorganism containing the mutant, and a method for producing O-succinyl homoserine using the microorganism.
  • O-succinyl homoserine acts as a precursor of methionine, a kind of essential amino acid in vivo.
  • Methionine is used as a feedstock and food additive, as well as a synthesis material for infusions and medicines.
  • Methionine is produced through chemical synthesis and biological synthesis.
  • a two-step process (WO / 2008/013432) for producing L-methionine by an enzyme conversion reaction from L-methionine precursor produced through fermentation is also known.
  • O-succinyl homoserine and O-acetyl homoserine are used as methionine precursors in the above two-step process.
  • O-succinyl homoserine and O-acetyl homoserine are used for economical mass production of methionine, It is very important to produce serine in high yield.
  • the metA gene consists of homoserine O-succinyl (homoserine), an enzyme that binds the succinyl group of succinyl-coA to form O-succinyl homoserine Is a gene coding for homoserine O-succinyltransferase (MetA), and is one of the most important genes in the development of O-succinyl homoserine producing strains.
  • a strain in which O-succinyl homoserine is accumulated through metB gene deletion encoding cystathionine gamma synthase in the methionine biosynthetic pathway can be produced.
  • the strain producing O-succinyl homoserine exhibits L-methionine requirement.
  • the homoserine O-succinyl transferase is inhibited by feedback inhibition by the methionine added to the medium, and ultimately, the high concentration of O-succinyl homoserine can not be obtained.
  • MetA O-succinyl homoserine
  • homoserine O-acetyltransferase homoserine O-acetyltransferase MetX
  • MetX is not subject to feedback inhibition and has high enzyme stability.
  • the present inventors have completed the present invention by discovering a protein having an activity of synthesizing O-succinyl homoserine.
  • One object of the present application is to provide a polypeptide having O-succinyl homoserine transferase activity, wherein the 313rd amino acid in the amino acid sequence of SEQ ID NO: 1 includes substitution with an amino acid other than leucine .
  • Another object of the present application is to provide a polynucleotide encoding said polypeptide.
  • It is another object of the present application is to provide a microorganism of the genus Corynebacterium (corynebacterium) to produce O- succinyl homoserine comprising a polypeptide having the O- succinyl homoserine transferase activity.
  • Another object of the present application is to provide a method for culturing a microorganism, comprising culturing the microorganism in a medium; And separating or recovering O-succinyl homoserine from the cultured microorganism or culture medium.
  • the present invention also provides a method for producing O-succinyl homoserine.
  • Another object of the present application is to provide a method for culturing a microorganism, comprising culturing the microorganism in a medium; And reacting the O-succinyl homoserine with a sulfide.
  • the present invention also provides a method for producing L-methionine.
  • the mutated O-succinyl homoserine transferase protein increases the O-succinyl homoserine conversion activity as compared with the native form, and the more efficient O-succinyl homoserine transferase as an alternative to the existing chemical synthesis pathway It will be widely used in mass production.
  • novel polypeptide having O-succinyl homoserine transferase activity includes an amino acid sequence derived from Corynebacterium glutamicum , specifically, an O-succinyl homolog, in which the 313rd amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid other than leucine And may be a polypeptide having an O-succinyl homoserine transferase activity.
  • polypeptide may have an O-succinyl homoserine transferase activity at the 313rd position in the amino acid sequence of SEQ ID NO: 1, including substitution with an amino acid other than leucine. More specifically, the polypeptide may be a polypeptide having an O-succinyl homoserine transferase activity in which the 313rd amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with an arginine, cysteine, isoleucine, or lysine, But is not limited to.
  • Such a mutant polypeptide is characterized in that O-succinyl homoserine transferase activity is enhanced as compared to a polypeptide having the activity of O-succinyl homoserine transferase of SEQ ID NO: 1.
  • O-succinyl homoserine transferase activity in the present application means the activity of converting homoserine into O-succinyl homoserine.
  • the O-succinyl homoserine transferase refers to an enzyme capable of converting CoA and O-succinyl homoserine to succinyl CoA and L-homoserine as substrates.
  • O-succinyl homoserine transferase means that one part of the amino acid sequence of MetX protein, which is O-acetyl homoserine transporter, is converted into another amino acid and has the activity of O-succinyl homoserine transferase.
  • the MetX proteins genus Corynebacterium may be derived MetX, more specifically, Corynebacterium glutamicum (Corynebacterium glutamicum ) derived from SEQ ID NO: 1, but is not limited thereto.
  • the MetX protein can be obtained from GenBank of NCBI, a known database.
  • various methods well known in the art are applicable to the method for securing the O-succinyl homoserine transferase.
  • examples of such methods include gene synthesis techniques that include codon optimization so as to obtain enzymes at a high efficiency in Corynebacterium sp.
  • Microorganisms which are commonly used for enzyme expression, and bioinformatic methods based on massive genome information of microorganisms And can be obtained through a screening method of available enzyme resources, but is not limited thereto.
  • O-succinyl homoserine transferase mutant in the present application can be mixed with " mutated O-succinyl homoserine transferase " or " mutant type O-succinyl homoserine transferase ".
  • these variants may be non-naturally occurring.
  • Corynebacterium having the amino acid sequence shown in SEQ ID NO: 1 in Solarium (Corynebacterium sp . ) Derived MetX may be replaced with another amino acid other than leucine.
  • the 313rd leucine amino acid residue may be substituted with arginine, cysteine, isoleucine, or lysine, but is not limited thereto.
  • the mutated O-succinyl homoserine transferase of the present application comprises a polypeptide comprising a mutation at position 313 from the N-terminus of the amino acid sequence of SEQ ID NO: 1, wherein the mutation is selected from the group consisting of arginine, cysteine wherein the polypeptide comprises an amino acid substitution selected from the group consisting of cysteine, isoleucine, and lysine, the polypeptide having at least 85% homology or identity with SEQ ID NO: 1, It does not.
  • polypeptide having O-succinyl homoserine transferase activity of the present application is selected from the group consisting of the amino acid sequence shown in SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 75 and SEQ ID NO: 81 Or the like.
  • O-succinyl homoserine transferase O (SEQ ID NO: 1)
  • the 313th amino acid from the N terminus is mutated into arginine, cysteine, isoleucine or lysine, -succinyl homoserine transferase activity, but is not limited thereto.
  • MetX in the present application may be a MetX protein consisting of an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 80% homology or homology thereto, but is not limited thereto.
  • the MetX protein of the present invention has at least 80%, at least 85%, specifically at least 90%, more specifically at least 95%, even more specifically at least 99% Homology or identity of the protein.
  • variant refers to a polypeptide that differs from the recited sequence in conservative substitution and / or modification of one or more amino acids, Quot; refers to a polypeptide in which functions or properties are maintained. Mutant polypeptides differ from the identified sequences by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one of the polypeptide sequences and evaluating the properties of the modified polypeptide. That is, the ability of a variant may be increased, unchanged, or decreased relative to the native protein. Such variants can generally be identified by modifying one of the polypeptide sequences and assessing the reactivity of the modified polypeptide.
  • variants may include variants in which one or more portions, such as an N-terminal leader sequence or transmembrane domain, have been removed.
  • Other variants may include variants in which a portion is removed from the N- and / or C-terminus of the mature protein.
  • mutant type can be used as a variant, a variant, a mutated protein, a variant polypeptide, a variant, etc. (in English, modified protein, modified polypeptide, mutant, mutein, divergent, The term used herein is not limited thereto.
  • the mutant includes a variant in which the amino acid of O-succinyl homoserine transferase derived from Corynebacterium glutamicum is mutated so that its activity can be efficiently increased as compared with the wild type.
  • conservative substitution means replacing one amino acid with another amino acid having similar structural and / or chemical properties.
  • the variant may have, for example, one or more conservative substitutions while still retaining one or more biological activities.
  • Such amino acid substitutions can generally occur based on the polarity, charge, solubility, hydrophobicity, hydrophilicity and / or similarity in the amphipathic nature of the moiety.
  • positively charged (basic) amino acids include arginine, lysine, and histidine
  • Negatively charged (acidic) amino acids include glutamic acid and arpartic acid
  • Aromatic amino acids include phenylalanine, tryptophan and tyrosine
  • hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine and tryptophan.
  • conservative substitutions have little or no effect on the activity of the resulting polypeptide.
  • variants may include other characteristics, including deletion or addition of amino acids with minimal effect on the properties and secondary structure of the polypeptide.
  • a polypeptide can be conjugated to a signal (or leader) sequence of a protein N-terminal that is involved in the transfer of proteins co-translationally or post-translationally.
  • the polypeptide may also be conjugated to another sequence or linker so that the polypeptide can be identified, purified, or synthesized.
  • the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 75, and SEQ ID NO: 81 includes at least one amino acid sequence selected from the group consisting of , A protein, or a polynucleotide that can be translated into a protein having homology or homology thereto.
  • a probe that can be prepared from a known gene sequence for example, hydrolized under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence, to obtain a polynucleotide having an O-succinyl homoserine transferase activity
  • Any sequence that encodes a protein may be included without limitation.
  • stringent conditions means conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (e.g., J. Sambrook et al., Sangdong). For example, it is preferable that 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more,
  • the hybridization of the genes having the above homology or identity with each other and the hybridization of the genes having less homology or homology with each other are carried out under the conditions of 60 ° C, 1XSSC, 0.1% SDS, specifically the hybridization conditions for normal hybridization
  • the conditions for washing once, specifically twice to three times at 60 ⁇ ⁇ , 0.1 ⁇ SSC, 0.1% SDS, more specifically at a salt concentration and temperature corresponding to 68 ⁇ ⁇ , 0.1 ⁇ SSC, 0.1% SDS have.
  • Hybridization requires that two nucleic acids have a complementary sequence, although mismatches between bases are possible, depending on the severity of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing with each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions that include a hybridization step at a Tm value of 55 ° C and using the conditions described above.
  • the Tm value may be 60 ° C, 63 ° C, or 65 ° C, but is not limited thereto and may be suitably adjusted by those skilled in the art according to the purpose.
  • Suitable stringency to hybridize polynucleotides depends on the length and complementarity of the polynucleotide and the variables are well known in the art (see Sambrook et al., Supra, 9.50-9.51, 11.7-11.8).
  • Homology or identity refers to the degree of association with two given amino acid sequences or nucleotide sequences and can be expressed as a percentage.
  • Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms and default gap penalties established by the program used can be used together.
  • Substantially homologous or identical sequences generally have at least about 50%, 60%, 70%, 80% or 90% of the length of the sequence or the entire length of the sequence under moderate or high stringency conditions can be hybridized under stringent conditions.
  • Polynucleotides containing degenerate codons instead of codons in hybridizing polynucleotides can also be considered.
  • BLAST Altschul, [S.] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994; and CARILLO ETA /. (1988) SIAM J Applied Math 48: 1073)
  • BLAST or ClustalW, of the National Center for Biotechnology Information Database can be used to determine homology, similarity, or identity.
  • the homology, similarity or identity of polynucleotides or polypeptides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2: 482, for example, in Needleman et al. (1970), J Mol Biol. 48: 443, by comparing the sequence information using a GAP computer program.
  • the GAP program defines the total number of symbols in the shorter of the two sequences, divided by the number of similar aligned symbols (ie, nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a linear comparison matrix (containing 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp.
  • Another embodiment of the present application provides a polynucleotide encoding a polypeptide having the O-succinyl homoserine transferase activity.
  • polynucleotide in the present application means a polymer of a nucleotide in which a nucleotide monomer is linked in a long chain by covalent bonds, as a DNA or RNA strand of a predetermined length or more, Quot; polynucleotide "
