WO2021187781A1 - 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법 - Google Patents

프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법 Download PDF

Info

Publication number
WO2021187781A1
WO2021187781A1 PCT/KR2021/002763 KR2021002763W WO2021187781A1 WO 2021187781 A1 WO2021187781 A1 WO 2021187781A1 KR 2021002763 W KR2021002763 W KR 2021002763W WO 2021187781 A1 WO2021187781 A1 WO 2021187781A1
Authority
WO
WIPO (PCT)
Prior art keywords
tryptophan
microorganism
activity
producing
protein
Prior art date
Application number
PCT/KR2021/002763
Other languages
English (en)
French (fr)
Inventor
서창일
김현아
손성광
정기용
정무영
김태연
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to JP2022556021A priority Critical patent/JP2023518743A/ja
Priority to CN202180022503.7A priority patent/CN115516097A/zh
Priority to CA3171191A priority patent/CA3171191A1/en
Priority to MX2022011543A priority patent/MX2022011543A/es
Priority to US17/911,083 priority patent/US20230134555A1/en
Priority to BR112022018514A priority patent/BR112022018514A2/pt
Publication of WO2021187781A1 publication Critical patent/WO2021187781A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/227—Tryptophan
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01051—Prephenate dehydratase (4.2.1.51)

Definitions

  • the present application relates to a method for producing L-tryptophan by enhancing prephenate dehydratase (PheA) activity.
  • PheA prephenate dehydratase
  • L-tryptophan is one of the essential amino acids and has been widely used as a raw material for pharmaceuticals such as feed additives and infusions, and as a material for health foods.
  • the direct fermentation method using microorganisms is mainly used for the production of L-tryptophan.
  • Microorganisms used for L-tryptophan production were initially selected for chemical or physical mutations, and strains showing resistance to L-tryptophan analogs were mainly used. Accordingly, recombinant strains using genetic manipulation techniques are mainly used.
  • the present inventors have produced a Corynebacterium strain that produces a high yield of L-tryptophan without deletion and weakening of the phenylalanine or tyrosine pathway from a wild-type Corynebacterium strain (US Publication US 2020) -0063219 A1).
  • a Corynebacterium strain producing the high yield of L-tryptophan there was no phenomenon of phenylalanine accumulation in the culture medium during high-concentration fermenter culture, and tyrosine was produced at a level of 0.2 g/L at the end of the culture. It was observed.
  • the strain had a problem in that L-tryptophan production could not be maximized as anthranilate was produced in the latter half of culture.
  • the present inventors have discovered that the biosynthesis between phenylalanine and tyrosine from prephenate through enhancement of prephenate dehydratase (PheA) activity in addition to the Corynebacterium strain producing the high yield of L-tryptophan.
  • the distribution was corrected.
  • Aromatic amino acid production correction in this competitive pathway not only controls the final production amount of phenylalanine or tyrosine in the culture medium, but also reduces the production of anthranilate in the second half of culture, and as a result, the L-tryptophan production was remarkably improved, thereby completing the present application.
  • the present application is to provide a microorganism producing L-tryptophan with enhanced prephenate dehydratase activity.
  • the present application provides a method for producing L-tryptophan, comprising culturing a microorganism producing L-tryptophan in a medium having enhanced prephenate dehydratase activity.
  • the present application provides a composition for producing L-tryptophan, comprising a microorganism producing L-tryptophan with enhanced prephenate dehydratase activity.
  • the microorganism producing L-tryptophan with enhanced prephenate dehydratase activity of the present application can minimize the accumulation of anthranilate and produce L-tryptophan with high efficiency.
  • FIG. 1 is a schematic diagram of a pDCM2 plasmid.
  • prephenate dehydratase activity is enhanced, provides a microorganism producing L- tryptophan.
  • L-tryptophan is one of 20 ⁇ -amino acids, and is an essential amino acid that is not biosynthesized in many organisms, including humans. Tryptophan is known to mainly act as a biochemical precursor, and for example, various substances such as neurotransmitters such as serotonin, neurohormones such as melatonin, niacin and auxin are synthesized from tryptophan.
  • L-tryptophan is synthesized from chorismate (chorismic acid), and a group of genes encoding enzymes involved in this process is known as tryptophan operon (Trp operon).
  • the tryptophan operon is known to include a structural gene and an expression regulatory region. Ordinary tryptophan operon is actively transcribed to produce a sufficient amount of tryptophan required by the cell, but when there is sufficient intracellular tryptophan, a repressor binds to tryptophan and the tryptophan operon is inactivated, so transcription is inhibited. .
  • the tryptophan operon may be derived from various microorganisms such as microorganisms of the genus Corynebacterium and microorganisms of the genus Escherichia.
  • the "expression control region" of the tryptophan operon refers to a region that exists upstream of the structural gene constituting the tryptophan operon and can regulate the expression of the structural gene.
  • the structural gene constituting the tryptophan operon in the microorganism of the genus Corynebacterium may be composed of trpE, trpG, trpD, trpC, trpB, and trpA genes, and the structural gene constituting the tryptophan operon in the microorganism of the genus Escherichia is trpE, It may be composed of trpD, trpC, trpB, and trpA genes.
  • the expression control region of the tryptophan operon may be present upstream of trpE at the 5' position of the tryptophan operon structural gene.
  • tryptophan regulator trp regulator; trpR
  • promoter trp promoter
  • operator trp operator
  • tryptophan leader peptide trp leaderpeptide; trp L
  • tryptophan attenuation factor trp attenuator
  • it may include a promoter (trp promoter), an operator (trp operator), a tryptophan leader peptide (trp leaderpeptide; trp L), and a tryptophan attenuator (trp attenuator).
  • prephenate dehydratase (hereinafter, "PheA") is an enzyme of the pathway for producing L-phenylalanine from chorismate or prephenate, and competes with the tyrosine biosynthetic pathway. It is known as an enzyme in the phase.
  • the protein may also be referred to as a bifunctional chorismate mutase/prephenate dehydratase.
  • the gene encoding the protein may be, for example, a pheA gene, but is not limited thereto, and the pheA gene may be regulated by the tryptophan operon described above. In the present application, ' pheA gene' may be used interchangeably with 'gene encoding prephenate dehydratase' and 'pheA gene'.
  • the PheA may have the amino acid sequence of SEQ ID NO: 1, consist of the amino acid sequence of SEQ ID NO: 1, or include the amino acid sequence set forth in SEQ ID NO: 1, but is not limited thereto.
  • the sequence of SEQ ID NO: 1 can be confirmed in NCBI Genbank, a known database.
  • the PheA has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology with SEQ ID NO: 1 and/or SEQ ID NO: 1 ) or an amino acid sequence having identity.
  • PheA having an amino acid sequence in which some sequences are deleted, modified, substituted or added is also included within the scope of the present application, as long as the amino acid sequence has such homology or identity and exhibits a function corresponding to the PheA.
  • homology and identity refer to the degree to which two given amino acid sequences or base sequences are related, and may be expressed as a percentage.
  • homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used.
  • Substantially homologous or identical sequences under moderate or high stringent conditions generally contain at least about 50%, 60%, 70%, 80% of the total or full-length of the sequence. or more than 90% hybrid. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
  • Homology or identity to said polypeptide or polynucleotide sequence is determined, for example, by the algorithm BLAST according to the literature [Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)], or FASTA by Pearson (Methods Enzymol., 183, 63, 1990).
  • BLAST a program called BLASTN or BLASTX has been developed (refer to http://www.ncbi.nlm.nih.gov).
  • L-tryptophan-producing microorganism refers to a microorganism that is endowed with L-tryptophan-producing ability to a microorganism naturally having L-tryptophan-producing ability or a parent strain without L-tryptophan-producing ability.
  • the microorganism may be a microorganism producing L-tryptophan with enhanced PheA activity, but is not limited thereto.
  • the "L-tryptophan-producing microorganism” includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially. More specifically, it is a microorganism in which a specific mechanism is weakened or enhanced due to causes such as insertion of an external gene or intensification or inactivation of the activity of an endogenous gene, and a genetic mutation occurs or L- It may be a microorganism that has enhanced tryptophan production activity.
  • the L-tryptophan-producing microorganism is characterized in that the PheA activity is enhanced, thereby increasing the desired L-tryptophan production ability, and may be a genetically modified microorganism or a recombinant microorganism, but limited thereto doesn't happen
  • the term “enhancement of activity” of a protein means that the activity of the protein is increased compared to the intrinsic activity.
  • the "intrinsic activity” refers to the activity of a specific protein originally possessed by the parent strain or unmodified microorganism before the transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “pre-modification activity”.
  • pre-modification activity When the activity of a protein is "increased" compared to the intrinsic activity, it means that the activity of a specific protein is improved compared to the original activity of the parent strain or the unmodified microorganism before transformation.
  • the "increase in activity” can be achieved by introducing an exogenous protein or enhancing the activity of an intrinsic protein, but specifically, it may be achieved through enhancing the activity of an intrinsic protein. Whether or not the activity of the protein is enhanced can be confirmed from the increase in the level of activity, expression, or the amount of product produced from the protein.
  • the protein to which the activity is enhanced that is, the target protein may be PheA, but is not limited thereto.
  • the product produced from the corresponding protein may be L-tryptophan, but is not limited thereto.
  • the enhancement of the activity of the protein can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target protein compared to the microorganism before modification.
