WO2016208854A1 - 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 - Google Patents
퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 Download PDFInfo
- Publication number
- WO2016208854A1 WO2016208854A1 PCT/KR2016/003198 KR2016003198W WO2016208854A1 WO 2016208854 A1 WO2016208854 A1 WO 2016208854A1 KR 2016003198 W KR2016003198 W KR 2016003198W WO 2016208854 A1 WO2016208854 A1 WO 2016208854A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ornithine
- seq
- microorganism
- putrescine
- sugr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/10—Citrulline; Arginine; Ornithine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1018—Carboxy- and carbamoyl transferases (2.1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/001—Amines; Imines
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y201/00—Transferases transferring one-carbon groups (2.1)
- C12Y201/03—Carboxy- and carbamoyltransferases (2.1.3)
- C12Y201/03003—Ornithine carbamoyltransferase (2.1.3.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/03—Acyl groups converted into alkyl on transfer (2.3.3)
- C12Y203/03001—Citrate (Si)-synthase (2.3.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01017—Ornithine decarboxylase (4.1.1.17)
Definitions
- the present invention relates to a recombinant microorganism for producing putrescine or ornithine and a method for producing putrescine or ornithine using the same.
- Putrescine is found in gram-negative bacteria and fungi, and is present in high concentrations in various species and is expected to play an important role in the metabolism of microorganisms.
- putrescine is an important raw material for synthesizing polyamine nylon-4,6, and is mainly produced by chemical synthesis.
- the chemical synthesis method comprises a three-step process including a catalytic oxidation step, a cyanide compound and a hydrogenation step using high pressure hydrogen. Accordingly, there is a demand for a method using biomass that is more environmentally friendly and can reduce energy consumption for the production of putrescine.
- Ornithine is a substance widely found in plants, animals and microorganisms and is a precursor used for the biosynthesis of arginine, proline and polyamines. It also plays an important role in the pathway of the production of urea from amino acids or ammonia through the ornithine cycle in the metabolism of higher animals in vitro. Ornithine is also used industrially as a nutritional supplement or as a medicine to improve cirrhosis and liver dysfunction.
- a method for producing ornithine a method of treating milk casein with a digestive enzyme and a method using transformed E. coli or Corynebacterium microorganisms are known (Korea Registration No. 10-1372635; T Gotoh et al., Bioprocess Biosyst.Eng., 33: 773-777, 2010).
- SugR a transcriptional regulator of sugar metabolism
- Corynebacterium encodes a PEP-protein phosphotransferase of PTS system of the PTS system. It has been reported to inhibit genes involved in glycolysis and glycolysis (VF Wendisch, et al., J. Bacteriol. 190: 24, 8033-8044, 2008).
- Citrate synthase is the first to act on the TCA cycle and is an enzyme that can regulate the rate of the TCA cycle. Mutations with reduced GltA activity in Corynebacterium have been reported to increase aspartate and lysine production (Shiio et al., Agric Biol Chem. 46; 101-107, 1982).
- the inventors have found that putrescine or ornithine sanity is improved when manipulating the gene sugR, which encodes the transcriptional regulator of sugar metabolism, and the gene gltA, which encodes a citrate synthase.
- the present invention was completed by confirming.
- Another object of the present invention is to provide a method for producing putrescine or ornithine using the microorganism.
- the microorganism of the present invention can be widely used to industrially produce putrescine or ornithine, and is widely used as an effective and desirable means for providing raw materials in terms of economic and environmental aspects in producing various polymer products used as raw materials. Can be utilized.
- One aspect of the invention is that i) the transcriptional regulator of sugar metabolism (SugR) activity is attenuated relative to endogenous activity, or ii) the citrate synthase (GltA) activity is enhanced compared to endogenous activity. Or iii) a microorganism of the genus Corynebacterium that has putrescine or ornithine production capacity, wherein the metabolic transcriptional regulator activity is attenuated relative to endogenous activity and mutated to enhance citrate synthase activity relative to endogenous activity. to provide.
- One embodiment of the present invention is a microorganism of the genus Corynebacterium is putrescine or ornithine, wherein the metabolic transcriptional regulator activity is attenuated compared to the endogenous activity and the citrate synthase activity is enhanced compared to the endogenous activity It provides a microorganism of the genus Corynebacterium having a production capacity.
- Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having a putrescine or ornithine production capacity, consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 of the sugar metabolism transcriptional regulator.
- Another embodiment of the present invention provides a microorganism belonging to the genus Corynebacterium having citrate synthase having the ability to produce putrescine or ornithine, consisting of the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7.
- Corynebacterium genus microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum), Corynebacterium ammoniagenes's Ness (Corynebacterium ammoniagenes), Corynebacterium Thermo Amino's Ness (Corynebacterium thermoaminogenes), Brevibacterium Playa boom (Brevibacterium flavum) and Brevibacterium lactofermentum (Brevibacterium lactofermentum ) provides a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine.
- Another embodiment of the present invention is the Corynebacterium genus of the genus Corynebacterium having a putrescine-producing ability, which is further modified to introduce the activity of ornithine decarboxylase (ornithine decarboxylase, ODC) Provide microorganisms.
- ornithine decarboxylase ornithine decarboxylase, ODC
- Another embodiment of the present invention provides the microorganism of the genus Corynebacterium having the ability to produce putrescine, ornithine dicarboxylase consisting of the amino acid sequence of SEQ ID NO: 17.
- Another embodiment of the present invention is a microorganism of the genus Corynebacterium additionally i) ornithine carbamoyl transferase (ArgF), ii) glutamate exporter or iii) ornithine carbamoyl transferase and Provided are microorganisms of the genus Corynebacterium having a putrescine or ornithine production capacity, wherein the activity of glutamate exporter is mutated to be less than the intrinsic activity.
- ornithine carbamoyl transferase is composed of the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11
- the glutamate exporter is composed of the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15 It provides a microorganism of the genus Corynebacterium having a putrescine or ornithine production ability.
- Corynebacterium genus microorganisms are additionally acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase ( ArgB), and the genus Corynebacterium, having a putrescine or ornithine production capacity, wherein at least one activity selected from the group consisting of acetyl ornithine amino transferase (ArgD) is mutated to be enhanced relative to endogenous activity.
- ArgC acetyl gamma glutamyl phosphate reductase
- ArgJ acetyl glutamate synthase or ornithine acetyl transferase
- ArgB acetyl glutamate kinase
- the genus Corynebacterium having
- acetyl gamma glutamyl phosphate reductase is composed of the amino acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21, acetyl glutamate synthase or ornithine acetyl transferase is SEQ ID NO: 23 or
- the acetyl glutamate kinase consists of the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 29, and the acetyl ornithine amino transferase consists of the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 33 It provides a microorganism of the genus Corynebacterium having a putrescine or ornithine production capacity.
- Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having putrescine-producing ability, wherein the microorganism of the genus Corynebacterium is further mutated so that the activity of the acetyltransferase is less than the intrinsic activity. .
- Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having putrescine production capacity, wherein the acetyltransferase is composed of the amino acid sequence of SEQ ID NO: 35 or SEQ ID NO: 37.
- Another embodiment of the present invention is a microorganism of the genus Corynebacterium additionally transforms the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 39 or SEQ ID NO: 41 to enhance the intrinsic activity, putrescine production capacity Eggplants provide microorganisms of the genus Corynebacterium.
- step (ii) separating the putrescine or ornithine from the microorganism or medium cultured in the step (i), it provides a putrescine or ornithine production method.
- One embodiment of the present invention provides a method for producing putrescine or ornithine, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
- One aspect of the invention is that i) the transcriptional regulator of sugar metabolism (SugR) activity is attenuated relative to endogenous activity, or ii) the citrate synthase (GltA) activity is enhanced compared to endogenous activity. Or iii) a microorganism of the genus Corynebacterium having a putrescine or ornithine production capacity, wherein the metabolic transcriptional regulator activity is attenuated relative to endogenous activity and mutated to enhance citrate synthase activity relative to endogenous activity. It is about.
- the metabolic transcriptional regulator activity is attenuated relative to endogenous activity and the citrate synthase activity is enhanced to be enhanced relative to endogenous activity.
- the term “transcriptional regulator of sugar metabolism (SugR)” refers to a variety of sugars, including sugar uptake and phosphotransferase systems, glycolysis and fermentation involving lactate dehydrogenase. It is an enzyme that functions broadly as a suppressor for genes involved in metabolism.