  • the gene encoding the amino acid sequence of O-succinyl homoserine transferase in the present application is a mutant O-succinyl homoserine transferase gene, and may be specifically derived from Corynebacterium glutamicum. Nucleotide sequences coding for the same amino acid sequence and variants thereof due to genetic code degeneracy of the genetic code are also included in the present application and include, for example, SEQ ID NO: 60, SEQ ID NO: 68, SEQ ID NO: 76 or SEQ ID NO: 82 But is not limited thereto.
  • mutant polynucleotides are also included in the present application, including nucleotide sequences coding for the same amino acid sequence and mutants thereof, due to genetic code degeneracy of the genetic code.
  • the present application provides a host cell comprising a polynucleotide encoding the mutated polypeptide and a microorganism transformed with a vector comprising the polynucleotide encoding the mutated polypeptide.
  • the introduction may be by transformation, but is not limited thereto.
  • the microorganism comprising the O-succinyl homoserine transferase variant polypeptide is more preferable than the microorganism comprising the wild-type O-succinyl homoserine transferase polypeptide, without inhibiting the growth of the host cell, Production ability is improved, and O-succinyl homoserine can be obtained from these microorganisms with high yield.
  • the term " vector" means a DNA construct containing a nucleotide sequence of a polynucleotide encoding the desired protein operably linked to a suitable regulatory sequence so as to be capable of expressing the protein of interest in the appropriate host.
  • the regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling the termination of transcription and translation.
  • the vector may be transcribed into an appropriate host cell and then cloned or functioned independently of the host genome and integrated into the genome itself.
  • the vector used in the present application is not particularly limited as long as it is replicable in the host cell, and any vector known in the art can be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in their natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A and Charon21A can be used as the phage vector or cosmid vector
  • pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector and the like can be used but are not limited thereto.
  • the vector usable in the present application is not particularly limited, and known expression vectors can be used.
  • a polynucleotide encoding a target protein can be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto. And may further include a selection marker for confirming whether or not the chromosome is inserted.
  • Selection markers are used to select cells that are transfected with a vector, that is, to confirm the insertion of a target nucleic acid molecule, and are provided with selectable phenotypes such as drug resistance, resistance to nutritional requirement, tolerance to cytotoxic agents, May be used. In the environment treated with the selective agent, only the cells expressing the selectable marker survive or express different phenotypes, so that the transformed cells can be selected.
  • transformed means introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • Transformed polynucleotides may include all of these, whether inserted into the chromosome of the host cell or located outside the chromosome, provided that the polynucleotide can be expressed in the host cell.
  • the polynucleotide includes DNA and RNA encoding a target protein.
  • the polynucleotide may be introduced in any form as far as it is capable of being introduced into a host cell and expressed.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all the elements necessary for its expression.
  • the expression cassette can typically include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into the host cell in its own form and operatively linked to the sequence necessary for expression in the host cell, but is not limited thereto.
  • Such a transformation method includes any method of introducing a nucleic acid into a cell, and may be carried out by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (Ca (H 2 PO 4 ) 2 , CaHPO 4 , or Ca 3 (PO 4 ) 2 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, Polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method, but the present invention is not limited thereto.
  • a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (Ca (H 2 PO 4 ) 2 , CaHPO 4 , or Ca 3 (PO 4 ) 2 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, Polyethylene glycol (PEG) method, DEAE-dextran method,
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the protein of interest of the present application.
  • Operable linkages can be made using known recombinant techniques in the art, and site-specific DNA cleavage and linkage can be made using, but not limited to, cutting and linking enzymes in the art.
  • microorganism producing O-succinyl homoserine means a microorganism having naturally occurring O-succinyl homoserine production ability or a microorganism having no ability to produce O- succinyl homoserine, Means a microorganism to which the ability to produce NN-homoserine has been imparted.
  • the microorganism that produces O-succinyl homoserine may be a microorganism that contains a polynucleotide encoding a mutant polypeptide or may be transformed with a vector containing a polynucleotide encoding a mutant polypeptide to express a mutant polypeptide
  • the host cell or microorganism can be any microorganism capable of producing O-succinyl homoserine, including a MetX mutant polypeptide.
  • Escherichia Escherichia
  • Serratia marcescens Serratia
  • An air Winiah Erwinia
  • Enterobacter bacteria Enterobacter bacteria
  • Salmonella Salmonella
  • Streptomyces Streptomyces
  • Pseudomonas Pseudomonas
  • Brevibacterium genus or Corynebacterium genus
  • Corynebacterium genus may be specifically a microorganism belonging to the genus Corynebacterium. More specific examples thereof include Corynebacterium glutamic acid Corynebacterium glutamicum ).
  • genus Corynebacterium microorganism producing the O-succinyl homoserine in the present application means a microorganism belonging to the genus Corynebacterium which is capable of producing O-succinyl homoserine through natural type or mutation . It is already known that cultures of microorganisms of the genus Corynebacterium have O-succinyl homoserine. However, the production of O-succinyl homoserine is remarkably low, and the genes and mechanisms underlying the production mechanism are not known.
  • the microorganism of the genus Corynebacterium having O-succinyl homoserine producing ability in the present application means that the gene associated with the natural microorganism itself or the production mechanism of the external O-succinyl homoserine is inserted or the intrinsic gene activity is enhanced Means a microorganism belonging to the genus Corynebacterium which is inactivated to have improved O-succinyl homoserine producing ability.
  • the "microorganism of the genus Corynebacterium” in the present application is specifically exemplified by Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum , Brevibacterium sp . Brevibacterium flavu m), Corynebacterium thermo amino to Ness (Corynebacterium thermoaminogenes), Corynebacterium epi syeonseu (Corynebacterium efficiens ), but it is not necessarily limited thereto.
  • the microorganism of the genus Corynebacterium in the present application may be Corynebacterium glutamicum , which is less affected by cell growth and survival even when exposed to high concentrations of O-succinyl homoserine.
  • the microorganism may be inactivated of at least one protein activity selected from the group consisting of cystathionine synthase, O-acetyl homoserine (thiol) -lease, and homoserine kinase. That is, one protein activity, two protein activities, or all three activities selected in the above may be inactivated.
  • the term "inactivating" the activity of a protein is a concept that includes both an activity that is weaker or less active than an intrinsic activity.
  • Inactivation of such protein activity can be achieved by the application of various methods well known in the art.
  • Examples of the method include a method of deleting all or a part of a gene on a chromosome coding for the protein including the case where the activity of the protein is eliminated; A method of replacing the gene encoding the protein on the chromosome with the mutated gene so that the activity of the enzyme is decreased; A method of introducing a mutation into an expression control sequence of a gene on a chromosome encoding the protein; A method of replacing the expression control sequence of the gene encoding the protein with a weak or absent sequence (for example, a method of replacing the promoter of the gene with a weaker promoter than the endogenous promoter); Deletion of all or part of the gene on the chromosome encoding the protein; A method of introducing an antisense oligonucleotide (for example, antisense RNA) that binds complementarily to a transcript of a gene on the chromosome
  • a method of deleting a part or all of a gene encoding a protein is to replace a polynucleotide encoding an intrinsic target protein in a chromosome with a polynucleotide or marker gene in which a part of the nucleic acid sequence has been deleted through a vector for insertion of the chromosome in the microorganism .
  • a method of deletion of a gene by homologous recombination there can be used, but not limited to, a method of deletion of a gene by homologous recombination.
  • the term " part" is different depending on the kind of the polynucleotide, and can be appropriately determined by those skilled in the art. Specifically, it is 1 to 300, more specifically 1 to 100, . However, the present invention is not particularly limited thereto.
  • a method of modifying an expression control sequence may be performed by inducing a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to further inactivate the activity of the expression control sequence, With a nucleic acid sequence having a weaker activity.
  • the expression control sequence may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating termination of transcription and translation.
  • the method of modifying a gene sequence on a chromosome may be carried out by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in order to more inactivate the activity of the protein, , Or by replacing the gene sequence with an improved gene sequence to have no activity or with no activity.
  • the microorganism has a metB gene encoding cystathionine gamma-synthase, a metY gene encoding O-acetyl homoserine (thiol) -lease , which is a degradation pathway of O-succinyl homoserine, and a homoserine kinase
  • a metB gene encoding cystathionine gamma-synthase
  • a metY gene encoding O-acetyl homoserine (thiol) -lease , which is a degradation pathway of O-succinyl homoserine
  • a homoserine kinase At least one gene selected from the group consisting of the gene (s) thrB encoding the gene ( s ) is further deficient or weakened.
  • deletion means a form in which a nucleotide sequence from the nucleotide sequence corresponding to the initiation codon of the target gene to the termination codon or a nucleotide sequence of the regulatory region is removed from within the chromosome do.
  • weakening refers to the removal or reduction of intracellular activity against one or more enzymes encoded by the corresponding DNA in a microbial strain, for example, a promoter of a gene, Site and the 5'-UTR region to weaken the expression of the protein or to induce a mutation at the ORF region of the gene to weaken the activity of the protein.
  • the microorganism of the genus Corynebacterium may be a microorganism of the genus Corynebacterium which produces O-succinyl homoserine, wherein the aspartokinase activity is further enhanced as compared with the non-mutant microorganism.
  • enhancing the activity of a protein in the present application means that the activity of the protein is introduced or increased relative to the intrinsic activity. &Quot; Introduction “ of the activity means that the activity of a specific polypeptide, which is not naturally or artificially inherent to the microorganism, appears.
  • the term " increasing " the activity of a protein relative to the intrinsic activity means that the activity of the microorganism is enhanced compared to the intrinsic activity or the pre-modification activity of the protein.
  • intrinsic activity refers to the activity of a specific protein originally possessed by a parent strain or an unmodified microorganism before transformation, when a genetic variation caused by a natural or an anthropogenic factor changes the microorganism's trait. It can be used in combination as a pre-strain activity.
  • the copy number increase of the 1) polynucleotide can be carried out in a form that is not particularly limited but is operably linked to a vector or inserted into a chromosome in a host cell.
  • a polynucleotide encoding the protein of the present invention may be operatively linked to a vector capable of being replicated and functioned independently of the host, and introduced into the host cell, or the polynucleotide may be inserted into a chromosome in the host cell
  • the polynucleotide may be operably linked to a vector capable of being introduced into the host cell to increase the number of copies of the polynucleotide in the chromosome of the host cell.
  • nucleic acid sequence may be deleted, inserted, non-conserved or conservative substitution, or the like to enhance the activity of the expression control sequence. , Or by replacing with a nucleic acid sequence having more potent activity.
  • the expression regulatory sequence may include, but is not limited to, promoters, operator sequences, sequences encoding ribosomal binding sites, sequences regulating the termination of transcription and translation, and the like.
  • a strong heterologous promoter may be connected in place of the original promoter.
  • the strong promoter include CJ7 promoter (Korea Patent No. 0620092 and WO 2006/065095), lysCP1 promoter (WO2009 / 096689), EF -Tu promoter, groEL promoter, aceA or aceB promoter, but are not limited thereto.
  • 3) modification of the polynucleotide sequence on the chromosome is not particularly limited. However, modification of the nucleotide sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof may be used to further enhance the activity of the polynucleotide sequence. , Or by replacing the polynucleotide sequence with an improved polynucleotide sequence so as to have stronger activity.