  • the method may be one using genetic engineering or protein engineering, but is not limited thereto.
  • the method for enhancing protein activity using the genetic engineering is, for example,
  • the method for enhancing protein activity using the protein engineering may be performed by, for example, selecting an exposed site by analyzing the tertiary structure of the protein and modifying or chemically modifying it, but is not limited thereto.
  • the increase in the intracellular copy number of the gene encoding the protein can be performed by any method known in the art, for example, a gene encoding the protein can be replicated and functioned independently of the host, to which the gene encoding the protein is operably linked. This can be carried out by introducing the vector into a host cell. Alternatively, a vector capable of inserting the gene into a chromosome in the host cell, to which the gene is operably linked, may be introduced into the host cell, but is not limited thereto.
  • the term "vector” refers to a DNA preparation containing a polynucleotide sequence encoding a protein of interest in a suitable host in a form operably linked to regulatory sequences suitable for expressing the protein of interest.
  • the expression control sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector After transformation into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited as long as it is capable of replication in a host cell, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, ⁇ MBL3, ⁇ MBL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors can be used.
  • the vector usable in the present application may be pDCM2 (FIG. 1, SEQ ID NO: 3) prepared for insertion and replacement of genes in the Corynebacterium chromosome, but is not particularly limited thereto, and a known expression vector may be used. Can be used.
  • the term "transformation” refers to introducing a recombinant vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide it may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome.
  • the transformation method includes any method of introducing a nucleic acid into a cell, and can be performed by selecting a suitable standard technique as known in the art depending on the host cell.
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence or expression control region that initiates and mediates transcription of the polynucleotide encoding the target protein of the present application. do.
  • the operable linkage may be prepared using a genetic recombination technique known in the art, and site-specific DNA cleavage and ligation may be made using a cleavage and ligation enzyme in the art, but is not limited thereto.
  • the method for replacing a gene expression control sequence on a chromosome encoding a protein with a sequence with strong activity is any method known in the art, for example, a nucleic acid sequence is deleted to further enhance the activity of the expression control sequence. , insertion, non-conservative or conservative substitution, or a combination thereof by inducing a mutation in the sequence, or by replacing the nucleic acid sequence with a stronger activity.
  • the expression control sequence is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence for controlling the termination of transcription and translation, and the like.
  • the method may specifically be to link a strong heterologous promoter instead of the original promoter, but is not limited thereto.
  • strong promoters examples include the mutant lysC promoter (US 8426577), the CJ7 promoter (US 7662943 B2), the CJ1 promoter (US 7662943 B2), the lac promoter, the Trp promoter, the trc promoter, tac promoter, lambda phage PR promoter, PL promoter and tet promoter may be included, but are not limited thereto.
  • the strong promoter usable in the present application may be PlysCm1 (SEQ ID NO: 4) produced by changing some sequences of the variant lysC promoter (US Registration Publication No. US 8426577), but is not particularly limited thereto, and a known promoter can be used
  • the method of modifying the nucleotide sequence of the protein start codon or 5'-UTR region is any method known in the art, for example, the protein expression rate is higher than the intrinsic start codon of the protein. It may be substituted with another higher start codon, but is not limited thereto.
  • the method of modifying the polynucleotide sequence on the chromosome to increase the protein activity is any method known in the art, for example, deletion, insertion, ex vivo of the nucleic acid sequence to further enhance the activity of the polynucleotide sequence. It can be carried out by inducing mutation by total or conservative substitution or a combination thereof, or by replacing it with a polynucleotide sequence improved to have stronger activity. The replacement may specifically be to insert the gene into the chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether the gene to be introduced is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface protein expression. Markers to be given may be used, but the present invention is not limited thereto. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the introduction of the foreign polynucleotide exhibiting the activity of the protein can be performed by any method known in the art, for example, a foreign polynucleotide encoding a protein exhibiting the same/similar activity as the protein, or a codon-optimized method thereof. It can be carried out by introducing the variant polynucleotide into a host cell.
  • the foreign polynucleotide may be used without limitation in origin or sequence as long as it exhibits the same/similar activity as the protein.
  • the introduced foreign polynucleotide can be introduced into the host cell by optimizing its codon so that the optimized transcription and translation are performed in the host cell.
  • the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to produce a protein and increase its activity.
  • Such enhancement of protein activity may be that the activity or concentration of the corresponding protein is increased based on the activity or concentration of the protein expressed in the wild-type or pre-modified microbial strain, or the amount of product produced from the protein may be increased.
  • the present invention is not limited thereto.
  • the term "pre-transformation strain” or "pre-transformation microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a natural strain itself, or a genetic variation caused by an artificial factor. This means the strain before the change.
  • the transformation may be enhancement of PheA activity.
  • pre-modified strain or "pre-modified microorganism” may be used interchangeably with “unmodified strain”, “unmodified strain”, “unmodified microorganism”, “unmodified microorganism” or “reference microorganism”.
  • the reference microorganism is not particularly limited as long as it is a microorganism producing L-tryptophan, and mutant strains having enhanced L-tryptophan production ability compared to the wild type are also included without limitation.
  • mutant strains having enhanced L-tryptophan production ability compared to the wild type are also included without limitation.
  • wild-type Corynebacterium glutamicum ATCC13869 strain, CJ04-8321 strain (PCT Publication No. WO WO2019-164346 A1) or a strain in which one or more genetic modifications are added to the strain to enhance the L-tryptophan biosynthesis pathway may be included, but is not limited thereto.
  • the one or more genetic modifications are, for example, overexpressing the activity of the L-tryptophan operon; improving the supply and efficiency of L-tryptophan precursors; enhance the excretion of L-tryptophan; attenuating or inactivating the activity of competitive pathway genes, L-tryptophan operon directional pathway regulators, L-tryptophan transgenes, L-tryptophan uptake and degradation genes; It may be any one or more genetic modifications selected from among them, but is not limited thereto.
  • the genetic modification for overexpressing the activity of the L-tryptophan operon may be, for example, i) strengthening the promoter of the L-tryptophan biosynthesis gene operon, ii) feedback of the TrpE protein according to the improvement of L-tryptophan operon endogenous production Restriction (feedback inhibition) may be eliminated, and iii) may be to strengthen the promoter of the L-tryptophan biosynthesis gene operon, specifically, i) replaces the promoter of the L-tryptophan biosynthesis gene operon with a strong promoter SPL7 and trpE(P21S)DCBA or trpE(S38R)DCBA, which are L-tryptophan operons having a feedback-restricted trpE trait, in ii) above, iii) is L-tryptophan biosynthesis gene operon It may be reinforced by replacing the promoter of SPL7 with a strong promoter, but is not limited thereto.
  • the genetic modification to improve the supply and efficiency of the L-tryptophan precursor is, for example, the continuous supply of L-tryptophan precursors such as E4P (erythorse-4-phosphate) and the expression of related genes for efficient use of energy may be to enhance, specifically, tkt (transketolase) may be to introduce a gene encoding or enhance its expression, but is not limited thereto.
  • L-tryptophan precursors such as E4P (erythorse-4-phosphate)
  • tkt transketolase
  • tkt transketolase
  • the genetic modification to improve the excretion of L-tryptophan may be, for example, introducing a foreign membrane protein that improves the excretion of L-tryptophan, specifically, Herbaspirillum rhizosphaerae )-derived membrane It may be to introduce a gene encoding a protein (registration number NZ_LFLU01000012.1), but is not limited thereto.
  • the strain to which the one or more genetic modifications have been added includes, for example, SPL7, a strong promoter for strain ATCC13869, and CA04-8325 (US Publication of the United States Publications) Publication US 2020-0063219 A1), CA04-8352 in which the tkt gene is inserted into strain CA04-8325 (PCT Publication No. WO WO2019-164346 A1), which encodes a membrane protein derived from Herbaspilium risospere in strain CJ04-8352 It may be a CA04-8405 strain (US Publication US 2020-0063219 A1) produced by introducing a gene, but is not limited thereto.
  • the microorganism producing L-tryptophan may be any microorganism capable of producing L-tryptophan by enhancing PheA activity by the above-described method.
  • the term "L-tryptophan-producing microorganism” may be used interchangeably with “L-tryptophan-producing microorganism” and "microorganism having L-tryptophan-producing ability”.
  • the microorganism is, for example, Corynebacterium (Corynebacterium) genus Escherichia (Escherichia) genus Enterobacter (Enterbacter), An air Winiah (Erwinia) genus, Serratia marcescens (Serratia) genus, Providencia (Providencia ) may be a microorganism belonging to the genus and Brevibacterium , specifically, may be a microorganism belonging to the genus Corynebacterium .