- the glucose metabolism transcriptional regulator includes both the internal protein or the foreign protein of the genus Corynebacterium, and specifically, may be SugR derived from Corynebacterium spp.
- the glucose metabolism transcriptional regulator is a protein comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically Any amino acid sequence having at least 95%, even more specifically at least 98%, most specifically at least 99% homology, and having substantially the activity of a glycoside transcriptional regulator can be included without limitation.
- the glycoside transcriptional regulator is not limited to the origin in the present invention, for example, Corynebacterium genus microorganism Derived, specifically Corynebacterium glutamicum derived.
- the sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 1 or SEQ ID NO: 3, even if some sequences have an amino acid sequence deleted, modified, substituted or added Obviously, it is included in the scope of the present invention.
- the polynucleotide encoding the glyco metabolism transcriptional regulator of the present invention is at least 70%, specifically 80%, of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 or as long as it has similar activity as that of the sugar metabolism transcriptional regulator protein Or more, more specifically at least 90%, even more specifically at least 95%, even more specifically at least 98%, and most specifically at least 99%.
- the polynucleotide encoding the glucose metabolism transcriptional regulator does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codon or in view of the preferred codons in the organism to express the modulator.
- Various modifications may be made to the coding region within a range, and specifically, may include a polynucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4, but is not limited thereto.
- citrate synthase is an enzyme involved in the production of various intracellular biosynthetic intermediates and reduced purine nucleic acids. It is known to act on the production of citrate by mediating the condensation reaction of acetyl-CoA with oxaloacetate.
- the citrate synthase includes all the internal proteins or foreign proteins in the microorganism of Corynebacterium, and specifically, may be GltA derived from the microorganism of Corynebacterium.
- Citrate synthase in the present invention is a protein comprising the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically Is at least 95%, even more specifically at least 98%, most specifically at least 99% homology, showing that the citrate is produced by substantially mediating the hydrolytic condensation reaction between acetyl-CoA and oxaloacetate.
- Eggplant may be included without limitation if the protein.
- citrate synthase in the present invention is not limited to the origin, for example, Corynebacterium genus microorganism Derived, specifically from Corynebacterium glutamicum.
- sequence having homology with the sequence is an amino acid sequence having a biological activity substantially the same as or corresponding to the protein of SEQ ID NO: 5 or SEQ ID NO: 7, even if some sequences have an amino acid sequence deleted, modified, substituted or added Obviously, it is included in the scope of the present invention.
- the polynucleotide encoding the citrate synthase of the present invention is at least 70%, specifically at least 80% of the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7 or the sequence, as long as it has similar activity to the citrate synthase protein. And, more specifically, at least 90%, even more specifically at least 95%, even more specifically at least 98%, most specifically at least 99%.
- the polynucleotide encoding the citrate synthase does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codon or in view of the codons preferred in the organism to express the modulator.
- Various modifications may be made to the coding region within a range, and specifically, may include a polynucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 8, but is not limited thereto.
- homology means a degree of agreement with a given amino acid sequence or polynucleotide sequence and may be expressed as a percentage.
- homologous sequences thereof having the same or similar activity as a given amino acid sequence or polynucleotide sequence are denoted as "% homology”.
- % homology For example, using standard software that calculates parameters such as score, identity and similarity, in particular BLAST 2.0, or by hybridization experiments used under defined stringent conditions Appropriate hybridization conditions, which are defined within the scope of the art, are well known to those skilled in the art, and are well known to those skilled in the art (e.g., J.
- the polynucleotide encoding the glycomechanical transcriptional regulator and citrate synthase of the present invention is a polynucleotide sequence of SEQ ID NO: 2 or 4 and SEQ ID NO: 6 or 8, or a probe derived from the polynucleotide sequence and It may hybridize under stringent conditions and may be a variant that encodes a normally functioning glucose metabolism transcriptional regulator and citrate synthase.
- stringent conditions means conditions that enable specific hybridization between polynucleotides. For example, such stringent conditions are described specifically in the literature (eg, J. Sambrook et al., Homology).
- the activity of the glycine metabolism transcription regulator SugR in the microorganism of the genus Corynebacterium having putrescine or ornithine production capacity, or enhance the activity of citrate synthase GltA, or weaken the SugR activity and GltA Enhancement was simultaneously applied, and as a result, it was confirmed that putrescine or ornithine production was improved in all mutant strains.
- the microorganism of the present invention may include both natural or mutant microorganisms as long as it can produce putrescine or ornithine.
- Examples include Escherichia sp., Shigella sp., Citrobacter sp., Salmonella sp., Enterobacter sp.
- the microorganism of the present invention may be a microorganism belonging to the genus Corynebacterium, more specifically Corynebacterium glutamicum ( Corynebacterium glutamicum), Corynebacterium ammoniagenes's Ness (Corynebacterium ammoniagenes), Corynebacterium Thermo Amino's Ness (Corynebacterium thermoaminogenes), Brevibacterium Playa boom (Brevibacterium flavum) and Brevibacterium lactofermentum (Brevibacterium lactofermentum ) may be selected from the group consisting of, and more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), but is not limited thereto.
- Corynebacterium glutamicum Corynebacterium glutamicum
- Corynebacterium ammoniagenes'ss Corynebacterium ammoniagenes
- the term "having putrescine or ornithine" in the present invention refers to putrescine or to a parent strain that is naturally capable of producing putrescine or ornithine, or that is not capable of producing putrescine or ornithine. It means a microorganism to which ornithine is produced.
- the microorganism having the ability to produce putrescine or ornithine is glutamate x, which is a protein involved in the release of ornithine carbamoyltransfrase (ArgF) and / or glutamate involved in arginine synthesis in ornithine. It may be mutated to weaken the activity of the porter (NCgl1221) compared to the intrinsic activity.
- the microorganism having the putrescine-producing ability is mutated to weaken the activity of acetyltransferase (NCgl1469), which is a protein that acetylates putrescine, and / or converts ornithine to putrescine. It may be modified to introduce the activity of phosphorus ornithine decarboxylase (ornithine decarboxylase, ODC).
- NCgl1469 acetyltransferase
- ODC phosphorus ornithine decarboxylase
- the variation such as the activity is introduced, enhanced or weakened activity may occur through a process called transformation.
- transformation refers to a polynucleotide encoding a specific protein or a vector containing a strong or weakly active promoter sequence into a host cell, thereby expressing the protein encoded by the polynucleotide in the host cell. Or to induce mutations in the chromosome of the host cell.
- the polynucleotide also includes DNA and RNA encoding the target protein.
- the polynucleotide may be introduced in any form as long as it can be introduced into a host cell to induce expression or mutation.
- the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all the elements necessary for its expression.
- the expression cassette may include a promoter, a transcription termination signal, a ribosomal binding site, and a translation termination signal, which are typically operably linked to the polynucleotide.
- the expression cassette may be in the form of an expression vector capable of self replication.
- the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell, but is not limited thereto.
- operably linked means that the gene sequence is functionally linked with a promoter sequence for initiating and mediating the transcription of a polynucleotide encoding a particular protein of the invention.
- the term "vector” refers to a DNA preparation containing a polynucleotide sequence encoding said target protein operably linked to a suitable regulatory sequence to enable expression of the target protein in a suitable host.
- the regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. After being transformed into a suitable host cell, the vector can be replicated or function independent of the host genome and integrated into the genome itself.
- the vector to be used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used.
- Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
- pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and pBR-based, pUC-based, pBluescriptII-based, etc. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
- the vector usable in the present invention is not particularly limited and known expression vectors can be used. Specifically, pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector and the like can be used.
- the bacterial chromosome insertion vector can replace the polynucleotide encoding the target protein in the chromosome with the mutated polynucleotide. Insertion of the polynucleotide into the chromosome can be made by any method known in the art, such as, but not limited to, homologous recombination. Since the vector of the present invention may be inserted into a chromosome by causing homologous recombination, the vector may further include a selection marker for confirming whether the chromosome is inserted.
- Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a polynucleotide of interest, and to give selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers can be used. In an environment in which a selective agent is treated, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.
- enhancing activity of the present invention not only includes the introduction of new or increased activity of the protein itself, resulting in an effect beyond the original function, but also an increase in endogenous gene activity, endogenous gene amplification from internal or external factors, Its activity is increased by deletion of inhibitory regulatory factors of gene expression, increase in gene copy number, introduction of genes from outside, modification of expression control sequences, in particular promoter replacement or modification, and increased enzyme activity by intragenic mutations. do.