  • introduction of the foreign polynucleotide sequence can be carried out by introducing an exogenous polynucleotide encoding a protein exhibiting the same / similar activity as the protein, or a codon-optimized mutant polynucleotide thereof into a host cell.
  • the foreign polynucleotide can be used without limitation in its sequence or sequence as long as it exhibits the same / similar activity as the protein.
  • the introduced foreign polynucleotide can be introduced into the host cell by optimizing its codon so that transcription and translation are optimized in the host cell.
  • introduction can be carried out by appropriately selecting a person skilled in the art by a known transformation method, and by expressing the introduced polynucleotide in a host cell, a protein can be produced and its activity can be increased.
  • a method of modifying to be enhanced by a combination of 1) to 4) above comprises: increasing the number of copies of the polynucleotide encoding the protein, modifying the expression control sequence so that its expression is increased, modifying the polynucleotide A modification of the sequence and an exogenous polynucleotide expressing the activity of the protein or a modification of the codon optimized mutated polynucleotide thereof.
  • sequence of the gene or polynucleotides can be obtained from a database such as the National Center for Biotechnology Information (NCBI).
  • NCBI National Center for Biotechnology Information
  • the present application relates to a method of producing O-succinyl homoserine, comprising culturing the microorganism as described and recovering O-succinyl homoserine from the cultured microorganism or culture medium ≪ / RTI >
  • the present application provides a method for producing L-methionine, comprising culturing the microorganism as described and reacting the cultured microorganism or O-succinyl homoserine with a sulfide.
  • the step of reacting with the sulfide means producing L-methionine from O-succinyl homoserine using any known method.
  • methyl mercaptan which is a sulfide
  • a cysteine which is a sulfide
  • a catalyst or an enzyme may be added, or the reaction may be carried out in a microorganism containing an enzyme.
  • the 'O-succinyl homoserine' may be a fermentation broth containing O-succinyl homoserine produced by the microorganism described in the present application, or may be in a purified form.
  • the 'sulfide' may be, for example, methylmercaptan, and the methylmercaptan may be in the form of sodium methyl mercaptan (CH3S-Na), methyl mercaptan (CH3SH) in gas or liquefied state
  • CH3S-Na sodium methyl mercaptan
  • CH3SH methyl mercaptan
  • methylmercaptan derivatives including forms capable of providing sulfur atoms such as methyl mercaptan, including dimethylsulfide (DMS), in the form described in WO2010 / 098629 .
  • the method for producing L-methionine can be easily determined by those skilled in the art under optimized culture conditions and enzyme activity conditions known in the art.
  • the specific culture method and medium are as described above.
  • the L-methionine production method may further include the step of separating or recovering O-succinyl homoserine from the microorganism or medium cultured in the culturing step.
  • O-succinyl homoserine of the present application encompasses not only its own form of O-succinyl homoserine but also its salt form.
  • the step of culturing the microorganism is not particularly limited, but may be carried out by a known batch culture method, a continuous culture method, a fed-batch culture method and the like.
  • the culturing conditions are not particularly limited, but may be carried out at a suitable pH (for example, a pH of 5 to 9, specifically, a pH of 5 to 10, and a pH of 5 to 10) using a basic compound such as sodium hydroxide, potassium hydroxide or ammonia or an acidic compound such as phosphoric acid or sulfuric acid.
  • PH 6 to 8, most specifically pH 6.8 oxygen or an oxygen-containing gas mixture can be introduced into the culture to maintain aerobic conditions.
  • the incubation temperature can be maintained at 20 to 45 ⁇ , specifically at 25 to 40 ⁇ , and can be cultured for about 10 to 160 hours, but is not limited thereto.
  • the O-succinyl homocerin produced by the above culture may be secreted into the medium or may remain in the cells.
  • the culture medium used may be a carbon source such as sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as soybean oil, sunflower seeds Alcohols such as glycerol and ethanol, and organic acids such as acetic acid may be used individually or in combination with each other, , But is not limited thereto.
  • a carbon source such as sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as soybean oil, sunflower seeds Alcohols such as glycerol and ethanol, and organic acids such as acetic acid may be used individually or in combination with each other, , But is not limited thereto.
  • nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, juice, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, Ammonium nitrate), and the like may be used individually or in combination, but the present invention is not limited thereto.
  • the phosphorus source potassium dihydrogenphosphate, dipotassium hydrogenphosphate, and the corresponding sodium-containing salt may be used individually or in combination, but the present invention is not limited thereto.
  • the medium may include essential growth-promoting substances such as other metal salts (e.g., magnesium sulfate or ferrous sulfate), amino acids and vitamins.
  • the method of recovering O-succinyl homoserine or L-methionine produced in the above cultivation step of the present application can collect desired amino acids from the culture medium by a suitable method known in the art according to the culture method have. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC can be used, and the desired O-succinyl homoserine or L-methionine can be separated from the culture medium or microorganism using a suitable method known in the art Can be recovered.
  • SEQ ID NO: primer The sequence (5'-3 ') 5 Primer 1 GGATCCCCTCGTTGTTCACCCAGCAACC 6 Primer 2 GGATCCCAAAGTCACAACTACTTATGTTAG
  • PCR conditions were denaturation at 95 ° C. for 5 minutes, denaturation at 95 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds, and polymerization at 72 ° C. for 90 seconds. The polymerization was carried out at 72 ° C. for 7 minutes. As a result, a DNA fragment of 1546 bp coding region of the metX gene was obtained.
  • pECCG117 (Korean Patent No. 10-0057684) vector and metX DNA fragment were treated with restriction enzyme BamHI , ligated using a DNA joining enzyme, and cloned to obtain a plasmid, which was named pECCG117- metX WT.
  • a new metX mutation site was selected and the 313rd amino acid in the amino acid sequence of SEQ ID NO: 1 was replaced with another amino acid other than leucine.
  • the pECCG117- metX WT A pair of primers (SEQ ID NOS: 7 and 8) was designed to make a mutation vector in which the plasmid was used as a template and the 313rd amino acid of O-acetyl homoserine transferase was replaced with another amino acid.
  • the L313R mutant plasmid based on the existing wild-type plasmid WT was named WT_L313R.
  • a primer for amplifying the top part one pairs SEQ ID NO: 9 and 10
  • 3 'primer for amplifying a bottom portion one pairs SEQ ID NOS: 11 and 12
  • the primers of SEQ ID NOS: 9 and 12 inserted Xba I restriction sites (underlined) at each end.
  • PCR was performed using the primers of SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 using the WT chromosome as a template.
  • the PCR conditions were denaturation at 95 ° C. for 5 minutes, denaturation at 95 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds, and polymerization at 72 ° C. for 90 seconds.
  • the polymerization was carried out at 72 ° C. for 7 minutes.
  • metB A 450 bp DNA fragment at the 5'-upper portion of the gene and a 467-bp DNA fragment at the 3'-lower portion of the gene were obtained.
  • PCR was performed with the primers of SEQ ID NO: 9 and SEQ ID NO: 12 using the two amplified DNA fragments as a template.
  • the PCR conditions were denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and polymerization at 72 ° C for 3 minutes.
  • the polymerisation reaction was carried out at 72 ° C for 7 minutes.
  • metB The central portion of the gene was deleted and a DNA fragment of 917 bp containing only the upper and lower ends was amplified.
  • the pDZ vector and the 917 bp DNA fragment were treated with restriction enzyme XbaI, ligated using a DNA joining enzyme, and cloned to obtain a plasmid, which was named pDZ-? metB .
  • WT ⁇ metB a metB gene-deficient strain, was obtained by a DNA fragment inserted on the chromosome by a secondary recombination process (cross-over).
  • SEQ ID NOS: 13 and 14 for amplifying the 5'- upper region of the metY gene based on the nucleotide sequence information of the metY gene derived from WT in order to delete the metY gene, which is another degradation pathway of O-succinyl homoserine
  • a pair of primers for amplifying the 3 ' bottom region were designed.
  • the primers of SEQ ID NOS: 13 and 16 inserted Xba I restriction sites (underlined) at each end.
  • PCR was performed using the primers of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 using the WT chromosome as a template.
  • the PCR conditions were denaturation at 95 ° C. for 5 minutes, denaturation at 95 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds, and polymerization at 72 ° C. for 90 seconds.
  • the polymerization was carried out at 72 ° C. for 7 minutes. As a result, metY A 512 bp DNA fragment at the 5'-upper portion of the gene and a 520-bp DNA fragment at the 3'-lower portion of the gene were obtained.
  • PCR was carried out using the primers of SEQ ID NO: 13 and SEQ ID NO: 16, using the two amplified DNA fragments as a template.
  • the PCR conditions were denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and polymerization at 72 ° C for 3 minutes.
  • the polymerisation reaction was carried out at 72 ° C for 7 minutes. As a result, the central portion of the metY gene was deleted, and a DNA fragment of 1032 bp containing only the upper and lower ends was amplified.
  • the pDZ vector and the 1032 bp DNA fragment were treated with restriction enzyme XbaI, ligated using a DNA joining enzyme, and cloned to obtain a plasmid, which was named pDZ- ? metY .
  • the pDZ-DELTA metY vector was introduced into the WT DELTA metB strain prepared above by electric pulse method, and a transformant strain was obtained in a selection medium containing 25 mg / L of kanamycin.
  • the lysC gene (SEQ ID NO: 18) encoding the WT-derived aspartokinase (SEQ ID NO: 17) (SEQ ID NOS: 19 and 20) and a pair of primers (SEQ ID NOS: 21 and 22) for amplifying the 3'-bottom region were designed.
  • the primers of SEQ ID NOs: 19 and 22 inserted an Xba I restriction site (underlined) at each end, and the primers of SEQ ID NOs: 20 and 21 were designed so that nucleotide substitution mutations Respectively.
  • PCR was carried out using the primers of SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22 using the WT chromosome as a template.
  • the PCR conditions were denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and polymerization at 72 ° C for 30 seconds.
  • the reaction was carried out at 72 ° C for 7 minutes.
  • lysC A 509 bp DNA fragment at the 5'-upper portion and a 520-bp DNA fragment at the 3'-lower portion were obtained centering on the mutation of the gene.
  • PCR was performed with the primers of SEQ ID NO: 19 and SEQ ID NO: 22 using the two amplified DNA fragments as a template.
  • the PCR conditions were denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and polymerization at 72 ° C for 60 seconds.
  • the reaction was carried out at 72 ° C for 7 minutes.
  • lysC SEQ ID NO: 23
  • SEQ ID NO: 23 coding for the aspartokinase mutant (SEQ ID NO: 23) substituted with isoleucine at the 311st threonine
  • SEQ ID NO: 24 A DNA fragment of 1011 bp containing the mutation of the gene
  • a pDZ vector (Korean Patent No. 0924065) and a DNA fragment of 1011 bp, which can not be cloned in Corynebacterium glutamicum, were treated with restriction enzyme Xba I, ligated using a DNA joining enzyme, and cloned, And named it pDZ- lysC (T311I).
  • the pDZ- lysC (T311I) vector was introduced into WT ⁇ metB ⁇ metY by the electric pulse method (Appl. Microbiol. Biothcenol. (1999) 52: 541-545) and cultured in a selective medium containing 25 mg / L of kanamycin And a transformant strain was obtained.
  • WT ⁇ metB ⁇ metY , lysC (T311I) in which the nucleotide mutation was introduced into the lysC gene, was obtained by the DNA fragment inserted on the chromosome by the secondary recombination process (cross-over) glutamicum WT ⁇ ⁇ metB was metY, named lysC (T311I).
  • the pECCG117- metX WT and pECCG117- metX WT_L313R vectors prepared in Examples 1 and 2 were introduced into WT DELTA metB DELTA metY prepared above by electric pulse method, and then cultured in a selection medium containing 25 mg / L of kanamycin To obtain respective transgenic strains.
  • O-acetyl homoserine O-AH
  • O-succinyl homoserine O-SH
  • the manufactured WT ⁇ metB ⁇ metY, lysC ( T311I) / pECCG117- metX WT_L313R strain is referred to as CA05-5132, and deposited them on May 11th 2017 in depositary institutions Korea Culture Center of Microorganisms under the Budapest Treaty Depositary No. KCCM12023P.
  • Saturated mutagenesis was used to construct mutants in which other amino acids were substituted for metX mutants at high O-succinyl homoserine production.
  • 18 kinds of plasmids prepared in Example 1 were used as a template in which other amino acids were substituted at the 313rd amino acid position of metX.
  • the respective mutants, substituted amino acids, and primer sequence numbers used in each variant are shown in Table 7 below.
  • a mutation-type metX gene was prepared by performing a site-directed mutagenesis kit (Stratagene, USA) using the primers shown in Table 2 above.
  • the fabricated mutagenic plasmid in WT ⁇ ⁇ metB metY, lysC (T311I) strain, and the flask was carried evaluated in the same manner as in Example 4. The results are shown in Table 8 below.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 출원은 O-숙시닐 호모세린 트랜스퍼라제 변이체, 이를 코딩하는 폴리뉴크레오티드, 상기 변이체를 포함하는 미생물 및 상기 미생물을 이용한 O-숙시닐 호모세린의 생산방법에 관한 것이다.