  • Corynebacterium genus microorganisms are Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium station nis ( Corynebacterium stationis ), Corynebacter Rium singulare ( Corynebacterium singulare ), Corynebacterium halotolerans ( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium glutamicum ), Coryn
  • Another aspect of the present application provides a method for producing L-tryptophan, comprising culturing a microorganism producing L-tryptophan in a medium having enhanced prephenate dehydratase activity.
  • microorganisms producing the prephenate dehydratase, activity enhancement, and L-tryptophan are as described above.
  • the step of culturing the microorganism is not particularly limited, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, and the like.
  • the culture conditions are not particularly limited thereto, but use a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) to an appropriate pH (eg, pH 5 to 9, specifically can control pH 6 to 8, most specifically pH 7.0) and maintain aerobic conditions by introducing oxygen or an oxygen-containing gas mixture into the culture.
  • the culture temperature may be maintained at 20 to 45° C., specifically 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • the amino acids produced by the culture may be secreted into the medium or remain in the cells.
  • the culture medium used is a carbon source that includes sugars and carbohydrates (eg, glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), oils and fats (eg, soybean oil, sunflower seeds). Oil, peanut oil and coconut oil), fatty acids (eg palmitic acid, stearic acid and linoleic acid), alcohols (eg glycerol and ethanol), and organic acids (eg acetic acid) may be used individually or in combination. , but not limited thereto.
  • sugars and carbohydrates eg, glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose
  • oils and fats eg, soybean oil, sunflower seeds. Oil, peanut oil and coconut oil
  • fatty acids eg palmitic acid, stearic acid and linoleic acid
  • alcohols eg glycerol and ethanol
  • organic acids eg acetic acid
  • Nitrogen sources include nitrogen-containing organic compounds (e.g., peptone, yeast extract, broth, malt extract, corn steep liquor, soy meal and urea), or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate) may be used individually or in combination, but is not limited thereto.
  • organic compounds e.g., peptone, yeast extract, broth, malt extract, corn steep liquor, soy meal and urea
  • inorganic compounds e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate
  • potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium-containing salt corresponding thereto, etc. may be used individually or in combination, but is not limited thereto.
  • the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulf
  • the method according to the present application may further include the step of recovering L-tryptophan from the cultured medium or microorganism.
  • the method of recovering the amino acid produced in the culturing step of the present application may be to collect the desired amino acid from the culture medium using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC may be used, and a desired amino acid may be recovered from the medium or microorganism using a suitable method known in the art.
  • the recovery step may include a purification process, and may be performed using a suitable method known in the art.
  • the recovered amino acid may be in a purified form or a microbial fermentation broth containing the amino acid (Introduction to Biotechnology and Genetic Engineering, A. J. Nair., 2008).
  • the target amino acid can be efficiently recovered.
  • compositions for producing L-tryptophan including a microorganism producing L-tryptophan, in which prephenate dehydratase activity is enhanced.
  • microorganisms producing the prephenate dehydratase, activity enhancement, and L-tryptophan are as described above.
  • the composition for producing L-tryptophan includes the pheA gene encoding the PheA, and may include without limitation a composition capable of enhancing the PheA or pheA gene.
  • the construct may be in a form included in a vector so that the operably linked gene can be expressed in the introduced host cell, as described above.
  • the expression of the pheA gene which is a gene encoding the prephenate dehydratase, may be enhanced by increasing the copy number of the gene or replacing it with a strong promoter.
  • Another aspect of the present application provides the use of the composition for the production of L-tryptophan.
  • a plasmid (pDCM2, FIG. 1, SEQ ID NO: 3) for the insertion and replacement of genes in the Corynebacterium chromosome was designed, and the plasmid was synthesized using the Gene-synthesis service of Binix Co., Ltd.
  • a plasmid was designed to include a restriction enzyme that is easy to use for cloning with reference to the generally known sacB system related paper [Gene, 145 (1994) 69-73].
  • the thus synthesized pDCM2 plasmid has the following characteristics.
  • Example 2 Preparation of a plasmid for enhancing prephenate dehydratase
  • prephenate dehydratase (hereinafter referred to as "pheA"), some sequences were changed based on the mutant lysC promoter known as a strong promoter (US Registration Publication No. US 8426577 B2) to SEQ ID NO: 4 and synthesized using the gene synthesis service of Bionics Co., Ltd., which was named PlysCm1 promoter.
  • PlysCm1 promoter Using the PlysCm1 promoter to prepare a plasmid to enhance the free phenate di Hydra other dehydratase activity by adding the pheA gene insert or replace the wild type promoter of the pheA gene as PlysCm1.
  • Example 2-1 Construction of a plasmid for gene insertion
  • PCR was performed to obtain the above fragments.
  • Solg TM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification was performed at 95°C for 4 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds after repeating 27 times. Polymerization reaction was performed at 72° C. for 5 minutes.
  • a PlysCm1 promoter fragment was obtained using SEQ ID NO: 9 and SEQ ID NO: 10 using the synthesized SEQ ID NO: 4 as a template.
  • a pheA gene fragment (SEQ ID NO: 2) was obtained using SEQ ID NO: 11 and SEQ ID NO: 12 using the wild species Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template.
  • the primer sequences used herein are shown in Table 2 below.
  • Solg TM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification was repeated 27 times by denaturing at 95°C for 4 minutes, then denaturing at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 1 minute. Polymerization reaction was performed at 72° C. for 5 minutes.
  • the upstream fragment, the downstream fragment, the PlysCm1 promoter fragment, the pheA gene fragment, and the SmaI restriction enzyme-cleaved vector pDCM2 for chromosome transformation of the region where homologous recombination occurs on the chromosome obtained through the above process were prepared using the Gibson assembly method (DG Gibson). et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) was used to obtain a recombinant plasmid by cloning, which was named pDCM2-Tn::PlysCm1_pheA.
  • DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix
  • a gene fragment including the PlysCm1 promoter and its downstream was obtained by using the previously prepared pDCM2-Tn::PlysCm1_pheA plasmid as a template and primers SEQ ID NO: 15 and SEQ ID NO: 16.
  • the primer sequences used herein are shown in Table 3 below.
  • Polymerase Solg TM Pfu-X DNA polymerase was used to obtain the above fragments, and PCR amplification was performed at 95°C for 4 minutes, then at 95°C for 30 seconds, denatured at 95°C for 30 seconds, annealed at 60°C for 30 seconds, and polymerized at 72°C for 50 seconds. After repeating 27 times, polymerization reaction was performed at 72° C. for 5 minutes.
  • a recombinant plasmid was obtained by cloning the vector pDCM2 for chromosome transformation cut with the SmaI restriction enzyme, the upstream fragment of the pheA promoter obtained through the above process, the promoter and downstream fragment including PlysCm1, using the Gibson assembly method, and this was obtained as pDCM2 -Pn::PlysCm1_pheA was named.
  • Example 3 Preparation of strains with enhanced expression of prephenate dehydratase and confirmation of tryptophan production
  • CA04 produced by introducing a gene (registration number NZ_LFLU01000012.1) encoding a membrane protein derived from Herbaspirillum rhizosphaerae into a tryptophan-producing strain CA04-8352 (Korean Patent No. 10-1968317) Electroporation of pDCM2-Tn::PlysCm1_pheA prepared in Example 2-1 to the -8405 strain (KCCM12099P, US Publication No. US 2020-0063219 A1) (Appl. Microbiol. Biotechnol. (1999) 52:541-545) ) to obtain a strain in which the PlysCm1_pheA gene was additionally inserted through a secondary crossover process.
  • the gene was inserted through PCR amplification and genomic sequencing using a pair of primers of SEQ ID NO: 17 and SEQ ID NO: 18 that can amplify the external regions of the homologous recombination upstream region and the downstream region, respectively.
  • the strain into which the gene was inserted was named CM05-9157.
  • the primer sequences used herein are shown in Table 4 below.
  • the CA04-8405 strain was transformed with the pDCM2-Pn::PlysCm1_pheA prepared in Example 2-2 using electroporation, and then the wild-type pheA promoter was converted to the PlysCm1 promoter through a secondary crossover process.
  • a replaced strain was obtained. It was confirmed that the promoter was replaced through PCR amplification and genome sequencing using a pair of primers of SEQ ID NO: 19 and SEQ ID NO: 20 capable of amplifying the regions outside of the corresponding recombination upstream region and the downstream region, respectively.
  • the strain in which the promoter was replaced was named CM05-9158.
  • the primer sequences used herein are shown in Table 5 below.
  • the CA04-8405 strain was used as a control, and culture and tryptophan production were compared in the following manner.
  • Each strain was inoculated in a 250 ml corner-baffle flask containing 25 ml of the seed medium, and incubated at 30° C. for 20 hours with shaking at 200 rpm.
  • a 250 ml corner-baffle flask containing 25 ml of a production medium was newly prepared, 3 each for each strain, and 1 ml of the seed culture solution was inoculated therein, and cultured with shaking at 30° C. for 24 hours at 200 rpm. After the shaking culture was completed, the production of L-tryptophan was measured using HPLC.
  • Glucose 30g (NH 4 ) 2 SO 4 15 g, MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 1 g, yeast extract 5 g, biotin 900 ⁇ g, thiamine hydrochloride 4500 ⁇ g, calcium-pantothenic acid 4500 ⁇ g, CaCO 3 30 g (based on 1 liter of distilled water).
  • CM05-9157 strain was internationally deposited with the Korean Microorganism Conservation Center (KCCM), an international depository under the Budapest Treaty, as of February 20, 2020, and was given an accession number as KCCM12670P.
  • KCCM Korean Microorganism Conservation Center

