WO2016208854A1 - 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 - Google Patents

퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 Download PDF

Info

Publication number
WO2016208854A1
WO2016208854A1 PCT/KR2016/003198 KR2016003198W WO2016208854A1 WO 2016208854 A1 WO2016208854 A1 WO 2016208854A1 KR 2016003198 W KR2016003198 W KR 2016003198W WO 2016208854 A1 WO2016208854 A1 WO 2016208854A1
Authority
WO
WIPO (PCT)
Prior art keywords
ornithine
seq
microorganism
putrescine
sugr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/003198
Other languages
English (en)
French (fr)
Inventor
정희경
엄혜원
리홍선
박수진
양영렬
이경민
이효형
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CJ CheilJedang Corp
Original Assignee
CJ CheilJedang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA2990376A priority Critical patent/CA2990376C/en
Priority to AU2016284767A priority patent/AU2016284767B2/en
Priority to CN201680036420.2A priority patent/CN107849576B/zh
Priority to US15/739,699 priority patent/US11053525B2/en
Priority to SG11201710665TA priority patent/SG11201710665TA/en
Priority to JP2017566629A priority patent/JP6588575B2/ja
Priority to BR112017028181-3A priority patent/BR112017028181B1/pt
Priority to NZ73865916A priority patent/NZ738659A/en
Application filed by CJ CheilJedang Corp filed Critical CJ CheilJedang Corp
Priority to RU2017145909A priority patent/RU2691303C1/ru
Priority to MX2017016185A priority patent/MX2017016185A/es
Priority to MYPI2017001902A priority patent/MY187501A/en
Publication of WO2016208854A1 publication Critical patent/WO2016208854A1/ko
Priority to PH12017502396A priority patent/PH12017502396A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/10Citrulline; Arginine; Ornithine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1018Carboxy- and carbamoyl transferases (2.1.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/001Amines; Imines
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y201/00Transferases transferring one-carbon groups (2.1)
    • C12Y201/03Carboxy- and carbamoyltransferases (2.1.3)
    • C12Y201/03003Ornithine carbamoyltransferase (2.1.3.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/03Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/03001Citrate (Si)-synthase (2.3.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y401/00Carbon-carbon lyases (4.1)
    • C12Y401/01Carboxy-lyases (4.1.1)
    • C12Y401/01017Ornithine decarboxylase (4.1.1.17)