- the activity enhancement or increase is a parameter that influences the activity of the present invention.
- the copy number increase of the polynucleotide is not particularly limited, but may be performed in a form operably linked to a vector or by inserting into a chromosome in a host cell.
- a host capable of being cloned and functioning independently of a host, in which a polynucleotide encoding an enzyme of the present invention is operably linked may be performed by introducing into a host cell, or the host is operably linked.
- a vector capable of inserting the polynucleotide into the chromosome in the cell may be introduced into the host cell to increase the copy number of the polynucleotide in the chromosome of the host cell.
- 2) modification of the expression control sequence to increase the expression of the polynucleotide is not particularly limited thereto, but the deletion, insertion, non-conservative or conservative substitution of the polynucleotide sequence to further enhance the activity of the expression control sequence or Combinations can be made by inducing variations in the sequence or by replacing with polynucleotide sequences having stronger activity.
- the expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, a sequence that controls the termination of transcription and translation, and the like.
- the heterologous promoter may be linked to the top of the polynucleotide expression unit instead of the original promoter.
- the strong promoter include a CJ7 promoter, a lysCP1 promoter, an EF-Tu promoter, a groEL promoter, an aceA or aceB promoter, and the like.
- the lysCP1 promoter (WO2009 / 096689) or the CJ7 promoter (Korean Patent No. 0620092 and WO2006 / 065095), which are corynebacterium-derived promoters, may be operably linked to improve the expression rate of the polynucleotide encoding the enzyme.
- the present invention is not limited thereto.
- 3) modification of the polynucleotide sequence on the chromosome is not particularly limited, and expression control is performed by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the polynucleotide sequence. This can be done by inducing variations in the sequence or by replacing with a polynucleotide sequence that has been improved to have stronger activity.
- the term "attenuated activity" of the present invention the deletion of part or all of the polynucleotide encoding a protein to weaken the activity, modification of the expression control sequence to reduce the expression of the polynucleotide, weakening the activity of the protein Possibly by modification of the polynucleotide sequence on the chromosome, and combinations thereof.
- the active weakening is
- a method of deleting part or all of a polynucleotide encoding a protein may include a polynucleotide or a marker gene in which a polynucleotide encoding an intrinsic target protein in a chromosome through a bacterial chromosome insertion vector is deleted from a polynucleotide sequence.
- a marker gene in which a polynucleotide encoding an intrinsic target protein in a chromosome through a bacterial chromosome insertion vector is deleted from a polynucleotide sequence.
- the method of modifying the expression control sequence is carried out by inducing a mutation on the expression control sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof to further weaken the activity of the expression control sequence, or By replacing with a polynucleotide sequence with weaker activity.
- the expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence that controls the termination of transcription and translation.
- a method of modifying a polynucleotide sequence on a chromosome is carried out by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further weaken the activity of the enzyme, or weaker. By replacing with a polynucleotide sequence that has been improved to have activity.
- the method of deleting a regulator that inhibits the expression of the polynucleotide of the enzyme may be performed by replacing the polynucleotide of the expression inhibitory factor with a polynucleotide or a marker gene that is missing some polynucleotide sequence.
- the term "some" differs depending on the kind of polynucleotide, but is specifically 1 to 300, specifically 1 to 100, and more specifically 1 to 50.
- intrinsic activity refers to an active state of an enzyme that is originally in an unmodified state, for example, a natural state
- "enhanced" compared to an intrinsic activity means that a gene exhibiting activity. Is not compared to the activity of microorganisms before the introduction of or manipulations such as an increase in the number of copies of the gene, deletion of the inhibitory regulators of gene expression or modification of expression control sequences, for example the use of an improved promoter. It means a state in which the activity of the microorganisms after the increase is increased.
- the microorganism of the genus Corynebacterium of the present invention may be a microorganism of the genus Corynebacterium having the ability to produce putrescine, in which the activity of ornithine decarboxylase (ODC) is introduced.
- ODC ornithine decarboxylase
- ornithine decarboxylase means an enzyme that produces putrescine by mediating the decarboxylation of ornithine.
- Microorganisms in Corynebacterium do not have a putrescine biosynthetic pathway, but when ornithine decarboxylase (ODC) is introduced from the outside, putrescine is synthesized and putrescine is released into the cell.
- ODC ornithine decarboxylase
- the ornithine dicarboxylase may be composed of the amino acid sequence of SEQ ID NO: 17, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically Any protein having substantially the activity of ornithine dicarboxylase as an amino acid sequence exhibiting at least 95%, even more specifically at least 98% and most specifically at least 99% homology can be included without limitation.
- ornithine dicarboxylase is not limited to the origin in the present invention, because there may be a difference in the amino acid sequence of the protein showing the activity depending on the species or strain of the microorganism, specifically, ornithine dicarboxyl derived from E. coli May be laze.
- sequence having homology with the above sequence is an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 17, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is also provided. It is obvious that it is included in the category.
- the polynucleotide encoding ornithine dicarboxylase of the present invention is at least 70%, specifically 80% or more, of the amino acid sequence of SEQ ID NO: 17 or as long as it has similar activity to the ornithine dicarboxylase protein. Specifically, it may include polynucleotides encoding proteins that exhibit at least 90%, even more specifically at least 95%, even more specifically at least 98%, most specifically at least 99% homology.
- the polynucleotide encoding the ornithine decarboxylase does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codons or in view of the codons preferred in the organism to express the modulator.
- Various modifications may be made to the coding region without departing from the scope of the present invention.
- the microorganisms of the genus Corynebacterium of the present invention may additionally include i) ornithine carbamoyl transferase (ArgF), ii) glutamate exporter (NCgl1221) or iii) ornithine carbamoyl transferase and glutamate exporter. It may be a microorganism of the genus Corynebacterium that has attenuated putrescine or ornithine production compared to this intrinsic activity.
- Ornithine carbamoyl transferase in the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11, or 70% or more, specifically 80% or more, more specifically 90% or more of the sequence More specifically, at least 95%, even more specifically at least 98%, most specifically at least 99% of the amino acid sequence showing a homology can be included without limitation any protein having substantially the activity of ornithine carbamoyl transferase. have.
- the glutamate exporter is a protein consisting of the amino acid sequence of SEQ ID NO: 13 or 15, or 70% or more, specifically 80% or more, more specifically 90% or more, and 95% or more with the sequence. As described above, even more specifically, an amino acid sequence exhibiting homology of 98% or more and most specifically 99% or more may be included without limitation as long as the protein has substantially the activity of glutamate exporter.
- the microorganisms of the genus Corynebacterium further include acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase (ArgB), and acetyl ornithine.
- the at least one activity selected from the group consisting of tin amino transferases (ArgD) may be microorganisms of the genus Corynebacterium having potrecin or ornithine production, enhanced relative to intrinsic activity.
- Acetyl gamma glutamyl phosphate reductase in the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21, or 70% or more, specifically 80% or more, more specifically 90% or more of the sequence More specifically, an amino acid sequence showing at least 95%, even more specifically at least 98%, and most specifically at least 99%, and may be included without limitation as long as the protein has substantially the activity of acetyl gamma glutamyl phosphate reductase. have.
- the acetyl glutamate synthase or ornithine acetyl transferase is a protein consisting of the amino acid sequence of SEQ ID NO: 23 or SEQ ID NO: 25, or 70% or more, specifically 80% or more, and more specifically Activity of substantially acetyl glutamate synthase or ornithine acetyl transferase as an amino acid sequence exhibiting at least 90%, more specifically at least 95%, even more specifically at least 98%, most specifically at least 99% homology Any protein having may be included without limitation.
- Acetyl glutamate kinase in the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 29, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically 95 Any protein having substantially the activity of acetyl glutamate kinase as an amino acid sequence exhibiting at least%, even more specifically at least 98%, most specifically at least 99%, can be included without limitation.
- the acetyl ornithine amino transferase in the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 31, or 70% or more, specifically 80% or more, more specifically 90% or more of the sequence, More specifically, at least 95%, even more specifically at least 98%, most specifically at least 99% of the amino acid sequence showing a homology can be included without limitation any protein having substantially the activity of acetyl ornithine amino transferase. have.
- Corynebacterium genus microorganism of the present invention may further be a Corynebacterium genus microorganism having a putrescine production capacity, the activity of acetyltransferase (NCgl1469) is weakened than the intrinsic activity.
- Acetyltransferase in the present invention may be included without limitation so long as it is a protein that serves to transfer the acetyl group to putrescine.