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 프리페네이트 디하이드라타아제(prephenate dehydratase, PheA) 활성 강화를 통한 L-트립토판을 생산하는 방법에 관한 것이다.

Description

프리페네이트 디하이드라타아제 활성 강화를 통한 L-트립토판을 생산하는 방법
본 출원은 프리페네이트 디하이드라타아제(prephenate dehydratase, PheA) 활성 강화를 통한 L-트립토판을 생산하는 방법에 관한 것이다.
L-트립토판(L-tryptophan)은 필수 아미노산 중 하나로 사료 첨가제, 수액제와 같은 의약품의 원료 및 건강식품의 소재 등으로 널리 사용되어 왔다. 아울러, 현재 L-트립토판 생산에 미생물을 이용한 직접 발효법이 주로 이용되고 있다.
L-트립토판 생산에 사용되는 미생물들은 초기에 화학적 또는 물리적 돌연변이 선별을 통해, L-트립토판 유사체의 내성을 나타내는 균주들을 주로 사용하였으나, 1990년대 유전자 재조합 기술의 급격한 발전과 분자수준의 다양한 조절 기작들이 규명됨에 따라 유전자 조작 기법을 이용한 재조합 균주들이 주로 사용되고 있다.
한편, 재조합 L-트립토판 생산 균주에는 일반적으로 코리스메이트(chorismate)를 기준으로 경쟁 경로 상에 있는 페닐알라닌(Phe) 또는 타이로신(Tyr)의 생합성 경로를 결손 또는 약화시켜 트립토판의 발효수율을 극대화하고자 하였었다[J Ind Microbiol Biotechnol. 2011 Dec;38(12):1921-9], [Appl Environ Microbiol. 1999 Jun;65(6):2497-502].
하지만, 페닐알라닌 또는 타이로신 요구성 L-트립토판 생산균주는 성장 단계(Growth-phase) 및 생산 단계(Production-phase)에서 상기 두 아미노산(페닐알라닌, 타이로신)을 투입하는 양을 달리 조절해야 하는 어려움, 대량 생산에 있어 추가적인 비용의 증가, 및 상기 두 아미노산(페닐알라닌, 타이로신)의 낮은 용해도로 인한 메인(Main), 피드(Feed) 배지 조제상의 어려움이 있었다.
이러한 문제를 개선하기 위해서 본 발명자들은 야생형 코리네박테리움 균주로부터 페닐알라닌 또는 타이로신 경로의 결손 및 약화 없이 고수율의 L-트립토판을 생산하는 코리네박테리움 균주를 제작한 바 있다(미국 공개공보 US 2020-0063219 A1). 상기 고수율의 L-트립토판을 생산하는 코리네박테리움 균주를 이용할 경우, 고농도 발효조 배양시 배양액에서 페닐알라닌이 쌓이는 현상은 없었고 배양 종료시점에서 타이로신은 0.2 g/L 수준으로 생성되는 점이 관찰되었다. 그러나, 상기 균주는 배양 후반 안트라닐레이트(anthranilate)가 생성됨에 따라 L-트립토판 생성이 최대화되지 못하는 문제점이 있었다.
본 발명자들은 상기 고수율의 L-트립토판을 생산하는 코리네박테리움 균주에 추가적으로 프리페네이트 디하이드라타아제(prephenate dehydratase, PheA) 활성 강화를 통해서 프로페네이트(prephenate)로부터 페닐알라닌과 타이로신 간의 생합성 분배를 보정하였다. 이러한 경쟁 경로의 아로마틱 아미노산 생성 보정은 배양액 내의 페닐알라닌 또는 타이로신 최종 생성량을 조절할 뿐만 아니라 배양 후반 안트라닐레이트 생성을 저감시켰으며, 결과적으로 L-트립토판 생산량이 획기적으로 향상됨을 확인함으로써 본 출원을 완성하였다.
본 출원은 프리페네이트 디하이드라타아제(prephenate dehydratase) 활성이 강화된, L-트립토판을 생산하는 미생물을 제공하는 것이다.
본 출원은 프리페네이트 디하이드라타아제 활성이 강화된, L-트립토판을 생산하는 미생물을 배지에서 배양하는 단계를 포함하는, L-트립토판의 생산 방법을 제공하는 것이다.
본 출원은 프리페네이트 디하이드라타아제 활성이 강화된, L-트립토판을 생산하는 미생물을 포함하는, L-트립토판 생산용 조성물을 제공하는 것이다.
본 출원의 프리페네이트 디하이드라타아제 활성이 강화된, L-트립토판을 생산하는 미생물은 안트라닐레이트(anthranilate)의 축적을 최소화하며, L-트립토판을 고효율로 생산할 수 있다.
도 1은 pDCM2 플라스미드의 모식도이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본 출원의 하나의 양태는, 프리페네이트 디하이드라타아제(prephenate dehydratase) 활성이 강화된, L-트립토판을 생산하는 미생물을 제공한다.
본 출원의 용어 "L-트립토판(L-tryptophan)"은 20개 α-아미노산 중 하나로써, 사람을 포함한 많은 생물체에서 생합성되지 않는 필수아미노산이다. 트립토판은 주로 생화학적 전구체로 작용하는 것으로 알려져 있으며, 예를 들면, 세로토닌과 같은 신경전달물질, 멜라토닌과 같은 신경호르몬, 나이아신 및 옥신 등 다양한 물질이 트립토판으로부터 합성된다.
L-트립토판은 코리스메이트(chorismate; chorismic acid)로부터 합성되며, 이 과정에 관여하는 효소를 암호화하고 있는 유전자군은 트립토판 오페론(tryptophan operon; Trp operon)으로 알려져 있다. 상기 트립토판 오페론은 구조 유전자(Structure Gene) 및 발현조절영역(regulatory region)을 포함하는 것으로 알려져 있다. 통상의 트립토판 오페론은 세포가 요구하는 충분한 양의 트립토판을 생산할 수 있도록 활발히 전사하지만, 세포내 트립토판이 충분히 존재하는 경우에 억제인자(repressor)가 트립토판과 결합하여 트립토판 오페론이 불활성화되므로 전사가 억제된다. 상기 트립토판 오페론은 코리네박테리움 속 미생물, 에스케리키아 속 미생물 등 다양한 미생물로부터 유래할 수 있다. 상기 트립토판 오페론의 "발현조절영역"은 트립토판 오페론을 구성하는 구조 유전자의 업스트림에 존재하여 구조 유전자의 발현을 조절할 수 있는 부위를 의미한다. 코리네박테리움 속 미생물에서 트립토판 오페론을 구성하는 구조 유전자는 trpE, trpG, trpD, trpC, trpB, trpA 유전자로 구성되어 있을 수 있으며, 에스케리키아 속 미생물에서 트립토판 오페론을 구성하는 구조 유전자는 trpE, trpD, trpC, trpB, trpA 유전자로 구성되어 있을 수 있다. 상기 트립토판 오페론의 발현조절영역은 트립토판 오페론 구조 유전자의 5'위치에 있는 trpE의 업스트림에 존재하는 것일 수 있다. 구체적으로, 트립토판 오페론을 구성할 수 있는 구조 유전자를 제외한 트립토판 레귤레이터(trp regulator; trpR), 프로모터(trp promoter), 오퍼레이터(trp operator), 트립토판 리더펩타이드(trp leaderpeptide; trp L) 및 트립토판 감쇠인자(trp attenuator)를 포함하는 것일 수 있다. 보다 구체적으로는, 프로모터(trp promoter), 오퍼레이터(trp operator), 트립토판 리더펩타이드(trp leaderpeptide; trp L) 및 트립토판 감쇠인자(trp attenuator)를 포함하는 것일 수 있다.
본 출원의 용어 "프리페네이트 디하이드라타제(prephenate dehydratase, 이하, "PheA")"는 코리스메이트 또는 프리페네이트(prephenate)에서 L-페닐알라닌을 생산하는 경로의 효소이며 타이로신 생합성 경로와 경쟁하는 단계에 있는 효소로 알려져 있다. 상기 단백질은 이중 작용성 코리스메이트 뮤타제/프리페네이트 디하이드라타제(Bifunctional chorismate mutase/prephenate dehydratase)로도 명명될 수 있다. 상기 단백질을 코딩하는 유전자는 그 예로 pheA 유전자일 수 있으나, 이에 제한되지 않으며, 상기 pheA 유전자는 전술한 트립토판 오페론에 의해 조절될 수 있다. 본 출원에서 'pheA 유전자'는 '프리페네이트 디하이드라타제를 코딩하는 유전자' 및 'pheA 유전자'와 혼용되어 사용될 수 있다.
상기 PheA은 서열번호 1의 아미노산 서열을 가지거나, 서열번호 1의 아미노산 서열로 이루어지거나 또는 서열번호 1로 기재되는 아미노산 서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다. 상기 서열번호 1의 서열은 공지의 데이터 베이스인 NCBI Genbank에서 그 서열을 확인할 수 있다.
구체적으로, 상기 PheA은 서열번호 1 및/또는 상기 서열번호 1과 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 아미노산 서열일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 PheA에 상응하는 기능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 PheA도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원의 용어 "상동성(homology) 및 동일성(identity)"은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 중간 또는 높은 엄격한 조건(stringent conditions)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90% 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
상기 폴리펩타이드 또는 폴리뉴클레오티드 서열에 대한 상동성 또는 동일성은 예를 들면, 문헌에 의한 알고리즘 BLAST[참조: Karlin 및 Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)], 또는 Pearson에 의한 FASTA(참조: Methods Enzymol., 183, 63, 1990)을 사용하여 결정할 수 있다. 이러한 알고리즘 BLAST에 기초하여, BLASTN이나 BLASTX라고 불리는 프로그램이 개발되어 있다(참조: http://www.ncbi.nlm.nih.gov). 또한, 임의의 아미노산 또는 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology)일 수 있다.
본 출원의 용어 "L-트립토판을 생산하는 미생물"이란, 자연적으로 L-트립토판의 생산능을 가지고 있는 미생물 또는 L-트립토판의 생산능이 없는 모균주에 L-트립토판의 생산능이 부여된 미생물을 의미한다. 구체적으로 상기 미생물은 PheA 활성이 강화된, L-트립토판을 생산하는 미생물일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 "L-트립토판을 생산하는 미생물"은 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함한다. 더욱 구체적으로, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 L-트립토판 생산을 위하여 유전적 변이가 일어나거나 L-트립토판 생산 활성을 강화시킨 미생물일 수 있다. 본 출원의 목적상, 상기 L-트립토판을 생산하는 미생물은 상기 PheA 활성이 강화되어, 목적하는 L-트립토판 생산능이 증가된 것을 특징으로 하며, 유전적으로 변형된 미생물 또는 재조합 미생물일 수 있으나, 이에 제한되지 않는다.
본 출원의 용어 단백질의 "활성 강화"는, 단백질의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성을 의미한다. 이는 "변형전 활성"과 혼용되어 사용될 수 있다. 단백질의 활성이 내재적 활성에 비하여 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성에 비하여 향상된 것을 의미한다.
상기 "활성 증가"는 외래의 단백질을 도입하거나, 내재적인 단백질의 활성 강화를 통해 달성할 수 있으나, 구체적으로는 내재적인 단백질의 활성 강화를 통해 달성하는 것일 수 있다. 상기 단백질의 활성 강화 여부는 해당 단백질의 활성 정도, 발현량 또는 해당 단백질로부터 생산되는 산물의 양의 증가로부터 확인할 수 있다.
본 출원에 있어서, 상기 활성 강화의 대상이 되는 단백질, 즉, 목적 단백질은 PheA일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원에 있어서, 상기 해당 단백질로부터 생산되는 산물은 L-트립토판일 수 있으나, 이에 제한되지 않는다.
상기 단백질의 활성 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 단백질의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 상기 방법은 유전자 공학 또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되는 것은 아니다.
상기 유전자 공학을 이용하여 단백질 활성을 강화하는 방법은, 예를 들면,
1) 상기 단백질을 코딩하는 유전자의 세포 내 카피수 증가,
2) 상기 단백질을 암호화하는 염색체상의 유전자 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법,
3) 상기 단백질 활성이 증가되도록 상기 단백질의 개시코돈 또는 5'-UTR 지역의 염기서열을 변형시키는 방법,
4) 상기 단백질 활성이 증가되도록 염색체 상의 폴리뉴클레오티드 서열을 변형시키는 방법,
5) 상기 단백질의 활성을 나타내는 외래 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드의 코돈 최적화된 변이형 폴리뉴클레오티드의 도입, 또는
