WO2022191467A1 - L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법 - Google Patents

L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법 Download PDF

Info

Publication number
WO2022191467A1
WO2022191467A1 PCT/KR2022/002505 KR2022002505W WO2022191467A1 WO 2022191467 A1 WO2022191467 A1 WO 2022191467A1 KR 2022002505 W KR2022002505 W KR 2022002505W WO 2022191467 A1 WO2022191467 A1 WO 2022191467A1
Authority
WO
WIPO (PCT)
Prior art keywords
zwf
seq
csck
microorganism
pcj7
Prior art date
Application number
PCT/KR2022/002505
Other languages
English (en)
French (fr)
Inventor
이한형
변효정
김병수
김희주
정무영
김형준
박슬기
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to CN202280020233.0A priority Critical patent/CN117460831A/zh
Priority to BR112023018087A priority patent/BR112023018087A2/pt
Priority to MX2023010584A priority patent/MX2023010584A/es
Priority to JP2023546556A priority patent/JP2024505267A/ja
Priority to AU2022235362A priority patent/AU2022235362A1/en
Priority to EP22767363.9A priority patent/EP4269598A1/en
Priority to CA3211373A priority patent/CA3211373A1/en
Publication of WO2022191467A1 publication Critical patent/WO2022191467A1/ko
Priority to US18/464,158 priority patent/US20240043886A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/227—Tryptophan
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01049—Glucose-6-phosphate dehydrogenase (1.1.1.49)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01004—Fructokinase (2.7.1.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01044—Galacturonokinase (2.7.1.44)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Definitions