Description

신규한 O-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 O-숙시닐 호모세린의 제조방법
본 출원은 O-숙시닐 호모세린 트랜스퍼라제 변이체, 이를 코딩하는 폴리뉴크레오티드, 상기 변이체를 포함하는 미생물 및 상기 미생물을 이용한 O-숙시닐 호모세린의 생산방법에 관한 것이다.
O-숙시닐 호모세린은 생체 내 필수 아미노산의 한 종류인 메치오닌의 전구체로 작용한다. 메치오닌은 사료 및 식품 첨가제뿐만 아니라 수액제, 의약품의 합성 원료로 사용된다.
메치오닌은 화학 합성과 생물학적 합성을 통해 생산된다. 한편, 발효를 통해 생산한 L-메치오닌 전구체로부터 효소전환 반응에 의하여 L-메치오닌을 생산하는 이단계 공법(국제 공개출원 WO/2008/013432)도 공지되었다.
상기의 이단계 공법에서는 메치오닌 전구체로 O-숙시닐 호모세린 (O-succinyl homoserine)과 O-아세틸 호모세린 (O-acetyl homoserine)이 사용되며, 메치오닌의 경제적인 대량 생산을 위하여 O-숙시닐 호모세린을 고수율로 생산하는 것이 매우 중요하다.
metA 유전자는 호모세린(Homoserine)에 숙시닐코에이(Succinyl-coA)의 숙시닐 부위(Succinyl group)를 결합시켜 O-숙시닐 호모세린(O-succinyl homoserine)을 만드는 효소인 호모세린 O-숙시닐트랜스퍼라제(homoserine O-succinyltransferase, MetA)를 코딩하는 유전자로서, O-숙시닐 호모세린 생산 균주의 개발에 있어서 가장 중요한 유전자 중 하나이다.
메치오닌 생합성 경로에서 시스타치오닌 감마 신타아제(cystathionine gamma synthase)를 코딩하는 metB 유전자 결손을 통해 O-숙시닐 호모세린이 축적되는 균주를 제작할 수 있다. 하지만, O-숙시닐 호모세린 생산 균주는 L-메치오닌 요구성을 나타낸다. 이런 이유로 배지에 첨가된 메치오닌에 의해서 호모세린 O-숙시닐트랜스퍼라제가 피드백저해(feedback inhibition)를 받아 활성이 억제되고 최종적으로는 고농도의 O-숙시닐 호모세린을 얻을 수 없게 된다.
따라서, 종래의 많은 특허들은 피드백 조절 체계로부터 metA의 피드백 저해를 해제하는 연구에 집중되었다. 하지만, metA에 의해서 코딩되는 호모세린 O-숙시닐 트랜스퍼라제는 야생형 단백질 자체로도 안정성이 낮고, 피드백해제를 위해서 변이가 도입되면 불안정성이 더 커지는 문제점을 안고 있다. 높은 생산능을 가지는 O-숙시닐 호모세린 생산 균주의 개발을 위해서는 metA 유전자의 피드백 저해가 제거되고 효소 안정성이 확보될 필요가 있다.
자연계에 존재하는 대부분의 미생물은 메치오닌을 생합성하기 위해서 O-숙시닐 호모세린 또는 O-아세틸 호모세린을 중간체로 이용하는데 일반적으로 MetA는 O-숙시닐 호모세린을, 호모세린 O-아세틸트랜스퍼라제(homoserine O-acetyltransferase, MetX)는 O-아세틸호모세린을 생성시킨다. 그리고, MetX는 MetA와는 달리 피드백저해를 받지 않으며 효소 안정성도 높다.
본 발명자들은 O-숙시닐 호모세린의 생산을 증가시키기 위해 예의 노력한 결과, O-숙시닐 호모세린을 합성하는 활성을 가지는 단백질을 발굴함으로써 본 발명을 완성하였다.
본 출원의 하나의 목적은 서열번호 1의 아미노산 서열 내 313번째 아미노산이 루신 이외의 다른 아미노산으로의 치환을 포함하는, O-숙시닐 호모세린 트랜스퍼라제 (O-succinyl homoserine transferase) 활성을 가지는 폴리펩티드를 제공하는 것이다.
본 출원의 다른 목적은 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 또 다른 목적은 상기 O-숙시닐 호모세린 트랜스퍼라제 활성을 가지는 폴리펩티드를 포함하는 O-숙시닐 호모세린을 생산하는 코리네박테리움(corynebacterium)속 미생물을 제공하는 것이다.
본 출원의 또 다른 목적은 상기 미생물을 배지에서 배양하는 단계; 및 상기 배양된 미생물 또는 배지에서 O-숙시닐 호모세린을 분리 또는 회수하는 단계를 포함하는, O-숙시닐 호모세린 생산방법을 제공하는 것이다.
본 출원의 또 다른 목적은 상기 미생물을 배지에서 배양하는 단계; 및 상기 O-숙시닐 호모세린과 황화물을 반응시키는 단계를 포함하는, L-메치오닌 생산방법을 제공하는 것이다.
본 출원에 따른 변이된 O-숙시닐 호모세린 트랜스퍼라제 단백질은 천연형에 비하여 O-숙시닐 호모세린 전환 활성이 증대시키는 바, 기존의 화학합성 경로의 대안으로 보다 효율적인 O-숙시닐 호모세린의 대량 생산에 널리 활용될 수 있을 것이다.
이하에서는, 본 출원을 더욱 상세히 설명한다.
한편, 본 출원에서 개시되는 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술되는 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 할 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
상기 목적을 달성하기 위한 본 출원의 하나의 양태는, 신규한 O-숙시닐 호모세린 트랜스퍼라제 (O-succinyl homoserine transferase) 활성을 가지는 폴리펩티드를 제공하는 것이다. 상기 신규한 변이형 폴리펩티드는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 유래의 아미노산 서열, 구체적으로 서열번호 1의 아미노산 서열에서 313번째 아미노산이 루신 이외의 다른 아미노산으로 치환된, O-숙시닐 호모세린 트랜스퍼라제 (O-succinyl homoserine transferase) 활성을 가지는 폴리펩티드일 수 있다. 또한, 상기 폴리펩타이드는 서열번호 1의 아미노산 서열 내 313번째 위치에서 루신 이외 다른 아미노산으로의 치환을 포함하고, O-숙시닐 호모세린 트랜스퍼라제 (O-succinyl homoserine transferase) 활성을 갖는 것일 수 있다. 보다 구체적으로, 상기 폴리펩티드는 서열번호 1의 아미노산 서열에서 상기 313번째 아미노산이 알지닌, 시스테인, 이소루신, 또는 라이신으로 치환된, O-숙시닐 호모세린 트랜스퍼라제 활성을 가지는 폴리펩티드일 수 있으나, 이에 제한되는 것은 아니다.
이와 같은 변이형 폴리펩티드는 서열번호 1의 O-숙시닐 호모세린 트랜스퍼라제의 활성을 갖는 폴리펩티드에 비해 O-숙시닐 호모세린 트랜스퍼라제 활성이 강화된 특징을 갖는다.
본 출원에서 용어, "O-숙시닐 호모세린 트랜스퍼라제 (O-succinyl homoserine transferase) 활성"은 호모세린(Homoserine)을 O-숙시닐 호모세린(O-succinyl homoserine)으로 전환하는 활성을 의미한다. 상기 O-숙시닐 호모세린 트랜스퍼라제는 숙시닐 CoA와 L-호모세린을 기질로 하여 CoA와 O-숙시닐 호모 세린으로 전환할 수 있는 효소를 통칭한다.
[반응식]
숙시닐 CoA + L-호모세린 ⇔ CoA + O-숙시닐 호모세린
본 출원에서 O-숙시닐 호모세린 트랜스퍼라제는, O-아세틸 호모세린트렌스퍼라제인 MetX 단백질의 아미노산 서열 중 일부를 다른 아미노산으로 변환하여 O-숙시닐 호모세린 트랜스퍼라제의 활성을 갖는 것을 의미한다. 상기 MetX 단백질은 코리네박테리움 속 유래 MetX일 수 있으며, 더욱 구체적으로는 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum) 유래 서열번호 1로 기재된 아미노산 서열을 갖는 MetX일 수 있으나, 이에 제한되지 않는다. 상기 MetX 단백질은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다.
본 출원에 있어서, O-숙시닐 호모세린 트랜스퍼라제를 확보하는 방법은 당해 분야에서 잘 알려진 다양한 방법이 적용 가능하다. 그 방법의 예로는 효소 발현에 통상적으로 널리 이용되는 코리네박테리움 속 미생물에서 효소를 고효율로 확보할 수 있도록 코돈 최적화가 포함된 유전자 합성 기술 그리고 미생물의 대량 유전체 정보를 기반으로 생물정보학적 방법에 의해 유용 효소자원의 스크리닝 방법을 통해 확보할 수 있으며, 이에 제한되는 것은 아니다.
본 출원에서 O-숙시닐 호모세린 트랜스퍼라제 변이체는, "변이된 O-숙시닐 호모세린 트랜스퍼라제" 또는 "변이형 O-숙시닐 호모세린 트랜스퍼라제"로 혼용될 수 있다. 한편, 이러한 변이체는 비자연적인 (non-naturally occurring) 것일 수 있다.
본 출원의 변이된 O-숙시닐 호모세린 트랜스퍼라제는 구체적으로, 서열번호 1로 기재된 아미노산 서열을 갖는 코리네박테리움속(Corynebacterium sp .) 유래 MetX의 N-말단으로부터 313번째 아미노산 잔기가 루신 이외의 다른 아미노산으로 치환된 것일 수 있다. 구체적으로는, 상기 313번째 루신(leucine) 아미노산 잔기가 알지닌(arginine), 시스테인(cysteine), 이소루신(isoleucine), 또는 라이신(Lysine)으로 치환된 것일 수 있으나, 이에 제한되지 않는다. 본 출원의 변이된 O-숙시닐 호모세린 트랜스퍼라제는, 서열번호 1로 기재된 아미노산 서열의 N-말단으로부터 313번째 위치에 변이를 포함하는 폴리펩티드를 포함하고, 상기 변이는 알지닌(arginine), 시스테인(cystein), 이소루신(isoleucine), 및 라이신(Lysine)으로 이루어진 군으로부터 선택되는 아미노산 치환을 포함하고, 상기 폴리펩티드는 서열번호 1과 적어도 85% 이상 상동성 또는 동일성을 갖는 것일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 O-숙시닐 호모세린 트랜스퍼라제 (O-succinyl homoserine transferase) 활성을 가지는 폴리펩티드는 서열번호 59, 서열번호 67, 서열번호 75 및 서열번호 81로 기재되는 아미노산 서열로 이루어지는 군으로부터 선택되는 적어도 어느 하나일 수 있다. 구체적으로 이는 서열번호 1의 각각 N 말단으로부터 313번째 아미노산이 알지닌(arginine), 시스테인(cysteine), 이소루신(isoleucine), 또는 라이신(Lysine)으로 변이된 O-숙시닐 호모세린 트랜스퍼라제 (O-succinyl homoserine transferase) 활성을 가지는 폴리펩티드에 대한 아미노산 서열일 수 있으나, 이에 제한되는 것은 아니다. 상기 변이를 포함하고 야생형보다 우수한 O-숙시닐 호모세린 전환 활성을 가지는 이상 상기 서열들과 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97% 또는 99% 이상의 상동성 또는 동일성을 가지는 폴리펩티드를 제한없이 포함할 수 있다.
또한, 본 출원에서의 MetX는 서열번호 1의 아미노산 서열 또는 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열로 구성되는 MetX 단백질일 수 있으나, 이에 제한되는 것은 아니다. 구체적으로 본 출원의 상기 MetX 단백질은 서열번호 1 및 상기 서열번호 1과 적어도 80 % 이상, 85 % 이상, 구체적으로는 90 % 이상, 더욱 구체적으로는 95%이상, 보다 더욱 구체적으로는 99% 이상의 상동성 또는 동일성을 나타내는 단백질을 포함할 수 있다.
본 출원에서 용어, 폴리펩티드 "변이형 (variant)"은 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)에 있어서 상기 열거된 서열 (the recited sequence)과 상이하나, 상기 폴리펩티드의 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 변이형 폴리펩티드는 수 개의 아미노산 치환, 결실 또는 부가에 의해 식별되는 서열(identified sequence)와 상이하다. 이러한 변이형은 일반적으로 상기 폴리펩티드 서열 중 하나를 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 식별될 수 있다. 즉, 변이형의 능력은 본래 단백질(native protein)에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 이러한 변이형은 일반적으로 상기 폴리펩티드 서열 중 하나를 변형하고, 변형된 폴리펩티드의 반응성을 평가하여 식별될 수 있다. 또한, 일부 변이형은 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이형을 포함할 수 있다. 다른 변이형은 성숙 단백질 (mature protein) 의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이형을 포함할 수 있다. 상기 용어 "변이형"은 변이체, 변형, 변이된 단백질, 변이형 폴리펩티드, 변이, 등의 용어(영문 표현으로는 modification, modified protein, modified polypeptide, mutant, mutein, divergent 등)가 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다. 구체적으로 상기 변이형은 코리네박테리움 글루타미쿰 유래 O-숙시닐 호모세린 트랜스퍼라제의 아미노산이 변이되어 그 활성이 야생형과 비교하여 효율적으로 증가될 수 있는 변이형을 포함한다.
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 상기 변이형은 하나 이상의 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 예를 들면, 양으로 하전된 (염기성) (Positively charged (basic)) 아미노산은 알지닌, 리신, 및 히스티딘을 포함하고; 음으로 하전된 (산성) (negatively charged (acidic)) 아미노산은 글루탐산 및 아르파르트산을 포함하고; 방향족 아미노산은 페닐알라닌, 트립토판 및 타이로신을 포함하고, 소수성 아미노산은 알라닌, 발린, 이소류신, 류신, 메티오닌, 페닐알라닌, 타이로신 및 트립토판을 포함한다. 통상적으로, 보존성 치환은 생성된 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않는다.