6) 상기 방법들의 조합 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 단백질 공학을 이용하여 단백질 활성을 강화하는 방법은, 예를 들면, 단백질의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 방법 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 1) 단백질을 코딩하는 유전자의 세포 내 카피수 증가는, 당업계에 알려진 임의의 방법, 예를 들면, 해당 단백질을 코딩하는 유전자가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터를 숙주세포 내에 도입됨으로써 수행될 수 있다. 또는, 상기 유전자가 작동가능하게 연결된, 숙주세포 내의 염색체 내로 상기 유전자를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "벡터"는 적합한 숙주 내에서 목적하는 단백질을 코딩하는 폴리뉴클레오티드 서열을 목적 단백질을 발현시키기에 적합한 조절 서열에 작동 가능하게 연결된 형태로 함유하는 DNA 제조물을 의미한다. 상기 발현 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로, 본 출원에서 사용 가능한 벡터는 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위해 제작된 pDCM2(도 1, 서열번호 3)일 수 있으나, 이에 특별히 제한되는 것이 아니며, 공지된 발현 벡터를 사용할 수 있다.
본 출원에서 용어, "형질전환"은 목적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 재조합 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드가 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 상기 형질전환 하는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열 또는 발현조절영역과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
상기 2) 단백질을 암호화하는 염색체상의 유전자 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 발현 조절 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 가지는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현 조절 서열은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 상기 방법은 구체적으로 본래의 프로모터 대신 강력한 이종 프로모터를 연결시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 변이형 lysC 프로모터(미국 등록공보 US 8426577), CJ7 프로모터(미국 등록공보 US 7662943 B2), CJ1 프로모터(미국 등록공보 US 7662943 B2), lac 프로모터, Trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터 및 tet 프로모터가 포함될 수 있으나, 이에 제한되지 않는다. 구체적으로, 본 출원에서 사용 가능한 강력한 프로모터는 변이형 lysC 프로모터(미국 등록공보 US 8426577)의 일부 서열을 변경하여 제작된 PlysCm1(서열번호 4)일 수 있으나, 이에 특별히 제한되는 것이 아니며, 공지된 프로모터를 사용할 수 있다.
상기 3) 단백질의 개시코돈 또는 5'-UTR 지역의 염기서열을 변형시키는 방법은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 단백질의 내재적 개시코돈을 상기 내재적 개시코돈에 비해 단백질 발현율이 더 높은 다른 개시코돈으로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 상기 단백질 활성이 증가되도록 염색체 상의 폴리뉴클레오티드 서열을 변형시키는 방법은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다. 상기 교체는 구체적으로 상동재조합에 의하여 상기 유전자를 염색체내로 삽입하는 것일 수 있으나, 이에 제한되지 않는다.
이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 도입하고자 하는 유전자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있으며, 이에 한정되는 것은 아니다. 선택제 (selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
상기 5) 상기 단백질의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 단백질과 동일/유사한 활성을 나타내는 단백질을 암호화하는 외래 폴리뉴클레오티드, 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드를 숙주세포 내로 도입하여 수행될 수 있다. 상기 외래 폴리뉴클레오티드는 상기 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한 없이 사용될 수 있다. 또한 도입된 상기 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화하여 숙주세포 내로 도입할 수 있다. 상기 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 단백질이 생성되어 그 활성이 증가될 수 있다.
마지막으로, 6) 상기 방법들의 조합은 상기 1) 내지 5) 중 어느 하나 이상의 방법을 함께 적용하여 수행될 수 있다.
이와 같은 단백질의 활성 강화는, 상응하는 단백질의 활성 또는 농도가 야생형이나 변형전 미생물 균주에서 발현된 단백질의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 단백질로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다. 본 출원에서 용어, "변형전 균주" 또는 "변형전 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 균주 자체이거나, 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미한다. 본 출원에 있어서, 상기 형질 변화는 PheA의 활성 강화일 수 있다. 상기 "변형전 균주" 또는 "변형전 미생물"은 "비변이 균주", "비변형 균주", "비변이 미생물", "비변형 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원에 있어서, 상기 기준 미생물은 L-트립토판을 생산하는 미생물이라면 특별히 제한되지 않으며, 야생형에 비해 L-트립토판 생산능이 강화된 변이 균주 역시 제한 없이 포함된다. 그 예로, 야생형 코리네박테리움 글루타미쿰 ATCC13869 균주, CJ04-8321 균주(PCT 공개공보 WO WO2019-164346 A1) 또는 L-트립토판 생합성 경로를 강화하기 위하여 상기 균주에 하나 이상의 유전적 변형이 추가된 균주가 포함될 수 있으나, 이에 제한되지 않는다.
상기 하나 이상의 유전적 변형은 예를 들면, L-트립토판 오페론(operon)의 활성을 과발현시키거나; L-트립토판의 전구체의 공급 및 효율을 개선하거나; L-트립토판의 배출을 향상시키거나; 경쟁경로의 유전자, L-트립토판 오페론의 방향성 경로의 조절자, L-트립토판 유입유전자, L-트립토판 유입 및 분해 유전자의 활성을 약화 또는 불활성화시키는; 것 중 선택되는 어느 하나 이상의 유전적 변형일 수 있으나, 이에 제한되지 않는다.
상기 L-트립토판 오페론의 활성을 과발현시키는 유전적 변형은 예를 들면, i) L-트립토판 생합성 유전자 오페론의 프로모터를 강화하는 것일 수 있고, ii) L-트립토판 오페론 내생산 향상에 따른 TrpE 단백질의 피드백 제한(feedback inhibition)을 해소하는 것일 수 있고, iii) L-트립토판 생합성 유전자 오페론의 프로모터를 강화하는 것일 수 있으며, 구체적으로 상기 i)은 L-트립토판 생합성 유전자 오페론의 프로모터를 강한 프로모터인 SPL7로 교체하여 강화하는 것일 수 있고, 상기 ii)는 피드백 제한 trpE 형질을 갖는 L-트립토판 오페론인 trpE(P21S)DCBA 또는 trpE(S38R)DCBA을 도입하는 것일 수 있고, 상기 iii)은 L-트립토판 생합성 유전자 오페론의 프로모터를 강한 프로모터인 SPL7로 교체하여 강화하는 것일 수 있으나, 이에 제한되지 않는다.
상기 L-트립토판의 전구체의 공급 및 효율을 개선하는 유전적 변형은 예를 들면, E4P(erythorse-4-phosphate)와 같은 L-트립토판의 전구체의 지속적인 공급과 에너지의 효율적 이용을 위해 관련 유전자의 발현을 강화하는 것일 수 있고, 구체적으로 tkt(트랜스케토라제)를 코딩하는 유전자를 도입하거나 이의 발현을 강화하는 것일 수 있으나, 이에 제한되지 않는다.
상기 L-트립토판의 배출을 향상시키는 유전적 변형은 예를 들면, L-트립토판의 배출을 향상시키는 외래 막 단백질을 도입하는 것일 수 있고, 구체적으로 허바스필리움 리조스페레(Herbaspirillum rhizosphaerae) 유래 막 단백질을 코딩하는 유전자(등록번호 NZ_LFLU01000012.1)를 도입하는 것일 수 있으나, 이에 제한되지 않는다.
상기 하나 이상의 유전적 변형이 추가된 균주는 예를 들면, ATCC13869 균주에 강한 프로모터인 SPL7를 포함하고 피드백 제한 trpE 형질을 갖는 L-트립토판 오페론인 trpE(S38R)DCBA가 도입된 CA04-8325(미국 공개공보 US 2020-0063219 A1), CA04-8325 균주에 tkt 유전자가 삽입된 CA04-8352(PCT 공개공보 WO WO2019-164346 A1), CJ04-8352 균주에 허바스필리움 리조스페레 유래 막 단백질을 코딩하는 유전자를 도입하여 제작한 CA04-8405 균주(미국 공개공보 US 2020-0063219 A1)일 수 있으나, 이에 제한되지 않는다.
본 출원의 목적상, 상기 L-트립토판을 생산하는 미생물은 전술한 방법으로 PheA 활성이 강화되어, L-트립토판을 생산할 수 있는 미생물이라면 모두 가능하다. 본 출원에서 상기 "L-트립토판을 생산하는 미생물"은 "L-트립토판 생산 미생물", "L-트립토판 생산능을 갖는 미생물"과 혼용되어 사용될 수 있다.
상기 미생물은 예를 들면, 코리네박테리움(Corynebacterium) 속, 에스케리키아(Escherichia) 속, 엔테로박터(Enterbacter) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 일 수 있고, 구체적으로, 코리네박테리움(Corynebacterium) 속 미생물일 수 있다.
보다 구체적으로, 코리네박테리움(Corynebacterium) 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스Cxorynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens) 등일 수 있고, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있으며, 코리네박테리움 속에 속하는 미생물은 제한 없이 포함될 수 있다.
본 출원의 다른 하나의 양태는 프리페네이트 디하이드라타아제 활성이 강화된, L-트립토판을 생산하는 미생물을 배지에서 배양하는 단계를 포함하는, L-트립토판의 생산 방법을 제공한다.
상기 프리페네이트 디하이드라타아제, 활성 강화 및 L-트립토판을 생산하는 미생물에 대해서는 전술한 바와 같다.
상기 방법에 있어서, 상기 미생물을 배양하는 단계는, 특별히 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물(예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물(예: 인산 또는 황산)을 사용하여 적정 pH(예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8, 가장 구체적으로는 pH 7.0)를 조절할 수 있고, 산소 또는 산소-함유 가스 혼합물을 배양물에 도입시켜 호기성 조건을 유지할 수 있다. 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 제한 되는 것은 아니다. 상기 배양에 의하여 생산된 아미노산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
아울러, 사용되는 배양용 배지는 탄소 공급원으로는 당 및 탄수화물(예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방(예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산(예: 팔미트산, 스테아르산 및 리놀레산), 알코올(예: 글리세롤 및 에탄올) 및 유기산(예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 질소 공급원으로는 질소-함유 유기 화합물(예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 또는 무기 화합물(예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 또한, 배지에는 기타 금속염(예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 포함할 수 있다.
또한, 본 출원에 따른 방법은 배양된 배지 또는 미생물로부터 L-트립토판을 회수하는 단계를 더 포함하는 것일 수 있다. 본 출원의 상기 배양 단계에서 생산된 아미노산을 회수하는 방법은 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 아미노산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 아미노산을 회수 할 수 있다.