Definitions

  • the present invention relates to a recombinant microorganism for producing putrescine or ornithine and a method for producing putrescine or ornithine using the same.
  • Putrescine is found in gram-negative bacteria and fungi, and is present in high concentrations in various species and is expected to play an important role in the metabolism of microorganisms.
  • putrescine is an important raw material for synthesizing polyamine nylon-4,6, and is mainly produced by chemical synthesis.
  • the chemical synthesis method comprises a three-step process including a catalytic oxidation step, a cyanide compound and a hydrogenation step using high pressure hydrogen. Accordingly, there is a demand for a method using biomass that is more environmentally friendly and can reduce energy consumption for the production of putrescine.
  • Ornithine is a substance widely found in plants, animals and microorganisms and is a precursor used for the biosynthesis of arginine, proline and polyamines. It also plays an important role in the pathway of the production of urea from amino acids or ammonia through the ornithine cycle in the metabolism of higher animals in vitro. Ornithine is also used industrially as a nutritional supplement or as a medicine to improve cirrhosis and liver dysfunction.
  • a method for producing ornithine a method of treating milk casein with a digestive enzyme and a method using transformed E. coli or Corynebacterium microorganisms are known (Korea Registration No. 10-1372635; T Gotoh et al., Bioprocess Biosyst.Eng., 33: 773-777, 2010).
  • SugR a transcriptional regulator of sugar metabolism
  • Corynebacterium encodes a PEP-protein phosphotransferase of PTS system of the PTS system. It has been reported to inhibit genes involved in glycolysis and glycolysis (VF Wendisch, et al., J. Bacteriol. 190: 24, 8033-8044, 2008).
  • Citrate synthase is the first to act on the TCA cycle and is an enzyme that can regulate the rate of the TCA cycle. Mutations with reduced GltA activity in Corynebacterium have been reported to increase aspartate and lysine production (Shiio et al., Agric Biol Chem. 46; 101-107, 1982).
  • the inventors have found that putrescine or ornithine sanity is improved when manipulating the gene sugR, which encodes the transcriptional regulator of sugar metabolism, and the gene gltA, which encodes a citrate synthase.
  • the present invention was completed by confirming.
  • Another object of the present invention is to provide a method for producing putrescine or ornithine using the microorganism.
  • the microorganism of the present invention can be widely used to industrially produce putrescine or ornithine, and is widely used as an effective and desirable means for providing raw materials in terms of economic and environmental aspects in producing various polymer products used as raw materials. Can be utilized.
  • One aspect of the invention is that i) the transcriptional regulator of sugar metabolism (SugR) activity is attenuated relative to endogenous activity, or ii) the citrate synthase (GltA) activity is enhanced compared to endogenous activity. Or iii) a microorganism of the genus Corynebacterium that has putrescine or ornithine production capacity, wherein the metabolic transcriptional regulator activity is attenuated relative to endogenous activity and mutated to enhance citrate synthase activity relative to endogenous activity. to provide.
  • One embodiment of the present invention is a microorganism of the genus Corynebacterium is putrescine or ornithine, wherein the metabolic transcriptional regulator activity is attenuated compared to the endogenous activity and the citrate synthase activity is enhanced compared to the endogenous activity It provides a microorganism of the genus Corynebacterium having a production capacity.
  • Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having a putrescine or ornithine production capacity, consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 of the sugar metabolism transcriptional regulator.
  • Another embodiment of the present invention provides a microorganism belonging to the genus Corynebacterium having citrate synthase having the ability to produce putrescine or ornithine, consisting of the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7.
  • Corynebacterium genus microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum), Corynebacterium ammoniagenes's Ness (Corynebacterium ammoniagenes), Corynebacterium Thermo Amino's Ness (Corynebacterium thermoaminogenes), Brevibacterium Playa boom (Brevibacterium flavum) and Brevibacterium lactofermentum (Brevibacterium lactofermentum ) provides a microorganism of the genus Corynebacterium having the ability to produce putrescine or ornithine.
  • Another embodiment of the present invention is the Corynebacterium genus of the genus Corynebacterium having a putrescine-producing ability, which is further modified to introduce the activity of ornithine decarboxylase (ornithine decarboxylase, ODC) Provide microorganisms.
  • ornithine decarboxylase ornithine decarboxylase, ODC
  • Another embodiment of the present invention provides the microorganism of the genus Corynebacterium having the ability to produce putrescine, ornithine dicarboxylase consisting of the amino acid sequence of SEQ ID NO: 17.
  • Another embodiment of the present invention is a microorganism of the genus Corynebacterium additionally i) ornithine carbamoyl transferase (ArgF), ii) glutamate exporter or iii) ornithine carbamoyl transferase and Provided are microorganisms of the genus Corynebacterium having a putrescine or ornithine production capacity, wherein the activity of glutamate exporter is mutated to be less than the intrinsic activity.
  • ornithine carbamoyl transferase is composed of the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11
  • the glutamate exporter is composed of the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15 It provides a microorganism of the genus Corynebacterium having a putrescine or ornithine production ability.
  • Corynebacterium genus microorganisms are additionally acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase ( ArgB), and the genus Corynebacterium, having a putrescine or ornithine production capacity, wherein at least one activity selected from the group consisting of acetyl ornithine amino transferase (ArgD) is mutated to be enhanced relative to endogenous activity.
  • ArgC acetyl gamma glutamyl phosphate reductase
  • ArgJ acetyl glutamate synthase or ornithine acetyl transferase
  • ArgB acetyl glutamate kinase
  • the genus Corynebacterium having
  • acetyl gamma glutamyl phosphate reductase is composed of the amino acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21, acetyl glutamate synthase or ornithine acetyl transferase is SEQ ID NO: 23 or
  • the acetyl glutamate kinase consists of the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 29, and the acetyl ornithine amino transferase consists of the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 33 It provides a microorganism of the genus Corynebacterium having a putrescine or ornithine production capacity.
  • Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having putrescine-producing ability, wherein the microorganism of the genus Corynebacterium is further mutated so that the activity of the acetyltransferase is less than the intrinsic activity. .
  • Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having putrescine production capacity, wherein the acetyltransferase is composed of the amino acid sequence of SEQ ID NO: 35 or SEQ ID NO: 37.
  • Another embodiment of the present invention is a microorganism of the genus Corynebacterium additionally transforms the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 39 or SEQ ID NO: 41 to enhance the intrinsic activity, putrescine production capacity Eggplants provide microorganisms of the genus Corynebacterium.
  • step (ii) separating the putrescine or ornithine from the microorganism or medium cultured in the step (i), it provides a putrescine or ornithine production method.
  • One embodiment of the present invention provides a method for producing putrescine or ornithine, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
  • One aspect of the invention is that i) the transcriptional regulator of sugar metabolism (SugR) activity is attenuated relative to endogenous activity, or ii) the citrate synthase (GltA) activity is enhanced compared to endogenous activity. Or iii) a microorganism of the genus Corynebacterium having a putrescine or ornithine production capacity, wherein the metabolic transcriptional regulator activity is attenuated relative to endogenous activity and mutated to enhance citrate synthase activity relative to endogenous activity. It is about.
  • the metabolic transcriptional regulator activity is attenuated relative to endogenous activity and the citrate synthase activity is enhanced to be enhanced relative to endogenous activity.
  • the term “transcriptional regulator of sugar metabolism (SugR)” refers to a variety of sugars, including sugar uptake and phosphotransferase systems, glycolysis and fermentation involving lactate dehydrogenase. It is an enzyme that functions broadly as a suppressor for genes involved in metabolism.
  • the glucose metabolism transcriptional regulator includes both the internal protein or the foreign protein of the genus Corynebacterium, and specifically, may be SugR derived from Corynebacterium spp.
  • the glucose metabolism transcriptional regulator is a protein comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically Any amino acid sequence having at least 95%, even more specifically at least 98%, most specifically at least 99% homology, and having substantially the activity of a glycoside transcriptional regulator can be included without limitation.
  • the glycoside transcriptional regulator is not limited to the origin in the present invention, for example, Corynebacterium genus microorganism Derived, specifically Corynebacterium glutamicum derived.
  • the sequence is homologous to the sequence and has an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 1 or SEQ ID NO: 3, even if some sequences have an amino acid sequence deleted, modified, substituted or added Obviously, it is included in the scope of the present invention.
  • the polynucleotide encoding the glyco metabolism transcriptional regulator of the present invention is at least 70%, specifically 80%, of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 or as long as it has similar activity as that of the sugar metabolism transcriptional regulator protein Or more, more specifically at least 90%, even more specifically at least 95%, even more specifically at least 98%, and most specifically at least 99%.
  • the polynucleotide encoding the glucose metabolism transcriptional regulator does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codon or in view of the preferred codons in the organism to express the modulator.
  • Various modifications may be made to the coding region within a range, and specifically, may include a polynucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4, but is not limited thereto.
  • citrate synthase is an enzyme involved in the production of various intracellular biosynthetic intermediates and reduced purine nucleic acids. It is known to act on the production of citrate by mediating the condensation reaction of acetyl-CoA with oxaloacetate.
  • the citrate synthase includes all the internal proteins or foreign proteins in the microorganism of Corynebacterium, and specifically, may be GltA derived from the microorganism of Corynebacterium.
  • Citrate synthase in the present invention is a protein comprising the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically Is at least 95%, even more specifically at least 98%, most specifically at least 99% homology, showing that the citrate is produced by substantially mediating the hydrolytic condensation reaction between acetyl-CoA and oxaloacetate.
  • Eggplant may be included without limitation if the protein.
  • citrate synthase in the present invention is not limited to the origin, for example, Corynebacterium genus microorganism Derived, specifically from Corynebacterium glutamicum.
  • sequence having homology with the sequence is an amino acid sequence having a biological activity substantially the same as or corresponding to the protein of SEQ ID NO: 5 or SEQ ID NO: 7, even if some sequences have an amino acid sequence deleted, modified, substituted or added Obviously, it is included in the scope of the present invention.
  • the polynucleotide encoding the citrate synthase of the present invention is at least 70%, specifically at least 80% of the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7 or the sequence, as long as it has similar activity to the citrate synthase protein. And, more specifically, at least 90%, even more specifically at least 95%, even more specifically at least 98%, most specifically at least 99%.
  • the polynucleotide encoding the citrate synthase does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codon or in view of the codons preferred in the organism to express the modulator.
  • Various modifications may be made to the coding region within a range, and specifically, may include a polynucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 8, but is not limited thereto.
  • homology means a degree of agreement with a given amino acid sequence or polynucleotide sequence and may be expressed as a percentage.
  • homologous sequences thereof having the same or similar activity as a given amino acid sequence or polynucleotide sequence are denoted as "% homology”.
  • % homology For example, using standard software that calculates parameters such as score, identity and similarity, in particular BLAST 2.0, or by hybridization experiments used under defined stringent conditions Appropriate hybridization conditions, which are defined within the scope of the art, are well known to those skilled in the art, and are well known to those skilled in the art (e.g., J.
  • the polynucleotide encoding the glycomechanical transcriptional regulator and citrate synthase of the present invention is a polynucleotide sequence of SEQ ID NO: 2 or 4 and SEQ ID NO: 6 or 8, or a probe derived from the polynucleotide sequence and It may hybridize under stringent conditions and may be a variant that encodes a normally functioning glucose metabolism transcriptional regulator and citrate synthase.
  • stringent conditions means conditions that enable specific hybridization between polynucleotides. For example, such stringent conditions are described specifically in the literature (eg, J. Sambrook et al., Homology).
  • the activity of the glycine metabolism transcription regulator SugR in the microorganism of the genus Corynebacterium having putrescine or ornithine production capacity, or enhance the activity of citrate synthase GltA, or weaken the SugR activity and GltA Enhancement was simultaneously applied, and as a result, it was confirmed that putrescine or ornithine production was improved in all mutant strains.
  • the microorganism of the present invention may include both natural or mutant microorganisms as long as it can produce putrescine or ornithine.
  • Examples include Escherichia sp., Shigella sp., Citrobacter sp., Salmonella sp., Enterobacter sp.
  • the microorganism of the present invention may be a microorganism belonging to the genus Corynebacterium, more specifically Corynebacterium glutamicum ( Corynebacterium glutamicum), Corynebacterium ammoniagenes's Ness (Corynebacterium ammoniagenes), Corynebacterium Thermo Amino's Ness (Corynebacterium thermoaminogenes), Brevibacterium Playa boom (Brevibacterium flavum) and Brevibacterium lactofermentum (Brevibacterium lactofermentum ) may be selected from the group consisting of, and more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), but is not limited thereto.
  • Corynebacterium glutamicum Corynebacterium glutamicum
  • Corynebacterium ammoniagenes'ss Corynebacterium ammoniagenes
  • the term "having putrescine or ornithine" in the present invention refers to putrescine or to a parent strain that is naturally capable of producing putrescine or ornithine, or that is not capable of producing putrescine or ornithine. It means a microorganism to which ornithine is produced.
  • the microorganism having the ability to produce putrescine or ornithine is glutamate x, which is a protein involved in the release of ornithine carbamoyltransfrase (ArgF) and / or glutamate involved in arginine synthesis in ornithine. It may be mutated to weaken the activity of the porter (NCgl1221) compared to the intrinsic activity.
  • the microorganism having the putrescine-producing ability is mutated to weaken the activity of acetyltransferase (NCgl1469), which is a protein that acetylates putrescine, and / or converts ornithine to putrescine. It may be modified to introduce the activity of phosphorus ornithine decarboxylase (ornithine decarboxylase, ODC).
  • NCgl1469 acetyltransferase
  • ODC phosphorus ornithine decarboxylase
  • the variation such as the activity is introduced, enhanced or weakened activity may occur through a process called transformation.
  • transformation refers to a polynucleotide encoding a specific protein or a vector containing a strong or weakly active promoter sequence into a host cell, thereby expressing the protein encoded by the polynucleotide in the host cell. Or to induce mutations in the chromosome of the host cell.
  • the polynucleotide also includes DNA and RNA encoding the target protein.
  • the polynucleotide may be introduced in any form as long as it can be introduced into a host cell to induce expression or mutation.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all the elements necessary for its expression.
  • the expression cassette may include a promoter, a transcription termination signal, a ribosomal binding site, and a translation termination signal, which are typically operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that the gene sequence is functionally linked with a promoter sequence for initiating and mediating the transcription of a polynucleotide encoding a particular protein of the invention.
  • the term "vector” refers to a DNA preparation containing a polynucleotide sequence encoding said target protein operably linked to a suitable regulatory sequence to enable expression of the target protein in a suitable host.
  • the regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. After being transformed into a suitable host cell, the vector can be replicated or function independent of the host genome and integrated into the genome itself.
  • the vector to be used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and pBR-based, pUC-based, pBluescriptII-based, etc. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • the vector usable in the present invention is not particularly limited and known expression vectors can be used. Specifically, pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector and the like can be used.
  • the bacterial chromosome insertion vector can replace the polynucleotide encoding the target protein in the chromosome with the mutated polynucleotide. Insertion of the polynucleotide into the chromosome can be made by any method known in the art, such as, but not limited to, homologous recombination. Since the vector of the present invention may be inserted into a chromosome by causing homologous recombination, the vector may further include a selection marker for confirming whether the chromosome is inserted.
  • Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a polynucleotide of interest, and to give selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers can be used. In an environment in which a selective agent is treated, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.
  • enhancing activity of the present invention not only includes the introduction of new or increased activity of the protein itself, resulting in an effect beyond the original function, but also an increase in endogenous gene activity, endogenous gene amplification from internal or external factors, Its activity is increased by deletion of inhibitory regulatory factors of gene expression, increase in gene copy number, introduction of genes from outside, modification of expression control sequences, in particular promoter replacement or modification, and increased enzyme activity by intragenic mutations. do.
  • the activity enhancement or increase is a parameter that influences the activity of the present invention.
  • the copy number increase of the polynucleotide is not particularly limited, but may be performed in a form operably linked to a vector or by inserting into a chromosome in a host cell.
  • a host capable of being cloned and functioning independently of a host, in which a polynucleotide encoding an enzyme of the present invention is operably linked may be performed by introducing into a host cell, or the host is operably linked.
  • a vector capable of inserting the polynucleotide into the chromosome in the cell may be introduced into the host cell to increase the copy number of the polynucleotide in the chromosome of the host cell.
  • 2) modification of the expression control sequence to increase the expression of the polynucleotide is not particularly limited thereto, but the deletion, insertion, non-conservative or conservative substitution of the polynucleotide sequence to further enhance the activity of the expression control sequence or Combinations can be made by inducing variations in the sequence or by replacing with polynucleotide sequences having stronger activity.
  • the expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, a sequence that controls the termination of transcription and translation, and the like.
  • the heterologous promoter may be linked to the top of the polynucleotide expression unit instead of the original promoter.
  • the strong promoter include a CJ7 promoter, a lysCP1 promoter, an EF-Tu promoter, a groEL promoter, an aceA or aceB promoter, and the like.
  • the lysCP1 promoter (WO2009 / 096689) or the CJ7 promoter (Korean Patent No. 0620092 and WO2006 / 065095), which are corynebacterium-derived promoters, may be operably linked to improve the expression rate of the polynucleotide encoding the enzyme.
  • the present invention is not limited thereto.
  • 3) modification of the polynucleotide sequence on the chromosome is not particularly limited, and expression control is performed by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the polynucleotide sequence. This can be done by inducing variations in the sequence or by replacing with a polynucleotide sequence that has been improved to have stronger activity.
  • the term "attenuated activity" of the present invention the deletion of part or all of the polynucleotide encoding a protein to weaken the activity, modification of the expression control sequence to reduce the expression of the polynucleotide, weakening the activity of the protein Possibly by modification of the polynucleotide sequence on the chromosome, and combinations thereof.
  • the active weakening is
  • a method of deleting part or all of a polynucleotide encoding a protein may include a polynucleotide or a marker gene in which a polynucleotide encoding an intrinsic target protein in a chromosome through a bacterial chromosome insertion vector is deleted from a polynucleotide sequence.
  • a marker gene in which a polynucleotide encoding an intrinsic target protein in a chromosome through a bacterial chromosome insertion vector is deleted from a polynucleotide sequence.
  • the method of modifying the expression control sequence is carried out by inducing a mutation on the expression control sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof to further weaken the activity of the expression control sequence, or By replacing with a polynucleotide sequence with weaker activity.
  • the expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence that controls the termination of transcription and translation.
  • a method of modifying a polynucleotide sequence on a chromosome is carried out by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further weaken the activity of the enzyme, or weaker. By replacing with a polynucleotide sequence that has been improved to have activity.
  • the method of deleting a regulator that inhibits the expression of the polynucleotide of the enzyme may be performed by replacing the polynucleotide of the expression inhibitory factor with a polynucleotide or a marker gene that is missing some polynucleotide sequence.
  • the term "some" differs depending on the kind of polynucleotide, but is specifically 1 to 300, specifically 1 to 100, and more specifically 1 to 50.
  • intrinsic activity refers to an active state of an enzyme that is originally in an unmodified state, for example, a natural state
  • "enhanced" compared to an intrinsic activity means that a gene exhibiting activity. Is not compared to the activity of microorganisms before the introduction of or manipulations such as an increase in the number of copies of the gene, deletion of the inhibitory regulators of gene expression or modification of expression control sequences, for example the use of an improved promoter. It means a state in which the activity of the microorganisms after the increase is increased.
  • the microorganism of the genus Corynebacterium of the present invention may be a microorganism of the genus Corynebacterium having the ability to produce putrescine, in which the activity of ornithine decarboxylase (ODC) is introduced.
  • ODC ornithine decarboxylase