  • the present application relates to a microorganism of the genus Corynebacterium that produces L-amino acids, a method for producing L-amino acids using the same, uses for producing L-amino acids, and a composition for producing L-amino acids.
  • L-amino acid is a basic structural unit of protein and is used as an important material for pharmaceutical raw materials, food additives, animal feed, nutrients, pesticides, and disinfectants.
  • L-lysine is an essential amino acid that is not biosynthesized at all in the body, and is known to be necessary for growth promotion, calcium metabolism, gastric juice secretion promotion, and resistance to disease.
  • the L-lysine is variously used in feed, medicine, food, and the like.
  • L-tryptophan is also one of the essential amino acids, and is used as a feed additive, infusion, pharmaceutical raw material, and health food material.
  • Corynebacterium sp. strain Corynebacterium
  • Corynebacterium glutamicum Corynebacterium glutamicum
  • a target substance-specific approach such as increasing the expression of a gene encoding an enzyme involved in amino acid biosynthesis or removing a gene unnecessary for amino acid biosynthesis is mainly used ( Korean Patent Publication Nos. 10-0924065, 10-1208480,).
  • An object of the present application is to provide a microorganism of the genus Corynebacterium with enhanced activity of glucose-6-phosphate dehydrogenase (Glucose-6-phosphate 1-dehydrogenase) and fructokinase (Fructokinase).
  • glucose-6-phosphate dehydrogenase Glucose-6-phosphate 1-dehydrogenase
  • fructokinase Fructokinase
  • One object of the present application is the activity of glucose-6-phosphate dehydrogenase (Glucose-6-phosphate 1-dehydrogenase) and fructokinase (Fructokinase) is enhanced, Corynebacterium genus to produce L- amino acids to provide microbes.
  • glucose-6-phosphate dehydrogenase Glucose-6-phosphate 1-dehydrogenase
  • fructokinase Flructokinase
  • Another object of the present application is to provide a method for producing L-amino acids using the microorganism.
  • Another object of the present application is to provide a use for the production of L-amino acids of the microorganism.
  • Another object of the present application is the microorganism; And/or to provide a composition for the production of L- amino acids comprising the culture of the microorganism.
  • glucose-6-phosphate dehydrogenase Glucose-6-phosphate 1-dehydrogenase
  • fructokinase of the present application is enhanced, and the microorganism producing L-amino acid can produce L-amino acid with high efficiency.
  • glucose-6-phosphate dehydrogenase Glucose-6-phosphate 1-dehydrogenase
  • fructokinase Fructokinase
  • L-amino acid includes all L-amino acids that microorganisms can produce through metabolic processes from various carbon sources, specifically, basic amino acids such as L-lysine, L-arginine, and L-histidine.
  • Non-polar amino acids such as , L-valine, L-leucine, L-glycine, L-isoleucine, L-alanine, L-proline, L-methionine, L-serine, L-threonine, L-cysteine, L-aspartic acid, L -Polar amino acids such as glutamine, aromatic amino acids such as L-phenylalanine, L-tyrosine and L-tryptophan, and acidic amino acids such as L-glutamic acid and L-aspartic acid. More specifically, in the present application, the L-amino acid may be L-lysine or L-tryptophan, but is not limited thereto.
  • glucose-6-phosphate 1-dehydrogenase (hereinafter, "Zwf") is involved in a metabolic pathway, the pentose phosphate pathway, and glucose 6 - It means that it plays a role in reducing NADP+ to NADPH while oxidizing phosphoric acid.
  • the protein may also be referred to as 'G6PD', 'G6PDH', 'glucose-6-phosphate dehydrogenase' or 'Zwf'.
  • the gene encoding the protein may be, for example, a zwf gene, but is not limited thereto.
  • ' zwf gene' may be used interchangeably with 'gene encoding glucose-6-phosphate dehydrogenase'.
  • the protein may be, for example, the same protein as the protein derived from Corynebacterium glutamicum, but is not limited thereto as long as it can increase the production of L-amino acids.
  • the Zwf may have the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or consist of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or include the amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3 , but not limited thereto.
  • the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 can be confirmed in NCBI Genbank, a known database.
  • the Zwf may include a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4, but is not limited thereto.
  • the sequence of SEQ ID NO: 2 or SEQ ID NO: 4 can be confirmed in NCBI Genbank, a known database.
  • the Zwf is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, Or it may be an amino acid sequence having at least 99% homology or identity. In addition, as long as it is an amino acid sequence having such homology or identity and exhibiting a function corresponding to the Zwf, it is apparent that Zwf having an amino acid sequence in which some sequences are deleted, modified, substituted or added is also included within the scope of the present application.
  • CscK fructokinase
  • the protein may also be referred to as 'fructose phosphorylation enzyme', 'fructokinase', or 'CscK'.
  • the gene encoding the protein may be, for example, a csck gene, but is not limited thereto.
  • ' csck gene' may be used interchangeably with 'fructokinase-encoding gene'.
  • the protein may be, for example, the same protein as the protein derived from Escherichia coli , but is not limited thereto as long as it can increase the production of L-amino acids.
  • the CscK may have the amino acid sequence of SEQ ID NO: 5, consist of the amino acid sequence of SEQ ID NO: 5, or include the amino acid sequence set forth in SEQ ID NO: 5, but is not limited thereto.
  • the sequence of SEQ ID NO: 5 can be confirmed in NCBI Genbank, a known database.
  • the CscK may include a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 6, but is not limited thereto.
  • the sequence of SEQ ID NO: 6 can be confirmed in NCBI Genbank, a known database.
  • the CscK has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to SEQ ID NO: 5 and/or SEQ ID NO: 5 ) or an amino acid sequence having identity.
  • it is an amino acid sequence having such homology or identity and exhibiting a function corresponding to the CscK, it is obvious that CscK having an amino acid sequence in which some sequences are deleted, modified, substituted or added is also included within the scope of the present application.
  • homology and identity refer to the degree to which two given amino acid sequences or base sequences are related, and may be expressed as a percentage.
  • homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially, homologous or identical sequences are generally at least about 50%, 60%, 70%, 80% of the entire or full-length sequence under moderate or high stringent conditions. or more than 90% hybrid. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
  • Homology or identity to said polypeptide or polynucleotide sequence can be determined, for example, by the algorithm BLAST according to the literature [Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)], or FASTA by Pearson (Methods Enzymol., 183, 63, 1990). Based on such an algorithm BLAST, a program called BLASTN or BLASTX has been developed (refer to http://www.ncbi.nlm.nih.gov).
  • the "microorganism that produces L-amino acids” includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially. Specifically, as a microorganism in which a specific mechanism is weakened or enhanced due to a cause such as insertion of an external gene or intensification or inactivation of the activity of an intrinsic gene, genetic mutation occurs or L-amino acid is produced for the desired L-amino acid production. It may be a microorganism that has enhanced production activity.
  • the microorganism producing the L-amino acid is characterized in that the expression or activity of the Zwf and Csck proteins is enhanced, and the desired L-amino acid production ability is increased, and a genetically modified microorganism or recombinant microorganism may be, but is not limited thereto.
  • the term "enhancement of activity" of a protein in the present application means that the activity of the protein is increased compared to the intrinsic activity.
  • the "intrinsic activity” refers to the activity of a specific protein originally possessed by the parent strain or unmodified microorganism before the transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “pre-modification activity”.
  • pre-modification activity When the activity of a protein is "increased” compared to the intrinsic activity, it means that the activity of a specific protein is improved compared to the original activity of the parent strain or the unmodified microorganism before transformation.
  • the "increase in activity” may be achieved by introducing an exogenous protein or enhancing the activity of an intrinsic protein, but specifically, it may be achieved through enhancing the activity of an intrinsic protein. Whether the activity of the protein is enhanced can be confirmed from the increase in the level of activity, expression, or the amount of product produced from the protein.
  • the enhancement of the activity can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target protein compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • the protein to be the target of the activity enhancement that is, the target protein may be Zwf and Csck, but is not limited thereto.
  • the protein activity enhancement of the present application is,
  • modification of the polynucleotide sequence encoding the protein to enhance protein activity eg, modification of the gene sequence encoding the protein to encode the modified protein to enhance activity
  • It may be a combination of two or more selected from 1) to 8), but is not limited thereto.
  • the increase in the intracellular copy number of the gene encoding the protein is performed by any method known in the art, for example, the gene encoding the protein is cloned and functions independently of the host, to which the gene encoding the protein is operably linked. It can be carried out by introducing a vector capable of it into a host cell. Alternatively, a vector capable of inserting the gene into a chromosome in the host cell, to which the gene is operably linked, may be introduced into the host cell, but is not limited thereto.
  • the term "vector” refers to a DNA preparation containing a polynucleotide sequence encoding a target protein in a suitable host in a form operably linked to regulatory sequences suitable for expressing the target protein.
  • the expression control sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDZ pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • pC1BAC vectors and the like can be used.
  • the term "transformation” refers to introducing a recombinant vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide it may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome.
  • the transformation method includes any method of introducing a nucleic acid into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell.
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence or expression control region that initiates and mediates transcription of the polynucleotide encoding the target protein of the present application. do.
  • the operable linkage may be prepared using a genetic recombination technique known in the art, and site-specific DNA cleavage and ligation may be made using a cleavage and ligation enzyme in the art, but is not limited thereto.
  • the method of replacing a gene expression control sequence on a chromosome encoding a protein with a sequence with strong activity is any method known in the art, for example, a nucleic acid sequence is deleted to further enhance the activity of the expression control sequence. , insertion, non-conservative or conservative substitution, or a combination thereof by inducing a mutation in the sequence, or by replacing the nucleic acid sequence with a stronger activity.
  • the expression control sequence is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence for regulating the termination of transcription and translation.
  • the method may specifically be to link a strong heterologous promoter instead of the original promoter, but is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoters (US Pat. No. 7662943 B2), lac promoter, Trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter and rmf promoter. It is not limited thereto, and includes any substitution with a promoter that is stronger than the intrinsic activity.
  • the base sequence modification of the start codon or 5'-UTR region of the gene transcript encoding the protein is performed by any method known in the art, for example, the intrinsic start codon of the protein is compared to the intrinsic start codon. It may be substituted with another start codon having a higher protein expression rate, but is not limited thereto.
  • Modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above can be performed by any method known in the art, for example, by deleting, inserting, non-conservative or It can be carried out by inducing a mutation in the expression control sequence by conservative substitution or a combination thereof, or by replacing the polynucleotide sequence with an improved polynucleotide sequence to have stronger activity.
  • the replacement may specifically be to insert the gene into the chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether the gene to be introduced is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface protein expression. Markers to be given may be used, but the present invention is not limited thereto. In an environment treated with a selective agent, only cells expressing a selectable marker survive or exhibit other expression traits, and thus transformed cells can be selected.
  • the introduction of the foreign polynucleotide exhibiting the activity of the protein may be performed by any method known in the art, for example, a foreign polynucleotide encoding a protein exhibiting the same/similar activity as the protein, or a codon-optimized mutation thereof It can be carried out by introducing the type polynucleotide into a host cell.
  • the foreign polynucleotide may be used without limitation in origin or sequence as long as it exhibits the same/similar activity as the protein.
  • the introduced foreign polynucleotide may be introduced into the host cell by optimizing its codon so that the optimized transcription and translation are performed in the host cell.
  • the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a protein and increase its activity.
  • Codon optimization of the polynucleotide encoding the protein is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide is optimized in the host cell. It may be that its codons are optimized so that the
  • Selecting an exposed site by analyzing the tertiary structure of the protein and modifying or chemically modifying it for example, compares the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored to determine the degree of sequence similarity. Accordingly, it may be to determine a template protein candidate, check the structure based on this, and select an exposed site to be modified or chemically modified and modified or modified.
  • Such protein activity enhancement may be that the activity or concentration of the corresponding protein is increased based on the activity or concentration of the protein expressed in the wild-type or pre-modified microbial strain, or the amount of product produced from the protein is increased.
  • the present invention is not limited thereto.
  • the term "pre-transformation strain” or "pre-transformation microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a natural strain itself, or a genetic variation caused by an artificial factor. This means the strain before the change.
  • the transformation may be enhancement of PheA activity.
  • pre-modified strain or “pre-modified microorganism” may be used interchangeably with “unmutated strain”, “unmodified strain”, “unmodified microorganism”, “unmodified microorganism” or “reference microorganism”.
  • the reference microorganism is not particularly limited as long as it is a microorganism that produces L-amino acids, and mutant strains with enhanced L-amino acid production ability compared to the wild type are also included without limitation.
  • Corynebacterium glutamicum KCCM11016P (Korean Patent No. 10-0159812), KCCM10770P (Korean Patent No. 10-0924065), CJ3P (Binder et al. Genome Biology 2012, 13: R40) strain or L-tryptophan-producing Corynebacterium glutamicum KCCM12218P (Korean Patent No. 10-2035844) strain in which one or more genetic modifications are added to the strain to enhance the biosynthetic pathway may be included, but is not limited thereto.
  • the microorganism producing the L-amino acid is any microorganism capable of producing L-amino acid by enhancing Zwf and Csck activity by the above-described method.
  • the "microorganism that produces L-amino acids” may be used interchangeably with “microorganisms producing L-amino acids” and “microorganisms having L-amino acid production ability", and specifically may be microorganisms of the genus Corynebacterium, but , but not limited thereto.
  • microorganisms of the genus Corynebacterium may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ) , Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ), Corynebacterium halo Tolerans ( Corynebacterium halotolerans ), Corynebacterium Lium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ), Corynebacterium