또한, 상기 회수 단계는 정제 공정을 포함할 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 수행될 수 있다. 따라서, 상기의 회수되는 아미노산은 정제된 형태 또는 아미노산을 함유한 미생물 발효액일 수 있다(Introduction to Biotechnology and Genetic Engineering, A. J. Nair., 2008). 또한, 상기 배양 단계의 전후, 상기 회수 단계의 전후에 당해 분야에서 공지된 적합한 방법을 추가하여, 목적 아미노산의 회수를 효율적으로 수행할 수 있다.
본 출원의 다른 하나의 양태는 프리페네이트 디하이드라타아제 활성이 강화된, L-트립토판을 생산하는 미생물을 포함하는, L-트립토판 생산용 조성물을 제공한다.
상기 프리페네이트 디하이드라타아제, 활성 강화 및 L-트립토판을 생산하는 미생물에 대해서는 전술한 바와 같다.
상기 L-트립토판 생산용 조성물은 상기 PheA를 코딩하는 pheA 유전자를 포함하며, 상기 PheA 또는 pheA 유전자를 강화시킬 수 있는 구성을 제한없이 포함할 수 있다. 구체적으로, 상기 구성은 도입된 숙주 세포에서 작동가능하게 연결된 유전자를 발현시킬 수 있도록 벡터 내에 포함된 형태일 수 있으며, 이에 대해서는 전술한 바와 같다. 구체적으로, 상기 프리페네이트 디하이드라타제를 코딩하는 유전자인 pheA 유전자의 발현은 유전자의 카피수 증가 또는 강한 프로모터로의 교체를 통해 강화되는 것일 수 있다.
본 출원의 또 다른 하나의 양태는 L-트립토판 생산을 위한, 조성물의 용도를 제공한다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 플라스미드의 제작
코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드(pDCM2, 도 1, 서열번호 3)을 디자인하였고, 바이닉스(주)의 유전자 합성(Gene-synthesis) 서비스를 이용하여 플라스미드를 합성하였다. 일반적으로 알려진 sacB 시스템 관련 논문[Gene, 145 (1994) 69-73]을 참고로 하여 클로닝에 활용하기 용이한 제한효소(restriction enzyme)를 포함하도록 플라스미드를 설계하였다. 이렇게 합성된 pDCM2 플라스미드는 다음과 같은 특성을 갖는다.
1) 대장균에서만 작용하는 복제 기점(replication origin)을 가지고 있어 대장균 내에서는 자가 복제(self-replication)가 가능하나 코리네박테리움에서는 자가 복제가 불가능한 특성을 갖는다.
2) 선별 마커로 카나마이신 내성 유전자를 갖는다.
3) 2차 양성 선별(positive-selection) 마커로 레반 수크라제(Levan sucrose) 유전자(sacB)를 갖는다.
4) 최종 제작된 균주에는 pDCM2 플라스미드로부터 유래한 어떠한 유전자 정보도 남지 않는다.
실시예 2: 프리페네이트 디하이드라타아제 강화용 플라스미드의 제작
프리페네이트 디하이드라타아제(prephenate dehydratase, 이하 "pheA")의 활성을 강화시키기 위해서, 강한 프로모터로 알려진 변이형 lysC 프로모터(미국 등록공보 US 8426577 B2)를 기반으로 일부 서열을 변경하여 서열번호 4로 디자인하고 바이오닉스(주) 유전자 합성 서비스를 이용하여 합성하였으며, 이를 PlysCm1 프로모터로 명명하였다. 상기 PlysCm1 프로모터를 이용하여, pheA 유전자를 추가 삽입하거나 pheA 유전자의 야생형 프로모터를 PlysCm1으로 교체함으로써 프리페네이트 디하이드라타아제 활성을 강화하는 플라스미드를 제작하였다.
실시예 2-1: 유전자 삽입을 위한 플라스미드의 제작
상기의 PlysCm1 프로모터를 이용하여, pheA 유전자를 추가 삽입하기 위해, 야생종의 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하고 서열번호 5 및 서열번호 6의 프라이머 쌍을 이용하여 염색체상 상동재조합(Homologous recombiantion)이 발생하는 업스트림(Upstream) 지역을, 서열번호 7 및 서열번호 8의 프라이머 쌍을 이용하여 다운스트림(Downsteam) 지역을 증폭한 뒤 각각의 유전자 단편을 수득하였다. 여기에서 사용된 프라이머 서열은 하기 표 1과 같다.
서열번호 명칭 서열(5'→ 3')
5 HR1 F tgaattcgagctcggtacccAGGGTTTAGTGATGTCCG
6 HR1 R ATGGCTCCCTAAGGAGCACTGTCCGCGGCAAGACAGT
7 HR2 F ACTTGTCGACTTTCCAGGAC
8 HR2 R gtcgactctagaggatccccCGCAACGCATGCTGAA
상기의 단편들을 획득하기 위해서 PCR이 진행되었다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭은 95℃에서 4분간 변성 후, 95℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 50초 중합을 27회 반복한 후, 72℃에서 5분간 중합 반응하는 조건으로 수행하였다.
또한, 기합성된 서열번호 4를 주형으로 서열번호 9과 서열번호 10를 이용하여 PlysCm1 프로모터 단편을 획득하였다. 추가적으로 야생종의 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 11과 서열번호 12를 이용하여 pheA 유전자 단편(서열번호 2)을 수득하였다. 여기에서 사용된 프라이머 서열은 하기 표 2와 같다.
서열번호 명칭 서열(5'→ 3')
9 PlysCm1 F ACTGTCTTGCCGCGGACAGTGCTCCTTAGGGAGCCAT
10 PlysCm1 R CGTCGCTCATATGTGTGCACCTTTCGA
11 PheA F GTGCACACATATGAGCGACGCACCAAT
12 PheA R GTCCTGGAAAGTCGACAAGTCTAGTTAAGTTTCCTTCCTTCG
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭은 95℃에서 4분간 변성 후, 95℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 1분 중합을 27회 반복한 후, 72℃에서 5분간 중합 반응하는 조건으로 수행하였다.
상기의 과정으로 획득된 염색체상 상동재조합이 발생하는 지역의 업스트림 단편, 다운스트림 단편, PlysCm1 프로모터 단편, pheA 유전자 단편, 그리고 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2을 깁슨 어셈블리 방법(DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix)을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, 이를 pDCM2-Tn::PlysCm1_pheA로 명명하였다.
실시예 2-2: 프로모터 교체를 위한 플라스미드 제작
pheA 유전자의 야생형 프로모터를 PlysCm1으로 교체함으로써 프리페네이트 디하이드라타아제 활성을 강화하는 플라스미드를 제작하고자 하였다. 구체적으로, 야생종의 코리네박테리움 글루타미쿰(ATCC13869) 염색체 DNA를 주형으로 서열번호 13 및 서열번호 14의 프라이머 쌍을 이용하여 염색체상 상동재조합(Homologous recombiantion)이 발생하는 pheA 유전자의 야생형 프로모터 업스트림(Upstream) 지역의 유전자 단편을 수득하였다. 그리고 앞서 제작한 pDCM2-Tn::PlysCm1_pheA 플라스미드를 주형으로 프라이머 서열번호 15 및 서열번호 16을 이용하여 PlysCm1 프로모터 및 이의 다운스트림을 함께 포함한 유전자 단편을 수득하였다. 여기에서 사용된 프라이머 서열은 하기 표 3과 같다.
서열번호 명칭 서열(5'→ 3')
13 UP F tgaattcgagctcggtacccACGCACTTGGGTGGCCAC
14 UP R ATGGCTCCCTAAGGAGCACTGTCCGCGGCAAGACAGT
15 PlysCm1 F2 ACTTGTCGACTTTCCAGGAC
16 pheA partialR gtcgactctagaggatccccCGCAACGCATGCTGAA
상기의 단편들을 획득하기 위해서 중합효소 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭은 95℃에서 4분간 변성 후, 95℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 50초 중합을 27회 반복한 후, 72℃에서 5분간 중합 반응하는 조건으로 수행하였다.
상기의 과정으로 획득된 pheA 프로모터의 업스트림 단편, PlysCm1를 포함한 프로모터 및 다운스트림 단편, SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2을 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, 이를 pDCM2-Pn::PlysCm1_pheA로 명명하였다.
실시예 3: 프리페네이트 디하이드라타아제 발현이 강화된 균주의 제작 및 트립토판의 생산 확인
허바스필리움 리조스페레(Herbaspirillum rhizosphaerae) 유래 막 단백질을 코딩하는 유전자(등록번호 NZ_LFLU01000012.1)를 트립토판 생산 균주인 CA04-8352 균주(대한민국 등록특허 제10-1968317호)에 도입하여 제작한 CA04-8405 균주(KCCM12099P, 미국 공개공보 US 2020-0063219 A1)에 상기 실시예 2-1에서 제작한 pDCM2-Tn::PlysCm1_pheA를 전기천공법(Appl. Microbiol.Biotechnol. (1999) 52:541-545)을 이용하여 형질전환한 후, 2차 교차 과정을 거쳐 PlysCm1_pheA 유전자가 추가로 삽입된 균주를 얻었다. 해당 상동재조합 업스트림 지역 및 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 17 및 서열번호 18의 프라이머 쌍을 이용하여 PCR 증폭 및 게놈 시퀀싱을 통해 해당 유전자가 삽입되었음을 확인하였다. 상기 유전자가 삽입된 균주를 CM05-9157로 명명하였다. 여기에서 사용된 프라이머 서열은 하기 표 4와 같다.
서열번호 명칭 서열(5'→ 3')
17 confirm_F1 CCAGCGACTAAGCTTG
18 confirm_R1 AAGCCATCCAAGCAGC
상기와 동일한 방법으로 CA04-8405 균주에 상기 실시예 2-2에서 제작한 pDCM2-Pn::PlysCm1_pheA를 전기천공법을 이용하여 형질전환한 후, 2차 교차 과정을 거쳐 야생형 pheA 프로모터가 PlysCm1 프로모터로 교체된 균주를 얻었다. 해당 상동재조합 업스트림 지역 및 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 19 및 서열번호 20의 프라이머 쌍을 이용하여 PCR 증폭 및 게놈 시퀀싱을 통해 프로모터가 교체되었음을 확인하였다. 상기 프로모터가 교체된 균주를 CM05-9158로 명명하였다. 여기에서 사용된 프라이머 서열은 하기 표 5와 같다.
서열번호 명칭 서열(5'→ 3')
19 confirm_F2 TCTGGTGCGTGGTTGAAG
20 confirm_R2 TGGCACATTCGGTAGGG
상기 과정을 통해 제작된 CM05-9157 및 CM05-9158 균주의 트립토판 생산을 확인하기 위해, CA04-8405 균주를 대조군으로 하여 하기와 같은 방법으로 배양 및 트립토판 생산량을 비교하였다. 종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 배양 후, 균주별로 각각 3개씩 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크를 새로 준비하고 여기에 상기 종 배양액을 1 ㎖ 접종하였으며 30℃에서 24시간 동안, 200 rpm에서 진탕 배양하였다. 진탕 배양 종료 후 HPLC를 이용하여 L-트립토판의 생산량을 측정하였다.
종 배지 (pH 7.0)
포도당 20g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
생산 배지 (pH 7.0)
포도당 30g, (NH4)2SO4 15 g, MgSO4 7H2O 1.2 g, KH2PO4 1 g, 효모추출물 5 g, 바이오틴 900 ㎍, 티아민 염산염 4500 ㎍, 칼슘-판토텐산 4500 ㎍, CaCO3 30 g (증류수 1리터 기준).
CA04-8405, pheA 발현이 강화된 CM05-9157 및 CM05-9158 균주의 배양 후, 배지 중 L-트립토판 생산에 대한 결과는 하기 표 6과 같다.
　 OD562
(표준편차)		 L-트립토판
(g/L)
(표준편차)		 트립토판 수율
(*100 g/g, %)
(표준편차)		 안트라닐레이트 (g/L)
(표준편차)
CA04-8405 53.2 (0.82) 1.57 (0.03) 5.22 (0.11) 0.17 (0.01)
CM05-9157 56.5 (0.45) 1.93 (0.02) 6.43 (0.07) 0.00
CM05-9158 56.4 (0.08) 1.94 (0.02) 6.48 (0.06) 0.00
pheA 발현이 강화된 CM05-9157 및 CM05-9158 균주의 배양 결과 각각 1.93 및 1.94 g/L의 L-트립토판을 생산하였다. 이는 대조군인 CA04-8405 균주에 비해 약 0.37 g/L이 증가한 것이며, 발효 수율은 약 23~24% 향상된 것이다. 또한, pheA 발현의 강화로 안트라닐레이트(anthranilate) 생성이 줄어들었음을 확인하였으며, 이로 인해 트립토판 생산량이 증가한 것을 확인하였다.
상기 CM05-9157 균주는 2020년 02월 20일자로 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(KCCM)에 국제기탁하여 KCCM12670P로 기탁번호를 부여받았다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2021002763-appb-I000001