- the acetyltransferase is a protein consisting of the amino acid sequence of SEQ ID NO: 35 or SEQ ID NO: 37, or 70% or more, specifically 80% or more, more specifically 90% or more, and even more specifically 95% or more with the sequence. More specifically, it may be included without limitation, as long as it is an amino acid sequence exhibiting homology of 98% or more, most specifically 99% or more, and having a substantially acetyltransferase activity.
- Corynebacterium microorganism of the present invention may further be a Corynebacterium microorganism having a putrescine-producing ability, the activity of NCgl2522 is enhanced than the intrinsic activity.
- NCgl2522 is a protein that functions to release putrescine, and is composed of the amino acid sequence of SEQ ID NO: 39 or SEQ ID NO: 41, or 70% or more, specifically 80% or more, and 90% of the sequence. Any protein having substantially the same activity as an amino acid sequence showing at least%, even more specifically at least 95%, even more specifically at least 98%, and most specifically at least 99% may be included without limitation.
- step (ii) separating the putrescine or ornithine from the microorganism or medium cultured in the step (i), it provides a putrescine or ornithine production method.
- the microorganism of the genus Corynebacterium in the present invention may be Corynebacterium glutamicum.
- microorganism of the genus Corynebacterium having the putrescine or ornithine production capacity of the present invention is as described above.
- the step of culturing the microorganism is not particularly limited thereto, and may be performed by a known batch culture method, continuous culture method, fed-batch culture method, or the like.
- the culture conditions are not particularly limited, but using a basic compound (eg sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg phosphoric acid or sulfuric acid) to an appropriate pH (eg pH 5 to 9, specifically PH 6 to 8, most specifically pH 6.8) can be adjusted, the aerobic conditions can be maintained by introducing an oxygen or oxygen-containing gas mixture into the culture, the culture temperature is 20 to 45 °C, specifically 25 To 40 ° C., and may be incubated for about 10 to 160 hours. Putrescine or ornithine produced by the culture may be secreted into the medium or remain in the cells.
- a basic compound eg sodium hydroxide, potassium hydroxide or ammonia
- an acidic compound eg phosphoric acid or sulfuric acid
- pH eg pH 5 to 9, specifically
- the carbon sources in the culture medium used are sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), fats and oils (e.g. soybean oil, sunflower seeds). Oils, peanut oils and coconut oils), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (e.g. glycerol and ethanol) and organic acids (e.g. acetic acid) may be used individually or in combination. This is not restrictive.
- sugars and carbohydrates e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose
- fats and oils e.g. soybean oil, sunflower seeds. Oils, peanut oils and coconut oils
- fatty acids e.g. palmitic acid, stearic acid and linoleic acid
- alcohols e.g. glycerol and ethanol
- Nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and Ammonium nitrate) and the like can be used individually or in combination, but is not limited thereto.
- a source of phosphorus potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, and the like may be used individually or in combination, but is not limited thereto. It may also include essential growth-promoting substances such as other metal salts (eg magnesium sulfate or iron sulfate), amino acids and vitamins.
- the method for recovering putrescine or ornithine produced in the culturing step of the present invention may be carried out using a suitable method known in the art according to a culture method, for example, a batch, continuous or fed-batch culture method. Material can be collected.
- the present inventors confirmed the effect of the weakening of the gene sugR, which encodes a transcriptional regulator of sugar metabolism, on putrescine production in putrescine-producing strains.
- a vector was prepared for alteration of sugR start codons. Obtaining a primer pair of SEQ ID NOs: 43 and 44 and a rear homologous recombination fragment of the sugR initiation codon to obtain a front homologous fragment of the sugR initiation codon, near the polynucleotide sequence described in SEQ ID NO: 2 of the gene encoding the SugR Primer pairs of SEQ ID NO: 45 or 46 and 47 were prepared. Primers used for the start codon change are summarized in Table 1 below.
- PCR using genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, PCR using two pairs of primers was performed to amplify PCR fragments at the front and rear portions of the sugR gene initiation codon, respectively, and then subjected to electrophoresis. A fragment was obtained. At this time, the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C. The resulting fragments were purified by electrophoresis on a 0.8% agarose gel and then eluting a band of the desired size.
- the pDZ vector (Korean Patent No. 10-0924065) was treated with BamHI and SalI and fusion cloned the PCR product of the ATCC13032 strain. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). In this process, plasmids pDZ-1'sugR (GTG) and pDZ-1'sugR (TTG) were prepared.
- SEQ ID NO: 48 for the preparation of the vector was prepared as shown in Table 2 below.
- a primer pair of SEQ ID NOs: 43 and 44 and a rear homologous recombination fragment of the sugR initiation codon to obtain a front homologous recombination fragment of the sugR initiation codon, near the polynucleotide sequence described in SEQ ID NO: 2 of the gene encoding the SugR PCR was performed using primer pairs of SEQ ID NOs: 48 and 47 to obtain and amplified PCR fragments at the front and rear portions of the sugR gene initiation codon, respectively, followed by electrophoresis to obtain the desired fragments.
- the resulting fragments were purified by electrophoresis on a 0.8% agarose gel and then eluting a band of the desired size.
- the pDZ vector was treated with BamHI and SalI and fusion cloned the PCR product of the ATCC13032 strain. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). In this process, plasmid pDZ-1 'sugR (B6) was prepared.
- the plasmids pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) were putrescine-producing Corynebacterium microorganisms KCCM11240P (Korea Patent Publication No. 10-2013-0082478 And electroporation to obtain a transformant, which was transformed into kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin--D).
- Colonies were formed by smearing and incubating in BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%) containing -galactoside. By selecting blue colonies from the colonies formed therefrom, strains into which the plasmids pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) were introduced were selected.
- GTG pDZ-1'sugR
- TTG pDZ-1'sugR
- B6 pDZ-1'sugR
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- Shake culture (30 °C, 8 hours), and diluted sequentially from 10-4 to 10-10, respectively, plated and cultured in X-gal-containing solid medium to form colonies.
- DAB12-a ⁇ NCgl1469 (Korean Patent No. 10-2014-0115244), a putrescine-producing strain based on Corynebacterium glutamicum ATCC13869, was named DAB12-b, and a sugR weakened strain was produced based on the strain. It was.
- the PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 1 minute 30 seconds at 72 °C.
- the gene encoding the SugR derived from Corynebacterium glutamicum ATCC13869 was confirmed to include the polynucleotide sequence set forth in SEQ ID NO: 4. It was.
- the sequence of the protein encoded therefrom was compared with the amino acid sequence of the SugR derived from Corynebacterium glutamicum ATCC13032 (SEQ ID NO: 1). As a result, sequence homology was confirmed at 99%.
- the genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template for sugR initiation codon alteration and B6 weakening promoter replacement derived from Corynebacterium glutamicum ATCC13869, and the Tables 1 and 2 above.
- PCR using the primers described in amplified PCR fragments in the front and rear regions of the sugR gene initiation codon, respectively, and then electrophoresed to obtain the desired fragments.
- the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C.
- the resulting fragments were purified by electrophoresis on a 0.8% agarose gel and then eluting a band of the desired size.
- the pDZ vector was treated with BamHI and SalI and fusion cloned the PCR product of the ATCC13032 strain. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). In this process, plasmids pDZ-2'sugR (GTG), pDZ-2'sugR (TTG) and pDZ-2'sugR (B6) were prepared.
- the plasmids pDZ-2'sugR (GTG), pDZ-2'sugR (TTG) and pDZ-2'sugR (B6) were transfected into Corynebacterium glutamicum DAB12-b in the same manner as in Example 1-1. Strains were selected to change sugR initiation codon alteration and / or conversion to the B6 attenuated promoter. Corynebacterium glutamicum mutants selected therefrom were named DAB12-b sugR (GTG), DAB12-b sugR (TTG) and DAB12-b sugR (B6).
- the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template was used to amplify the gltA gene fragment using SEQ ID NOs: 50 and 51 primers (Table 4). At this time, the PCR reaction was repeated 30 times denaturation at 95 °C, 30 seconds annealing at 55 °C 30 and 30 seconds or 1 minute 30 seconds stretching process at 72 °C. This PCR result was electrophoresed on a 0.8% agarose gel and then purified by eluting a band of the desired size.
- the prepared plasmid was introduced into KCCM11240P by electroporation to obtain a transformant, and the transformant was obtained by CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, Beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8), shake incubation (30 ° C., 8 hours), dilute sequentially from 10-4 to 10-10, and then X- The colonies were plated and cultured on gal containing solid medium.