또한, 변이형은 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함하는 다른 변형을 포함할 수 있다. 예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널 (또는 리더)서열과 컨쥬게이트 할 수 있다. 또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다. 즉, 본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 갖는 단백질 또는 폴리펩티드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, 상기 변이형 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면 상기 아미노산 서열 앞뒤에 단백질의 기능을 변경하지 않는 서열 추가, 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 제외하는 것이 아니며, 이러한 서열 추가 혹은 돌연변이를 가지는 경우에도 본원의 범위 내에 속하는 것이 자명하다.
또한, 코돈 축퇴성 (codon degeneracy)에 의해 상기 서열번호 1, 서열번호 59, 서열번호 67, 서열번호 75, 및 서열번호 81 의 아미노산 서열로 이루어진 군으로부터 선택되는 적어도 어느 하나의 아미노산 서열을 포함하는, 단백질 또는 이와 상동성 또는 동일성을 가지는 단백질로 번역될 수 있는 폴리뉴클레오티드 역시 포함될 수 있음은 자명하다. 또는 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리뉴크레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, O-숙시닐 호모세린 트랜스퍼라제 활성을 가지는 단백질을 코딩하는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 유전자끼리, 80% 이상, 85 % 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1XSSC, 0.1% SDS, 구체적으로는 60℃, 0.1XSSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1XSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
상동성(homology) 또는 동일성(identity)은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다.
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드하는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려될 수 있다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48 : 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본원에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 서열들간의 관련성(relevance)를 나타낸다.
본 출원의 다른 하나의 양태는 상기 O-숙시닐 호모세린 트랜스퍼라제 활성을 가지는 폴리펩티드를 코딩하는 폴리뉴클레오티드를 제공한다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원에서 O-숙시닐 호모세린 트랜스퍼라제의 아미노산 서열을 코딩하는 유전자는 변이형 O-숙시닐 호모세린 트랜스퍼라제 유전자이며, 구체적으로 코리네박테리움 글루타미쿰 유래일 수 있다. 유전 암호의 축퇴성(genetic code degeneracy)에 기인하여 동일 아미노산 서열을 코딩하는 염기서열 및 이의 변이체 또한 본 출원에 포함되며, 그 예로 서열번호 60, 서열번호 68, 서열번호 76 또는 서열번호 82로 표시될 수 있으나, 이에 제한되지 않는다.
또한, 변이형 폴리뉴클레오티드 역시 유전 암호의 축퇴성(genetic code degeneracy)에 기인하여 동일 아미노산 서열을 코딩하는 염기서열 및 이의 변이체 또한 본 출원에 포함된다.
본 출원의 또 하나의 양태로서, 본 출원은 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 숙주세포 및 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환된 미생물을 제공하는 것이다. 구체적으로 상기 도입은 형질전환에 의해 이루어질 수 있으나, 이에 제한되지 않는다.
구체적으로 O-숙시닐 호모세린 트랜스퍼라제 변이형 폴리펩티드를 포함하는 미생물은 야생형 O-숙시닐 호모세린 트랜스퍼라제 폴리펩티드를 포함하는 미생물에 비하여 숙주세포의 성장을 저해함이 없이 O-숙시닐 호모세린의 생산능이 향상되므로, 이들 미생물로부터 O-숙시닐 호모세린을 고수율로 수득할 수 있다.
본 출원에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있으나, 이에 제한되지 않는다.
본 출원에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다. 또한, 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 단백질을 코딩하는 폴리뉴클레오티드를 삽입시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다. 상기 형질전환 하는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (Ca(H2PO4)2, CaHPO4, 또는 Ca3(PO4)2) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
본 출원에서 사용되는 용어 "O-숙시닐 호모세린을 생산하는 미생물" 이란, 자연적으로 O-숙시닐 호모세린 생산능을 가지고 있는 미생물 또는 O-숙시닐 호모세린 생산능이 없는 모균주에 O-숙시닐 호모세린의 생산능이 부여된 미생물을 의미한다.
상기 O-숙시닐 호모세린을 생산하는 미생물은, 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하거나, 또는 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어 변이형 폴리펩티드를 발현할 수 있는 세포 또는 미생물로서, 본 출원의 목적상 상기 숙주세포 또는 미생물은 MetX 변이형 폴리펩티드를 포함하여 O-숙시닐 호모세린을 생산할 수 있는 미생물이라면 모두 가능하다. 구체적 예로, 에스케리키아(Escherichia) 속, 세라티아(Serratia) 속, 어위니아(Erwinia) 속, 엔테로박테리아(Enterobacteria) 속, 살모넬라 (Salmonella) 속, 스트렙토마이세스(Streptomyces) 속, 슈도모나스(Pseudomonas) 속, 브레비박테리움(Brevibacterium) 속 또는 코리네박테리움(Corynebacterium) 속 등의 미생물 균주가 포함될 수 있으며, 구체적으로 코리네박테리움 속 미생물일 수 있고, 보다 구체적인 예로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있으나 이에 한정되지 않는다.
본 출원에서 용어 "O-숙시닐 호모세린를 생산하는 코리네박테리움 속 (the genus Corynebacterium) 미생물"이란, 천연형 또는 변이를 통하여 O-숙시닐 호모세린 생산능을 가지고 있는 코리네박테리움 속 미생물을 의미한다. 코리네박테리움 속 미생물의 배양물이 O-숙시닐 호모세린을 가지고 있는 것은 이미 알려져 있었다. 다만, O-숙시닐 호모세린의 생산능이 현저히 낮으며 생산 기작에 작용하는 유전자나 기작 원리가 밝혀지지 않은 상태이다. 따라서, 본 출원에서 O-숙시닐 호모세린 생산능을 가지는 코리네박테리움 속 미생물이란 천연형 미생물 자체 또는 외부 O-숙시닐 호모세린 생산 기작과 관련된 유전자가 삽입되거나 내재적 유전자의 활성을 강화시키거나 불활성시켜 향상된 O-숙시닐 호모세린 생산능을 가지게 된 코리네박테리움 속 미생물을 의미한다.
본 출원에서 "코리네박테리움 속 미생물"은 구체적으로는 코리네박테리움 글루타미쿰, 코리네박테리움 암모니아게네스, 브레비박테리움 락토퍼멘텀 (Brevibacterium lactofermentum), 브레비박테리움 플라범 (Brevibacterium flavum), 코리네박테리움 써모아미노게네스 (Corynebacterium thermoaminogenes), 코리네박테리움 에피션스 (Corynebacterium efficiens) 등이나, 반드시 이에 한정되는 것은 아니다. 더욱 구체적으로는, 본 출원에서 코리네박테리움 속 미생물은 고농도의 O-숙시닐 호모세린에 노출되더라도 세포 생장과 생존에 영향을 적게 받는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있다.
상기 미생물은, 시스타치오닌 신타아제(cystathionine synthase), O-아세틸 호모세린 (티올)-라이아제, 및 호모세린 키나아제로 이루어진 군으로부터 선택되는 적어도 하나 이상의 단백질 활성이 불활성화될 수 있다. 즉, 상기에서 선택된 1개 단백질 활성, 2개 단백질 활성 또는 3개 모두의 활성이 불활성이 될 수 있다.
본 출원에서 용어, 단백질 활성의 "불활성화"는 내재적 활성에 비하여 활성이 약화되거나 또는 활성이 없는 것을 모두 포함하는 개념이다.
이러한 단백질 활성의 불활성화는, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 상기 단백질의 활성이 제거된 경우를 포함하여 상기 단백질을 코딩하는 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 상기 효소의 활성이 감소되도록 돌연변이된 유전자로, 염색체상의 상기 단백질을 코딩하는 유전자를 대체하는 방법; 상기 단백질을 코딩하는 염색체상의 유전자의 발현 조절 서열에 변이를 도입하는 방법; 상기 단백질을 코딩하는 유전자의 발현 조절 서열을 활성이 약하거나 없는 서열로 교체하는 방법(예컨대, 상기 유전자의 프로모터를 내재적 프로모터보다 약한 프로모터로 교체하는 방법); 상기 단백질을 코딩하는 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 상기 염색체상의 유전자의 전사체에 상보적으로 결합하여 상기 mRNA로부터 단백질로의 번역을 저해하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)를 도입하는 방법; 상기 단백질을 코딩하는 유전자의 SD 서열 앞단에 SD 서열과 상보적인 서열을 인위적으로 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착이 불가능하게 만드는 법 및 해당 서열의 ORF(open reading frame)의 3' 말단에 역전사되도록 프로모터를 부가하는 RTE(Reverse transcription engineering) 방법 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 상기 예에 의해 특별히 제한되는 것은 아니다.
구체적으로, 단백질을 코딩하는 유전자의 일부 또는 전체를 결실하는 방법은, 미생물 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 코딩하는 폴리뉴클레오티드를 일부 핵산 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 이의 일례로 상동재조합에 의하여 유전자를 결실시키는 방법을 사용할 수 있으나, 이에 한정되지 않는다. 또한, 상기에서 "일부"란 폴리뉴클레오티드의 종류에 따라서 상이하고, 당업자가 적절히 결정할 수 있으나, 구체적으로는 1 내지 300개, 보다 구체적으로는 1 내지 100개, 보다 더 구체적으로는 1 내지 50개일 수 있다. 그러나, 특별히 이에 제한되는 것은 아니다.
또한, 발현 조절서열을 변형하는 방법은 상기 발현 조절서열의 활성을 더욱 불활성화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 핵산 서열로 교체함으로써 수행할 수 있다. 상기 발현 조절서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함할 수 있으나, 이에 한정되지 않는다.
아울러, 염색체상의 유전자 서열을 변형하는 방법은 상기 단백질의 활성을 더욱 불활성화하도록 유전자 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 유전자 서열 또는 활성이 없도록 개량된 유전자 서열로 교체함으로써 수행할 수 있으나, 이에 한정되는 것은 아니다. 구체적으로, 상기 미생물은 시스타치오닌 감마-신타제를 코딩하는 metB 유전자, O-숙시닐 호모세린의 분해경로인 O-아세틸 호모세린 (티올)-라이아제를 코딩하는 metY 유전자, 및 호모세린 키나아제를 코딩하는 유전자 thrB로 이루어진 군으로부터 선택되는 적어도 하나 이상의 유전자가 추가로 결손 또는 약화될 수 있다.
본 출원에서 사용되는 상기 용어 "결손(deletion)"은 목적 유전자의 개시코돈에 해당하는 염기서열로부터 종결코돈까지의 염기서열 영역 혹은 그 조절부위 염기서열 중 일부 혹은 전부를 염색체 내부에서 제거한 형태를 의미한다.
본원에서 사용되는 상기 용어 "약화(weakening)"는 미생물 균주에서 상응하는 DNA에 의해 코딩되는 하나 이상의 효소에 대한 세포 내 활성을 제거하거나 감소시키는 것을 의미하는데, 예를 들어, 유전자의 프로모터(promoter) 부위 및 5'-UTR 부위의 염기서열을 변형시킴으로써 단백질의 발현을 약화시키거나 해당 유전자의 ORF 부위에 돌연변이를 도입함으로써 단백질의 활성을 약화시킬 수 있다.
또한, 상기 코리네박테리움 속 미생물은 아스파토키나아제 (aspartokinase) 활성이 비변이 미생물에 비하여 추가로 강화된, O-숙시닐 호모세린을 생산하는 코리네박테리움 속 미생물일 수 있다.