Claims (8)

  1. 프리페네이트 디하이드라타아제(prephenate dehydratase) 활성이 강화된, L-트립토판을 생산하는 미생물.
  2. 제1항에 있어서, 상기 프리페네이트 디하이드라타아제는 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 아미노산 서열을 포함하는, 미생물.
  3. 제1항에 있어서, 상기 활성 강화는 상기 프리페네이트 디하이드라타아제를 코딩하는 유전자의 카피수 증가 또는 상기 유전자 프로모터의 강한 프로모터로의 교체를 통한 것인, 미생물.
  4. 제1항에 있어서, 상기 미생물은 코리네박테리움 속(Corynebacterium sp.)인, 미생물.
  5. 제4항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, 미생물.
  6. 프리페네이트 디하이드라타아제 활성이 강화된, L-트립토판을 생산하는 미생물을 배지에서 배양하는 단계를 포함하는, L-트립토판의 생산 방법.
  7. 제6항에 있어서, 상기 방법은 배양된 배지 또는 미생물로부터 L-트립토판을 회수하는 단계를 더 포함하는, L-트립토판의 생산 방법.
  8. 프리페네이트 디하이드라타아제 활성이 강화된, L-트립토판을 생산하는 미생물을 포함하는, L-트립토판 생산용 조성물.
PCT/KR2021/002763 2020-03-17 2021-03-05 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법 WO2021187781A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP2022556021A JP2023518743A (ja) 2020-03-17 2021-03-05 プレフェナートデヒドラターゼ活性強化によるｌ－トリプトファンを生産する方法
CN202180022503.7A CN115516097A (zh) 2020-03-17 2021-03-05 用于通过增强预苯酸脱水酶活性产生l-色氨酸的方法
CA3171191A CA3171191A1 (en) 2020-03-17 2021-03-05 Method for producing l-tryptophan through enhancement of prephenate dehydratase activity
MX2022011543A MX2022011543A (es) 2020-03-17 2021-03-05 Procedimiento de produccion de l-triptofano a traves del aumento de la actividad de prefenato deshidratasa.
US17/911,083 US20230134555A1 (en) 2020-03-17 2021-03-05 Method for producing l-tryptophan through enhancement of prephenate dehydratase activity
BR112022018514A BR112022018514A2 (pt) 2020-03-17 2021-03-05 Método para produzir l-triptofano através do aprimoramento da atividade da prefenato desidratase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0032783 2020-03-17
KR1020200032783A KR102278000B1 (ko) 2020-03-17 2020-03-17 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Publications (1)

Publication Number Publication Date
WO2021187781A1 true WO2021187781A1 (ko) 2021-09-23

Family

ID=73779330

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/002763 WO2021187781A1 (ko) 2020-03-17 2021-03-05 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Country Status (8)

Country Link
US (1) US20230134555A1 (ko)
JP (1) JP2023518743A (ko)
KR (1) KR102278000B1 (ko)
CN (1) CN115516097A (ko)
BR (1) BR112022018514A2 (ko)
CA (1) CA3171191A1 (ko)
MX (1) MX2022011543A (ko)
WO (1) WO2021187781A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022186487A1 (ko) 2021-03-05 2022-09-09 씨제이제일제당 (주) 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법