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, Beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- shake incubation (30 ° C., 8 hours
- ATCC13869 base Putrescine From the production strain gltA Preparation of Fortified Strains
- a gltA enriched strain was prepared for DAB12-b used in Example 1-2.
- genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template and primers of SEQ ID NOs: 50 and 51 PCR was performed using the pairs.
- PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 1 minute 30 seconds at 72 °C.
- PCR product obtained therefrom was subjected to electrophoresis and sequence analysis.
- the gene encoding gltA derived from Corynebacterium glutamicum ATCC13869 was confirmed to include the polynucleotide sequence represented by SEQ ID NO: 8. It was.
- the sequence of the protein encoded therefrom was compared with the amino acid sequence of gltA derived from Corynebacterium glutamicum ATCC13032 (SEQ ID NO: 5). As a result, sequence homology was confirmed at 99%.
- Gene fragments were amplified using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template to enhance gltA derived from Corynebacterium glutamicum ATCC13869 using SEQ ID NOs: 50 and 51 primers .
- the PCR reaction was repeated 30 times denaturation at 95 °C, 30 seconds annealing at 55 °C 30 and 30 seconds or 1 minute 30 seconds stretching process at 72 °C.
- This PCR result was electrophoresed on a 0.8% agarose gel and then purified by eluting a band of the desired size.
- the plasmid pDZTn2'-gltA was transformed into Corynebacterium glutamicum DAB12-b in the same manner as in Example 2-1 to select a gltA-enhanced strain. Corynebacterium glutamicum mutants selected therefrom were named DAB12-b Tn: gltA.
- Example 3 Putrescine production sugR Weakening and gltA Preparation of Enhanced Consolidated Strains and Their Production of Putrescine
- the plasmid pDZTn1'-gltA was transformed into Corynebacterium glutamicum KCCM11240P sugR (GTG), KCCM11240P sugR (TTG) and KCCM11240P sugR (B6) in the same manner as in Example 2-1 to enhance gltA. Strains were prepared.
- the prepared Corynebacterium glutamicum mutants were named KCCM11240P sugR (GTG) Tn :: gltA, KCCM11240P sugR (TTG) Tn :: gltA and KCCM11240P sugR (B6) Tn :: gltA, of which KCCM11240P sugR TTG) Tn :: gltA ( Corynebacterium glutamicum CC01-1147) was deposited with KCCM11615P on November 28, 2014.
- the plasmid pDZTn2'-gltA was transfected to Corynebacterium glutamicum DAB12-b sugR (GTG), DAB12-b sugR (TTG) and DAB12-b sugR (B6) in the same manner as in Example 2-2. Conversion was made to strains with enhanced gltA.
- Corynebacterium glutamicum mutants prepared above were named DAB12-b sugR (GTG) Tn :: gltA, DAB12-b sugR (TTG) Tn :: gltA and DAB12-b sugR (B6) Tn :: gltA. .
- Example 4 Putrescine production sugR Weakening and gltA Reinforced integrated strains Putrescine student Performance evaluation
- titer medium Glucose 8%, soy protein 0.25%, corn solid 0.50%, (NH 4 ) 2 SO 4 4%, KH 2 PO 4 0.1%, MgSO 4 7H 2 O 0.05%, urea 0.15%, biotin 100 g, thiamine hydrochloride 3 mg, calcium-pantothenic acid 3 mg, nicotinamide 3 mg, CaCO 3 5% 1 L
- titer medium Glucose 8%, soy protein 0.25%, corn solid 0.50%, (NH 4 ) 2 SO 4 4%, KH 2 PO 4 0.1%, MgSO 4 7H 2 O 0.05%, urea 0.15%, biotin 100 g, thiamine hydrochloride 3 mg, calcium-pantothenic acid 3 mg, nicotinamide 3 mg, CaCO 3 5% 1 L
- KCCM11240P 5.8 0.116 100 KCCM11240P sugR (TTG) 6.3 0.126 109 KCCM11240P sugR (GTG) 6.3 0.126 109 KCCM11240P sugR (B6) 6.0 0.120 103 KCCM11240P Tn :: gltA 6.2 0.124 107 KCCM11240P sugR (TTG) Tn :: gltA 6.8 0.136 117 KCCM11240P sugR (GTG) Tn :: gltA 6.5 0.130 112 KCCM11240P sugR (B6) Tn :: gltA 6.3 0.126 109 DAB12-b 6.5 0.129 100 DAB12-b sugR (TTG) 6.9 0.138 107 DAB12-b sugR (GTG) 6.8 0.136 105 DAB12-b sug
- the Corynebacterium glutamicum mutant strain with weakened sugR or enhanced gltA increased 4 to 9% of putrescine productivity, and at the same time gltA was weakened with sugR weakened.
- putrescine productivity increased by 10-13%.
- Example 5 Putrescine Discharge capacity Increased Putrescine Production strain based sugR Preparation of attenuated and gltA enhanced integrated strain and its putrescine production capacity confirmed
- KCCM11401P Korean Patent Publication No. 10-2014-0115244
- a mutant strain was tested to confirm whether putrescine production ability is improved by attenuating sugR gene activity and enhancing gltA gene activity. Produced.
- Corynebacterium glutamicum KCCM 11401P was transformed to convert sugR initiation codon into TTG to select strains with reduced sugR.
- Corynebacterium glutamicum mutants selected therefrom were named KCCM11401P sugR (GTG), KCCM11401P sugR (TTG) and KCCM11401P sugR (B6).
- the gltA gene was introduced into the transposon gene of the prepared sugR gene.
- the vector pDZTn1'-gltA produced in Example 2-1 was used.
- Example 2-1 the plasmid pDZTn1'-gltA prepared in Example 2-1 was used in the same manner as Example 2-1, and the Corynebacterium glutamicum mutant KCCM11401P sugR (GTG), KCCM11401P sugR (TTG) and KCCM11401P sugR ( B6) was transformed to select a strain enriched with gltA.
- Corynebacterium glutamicum mutants selected therefrom were named mutants KCCM11401P sugR (GTG) Tn :: gltA, KCCM11401P sugR (TTG) Tn :: gltA and KCCM11401P sugR (B6) Tn :: gltA.
- putrescine production capacity was tested in the Corynebacterium glutamicum mutant prepared in Example 5-1. Compared.
- KCCM11401P 5.3 0.106 100 KCCM11401P sugR (TTG) 5.6 0.112 106 KCCM11401P sugR (GTG) 5.5 0.110 104 KCCM11401P sugR (B6) 5.4 0.108 102 KCCM11401P Tn :: gltA 5.6 0.112 106 KCCM11401P sugR (TTG) Tn :: gltA 6.1 0.122 115 KCCM11401P sugR (GTG) Tn :: gltA 5.9 0.118 111 KCCM11401P sugR (B6) Tn :: gltA 5.8 0.116 109
- mutant strains were prepared using the vectors prepared in Example 1-1.
- Plasmids pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) prepared in Example 1-1 were used as the parent strain of Corynebacterium glutamicum ATCC13032.
- the prepared KCCM11137P (Korean Patent No. 10-1372635) was introduced by electroporation to obtain a transformant, and the transformant was kanamycin (25 ⁇ g / ml) and X-gal (5-bromo).
- Colonies were formed by plating and incubating in BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, 2% agar) containing -4-chloro-3-indolin-D-galactoside. By selecting blue colonies from the colonies formed therefrom, strains into which the plasmids pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) were introduced were selected.
- GTG pDZ-1'sugR
- TTG pDZ-1'sugR
- B6 pDZ-1'sugR
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- Shake culture (30 °C, 8 hours)
- 10-4 to 10-10 plated and cultured in X-gal-containing solid medium to form colonies.
- white colonies appearing in a relatively low proportion among the colonies formed the strains in which sugR initiation codons were changed to GTG or TTG and secondary promoters were replaced by B6 by secondary crossover.
- the selected strains were subjected to PCR using primer pairs of SEQ ID NOs: 43 and 47 to confirm whether the initiation codon of sugR was changed to GTG or TTG, and the Kineccerium glutamicum mutants obtained from KCCM11137P sugR ( GTG), KCCM11137P sugR (TTG) and KCCM11137P sugR (B6).
- a mutant strain was prepared by inserting the gltA gene into the chromosome of the ornithine producing strain using the vector prepared in Example 2-1. It was.