본 출원에서 용어, 단백질의 활성의 "강화"는 상기 단백질의 활성이 도입되거나, 또는 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 활성의 "도입"은, 자연적 혹은 인위적으로 미생물이 본래 가지고 있지 않았던 특정 폴리펩타이드의 활성이 나타나게 되는 것을 의미한다.
본 출원에서 용어, 단백질의 활성이 내재적 활성에 비하여 "증가"한다는 것은, 미생물이 가진 단백질의 내재적 활성 또는 변형 전 활성에 비하여 활성이 향상된 것을 의미한다. 상기 "내재적 활성"은, 자연적 또는 인위적 요인에 의한 유전적 변이로 미생물의 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성을 말한다. 변형 전 활성으로 혼용되어 사용될 수 있다.
구체적으로, 본 출원에서 활성 증가는,
1) 상기 단백질을 코딩하는 폴리뉴클레오티드의 카피수 증가,
2) 상기 폴리뉴클레오티드의 발현이 증가하도록 발현조절 서열의 변형,
3) 상기 단백질의 활성이 강화되도록 염색체 상의 폴리뉴클레오티드 서열의 변형,
4) 상기 단백질의 활성을 나타내는 외래 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드의 코돈 최적화된 변이형 폴리뉴클레오티드의 도입, 또는
5) 이의 조합에 의해 강화되도록 변형하는 방법 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 1) 폴리뉴클레오티드의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동 가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 숙주와 무관하게 복제되고 기능할 수 있는 벡터에 본원의 단백질을 코딩하는 폴리뉴클레오티드가 작동 가능하게 연결되어 숙주세포 내에 도입됨으로써 수행될 수 있거나, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터에 상기 폴리뉴클레오티드가 작동 가능하게 연결되어 숙주세포 내에 도입됨으로써 상기 숙주세포의 염색체 내 상기 폴리뉴클레오티드의 카피수를 증가하는 방법으로 수행될 수 있다.
다음으로, 2) 폴리뉴클레오티드의 발현이 증가하도록 발현조절 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 발현조절 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 가지는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현조절 서열은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 이종 프로모터가 연결될 수 있는데, 상기 강력한 프로모터의 예로는 CJ7 프로모터(대한민국 등록특허 제0620092호 및 WO2006/065095), lysCP1 프로모터(WO2009/096689), EF-Tu 프로모터, groEL 프로모터, aceA 혹은 aceB 프로모터 등이 있으나, 이에 한정되지 않는다. 아울러, 3) 염색체 상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
또한, 4) 외래 폴리뉴클레오티드 서열의 도입은, 상기 단백질과 동일/유사한 활성을 나타내는 단백질을 코딩하는 외래 폴리뉴클레오티드, 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드를 숙주세포 내로 도입하여 수행될 수 있다. 상기 외래 폴리뉴클레오티드는 상기 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한 없이 사용될 수 있다. 또한 도입된 상기 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화하여 숙주세포 내로 도입할 수 있다. 상기 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 단백질이 생성되어 그 활성이 증가될 수 있다.
마지막으로, 5) 상기 1) 내지 4)의 조합에 의해 강화되도록 변형하는 방법은, 상기 단백질을 코딩하는 폴리뉴클레오티드의 카피수 증가, 이의 발현이 증가하도록 발현조절 서열의 변형, 염색체 상의 상기 폴리뉴클레오티드 서열의 변형 및 상기 단백질의 활성을 나타내는 외래 폴리뉴클레오티드 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드의 변형 중 하나 이상의 방법을 함께 적용하여 수행될 수 있다.
본 출원에서, 상기 유전자 또는 폴리뉴클레오티드들의 서열은 미국생물공학정보센터(NCBI)와 같은 데이터베이스로부터 얻을 수 있다.
본 출원의 또 하나의 양태로서, 본 출원은 기술된 미생물을 배양하는 단계 및 배양된 미생물 또는 배양 배지로부터 O-숙시닐 호모세린을 회수하는 단계를 포함하는, O-숙시닐 호모세린을 생산하는 방법을 제공한다.
본 출원의 또 하나의 양태로서, 본 출원은 기술된 미생물을 배양하는 단계 및 배양된 미생물 또는 O-숙시닐 호모세린과 황화물을 반응시키는 단계를 포함하는, L-메치오닌 생산방법을 제공한다.
구체적으로 상기 황화물과 반응시키는 단계는 공지된 어느 방법을 이용하여서 O-숙시닐 호모세린으로부터 L-메치오닌을 생성하는 것을 의미한다. 일 예로 황화물인 메틸머캅탄을 O-숙시닐 호모세린과 반응시켜, L-메치오닌을 생산할 수 있고, 황화물인 시스테인을 반응시켜 시스타치오닌을 생성한 후, 단계적 반응에 의해서 메치오닌을 생산할 수 있다. 또한, 각 반응의 속도 및 수율 향상을 위해서 촉매나 효소를 첨가하거나, 효소를 포함하는 미생물 내에서 반응시킬 수 있다.
상기 'O-숙시닐 호모세린'은, 본 출원의 기술된 미생물이 생산한 O-숙시닐 호모세린을 함유한 발효액이거나, 정제된 형태일 수 있다. 또한 상기의 '황화물'은 예를 들어 메틸머캅탄일 수 있고, 상기 메틸머캅탄은 액상의 소디움메틸머캅탄(sodium methyl mercaptan, CH3S-Na) 형태, 가스 또는 액화 상태의 메틸머캅탄(CH3SH) 뿐만 아니라 국제 공개특허 제WO2010/098629호에 언급된 형태로 디메칠설파이드(DMS, Dimethylsulfide)를 포함한 메틸머캅탄 등 황 원자를 제공할 수 있는 형태를 포함하고 있는 메틸머캅탄 유도체 모두를 의미할 수 있다.
상기 L-메티오닌을 생산하는 방법은 당업계에 공지된 최적화된 배양 조건 및 효소 활성 조건에서 당업자에 의해 용이하게 결정될 수 있다. 구체적인 배양 방법 및 배지는 상기 설명한 바와 같다.
또한, 상기 L-메치오닌 생산방법은 상기 배양단계에서 배양된 미생물 또는 배지에서 O-숙시닐 호모세린을 분리 또는 회수하는 단계를 추가로 포함하는 것일 수 있다.
본 출원의 "O-숙시닐 호모세린"은 O-숙시닐 호모세린 그 자체 형태뿐 아니라, 이의 염 형태도 모두 포함함은 당업자에게 자명하다.
상기 방법에 있어서, 상기 미생물을 배양하는 단계는, 특별히 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물 (예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물 (예: 인산 또는 황산)을 사용하여 적정 pH (예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8, 가장 구체적으로는 pH 6.8)를 조절할 수 있고, 산소 또는 산소-함유 가스 혼합물을 배양물에 도입시켜 호기성 조건을 유지할 수 있다. 배양온도는 20 내지 45 ℃, 구체적으로는 25 내지 40 ℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 제한 되는 것은 아니다. 상기 배양에 의하여 생산된 O-숙시닐 호모세린는 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
아울러, 사용되는 배양용 배지는 탄소 공급원으로는 당 및 탄수화물 (예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방 (예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산 (예: 팔미트산, 스테아르산 및 리놀레산), 알코올 (예: 글리세롤 및 에탄올) 및 유기산 (예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 질소 공급원으로는 질소-함유 유기 화합물 (예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 또는 무기 화합물 (예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 또한, 배지에는 기타 금속염 (예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 포함할 수 있다.
본 출원의 상기 배양 단계에서 생산된 O-숙시닐 호모세린 또는 L-메치오닌을 회수하는 방법은 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 아미노산을 수집(collect)할 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 O-숙시닐 호모세린 또는 L-메치오닌을 회수 할 수 있다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로, 본 출원의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1: O-아세틸 호모세린 트랜스퍼라제 활성을 갖는 metX 플라스미드 제작
O-아세틸 호모세린 트랜스퍼라제 (MetX)를 코딩하는 유전자를 증폭하기 위하여 WT(Wild type) 유래의 보고된 서열에 근거하여 프로모터 부위(개시코돈 상단 약 300bp)로부터 터미네이터 부위(종결코돈 하단 약 100bp)까지 증폭하기 위한 프라이머(서열번호 5 및 6)의 양 말단에 BamHI 제한 효소 부위를 삽입하여 고안하였다.
서열번호 프라이머 서열(5'-3')
5 Primer 1 GGATCCCCTCGTTGTTCACCCAGCAACC
6 Primer 2 GGATCCCAAAGTCACAACTACTTATGTTAG
PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 metX 유전자의 코딩 부위 1546 bp의 DNA 단편을 수득하였다. pECCG117 (대한민국 등록특허 제10-0057684호) 벡터와 metX DNA 단편을 제한 효소 BamHⅠ으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였고 이를 pECCG117-metX WT라 명명하였다.
실시예 2: O- 숙시닐 호모세린 트랜스퍼라제 활성을 갖는 변이형 metX 플라스미드 제작
신규한 metX 변이 위치를 선별하였으며, 서열번호 1의 아미노산 서열에서 313번째 아미노산을 루신이 이외의 다른 아미노산으로 치환하였다.
더욱 구체적으로는, 실시예 1에서 제작된 pECCG117-metX WT 플라스미드를 주형으로 O-아세틸 호모세린 트랜스퍼라제 313번째 아미노산이 다른 아미노산으로 치환되는 변이벡터를 만들기 위해 프라이머 한쌍 (서열번호 7 및 8)을 고안하였다.
서열번호 프라이머 서열(5'-3')
7 Primer 3 GTAGATACCGATATTCGGTACCCCTACCACCAG
8 Primer 4 CTGGTGGTAGGGGTACCGAATATCGGTATCTAC
상기 프라이머와 함께 위치-특이적 돌연변이 키트(site-directed mutagenesis kit, stratagene, 미국)을 이용하여 metX 변이 유전자를 제조하였다. 기존 야생형 플라스미드 WT을 기반으로 한, L313R 변이형 플라스미드는 WT_L313R로 명명되었다.
실시예 3: O- 숙시닐 호모세린 트랜스퍼라제 활성을 갖는 변이형 metX의 기질 특이성 및 활성 비교 실험
O-숙시닐 호모세린을 과량 생산하는 변이형 metX의 활성을 비교하기 위해 호모세린을 축적하고, 생산된 O-숙시닐 호모세린의 이용성이 결손된 균주를 제작하였다. O-숙시닐 호모세린 분해 경로인 시스타치오닌 감마-신타제를 코딩하는 metB 유전자, O-숙시닐 호모세린의 분해경로인 O-아세틸 호모세린 (티올)-라이아제를 코딩하는 metY 유전자가 결손된 균주를 제작하였다. 먼저 metB 유전자를 결손하기 위하여 WT 유래의 metB 유전자의 염기서열 정보를 기반으로 metB 유전자의 5' 상단 부위를 증폭하기 위한 프라이머 한쌍(서열번호 9 및 10)과 3' 하단 부위를 증폭하기 위한 프라이머 한쌍(서열번호 11 및 12)을 고안하였다. 서열번호 9 및 12의 프라이머는 각 말단에 XbaⅠ 제한 효소 부위(밑줄로 표시)를 삽입하였다.
서열번호 프라이머 서열(5'-3')
9 Primer 5 TCTAGATGCGCTGATTATCTCACC
10 Primer 6 ACTGGTGGGTCATGGTTGCATATGAGATCAACTCCTGTAA
11 Primer 7 TTACAGGAGTTGATCTCATATGCAACCATGACCCACCAGT
12 Primer 8 TCTAGACCTTGAAGTTCTTGACTG
WT의 염색체를 주형으로 하여 서열번호 9 및 서열번호 10, 서열번호 11 및 서열번호 12의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 metB 유전자의 5` 상단 부위의 450 bp DNA 단편과 3' 하단 부위의 467 bp의 DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 9 및 서열번호 12의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 3분 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과, metB 유전자의 중앙부분이 결손되어 상단과 하단만 포함하는 917 bp의 DNA 단편이 증폭되었다.
pDZ 벡터와 917 bp의 DNA 단편을 제한효소 XbaⅠ으로 처리한 뒤, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였고 이를 pDZ-△metB라 명명하였다.