  • ornithine decarboxylase means an enzyme that produces putrescine by mediating the decarboxylation of ornithine.
  • Microorganisms in Corynebacterium do not have a putrescine biosynthetic pathway, but when ornithine decarboxylase (ODC) is introduced from the outside, putrescine is synthesized and putrescine is released into the cell.
  • ODC ornithine decarboxylase
  • the ornithine dicarboxylase may be composed of the amino acid sequence of SEQ ID NO: 17, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically Any protein having substantially the activity of ornithine dicarboxylase as an amino acid sequence exhibiting at least 95%, even more specifically at least 98% and most specifically at least 99% homology can be included without limitation.
  • ornithine dicarboxylase is not limited to the origin in the present invention, because there may be a difference in the amino acid sequence of the protein showing the activity depending on the species or strain of the microorganism, specifically, ornithine dicarboxyl derived from E. coli May be laze.
  • sequence having homology with the above sequence is an amino acid sequence having a biological activity substantially the same as or corresponding to that of the protein of SEQ ID NO: 17, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is also provided. It is obvious that it is included in the category.
  • the polynucleotide encoding ornithine dicarboxylase of the present invention is at least 70%, specifically 80% or more, of the amino acid sequence of SEQ ID NO: 17 or as long as it has similar activity to the ornithine dicarboxylase protein. Specifically, it may include polynucleotides encoding proteins that exhibit at least 90%, even more specifically at least 95%, even more specifically at least 98%, most specifically at least 99% homology.
  • the polynucleotide encoding the ornithine decarboxylase does not change the amino acid sequence of the protein expressed from the coding region due to the degeneracy of the codons or in view of the codons preferred in the organism to express the modulator.
  • Various modifications may be made to the coding region without departing from the scope of the present invention.
  • the microorganisms of the genus Corynebacterium of the present invention may additionally include i) ornithine carbamoyl transferase (ArgF), ii) glutamate exporter (NCgl1221) or iii) ornithine carbamoyl transferase and glutamate exporter. It may be a microorganism of the genus Corynebacterium that has attenuated putrescine or ornithine production compared to this intrinsic activity.
  • Ornithine carbamoyl transferase in the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11, or 70% or more, specifically 80% or more, more specifically 90% or more of the sequence More specifically, at least 95%, even more specifically at least 98%, most specifically at least 99% of the amino acid sequence showing a homology can be included without limitation any protein having substantially the activity of ornithine carbamoyl transferase. have.
  • the glutamate exporter is a protein consisting of the amino acid sequence of SEQ ID NO: 13 or 15, or 70% or more, specifically 80% or more, more specifically 90% or more, and 95% or more with the sequence. As described above, even more specifically, an amino acid sequence exhibiting homology of 98% or more and most specifically 99% or more may be included without limitation as long as the protein has substantially the activity of glutamate exporter.
  • the microorganisms of the genus Corynebacterium further include acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase (ArgJ), acetyl glutamate kinase (ArgB), and acetyl ornithine.
  • the at least one activity selected from the group consisting of tin amino transferases (ArgD) may be microorganisms of the genus Corynebacterium having potrecin or ornithine production, enhanced relative to intrinsic activity.
  • Acetyl gamma glutamyl phosphate reductase in the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21, or 70% or more, specifically 80% or more, more specifically 90% or more of the sequence More specifically, an amino acid sequence showing at least 95%, even more specifically at least 98%, and most specifically at least 99%, and may be included without limitation as long as the protein has substantially the activity of acetyl gamma glutamyl phosphate reductase. have.
  • the acetyl glutamate synthase or ornithine acetyl transferase is a protein consisting of the amino acid sequence of SEQ ID NO: 23 or SEQ ID NO: 25, or 70% or more, specifically 80% or more, and more specifically Activity of substantially acetyl glutamate synthase or ornithine acetyl transferase as an amino acid sequence exhibiting at least 90%, more specifically at least 95%, even more specifically at least 98%, most specifically at least 99% homology Any protein having may be included without limitation.
  • Acetyl glutamate kinase in the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 29, or 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically 95 Any protein having substantially the activity of acetyl glutamate kinase as an amino acid sequence exhibiting at least%, even more specifically at least 98%, most specifically at least 99%, can be included without limitation.
  • the acetyl ornithine amino transferase in the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 31, or 70% or more, specifically 80% or more, more specifically 90% or more of the sequence, More specifically, at least 95%, even more specifically at least 98%, most specifically at least 99% of the amino acid sequence showing a homology can be included without limitation any protein having substantially the activity of acetyl ornithine amino transferase. have.
  • Corynebacterium genus microorganism of the present invention may further be a Corynebacterium genus microorganism having a putrescine production capacity, the activity of acetyltransferase (NCgl1469) is weakened than the intrinsic activity.
  • Acetyltransferase in the present invention may be included without limitation so long as it is a protein that serves to transfer the acetyl group to putrescine.
  • the acetyltransferase is a protein consisting of the amino acid sequence of SEQ ID NO: 35 or SEQ ID NO: 37, or 70% or more, specifically 80% or more, more specifically 90% or more, and even more specifically 95% or more with the sequence. More specifically, it may be included without limitation, as long as it is an amino acid sequence exhibiting homology of 98% or more, most specifically 99% or more, and having a substantially acetyltransferase activity.
  • Corynebacterium microorganism of the present invention may further be a Corynebacterium microorganism having a putrescine-producing ability, the activity of NCgl2522 is enhanced than the intrinsic activity.
  • NCgl2522 is a protein that functions to release putrescine, and is composed of the amino acid sequence of SEQ ID NO: 39 or SEQ ID NO: 41, or 70% or more, specifically 80% or more, and 90% of the sequence. Any protein having substantially the same activity as an amino acid sequence showing at least%, even more specifically at least 95%, even more specifically at least 98%, and most specifically at least 99% may be included without limitation.
  • step (ii) separating the putrescine or ornithine from the microorganism or medium cultured in the step (i), it provides a putrescine or ornithine production method.
  • the microorganism of the genus Corynebacterium in the present invention may be Corynebacterium glutamicum.
  • microorganism of the genus Corynebacterium having the putrescine or ornithine production capacity of the present invention is as described above.
  • the step of culturing the microorganism is not particularly limited thereto, and may be performed by a known batch culture method, continuous culture method, fed-batch culture method, or the like.
  • the culture conditions are not particularly limited, but using a basic compound (eg sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg phosphoric acid or sulfuric acid) to an appropriate pH (eg pH 5 to 9, specifically PH 6 to 8, most specifically pH 6.8) can be adjusted, the aerobic conditions can be maintained by introducing an oxygen or oxygen-containing gas mixture into the culture, the culture temperature is 20 to 45 °C, specifically 25 To 40 ° C., and may be incubated for about 10 to 160 hours. Putrescine or ornithine produced by the culture may be secreted into the medium or remain in the cells.
  • a basic compound eg sodium hydroxide, potassium hydroxide or ammonia
  • an acidic compound eg phosphoric acid or sulfuric acid
  • pH eg pH 5 to 9, specifically
  • the carbon sources in the culture medium used are sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), fats and oils (e.g. soybean oil, sunflower seeds). Oils, peanut oils and coconut oils), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (e.g. glycerol and ethanol) and organic acids (e.g. acetic acid) may be used individually or in combination. This is not restrictive.
  • sugars and carbohydrates e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose
  • fats and oils e.g. soybean oil, sunflower seeds. Oils, peanut oils and coconut oils
  • fatty acids e.g. palmitic acid, stearic acid and linoleic acid
  • alcohols e.g. glycerol and ethanol
  • Nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and Ammonium nitrate) and the like can be used individually or in combination, but is not limited thereto.
  • a source of phosphorus potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, and the like may be used individually or in combination, but is not limited thereto. It may also include essential growth-promoting substances such as other metal salts (eg magnesium sulfate or iron sulfate), amino acids and vitamins.
  • the method for recovering putrescine or ornithine produced in the culturing step of the present invention may be carried out using a suitable method known in the art according to a culture method, for example, a batch, continuous or fed-batch culture method. Material can be collected.
  • the present inventors confirmed the effect of the weakening of the gene sugR, which encodes a transcriptional regulator of sugar metabolism, on putrescine production in putrescine-producing strains.
  • a vector was prepared for alteration of sugR start codons. Obtaining a primer pair of SEQ ID NOs: 43 and 44 and a rear homologous recombination fragment of the sugR initiation codon to obtain a front homologous fragment of the sugR initiation codon, near the polynucleotide sequence described in SEQ ID NO: 2 of the gene encoding the SugR Primer pairs of SEQ ID NO: 45 or 46 and 47 were prepared. Primers used for the start codon change are summarized in Table 1 below.
  • PCR using genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, PCR using two pairs of primers was performed to amplify PCR fragments at the front and rear portions of the sugR gene initiation codon, respectively, and then subjected to electrophoresis. A fragment was obtained. At this time, the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C. The resulting fragments were purified by electrophoresis on a 0.8% agarose gel and then eluting a band of the desired size.
  • the pDZ vector (Korean Patent No. 10-0924065) was treated with BamHI and SalI and fusion cloned the PCR product of the ATCC13032 strain. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). In this process, plasmids pDZ-1'sugR (GTG) and pDZ-1'sugR (TTG) were prepared.
  • SEQ ID NO: 48 for the preparation of the vector was prepared as shown in Table 2 below.
  • a primer pair of SEQ ID NOs: 43 and 44 and a rear homologous recombination fragment of the sugR initiation codon to obtain a front homologous recombination fragment of the sugR initiation codon, near the polynucleotide sequence described in SEQ ID NO: 2 of the gene encoding the SugR PCR was performed using primer pairs of SEQ ID NOs: 48 and 47 to obtain and amplified PCR fragments at the front and rear portions of the sugR gene initiation codon, respectively, followed by electrophoresis to obtain the desired fragments.
  • the resulting fragments were purified by electrophoresis on a 0.8% agarose gel and then eluting a band of the desired size.
  • the pDZ vector was treated with BamHI and SalI and fusion cloned the PCR product of the ATCC13032 strain. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). In this process, plasmid pDZ-1 'sugR (B6) was prepared.
  • the plasmids pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) were putrescine-producing Corynebacterium microorganisms KCCM11240P (Korea Patent Publication No. 10-2013-0082478 And electroporation to obtain a transformant, which was transformed into kanamycin (25 ⁇ g / ml) and X-gal (5-bromo-4-chloro-3-indolin--D).
  • Colonies were formed by smearing and incubating in BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%) containing -galactoside. By selecting blue colonies from the colonies formed therefrom, strains into which the plasmids pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) were introduced were selected.
  • GTG pDZ-1'sugR
  • TTG pDZ-1'sugR
  • B6 pDZ-1'sugR
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • Shake culture (30 °C, 8 hours), and diluted sequentially from 10-4 to 10-10, respectively, plated and cultured in X-gal-containing solid medium to form colonies.
  • DAB12-a ⁇ NCgl1469 (Korean Patent No. 10-2014-0115244), a putrescine-producing strain based on Corynebacterium glutamicum ATCC13869, was named DAB12-b, and a sugR weakened strain was produced based on the strain. It was.
  • the PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 1 minute 30 seconds at 72 °C.
  • the gene encoding the SugR derived from Corynebacterium glutamicum ATCC13869 was confirmed to include the polynucleotide sequence set forth in SEQ ID NO: 4. It was.
  • the sequence of the protein encoded therefrom was compared with the amino acid sequence of the SugR derived from Corynebacterium glutamicum ATCC13032 (SEQ ID NO: 1). As a result, sequence homology was confirmed at 99%.
  • the genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template for sugR initiation codon alteration and B6 weakening promoter replacement derived from Corynebacterium glutamicum ATCC13869, and the Tables 1 and 2 above.
  • PCR using the primers described in amplified PCR fragments in the front and rear regions of the sugR gene initiation codon, respectively, and then electrophoresed to obtain the desired fragments.
  • the PCR reaction was repeated 30 times of denaturation at 95 °C, 30 seconds annealing at 55 °C and 30 seconds elongation process at 72 °C.
  • the resulting fragments were purified by electrophoresis on a 0.8% agarose gel and then eluting a band of the desired size.
  • the pDZ vector was treated with BamHI and SalI and fusion cloned the PCR product of the ATCC13032 strain. Fusion cloning was performed using an In-Fusion ® HD Cloning Kit (Clontech). In this process, plasmids pDZ-2'sugR (GTG), pDZ-2'sugR (TTG) and pDZ-2'sugR (B6) were prepared.
  • the plasmids pDZ-2'sugR (GTG), pDZ-2'sugR (TTG) and pDZ-2'sugR (B6) were transfected into Corynebacterium glutamicum DAB12-b in the same manner as in Example 1-1. Strains were selected to change sugR initiation codon alteration and / or conversion to the B6 attenuated promoter. Corynebacterium glutamicum mutants selected therefrom were named DAB12-b sugR (GTG), DAB12-b sugR (TTG) and DAB12-b sugR (B6).
  • the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template was used to amplify the gltA gene fragment using SEQ ID NOs: 50 and 51 primers (Table 4). At this time, the PCR reaction was repeated 30 times denaturation at 95 °C, 30 seconds annealing at 55 °C 30 and 30 seconds or 1 minute 30 seconds stretching process at 72 °C. This PCR result was electrophoresed on a 0.8% agarose gel and then purified by eluting a band of the desired size.
  • the prepared plasmid was introduced into KCCM11240P by electroporation to obtain a transformant, and the transformant was obtained by CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, Beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8), shake incubation (30 ° C., 8 hours), dilute sequentially from 10-4 to 10-10, and then X- The colonies were plated and cultured on gal containing solid medium.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, Beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • shake incubation (30 ° C., 8 hours
  • ATCC13869 base Putrescine From the production strain gltA Preparation of Fortified Strains
  • a gltA enriched strain was prepared for DAB12-b used in Example 1-2.
  • genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template and primers of SEQ ID NOs: 50 and 51 PCR was performed using the pairs.
  • PCR reaction was repeated 30 times of denaturation of 30 seconds at 95 °C, annealing of 30 seconds at 55 °C and elongation of 1 minute 30 seconds at 72 °C.
  • PCR product obtained therefrom was subjected to electrophoresis and sequence analysis.
  • the gene encoding gltA derived from Corynebacterium glutamicum ATCC13869 was confirmed to include the polynucleotide sequence represented by SEQ ID NO: 8. It was.
  • the sequence of the protein encoded therefrom was compared with the amino acid sequence of gltA derived from Corynebacterium glutamicum ATCC13032 (SEQ ID NO: 5). As a result, sequence homology was confirmed at 99%.
  • Gene fragments were amplified using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template to enhance gltA derived from Corynebacterium glutamicum ATCC13869 using SEQ ID NOs: 50 and 51 primers .
  • the PCR reaction was repeated 30 times denaturation at 95 °C, 30 seconds annealing at 55 °C 30 and 30 seconds or 1 minute 30 seconds stretching process at 72 °C.
  • This PCR result was electrophoresed on a 0.8% agarose gel and then purified by eluting a band of the desired size.
  • the plasmid pDZTn2'-gltA was transformed into Corynebacterium glutamicum DAB12-b in the same manner as in Example 2-1 to select a gltA-enhanced strain. Corynebacterium glutamicum mutants selected therefrom were named DAB12-b Tn: gltA.
  • Example 3 Putrescine production sugR Weakening and gltA Preparation of Enhanced Consolidated Strains and Their Production of Putrescine
  • the plasmid pDZTn1'-gltA was transformed into Corynebacterium glutamicum KCCM11240P sugR (GTG), KCCM11240P sugR (TTG) and KCCM11240P sugR (B6) in the same manner as in Example 2-1 to enhance gltA. Strains were prepared.
  • the prepared Corynebacterium glutamicum mutants were named KCCM11240P sugR (GTG) Tn :: gltA, KCCM11240P sugR (TTG) Tn :: gltA and KCCM11240P sugR (B6) Tn :: gltA, of which KCCM11240P sugR TTG) Tn :: gltA ( Corynebacterium glutamicum CC01-1147) was deposited with KCCM11615P on November 28, 2014.
  • the plasmid pDZTn2'-gltA was transfected to Corynebacterium glutamicum DAB12-b sugR (GTG), DAB12-b sugR (TTG) and DAB12-b sugR (B6) in the same manner as in Example 2-2. Conversion was made to strains with enhanced gltA.
  • Corynebacterium glutamicum mutants prepared above were named DAB12-b sugR (GTG) Tn :: gltA, DAB12-b sugR (TTG) Tn :: gltA and DAB12-b sugR (B6) Tn :: gltA. .
  • Example 4 Putrescine production sugR Weakening and gltA Reinforced integrated strains Putrescine student Performance evaluation
  • titer medium Glucose 8%, soy protein 0.25%, corn solid 0.50%, (NH 4 ) 2 SO 4 4%, KH 2 PO 4 0.1%, MgSO 4 7H 2 O 0.05%, urea 0.15%, biotin 100 g, thiamine hydrochloride 3 mg, calcium-pantothenic acid 3 mg, nicotinamide 3 mg, CaCO 3 5% 1 L
  • titer medium Glucose 8%, soy protein 0.25%, corn solid 0.50%, (NH 4 ) 2 SO 4 4%, KH 2 PO 4 0.1%, MgSO 4 7H 2 O 0.05%, urea 0.15%, biotin 100 g, thiamine hydrochloride 3 mg, calcium-pantothenic acid 3 mg, nicotinamide 3 mg, CaCO 3 5% 1 L
  • KCCM11240P 5.8 0.116 100 KCCM11240P sugR (TTG) 6.3 0.126 109 KCCM11240P sugR (GTG) 6.3 0.126 109 KCCM11240P sugR (B6) 6.0 0.120 103 KCCM11240P Tn :: gltA 6.2 0.124 107 KCCM11240P sugR (TTG) Tn :: gltA 6.8 0.136 117 KCCM11240P sugR (GTG) Tn :: gltA 6.5 0.130 112 KCCM11240P sugR (B6) Tn :: gltA 6.3 0.126 109 DAB12-b 6.5 0.129 100 DAB12-b sugR (TTG) 6.9 0.138 107 DAB12-b sugR (GTG) 6.8 0.136 105 DAB12-b sug
  • the Corynebacterium glutamicum mutant strain with weakened sugR or enhanced gltA increased 4 to 9% of putrescine productivity, and at the same time gltA was weakened with sugR weakened.
  • putrescine productivity increased by 10-13%.
  • Example 5 Putrescine Discharge capacity Increased Putrescine Production strain based sugR Preparation of attenuated and gltA enhanced integrated strain and its putrescine production capacity confirmed
  • KCCM11401P Korean Patent Publication No. 10-2014-0115244
  • a mutant strain was tested to confirm whether putrescine production ability is improved by attenuating sugR gene activity and enhancing gltA gene activity. Produced.
  • Corynebacterium glutamicum KCCM 11401P was transformed to convert sugR initiation codon into TTG to select strains with reduced sugR.
  • Corynebacterium glutamicum mutants selected therefrom were named KCCM11401P sugR (GTG), KCCM11401P sugR (TTG) and KCCM11401P sugR (B6).
  • the gltA gene was introduced into the transposon gene of the prepared sugR gene.
  • the vector pDZTn1'-gltA produced in Example 2-1 was used.
  • Example 2-1 the plasmid pDZTn1'-gltA prepared in Example 2-1 was used in the same manner as Example 2-1, and the Corynebacterium glutamicum mutant KCCM11401P sugR (GTG), KCCM11401P sugR (TTG) and KCCM11401P sugR ( B6) was transformed to select a strain enriched with gltA.
  • Corynebacterium glutamicum mutants selected therefrom were named mutants KCCM11401P sugR (GTG) Tn :: gltA, KCCM11401P sugR (TTG) Tn :: gltA and KCCM11401P sugR (B6) Tn :: gltA.
  • putrescine production capacity was tested in the Corynebacterium glutamicum mutant prepared in Example 5-1. Compared.
  • KCCM11401P 5.3 0.106 100 KCCM11401P sugR (TTG) 5.6 0.112 106 KCCM11401P sugR (GTG) 5.5 0.110 104 KCCM11401P sugR (B6) 5.4 0.108 102 KCCM11401P Tn :: gltA 5.6 0.112 106 KCCM11401P sugR (TTG) Tn :: gltA 6.1 0.122 115 KCCM11401P sugR (GTG) Tn :: gltA 5.9 0.118 111 KCCM11401P sugR (B6) Tn :: gltA 5.8 0.116 109
  • mutant strains were prepared using the vectors prepared in Example 1-1.
  • Plasmids pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) prepared in Example 1-1 were used as the parent strain of Corynebacterium glutamicum ATCC13032.
  • the prepared KCCM11137P (Korean Patent No. 10-1372635) was introduced by electroporation to obtain a transformant, and the transformant was kanamycin (25 ⁇ g / ml) and X-gal (5-bromo).
  • Colonies were formed by plating and incubating in BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, 2% agar) containing -4-chloro-3-indolin-D-galactoside. By selecting blue colonies from the colonies formed therefrom, strains into which the plasmids pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) were introduced were selected.
  • GTG pDZ-1'sugR
  • TTG pDZ-1'sugR
  • B6 pDZ-1'sugR
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • Shake culture (30 °C, 8 hours)
  • 10-4 to 10-10 plated and cultured in X-gal-containing solid medium to form colonies.
  • white colonies appearing in a relatively low proportion among the colonies formed the strains in which sugR initiation codons were changed to GTG or TTG and secondary promoters were replaced by B6 by secondary crossover.
  • the selected strains were subjected to PCR using primer pairs of SEQ ID NOs: 43 and 47 to confirm whether the initiation codon of sugR was changed to GTG or TTG, and the Kineccerium glutamicum mutants obtained from KCCM11137P sugR ( GTG), KCCM11137P sugR (TTG) and KCCM11137P sugR (B6).
  • a mutant strain was prepared by inserting the gltA gene into the chromosome of the ornithine producing strain using the vector prepared in Example 2-1. It was.
  • Example 2-1 the vector prepared in Example 2-1 was introduced into ornithine-producing strain KCCM11137P (Korean Patent No. 10-1372635) to obtain a transformant by electroporation, and the transformation was performed.
  • the sieve was shaken in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8). 30 ° C., 8 hours), diluted 10-4 to 10-10 sequentially, and then plated and cultured in X-gal-containing solid medium to form colonies.
  • CM medium glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8
  • gltA was used as a transposon gene. Introduced within. At this time, the vector pDZTn1'-gltA produced in Example 2-1 was used.
  • the plasmid pDZTn1'-gltA was transformed into Corynebacterium glutamicum KCCM11137P sugR (TTG) in the same manner as in Example 2-1 to select a gltA-enhanced strain.
  • Corynebacterium glutamicum mutants selected therefrom were named KCCM11137P sugR (GTG) Tn :: gltA, KCCM11137P sugR (TTG) Tn :: gltA and KCCM11137P sugR (B6) Tn :: gltA.
  • ornithine production was compared against the Corynebacterium glutamicum mutant strain prepared in Example 8-1. .
  • Corynebacterium glutamicum mutants ((KCCM11137P sugR (GTG), KCCM11137P sugR (TTG), KCCM11137P sugR (B6), KCCM11137P sugR (GTG), KCCM11137P sugR (GTG) Tn :: gg) KCCM11137P sugR (TTG) Tn :: gltA and KCCM11137P sugR (B6) Tn :: gltA) and one parent strain (KCCM11137P) were respectively added 1 mM arginine-containing CM flat media (glucose 1%, polypeptone 1%, yeast extract 0.5) %, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 l, agar 2%, pH 6.8, 1 L basis) and incubated for 24 hours at 30 °C.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 퓨트레신 또는 오르니틴을 생산하기 위한 재조합 미생물 및 이를 이용하여 퓨트레신 또는 오르니틴을 생산하는 방법에 관한 것이다. 구체적으로, 당대사 전사 조절자(transcriptional regulator of sugar metabolism, SugR)를 약화하거나 시트레이트 신타아제(citrate synthase, GltA)를 강화하거나 상기 모두 적용되도록 조작된 퓨트레신 또는 오르니틴을 생산하는 코리네박테리움 속 미생물 및 이를 이용하여 퓨트레신 또는 오르니틴을 생산하는 방법에 관한 것이다.