- Example 2-1 the vector prepared in Example 2-1 was introduced into ornithine-producing strain KCCM11137P (Korean Patent No. 10-1372635) to obtain a transformant by electroporation, and the transformation was performed.
- the sieve was shaken in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8). 30 ° C., 8 hours), diluted 10-4 to 10-10 sequentially, and then plated and cultured in X-gal-containing solid medium to form colonies.
- CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
- gltA was used as a transposon gene. Introduced within. At this time, the vector pDZTn1'-gltA produced in Example 2-1 was used.
- the plasmid pDZTn1'-gltA was transformed into Corynebacterium glutamicum KCCM11137P sugR (TTG) in the same manner as in Example 2-1 to select a gltA-enhanced strain.
- Corynebacterium glutamicum mutants selected therefrom were named KCCM11137P sugR (GTG) Tn :: gltA, KCCM11137P sugR (TTG) Tn :: gltA and KCCM11137P sugR (B6) Tn :: gltA.
- ornithine production was compared against the Corynebacterium glutamicum mutant strain prepared in Example 8-1. .
- Corynebacterium glutamicum mutants ((KCCM11137P sugR (GTG), KCCM11137P sugR (TTG), KCCM11137P sugR (B6), KCCM11137P sugR (GTG), KCCM11137P sugR (GTG) Tn :: gg) KCCM11137P sugR (TTG) Tn :: gltA and KCCM11137P sugR (B6) Tn :: gltA) and one parent strain (KCCM11137P) were respectively added 1 mM arginine-containing CM flat media (glucose 1%, polypeptone 1%, yeast extract 0.5) %, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 l, agar 2%, pH 6.8, 1 L basis) and incubated for 24 hours at 30 °C.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
| 프라이머 | 서열 5' -> 3' |
| sugR F1_SalI (서열번호: 43) | CTTGCATGCCTGCAGGTCGACAGGATTCATCTGGCATCTGGC |
| sugR-R1 (서열번호: 44) | GTCACTCCTTAAAGCAAAAAGCC |
| sugR-F2_GTG (서열번호: 45) | TTTTTGCTTTAAGGAGTGACGTGTACGCAGAGGAGCGCCGTC |
| sugR -F2_TTG (서열번호: 46) | TTTTTGCTTTAAGGAGTGACTTGTACGCAGAGGAGCGCCGTC |
| sugR-R2_BamHI (서열번호: 47) | CGAGCTCGGTACCCGGGGATCCGCGAGAGTACGAAGCGCAGT |
| 프라이머 | 서열 5' -> 3' |
| sugR F3(서열번호: 48) | TTTTTGCTTTAAGGAGTGACGAAGGCAACCATGAACTCTAATGTACGCAGAGGAGCGCCGTC |
| 프라이머 | 서열 5' -> 3' |
| sugR R(서열번호: 49) | GGACTTGCAGTGACTGTAAGAA |
| 프라이머 | 서열 5'->3' |
| gltA F_speI (서열번호: 50) | GAAGGAATGAGTTCCTCGAGACTAGTACTCGGCACCCATCCTTGTC |
| gltA R_speI (서열번호: 51) | GTTATTAGATGTCGGGCCCACTAGTGTGCTGTACATGCTCCTTGAAAATC |
| 균주 | 퓨트레신 (g/L) | 생산성 (g/L/h) | fold (%) |
| KCCM11240P | 5.8 | 0.116 | 100 |
| KCCM11240P sugR(TTG) | 6.3 | 0.126 | 109 |
| KCCM11240P sugR(GTG) | 6.3 | 0.126 | 109 |
| KCCM11240P sugR(B6) | 6.0 | 0.120 | 103 |
| KCCM11240P Tn::gltA | 6.2 | 0.124 | 107 |
| KCCM11240P sugR(TTG) Tn::gltA | 6.8 | 0.136 | 117 |
| KCCM11240P sugR(GTG) Tn::gltA | 6.5 | 0.130 | 112 |
| KCCM11240P sugR(B6) Tn::gltA | 6.3 | 0.126 | 109 |
| DAB12-b | 6.5 | 0.129 | 100 |
| DAB12-b sugR(TTG) | 6.9 | 0.138 | 107 |
| DAB12-b sugR(GTG) | 6.8 | 0.136 | 105 |
| DAB12-b sugR(B6) | 6.7 | 0.134 | 104 |
| DAB12-b Tn::gltA | 7.0 | 0.140 | 109 |
| DAB12-b sugR(TTG) Tn::gltA | 7.3 | 0.146 | 113 |
| DAB12-b sugR(GTG) Tn::gltA | 7.1 | 0.142 | 110 |
| DAB12-b sugR(B6) Tn::gltA | 7.1 | 0.142 | 110 |
| 균주 | 퓨트레신 (g/L) | 생산성 (g/l/h) | fold(%) |
| KCCM11401P | 5.3 | 0.106 | 100 |
| KCCM11401P sugR(TTG) | 5.6 | 0.112 | 106 |
| KCCM11401P sugR(GTG) | 5.5 | 0.110 | 104 |
| KCCM11401P sugR(B6) | 5.4 | 0.108 | 102 |
| KCCM11401P Tn::gltA | 5.6 | 0.112 | 106 |
| KCCM11401P sugR(TTG) Tn::gltA | 6.1 | 0.122 | 115 |
| KCCM11401P sugR(GTG) Tn::gltA | 5.9 | 0.118 | 111 |
| KCCM11401P sugR(B6) Tn::gltA | 5.8 | 0.116 | 109 |
| 균주 | 오르니틴 (g/L) | 생산성 (g/l/h) | fold(%) |
| KCCM11137P | 11.5 | 0.230 | 100 |
| KCCM11137P sugR(TTG) | 12.5 | 0.250 | 109 |
| KCCM11137P sugR(GTG) | 12.3 | 0.246 | 107 |
| KCCM11137P sugR(B6) | 12.5 | 0.250 | 109 |
| KCCM11137P Tn::gltA | 12.4 | 0.248 | 108 |
| KCCM11137P sugR(TTG) Tn::gltA | 13.5 | 0.270 | 117 |
| KCCM11137P sugR(GTG) Tn::gltA | 13 | 0.260 | 113 |
| KCCM11137P sugR(B6) Tn::gltA | 12.9 | 0.258 | 112 |
Claims (15)
- 당대사 전사 조절자(transcriptional regulator of sugar metabolism, SugR) 활성이 내재적 활성에 비해 약화되고 시트레이트 신타아제(citrate synthase, GltA) 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 당대사 전사 조절자는 서열번호 1 또는 서열번호 3의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 시트레이트 신타아제는 서열번호 5 또는 서열번호 7의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 써모아미노게네스(Corynebacterium thermoaminogenes), 브레비박테리움 플라붐(Brevibacterium flavum) 및 브레비박테리움 락토페르멘툼(Brevibacterium lactofermentum)으로 이루어진 군으로부터 선택되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 오르니틴 디카복실라제(ornithine decarboxylase, ODC)의 활성이 도입되도록 변이된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물.
- 제5항에 있어서, 상기 오르니틴 디카복실라제는 서열번호 17의 아미노산 서열로 구성되는, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 i) 오르니틴 카르바모일 트랜스퍼라아제(ArgF), ii) 글루타메이트 엑스포터 또는 iii) 오르니틴 카르바모일 트랜스퍼라아제 및 글루타메이트 엑스포터의 활성이 내재적 활성에 비해 약화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제7항에 있어서, 상기 오르니틴 카르바모일 트랜스퍼라아제는 서열번호 9 또는 서열번호 11의 아미노산 서열로 구성되고, 상기 글루타메이트 엑스포터는 서열번호 13 또는 15의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제(ArgJ), 아세틸 글루타메이트 키나아제(ArgB), 및 아세틸 오르니틴 아미노 트랜스퍼라아제(ArgD)로 구성되는 군으로부터 선택되는 1종 이상의 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제9항에 있어서, 상기 아세틸 감마 글루타밀 포스페이트 리덕타아제는 서열번호 19 또는 서열번호 21의 아미노산 서열로 구성되고, 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제는 서열번호 23 또는 서열번호 25의 아미노산 서열로 구성되며, 아세틸 글루타메이트 키나아제는 서열번호 27 또는 서열번호 29의 아미노산 서열로 구성되고, 아세틸 오르니틴 아미노 트랜스퍼라아제는 서열번호 31 또는 서열번호 33의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아세틸트랜스퍼라아제의 활성이 내재적 활성보다 약화되도록 변이된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물.