pDZ-△metB 벡터를 WT 균주에 전기펄스법으로 도입한 후 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 metB 유전자가 결손된 균주인 WT△metB를 획득하였다.
O-숙시닐 호모세린의 또 하나의 분해경로인 metY 유전자를 결손하기 위하여 WT유래 metY 유전자의 염기서열 정보를 기반으로 metY 유전자의 5' 상단 부위를 증폭하기 위한 프라이머 한쌍(서열번호 13 및 14)과 3' 하단 부위를 증폭하기 위한 프라이머 한쌍(서열번호 15 및 16)을 고안하였다. 서열번호 13 및 16의 프라이머는 각 말단에 XbaⅠ 제한 효소 부위(밑줄로 표시)를 삽입하였다.
서열번호 프라이머 서열(5'-3')
13 Primer 9 TCTAGAAGTAGCGTTGCTGTACAC
14 Primer 10 ATCAATGGTCTCGATGCCCATATGGCATTTGGAGGTCCTTAAG
15 Primer 11 CTTAAGGACCTCCAAATGCCATATGGGCATCGAGACCATTGAT
16 Primer 12 TCTAGATGGAACCGTTGCAACCAC
WT의 염색체를 주형으로 하여 서열번호 13 및 서열번호 14 서열번호 15, 및 서열번호 16의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 metY 유전자의 5` 상단 부위의 512 bp DNA 단편과 3' 하단 부위의 520 bp의 DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 13 및 서열번호 16의 프라이머로 PCR을 수행하였다. PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 3분 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과, metY 유전자의 중앙부분이 결손되어 상단과 하단만 포함하는 1032 bp의 DNA 단편이 증폭되었다.
pDZ 벡터와 1032 bp의 DNA 단편을 제한효소 XbaⅠ으로 처리한 뒤, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였고 이를 pDZ-△metY라 명명하였다.
pDZ-△metY 벡터를 상기에 제작된 WT△metB 균주에 각가 전기펄스법으로 도입한 후 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 metY 유전자가 결손된 균주인 WT△metB△metY 를 획득하였다.
O-숙시닐 호모세린 생성 극대화를 위하여 WT 유래의 아스파토키나아제 (서열번호 17)를 코딩하는 lysC 유전자(서열번호 18)를 대상으로 변이 도입 벡터를 제작하기 위하여 변이 위치를 중심으로 5' 상단 부위를 증폭하기 위한 프라이머 한쌍(서열번호 19 및 20)과 3' 하단 부위를 증폭하기 위한 프라이머 한쌍(서열번호 21 및 22)을 고안하였다. 서열번호 19 및 22의 프라이머는 각 말단에 XbaⅠ 제한 효소 부위(밑줄로 표시)를 삽입하였고, 서열번호 20 및 21의 프라이머는 서로 교차되도록 고안한 부위에 뉴클레오티드 치환 변이(밑줄로 표시)가 위치하도록 하였다.
서열번호 프라이머 서열(5'-3')
19 Primer 13 tcctctagaGCTGCGCAGTGTTGAATACG
20 Primer 14 CACCGACATCATCTTCACCTGCC
21 Primer 15 GGCAGGTGAAGATGATGTCGGTG
22 Primer 16 gactctagaGTTCACCTCAGAGACGATTA
WT의 염색체를 주형으로 하여 서열번호 19 및 서열번호 20, 서열번호 21 및 서열번호 22의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 lysC 유전자의 변이를 중심으로 5' 상단 부위의 509 bp DNA 단편과 3' 하단 부위의 520 bp의 DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 19 및 서열번호 22의 프라이머로 PCR을 수행하였다. PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과, 311번째 트레오닌이 이소류신으로 치환된 아스파토키나아제 변이체(서열번호 23)를 코딩하는 lysC 유전자의 변이(서열번호 24)를 포함하는 1011 bp의 DNA 단편이 증폭되었다.
코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDZ 벡터(한국 등록특허 제0924065호)와 1011 bp의 DNA 단편을 제한효소 XbaⅠ으로 처리한 뒤, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였고 이를 pDZ-lysC(T311I)라 명명하였다.
pDZ-lysC(T311I) 벡터를 WT△metB△metY에 전기펄스법(Appl. Microbiol. Biothcenol.(1999) 52:541-545)으로 도입한 후 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 lysC 유전자에 뉴클레오티드 변이가 도입된 균주, WT△metB△metY , lysC(T311I)를 획득하였고, 이를 코리네박테리움 글루타미쿰 WT△metB△metY, lysC(T311I)이라 명명하였다.
상기의 실시예 1과 2에서 제작된 pECCG117-metX WT, pECCG117-metX WT_L313R벡터를 상기에 제작된 WT△metB△metY에 전기펄스법으로 도입한 후 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에 도말하여 각각의 형질전환주를 획득하였다.
상기에 제작된 균주들의 O-아세틸 호모세린(O-AH; O-Acetyl Homoserine) 및 O-숙시닐 호모세린(O-SH; O-Succinyl Homoserine)생산능을 비교하고자 아래와 같은 방법으로 배양하여 배양액 중 O-아세틸 호모세린 및 O-숙시닐 호모세린 농도를 분석하였다.
하기의 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 균주를 1백금이 접종하고, 37 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. HPLC를 이용하여 O-아세틸 호모세린 및 O-숙시닐 호모세린 농도를 분석하였으며, 분석된 농도는 [표 6]과 같다.
<배지 조성(pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g, L-methionine 0.3g (증류수 1리터 기준).
균주 O-아세틸 호모세린(g/L) O-숙시닐 호모세린(g/L)
배치1 배치2 배치3 배치1 배치2 배치3
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT 2.0 2.2 2.1 0.01 0.03 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313R 0.05 0.06 0.04 1.2 1.1 1.0
상기의 표 6을 참고하면, 대조군 metX WT 플라스미드 도입된 균주의 경우 O-아세틸 호모세린을 생성하는 것과 달리, metX 변이 플라스미드 도입된 균주의 경우 O-숙시닐 호모세린을 생성하는 것을 확인하였다. 즉, 상기 변이가 도입된 균주는 트랜스퍼라제의 기질특이성이 바뀌어 O-숙시닐 호모세린을 생성하였다.
또한, 상기 제작된 WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313R 균주는 CA05-5132로 지칭되며, 이를 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2017년 5월 11일자로 기탁하여 수탁번호 KCCM12023P를 부여받았다.
실시예 4: saturated mutagenesis를 통한 MetX 변이 제작 및 O-아세틸 호모세린 생산능 평가
O-숙시닐 호모세린 생산능이 높은 metX 변이 위치에 다른 아미노산이 치환된 변이형을 제작하기 위해 saturated mutagenesis를 이용하였다. metX의 313 번째 아미노산 위치에 다른 아미노산이 치환된 18종을 제작하였으며, 실시예 1에서 제작된 플라스미드를 주형으로 사용하였다. 각각의 변이형, 치환된 아미노산, 및 각 변이형에 사용된 프라이머 서열번호는 다음 표 7에 나타내었다.
변이 플라스미드 치환 아미노산 프라이머 서열번호
313 변이 L313R 서열번호 7,8
L313F 서열번호 25,26
L313S 서열번호 27,28
L313Y 서열번호 29,30
L313C 서열번호 31,32
L313P 서열번호 33,34
L313H 서열번호 35,36
L313Q 서열번호 37,38
L313I 서열번호 39,40
L313T 서열번호 41,42
L313N 서열번호 43,44
L313K 서열번호 45,46
L313V 서열번호 47,48
L313A 서열번호 49,50
L313D 서열번호 51,52
L313E 서열번호 53,54
L313G 서열번호 55,56
L313W 서열번호 57,58
구체적으로, 상기 표 2에서 제시한 프라이머를 이용하여 위치-특이적 돌연변이 키트(site-directed mutagenesis kit, Stratagene, 미국)을 실시하여 변이형 metX 유전자를 제조하였다. 제작된 변이 플라스미드를 WT△metB△metY , lysC(T311I) 균주에 도입하고 실시예 4와 동일한 방법으로 플라스크 평가를 진행하였다. 그 결과는 다음 표 8과 같다.
균주 변이위치 O-아세틸 호모세린(g/L) O-숙시닐 호모세린(g/L)
배치1 배치2 배치3 배치1 배치2 배치3
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT 2.0 2.2 2.1 0.01 0.03 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313R서열번호 59 L313R 0.05 0.06 0.04 1.2 1.1 1.0
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313F서열번호 61 L313F 2.0 2.3 2.0 0.02 0.01 0.02
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313S서열번호 63 L313S 2.0 1.9 2.4 0.00 0.01 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313Y서열번호 65 L313Y 2.2 2.3 1.8 0.03 0.01 0.03
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313C서열번호 67 L313C 1.3 1.2 1.0 0.7 0.5 0.4
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313P서열번호 69 L313P 1.6 1.5 1.8 0.02 0.02 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313H서열번호 71 L313H 1.3 1.5 1.6 0.03 0.01 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313Q서열번호 73 L313Q 1.5 1.9 2.0 0.01 0.02 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313I서열번호 75 L313I 2.0 2.1 2.2 0.6 0.5 0.5
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313T서열번호 77 L313T 1.7 2.0 1.8 0.02 0.02 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313N서열번호 79 L313N 1.9 2.2 2.1 0.01 0.00 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313K서열번호 81 L313K 1.2 1.4 1.0 0.9 0.7 0.8
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313V서열번호 83 L313V 1.9 1.5 1.8 0.02 0.03 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313A서열번호 85 L313A 2.1 1.8 2.0 0.01 0.01 0.04
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313D서열번호 87 L313D 2.0 2.2 1.8 0.02 0.02 0.03
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313E서열번호 89 L313E 2.1 2.2 1.9 0.03 0.01 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313G서열번호 91 L313G 2.3 2.1 2.1 0.04 0.02 0.01
WT△metB△metY , lysC(T311I)/ pECCG117-metX WT_L313W서열번호 93 L313W 2.0 1.6 1.9 0.02 0.03 0.04
상기의 표3를 참고하면, 대부분의 변이체가 O-숙시닐 호모세린을 생성하지 못하였으나, metX의 313번째 아미노산이 변이된 변이체 (L313R), (L313C), (L313I), 또는 (L313K)에서 각각 야생형 보다 높은 수준으로 O-숙시닐 호모세린을 생성하는 것을 확인하였다. 즉, 서열번호 1의 아미노산 서열에서 313번째 아미노산이 알지닌, 시스테인, 이소루신, 또는 라이신으로 치환된 경우, 숙시닐 코에이에 대한 기질특이성이 트랜스퍼라제에 부여되며, 결과적으로 O-숙시닐 호모세린을 생성할 수 있는 것을 확인하였다.
이상의 결과들은 본 출원의 변이체가 O-숙시닐 호모세린의 생산을 증가시킬 수 있음을 시사하는 것이다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2018007408-appb-I000001