Description

퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
본 발명은 퓨트레신 또는 오르니틴을 생산하기 위한 재조합 미생물 및 이를 이용하여 퓨트레신 또는 오르니틴을 생산하는 방법에 관한 것이다.
퓨트레신은 그람 음성 박테리아나 곰팡이에서 발견되며 다양한 종에서 고농도로 존재하기 때문에 미생물의 대사에 중요한 역할을 수행할 것으로 예측되고 있다. 일반적으로, 퓨트레신은 폴리아민나일론-4,6을 합성하는 중요한 원료물질로서, 주로 화학 합성법으로 생산된다. 상기 화학 합성법은 촉매적 산화반응 단계, 시아나이드(cyanide) 화합물을 사용하는 단계와 고압 수소를 사용하는 수소화 반응 단계 등을 포함하는 3 단계 공정으로 이루어진다. 이에, 퓨트레신의 생산을 위해 보다 환경 친화적이고 에너지 소비를 절감할 수 있는 바이오매스를 활용한 방법이 요구되고 있다.
이러한 배경 하에, 미생물을 이용해 퓨트레신을 생산하는 방법으로는 대장균과 코리네박테리움 속 미생물을 형질전환하여 퓨트레신을 고농도로 생산하는 방법이 공개되었다(국제특허공개 WO06/005603; 국제특허공개 WO09/125924; Qian ZD et al., Biotechnol. Bioeng. 104(4): 651-662, 2009; Schneider et al., Appl. Microbiol. Biotechnol. 88(4): 859-868, 2010; Schneider et al., Appl. Microbiol. Biotechnol. 95: 169-178., 2012).
오르니틴(ornithine)은 식물, 동물, 미생물에서 널리 발견되는 물질로 아르기닌, 프롤린 및 폴리아민의 생합성에 사용되는 전구체이다. 또한, 고등동물의 생체 내 대사에서 오르니틴 회로를 통해 아미노산 또는 암모니아로부터 요소를 생성하여 체외로 배출하는 경로에서 중요한 역할을 한다. 오르니틴은 산업적으로 영양보충제나 간경화와 간기능 장애를 개선하는 의약품으로도 이용되고 있다. 이러한 오르니틴을 생산하는 방법으로는 우유 카제인(casein)을 소화 효소로 처리하는 방법 및 형질전환된 대장균 또는 코리네박테리움 속 미생물을 이용한 방법이 알려져 있다 (대한민국 등록번호 제10-1372635호; T. Gotoh et al., Bioprocess Biosyst. Eng., 33:773-777, 2010).
한편, 당대사 전사 조절자(transcriptional regulator of sugar metabolism)인 SugR은 코리네박테리움에서 전사 조절자로 알려져 있으며, PTS 시스템의 PEP-단백질 포스포트랜스퍼라아제(PEP-protein phosphotransferase of PTS system)를 코딩하는 유전자 및 당 해당과정(glycolysis)에 관련된 유전자를 저해한다는 보고가 있다(VF Wendisch, et al., J.Bacteriol.190: 24, 8033-8044, 2008). 시트레이트 신타아제는 TCA 회로에 첫번째로 작용하며, TCA 회로 속도를 조절할 수 있는 효소이다. 코리네박테리움에서 GltA 활성이 감소된 변이주의 경우 aspartate와 lysine 생산이 증가한다는 보고가 있다(Shiio et al., Agric Biol Chem. 46; 101-107, 1982).
본 발명자들은 당대사 전사 조절자(transcriptional regulator of sugar metabolism)를 코딩하는 유전자 sugR 및 시트레이트 신타아제(citrate synthase)를 코딩하는 유전자 gltA를 조작하였을 때, 퓨트레신 또는 오르니틴 샌상능이 향상되는 것을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 퓨트레신 또는 오르니틴을 고수율로 생산할 수 있는 재조합 미생물을 제공하는 것이다.
본 발명의 다른 목적은 상기 미생물을 이용하여 퓨트레신 또는 오르니틴을 생산하는 방법을 제공하는 것이다.
본 발명의 퓨트레신 또는 오르니틴을 생산하는 코리네박테리움 속 미생물에 당대사 전사 조절자(transcriptional regulator of sugar metabolism, SugR)를 약화함과 동시에 시트레이트 신타아제(citrate synthase, GltA)를 강화하는 것을 통해 퓨트레신 및 오르니틴의 생산량이 증가함을 확인하였다. 이에 따라 본 발명의 미생물은 퓨트레신 또는 오르니틴을 산업적으로 생산하는데 널리 활용될 수 있으며, 이들이 원료로 사용되는 여러 고분자 제품 생산에도 경제적인 측면 및 환경적인 측면에서 효과적이고 바람직한 원료 제공 수단으로 널리 활용될 수 있다.
본 발명의 일 양태는 i) 당대사 전사 조절자(transcriptional regulator of sugar metabolism, SugR) 활성이 내재적 활성에 비해 약화되거나, ii) 시트레이트 신타아제(citrate synthase, GltA) 활성이 내재적 활성에 비해 강화되거나, 또는 iii) 당대사 전사 조절자 활성이 내재적 활성에 비해 약화되고 시트레이트 신타아제 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 하나의 구체예는 상기 코리네박테리움 속 미생물은 당대사 전사 조절자 활성이 내재적 활성에 비해 약화되고 시트레이트 신타아제 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 다른 하나의 구체예는 상기 당대사 전사 조절자는 서열번호 1 또는 서열번호 3의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 시트레이트 신타아제는 서열번호 5 또는 서열번호 7의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 써모아미노게네스(Corynebacterium thermoaminogenes), 브레비박테리움 플라붐(Brevibacterium flavum) 및 브레비박테리움 락토페르멘툼(Brevibacterium lactofermentum)으로 이루어진 군으로부터 선택되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 오르니틴 디카복실라제(ornithine decarboxylase, ODC)의 활성이 도입되도록 변이된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 오르니틴 디카복실라제는 서열번호 17의 아미노산 서열로 구성되는, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 i) 오르니틴 카르바모일 트랜스퍼라아제(ArgF), ii) 글루타메이트 엑스포터 또는 iii) 오르니틴 카르바모일 트랜스퍼라아제 및 글루타메이트 엑스포터의 활성이 내재적 활성에 비해 약화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 오르니틴 카르바모일 트랜스퍼라아제는 서열번호 9 또는 서열번호 11의 아미노산 서열로 구성되고, 상기 글루타메이트 엑스포터는 서열번호 13 또는 서열번호 15의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제(ArgJ), 아세틸 글루타메이트 키나아제(ArgB), 및 아세틸 오르니틴 아미노 트랜스퍼라아제(ArgD)로 구성되는 군으로부터 선택되는 1종 이상의 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 아세틸 감마 글루타밀 포스페이트 리덕타아제는 서열번호 19 또는 서열번호 21의 아미노산 서열로 구성되고, 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제는 서열번호 23 또는 서열번호 25의 아미노산 서열로 구성되며, 아세틸 글루타메이트 키나아제는 서열번호 27 또는 서열번호 29의 아미노산 서열로 구성되고, 아세틸 오르니틴 아미노 트랜스퍼라아제는 서열번호 31 또는 서열번호 33의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 아세틸트랜스퍼라아제의 활성이 내재적 활성보다 약화되도록 변이된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 아세틸트랜스퍼라아제가 서열번호 35 또는 서열번호 37의 아미노산 서열로 구성되는, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 또 다른 하나의 구체예는 상기 코리네박테리움 속 미생물은 추가적으로 서열번호 39 또는 서열번호 41의 아미노산 서열로 구성되는 단백질의 활성이 내재적 활성보다 강화되도록 변이된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물을 제공한다.
본 발명의 다른 양태는
(i) 상기 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
(ii) 상기 (i) 단계에서 배양된 미생물 또는 배지로부터 퓨트레신 또는 오르니틴을 분리하는 단계를 포함하는, 퓨트레신 또는 오르니틴 생산 방법을 제공한다.
본 발명의 하나의 구체예는 상기 코리네박테리움 속 미생물이 코리네박테리움 글루타미쿰인, 퓨트레신 또는 오르니틴의 생산방법을 제공한다.
이하, 본 발명을 상세히 설명한다.
본 발명의 일 양태는 i) 당대사 전사 조절자(transcriptional regulator of sugar metabolism, SugR) 활성이 내재적 활성에 비해 약화되거나, ii) 시트레이트 신타아제(citrate synthase, GltA) 활성이 내재적 활성에 비해 강화되거나, 또는 iii) 당대사 전사 조절자 활성이 내재적 활성에 비해 약화되고 시트레이트 신타아제 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물에 대한 것이다. 구체적으로, 당대사 전사 조절자 활성이 내재적 활성에 비해 약화되고 시트레이트 신타아제 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물에 대한 것이다.
본 발명에서 사용되는 용어 "당대사 전사 조절자(transcriptional regulator of sugar metabolism, SugR)"는 당 유입(sugar uptake)과 포스포트랜스퍼라제 시스템, 당분해(glycolysis) 및 젖산 탈수소 효소 관련 발효 등 다양한 당 대사에 관련된 유전자에 대해 폭넓게 억제자 기능을 하는 효소이다. 본 발명에서 당대사 전사 조절자는 코리네박테리움 속 미생물 내 내재 단백질 또는 외래 단백질을 모두 포함하며, 구체적으로 코리네박테리움 속 미생물 유래 SugR일 수 있다.
본 발명에서 당대사 전사 조절자는 서열번호 1 또는 서열번호 3의 아미노산 서열을 포함하는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 당대사 전사 조절자의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 미생물의 종 또는 균주에 따라 상기 활성을 나타내는 단백질의 아미노산 서열에 차이가 존재하는 경우가 있기 때문에, 본 발명에서 당대사 전사 조절자는 유래에 한정되지 않으나 예를 들어, 코리네박테리움 속 미생물 유래, 구체적으로 코리네박테리움 글루타미쿰 유래일 수 있다. 상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 1 또는 서열번호 3의 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 발명의 범주에 포함됨은 자명하다.
본 발명의 당대사 전사 조절자를 코딩하는 폴리뉴클레오티드는 상기 당대사 전사 조절자 단백질과 유사한 활성을 가지는 한, 서열번호 1 또는 서열번호 3의 아미노산 서열 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 단백질을 코딩하는 폴리뉴클레오티드를 포함할 수 있다. 상기 당대사 전사 조절자를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 조절자를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있으며, 구체적으로는 서열번호 2 또는 서열번호 4의 폴리뉴클레오티드 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 사용되는 용어 "시트레이트 신타아제(citrate synthase, GltA)"는 다양한 세포 내 생합성 중간체 생성과 환원된 퓨린 핵산의 생성에 관여하는 효소이다. 아세틸-CoA와 옥살로아세테이트의 가수 축합 반응을 매개하여 시트레이트를 생성하는데 작용하는 것으로 알려져 있다. 본 발명에서 시트레이트 신타아제는 코리네박테리움 속 미생물 내 내재 단백질 또는 외래 단백질을 모두 포함하며, 구체적으로는 코리네박테리움 속 미생물 유래 GltA일 수 있다.
본 발명에서 시트레이트 신타아제는 서열번호 5 또는 서열번호 7의 아미노산 서열을 포함하는 단백질, 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세틸-CoA와 옥살로아세테이트의 가수 축합 반응을 매개하여 시트레이트를 생성하는 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 미생물의 종 또는 균주에 따라 상기 활성을 나타내는 단백질의 아미노산 서열에 차이가 존재하는 경우가 있기 때문에, 본 발명에서 시트레이트 신타아제는 유래에 한정되지 않으나 예를 들어, 코리네박테리움 속 미생물 유래, 구체적으로는 코리네박테리움 글루타미쿰 유래일 수 있다. 상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 5 또는 서열번호 7의 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 발명의 범주에 포함됨은 자명하다.
본 발명의 시트레이트 신타아제를 코딩하는 폴리뉴클레오티드는 상기 시트레이트 신타아제 단백질과 유사한 활성을 가지는 한, 서열번호 5 또는 서열번호 7의 아미노산 서열 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 단백질을 코딩하는 폴리뉴클레오티드를 포함할 수 있다. 상기 시트레이트 신타아제를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 조절자를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있으며, 구체적으로는 서열번호 6 또는 서열번호 8의 폴리뉴클레오티드 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다.
상기에서 용어 "상동성"은 주어진 아미노산 서열 또는 폴리뉴클레오티드 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 아미노산 서열 또는 폴리뉴클레오티드 서열과 동일하거나 유사한 활성을 갖는 그의 상동성 서열이 "% 상동성"으로 표시된다. 예를 들면, 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)들을 계산하는 표준 소프트웨어, 구체적으로 BLAST 2.0을 이용하거나, 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
또한, 본 발명의 당대사 전사 조절자와 시트레이트 신타아제를 코딩하는 폴리뉴클레오티드는 각각 서열번호 2 또는 4와 서열번호 6 또는 8의 폴리뉴클레오티드 서열 또는 상기 폴리뉴클레오티드 서열로부터 유래된 프로브(probe)와 엄격한 조건(stringent conditions)에서 혼성화될 수 있고, 정상적으로 기능하는 당대사 전사 조절자와 시트레이트 신타아제를 코딩하는 변이형일 수 있다. 상기에서 용어 "엄격한 조건"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 예를 들어, 이러한 엄격한 조건은 문헌(예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다.
본 발명에서는 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물에 당대사 전사 조절자 SugR의 활성을 약화시키거나, 시트레이트 신타아제 GltA의 활성을 강화하거나, 상기 SugR 활성 약화와 GltA 활성 강화를 동시에 적용하였으며, 그 결과, 모든 변이균주에서 퓨트레신 또는 오르니틴 생산량이 향상되는 것을 확인하였다.