Families Citing this family (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102278000B1 (ko) * 2020-03-17 2021-07-15 씨제이제일제당 주식회사 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법
KR102470602B1 (ko) 2020-12-11 2022-11-25 씨제이제일제당 주식회사 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
KR102464883B1 (ko) 2020-12-11 2022-11-09 씨제이제일제당 주식회사 신규한 감마-아미노부티르산 퍼미에이즈 변이체 및 이를 이용한 이소류신 생산 방법
KR102284725B1 (ko) * 2021-01-25 2021-08-02 씨제이제일제당 주식회사 신규한 페로체라테이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
KR102284726B1 (ko) * 2021-01-25 2021-08-02 씨제이제일제당 주식회사 신규한 타우토머레이즈 pptA 변이체 및 이를 이용한 L-트립토판 생산 방법
KR102495918B1 (ko) 2021-01-26 2023-02-06 씨제이제일제당 주식회사 aroG 알돌라아제 (Phospho-2-dehydro-3-deoxyheptonate aldolase) 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
KR102314882B1 (ko) 2021-01-29 2021-10-19 씨제이제일제당 (주) 신규한 막단백질 TerC 변이체 및 이를 이용한 L-라이신 생산 방법
KR102527096B1 (ko) * 2021-02-01 2023-04-28 씨제이제일제당 주식회사 프리페네이트 탈수 효소 (Prephenate dehydratase) 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
KR102525074B1 (ko) 2021-03-10 2023-04-24 씨제이제일제당 주식회사 신규한 시트레이트 신타아제 변이체 및 이를 이용한 o-아세틸-l-호모세린 또는 l-메티오닌 생산 방법
KR102306008B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 전사 조절자 변이체 및 이를 이용한 l-발린 생산 방법
KR102306009B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 WhiB 계열 전사 조절자 WhcA 변이체 및 이를 이용한 L-발린 생산 방법
KR102281369B1 (ko) 2021-04-07 2021-07-22 씨제이제일제당 (주) 신규한 디히드로리포일 아세틸기전이효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102281371B1 (ko) 2021-04-07 2021-07-22 씨제이제일제당 (주) 신규한 글리세르알데히드-3-인산탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102306010B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102281370B1 (ko) 2021-04-07 2021-07-22 씨제이제일제당 (주) 신규한 2-이소프로필말레이트합성효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102306007B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 슈가 포터 계열 mfs 트랜스포터 변이체 및 이를 이용한 l-발린 생산 방법
KR102314884B1 (ko) 2021-04-12 2021-10-18 씨제이제일제당 (주) 신규한 세포분해 막단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR102314885B1 (ko) 2021-04-12 2021-10-18 씨제이제일제당 (주) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR102303747B1 (ko) 2021-04-12 2021-09-16 씨제이제일제당 (주) 신규한 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체 및 이를 이용한 l-라이신 생산 방법
KR102338875B1 (ko) 2021-04-12 2021-12-10 씨제이제일제당 (주) 신규한 당 인산염 이성질화효소/에피머레이즈 변이체 및 이를 이용한 l-라이신 생산 방법
KR102273639B1 (ko) 2021-04-20 2021-07-06 씨제이제일제당 주식회사 신규한 이중기능성 메틸렌테트라히드로폴레이트 탈수소효소/메테닐테트라하이드로폴레이트 사이클로하이드롤라아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
KR102635860B1 (ko) 2021-04-20 2024-02-13 씨제이제일제당 주식회사 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산 방법
KR102279137B1 (ko) 2021-04-29 2021-07-19 씨제이제일제당 주식회사 신규한 아데닌 포스포리보실기 전이효소 변이체 및 이를 이용한 imp 생산 방법
KR102277410B1 (ko) 2021-04-29 2021-07-14 씨제이제일제당 주식회사 신규한 이중기능성 pyr 오페론 전사조절자/우라실 포스포리보실 전달 효소 변이체 및 이를 이용한 IMP 생산 방법
KR102339264B1 (ko) 2021-05-07 2021-12-14 씨제이제일제당 주식회사 신규 프로모터 및 이의 용도
KR102339271B1 (ko) 2021-05-07 2021-12-14 씨제이제일제당 주식회사 신규 프로모터 및 이의 용도
KR102377745B1 (ko) 2021-05-12 2022-03-23 씨제이제일제당 주식회사 신규 프로모터 및 이의 용도
KR20220157144A (ko) 2021-05-20 2022-11-29 씨제이제일제당 (주) 신규 프로모터 및 이의 용도
KR102600520B1 (ko) 2021-06-09 2023-11-09 씨제이제일제당 주식회사 제라닐제라닐 피로포스페이트 신타아제 변이체 및 이를 이용한 테트라테르펜, 이의 전구체, 및 테트라테르펜을 전구체로 하는 물질의 생산방법
CN117916385A (zh) 2021-06-25 2024-04-19 Cj第一制糖株式会社 用于生产聚-4-羟基丁酸酯和1,4-丁二醇的新方法
KR102611977B1 (ko) 2021-07-15 2023-12-08 씨제이제일제당 주식회사 신규한 베타-카로틴 15,15 -옥시게네이즈 변이체 및 이를 이용한 레티노이드 생산방법
KR20230016505A (ko) 2021-07-26 2023-02-02 씨제이제일제당 (주) LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법
KR102419166B1 (ko) 2021-09-23 2022-07-08 씨제이제일제당 주식회사 신규한 글루타민 가수분해 gmp 합성효소 변이체 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
KR20230042953A (ko) 2021-09-23 2023-03-30 씨제이제일제당 (주) 고농도 l-글루탐산을 생산하기 위한 균주 및 이를 이용한 l-글루탐산 생산방법
AU2022357997A1 (en) 2021-09-29 2024-04-18 Cj Cheiljedang Corporation Novel acetohydroxy acid synthase variant, and method for producing l-isoleucine using same
KR20230045990A (ko) 2021-09-29 2023-04-05 씨제이제일제당 (주) 신규한 아세토하이드록시산 신테아제 변이체 및 이를 이용한 l-이소류신 생산방법
KR20230054183A (ko) 2021-10-15 2023-04-24 씨제이제일제당 (주) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
KR20230059451A (ko) 2021-10-26 2023-05-03 씨제이제일제당 (주) LysE 변이체 및 이를 이용한 L-아르기닌 생산방법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6355454B1 (en) * 1999-02-20 2002-03-12 Degussa Huls Ag Process for the fermentative production of L-amino acids using coryneform bacteria
KR20050044860A (ko) * 2001-11-23 2005-05-13 아지노모토 가부시키가이샤 에스케리키아속 세균을 사용한 ｌ-아미노산의 제조방법
KR20180089329A (ko) * 2018-02-23 2018-08-08 씨제이제일제당 (주) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
KR101968317B1 (ko) * 2018-02-23 2019-04-11 씨제이제일제당 주식회사 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
KR20200136813A (ko) * 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6355454B1 (en) * 1999-02-20 2002-03-12 Degussa Huls Ag Process for the fermentative production of L-amino acids using coryneform bacteria
KR20050044860A (ko) * 2001-11-23 2005-05-13 아지노모토 가부시키가이샤 에스케리키아속 세균을 사용한 ｌ-아미노산의 제조방법
KR20180089329A (ko) * 2018-02-23 2018-08-08 씨제이제일제당 (주) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
KR101968317B1 (ko) * 2018-02-23 2019-04-11 씨제이제일제당 주식회사 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
KR20200136813A (ko) * 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
IKEDA, M. ET AL.: "Metabolic Engineering To Produce Tyrosine or Phenylalanine in a Tryptophan- Producing Corynebacterium glutamicum Strain", APPL. ENVIRON. MICROBIOL., vol. 58, no. 3, 1992, pages 781 - 7 85, XP009091970 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022186487A1 (ko) 2021-03-05 2022-09-09 씨제이제일제당 (주) 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법

Also Published As

Publication number Publication date
MX2022011543A (es) 2022-10-13
CA3171191A1 (en) 2021-09-23
JP2023518743A (ja) 2023-05-08
BR112022018514A2 (pt) 2022-10-25
US20230134555A1 (en) 2023-05-04
KR102278000B1 (ko) 2021-07-15
KR20200136813A (ko) 2020-12-08
CN115516097A (zh) 2022-12-23

Similar Documents

Publication Publication Date Title
WO2021187781A1 (ko) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법
WO2013105827A2 (ko) 퓨트레신 생산능이 향상된 재조합 미생물 및 이를 이용하여 퓨트레신을 생산하는 방법
WO2020122505A1 (ko) L-글루탐산 생산능이 향상된 변이 균주 및 이를 이용한 l-글루탐산의 제조 방법
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2021112469A1 (ko) 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
WO2022225322A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 알파 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022231058A1 (ko) 신규한 수용성 피리딘 뉴클레오티드 트랜스수소효소 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2021125493A1 (ko) 다중약물 수송체의 활성을 증가시키는 유전적 변형을 포함하는 미생물, 및 그를 이용한 트립토판 대사체의 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225321A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 감마 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022231057A1 (ko) 신규한 아이소시트르산 디하이드로게네이즈 키나아제/포스파타제 효소 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158646A1 (ko) 신규한 쿠퍼익스포팅 p-type 에이티피에이즈 a 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158652A1 (ko) 신규한 사이토신 퍼미에이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158650A1 (ko) 신규한 페로체라테이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022158645A1 (ko) 신규한 데옥시구아노신트리포스페이트 트리포스포하이드로레이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21772261

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3171191

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022556021

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022018514

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2022123861

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112022018514

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220915

122 Ep: pct application non-entry in european phase

Ref document number: 21772261

Country of ref document: EP

Kind code of ref document: A1