  • microorganisms of the genus Corynebacterium can produce L-amino acids, but their production capacity is remarkably low, and neither genes nor mechanism principles acting on the production mechanism have been identified. Therefore, the 'microorganism of the genus Corynebacterium that produces L-amino acids' of the present application enhances or inactivates the activity of the natural wild-type microorganism itself, the gene related to the L-amino acid production mechanism, to have improved L-amino acid production ability.
  • Corynebacterium refers to a microorganism of the genus Corynebacterium, or a microorganism of the genus Corynebacterium having improved L-amino acid production ability by introducing or enhancing the activity of an external gene.
  • the present application is another aspect, comprising the steps of culturing the microorganism according to the present application in a medium; And it provides a method for producing L- amino acids, comprising the step of recovering L- amino acids from the microorganism or medium.
  • microorganism according to the present application is as described above.
  • any culture conditions and culture methods known in the art may be used for the culturing of microorganisms of the genus Corynebacterium.
  • the term "cultivation” means growing microorganisms in an appropriately artificially controlled environmental condition.
  • the method of culturing L-amino acid using a microorganism producing L-amino acid may be performed using a method widely known in the art. Specifically, the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto. The medium used for culture should meet the requirements of the particular strain in an appropriate way. Culture media for Corynebacterium strains are known (eg, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
  • Carbon sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid , fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
  • Nitrogen sources that may be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate.
  • the nitrogen source may also be used individually or as a mixture, but is not limited thereto.
  • the phosphorus contained in the medium may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a salt containing the corresponding sodium.
  • the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth.
  • essential growth substances such as amino acids and vitamins can be used.
  • precursors suitable for the culture medium may be used. The above-mentioned raw materials may be added in a batch or continuous manner by an appropriate method to the culture during the culture process, but is not limited thereto.
  • a basic compound such as sodium hydroxide, potassium hydroxide, ammonia, or an acid compound such as phosphoric acid or sulfuric acid may be used in an appropriate manner to adjust the pH of the culture.
  • an antifoaming agent such as a fatty acid polyglycol ester may be used to inhibit the formation of bubbles.
  • Oxygen or oxygen-containing gas eg, air
  • the temperature of the culture may be usually 20 °C to 45 °C, specifically 25 °C to 40 °C.
  • the incubation time may be continued until a desired amount of L-amino acid is obtained, but specifically, it may be 10 to 160 hours. However, it is not limited to these examples.
  • the present application may additionally include a step of preparing a medium before the step of culturing in the method of the present application, but is not limited thereto.
  • Isolation of L-amino acids from the culture can be accomplished by conventional methods known in the art.
  • separation method methods such as centrifugation, filtration, chromatography and crystallization may be used.
  • a supernatant obtained by removing the biomass by centrifuging the culture at low speed may be separated through ion exchange chromatography, but is not limited thereto.
  • the recovery step may include a purification process, and may be performed using a suitable method known in the art.
  • the present application provides a use for producing L-amino acids of the microorganism according to the present application.
  • microorganism and L-amino acid according to the present application are as described above.
  • the present application is another aspect, the microorganism according to the present application; And/or it provides a composition for the production of L- amino acids comprising the culture of the microorganism.
  • microorganism and L-amino acid according to the present application are as described above.
  • Example 1-1 Corynebacterium glutamicum ( Corynebacterium glutamicum ) Construction of a vector in which the glucose-6-phosphate dehydrogenase gene (zwf) derived from ATCC13032 is enhanced
  • the enhancement of the gene is the SPL13 promoter (US 10584338 B2) in the transposon of Corynebacterium glutamicum ATCC13032, respectively, and the CJ7 promoter derived from Corynebacterium ammoniagenes ( US 7662943 B2 ) The effect was confirmed by putting zwf connected to .
  • zwf was Corynebacterium glutamicum ATCC13032 genomic DNA as a template, respectively, based on NCBI nucleotide sequence (NC_003450.3) information of SEQ ID NOs: 9, 10 (Table 1) and SEQ ID NOs: 13, 14 (Table 2)
  • NCBI nucleotide sequence NCBI nucleotide sequence
  • SEQ ID NOs: 9, 10 Table 1
  • SEQ ID NOs: 13, 14 Table 2
  • a primer containing a polynucleotide was prepared and PCR (SolgTM Pfu-X DNA polymerase) was performed under the conditions shown in Table 4 to obtain a zwf gene fragment for constructing a vector.
  • pDZTn-Pcj7-zwf (C.gl13032) primer sequence No. designation DNA sequence SEQ ID NO: 11 primer 5 GCAGAAGGAATGAGTTCCTCagaaacatcccagcgctact SEQ ID NO: 12 primer 6 gagtgtttcctttcgttgggtac SEQ ID NO: 13 primer 7 cccaacgaaaggaacactcGTGAGCACAAACACG SEQ ID NO: 14 primer 8 GTTATTAGATGTCGGGCCCATTATGGCCTCGCGCCAGGTGT
  • SEQ ID NOs: 7 and 8 (Table 1), SEQ ID NOs: 11 and 12 (Table 2) primers were used and PCR (SolgTM Pfu-X DNA polymerase) was performed.
  • Table 4 Amplified SPL13, CJ7 promoter region, zwf gene fragment, and vector pDZTn (US Pat. No. 8932861 B2) digested with ScaI restriction enzyme was prepared by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL. 6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) was used to connect, transforming E.
  • Plasmids were obtained from the selected colonies using a commonly known plasmid extraction method, and the plasmids were named pDZTn-Pspl13-zwf (C.gl13032) and pDZTn-Pcj7-zwf (C.gl13032).
  • Example 1-2 Construction of a vector in which the glucose-6-phosphate dehydrogenase gene (zwf) derived from Corynebacterium glutamicum ATCC13869 is enhanced
  • Corynebacterium glutamicum ATCC13869-derived zwf strengthening effect was confirmed by using Corynebacterium glutamicum ATCC13869 genomic DNA as a template, respectively, and Corynebacterium glutamicum registered in the US National Institutes of Health (NIH GenBank). Based on the information on the cum ATCC13869 gene and surrounding nucleotide sequences, primers containing polynucleotides of SEQ ID NOs: 17 and 18 (Table 5) and SEQ ID NOs: 21, 22 (Table 6) were prepared and PCR (SolgTM) under the conditions of Table 4 Pfu-X DNA polymerase) to obtain a zwf gene fragment to construct a vector.
  • pDZTn-Pspl13-zwf (C.gl13869) primer sequence No. designation DNA sequence SEQ ID NO: 15 primer 9 GCAGAAGGAATGAGTTCCTCGGCGCTTCATGTCAACAATC SEQ ID NO: 16 primer 10 tgttttgatctcctccaataatc SEQ ID NO: 17 primer 11 tattggaggagatcaaacaGTGAGCACAAACACG SEQ ID NO: 18 primer 12 GTTATTAGATGTCGGGCCCATTATGGCCTCGCGCCAGGTGT
  • SPL13 promoter and the CJ7 promoter derived from Corynebacterium ammoniagenes SEQ ID NOs: 15 and 16 (Table 5), SEQ ID NOs: 19 and 20 (Table 6) primers were used, and PCR (SolgTM Pfu- X DNA polymerase) was performed.
  • Amplified SPL13, CJ7 promoter region, zwf gene fragment, and vector pDZTn (US Pat. No. 8932861 B2) digested with ScaI restriction enzyme was synthesized by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009). , NEBuilder HiFi DNA Assembly Master Mix) after ligation, transformed into E. coli DH5 ⁇ and plated on LB solid medium containing kanamycin (25 mg/l). In order to select colonies transformed with the vector linking the desired gene and pDZTn, PCR was performed with primers of SEQ ID NOs: 47 and 48 (Table 3).
  • Plasmids were obtained from the selected colonies using a commonly known plasmid extraction method, and these plasmids were named pDZTn-Pspl13-zwf (C.gl13869) and pDZTn-Pcj7-zwf (C.gl13869).
  • Escherichia coli Echerichia coli
  • cscK gene information was obtained from NCBI's Echerichia coli W (CP002967), and based on this, SEQ ID NOs: 25 and 26 (Table 7), SEQ ID NOs: 29 and 30 (Table 8) containing polynucleotides
  • a cscK gene fragment for preparing a vector was obtained by preparing a primer and performing PCR (SolgTM Pfu-X DNA polymerase) under the conditions shown in Table 4.
  • SEQ ID NOs: 23 and 24 (Table 7), SEQ ID NOs: 27 and 28 (Table 8) primers were used, and PCR (SolgTM Pfu-X DNA polymerase) was performed under the conditions of Table 4.
  • the amplified SPL13, CJ7 promoter region, cscK (E.co) gene fragment, and vector pDZTn (US Patent No. 8932861 B2) digested with ScaI restriction enzyme was converted to Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO). .5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) after ligation, transformed into E. coli DH5 ⁇ and plated on LB solid medium containing kanamycin (25 mg/l).
  • PCR was performed with primers of SEQ ID NOs: 47 and 48 (Table 3).
  • Plasmids were obtained from the selected colonies using a commonly known plasmid extraction method, and the plasmids were named pDZTn-Pspl13-cscK (E.co) and pDZTn-Pcj7-cscK (E.co).
  • Examples 1-4 Construction of a vector enhanced with zwf derived from Corynebacterium glutamicum ATCC13032 and cscK derived from Escherichia coli
  • Example 1-1 By confirming the individual gene enhancing effect of Example 1-1 and Example 1-3, a vector was prepared to confirm the simultaneous strengthening effect of the two genes.
  • a plasmid was obtained from the selected colony using a commonly known plasmid extraction method, and the plasmid was named pDZTn-Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co).
  • a plasmid was obtained from the selected colony using a commonly known plasmid extraction method, and the plasmid was named pDZTn-Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co).
  • a plasmid was obtained from the selected colony using a commonly known plasmid extraction method, and the plasmid was named pDZTn-Pspl13-zwf(C.gl13869)_Pcj7-cscK(E.co).
  • a plasmid was obtained from the selected colony using a commonly known plasmid extraction method, and this plasmid was named pDZTn-Pcj7-zwf(C.gl13869)_Pspl13-cscK(E.co).
  • Example 2-1 Production of a lysine-producing strain with enhanced zwf derived from Corynebacterium glutamicum ATCC13032
  • Corynebacterium glutamicum KCCM11016P (Korea) for producing L-lysine using the pDZTn-Pspl13-zwf (C.gl13032) and pDZTn-Pcj7-zwf (C.gl13032) vectors prepared in Example 1-1, respectively.
  • Registered Patent No. 10-0159812), KCCM10770P (Korean Patent No. 10-0924065), and CJ3P (Binder et al. Genome Biology 2012, 13:R40) strains were electroporated (Appl. Microbiol. Biotechnol.
  • Example 2-2 Preparation of a tryptophan-producing strain with enhanced zwf derived from Corynebacterium glutamicum ATCC13869
  • Corynebacterium glutamicum KCCM12218P for producing L-tryptophan using the pDZTn-Pspl13-zwf (C.gl13869) and pDZTn-Pcj7-zwf (C.gl13869) vectors prepared in Example 1-2, respectively Registered Patent No. 10-2035844)
  • Pspl13-zwf C.gl13869
  • Pcj7-zwf C.gl13869
  • the strain thus obtained was named Corynebacterium glutamicum KCCM12218P_Pspl13-zwf (C.gl13869) and KCCM12218P_Pcj7-zwf (C.gl13869).
  • Example 2-3 Production of Escherichia coli-derived cscK-enhanced lysine and tryptophan-producing strains
  • Corynebacterium glutamicum KCCM11016P (Korea) for producing L-lysine using the pDZTn-Pspl13-cscK (E.co) and pDZTn-Pcj7-cscK (E.co) vectors prepared in Example 1-3, respectively Registered Patent No. 10-0159812), KCCM10770P (Korean Patent No. 10-0924065), CJ3P (Binder et al. Genome Biology 2012, 13:R40) strains and Corynebacterium glutamicum producing L-tryptophan After transforming the KCCM12218P (Korean Patent No. 10-2035844) strain by electroporation (Appl. Microbiol.
  • the lysine-producing strain thus obtained is Corynebacterium glutamicum KCCM11016P_Pspl13-cscK (E.co), KCCM11016P_Pcj7-cscK (E.co), KCCM10770P_Pspl13-cscK (E.co), KCCM10770P_Pcj7-cscK (E.co), CJ3P_Pspl13-cscK (E.co) and CJ3P_Pcj7-cscK (E.co) were named, and tryptophan-producing strains were named KCCM12218P_Pspl13-cscK (E.co), KCCM12218P_Pcj7-cscK (E.co).
  • Example 2-4 Preparation of lysine-producing strains with enhanced zwf and Escherichia coli-derived cscK derived from Corynebacterium glutamicum ATCC13032
  • the obtained strain was Corynebacterium glutamicum KCCM11016P_Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co), KCCM11016P_Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co), KCCM10770P_Pspl13-zwf (C.gl13032)_Pcj7-cscK(E.co), KCCM10770P_Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co), CJ3P_Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co), CJ3P_Pcj7 It was named zwf(C.gl13032)_Pspl13-cscK(E.co).
  • Example 2-5 Preparation of tryptophan-producing strains with enhanced zwf and Escherichia coli-derived cscK derived from Corynebacterium glutamicum ATCC13869
  • Pspl13-zwf(C.gl13869)_Pcj7-cscK(E.co) and Pcj7-zwf(C.gl13869)_Pspl13-cscK(E.co) were inserted between the transposon genes through a secondary crossover process.
  • strains were obtained.
  • PCR and sequencing were performed using primers (Table 3) of SEQ ID NO: 47 and SEQ ID NO: 48 that can amplify adjacent regions including the position at which the gene was inserted, and the corresponding genetic manipulation was confirmed.
  • the tryptophan-producing strain thus obtained was named Corynebacterium glutamicum KCCM12218P_Pspl13-zwf(C.gl13869)_Pcj7-cscK(E.co), KCCM12218P_Pcj7-zwf(C.gl13869)_Pspl13-cscK(E.co). .
  • Example 3-1 Corynebacterium glutamicum ATCC13032-derived zwf, Escherichia coli-derived cscK-enhanced strain L-lysine-producing ability comparison
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and incubated at 37° C. for 42 hours, shaking at 200 rpm.
  • the production of L-lysine was measured by HPLC. The experiment was repeated 3 times, and the culture results (average values) are shown in Tables 13, 14, and 15.
  • Raw sugar 45 g (NH4)2SO4 15 g, soy protein 10 g, molasses 10 g, KH2PO4 0.55 g, MgSO4 7H2O 0.6 g, biotin 0.9 mg, thiamine hydrochloride 4.5 mg, calcium-pantothenic acid 4.5 mg, nicotinamide 30 mg, MnSO4 9 mg, FeSO4 9 mg, ZnSO4 0.45 mg, CuSO4 0.45 mg, CaCO3 30 g (based on 1 liter of distilled water).
  • the prepared zwf (C.gl13032), cscK (E.co) single-enhanced or simultaneous-enhanced lysine-producing strains confirmed the effect of improving the yield by 1.2 to 2.6%P compared to the parent strain KCCM11016P, as shown in Table 13 below. Since 4 mol of NADPH is required to produce 1 mol of lysine in Corynebacterium, an increase in NADPH supply capacity in a lysine-producing strain is closely related to an increase in yield (Kjeld Raunkjaer Kjeldsen at el., Biotechnol. Bioeng., 2009 Feb 1 ;102(2):583-97.).
  • the ability to supply NADPH was improved by enhancing the zwf gene alone in the KCCM1016P strain, thereby confirming the effect of improving production by 0.9g/L.
  • the cscK(E.co) gene was introduced so that the fructose inside the cell generated when the raw sugar of Corynebacterium was used could be directly used, and the improvement effect of 2.1/L increased by 15.2% compared to the parent strain KCCM11016P was confirmed.
  • the reducing power supply ability through the zwf gene is maximized, and the effect of improving the lysine yield is significantly increased compared to the single enhancement.
  • the reinforcing effect of the gene showed the same effect in other lysine-producing strains KCCM10770P and CJ3P as shown in Tables 14 and 15.
  • zwf (C.gl13032) and cscK (E.co) were strengthened at the same time compared to the single-enhanced strains, 22.1% and 27.1% increased production compared to the parent strain, respectively, 1.9g/L and 1.6g/L improved results.
  • Example 3-2 Comparison of L-tryptophan-producing ability of zwf derived from Corynebacterium glutamicum ATCC13869 and cscK-enhanced strain derived from Escherichia coli
  • the KCCM12218P-based cscK(E.co)-enhanced strain prepared in 3 was cultured in the following manner, respectively, and the cell mass, glucose consumption, and tryptophan production capacity were compared.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and incubated at 37° C. for 42 hours, shaking at 200 rpm.
  • the production of L-tryptophan was measured by HPLC. The experiment was repeated 3 times, and the culture results (average values) are shown in Table 16.
  • Raw sugar 30g (NH4)2SO4 15 g, MgSO4 7H2O 1.2 g, KH2PO4 1 g, yeast extract 5 g, biotin 900 ⁇ g, thiamine hydrochloride 4500 ⁇ g, calcium-pantothenic acid 4500 ⁇ g, CaCO3 30 g (based on 1 liter of distilled water).
  • the enhancement of the tryptophan yield due to the expression of the zwf gene improved the intracellular concentrations of PRPP and E4P, which are used as precursors of tryptophan.
  • the tryptophan yield improving factors were integrated, and the production of tryptophan was improved by 34% to 45% compared to the parent strain KCCM12218P, and the two genes were significantly enhanced compared to when the two genes were enhanced alone. An improved tryptophan yield was confirmed.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 출원은 Ｌ-아미노산을 생산하는 코리네박테리움 속 미생물, 이를 이용하여 L-아미노산을 생산하는 방법, L-아미노산 생산 용도, 및 L-아미노산 생산용 조성물에 관한 것이다.