한편, 본 발명의 미생물은 퓨트레신 또는 오르니틴을 생산할 수 있으면 천연형 또는 변이형 미생물을 모두 포함할 수 있다. 예로는 에스케리치아 속(Escherichia sp.), 시겔라 속(Shigella sp.), 시트로박터 속(Citrobacter sp.), 살모넬라 속(Salmonella sp.), 엔테로박터 속(Enterobacter sp.) 여시니아 속(Yersinia sp.), 크렙시엘라 속(Klebsiella sp.), 어위니아 속(Erwinia sp.), 코리네박테리움 속(Corynebacterium sp.), 브레비박테리움 속(Brevibacterium sp.), 락토바실러스 속(Lactobacillus sp.), 셀레노모나스 속(Selenomanas sp.), 비브리오 속(Vibrio sp.), 슈도모나스 속(Pseudomonas sp.), 스트렙토마이시스 속(Streptomyces sp.), 아카노박테리아 속(Arcanobacterium sp.), 알칼리젠 속(Alcaligenes sp) 등에 속하는 미생물일 수 있다. 구체적으로 본 발명의 미생물은 코리네박테리움 속에 속하는 미생물일 수 있으며, 더욱 구체적으로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 써모아미노게네스(Corynebacterium thermoaminogenes), 브레비박테리움 플라붐(Brevibacterium flavum) 및 브레비박테리움 락토페르멘툼(Brevibacterium lactofermentum)으로 이루어진 군으로부터 선택되는 것일 수 있고, 더욱 더 구체적으로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있으나, 이에 한정되지 않는다.
특히, 본 발명의 용어 "퓨트레신 또는 오르니틴 생산능을 가지는"은 퓨트레신 또는 오르니틴의 생산능이 천연적으로 있거나, 퓨트레신 또는 오르니틴의 생산능이 없는 모균주에 퓨트레신 또는 오르니틴의 생산능이 부여된 미생물을 의미한다.
또한, 상기 퓨트레신 또는 오르니틴 생산능을 가지는 미생물은 오르니틴에서 아르기닌 합성에 관여하는 오르니틴 카르바모일 트랜스퍼라아제(ornithine carbamoyltransfrase, ArgF) 및/또는 글루타메이트의 배출에 관여하는 단백질인 글루타메이트 엑스포터(NCgl1221)의 활성을 내재적 활성에 비하여 약화시키도록 변이된 것일 수 있다.
아울러, 상기 퓨트레신 생산능을 가지는 미생물은 퓨트레신을 아세틸화시키는 단백질인 아세틸트랜스퍼라제(NCgl1469)의 활성을 내재적 활성에 비하여 약화시키도록 변이되고/되거나, 오르니틴을 퓨트레신으로 전환시키는 단백질인 오르니틴 디카르복실라아제(ornithine decarboxylase, ODC)의 활성을 도입하도록 변형된 것일 수 있다.
한편, 본 발명에서 활성이 도입되거나 활성이 강화되거나 활성이 약화되는 등의 변이는 형질전환이라는 과정을 통해서 일어날 수 있다. 본 발명에서 용어 "형질전환"은 특정 단백질을 코딩하는 폴리뉴클레오티드나 활성이 강하거나 약한 프로모터 서열 등을 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하거나 숙주세포의 염색체의 변이를 유도하는 것을 의미한다.
또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현 또는 변이를 유도할 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 발명의 특정 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 발명에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드 서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 발명에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 본 발명에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다. 구체적으로는 pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
이처럼 세균 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 본 발명의 벡터는 상동재조합을 일으켜서 염색체 내로 삽입될 수 있으므로 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 폴리뉴클레오티드의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택 가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 발명의 용어 "활성이 강화"되는 것은 단백질 자체의 활성이 새로 도입되거나 증대되어 본래 기능 이상의 효과를 도출하는 것을 포함할 뿐만 아니라, 내재적 유전자 활성의 증가, 내부 또는 외부 요인으로부터 내재적 유전자 증폭, 상기 유전자 발현의 억제 조절 인자의 결실, 유전자 카피수 증가, 외부로부터의 유전자 도입, 발현조절 서열의 변형, 특히 프로모터 교체 또는 변형 및 유전자내 돌연변이에 의한 효소 활성의 증가 등에 의해 그 활성이 증가되는 것을 포함한다.
구체적으로, 본 발명에서 활성 강화 또는 증가는,
1) 상기 효소를 암호화하는 폴리뉴클레오티드의 카피수 증가,
2) 상기 폴리뉴클레오티드의 발현이 증가하도록 발현조절 서열의 변형,
3) 상기 효소의 활성이 강화되도록 염색체 상의 폴리뉴클레오티드 서열의 변형, 또는
4) 이의 조합에 의해 강화되도록 변형하는 방법 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 1) 폴리뉴클레오티드의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 본 발명의 효소를 암호화하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있거나, 상기 폴리뉴클레오티드가 작동가능 하게 연결된, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 상기 숙주세포의 염색체 내 상기 폴리뉴클레오티드의 카피수를 증가하는 방법으로 수행될 수 있다.
다음으로, 2) 폴리뉴클레오티드의 발현이 증가하도록 발현조절 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 발현조절 서열의 활성을 더욱 강화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다. 상기 발현조절 서열은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 이종 프로모터가 연결될 수 있는데, 상기 강력한 프로모터의 예로는 CJ7 프로모터, lysCP1 프로모터, EF-Tu 프로모터, groEL 프로모터, aceA 혹은 aceB 프로모터 등이 있으며, 더욱 구체적으로는 코리네박테리움 유래 프로모터인 lysCP1 프로모터(WO2009/096689) 혹은 CJ7 프로모터(대한민국 등록특허 제0620092호 및 WO2006/065095)와 작동가능하게 연결되어 상기 효소를 코딩하는 폴리뉴클레오티드의 발현율을 향상시킬 수 있으나, 이에 한정되지 않는다.
아울러, 3) 염색체 상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
본 발명의 용어 "활성이 약화"는, 활성을 약화시키고자 하는 단백질을 코딩하는 폴리뉴클레오티드의 일부 또는 전체의 결실, 상기 폴리뉴클레오티드의 발현이 감소하도록 발현 조절서열의 변형, 상기 단백질의 활성이 약화되도록 염색체상의 상기 폴리뉴클레오티드 서열의 변형, 및 이들의 조합으로부터 선택된 방법에 의해 달성될 수 있다.
구체적으로, 본 발명에서 활성 약화는,
1) 상기 단백질을 코딩하는 폴리뉴클레오티드의 일부 또는 전체의 결실,
2) 상기 폴리뉴클레오티드의 발현이 감소하도록 발현 조절서열의 변형,
3) 상기 단백질의 활성이 약화되도록 염색체 상의 상기 폴리뉴클레오티드 서열의 변형, 및
4) 이들의 조합으로부터 선택된 방법에 의해 달성될 수 있으며, 이에 한정되지 않는다.
구체적으로, 단백질을 암호화하는 폴리뉴클레오티드의 일부 또는 전체를 결실하는 방법은, 세균 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 폴리뉴클레오티드를 일부 폴리뉴클레오티드 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 상기 "일부"란 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 구체적으로는 1 내지 100개, 더욱 구체적으로는 1 내지 50개이다.
또한, 발현 조절서열을 변형하는 방법은 상기 발현 조절서열의 활성을 더욱 약화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절서열 상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 폴리뉴클레오티드 서열로 교체함으로써 수행할 수 있다. 상기 발현 조절서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함한다.
아울러, 염색체상의 폴리뉴클레오티드 서열을 변형하는 방법은 상기 효소의 활성을 더욱 약화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함으로써 수행할 수 있다.
뿐만 아니라, 상기 효소의 폴리뉴클레오티드의 발현을 억제하는 조절인자를 결실하는 방법은 발현 억제 인자의 폴리뉴클레오티드를 일부 폴리뉴클레오티드 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 상기 "일부"란 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 구체적으로는 1 내지 100개, 더욱 구체적으로는 1 내지 50개이다.
본 발명에서 사용되는 용어 "내재적 활성"이란, 본래 미생물이 변형되지 않은 상태, 예를 들어 천연 상태 등에서 가지고 있는 효소의 활성 상태를 의미하고, "내재적 활성에 비해 강화"되었다는 것은, 활성을 나타내는 유전자가 도입되거나 또는 당해 유전자의 카피수 증가, 상기 유전자 발현의 억제 조절 인자의 결실 또는 발현조절서열의 변형, 예를 들어 개량된 프로모터의 사용 등과 같은 조작이 이루어지기 전의 미생물이 가지는 활성에 비하여 조작이 이루어진 이후의 미생물이 가지고 있는 활성이 증가된 상태를 의미한다.
본 발명의 코리네박테리움 속 미생물은 추가적으로 오르니틴 디카복실라제(ornithine decarboxylase, ODC)의 활성이 도입되는 것인, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명에서 "오르니틴 디카복실라제"는 오르니틴의 디카복실화(decarboxylation)를 매개하여 퓨트레신을 생산하는 효소를 의미한다. 코리네박테리움 속 미생물에는 퓨트레신 생합성 경로가 없지만 외부로부터 오르니틴 디카르복실라아제(ornithine decarboxylase, ODC)를 도입하면 퓨트레신이 합성되면서 세포 외로 퓨트레신이 배출된다. 본 발명에서 상기 오르니틴 디카복실라제는 서열번호 17의 아미노산 서열로 구성되는 것일 수 있으며, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 오르니틴 디카복실라제의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 미생물의 종 또는 균주에 따라 상기 활성을 나타내는 단백질의 아미노산 서열에 차이가 존재하는 경우가 있기 때문에, 본 발명에서 오르니틴 디카복실라제는 유래에 한정되지 않으며, 구체적으로 대장균 유래 오르니틴 디카복실라제일 수 있다. 상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 17의 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 발명의 범주에 포함됨은 자명하다.
본 발명의 오르니틴 디카복실라제를 코딩하는 폴리뉴클레오티드는 상기 오르니틴 디카복실라제 단백질과 유사한 활성을 가지는 한, 서열번호 17의 아미노산 서열 또는 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 단백질을 코딩하는 폴리뉴클레오티드를 포함할 수 있다. 상기 오르니틴 디카복실라제를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 조절자를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있다.
본 발명의 코리네박테리움 속 미생물은 추가적으로 i) 오르니틴 카르바모일 트랜스퍼라아제(ArgF), ii) 글루타메이트 엑스포터(NCgl1221) 또는 iii) 오르니틴 카르바모일 트랜스퍼라아제 및 글루타메이트 엑스포터의 활성이 내재적 활성에 비해 약화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명에서 오르니틴 카르바모일 트랜스퍼라아제는 서열번호 9 또는 서열번호 11의 아미노산 서열로 구성되는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 오르니틴 카르바모일 트랜스퍼라아제의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 본 발명에서 글루타메이트 엑스포터는 서열번호 13 또는 15의 아미노산 서열로 구성되는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 글루타메이트 엑스포터의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 본 발명의 코리네박테리움 속 미생물은 추가적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제(ArgJ), 아세틸 글루타메이트 키나아제(ArgB), 및 아세틸 오르니틴 아미노 트랜스퍼라아제(ArgD)로 구성되는 군으로부터 선택되는 1종 이상의 활성이 내재적 활성에 비해 강화된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명에서 아세틸 감마 글루타밀 포스페이트 리덕타아제는 서열번호 19 또는 서열번호 21의 아미노산 서열로 구성되는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또한, 본 발명에서 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제는 서열번호 23 또는 서열번호 25의 아미노산 서열로 구성되는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
본 발명에서 아세틸 글루타메이트 키나아제는 서열번호 27 또는 서열번호 29의 아미노산 서열로 구성되는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세틸 글루타메이트 키나아제의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
아울러, 본 발명에서 아세틸 오르니틴 아미노 트랜스퍼라아제는 서열번호 31 또는 서열번호 33의 아미노산 서열로 구성되는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세틸 오르니틴 아미노 트랜스퍼라아제의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
아울러, 본 발명의 코리네박테리움 속 미생물은 추가적으로 아세틸트랜스퍼라아제(NCgl1469)의 활성이 내재적 활성보다 약화된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명에서 아세틸트랜스퍼라아제는 퓨트레신에 아세틸기를 전달하는 역할을 하는 단백질이면 제한없이 포함될 수 있다. 상기 아세틸트랜스퍼라제는 서열번호 35 또는 서열번호 37의 아미노산 서열로 구성되는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 아세틸트랜스퍼라아제의 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
마지막으로, 본 발명의 코리네박테리움 속 미생물은 추가적으로 NCgl2522의 활성이 내재적 활성보다 강화된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물일 수 있다.
본 발명에서 NCgl2522는 퓨트레신을 배출하는 기능을 하는 단백질로, 서열번호 39 또는 서열번호 41의 아미노산 서열로 구성되는 단백질, 또는 상기 서열과 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더욱더 구체적으로는 98% 이상, 가장 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 동일한 활성을 가지는 단백질이라면 제한없이 포함될 수 있다.
또 하나의 양태로서, 본 발명은
(i) 상기 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
(ii) 상기 (i) 단계에서 배양된 미생물 또는 배지로부터 퓨트레신 또는 오르니틴을 분리하는 단계를 포함하는, 퓨트레신 또는 오르니틴 생산 방법을 제공한다.
본 발명에서 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰일 수 있다.
상기 본 발명의 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물은 앞서 설명한 바와 같다.