- 제11항에 있어서, 상기 아세틸트랜스퍼라아제가 서열번호 35 또는 서열번호 37의 아미노산 서열로 구성되는, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물.
- 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 서열번호 39 또는 서열번호 41의 아미노산 서열로 구성되는 단백질의 활성이 내재적 활성보다 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
- (i) 제1항 내지 제13항 중 어느 한 항의 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및(ii) 상기 (i) 단계에서 배양된 미생물 또는 배지로부터 퓨트레신 또는 오르니틴을 분리하는 단계를 포함하는, 퓨트레신 또는 오르니틴 생산 방법.
- 제14항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, 퓨트레신 또는 오르니틴 생산 방법.
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112017028181-3A BR112017028181B1 (pt) | 2015-06-24 | 2016-03-29 | Micro-organismo modificado para produzir putrescina ou ornitina e método para produzir putrescina ou ornitina usando o dito micro-organismo |
| CN201680036420.2A CN107849576B (zh) | 2015-06-24 | 2016-03-29 | 用于产生腐胺或鸟氨酸的微生物以及使用这些微生物产生腐胺或鸟氨酸的方法 |
| US15/739,699 US11053525B2 (en) | 2015-06-24 | 2016-03-29 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| SG11201710665TA SG11201710665TA (en) | 2015-06-24 | 2016-03-29 | Microorganisms for Producing Putrescine or Ornithine and Process for Producing Putrescine or Ornithine Using Them |
| JP2017566629A JP6588575B2 (ja) | 2015-06-24 | 2016-03-29 | プトレシンまたはオルニチン生産微生物及びそれを用いたプトレシンまたはオルニチン生産方法 |
| NZ73865916A NZ738659A (en) | 2015-06-24 | 2016-03-29 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| RU2017145909A RU2691303C1 (ru) | 2015-06-24 | 2016-03-29 | Микроорганизм, продуцирующий путресцин или орнитин, и способ получения путресцина или орнитина с использованием этого микроорганизма |
| CA2990376A CA2990376C (en) | 2015-06-24 | 2016-03-29 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| AU2016284767A AU2016284767B2 (en) | 2015-06-24 | 2016-03-29 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| MX2017016185A MX2017016185A (es) | 2015-06-24 | 2016-03-29 | Microorganismos para producir putrescina u ornitina y procedimientos de produccion de putrescina u ornitina utilizando los mismos. |
| MYPI2017001902A MY187501A (en) | 2015-06-24 | 2016-03-29 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
| PH12017502396A PH12017502396A1 (en) | 2015-06-24 | 2017-12-21 | Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2015-0090021 | 2015-06-24 | ||
| KR1020150090021A KR101813759B1 (ko) | 2015-06-24 | 2015-06-24 | 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016208854A1 true WO2016208854A1 (ko) | 2016-12-29 |
Family
ID=56740763
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/003198 Ceased WO2016208854A1 (ko) | 2015-06-24 | 2016-03-29 | 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 |
Country Status (19)
| Country | Link |
|---|---|
| US (1) | US11053525B2 (ko) |
| EP (1) | EP3109318B1 (ko) |
| JP (1) | JP6588575B2 (ko) |
| KR (1) | KR101813759B1 (ko) |
| CN (1) | CN107849576B (ko) |
| AU (1) | AU2016284767B2 (ko) |
| BR (1) | BR112017028181B1 (ko) |
| CA (1) | CA2990376C (ko) |
| CL (1) | CL2017003249A1 (ko) |
| ES (1) | ES2739002T3 (ko) |
| MX (1) | MX2017016185A (ko) |
| MY (1) | MY187501A (ko) |
| NZ (1) | NZ738659A (ko) |
| PH (1) | PH12017502396A1 (ko) |
| PL (1) | PL3109318T3 (ko) |
| RU (2) | RU2759956C1 (ko) |
| SG (1) | SG11201710665TA (ko) |
| TW (1) | TWI632237B (ko) |
| WO (1) | WO2016208854A1 (ko) |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101937569B1 (ko) | 2017-06-14 | 2019-01-11 | 씨제이제일제당 (주) | 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법 |
| KR101941775B1 (ko) | 2017-06-14 | 2019-01-24 | 씨제이제일제당 (주) | 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법 |
| CN111019875A (zh) * | 2019-12-25 | 2020-04-17 | 江南大学 | 一种转录因子SugR编码基因及其在N-乙酰氨基葡萄糖生产中的应用 |
| CN111394291B (zh) * | 2020-03-27 | 2022-03-15 | 江南大学 | 一种利用重组谷氨酸棒杆菌发酵生产l-谷氨酸的方法 |
| CN112522171A (zh) * | 2020-12-18 | 2021-03-19 | 浙江中山化工集团股份有限公司 | 一种工程菌、含鸟氨酸溶液的处理方法及试剂盒 |
| KR102525072B1 (ko) * | 2021-03-10 | 2023-04-24 | 씨제이제일제당 주식회사 | 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법 |
| CN118813659A (zh) * | 2021-04-14 | 2024-10-22 | 上海凯赛生物技术股份有限公司 | 用于发酵生产1,5-戊二胺的重组dna、菌株及其用途 |
| KR102734703B1 (ko) * | 2021-10-15 | 2024-11-26 | 씨제이제일제당 주식회사 | L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법 |
| CN114350694B (zh) * | 2021-11-29 | 2024-05-24 | 新泰市佳禾生物科技有限公司 | L-鸟氨酸生产菌及其构建方法 |
| KR102952497B1 (ko) * | 2022-03-28 | 2026-04-15 | 씨제이제일제당 주식회사 | O-아세틸 호모세린 생산 미생물 및 이를 이용한 o-아세틸 호모세린 또는 l-메치오닌 생산 방법 |
| KR102770475B1 (ko) * | 2022-06-02 | 2025-02-20 | 씨제이제일제당 주식회사 | L-오르니틴 생산능을 가지는 미생물 및 이를 이용한 l-오르니틴 생산방법 |
| KR102919411B1 (ko) * | 2024-04-25 | 2026-01-28 | 씨제이제일제당 (주) | 신규한 이중 기능성 글루타메이트 n-아세틸트랜스퍼라제/아미노산 아세틸트랜스퍼라제 변이체 및 이를 이용한 글루타메이트 계열 아미노산 생산 방법 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009254323A (ja) * | 2008-04-21 | 2009-11-05 | Ajinomoto Co Inc | L−グルタミン酸系アミノ酸の製造法 |
| KR20130082478A (ko) * | 2012-01-11 | 2013-07-19 | 씨제이제일제당 (주) | 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법 |
| KR101372635B1 (ko) * | 2010-12-08 | 2014-03-13 | 씨제이제일제당 (주) | 오르니틴 생산능이 향상된 미생물 및 이를 이용하여 오르니틴을 생산하는 방법 |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146593B (zh) * | 2004-01-30 | 2015-07-15 | 味之素株式会社 | 生产l-氨基酸的微生物和生产l-氨基酸的方法 |
| WO2006001382A1 (ja) * | 2004-06-25 | 2006-01-05 | Kyowa Hakko Kogyo Co., Ltd. | ジペプチドまたはジペプチド誘導体の製造法 |
| US8497098B2 (en) | 2004-07-15 | 2013-07-30 | Dsm Ip Assets B.V. | Biochemical synthesis of 1,4-butanediamine |
| KR100620092B1 (ko) | 2004-12-16 | 2006-09-08 | 씨제이 주식회사 | 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법 |
| EP3170889A1 (en) | 2006-09-15 | 2017-05-24 | CJ Cheiljedang Corporation | A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same |
| KR100824457B1 (ko) | 2006-10-16 | 2008-04-22 | 씨제이제일제당 (주) | 고농도의 글루탐산을 생산하는 미생물 및 이를 이용한글루탐산의 제조 방법 |
| US8133714B2 (en) * | 2007-09-27 | 2012-03-13 | Evonik Degussa Gmbh | Process for the fermentative preparation of organic chemical compounds using coryneform bacteria in which the SugR gene is present in attenuated form |
| KR100930203B1 (ko) | 2008-01-28 | 2009-12-07 | 씨제이제일제당 (주) | 개량된 프로모터 및 이를 이용한 l-라이신의 생산 방법 |
| KR101126041B1 (ko) | 2008-04-10 | 2012-03-19 | 씨제이제일제당 (주) | 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 l-라이신 생산방법 |
| BRPI0903495B1 (pt) | 2008-04-10 | 2019-01-29 | Korea Advanced Institute Of Science And Technology | microorganismos mutantes com capacidade de produzir putrescina e método para produção de putrescina utilizando os mesmos |
| KR101348461B1 (ko) * | 2010-12-08 | 2014-01-08 | 씨제이제일제당 (주) | 퓨트레신을 생산하는 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법 |
| CN103492553B (zh) * | 2011-02-22 | 2018-06-12 | 巴斯夫欧洲公司 | 用于生产尸胺的方法和重组微生物 |
| KR101607741B1 (ko) * | 2013-03-20 | 2016-03-31 | 씨제이제일제당 (주) | 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법 |