Description

L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 L-아미노산의 생산방법
본 출원은 Ｌ-아미노산을 생산하는 코리네박테리움 속 미생물, 이를 이용하여 L-아미노산을 생산하는 방법, L-아미노산 생산 용도, 및 L-아미노산 생산용 조성물 에 관한 것이다.
L-아미노산은 단백질의 기본 구성단위로서, 약품 원료와 식품첨가제, 동물 사료, 영양제, 살충제, 살균제 등의 중요 소재로 사용된다. 그 중에서도, L-라이신은 생체 내에서 전혀 생합성되지 않는 필수 아미노산이며, 성장촉진, 칼슘 대사, 위액분비촉진, 병에 대한 저항력 증가에 필요하다고 알려져 있다. 상기 L-라이신은 사료, 의약품, 식품 등에 다양하게 쓰이고 있다. 또한, L-트립토판도 필수 아미노산 중 하나이며, 사료 첨가제, 수액제, 약품 원료 및 건강식품 소재 등으로 사용되고 있다.　
한편, 코리네박테리움 속 균주(Corynebacterium), 특히 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)은 L-아미노산 및 기타 유용물질 생산에 많이 이용되고 있는 그람 양성의 미생물이다. 상기 아미노산의 생산을 위해 고효율 생산 미생물 및 발효공정기술 개발을 위한 다양한 연구들이 수행되고 있다. 예를 들어, 코리네박테리움 속 균주에서 아미노산 생합성에 관여하는 효소를 암호화하는 유전자의 발현을 증가시키거나 또는 아미노산 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적인 접근 방법이 주로 이용되고 있다(한국 등록특허공보 제10-0924065호, 제10-1208480호,). 또한, 이러한 방법 이외에 아미노산 생산에 관여하지 않는 유전자를 제거하는 방법, 아미노산 생산에 있어 구체적으로 기능이 알려지지 않은 유전자를 제거하는 방법 또한 활용되고 있다. 그러나, 여전히 효율적으로 고수율로 L-아미노산을 생산할 수 있는 방법에 대한 연구의 필요성이 대두되고 있다.
본 출원의 해결하고자 하는 과제는 글루코스-6-포스페이트 디하이드로게나제(Glucose-6-phosphate 1-dehydrogenase) 및 프럭토키나제(Fructokinase)의 활성이 강화된 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 하나의 목적은 글루코스-6-포스페이트 디하이드로게나제(Glucose-6-phosphate 1-dehydrogenase) 및 프럭토키나제(Fructokinase)의 활성이 강화된, L-아미노산을 생산하는 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 또 하나의 목적은 상기 미생물을 이용한 Ｌ-아미노산의 생산방법을 제공하는 것이다.
본 출원의 또 하나의 목적은 상기 미생물의 L-아미노산 생산 용도를 제공하는 것이다.
본 출원의 또 하나의 목적은 상기 미생물; 및/또는 상기 미생물의 배양물을 포함하는 L-아미노산 생산용 조성물을 제공하는 것이다.
본 출원의 글루코스-6-포스페이트 디하이드로게나제(Glucose-6-phosphate 1-dehydrogenase) 및 프럭토키나제(Fructokinase)의 활성이 강화된, L-아미노산을 생산하는 미생물은 L-아미노산을 고효율로 생산할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는 글루코스-6-포스페이트 디하이드로게나제(Glucose-6-phosphate 1-dehydrogenase) 및 프럭토키나제(Fructokinase)의 활성이 강화된, L-아미노산을 생산하는 코리네박테리움 속 미생물을 제공한다.
본 출원에서 용어, "L-아미노산"은 미생물이 각종 탄소원으로부터 대사과정을 거쳐 생산될 수 있는 모든 L-아미노산을 포함하며, 구체적으로는 L-라이신, L-아르기닌, L-히스티딘 등의 염기성 아미노산, L-발린, L-류신, L-글리신, L-이소류신, L-알라닌, L-프롤린, L-메티오닌 등의 비극성 아미노산, L-세린, L-트레오닌, L-시스테인, L-아스파라긴산, L-글루타민 등의 극성 아미노산, L-페닐알라닌, L-티로신, L-트립토판 등의 방향족 아미노산, L-글루탐산, L-아스파르트산 등의 산성 아미노산일 수 있다. 보다 구체적으로 본 출원에서 L-아미노산은 L-라이신(L-lysine) 또는 L-트립토판(L-tryptophan)일 수 있으나, 이에 제한되지 않는다.
본 출원의 용어, "글루코스-6-포스페이트 디하이드로게나제(Glucose-6-phosphate 1-dehydrogenase, 이하, "Zwf")"는 대사 경로인 오탄당 인산 경로(pentose phosphate pathway)에 관여하며, 포도당 6-인산을 산화시키면서 NADP+를 NADPH로 환원시키는 역할을 하는 것을 의미한다.
본 출원의 목적상 상기 단백질은 'G6PD', 'G6PDH', '포도당-6-인산 탈수소효소' 또는 'Zwf'로도 명명될 수 있다. 상기 단백질을 코딩하는 유전자는 그 예로 zwf 유전자일 수 있으나, 이에 제한되지 않는다. 본 출원에서 'zwf 유전자'는 '글루코스-6-포스페이트 디하이드로게나제를 코딩하는 유전자'와 혼용되어 사용될 수 있다. 또한, 상기 단백질은 일 예로 코리네박테리움 글루타미쿰 유래의 단백질과 동일한 단백질일 수 있으나, L-아미노산의 생산을 증가시킬 수 있는 것이라면 이에 제한되지 않는다.
상기 Zwf는 서열번호 1 또는 서열번호 3의 아미노산 서열을 가지거나, 서열번호 1 또는 서열번호 3의 아미노산 서열로 이루어지거나, 또는 서열번호 1 또는 서열번호 3으로 기재되는 아미노산 서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다. 상기 서열번호 1 또는 서열번호 3의 서열은 공지의 데이터 베이스인 NCBI Genbank에서 그 서열을 확인할 수 있다.
상기 Zwf는 서열번호 2 또는 서열번호 4로 기재되는 아미노산 서열을 코딩하는 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다. 상기 서열번호 2 또는 서열번호 4의 서열은 공지의 데이터 베이스인 NCBI Genbank에서 그 서열을 확인할 수 있다.
구체적으로, 상기 Zwf은 서열번호 1, 서열번호 3 및/또는 상기 서열번호 1, 서열번호 3과 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 아미노산 서열일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 Zwf에 상응하는 기능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 Zwf도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원의 용어, "프럭토키나제(Fructokinase, 이하, "CscK")"는 ATP 존재하에서 인산을 전이하여 D-프룩토오스-6-인산과 ADP를 생성하는 반응을 촉매하는 효소를 의미한다.
본 출원의 목적상 상기 단백질은 '과당인산화 효소', '프룩토키나아제', 또는 'CscK'로도 명명될 수 있다. 상기 단백질을 코딩하는 유전자는 그 예로 csck 유전자일 수 있으나, 이에 제한되지 않는다. 본 출원에서 'csck 유전자'는 '프럭토키나제를 코딩하는 유전자'와 혼용되어 사용될 수 있다. 또한, 상기 단백질은 일 예로 에스케리키아 콜라이 (Echerichia coli) 유래의 단백질과 동일한 단백질일 수 있으나, L-아미노산의 생산을 증가시킬 수 있는 것이라면 이에 제한되지 않는다.
상기 CscK는 서열번호 5의 아미노산 서열을 가지거나, 서열번호 5의 아미노산 서열로 이루어지거나 또는 서열번호 5로 기재되는 아미노산 서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다. 상기 서열번호 5의 서열은 공지의 데이터 베이스인 NCBI Genbank에서 그 서열을 확인할 수 있다.
상기 CscK는 서열번호 6으로 기재되는 아미노산 서열을 코딩하는 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다. 상기 서열번호 6의 서열은 공지의 데이터 베이스인 NCBI Genbank에서 그 서열을 확인할 수 있다.
구체적으로, 상기 CscK는 서열번호 5 및/또는 상기 서열번호 5와 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 아미노산 서열일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 CscK에 상응하는 기능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 CscK도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원의 용어 "상동성(homology) 및 동일성(identity)"은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 중간 또는 높은 엄격한 조건(stringent conditions)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90% 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
상기 폴리펩타이드 또는 폴리뉴클레오티드 서열에 대한 상동성 또는 동일성은 예를 들면, 문헌에 의한 알고리즘 BLAST[참조: Karlin 및 Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)], 또는 Pearson에 의한 FASTA(참조: Methods Enzymol., 183, 63, 1990)을 사용하여 결정할 수 있다. 이러한 알고리즘 BLAST에 기초하여, BLASTN이나 BLASTX라고 불리는 프로그램이 개발되어 있다(참조: http://www.ncbi.nlm.nih.gov). 또한, 임의의 아미노산 또는 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology)일 수 있다.
구체적으로, 상기 "L-아미노산을 생산하는 미생물"은 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함한다. 구체적으로, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 L-아미노산 생산을 위하여 유전적 변이가 일어나거나 L-아미노산 생산 활성을 강화시킨 미생물일 수 있다. 본 출원의 목적상, 상기 L-아미노산을 생산하는 미생물은 상기 Zwf 및 Csck 단백질의 발현 또는 활성이 강화되어, 목적하는 L-아미노산 생산능이 증가된 것을 특징으로 하며, 유전적으로 변형된 미생물 또는 재조합 미생물일 수 있으나, 이에 제한되지 않는다.
본 출원의 용어 단백질의 "활성 강화"는, 단백질의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성을 의미한다. 이는 "변형전 활성"과 혼용되어 사용될 수 있다. 단백질의 활성이 내재적 활성에 비하여 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성에 비하여 향상된 것을 의미한다.
상기 "활성 증가"는 외래의 단백질을 도입하거나, 내재적인 단백질의 활성 강화를 통해 달성할 수 있으나, 구체적으로는 내재적인 단백질의 활성 강화를 통해 달성하는 것일 수 있다. 상기 단백질의 활성 강화 여부는 해당 단백질의 활성 정도, 발현량 또는 해당 단백질로부터 생산되는 산물의 양의 증가로부터 확인할 수 있다.
상기 활성 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 단백질의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
본 출원에 있어서, 상기 활성 강화의 대상이 되는 단백질, 즉, 목적 단백질은 Zwf 및 Csck 일 수 있으나, 이에 제한되지 않는다.
구체적으로, 본 출원의 단백질 활성 강화는,
1) 단백질을 코딩하는 유전자의 세포 내 카피수 증가;
2) 단백질을 암호화하는 염색체상의 유전자 발현 조절 서열을 활성이 강력한 서열로 교체;
3) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역의 염기서열의 변형;
4) 단백질 활성이 강화되도록 아미노산 서열을 변형;
5) 단백질 활성이 강화되도록 상기 단백질을 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 활성이 강화되도록 변형된 단백질을 코딩하도록 상기 단백질을 코딩하는 유전자 서열의 변형);
6) 단백질의 활성을 나타내는 외래 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드의 코돈 최적화된 변이형 폴리뉴클레오티드의 도입;
7) 단백질을 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 단백질의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 1) 단백질을 코딩하는 유전자의 세포 내 카피수 증가는, 당업계에 알려진 임의의 방법, 예를 들면, 해당 단백질을 코딩하는 유전자가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터를 숙주세포 내에 도입됨으로써 수행될 수 있다. 또는, 상기 유전자가 작동가능하게 연결된, 숙주세포 내의 염색체 내로 상기 유전자를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "벡터"는 적합한 숙주 내에서 목적하는 단백질을 코딩하는 폴리뉴클레오티드 서열을 목적 단백질을 발현시키기에 적합한 조절 서열에 작동 가능하게 연결된 형태로 함유하는 DNA 제조물을 의미한다. 상기 발현 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
본 출원에서 용어, "형질전환"은 목적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 재조합 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드가 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 상기 형질전환 하는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열 또는 발현조절영역과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
상기 2) 단백질을 암호화하는 염색체상의 유전자 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 발현 조절 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 가지는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현 조절 서열은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 상기 방법은 구체적으로 본래의 프로모터 대신 강력한 이종 프로모터를 연결시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, Trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터 및 rmf 프로모터가 포함될 수 있으나, 이에 제한되지 않고 내재적 활성에 비해 강력한 프로모터로 치환하는 것은 모두 포함한다.
상기 3) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역의 염기서열 변형은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 단백질의 내재적 개시코돈을 상기 내재적 개시코돈에 비해 단백질 발현율이 더 높은 다른 개시코돈으로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다. 상기 교체는 구체적으로 상동재조합에 의하여 상기 유전자를 염색체내로 삽입하는 것일 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 도입하고자 하는 유전자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있으며, 이에 한정되는 것은 아니다. 선택제 (selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
상기 6) 단백질의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 단백질과 동일/유사한 활성을 나타내는 단백질을 암호화하는 외래 폴리뉴클레오티드, 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드를 숙주세포 내로 도입하여 수행될 수 있다. 상기 외래 폴리뉴클레오티드는 상기 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한 없이 사용될 수 있다. 또한 도입된 상기 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화하여 숙주세포 내로 도입할 수 있다. 상기 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 단백질이 생성되어 그 활성이 증가될 수 있다.
상기 7) 단백질을 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 단백질의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 단백질의 활성 강화는, 상응하는 단백질의 활성 또는 농도가 야생형이나 변형전 미생물 균주에서 발현된 단백질의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 단백질로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다. 본 출원에서 용어, "변형전 균주" 또는 "변형전 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 균주 자체이거나, 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미한다. 본 출원에 있어서, 상기 형질 변화는 PheA의 활성 강화일 수 있다. 상기 "변형전 균주" 또는 "변형전 미생물"은 "비변이 균주", "비변형 균주", "비변이 미생물", "비변형 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원에 있어서, 상기 기준 미생물은 L-아미노산을 생산하는 미생물이라면 특별히 제한되지 않으며, 야생형에 비해 L-아미노산 생산능이 강화된 변이 균주 역시 제한 없이 포함된다. 그 예로, L-라이신을 생산하는 코리네박테리움 글루타미쿰 KCCM11016P(한국 등록특허 제10-0159812호), KCCM10770P(한국 등록특허 제10-0924065호), CJ3P(Binder et al. Genome Biology 2012, 13:R40)균주 또는 L-트립토판을 생산하는 코리네박테리움 글루타미쿰 KCCM12218P (한국 등록특허 제10-2035844호) 균주의 생합성 경로를 강화하기 위하여 상기 균주에 하나 이상의 유전적 변형이 추가된 균주가 포함될 수 있으나, 이에 제한되지 않는다.
본 출원의 목적상, 상기 L-아미노산을 생산하는 미생물은 전술한 방법으로 Zwf 및 Csck 활성이 강화되어, L-아미노산을 생산할 수 있는 미생물이라면 모두 가능하다. 본 출원에서 상기 "L-아미노산을 생산하는 미생물"은 "L-아미노산 생산 미생물", "L-아미노산 생산능을 갖는 미생물"과 혼용되어 사용될 수 있으며, 구체적으로 코리네박테리움 속 미생물 일 수 있으나, 이에 제한되지 않는다.