상기 방법에 있어서, 상기 미생물을 배양하는 단계는, 특별히 이에 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물(예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물(예: 인산 또는 황산)을 사용하여 적정 pH(예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8, 가장 구체적으로는 pH 6.8)를 조절할 수 있고, 산소 또는 산소-함유 가스 혼합물을 배양물에 도입시켜 호기성 조건을 유지할 수 있으며, 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160시간 동안 배양할 수 있다. 상기 배양에 의하여 생산된 퓨트레신 또는 오르니틴은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
아울러, 사용되는 배양용 배지에서 탄소 공급원으로는 당 및 탄수화물(예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방(예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산(예: 팔미트산, 스테아르산 및 리놀레산), 알코올(예: 글리세롤 및 에탄올) 및 유기산(예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나 이에 제한되지 않는다. 질소 공급원으로는 질소-함유 유기 화합물(예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 또는 무기 화합물(예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나 이에 제한되지 않는다. 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나 이에 제한되지 않는다. 또한, 기타 금속염(예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 포함할 수 있다.
본 발명의 상기 배양 단계에서 생산된 퓨트레신 또는 오르니틴을 회수하는 방법은 배양방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 물질을 수집할 수 있다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 퓨트레신 생산 균주에서 sugR 약화 균주의 제작
본 발명자들은 퓨트레신 생산 균주에서 당대사 전사 조절자(transcriptional regulator of sugar metabolism)를 코딩하는 유전자 sugR의 약화가 퓨트레신 생산에 미치는 영향을 확인하였다.
1-1. ATCC13032 기반 퓨트레신 생산 균주의 sugR 유전자 약화 균주의 제작
코리네박테리움 글루타미쿰 ATCC13032 기반의 퓨트레신 생산 균주인 KCCM11240P(대한민국 공개특허 제10-2013-0082478호)에서 당대사 전사 조절자 유전자의 약화가 퓨트레신 생산능에 연관되는지를 확인하기 위해, sugR 약화 균주를 제작하였다. 구체적으로, sugR 유전자 약화 균주는 sugR 유전자의 개시 코돈을 변경하고, 프로모터를 B6 약화 프로모터 (Patek M (2005) Regulation of gene expression. In: Eggeling L, Bott M (eds) Handbook of Corynebacterium glutamicum. CRC, BocaRaton)로 교체하는 방법으로 제작하였다.
먼저, sugR 개시 코돈의 변경을 위한 벡터를 제조하였다. 상기 SugR을 코딩하는 유전자의 서열번호 2로 기재되는 폴리뉴클레오티드 서열 근처를 대상으로 sugR 개시 코돈의 앞쪽 상동재조합 단편을 얻기 위한 서열번호 43 및 44의 프라이머 쌍과 sugR 개시 코돈의 뒤쪽 상동재조합 단편을 얻기 위한 서열번호 45 또는 46 및 47의 프라이머 쌍을 제작하였다. 상기 개시 코돈 변경에 사용된 프라이머는 하기 표 1에 정리하였다.
프라이머 서열 5' -> 3'
sugR F1_SalI (서열번호: 43) CTTGCATGCCTGCAGGTCGACAGGATTCATCTGGCATCTGGC
sugR-R1 (서열번호: 44) GTCACTCCTTAAAGCAAAAAGCC
sugR-F2_GTG (서열번호: 45) TTTTTGCTTTAAGGAGTGACGTGTACGCAGAGGAGCGCCGTC
sugR -F2_TTG (서열번호: 46) TTTTTGCTTTAAGGAGTGACTTGTACGCAGAGGAGCGCCGTC
sugR-R2_BamHI (서열번호: 47) CGAGCTCGGTACCCGGGGATCCGCGAGAGTACGAAGCGCAGT
코리네박테리움 글루타미쿰 ATCC13032의 게놈 DNA를 주형으로 하고, 2쌍의 프라이머 각각을 이용한 PCR을 수행하여 sugR 유전자 개시 코돈의 앞쪽과 뒤쪽 부위의 PCR 단편을 각각 증폭한 후, 이를 전기영동하여 목적하는 단편을 수득하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초의 신장 과정을 30회 반복하였다. 이로부터 수득된 단편을 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
pDZ 벡터(대한민국 등록특허 제10-0924065호)는 BamHI 및 SalI을 처리하고 ATCC13032 균주의 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD Cloning Kit(Clontech)를 사용하였다. 이러한 과정으로 플라스미드 pDZ-1'sugR(GTG) 및 pDZ-1'sugR(TTG)를 제작하였다.
B6 약화 프로모터로의 교체를 위한 벡터의 경우, 벡터 제작을 위한 서열번호 48을 하기 표 2와 같이 제작하였다.
프라이머 서열 5' -> 3'
sugR F3(서열번호: 48) TTTTTGCTTTAAGGAGTGACGAAGGCAACCATGAACTCTAATGTACGCAGAGGAGCGCCGTC
상기 SugR을 코딩하는 유전자의 서열번호 2로 기재되는 폴리뉴클레오티드 서열 근처를 대상으로 sugR 개시 코돈의 앞쪽 상동재조합 단편을 얻기 위한 서열번호 43 및 44의 프라이머 쌍과, sugR 개시 코돈의 뒤쪽 상동재조합 단편을 얻기 위한 서열번호 48및 47의 프라이머 쌍을 이용하여 PCR을 수행하고 sugR 유전자 개시 코돈의 앞쪽과 뒤쪽 부위의 PCR 단편을 각각 증폭한 후, 이를 전기영동하여 목적하는 단편을 수득하였다. 이로부터 수득된 단편을 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다. pDZ 벡터는 BamHI 및 SalI을 처리하고 ATCC13032 균주의 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD Cloning Kit(Clontech)를 사용하였다. 이러한 과정으로 플라스미드 pDZ-1'sugR(B6)를 제작하였다.
상기 플라스미드 pDZ-1'sugR(GTG), pDZ-1'sugR(TTG) 및 pDZ-1'sugR(B6)를 퓨트레신 생산 코리네박테리움속 미생물 KCCM11240P (대한민국 공개특허 제10-2013-0082478호)에 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin--D-galactoside)이 함유된 BHIS 평판 배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZ-1'sugR(GTG), pDZ-1'sugR(TTG) 및 pDZ-1'sugR(B6)가 도입된 균주를 선발하였다.
상기 선발된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체 배지에 도말하고 배양하여 콜로니를 형성시켰다.
형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 sugR의 개시코돈이 GTG 혹은 TTG로 변경된 균주 및 프로모터가 B6로 교체된 균주를 최종 선발하였다. 최종 선발된 균주를 대상으로 서열번호 43 및 47의 프라이머 쌍을 이용해 PCR을 수행하여 sugR의 개시코돈이 GTG 혹은 TTG로 변경되거나 B6 약화 프로모터로 전환된 것을 확인하고, 상기 코리네박테리움 글루타미쿰 변이주를 KCCM11240P sugR(GTG), KCCM11240P sugR(TTG), KCCM11240P sugR(B6)로 명명하였다.
1-2. ATCC13869 기반 퓨트레신 생산 균주의 sugR 유전자 약화 균주의 제작
코리네박테리움 글루타미쿰 ATCC13869 기반의 퓨트레신 생산 균주인 DAB12-a ΔNCgl1469 (대한민국 공개특허 제10-2014-0115244호)를 DAB12-b라 명명하고, 해당 균주를 바탕으로 sugR 약화 균주를 제작하였다.
구체적으로, 코리네박테리움 글루타미쿰 ATCC13869 유래 SugR을 코딩하는 유전자 및 그로부터 발현되는 단백질 서열을 확인하기 위해, 코리네박테리움 글루타미쿰 ATCC13869의 게놈 DNA를 주형으로 하고 서열번호 43 및 서열번호 49의 프라이머 쌍을 이용하여 PCR을 수행하였다.
프라이머 서열 5' -> 3'
sugR R(서열번호: 49) GGACTTGCAGTGACTGTAAGAA
이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 1분 30초의 신장 과정을 30회 반복하였다.
이로부터 수득된 PCR 산물을 전기영동으로 분리한 후 서열분석을 수행한 결과, 코리네박테리움 글루타미쿰 ATCC13869 유래의 SugR을 코딩하는 유전자는 서열번호 4로 기재되는 폴리뉴클레오티드 서열을 포함하는 것을 확인하였다. 이로부터 코딩되는 단백질의 서열과 코리네박테리움 글루타미쿰 ATCC13032 유래의 SugR의 아미노산 서열(서열번호 1)을 비교한 결과, 서열 상동성이 99%에 이름을 확인하였다.
코리네박테리움 글루타미쿰 ATCC13869 유래 sugR 개시 코돈 변경 및 B6 약화 프로모터 교체를 위해 상기 실시예 1-1에서와 같이 코리네박테리움 글루타미쿰 ATCC13869의 게놈 DNA를 주형으로 하고, 상기 표 1 및 2에 기재된 프라이머를 이용한 PCR을 수행하여 sugR 유전자 개시 코돈의 앞쪽과 뒤쪽 부위의 PCR 단편을 각각 증폭한 후, 이를 전기영동하여 목적하는 단편을 수득하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초의 신장 과정을 30회 반복하였다. 이로부터 수득된 단편을 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
pDZ 벡터는 BamHI 및 SalI을 처리하고 ATCC13032 균주의 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD Cloning Kit(Clontech)를 사용하였다. 이러한 과정으로 플라스미드 pDZ-2'sugR(GTG), pDZ-2'sugR(TTG) 및 pDZ-2'sugR(B6)를 제작하였다.
상기 플라스미드 pDZ-2'sugR(GTG), pDZ-2'sugR(TTG) 및 pDZ-2'sugR(B6)를 실시예 1-1과 동일한 방법으로 코리네박테리움 글루타미쿰 DAB12-b 에 형질전환하여 sugR 개시 코돈 변경 및 되거나 B6 약화 프로모터로 전환된 균주를 선발하였다. 이로부터 선발된 코리네박테리움 글루타미쿰 변이주를 DAB12-b sugR(GTG), DAB12-b sugR(TTG) 및 DAB12-b sugR(B6)로 명명하였다.
실시예 2: 퓨트레신 생산 균주에서 gltA 강화 균주의 제작
퓨트레신 생산 균주에서 시트레이트 신타아제(citrate synthase)인 gltA 활성 강화가 퓨트레신 생산에 미치는 영향을 확인하기 위해, 퓨트레신 생산 균주의 염색체 내 트랜스포존 유전자 내에 gltA 유전자를 도입한 변이균주를 제조하였다. 코리네박테리움 속 미생물의 트랜스포존 유전자 부위를 이용하여 염색체 내 유전자 도입을 가능하게 하는 형질전환용 벡터 pDZTn(WO 2009/125992)를 사용하였다.
2-1. ATCC13032 기반 퓨트레신 생산 균주에서 gltA 강화 균주의 제작
코리네박테리움 글루타미쿰 ATCC13032의 게놈 DNA를 주형으로 서열번호 50 및 51 프라이머를 이용하여 gltA 유전자 단편을 증폭하였다(표 4). 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초 또는 1분 30초의 신장 과정을 30회 반복하였다. 이 PCR 결과물을 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
pDZTn 벡터는 speI을 처리하고 상기에서 수득한 각 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD Cloning Kit(Clontech)를 사용하였다. 결과로 얻은 플라스미드를 pDZTn1'-gltA라 명명하였다.
프라이머 서열 5'->3'
gltA F_speI (서열번호: 50) GAAGGAATGAGTTCCTCGAGACTAGTACTCGGCACCCATCCTTGTC
gltA R_speI (서열번호: 51) GTTATTAGATGTCGGGCCCACTAGTGTGCTGTACATGCTCCTTGAAAATC
상기 제조한 플라스미드를 KCCM11240P에 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 CM 배지(glucose 10 g/ℓ, polypeptone 10 g/ℓ, yeast extract 5 g/ℓ, beef extract 5 g/ℓ, NaCl 2.5 g/ℓ, urea 2 g/ℓ, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다.
형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 gltA를 코딩하는 유전자가 도입된 균주를 최종 선발하였다. 최종 선발된 균주를 대상으로 서열번호 50 및 51 프라이머 쌍을 이용해 PCR을 수행하여 gltA를 코딩하는 유전자가 도입되었음을 확인하고, 상기 코리네박테리움 글루타미쿰 변이주를 KCCM11240P Tn::gltA 라 명명하였다.
2-2. ATCC13869 기반 퓨트레신 생산 균주에서 gltA 강화 균주의 제작
실시예 1-2에서 사용한 DAB12-b를 대상으로 gltA 강화 균주를 제작하였다.
구체적으로, 코리네박테리움 글루타미쿰 ATCC13869 유래 gltA를 코딩하는 유전자 및 그로부터 발현되는 단백질 서열을 확인하기 위해, 코리네박테리움 글루타미쿰 ATCC13869의 게놈 DNA를 주형으로 하고 서열번호 50 및 51의 프라이머 쌍을 이용하여 PCR을 수행하였다.
이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 1분 30초의 신장 과정을 30회 반복하였다. 이로부터 수득된 PCR 산물을 전기영동으로 분리한 후 서열분석을 수행한 결과, 코리네박테리움 글루타미쿰 ATCC13869 유래의 gltA를 코딩하는 유전자는 서열번호 8로 기재되는 폴리뉴클레오티드 서열을 포함하는 것을 확인하였다. 이로부터 코딩되는 단백질의 서열과 코리네박테리움 글루타미쿰 ATCC13032 유래의 gltA의 아미노산 서열(서열번호 5)을 비교한 결과, 서열 상동성이 99%에 이름을 확인하였다.
코리네박테리움 글루타미쿰 ATCC13869 유래 gltA 강화를 위해 상기 실시예 2-1에서와 같이 코리네박테리움 글루타미쿰 ATCC13869의 게놈 DNA를 주형으로 서열번호 50 및 51 프라이머를 이용하여 유전자 단편을 증폭하였다. 이때, PCR 반응은 95℃에서 30초의 변성, 55℃에서 30초의 어닐링 및 72℃에서 30초 또는 1분 30초의 신장 과정을 30회 반복하였다. 이 PCR 결과물을 0.8% 아가로스 겔에서 전기 영동한 후 원하는 크기의 밴드를 용리하여 정제하였다.
pDZTn 벡터는 speI을 처리하고 상기에서 수득한 각 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD Cloning Kit(Clontech)를 사용하였다. 결과로 얻은 플라스미드를 pDZTn2'-gltA라 명명하였다. 상기 플라스미드 pDZTn2'-gltA를 실시예 2-1과 동일한 방법으로 코리네박테리움 글루타미쿰 DAB12-b 에 형질전환하여 gltA가 강화된 균주를 선발하였다. 이로부터 선발된 코리네박테리움 글루타미쿰 변이주를 DAB12-b Tn:gltA 로 명명하였다.
실시예 3: 퓨트레신 생산 sugR 약화 및 gltA 강화 통합 균주의 제작 및 이의 퓨트레신 생산능 확인
상기 실시예 1-1과 1-2에서 제작한 sugR이 약화된 균주에서 gltA 유전자의 염색체 내 삽입을 통한 퓨트레신 생산능 향상을 확인하기 위해, gltA를 트랜스포존 유전자 내에 도입하였다. 이때 실시예 2-1과 2-2에서 제작한 벡터 pDZTn1'-gltA와 pDZTn2'-gltA를 이용하였다.
구체적으로, 상기 플라스미드 pDZTn1'-gltA를 실시예 2-1과 동일한 방법으로 코리네박테리움 글루타미쿰 KCCM11240P sugR(GTG), KCCM11240P sugR(TTG) 및 KCCM11240P sugR(B6) 에 형질전환하여 gltA가 강화된 균주를 제조하였다. 상기 제조된 코리네박테리움 글루타미쿰 변이주를 KCCM11240P sugR(GTG) Tn::gltA, KCCM11240P sugR(TTG) Tn::gltA 및 KCCM11240P sugR(B6) Tn::gltA 로 명명하고, 이 중 KCCM11240P sugR(TTG) Tn::gltA (Corynebacterium glutamicum CC01-1147)를 한국미생물보존센터에 2014년 11월 28일 KCCM11615P로 국제기탁하였다.