| CN111019875A (zh) * | 2019-12-25 | 2020-04-17 | 江南大学 | 一种转录因子SugR编码基因及其在N-乙酰氨基葡萄糖生产中的应用 |
-
2015
- 2015-06-24 KR KR1020150090021A patent/KR101813759B1/ko active Active
-
2016
- 2016-03-29 WO PCT/KR2016/003198 patent/WO2016208854A1/ko not_active Ceased
- 2016-03-29 BR BR112017028181-3A patent/BR112017028181B1/pt active IP Right Grant
- 2016-03-29 MX MX2017016185A patent/MX2017016185A/es unknown
- 2016-03-29 SG SG11201710665TA patent/SG11201710665TA/en unknown
- 2016-03-29 MY MYPI2017001902A patent/MY187501A/en unknown
- 2016-03-29 CA CA2990376A patent/CA2990376C/en active Active
- 2016-03-29 JP JP2017566629A patent/JP6588575B2/ja active Active
- 2016-03-29 US US15/739,699 patent/US11053525B2/en active Active
- 2016-03-29 AU AU2016284767A patent/AU2016284767B2/en active Active
- 2016-03-29 RU RU2019103640A patent/RU2759956C1/ru active
- 2016-03-29 NZ NZ73865916A patent/NZ738659A/en unknown
- 2016-03-29 RU RU2017145909A patent/RU2691303C1/ru active
- 2016-03-29 CN CN201680036420.2A patent/CN107849576B/zh active Active
- 2016-06-23 ES ES16175996T patent/ES2739002T3/es active Active
- 2016-06-23 EP EP16175996.4A patent/EP3109318B1/en active Active
- 2016-06-23 PL PL16175996T patent/PL3109318T3/pl unknown
- 2016-06-24 TW TW105119915A patent/TWI632237B/zh active
-
2017
- 2017-12-18 CL CL2017003249A patent/CL2017003249A1/es unknown
- 2017-12-21 PH PH12017502396A patent/PH12017502396A1/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009254323A (ja) * | 2008-04-21 | 2009-11-05 | Ajinomoto Co Inc | L−グルタミン酸系アミノ酸の製造法 |
| KR101372635B1 (ko) * | 2010-12-08 | 2014-03-13 | 씨제이제일제당 (주) | 오르니틴 생산능이 향상된 미생물 및 이를 이용하여 오르니틴을 생산하는 방법 |
| KR20130082478A (ko) * | 2012-01-11 | 2013-07-19 | 씨제이제일제당 (주) | 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법 |
Non-Patent Citations (4)
| Title |
|---|
| BLOMBACH, BASTIAN ET AL.: "L-Valine Production during Growth of Pyruvate Dehydrogenase Complex-deficient Corynebacterium Glutamicum in the Presence of Ethanol or by Inactivation of the Transcriptional Regulator SugR", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 75, no. 4, 2009, pages 1197 - 1200, XP055233519 * |
| DATABASE NCBI [O] 18 July 2013 (2013-07-18), "D-beta-D-heptose 1-phosphate adenosyltransferase [Corynebacterium glutamicum]", XP055341336, retrieved from ncbi Database accession no. WP_011014761.1 * |
| DATABASE NCBI [O] 18 July 2013 (2013-07-18), "MFS transporter [Corynebacterium glutamicum]", XP055341342, Database accession no. WP_011015248.1 * |
| DATABASE NCBI [O] 22 March 2015 (2015-03-22), "type II citrate synthase [Corynebacterium glutamicum]", XP055341339, Database accession no. WP_011013914.1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| JP6588575B2 (ja) | 2019-10-09 |
| KR20170000906A (ko) | 2017-01-04 |
| CA2990376C (en) | 2021-01-12 |
| AU2016284767B2 (en) | 2019-06-06 |
| JP2018523989A (ja) | 2018-08-30 |
| ES2739002T3 (es) | 2020-01-28 |
| EP3109318A1 (en) | 2016-12-28 |
| TW201712117A (zh) | 2017-04-01 |
| PH12017502396A1 (en) | 2018-06-25 |
| PL3109318T3 (pl) | 2019-10-31 |
| CA2990376A1 (en) | 2016-12-29 |
| RU2691303C1 (ru) | 2019-06-11 |
| US20180187222A1 (en) | 2018-07-05 |
| BR112017028181B1 (pt) | 2023-12-19 |
| CN107849576A (zh) | 2018-03-27 |
| NZ738659A (en) | 2019-09-27 |
| BR112017028181A2 (pt) | 2018-08-28 |
| EP3109318B1 (en) | 2019-06-05 |
| US11053525B2 (en) | 2021-07-06 |
| TWI632237B (zh) | 2018-08-11 |
| CN107849576B (zh) | 2021-04-27 |
| KR101813759B1 (ko) | 2018-01-02 |
| RU2759956C1 (ru) | 2021-11-19 |
| SG11201710665TA (en) | 2018-01-30 |
| MY187501A (en) | 2021-09-24 |
| MX2017016185A (es) | 2018-03-07 |
| AU2016284767A1 (en) | 2018-01-25 |
| CL2017003249A1 (es) | 2018-04-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2019190192A1 (ko) | 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법 | |
| WO2014148743A1 (ko) | 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법 | |
| WO2012077995A2 (ko) | 퓨트레신을 생산하는 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법 | |
| WO2017014532A1 (ko) | 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 | |
| WO2019231159A1 (ko) | 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법 | |
| WO2015199396A1 (ko) | O-아세틸 호모세린을 생산하는 미생물 및 상기 미생물을 이용하여 o-아세틸 호모세린을 생산하는 방법 | |
| WO2021167414A1 (ko) | 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법 | |
| WO2020218736A1 (ko) | L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법 | |
| WO2022050671A1 (ko) | L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법 | |
| WO2019172702A1 (ko) | 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법 | |
| WO2018230978A1 (ko) | 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법 | |
| WO2019013532A2 (ko) | 아세토하이드록시산 신타아제 변이체, 이를 포함하는 미생물 또는 이를 이용하는 l-분지쇄 아미노산 생산 방법 | |
| WO2018230977A1 (ko) | 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법 | |
| WO2022239953A1 (ko) | 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도 | |
| WO2023075397A1 (ko) | Lyse 변이체 및 이를 이용한 l-아르기닌 생산방법 | |
| WO2021045472A1 (ko) | 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법 | |
| WO2022191467A1 (ko) | L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법 | |
| WO2021235775A1 (ko) | 신규한 폴리펩티드 및 이를 이용한 l-류신의 생산 방법 | |
| WO2020256415A1 (ko) | L-타이로신을 생산하는 미생물 및 이를 이용한 l-타이로신 생산 방법 | |
| WO2022035011A1 (ko) | 퓨트레신 생산 미생물 및 이를 이용한 퓨트레신 생산방법 | |
| WO2023277307A1 (ko) | 고농도 l-글루탐산을 생산하기 위한 균주 및 이를 이용한 l-글루탐산 생산방법 | |
| WO2022239942A1 (ko) | 신규 프로모터 및 이의 용도 | |
| WO2015163591A1 (ko) | 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법 | |
| WO2021153866A1 (ko) | 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법 | |
| WO2015163592A1 (ko) | 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16814567 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2017/016185 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2990376 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12017502396 Country of ref document: PH |
|
| ENP | Entry into the national phase |
Ref document number: 2017566629 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11201710665T Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2017145909 Country of ref document: RU |
|
| ENP | Entry into the national phase |
Ref document number: 2016284767 Country of ref document: AU Date of ref document: 20160329 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112017028181 Country of ref document: BR |
|
| 32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 25/04/2018) |
|
| ENP | Entry into the national phase |
Ref document number: 112017028181 Country of ref document: BR Kind code of ref document: A2 Effective date: 20171226 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16814567 Country of ref document: EP Kind code of ref document: A1 |