본 출원에서 "코리네박테리움 속 미생물"은 모든 코리네박테리움 속 미생물을 포함할 수 있다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스Cxorynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있고, 더욱 구체적으로 코리네박테리움 글루타미쿰일 수 있다.
한편, 코리네박테리움 속 미생물이 L-아미노산을 생산할 수 있음은 이미 알려져 있었으나, 이의 생산능이 현저히 낮으며 생산 기작에 작용하는 유전자나 기작 원리가 모두 밝혀지지는 않은 상태이다. 따라서, 본 출원의 'L-아미노산을 생산하는 코리네박테리움 속 미생물'은 천연의 야생형 미생물 자체, L-아미노산 생산 기작과 관련된 유전자의 활성을 강화시키거나 불활성시켜 향상된 L-아미노산 생산능을 가지게 된 코리네박테리움 속 미생물, 또는 외부 유전자의 활성을 도입 또는 강화시켜 향상된 L-아미노산 생산능을 가지게 된 코리네박테리움 속 미생물을 의미한다.
본 출원은 다른 하나의 양태로서, 본 출원에 따른 상기 미생물을 배지에서 배양하는 단계; 및 상기 미생물 또는 배지로부터 L-아미노산을 회수하는 단계를 포함하는, L-아미노산 생산방법을 제공한다.
본 출원에 따른 상기 미생물은 앞서 설명한 바와 같다.
본 출원의 방법에 있어서, 코리네박테리움 속 미생물의 배양은 당업계에 알려진 임의의 배양 조건 및 배양 방법이 사용될 수 있다.
본 출원에서 용어 "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 출원에서 L-아미노산을 생산하는 미생물을 이용하여 L-아미노산을 배양하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되는 것은 아니다. 배양에 사용되는 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 코리네박테리움 균주에 대한 배양 배지는 공지되어 있다(예를 들면, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
배지 중에서 사용될 수 있는 탄소원으로는 포도당, 사카로즈, 유당, 과당, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으며, 이에 한정되는 것은 아니다.
사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함된다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으며, 이에 한정되는 것은 아니다.
상기 배지에 포함되는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨을 함유하는 염이 포함될 수 있다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다. 마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나, 이에 제한되지 않는다.
상기 미생물의 배양 중 수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체(예, 공기)를 주입할 수 있다. 배양물의 온도는 보통 20℃내지 45℃ 구체적으로는 25℃ 내지 40℃일 수 있다. 배양 시간은 원하는 L-아미노산의 생성량이 얻어질 때까지 계속할 수 있으나, 구체적으로는, 10 내지 160 시간일 수 있다. 그러나 이들 예시에 제한되는 것은 아니다.
본 출원은 본 출원의 방법에서 상기 배양하는 단계 이전, 배지를 준비하는 단계를 추가적으로 포함할 수 있으나, 이에 제한되지 않는다.
배양물로부터의 L-아미노산의 분리는 당업계에 알려진 통상적인 방법에 의하여 분리될 수 있다. 이러한 분리방법에는, 원심분리, 여과, 크로마토그래피 및 결정화 등의 방법이 이용될 수 있다. 예를 들면, 배양물을 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을, 이온교환 크로마토그래피를 통하여 분리할 수 있으나, 이에 한정되는 것은 아니다.
또한, 상기 회수 단계는 정제 공정을 포함할 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 수행될 수 있다.
본 출원은 다른 하나의 양태로서, 본 출원에 따른 상기 미생물의 L-아미노산 생산 용도를 제공한다.
본 출원에 따른 상기 미생물 및 L-아미노산은 앞서 설명한 바와 같다.
본 출원은 다른 하나의 양태로서, 본 출원에 따른 상기 미생물; 및/또는 상기 미생물의 배양물을 포함하는 L-아미노산 생산용 조성물을 제공한다.
본 출원에 따른 상기 미생물 및 L-아미노산은 앞서 설명한 바와 같다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 강화 벡터의 제작
실시예 1-1. 코리네박테리움 글루타미쿰( Corynebacterium glutamicum ) ATCC13032 유래의 글루코스-6-포스페이트 디하이드로게나제 유전자(zwf)가 강화된 벡터의 제작
상기 유전자의 강화는 코리네박테리움 글루타미쿰 ATCC13032의 트랜스포존(transposon)에 각각 SPL13 프로모터(미국 등록특허 US 10584338 B2)와 코리네박테리움 암모니아게네스 유래의 CJ7 프로모터(미국 등록특허 US 7662943 B2)로 연결된 zwf를 넣어 효과를 확인하였다.
zwf는 코리네박테리움 글루타미쿰 ATCC13032 genomic DNA를 각각 주형으로 하였고, NCBI 염기서열(NC_003450.3) 정보를 바탕으로 서열번호 9, 10(표 1)와 서열번호 13, 14(표 2)의 폴리뉴클레오티드를 포함하는 프라이머를 제작하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)하여 벡터를 제작하기 위한 zwf 유전자 단편을 획득하였다.
pDZTn-Pspl13-zwf(C.gl13032) 프라이머 서열
No. 명칭 DNA 서열
서열번호 7 primer 1 GCAGAAGGAATGAGTTCCTCGGCGCTTCATGTCAACAATC
서열번호 8 primer 2 tgttttgatctcctccaataatc
서열번호 9 primer 3 tattggaggagatcaaaacaGTGAGCACAAACACG
서열번호 10 primer 4 GTTATTAGATGTCGGGCCCATTATGGCCTGCGCCAGGTGT
pDZTn-Pcj7-zwf(C.gl13032) 프라이머 서열
No. 명칭 DNA 서열
서열번호 11 primer 5 GCAGAAGGAATGAGTTCCTCagaaacatcccagcgctact
서열번호 12 primer 6 gagtgtttcctttcgttgggtac
서열번호 13 primer 7 cccaacgaaaggaaacactcGTGAGCACAAACACG
서열번호 14 primer 8 GTTATTAGATGTCGGGCCCATTATGGCCTGCGCCAGGTGT
벡터 및 균주 제작 확인 프라이머 서열
No. 명칭 DNA 서열
서열번호 47 primer 41 ACGACGCTGGTATTTCTCCC
서열번호 48 primer 42 TGATTGTCGATATGACCGGG
PCR 수행 조건
단계 온도 시간
Initialization 95℃ 10분
Denaturation 95℃ 30초
Annealing 62℃ 30초
Elongation 72℃ 1~2분
Post Elongation 72℃ 5분
SPL13 프로모터와 코리네박테리움 암모니아게네스 유래의 CJ7 프로모터를 얻기 위해서 서열번호 7과 8(표 1), 서열번호 11과 12(표 2) 프라이머를 이용하고 PCR(SolgTM Pfu-X DNA polymerase)을 수행하였다(표 4).증폭된 SPL13, CJ7 프로모터 부위와 zwf 유전자 단편 및 ScaI 제한효소로 절단된 벡터 pDZTn (미국 등록특허 US 8932861 B2)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신 (25 mg/l) 이 포합된 LB 고체배지에 도말하였다. 목적한 유전자와 pDZTn이 연결된 벡터로 형질전환된 콜로니를 선별하기 위하여 서열번호 47과 48(표 3) 프라이머로 PCR을 수행하였다. 선별된 콜로니로부터 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 상기 플라스미드를 pDZTn-Pspl13-zwf(C.gl13032), pDZTn-Pcj7-zwf(C.gl13032)으로 명명하였다.
실시예 1-2. 코리네박테리움 글루타미쿰 ATCC13869 유래의 글루코스-6-포스페이트 디하이드로게나제 유전자(zwf)가 강화된 벡터의 제작
코리네박테리움 글루타미쿰 ATCC13869 유래의 zwf 강화 효과 확인은 코리네박테리움 글루타미쿰 ATCC13869 genomic DNA를 각각 주형으로 하였고, 미국 국립보건원 진뱅크(NIH GenBank)에 등록되어 있는 코리네박테리움 글루타미쿰 ATCC13869 유전자 및 주변 염기서열에 대한 정보를 바탕으로 서열번호 17, 18(표 5)와 서열번호 21, 22(표 6)의 폴리뉴클레오티드를 포함하는 프라이머를 제작하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)하여 벡터를 제작하기 위한 zwf 유전자 단편을 획득하였다.
pDZTn-Pspl13-zwf(C.gl13869) 프라이머 서열
No. 명칭 DNA 서열
서열번호 15 primer 9 GCAGAAGGAATGAGTTCCTCGGCGCTTCATGTCAACAATC
서열번호 16 primer 10 tgttttgatctcctccaataatc
서열번호 17 primer 11 tattggaggagatcaaaacaGTGAGCACAAACACG
서열번호 18 primer 12 GTTATTAGATGTCGGGCCCATTATGGCCTGCGCCAGGTGT
pDZTn-Pcj7-zwf(C.gl13869) 프라이머 서열
No. 명칭 DNA 서열
서열번호 19 primer 13 GCAGAAGGAATGAGTTCCTCagaaacatcccagcgctact
서열번호 20 primer 14 gagtgtttcctttcgttgggtac
서열번호 21 primer 15 cccaacgaaaggaaacactcGTGAGCACAAACACG
서열번호 22 primer 16 GTTATTAGATGTCGGGCCCATTATGGCCTGCGCCAGGTGT
SPL13 프로모터와 코리네박테리움 암모니아게네스 유래의 CJ7 프로모터를 얻기 위해서 서열번호 15와 16(표 5), 서열번호 19와 20(표 6) 프라이머를 이용하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)을 수행하였다.
증폭된 SPL13, CJ7 프로모터 부위와 zwf 유전자 단편 및 ScaI 제한효소로 절단된 벡터 pDZTn (미국 등록특허 US 8932861 B2)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신 (25 mg/l) 이 포합된 LB 고체배지에 도말하였다. 목적한 유전자와 pDZTn이 연결된 벡터로 형질전환된 콜로니를 선별하기 위하여 서열번호 47와 48(표 3) 프라이머로 PCR을 수행하였다. 선별된 콜로니로부터 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 이 플라스미드를 pDZTn-Pspl13-zwf(C.gl13869), pDZTn-Pcj7-zwf(C.gl13869) 으로 명명하였다.
실시예 1-3. 에스케리키아 콜라이 ( Echerichia coli ) 유래 프럭토키나제 유전자(cscK)가 강화된 벡터의 제작
에스케리키아 유래의 프럭토키나제 유전자의 염기서열은 이미 명백하게 밝혀져 있으며 공개되어 있다. NCBI의 에스케리키아 콜라이 (Echerichia coli) W (CP002967)로부터 cscK 유전자 정보를 확보하였고, 이를 바탕으로 서열번호 25과 26(표 7), 서열번호 29와 30(표 8)의 폴리뉴클레오티드를 포함하는 프라이머를 제작하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)하여 벡터를 제작하기 위한 cscK 유전자 단편을 획득하였다.
SPL13 프로모터와 CJ7 프로모터를 얻기 위해서 서열번호 23과 24(표 7), 서열번호 27와 28(표 8) 프라이머를 이용하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)을 수행하였다.
증폭된 SPL13, CJ7 프로모터 부위와 cscK(E.co) 유전자 단편 및 ScaI 제한효소로 절단된 벡터 pDZTn (미국 등록특허 US 8932861 B2)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신 (25 mg/l) 이 포합된 LB 고체배지에 도말하였다. 목적한 유전자와 pDZTn이 연결된 벡터로 형질전환된 콜로니를 선별하기 위하여 서열번호 47와 48(표 3) 프라이머로 PCR을 수행하였다. 선별된 콜로니로부터 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 상기 플라스미드를 pDZTn-Pspl13-cscK(E.co), pDZTn-Pcj7-cscK(E.co)으로 명명하였다.
pDZTn-Pspl13-cscK(E.co) 프라이머 서열
No. 명칭 DNA 서열
서열번호 23 primer 17 GCAGAAGGAATGAGTTCCTCGGCGCTTCATGTCAACAATC
서열번호 24 primer 18 tgttttgatctcctccaataatc
서열번호 25 primer 19 tattggaggagatcaaaacaATGTCAGCCAAAGTA
서열번호 26 primer 20 GTTATTAGATGTCGGGCCCACTATTCCAGTTCTTGTCGAC
pDZTn-Pcj7-cscK(E.co) 프라이머 서열
No. 명칭 DNA 서열
서열번호 27 primer 21 GCAGAAGGAATGAGTTCCTCagaaacatcccagcgctact
서열번호 28 primer 22 gagtgtttcctttcgttgggtac
서열번호 29 primer 23 cccaacgaaaggaaacactcATGTCAGCCAAAGTATGGGT
서열번호 30 primer 24 GTTATTAGATGTCGGGCCCACTATTCCAGTTCTTGTCGAC
실시예 1-4. 코리네박테리움 글루타미쿰 ATCC13032 유래 zwf와 에스케리키아 콜라이 유래 cscK가 강화된 벡터의 제작
실시예 1-1과 실시예 1-3의 개별 유전자 강화효과를 확인하여, 두 유전자의 동시 강화 효과를 확인하고자 벡터를 제작하였다.
실시예 1-1의 pDZTn-Pspl13-zwf(C.gl13032)와 실시예 1-3의 pDZTn-Pcj7-cscK(E.co)을 각각 주형으로 하고, 서열번호 31, 32와 서열번호 33, 34(표 9)의 폴리뉴클레오티드를 포함하는 프라이머를 제작하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)하여 Pspl13-zwf(C.gl13032)와 Pcj7-cscK(E.co)을 얻었다. 증폭된 Pspl13-zwf(C.gl13032)와 Pcj7-cscK(E.co) 유전자 단편 및 ScaI 제한효소로 절단된 벡터 pDZTn (미국 등록특허 US 8932861 B2)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신 (25 mg/l) 이 포합된 LB 고체배지에 도말하였다. 목적한 유전자와 pDZTn이 연결된 벡터로 형질전환된 콜로니를 선별하기 위하여 서열번호 47와 48(표 3) 프라이머로 PCR을 수행하였다. 선별된 콜로니로부터 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 상기 플라스미드를 pDZTn-Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co)으로 명명하였다.
위의 방법과 동일하게 실시예 1-1의 pDZTn-Pcj7-zwf(C.gl13032)와 실시예 1-3의 pDZTn-Pspl13-cscK(E.co)을 각각 주형으로 하고, 서열번호 35, 36(표 10)와 서열번호 37, 38(표 10)의 폴리뉴클레오티드를 포함하는 프라이머를 제작하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)하여 Pcj7-zwf(C.gl13032)와 Pspl13-cscK(E.co)을 얻었다. 증폭된 Pcj7-zwf(C.gl13032)와 Pspl13-cscK(E.co) 유전자 단편 및 ScaI 제한효소로 절단된 벡터 pDZTn (미국 등록특허 US 8932861 B2)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신 (25 mg/l) 이 포합된 LB 고체배지에 도말하였다. 목적한 유전자와 pDZTn이 연결된 벡터로 형질전환된 콜로니를 선별하기 위하여 서열번호 47와 48(표 3) 프라이머로 PCR을 수행하였다. 선별된 콜로니로부터 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 상기 플라스미드를 pDZTn-Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co)으로 명명하였다.
pDZTn-Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co) 프라이머 서열
No. 명칭 DNA 서열
서열번호 31 primer 25 GCAGAAGGAATGAGTTCCTCGGCGCTTCATGTCAACAATC
서열번호 32 primer 26 ggatgtttctTTATGGCCTGCGCCA
서열번호33 primer 27 CAGGCCATAAagaaacatcccagcg
서열번호 34 primer 28 GTTATTAGATGTCGGGCCCACTATTCCAGTTCTTGTCGAC
pDZTn-Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co) 프라이머 서열
No. 명칭 DNA 서열
서열번호 35 primer 29 GCAGAAGGAATGAGTTCCTCagaaacatcccagcgctact
서열번호 36 primer 30 atgaagcgccTTATGGCCTGCGCCA
서열번호 37 primer 31 CAGGCCATAAggcgcttcatgtcaa
서열번호 38 primer 32 GTTATTAGATGTCGGGCCCACTATTCCAGTTCTTGTCGAC
실시예 1-5. 코리네박테리움 글루타미쿰 ATCC13869 유래 zwf와 에스케리키아 콜라이 유래 cscK가 강화된 벡터의 제작
실시예 1-2과 실시예 1-3의 개별 유전자 강화효과를 확인하여, 두 유전자의 동시 강화 효과를 확인하고자 벡터를 제작하였다.
실시예 1-2의 pDZTn-Pspl13-zwf(C.gl13869)와 실시예 1-3의 pDZTn-Pcj7-cscK(E.co)을 각각 주형으로 하고, 서열번호 39, 10와 서열번호 41, 42(표 11)의 폴리뉴클레오티드를 포함하는 프라이머를 제작하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)하여 Pspl13-zwf(C.gl13869)와 Pcj7-cscK(E.co)을 얻었다. 증폭된 Pspl13-zwf(C.gl13869)와 Pcj7-cscK(E.co) 유전자 단편 및 ScaI 제한효소로 절단된 벡터 pDZTn (미국 등록특허 US 8932861 B2)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신 (25 mg/l) 이 포합된 LB 고체배지에 도말하였다. 목적한 유전자와 pDZTn이 연결된 벡터로 형질전환된 콜로니를 선별하기 위하여 서열번호 49와 50(표 3) 프라이머로 PCR을 수행하였다. 선별된 콜로니로부터 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 상기 플라스미드를 pDZTn-Pspl13-zwf(C.gl13869)_Pcj7-cscK(E.co)으로 명명하였다.