또한, 상기 플라스미드 pDZTn2'-gltA를 실시예 2-2과 동일한 방법으로 코리네박테리움 글루타미쿰 DAB12-b sugR(GTG), DAB12-b sugR(TTG) 및 DAB12-b sugR(B6)에 형질전환하여 gltA가 강화된 균주를 제조하였다. 상기 제조된 코리네박테리움 글루타미쿰 변이주를 DAB12-b sugR(GTG) Tn::gltA, DAB12-b sugR(TTG) Tn::gltA 및 DAB12-b sugR(B6) Tn::gltA 로 명명하였다.
실시예 4: 퓨트레신 생산 sugR 약화 및 gltA 강화 통합 균주의 퓨트레신 산능 평가
퓨트레신 생산 균주에서 sugR 약화 및 gltA 강화가 퓨트레신 생산에 미치는 효과를 확인하기 위하여, 상기 실시예 1, 실시예 2 및 실시예 3에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 퓨트레신 생산능을 비교하였다.
구체적으로, 6종의 코리네박테리움 글루타미쿰 변이주(KCCM11240P sugR(GTG) Tn::gltA/ KCCM11240P sugR(TTG) Tn::gltA/ KCCM11240P sugR(B6) Tn::gltA/ DAB12-b sugR(GTG) Tn::gltA/ DAB12-b sugR(TTG) Tn::gltA 및 DAB12-b sugR(B6) Tn::gltA)) 와 2종의 모균주(KCCM11240P, DAB12-b)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 l, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다.
이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수 고형물 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4ㆍ7H2O 0.05%, urea 0.15%, 바이오틴 100 g, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5% 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 50시간 동안 진탕 배양하였다.
모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 배양 후 각 배양물로부터 생산된 퓨트레신 농도를 측정하고 그 결과를 하기 표 5에 나타내었다.
균주 퓨트레신 (g/L) 생산성 (g/L/h) fold (%)
KCCM11240P 5.8 0.116 100
KCCM11240P sugR(TTG) 6.3 0.126 109
KCCM11240P sugR(GTG) 6.3 0.126 109
KCCM11240P sugR(B6) 6.0 0.120 103
KCCM11240P Tn::gltA 6.2 0.124 107
KCCM11240P sugR(TTG) Tn::gltA 6.8 0.136 117
KCCM11240P sugR(GTG) Tn::gltA 6.5 0.130 112
KCCM11240P sugR(B6) Tn::gltA 6.3 0.126 109
DAB12-b 6.5 0.129 100
DAB12-b sugR(TTG) 6.9 0.138 107
DAB12-b sugR(GTG) 6.8 0.136 105
DAB12-b sugR(B6) 6.7 0.134 104
DAB12-b Tn::gltA 7.0 0.140 109
DAB12-b sugR(TTG) Tn::gltA 7.3 0.146 113
DAB12-b sugR(GTG) Tn::gltA 7.1 0.142 110
DAB12-b sugR(B6) Tn::gltA 7.1 0.142 110
상기 표 5에 나타난 바와 같이, 비변형 균주 KCCM11240P 에 비해, sugR가 약화되거나 gltA가 강화된 코리네박테리움 글루타미쿰 변이주의 경우 퓨트레신 생산성이 3 내지 9% 증가하고, 또한, sugR이 약화됨과 동시에 gltA가 강화된 변이주의 경우, 퓨트레신 생산성이 9 내지 17% 더 증가되었다.
또한, 비변형 균주 DAB12-b의 경우, sugR가 약화되거나 gltA가 강화된 코리네박테리움 글루타미쿰 변이주의 경우 퓨트레신 생산성이 4 내지 9% 증가하고, 또한, sugR이 약화됨과 동시에 gltA가 강화된 변이주의 경우, 퓨트레신 생산성이 10 내지 13% 더 증가되었음을 확인하였다.
실시예 5: 퓨트레신 배출능이 증가된 퓨트레신 생산 균주 기반 sugR 약화 및 gltA 강화 통합 균주의 제작 및 이의 퓨트레신 생산능 확인
5-1. 퓨트레신 배출능이 증가된 균주 기반 sugR 약화 및 gltA 강화 통합 균주의 제작
퓨트레신 배출능이 증가된 KCCM11401P(대한민국 공개특허 제10-2014-0115244호) 균주를 기반으로 sugR 유전자 활성 약화와 gltA 유전자 활성 강화에 의하여 퓨트레신 생산능이 향상되는지를 확인하기 위해, 변이균주를 제작하였다.
구체적으로, 먼저 상기 실시예 1-1에서 제작한 pDZ-1'sugR(GTG), pDZ-1'sugR(TTG) 및 pDZ-1'sugR(B6) 를 상기 실시예 1-1과 동일한 방법으로 코리네박테리움 글루타미쿰 KCCM 11401P 에 형질전환하여 sugR 개시코돈이 TTG로 전환되어 sugR이 약화된 균주를 선발하였다. 이로부터 선발된 코리네박테리움 글루타미쿰 변이주를 KCCM11401P sugR(GTG), KCCM11401P sugR(TTG) 및 KCCM11401P sugR(B6) 로 명명하였다.
다음으로, gltA 유전자활성 강화에 의해 퓨트레신 생산능이 향상되는지를 확인하기 위해, 상기 제조한 sugR 유전자가 약화된 균주의 트랜스포존 유전자 내에 gltA 유전자를 도입하였다. 이때 실시예 2-1에서 제작한 벡터 pDZTn1'-gltA를 이용하였다.
구체적으로 상기 실시예 2-1에서 제작한 플라스미드 pDZTn1'-gltA를 실시예 2-1과 동일한 방법으로 상기 코리네박테리움 글루타미쿰 변이주 KCCM11401P sugR(GTG), KCCM11401P sugR(TTG) 및 KCCM11401P sugR(B6) 에 형질전환하여 gltA가 강화된 균주를 선발하였다. 이로부터 선발된 코리네박테리움 글루타미쿰 변이주를 변이주를 KCCM11401P sugR(GTG) Tn::gltA, KCCM11401P sugR(TTG) Tn::gltA 및 KCCM11401P sugR(B6) Tn::gltA 로 명명하였다.
5-2. 퓨트레신 배출능이 증가된 퓨트레신 생산 균주 기반 sugR 약화 및 gltA 강화 통합 균주의 퓨트레신 생산능 평가
퓨트레신 생산 균주에서 sugR 약화 및 gltA 강화가 퓨트레신 생산에 미치는 효과를 확인하기 위하여, 상기 실시예 5-1에서 제작한 코리네박테리움 글루타미쿰 변이주를 대상으로 퓨트레신 생산능을 비교하였다.
구체적으로, 7종의 코리네박테리움 글루타미쿰 변이주(KCCM11401P sugR(GTG), KCCM11401P sugR(TTG), KCCM11401P sugR(B6), KCCM11401P Tn::gltA, KCCM11401P sugR(GTG) Tn::gltA, KCCM11401P sugR(TTG) Tn::gltA 및 KCCM11401P sugR(B6) Tn::gltA) 와 1종의 모균주(KCCM11401P)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 l, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다.
이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수 고형물 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4ㆍ7H2O 0.05%, urea 0.15%, 바이오틴 100 g, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5% 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 50시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 배양 후 각 배양물로부터 생산된 퓨트레신 농도를 측정하고 그 결과를 하기 표 6에 나타내었다.
균주 퓨트레신 (g/L) 생산성 (g/l/h) fold(%)
KCCM11401P 5.3 0.106 100
KCCM11401P sugR(TTG) 5.6 0.112 106
KCCM11401P sugR(GTG) 5.5 0.110 104
KCCM11401P sugR(B6) 5.4 0.108 102
KCCM11401P Tn::gltA 5.6 0.112 106
KCCM11401P sugR(TTG) Tn::gltA 6.1 0.122 115
KCCM11401P sugR(GTG) Tn::gltA 5.9 0.118 111
KCCM11401P sugR(B6) Tn::gltA 5.8 0.116 109
상기 표 6에 나타난 바와 같이, 비변형 균주 KCCM11401P에 비해, sugR가 약화되거나 gltA가 강화된 코리네박테리움 글루타미쿰 변이주의 경우 퓨트레신 생산성이 2 내지 6% 증가하고, sugR이 약화됨과 동시에 gltA가 강화된 변이주의 경우, 퓨트레신 생산성이 9 내지 15% 더 증가되었음을 확인하였다. 이는 상기 표 5의 결과해석과 일치하는 것을 확인하였다
실시예 6. 오르니틴 생산 균주에서 sugR 약화 균주의 제작
코리네박테리움 글루타미쿰 ATCC13032 유래 sugR 약화가 오르니틴 생산능에 영향을 미치는지 확인하기 위해, 실시예 1-1에서 제작한 벡터를 이용하여 변이균주를 제작하였다.
상기 실시예 1-1에서 제작한 플라스미드 pDZ-1'sugR(GTG), pDZ-1'sugR(TTG) 및 pDZ-1'sugR(B6)를 코리네박테리움 글루타미쿰 ATCC13032를 모균주로 하여 제작한 KCCM11137P (대한민국 등록특허 제10-1372635호)에 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 카나마이신(25 ㎍/㎖)과 X-gal(5-bromo-4-chloro-3-indolin--D-galactoside)이 함유된 BHIS 평판 배지(Braine heart infusion 37 g/l, 소르비톨 91 g/l, 한천 2%)에 도말하여 배양함으로써 콜로니를 형성시켰다. 이로부터 형성된 콜로니 중에서 푸른색의 콜로니를 선택함으로써 상기 플라스미드 pDZ-1'sugR(GTG), pDZ-1'sugR(TTG) 및 pDZ-1'sugR(B6)가 도입된 균주를 선발하였다.
상기 선발된 균주를 CM 배지(glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체 배지에 도말하고 배양하여 콜로니를 형성시켰다. 형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 sugR의 개시코돈이 GTG 혹은 TTG로 변경된 균주 및 프로모터가 B6로 교체된 균주를 최종 선발하였다.
최종 선발된 균주를 대상으로 서열번호 43 및 47의 프라이머 쌍을 이용해 PCR을 수행하여 sugR의 개시코돈이 GTG 혹은 TTG로 변경되었는지를 확인하여 수득한 코리네박테리움 글루타미쿰 변이주를 각각 KCCM11137P sugR(GTG), KCCM11137P sugR(TTG) 및 KCCM11137P sugR(B6)로 명명하였다.
실시예 7. 오르니틴 생산 균주에서 gltA 강화 균주의 제작
오르니틴 생산 균주에서 gltA 유전자 활성 강화가 오르니틴 생산능에 미치는 영향을 확인하기 위하여, 상기 실시예 2-1에서 제작한 벡터를 이용하여 오르니틴 생산 균주의 염색체 내에 gltA 유전자를 삽입하여 변이균주를 제작하였다.
구체적으로, 오르니틴 생산 균주인 KCCM11137P (대한민국 등록특허 제10-1372635호)에 상기 실시예 2-1에서 제작한 벡터를 전기천공법(electroporation)으로 도입하여 형질전환체를 수득하고, 상기 형질전환체를 CM 배지(glucose 10 g/ℓ, polypeptone 10 g/ℓ, yeast extract 5 g/ℓ, beef extract 5 g/ℓ, NaCl 2.5 g/ℓ, urea 2 g/ℓ, pH 6.8)에서 진탕 배양(30℃, 8시간)하고, 각각 10-4부터 10-10까지 순차적으로 희석한 후 X-gal 함유 고체배지에 도말하고 배양하여 콜로니를 형성시켰다.
형성된 콜로니 중에서 상대적으로 낮은 비율로 나타나는 백색의 콜로니를 선택함으로써 2차 교차(crossover)에 의해 gltA를 코딩하는 유전자가 도입된 균주를 최종 선발하였다. 최종 선발된 균주를 대상으로 서열번호 50 및 51 프라이머 쌍을 이용해 PCR을 수행하여 gltA를 코딩하는 유전자가 도입되었음을 확인하였으며, 이렇게 수득한 코리네박테리움 글루타미쿰 변이주를 KCCM11137P Tn::gltA 라 명명하였다.
실시예 8. sugR 약화 및 gltA 강화 통합 균주의 제작 및 이의 오르니틴 생산 능 확인
8-1. ATCC13032 기반 오르니틴 생산 sugR 약화 및 gltA 강화 통합 균주의 제작
실시예 6에서 제작한 sugR이 약화된 KCCM11137P sugR(GTG), KCCM11137P sugR(TTG) 및 KCCM11137P sugR(B6)에서 gltA 유전자의 염색체 내 삽입을 통한 오르니틴 생산능 향상을 확인하기 위해, gltA를 트랜스포존 유전자 내에 도입하였다. 이때 실시예 2-1에서 제작한 벡터 pDZTn1'-gltA를 이용하였다.
상기 플라스미드 pDZTn1'-gltA를 실시예 2-1과 동일한 방법으로 코리네박테리움 글루타미쿰 KCCM11137P sugR(TTG)에 형질전환하여 gltA가 강화된 균주를 선발하였다. 이로부터 선발된 코리네박테리움 글루타미쿰 변이주를 KCCM11137P sugR(GTG) Tn::gltA, KCCM11137P sugR(TTG) Tn::gltA 및 KCCM11137P sugR(B6) Tn::gltA 로 명명하였다.
8-2. sugR 약화 및 gltA 강화 통합 균주의 오르니틴 생산능 평가
오르니틴 생산 균주에서 sugR 약화 및 gltA 강화가 오르니틴 생산에 미치는 효과를 확인하기 위하여, 상기 실시예 8-1에서 제작된 코리네박테리움 글루타미쿰 변이균주를 대상으로 오르니틴 생산능을 비교하였다.
구체적으로, 7종의 코리네박테리움 글루타미쿰 변이주((KCCM11137P sugR(GTG), KCCM11137P sugR(TTG), KCCM11137P sugR(B6), KCCM11137P Tn::gltA, KCCM11137P sugR(GTG) Tn::gltA, KCCM11137P sugR(TTG) Tn::gltA 및 KCCM11137P sugR(B6) Tn::gltA) 와 1종의 모균주(KCCM11137P)를 각각 1 mM 아르기닌 함유 CM 평판 배지(glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 l, agar 2%, pH 6.8, 1 L 기준)에 도말하여 30℃에서 24시간 동안 배양하였다.
이로부터 배양된 각 균주를 25 ml의 역가 배지(Glucose 8%, 대두단백질 0.25%, 옥수수 고형물 0.50%, (NH4)2SO4 4%, KH2PO4 0.1%, MgSO4ㆍ7H2O 0.05%, urea 0.15%, 바이오틴 100 g, 티아민 염산염 3 mg, 칼슘-판토텐산 3 mg, 니코틴아미드 3 mg, CaCO3 5% 1 L 기준)에 한 백금이 정도로 접종한 후 이를 30℃에서 200 rpm으로 50시간 동안 진탕 배양하였다. 모든 균주의 배양 시 배지에 1 mM 아르기닌을 첨가하였다. 배양 후 각 배양물로부터 생산된 퓨트레신 농도를 측정하고 그 결과를 하기 표 7에 나타내었다.
균주 오르니틴 (g/L) 생산성 (g/l/h) fold(%)
KCCM11137P 11.5 0.230 100
KCCM11137P sugR(TTG) 12.5 0.250 109
KCCM11137P sugR(GTG) 12.3 0.246 107
KCCM11137P sugR(B6) 12.5 0.250 109
KCCM11137P Tn::gltA 12.4 0.248 108
KCCM11137P sugR(TTG) Tn::gltA 13.5 0.270 117
KCCM11137P sugR(GTG) Tn::gltA 13 0.260 113
KCCM11137P sugR(B6) Tn::gltA 12.9 0.258 112
상기 표 7 에 나타난 바와 같이, 비변형 균주 KCCM11137P 에 비해, sugR가 약화되거나 gltA가 강화된 코리네박테리움 글루타미쿰 변이주의 경우 퓨트레신 생산성이 7 내지 10% 증가하고, 또한, sugR이 약화됨과 동시에 gltA가 강화된 변이주의 경우, 오르니틴 생산성이 12 내지 17% 더 증가되었음을 확인하였다.
상기 내용을 종합하면, 퓨트레신 또는 오르니틴을 생산하는 코리네박테리움 균주에 있어서, sugR를 약화하거나 gltA를 강화하는 것을 통해 퓨트레신과 오르니틴의 생산량이 증가하는 것을 확인하였으며, sugR을 약화함과 동시에 gltA를 강화하는 경우, 퓨트레신과 오르니틴의 생산량이 더욱 증가하는 것을 확인하였다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2016003198-appb-I000001