Claims (14)

  1. 서열번호 1의 아미노산 서열 내 313번째 위치에서 루신 이외 다른 아미노산으로의 치환을 포함하는, O-숙시닐 호모세린 트랜스퍼라제 (O-succinyl homoserine transferase) 활성을 가지는 폴리펩티드.
  2. 제1항에 있어서, 상기 313번째 아미노산은, 알지닌, 시스테인, 이소루신, 또는 라이신인, O-숙시닐 호모세린 트랜스퍼라제 활성을 가지는 폴리펩티드.
  3. 제1항에 있어서, 상기 폴리펩티드는 서열번호 59, 서열번호 67, 서열번호 75 및 서열번호 81의 아미노산 서열로 이루어진 군으로부터 선택되는 적어도 어느 하나의 아미노산 서열을 포함하는, O-숙시닐 호모세린 트랜스퍼라제 활성을 가지는 폴리펩티드.
  4. 제1항의 O-숙시닐 호모세린 트랜스퍼라제 활성을 가지는 폴리펩티드를 코딩하는 폴리뉴클레오티드.
  5. 제4항에 있어서, 상기 폴리뉴클레오티드는 서열번호 60, 서열번호 68, 서열번호 76 및 서열번호 82의 핵산 서열로 이루어진 군으로부터 선택되는 적어도 어느 하나의 서열을 포함하는, 폴리뉴클레오티드.
  6. 제1항의 O-숙시닐 호모세린 트랜스퍼라제 활성을 가지는 폴리펩티드 또는 이의 변이체 폴리펩티드가 포함되거나 과발현된, O-숙시닐 호모세린을 생산하는 코리네박테리움(corynebacterium)속 미생물.
  7. 제6항에 있어서, 상기 코리네박테리움 속 미생물은 아스파토키나아제 (aspartokinase) 활성이 비변이 미생물에 비하여 추가로 강화된, O-숙시닐 호모세린을 생산하는 코리네박테리움 속 미생물.
  8. 제6항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(corynebacterium glutamicum)인, O-숙시닐 호모세린을 생산하는 코리네박테리움 속 미생물.
  9. 제6항에 있어서, 상기 코리네박테리움 속 미생물은 시스타치오닌 신타아제(cystathionine synthase), O-아세틸 호모세린 (티올)-라이아제, 및 호모세린 키나아제로 이루어진 군으로부터 선택되는 적어도 하나 이상의 활성이 불활성화된, O-숙시닐 호모세린을 생산하는 코리네박테리움 속 미생물.
  10. 제6항에 있어서, 상기 코리네박테리움 속 미생물은 아스파토키나아제 (aspartokinase) 활성이 비변이 미생물에 비하여 추가로 강화되고, 시스타치오닌 신타아제(cystathionine synthase), O-아세틸 호모세린 (티올)-라이아제, 및 호모세린 키나아제로 이루어진 군으로부터 선택되는 적어도 하나 이상의 활성이 불활성화된, O-숙시닐 호모세린을 생산하는 코리네박테리움 속 미생물.
  11. 제6항 내지 제10항 중 어느 한 항의 O-숙시닐 호모세린을 생산하는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
    상기 배양단계에서 배양된 미생물 또는 배지에서 O-숙시닐 호모세린을 분리 또는 회수하는 단계를 포함하는, O-숙시닐 호모세린 생산방법.
  12. (a) 제6항 내지 제10항 중 어느 한 항의 O-숙시닐 호모세린을 생산하는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
    (b) 상기 O-숙시닐 호모세린과 황화물을 반응시키는 단계를 포함하는, L-메치오닌 생산방법.
  13. 제12항에 있어서, 상기 (a) 단계에서 배양된 미생물 또는 배지에서 O-숙시닐 호모세린을 분리 또는 회수하는 단계를 추가로 포함하는, L-메치오닌 생산방법.
  14. 제12항에 있어서, 상기 (b) 단계에서 O-숙시닐 호모세린과 황화물을 반응에 의해서 생성된 L-메치오닌을 분리 또는 회수하는 단계를 포함하는, L-메치오닌 생산방법.
PCT/KR2018/007408 2017-06-30 2018-06-29 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법 WO2019004779A2 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP18823952.9A EP3647416A4 (en) 2017-06-30 2018-06-29 NEW O-SUCCINYLHOMOSERIN TRANSFERASE MUTANT AND O-SUCCINYLHOMOSERIN PRODUCTION PROCESS USING THE LATTER
SG11201913889WA SG11201913889WA (en) 2017-06-30 2018-06-29 Novel o-succinyl homoserine transferase variant and method of producing o-succinyl homoserine using the same
CN201880053427.4A CN111315877B (zh) 2017-06-30 2018-06-29 新型o-琥珀酰高丝氨酸转移酶变体及使用其生产o-琥珀酰高丝氨酸的方法
BR112019027949-0A BR112019027949B1 (pt) 2017-06-30 2018-06-29 Polipeptídeo que compreende atividade de o-succinil, polinucleotídeo que codifica o polipeptídeo, micro-organismo de produção de osuccinil, método para produzir o-succinil e l-metionina
US16/627,655 US11142779B2 (en) 2017-06-30 2018-06-29 O-succinyl homoserine transferase variant and method of producing O-succinyl homoserine using the same
RU2020100467A RU2747493C1 (ru) 2017-06-30 2018-06-29 Новый вариант О-сукцинилгомосеринтрансферазы и способ получения О-сукцинилгомосерина с использованием этого варианта
JP2019571996A JP6980819B2 (ja) 2017-06-30 2018-06-29 新規なｏ−スクシニルホモセリントランスフェラーゼ変異体及びこれを用いたｏ−スクシニルホモセリンの製造方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170083438 2017-06-30
KR10-2017-0083438 2017-06-30

Publications (2)

Publication Number Publication Date
WO2019004779A2 true WO2019004779A2 (ko) 2019-01-03
WO2019004779A3 WO2019004779A3 (ko) 2019-05-02

Family

ID=64741762

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/007408 WO2019004779A2 (ko) 2017-06-30 2018-06-29 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법

Country Status (8)

Country Link
US (1) US11142779B2 (ko)
EP (1) EP3647416A4 (ko)
JP (1) JP6980819B2 (ko)
KR (1) KR102112232B1 (ko)
CN (1) CN111315877B (ko)
RU (1) RU2747493C1 (ko)
SG (1) SG11201913889WA (ko)
WO (1) WO2019004779A2 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016036209A1 (ko) * 2014-09-05 2016-03-10 씨제이제일제당 주식회사 L-쓰레오닌 생산능이 향상된 미생물 및 이를 이용한 l-쓰레오닌 생산방법
WO2018078014A1 (en) 2016-10-27 2018-05-03 Dsm Ip Assets B.V. Geranylgeranyl pyrophosphate synthases
CN112063572B (zh) * 2020-09-22 2022-07-19 浙江工业大学 一种高产o-乙酰-l-高丝氨酸的重组大肠杆菌及其应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006065095A1 (en) 2004-12-16 2006-06-22 Cj Corporation Novel promoter nucleic acid derived from corynebacterium genus bacteria, expression cassette comprising the promoter and vector comprising the cassette, host cell comprising the vector and method for expressing a gene using the cell
WO2008013432A1 (en) 2006-07-28 2008-01-31 Cj Cheiljedang Corporation Microorganism producing l-methionine precursor and method of producing l-methionine and organic acid from the l-methionine precursor
WO2009096689A2 (ko) 2008-01-28 2009-08-06 Cj Cheiljedang Corporation 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
WO2010098629A2 (ko) 2009-02-27 2010-09-02 씨제이제일제당 주식회사 메칠머캅탄과 디메칠설파이드의 혼합물을 사용하여 메치오닌 생산능을 증가시키는 방법

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004534501A (ja) * 1999-06-25 2004-11-18 ビーエーエスエフ アクチェンゲゼルシャフト 代謝経路タンパク質をコードするコリネバクテリウム−グルタミカム遺伝子
EP2657250B1 (en) * 2010-12-21 2017-09-06 CJ CheilJedang Corporation Variant polypeptide having homoserine acetyltransferase activity and microorganism expressing same
KR101565213B1 (ko) * 2013-10-23 2015-11-03 씨제이제일제당 (주) Ｏ-숙시닐호모세린 생산 미생물 및 이를 이용한 ｏ-숙시닐호모세린의 생산방법
WO2016179545A1 (en) * 2015-05-06 2016-11-10 Trelys, Inc. Compositions and methods for biological production of methionine

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006065095A1 (en) 2004-12-16 2006-06-22 Cj Corporation Novel promoter nucleic acid derived from corynebacterium genus bacteria, expression cassette comprising the promoter and vector comprising the cassette, host cell comprising the vector and method for expressing a gene using the cell
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
WO2008013432A1 (en) 2006-07-28 2008-01-31 Cj Cheiljedang Corporation Microorganism producing l-methionine precursor and method of producing l-methionine and organic acid from the l-methionine precursor
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
WO2009096689A2 (ko) 2008-01-28 2009-08-06 Cj Cheiljedang Corporation 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
WO2010098629A2 (ko) 2009-02-27 2010-09-02 씨제이제일제당 주식회사 메칠머캅탄과 디메칠설파이드의 혼합물을 사용하여 메치오닌 생산능을 증가시키는 방법

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
APPL. MICROBIOL. BIOTHCENOL., vol. 52, 1999, pages 541 - 545
ATSCHUL, J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO, SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
See also references of EP3647416A4
WATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482

Also Published As

Publication number Publication date
WO2019004779A3 (ko) 2019-05-02
CN111315877A (zh) 2020-06-19
CN111315877B (zh) 2023-08-08
EP3647416A2 (en) 2020-05-06
JP2020525017A (ja) 2020-08-27
US20200332322A1 (en) 2020-10-22
KR102112232B1 (ko) 2020-05-19
RU2747493C1 (ru) 2021-05-05
US11142779B2 (en) 2021-10-12
EP3647416A4 (en) 2021-03-03
KR20190003401A (ko) 2019-01-09
JP6980819B2 (ja) 2021-12-15
SG11201913889WA (en) 2020-01-30
BR112019027949A2 (pt) 2020-07-21

Similar Documents

Publication Publication Date Title
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2019004778A2 (ko) 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법
WO2019147078A1 (ko) 퓨린 뉴클레오티드를 생산하는 코리네박테리움 속 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019117671A1 (ko) 5&#39;-이노신산을 생산하는 미생물 및 이를 이용한 5&#39;-이노신산의 생산 방법
WO2020130236A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2014208970A1 (ko) 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019004779A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2019004780A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2018230977A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154181A1 (ko) 신규한 1,4-알파-글루칸-분지 효소 변이체 및 이를 이용한 imp 생산 방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022149865A2 (ko) GlxR 단백질 변이체 또는 이를 이용한 쓰레오닌 생산방법
WO2018230978A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18823952

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2019571996

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019027949

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2018823952

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2018823952

Country of ref document: EP

Effective date: 20200130

ENP Entry into the national phase

Ref document number: 112019027949

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20191226