위의 방법과 동일하게 실시예 1-2의 pDZTn-Pcj7-zwf(C.gl13869)와 실시예 1-3의 pDZTn-Pspl13-cscK(E.co)을 각각 주형으로 하고, 서열번호 43, 44와 서열번호 45, 46(표 12)의 폴리뉴클레오티드를 포함하는 프라이머를 제작하고 표 4의 조건으로 PCR(SolgTM Pfu-X DNA polymerase)하여 Pcj7-zwf(C.gl13869)와 Pspl13-cscK(E.co)을 얻었다. 증폭된 Pcj7-zwf(C.gl13869)와 Pspl13-cscK(E.co) 유전자 단편 및 ScaI 제한효소로 절단된 벡터 pDZTn (미국 등록특허 US 8932861 B2)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신 (25 mg/l) 이 포합된 LB 고체배지에 도말하였다. 목적한 유전자와 pDZTn이 연결된 벡터로 형질전환된 콜로니를 선별하기 위하여 서열번호 47와 48(표 3) 프라이머로 PCR을 수행하였다. 선별된 콜로니로부터 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 이 플라스미드를 pDZTn-Pcj7-zwf(C.gl13869)_Pspl13-cscK(E.co)으로 명명하였다.
pDZTn-Pspl13-zwf(C.gl13869)_Pcj7-cscK(E.co) 프라이머 서열
No. 명칭 DNA 서열
서열번호 39 primer 33 GCAGAAGGAATGAGTTCCTCGGCGCTTCATGTCAACAATC
서열번호 440 primer 34 ggatgtttctTTATGGCCTGCGCCA
서열번호 41 primer 35 CAGGCCATAAagaaacatcccagcg
서열번호 42 primer 36 GTTATTAGATGTCGGGCCCACTATTCCAGTTCTTGTCGAC
pDZTn-Pcj7-zwf(C.gl13869)_Pspl13-cscK(E.co) 프라이머 서열
No. 명칭 DNA 서열
서열번호 43 primer 37 GCAGAAGGAATGAGTTCCTCagaaacatcccagcgctact
서열번호 44 primer 38 atgaagcgccTTATGGCCTGCGCCA
서열번호 45 primer 39 CAGGCCATAAggcgcttcatgtcaa
서열번호 46 primer 40 GTTATTAGATGTCGGGCCCACTATTCCAGTTCTTGTCGAC
실시예 2. 강화 균주의 제작
실시예 2-1. 코리네박테리움 글루타미쿰 ATCC13032 유래의 zwf가 강화된 라이신 생산 균주의 제작
실시예 1-1에서 제작된 pDZTn-Pspl13-zwf(C.gl13032), pDZTn-Pcj7-zwf(C.gl13032) 벡터를 각각 이용하여 L-라이신을 생산하는 코리네박테리움 글루타미쿰 KCCM11016P(한국 등록특허 제10-0159812호), KCCM10770P(한국 등록특허 제10-0924065호), CJ3P(Binder et al. Genome Biology 2012, 13:R40)균주를 전기천공법 (Appl. Microbiol.Biotechnol. (1999) 52:541-545) 으로 형질 전환한 후, 2차 교차 과정을 거쳐 트랜스포존 유전자의 사이에 Pspl13-zwf(C.gl13032)와 Pcj7-zwf(C.gl13032)이 각각 삽입된 균주를 획득하였다. 해당 유전자가 삽입된 위치를 포함한 인접 부위를 증폭할 수 있는 서열번호 47와 서열번호 48의 프라이머(표 3)를 이용하여 PCR 및 염기서열 분석을 수행하였고, 해당 유전적 조작을 확인하였다. 이렇게 수득한 균주를 코리네박테리움 글루타미쿰 KCCM11016P_Pspl13-zwf(C.gl13032), KCCM11016P_Pcj7-zwf(C.gl13032), KCCM10770P_Pspl13-zwf(C.gl13032), KCCM10770P_Pcj7-zwf(C.gl13032), CJ3P_Pspl13-zwf(C.gl13032), CJ3P_Pcj7-zwf(C.gl13032)로 명명하였다.
실시예 2-2. 코리네박테리움 글루타미쿰 ATCC13869 유래의 zwf가 강화된 트립토판 생산 균주의 제작
실시예 1-2에서 제작된 pDZTn-Pspl13-zwf(C.gl13869), pDZTn-Pcj7-zwf(C.gl13869) 벡터를 각각 이용하여 L-트립토판을 생산하는 코리네박테리움 글루타미쿰 KCCM12218P (한국 등록특허 제10-2035844호) 균주를 전기천공법 (Appl. Microbiol.Biotechnol. (1999) 52:541-545) 으로 형질 전환한 후, 2차 교차 과정을 거쳐 트랜스포존 유전자의 사이에 Pspl13-zwf(C.gl13869)와 Pcj7-zwf(C.gl13869)이 각각 삽입된 균주를 획득하였다. 해당 유전자가 삽입된 위치를 포함한 인접 부위를 증폭할 수 있는 서열번호 47와 서열번호 48의 프라이머(표 3)를 이용하여 PCR 및 염기서열 분석을 수행하였고, 해당 유전적 조작을 확인하였다. 이렇게 수득한 균주를 코리네박테리움 글루타미쿰 KCCM12218P_Pspl13-zwf(C.gl13869), KCCM12218P_Pcj7-zwf(C.gl13869)로 명명하였다.
실시예 2-3. 에스케리키아 콜라이 유래 cscK가 강화된 라이신, 트립토판 생산 균주의 제작
실시예 1-3에서 제작된 pDZTn-Pspl13-cscK(E.co), pDZTn-Pcj7-cscK(E.co) 벡터를 각각 이용하여 L-라이신을 생산하는 코리네박테리움 글루타미쿰 KCCM11016P(한국 등록특허 제10-0159812호), KCCM10770P(한국 등록특허 제10-0924065호), CJ3P(Binder et al. Genome Biology 2012, 13:R40) 균주와 L-트립토판을 생산하는 코리네박테리움 글루타미쿰 KCCM12218P (한국 등록특허 제10-2035844호) 균주를 전기천공법 (Appl. Microbiol.Biotechnol. (1999) 52:541-545) 으로 형질 전환한 후, 2차 교차 과정을 거쳐 트랜스포존 유전자의 사이에 Pspl13-cscK(E.co)와 Pcj7-cscK(E.co)이 각각 삽입된 균주를 획득하였다. 해당 유전자가 삽입된 위치를 포함한 인접 부위를 증폭할 수 있는 서열번호 47와 서열번호 48의 프라이머(표 3)를 이용하여 PCR 및 염기서열 분석을 수행하였고, 해당 유전적 조작을 확인하였다. 이렇게 수득한 라이신 생산 균주는 코리네박테리움 글루타미쿰 KCCM11016P_Pspl13-cscK(E.co), KCCM11016P_Pcj7-cscK(E.co), KCCM10770P_Pspl13-cscK(E.co), KCCM10770P_Pcj7-cscK(E.co), CJ3P_Pspl13-cscK(E.co), CJ3P_Pcj7-cscK(E.co)로 명명하고, 트립토판 생산 균주는 KCCM12218P_Pspl13-cscK(E.co), KCCM12218P_Pcj7-cscK(E.co)로 명명하였다.
실시예 2-4. 코리네박테리움 글루타미쿰 ATCC13032 유래의 zwf와 에스케리키아 콜라이 유래 cscK가 강화된 라이신 생산 균주의 제작
실시예 1-4에서 제작된 pDZTn-Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co), pDZTn-Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co) 벡터를 각각 이용하여 L-라이신을 생산하는 코리네박테리움 글루타미쿰 KCCM11016P(한국 등록특허 제10-0159812호), KCCM10770P(한국 등록특허 제10-0924065호), CJ3P(Binder et al. Genome Biology 2012, 13:R40) 균주를 전기천공법 (Appl. Microbiol.Biotechnol. (1999) 52:541-545) 으로 형질 전환한 후, 2차 교차 과정을 거쳐 트랜스포존 유전자의 사이에 Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co)와 Pcj7-zwf(C.gl13032)_ Pspl13-cscK(E.co)이 각각 삽입된 균주를 획득하였다. 해당 유전자가 삽입된 위치를 포함한 인접 부위를 증폭할 수 있는 서열번호 47와 서열번호 48의 프라이머(표 3)를 이용하여 PCR 및 염기서열 분석을 수행하였고, 해당 유전적 조작을 확인하였다. 이렇게 수득한 균주를 코리네박테리움 글루타미쿰 KCCM11016P_Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co), KCCM11016P_Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co), KCCM10770P_ Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co), KCCM10770P_Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co), CJ3P_Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co), CJ3P_Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co)로 명명하였다.
실시예 2-5. 코리네박테리움 글루타미쿰 ATCC13869 유래의 zwf와 에스케리키아 콜라이 유래 cscK가 강화된 트립토판 생산 균주의 제작
실시예 1-5에서 제작된 pDZTn-Pspl13-zwf(C.gl13869)_Pcj7-cscK(E.co), pDZTn-Pcj7-zwf(C.gl13869)_Pspl13-cscK(E.co) 벡터를 각각 이용하여 L-트립토판을 생산하는 코리네박테리움 글루타미쿰 KCCM12218P 균주 (한국 등록특허 제10-2035844호) 균주를 전기천공법 (Appl. Microbiol.Biotechnol. (1999) 52:541-545)으로 형질 전환한 후, 2차 교차 과정을 거쳐 트랜스포존 유전자의 사이에 Pspl13-zwf(C.gl13869)_Pcj7-cscK(E.co)와 Pcj7-zwf(C.gl13869)_Pspl13-cscK(E.co)이 각각 삽입된 균주를 획득하였다. 해당 유전자가 삽입된 위치를 포함한 인접 부위를 증폭할 수 있는 서열번호 47와 서열번호 48의 프라이머(표 3)를 이용하여 PCR 및 염기서열 분석을 수행하였고, 해당 유전적 조작을 확인하였다. 이렇게 수득한 트립토판 생산 균주를 코리네박테리움 글루타미쿰 KCCM12218P_Pspl13-zwf(C.gl13869)_Pcj7-cscK(E.co), KCCM12218P_Pcj7-zwf(C.gl13869)_Pspl13-cscK(E.co)로 명명하였다.
실시예 3. zwf, cscK 강화 균주의 L-라이신 또는 L-트립토판 생산능 비교
실시예 3-1. 코리네박테리움 글루타미쿰 ATCC13032 유래 zwf, 에스케리키아 콜라이 유래 cscK 강화 균주의 L-라이신 생산능 비교
실시예 2-4에서 제작된 KCCM11016P, KCCM10770P, CJ3P 기반 zwf(C.gl13032), cscK(E.co) 동시 강화 균주와 실시예 2-1에서 제작된 KCCM11016P, KCCM10770P, CJ3P 기반 zwf(C.gl13032) 강화 균주, 실시예 2-3에서 제작된 KCCM11016P, KCCM10770P, CJ3P 기반 cscK(E.co) 강화 균주를 각각 아래와 같은 방법으로 배양하여, 균체량, 당소모능, 라이신 생산능을 비교하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 37℃에서 42 시간 동안, 200 rpm에서 진탕 배양하였다. 배양 종료 후 HPLC에 의해 L-라이신의 생산량을 측정하였다. 상기 실험은 3번 반복되었으며, 배양 결과(평균값)는 표 13, 14, 15에 나타내었다.
<종배지 (pH 7.0)>
원당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 22 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
원당 45 g, (NH4)2SO4 15 g, 대두 단백질 10 g, 당밀 10 g, KH2PO4 0.55 g, MgSO4·7H2O 0.6 g, 바이오틴 0.9 mg, 티아민 염산염 4.5 mg, 칼슘-판토텐산 4.5 mg, 니코틴아미드 30 mg, MnSO4 9 mg, FeSO4 9 mg, ZnSO4 0.45 mg, CuSO4 0.45 mg, CaCO3 30 g (증류수 1리터 기준).
상기 제작된 zwf(C.gl13032), cscK(E.co) 단독 강화 또는 동시 강화 라이신 생산 균주들은 하기 표 13에 나타낸 바와 같이 모균주 KCCM11016P 대비 수율 1.2~2.6%P 향상 효과를 확인하였다. 코리네박테리움에서 라이신 1mol 생산을 위해서는 NADPH 4mol이 필요하기 때문에 라이신 생산균주에서 NADPH 공급능의 증가는 곧 수율 증가와 밀접한 연관성을 가진다 (Kjeld Raunkjaer Kjeldsen at el., Biotechnol. Bioeng., 2009 Feb 1;102(2):583-97.). 본 출원에서는 KCCM1016P 균주에 zwf 유전자를 단독 강화하여 NADPH 공급능을 향상시켰고, 이로써 생산량 0.9g/L 향상 효과를 확인하였다. 추가적으로 코리네박테리움의 원당 이용 시 발생하는 세포 내부 과당을 바로 이용할 수 있도록 cscK(E.co) 유전자를 도입하여 모균주 KCCM11016P 대비 15.2% 증가된 2.1/L 향상 효과를 확인하였다. 최종적으로 cscK 와 zwf를 동시 강화함으로써 zwf 유전자를 통한 환원력 공급능이 극대화되어 라이신 수율 향상 효과가 단독강화 대비 크게 증가함을 KCCM11016P_Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co) 균주 평가를 통해 확인하였다.
상기 유전자의 강화 효과는 표 14 와 15와 같이 다른 라이신 생산균주 KCCM10770P, CJ3P 에서도 동일한 효과를 보였다. 모두 zwf(C.gl13032), cscK(E.co) 단독강화 균주보다 동시 강화를 하였을 때, 각각 모균주 대비 22.1%, 27.1% 증가된 생산량 1.9g/L, 1.6g/L 향상된 결과를 보였다.
L-라이신 생산능 비교 (KCCM11016P 기반)
균 주 OD562 소모당(g/L) 라이신 생산량(g/L) 모균주 대비 (%)
KCCM11016P 45.6 50 13.8 100
KCCM11016P_Pspl13-zwf(C.gl13032) 46.1 50 14.7 106.5
KCCM11016P_Pcj7-zwf(C.gl13032) 46.7 50 14.5 105.1
KCCM11016P_Pspl13-cscK(E.co) 45.8 50 14.4 104.3
KCCM11016P_Pcj7-cscK(E.co) 46.4 50 14.4 104.3
KCCM11016P_ Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co) 46.3 50 15.9 115.2
KCCM11016P_ Pcj7-zwf(C.gl13032)_Pspl13-cscK(E.co) 45.9 50 15.6 113.0
L-라이신 생산능 비교 (KCCM10770P 기반)
균 주 OD562 소모당
(g/L)		 라이신 생산량 (g/L) 모균주 대비 (%)
KCCM10770P 63.3 50 8.6 100%
KCCM10770P_Pspl13-zwf(C.gl13032) 60.1 50 9.2 107.0%
KCCM10770P_Pcj7-zwf(C.gl13032) 61.5 50 9 104.7%
KCCM10770P_Pspl13-cscK(E.co) 65.5 50 9.1 105.8%
KCCM10770P_Pcj7-cscK(E.co) 66.1 50 9.4 109.3%
KCCM10770P_ Pspl13-zwf(C.gl13032)_Pcj7-cscK(E.co) 64.9 50 10.5 122.1%
KCCM10770P_ Pcj7-zwf(C.gl13032) _Pspl13-cscK(E.co) 64.1 50 10.2 118.6%
L-라이신 생산능 비교 (CJ3P 기반)
균 주 OD562 소모당
(g/L)		 라이신 생산량 (g/L) 모균주 대비 (%)
CJ3P 48.8 50 5.9 100%
CJ3P_ Pspl13-zwf(C.gl13032) 46.7 50 6.4 108.5%
CJ3P_Pcj7-zwf(C.gl13032) 46.5 50 6.3 106.8%
CJ3P_Pspl13-cscK(E.co) 50.1 50 6.1 103.4%
CJ3P_Pcj7-cscK(E.co) 48.6 50 6.6 111.9%
CJ3P_Pspl13-zwf(C.gl13032)Pcj7-cscK(E.co) 49.4 50 7.5 127.1%
CJ3P_Pcj7_zwf(C.gl13032)_Pspl13-cscK(E.co) 50.3 50 7.2 122.0%
실시예 3-2. 코리네박테리움 글루타미쿰 ATCC13869 유래의 zwf와 에스케리키아 콜라이 유래 cscK 강화 균주의 L-트립토판 생산능 비교
실시예 2-5에서 제작된 KCCM12218P 기반 zwf(C.gl13869), cscK(E.co) 동시 강화 균주와 실시예 2-2에서 제작된 KCCM12218P 기반 zwf(C.gl13869) 강화 균주, 실시예 2-3에서 제작된 KCCM12218P 기반 cscK(E.co) 강화 균주를 각각 아래와 같은 방법으로 배양하여, 균체량, 당소모능, 트립토판 생산능을 비교하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 37℃에서 42 시간 동안, 200 rpm에서 진탕 배양하였다. 배양 종료 후 HPLC에 의해 L-트립토판의 생산량을 측정하였다. 상기 실험은 3번 반복되었으며, 배양 결과(평균값)는 표 16에 나타내었다.
<종배지 (pH 7.0)>
원당 20g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
원당 30g, (NH4)2SO4 15 g, MgSO4 7H2O 1.2 g, KH2PO4 1 g, 효모추출물 5 g, 바이오틴 900 ㎍, 티아민 염산염 4500 ㎍, 칼슘-판토텐산 4500 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 제작된 zwf(C.gl13869), cscK(E.co) 유전자가 단독 강화된 트립토판 생산 균주들은 하기 표 16에 나타낸 바와 같이 모균주인 KCCM12218P 와 비교해 트립토판의 수율이 0.58 ~ 1.67 % 향상되었다. 특히 cscK 유전자의 발현 강화가 zwf 유전자의 강화보다 트립토판 수율 향상에 더 큰 영향을 주었으며, 이는 세포 내부에서 원당이 분해되며 생성된 과당의 일부분이 세포 외부로 배출되지 않고 프럭토즈-6-포스페이트로 전환되어 해당과정으로 유입되었으며, 이러한 현상으로 인해 배출된 과당이 유입되면서 사용되는 PEP pool을 소모하지 않고 트립토판 전구체로 사용한 것으로 판단된다. 또한 zwf 유전자의 발현으로 인한 트립토판 수율 강화는 트립토판의 전구체로 사용되는 PRPP 및 E4P 의 세포내 농도를 향상시킨 것으로 판단된다. 상기 두 유전자 zwf 및 cscK 가 동시 강화된 균주에서는 트립토판 수율 향상 인자들이 통합되면서 모균주인 KCCM12218P 와 비교해 트립토판의 생산량이 34% ~ 45% 향상되었으며, 상기 두 유전자가 단독으로 강화되었을 때와 비교해 월등하게 향상된 트립토판 수율을 확인하였다.
L-트립토판 생산능 비교 (KCCM12218P 기반)
균 주 OD562 소모당 (g/L) 트립토판
생산량 (g/L)		 모균주 대비 (%)
KCCM12218P 69.7 30 2.15 100
KCCM12218P_Pspl13-zwf(C.gl13869) 64.1 30 2.33 108.4
KCCM12218P_Pcj7-zwf(C.gl13869) 68.5 30 2.32 107.9
KCCM12218P _Pspl13-cscK(E.co) 61.9 30 2.65 123.3
KCCM12218P_Pcj7-cscK(E.co) 62.1 30 2.44 113.5
KCCM12218P_Pspl13_zwf(C.gl13869)_Pcj7-cscK(E.co) 61.1 30 2.89 134.4
KCCM12218P_Pcj7_zwf(C.gl13869)_Pspl13-cscK(E.co) 59.8 30 3.12 145.1
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.