Claims (15)

  1. 당대사 전사 조절자(transcriptional regulator of sugar metabolism, SugR) 활성이 내재적 활성에 비해 약화되고 시트레이트 신타아제(citrate synthase, GltA) 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  2. 제1항에 있어서, 상기 당대사 전사 조절자는 서열번호 1 또는 서열번호 3의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  3. 제1항에 있어서, 상기 시트레이트 신타아제는 서열번호 5 또는 서열번호 7의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  4. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 써모아미노게네스(Corynebacterium thermoaminogenes), 브레비박테리움 플라붐(Brevibacterium flavum) 및 브레비박테리움 락토페르멘툼(Brevibacterium lactofermentum)으로 이루어진 군으로부터 선택되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  5. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 오르니틴 디카복실라제(ornithine decarboxylase, ODC)의 활성이 도입되도록 변이된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물.
  6. 제5항에 있어서, 상기 오르니틴 디카복실라제는 서열번호 17의 아미노산 서열로 구성되는, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물.
  7. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 i) 오르니틴 카르바모일 트랜스퍼라아제(ArgF), ii) 글루타메이트 엑스포터 또는 iii) 오르니틴 카르바모일 트랜스퍼라아제 및 글루타메이트 엑스포터의 활성이 내재적 활성에 비해 약화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  8. 제7항에 있어서, 상기 오르니틴 카르바모일 트랜스퍼라아제는 서열번호 9 또는 서열번호 11의 아미노산 서열로 구성되고, 상기 글루타메이트 엑스포터는 서열번호 13 또는 15의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  9. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아세틸 감마 글루타밀 포스페이트 리덕타아제(ArgC), 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제(ArgJ), 아세틸 글루타메이트 키나아제(ArgB), 및 아세틸 오르니틴 아미노 트랜스퍼라아제(ArgD)로 구성되는 군으로부터 선택되는 1종 이상의 활성이 내재적 활성에 비해 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  10. 제9항에 있어서, 상기 아세틸 감마 글루타밀 포스페이트 리덕타아제는 서열번호 19 또는 서열번호 21의 아미노산 서열로 구성되고, 아세틸 글루타메이트 신타아제 또는 오르니틴 아세틸 트랜스퍼라아제는 서열번호 23 또는 서열번호 25의 아미노산 서열로 구성되며, 아세틸 글루타메이트 키나아제는 서열번호 27 또는 서열번호 29의 아미노산 서열로 구성되고, 아세틸 오르니틴 아미노 트랜스퍼라아제는 서열번호 31 또는 서열번호 33의 아미노산 서열로 구성되는, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  11. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아세틸트랜스퍼라아제의 활성이 내재적 활성보다 약화되도록 변이된, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물.
  12. 제11항에 있어서, 상기 아세틸트랜스퍼라아제가 서열번호 35 또는 서열번호 37의 아미노산 서열로 구성되는, 퓨트레신 생산능을 가지는 코리네박테리움 속 미생물.
  13. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 서열번호 39 또는 서열번호 41의 아미노산 서열로 구성되는 단백질의 활성이 내재적 활성보다 강화되도록 변이된, 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물.
  14. (i) 제1항 내지 제13항 중 어느 한 항의 퓨트레신 또는 오르니틴 생산능을 가지는 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
    (ii) 상기 (i) 단계에서 배양된 미생물 또는 배지로부터 퓨트레신 또는 오르니틴을 분리하는 단계를 포함하는, 퓨트레신 또는 오르니틴 생산 방법.
  15. 제14항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, 퓨트레신 또는 오르니틴 생산 방법.
PCT/KR2016/003198 2015-06-24 2016-03-29 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법 Ceased WO2016208854A1 (ko)

Priority Applications (12)

Application Number Priority Date Filing Date Title
BR112017028181-3A BR112017028181B1 (pt) 2015-06-24 2016-03-29 Micro-organismo modificado para produzir putrescina ou ornitina e método para produzir putrescina ou ornitina usando o dito micro-organismo
CN201680036420.2A CN107849576B (zh) 2015-06-24 2016-03-29 用于产生腐胺或鸟氨酸的微生物以及使用这些微生物产生腐胺或鸟氨酸的方法
US15/739,699 US11053525B2 (en) 2015-06-24 2016-03-29 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
SG11201710665TA SG11201710665TA (en) 2015-06-24 2016-03-29 Microorganisms for Producing Putrescine or Ornithine and Process for Producing Putrescine or Ornithine Using Them
JP2017566629A JP6588575B2 (ja) 2015-06-24 2016-03-29 プトレシンまたはオルニチン生産微生物及びそれを用いたプトレシンまたはオルニチン生産方法
NZ73865916A NZ738659A (en) 2015-06-24 2016-03-29 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
RU2017145909A RU2691303C1 (ru) 2015-06-24 2016-03-29 Микроорганизм, продуцирующий путресцин или орнитин, и способ получения путресцина или орнитина с использованием этого микроорганизма
CA2990376A CA2990376C (en) 2015-06-24 2016-03-29 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
AU2016284767A AU2016284767B2 (en) 2015-06-24 2016-03-29 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
MX2017016185A MX2017016185A (es) 2015-06-24 2016-03-29 Microorganismos para producir putrescina u ornitina y procedimientos de produccion de putrescina u ornitina utilizando los mismos.
MYPI2017001902A MY187501A (en) 2015-06-24 2016-03-29 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
PH12017502396A PH12017502396A1 (en) 2015-06-24 2017-12-21 Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0090021 2015-06-24
KR1020150090021A KR101813759B1 (ko) 2015-06-24 2015-06-24 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법

Publications (1)

Publication Number Publication Date
WO2016208854A1 true WO2016208854A1 (ko) 2016-12-29

Family

ID=56740763

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/003198 Ceased WO2016208854A1 (ko) 2015-06-24 2016-03-29 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법

Country Status (19)

Country Link
US (1) US11053525B2 (ko)
EP (1) EP3109318B1 (ko)
JP (1) JP6588575B2 (ko)
KR (1) KR101813759B1 (ko)
CN (1) CN107849576B (ko)
AU (1) AU2016284767B2 (ko)
BR (1) BR112017028181B1 (ko)
CA (1) CA2990376C (ko)
CL (1) CL2017003249A1 (ko)
ES (1) ES2739002T3 (ko)
MX (1) MX2017016185A (ko)
MY (1) MY187501A (ko)
NZ (1) NZ738659A (ko)
PH (1) PH12017502396A1 (ko)
PL (1) PL3109318T3 (ko)
RU (2) RU2759956C1 (ko)
SG (1) SG11201710665TA (ko)
TW (1) TWI632237B (ko)
WO (1) WO2016208854A1 (ko)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101937569B1 (ko) 2017-06-14 2019-01-11 씨제이제일제당 (주) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
KR101941775B1 (ko) 2017-06-14 2019-01-24 씨제이제일제당 (주) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
CN111019875A (zh) * 2019-12-25 2020-04-17 江南大学 一种转录因子SugR编码基因及其在N-乙酰氨基葡萄糖生产中的应用
CN111394291B (zh) * 2020-03-27 2022-03-15 江南大学 一种利用重组谷氨酸棒杆菌发酵生产l-谷氨酸的方法
CN112522171A (zh) * 2020-12-18 2021-03-19 浙江中山化工集团股份有限公司 一种工程菌、含鸟氨酸溶液的处理方法及试剂盒
KR102525072B1 (ko) * 2021-03-10 2023-04-24 씨제이제일제당 주식회사 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법
CN118813659A (zh) * 2021-04-14 2024-10-22 上海凯赛生物技术股份有限公司 用于发酵生产1,5-戊二胺的重组dna、菌株及其用途
KR102734703B1 (ko) * 2021-10-15 2024-11-26 씨제이제일제당 주식회사 L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
CN114350694B (zh) * 2021-11-29 2024-05-24 新泰市佳禾生物科技有限公司 L-鸟氨酸生产菌及其构建方法
KR102952497B1 (ko) * 2022-03-28 2026-04-15 씨제이제일제당 주식회사 O-아세틸 호모세린 생산 미생물 및 이를 이용한 o-아세틸 호모세린 또는 l-메치오닌 생산 방법
KR102770475B1 (ko) * 2022-06-02 2025-02-20 씨제이제일제당 주식회사 L-오르니틴 생산능을 가지는 미생물 및 이를 이용한 l-오르니틴 생산방법
KR102919411B1 (ko) * 2024-04-25 2026-01-28 씨제이제일제당 (주) 신규한 이중 기능성 글루타메이트 n-아세틸트랜스퍼라제/아미노산 아세틸트랜스퍼라제 변이체 및 이를 이용한 글루타메이트 계열 아미노산 생산 방법

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009254323A (ja) * 2008-04-21 2009-11-05 Ajinomoto Co Inc L−グルタミン酸系アミノ酸の製造法
KR20130082478A (ko) * 2012-01-11 2013-07-19 씨제이제일제당 (주) 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법
KR101372635B1 (ko) * 2010-12-08 2014-03-13 씨제이제일제당 (주) 오르니틴 생산능이 향상된 미생물 및 이를 이용하여 오르니틴을 생산하는 방법

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103146593B (zh) * 2004-01-30 2015-07-15 味之素株式会社 生产l-氨基酸的微生物和生产l-氨基酸的方法
WO2006001382A1 (ja) * 2004-06-25 2006-01-05 Kyowa Hakko Kogyo Co., Ltd. ジペプチドまたはジペプチド誘導体の製造法
US8497098B2 (en) 2004-07-15 2013-07-30 Dsm Ip Assets B.V. Biochemical synthesis of 1,4-butanediamine
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
EP3170889A1 (en) 2006-09-15 2017-05-24 CJ Cheiljedang Corporation A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same
KR100824457B1 (ko) 2006-10-16 2008-04-22 씨제이제일제당 (주) 고농도의 글루탐산을 생산하는 미생물 및 이를 이용한글루탐산의 제조 방법
US8133714B2 (en) * 2007-09-27 2012-03-13 Evonik Degussa Gmbh Process for the fermentative preparation of organic chemical compounds using coryneform bacteria in which the SugR gene is present in attenuated form
KR100930203B1 (ko) 2008-01-28 2009-12-07 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 l-라이신의 생산 방법
KR101126041B1 (ko) 2008-04-10 2012-03-19 씨제이제일제당 (주) 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 l-라이신 생산방법
BRPI0903495B1 (pt) 2008-04-10 2019-01-29 Korea Advanced Institute Of Science And Technology microorganismos mutantes com capacidade de produzir putrescina e método para produção de putrescina utilizando os mesmos
KR101348461B1 (ko) * 2010-12-08 2014-01-08 씨제이제일제당 (주) 퓨트레신을 생산하는 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법
CN103492553B (zh) * 2011-02-22 2018-06-12 巴斯夫欧洲公司 用于生产尸胺的方法和重组微生物
KR101607741B1 (ko) * 2013-03-20 2016-03-31 씨제이제일제당 (주) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
CN111019875A (zh) * 2019-12-25 2020-04-17 江南大学 一种转录因子SugR编码基因及其在N-乙酰氨基葡萄糖生产中的应用

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009254323A (ja) * 2008-04-21 2009-11-05 Ajinomoto Co Inc L−グルタミン酸系アミノ酸の製造法
KR101372635B1 (ko) * 2010-12-08 2014-03-13 씨제이제일제당 (주) 오르니틴 생산능이 향상된 미생물 및 이를 이용하여 오르니틴을 생산하는 방법
KR20130082478A (ko) * 2012-01-11 2013-07-19 씨제이제일제당 (주) 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BLOMBACH, BASTIAN ET AL.: "L-Valine Production during Growth of Pyruvate Dehydrogenase Complex-deficient Corynebacterium Glutamicum in the Presence of Ethanol or by Inactivation of the Transcriptional Regulator SugR", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 75, no. 4, 2009, pages 1197 - 1200, XP055233519 *
DATABASE NCBI [O] 18 July 2013 (2013-07-18), "D-beta-D-heptose 1-phosphate adenosyltransferase [Corynebacterium glutamicum]", XP055341336, retrieved from ncbi Database accession no. WP_011014761.1 *
DATABASE NCBI [O] 18 July 2013 (2013-07-18), "MFS transporter [Corynebacterium glutamicum]", XP055341342, Database accession no. WP_011015248.1 *
DATABASE NCBI [O] 22 March 2015 (2015-03-22), "type II citrate synthase [Corynebacterium glutamicum]", XP055341339, Database accession no. WP_011013914.1 *

Also Published As

Publication number Publication date
JP6588575B2 (ja) 2019-10-09
KR20170000906A (ko) 2017-01-04
CA2990376C (en) 2021-01-12
AU2016284767B2 (en) 2019-06-06
JP2018523989A (ja) 2018-08-30
ES2739002T3 (es) 2020-01-28
EP3109318A1 (en) 2016-12-28
TW201712117A (zh) 2017-04-01
PH12017502396A1 (en) 2018-06-25
PL3109318T3 (pl) 2019-10-31
CA2990376A1 (en) 2016-12-29
RU2691303C1 (ru) 2019-06-11
US20180187222A1 (en) 2018-07-05
BR112017028181B1 (pt) 2023-12-19
CN107849576A (zh) 2018-03-27
NZ738659A (en) 2019-09-27
BR112017028181A2 (pt) 2018-08-28
EP3109318B1 (en) 2019-06-05
US11053525B2 (en) 2021-07-06
TWI632237B (zh) 2018-08-11
CN107849576B (zh) 2021-04-27
KR101813759B1 (ko) 2018-01-02
RU2759956C1 (ru) 2021-11-19
SG11201710665TA (en) 2018-01-30
MY187501A (en) 2021-09-24
MX2017016185A (es) 2018-03-07
AU2016284767A1 (en) 2018-01-25
CL2017003249A1 (es) 2018-04-13

Similar Documents

Publication Publication Date Title
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2012077995A2 (ko) 퓨트레신을 생산하는 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법
WO2017014532A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2019231159A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2015199396A1 (ko) O-아세틸 호모세린을 생산하는 미생물 및 상기 미생물을 이용하여 o-아세틸 호모세린을 생산하는 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2020218736A1 (ko) L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2019172702A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2018230978A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2019013532A2 (ko) 아세토하이드록시산 신타아제 변이체, 이를 포함하는 미생물 또는 이를 이용하는 l-분지쇄 아미노산 생산 방법
WO2018230977A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2023075397A1 (ko) Lyse 변이체 및 이를 이용한 l-아르기닌 생산방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2022191467A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2021235775A1 (ko) 신규한 폴리펩티드 및 이를 이용한 l-류신의 생산 방법
WO2020256415A1 (ko) L-타이로신을 생산하는 미생물 및 이를 이용한 l-타이로신 생산 방법
WO2022035011A1 (ko) 퓨트레신 생산 미생물 및 이를 이용한 퓨트레신 생산방법
WO2023277307A1 (ko) 고농도 l-글루탐산을 생산하기 위한 균주 및 이를 이용한 l-글루탐산 생산방법
WO2022239942A1 (ko) 신규 프로모터 및 이의 용도
WO2015163591A1 (ko) 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2015163592A1 (ko) 다이아민 생산 미생물 및 이를 이용한 다이아민 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16814567

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: MX/A/2017/016185

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2990376

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 12017502396

Country of ref document: PH

ENP Entry into the national phase

Ref document number: 2017566629

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 11201710665T

Country of ref document: SG

WWE Wipo information: entry into national phase

Ref document number: 2017145909

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 2016284767

Country of ref document: AU

Date of ref document: 20160329

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017028181

Country of ref document: BR

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 25/04/2018)

ENP Entry into the national phase

Ref document number: 112017028181

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20171226

122 Ep: pct application non-entry in european phase

Ref document number: 16814567

Country of ref document: EP

Kind code of ref document: A1