Claims (10)

  1. 글루코스-6-포스페이트 디하이드로게나제(Glucose-6-phosphate 1-dehydrogenase) 및 프럭토키나제(Fructokinase)의 활성이 강화된, L-아미노산을 생산하는 코리네박테리움 속 미생물.
  2. 제1항에 있어서, 상기 글루코스-6-포스페이트 디하이드로게나제는 서열번호 1 또는 서열번호 3의 아미노산 서열로 구성되는, L-아미노산을 생산하는 코리네박테리움 속 미생물.
  3. 제1항에 있어서, 상기 프럭토키나제는 서열번호 5의 아미노산 서열로 구성되는, L-아미노산을 생산하는 코리네박테리움 속 미생물.
  4. 제1항에 있어서, 상기 L-아미노산은 L-라이신(L-lysine) 또는 L-트립토판(L-tryptophan)인, 코리네박테리움 속 미생물.
  5. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, 코리네박테리움 속 미생물.
  6. 제1항 내지 제5항 중 어느 한 항에 따른 미생물을 배지에서 배양하는 단계; 및 상기 미생물 또는 배지로부터 L-아미노산을 회수하는 단계를 포함하는, L-아미노산의 생산방법.
  7. 제6항에 있어서, 상기 L-아미노산은 L-라이신 또는 L-트립토판인, L-아미노산의 생산방법.
  8. 제7항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, L-아미노산의 생산방법.
  9. 제1항 내지 제5항 중 어느 한 항에 따른 미생물의 L-아미노산 생산 용도.
  10. 제1항 내지 제5항 중 어느 한 항에 따른 미생물 또는 상기 미생물의 배양물을 포함하는 L-아미노산 생산용 조성물.
PCT/KR2022/002505 2021-03-08 2022-02-21 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법 WO2022191467A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CN202280020233.0A CN117460831A (zh) 2021-03-08 2022-02-21 生产l-氨基酸的棒状杆菌属微生物和使用其生产l-氨基酸的方法
BR112023018087A BR112023018087A2 (pt) 2021-03-08 2022-02-21 Micro-organismo do gênero corynebacterium que produz l-aminoácido, método para produzir l-aminoácido, uso da produção do l-aminoácido e composição para produzir l-aminoácido
MX2023010584A MX2023010584A (es) 2021-03-08 2022-02-21 Microorganismo del genero corynebacterium para la produccion de l-aminoacido y procedimiento para la produccion de l-aminoacido utilizando el mismo.
JP2023546556A JP2024505267A (ja) 2021-03-08 2022-02-21 Ｌ－アミノ酸を生産するコリネバクテリウム属微生物及びこれを用いたｌ－アミノ酸の生産方法
AU2022235362A AU2022235362A1 (en) 2021-03-08 2022-02-21 Microorganism Of The Genus Corynebacterium For Producing L-Amino Acid And Method For Producing L-Amino Acid Using The Same
EP22767363.9A EP4269598A1 (en) 2021-03-08 2022-02-21 Microorganism of genus corynebacterium, producing l-amino acids, and method for producing l-amino acids using same
CA3211373A CA3211373A1 (en) 2021-03-08 2022-02-21 Microorganism of genus corynebacterium, producing l-amino acid, and method for producing l-amino acid using same
US18/464,158 US20240043886A1 (en) 2021-03-08 2023-09-08 Microorganism of the genus corynebacterium for producing l-amino acid and method for producing l-amino acid using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210030087A KR102649245B1 (ko) 2021-03-08 2021-03-08 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
KR10-2021-0030087 2021-03-08

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/464,158 Continuation-In-Part US20240043886A1 (en) 2021-03-08 2023-09-08 Microorganism of the genus corynebacterium for producing l-amino acid and method for producing l-amino acid using the same

Publications (1)

Publication Number Publication Date
WO2022191467A1 true WO2022191467A1 (ko) 2022-09-15

Family

ID=83226866

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/002505 WO2022191467A1 (ko) 2021-03-08 2022-02-21 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법

Country Status (11)

Country Link
US (1) US20240043886A1 (ko)
EP (1) EP4269598A1 (ko)
JP (1) JP2024505267A (ko)
KR (1) KR102649245B1 (ko)
CN (1) CN117460831A (ko)
AR (1) AR125035A1 (ko)
AU (1) AU2022235362A1 (ko)
BR (1) BR112023018087A2 (ko)
CA (1) CA3211373A1 (ko)
MX (1) MX2023010584A (ko)
WO (1) WO2022191467A1 (ko)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR20120111807A (ko) * 2011-04-01 2012-10-11 씨제이제일제당 (주) 에세리키아 속 균주에서 유래된 프락토키나제 유전자가 도입된 코리네박테리움 속 균주 및 상기 균주를 이용하여 ｌ-아미노산을 생산하는 방법
KR101208480B1 (ko) 2003-07-29 2012-12-05 아지노모토 가부시키가이샤 말산 효소 활성이 감쇠된 에스케리키아 세균을 사용하는ｌ-라이신 또는 ｌ-트레오닌의 생산방법
US8932861B2 (en) 2008-04-10 2015-01-13 Cj Cheiljedang Corporation Transformation vector comprising transposon, microorganisms transformed with the vector, and method for producing L-lysine using the microorganism
KR102035844B1 (ko) 2018-02-23 2019-10-23 씨제이제일제당 주식회사 L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR101208480B1 (ko) 2003-07-29 2012-12-05 아지노모토 가부시키가이샤 말산 효소 활성이 감쇠된 에스케리키아 세균을 사용하는ｌ-라이신 또는 ｌ-트레오닌의 생산방법
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
US8932861B2 (en) 2008-04-10 2015-01-13 Cj Cheiljedang Corporation Transformation vector comprising transposon, microorganisms transformed with the vector, and method for producing L-lysine using the microorganism
KR20120111807A (ko) * 2011-04-01 2012-10-11 씨제이제일제당 (주) 에세리키아 속 균주에서 유래된 프락토키나제 유전자가 도입된 코리네박테리움 속 균주 및 상기 균주를 이용하여 ｌ-아미노산을 생산하는 방법
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
KR102035844B1 (ko) 2018-02-23 2019-10-23 씨제이제일제당 주식회사 L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
APPL. MICROBIOL. BIOTECHNOL, vol. 52, 1999, pages 541 - 545
APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545
BECKER, J. KLOPPROGGE, C. HEROLD, A. ZELDER, O. BOLTEN, C.J. WITTMANN, C.: "Metabolic flux engineering of l-lysine production in Corynebacterium glutamicum-over expression and modification of G6P dehydrogenase", JOURNAL OF BIOTECHNOLOGY, ELSEVIER, AMSTERDAM NL, vol. 132, no. 2, 22 October 2007 (2007-10-22), Amsterdam NL , pages 99 - 109, XP022308433, ISSN: 0168-1656, DOI: 10.1016/j.jbiotec.2007.05.026 *
BINDER ET AL., GENOME BIOLOGY, vol. 13, 2012, pages 40
D. G. GIBSON ET AL., NATURE METHODS, vol. 6, no. 5, May 2009 (2009-05-01)
DATABASE PROTEIN 28 February 2022 (2022-02-28), ANONYMOUS : "MULTISPECIES: aminoimidazole riboside kinase [Enterobacteriaceae] ", XP055965678, retrieved from NCBI Database accession no. WP_001274885 *
DATABASE PROTEIN 7 October 2016 (2016-10-07), ANONYMOUS : "Glucose-6-phosphate 1-dehydrogenase [Corynebacterium glutamicum ATCC 13032]", XP055965682, retrieved from NCBI Database accession no. BAB98969 *
DATABASE PROTEIN 8 June 2021 (2021-06-08), ANONYMOUS : "glucose-6-phosphate dehydrogenase [Corynebacterium glutamicum]", XP055965681, retrieved from NCBI Database accession no. WP_038584208 *
F. M. AUSUBEL ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
KARLINALTSCHUL, PRO. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873
KJELD RAUNKJAER KJELDSEN ET AL., BIOTECHNOL. BIOENG., vol. 102, no. 2, 1 February 2009 (2009-02-01), pages 583 - 97
SAMBROOK ET AL., MOLECULAR CLONING, 2012
SITNICKA ET AL.: "Functional Analysis of Genes", ADVANCES IN CELL BIOLOGY., vol. 2, 2010, pages 1 - 16

Also Published As

Publication number Publication date
MX2023010584A (es) 2023-09-22
BR112023018087A2 (pt) 2023-10-03
JP2024505267A (ja) 2024-02-05
CN117460831A (zh) 2024-01-26
US20240043886A1 (en) 2024-02-08
KR102649245B1 (ko) 2024-03-21
CA3211373A1 (en) 2022-09-15
AU2022235362A9 (en) 2024-05-16
EP4269598A1 (en) 2023-11-01
AU2022235362A1 (en) 2023-08-17
KR20220126029A (ko) 2022-09-15
AR125035A1 (es) 2023-05-31

Similar Documents

Publication Publication Date Title
WO2021187781A1 (ko) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2014208970A1 (ko) 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2016148490A1 (ko) 피루브산 디하이드로게나아제 변이체, 이를 포함하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2015156583A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022149865A2 (ko) GlxR 단백질 변이체 또는 이를 이용한 쓰레오닌 생산방법
WO2021242032A1 (ko) 신규 l-타이로신 배출 단백질 변이체 및 이를 이용한 l-타이로신을 생산하는 방법
WO2022191467A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2022005022A1 (ko) L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22767363

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022767363

Country of ref document: EP

Effective date: 20230725

WWE Wipo information: entry into national phase

Ref document number: 2023546556

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2022235362

Country of ref document: AU

Date of ref document: 20220221

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 3211373

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 202280020233.0

Country of ref document: CN

Ref document number: MX/A/2023/010584

Country of ref document: MX

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023018087

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112023018087

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230906

NENP Non-entry into the national phase

Ref country code: DE