WO2022239942A1 - 신규 프로모터 및 이의 용도 - Google Patents

신규 프로모터 및 이의 용도 Download PDF

Info

Publication number
WO2022239942A1
WO2022239942A1 PCT/KR2022/002984 KR2022002984W WO2022239942A1 WO 2022239942 A1 WO2022239942 A1 WO 2022239942A1 KR 2022002984 W KR2022002984 W KR 2022002984W WO 2022239942 A1 WO2022239942 A1 WO 2022239942A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
nucleotide
gdh
promoter
seq
Prior art date
Application number
PCT/KR2022/002984
Other languages
English (en)
French (fr)
Inventor
박고운
박소정
이한형
최우성
김희정
이재민
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to CA3218818A priority Critical patent/CA3218818A1/en
Priority to US18/560,239 priority patent/US20240229049A1/en
Priority to EP22807591.7A priority patent/EP4324924A1/en
Priority to JP2023569978A priority patent/JP2024520928A/ja
Priority to BR112023023665A priority patent/BR112023023665A2/pt
Priority to AU2022271753A priority patent/AU2022271753A1/en
Priority to CN202280049017.9A priority patent/CN117980477A/zh
Priority to MX2023013442A priority patent/MX2023013442A/es
Publication of WO2022239942A1 publication Critical patent/WO2022239942A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0016—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/60—Vectors containing traps for, e.g. exons, promoters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/34—Vector systems having a special element relevant for transcription being a transcription initiation element
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
    • C12Y104/01003—Glutamate dehydrogenase (NAD(P)+)(1.4.1.3)

Definitions

  • the present application relates to a novel promoter and a method for producing a target substance using the same, and more particularly, to a novel polynucleotide having promoter activity, a vector and a microorganism of the genus Corynebacterium containing the same, and production of a target substance using the microorganism It relates to methods and uses of promoters.
  • target substances eg, amino acids
  • microorganisms of the genus Corynebacterium sp., particularly Corynebacterium glutamicum are Gram-positive microorganisms that are widely used in the production of L-amino acids and other useful substances.
  • various studies are being conducted to develop highly efficient producing microorganisms and fermentation process technology.
  • L-lysine a representative material produced by microorganisms of the genus Corynebacterium, is used in animal feed, human medicine and cosmetics industries, and is produced by fermentation using Corynebacterium strains. Microorganisms with enhanced L-lysine biosynthesis-related genes and methods for producing L-lysine using the same are known (KR 10-0924065B1).
  • L-threonine is a kind of essential amino acid and is widely used as a feed and food additive, and is also used as a synthetic raw material for infusion solutions and pharmaceuticals. Since L-threonine is low in vegetable protein and is easily deficient in animals with a vegetarian-oriented diet, it is particularly useful as an additive for animal feed. L-threonine is mainly produced by fermentation using E. coli or Corynebacterium microorganisms developed by artificial mutation or genetic recombination. Representatively, a method using a genetic recombination strain (TURBA E, et al, Agric. Biol. Chem. 53:2269-2271, 1989) and the like are known.
  • O-acetyl homoserine is a material used as a precursor for methionine production and is an intermediate in the methionine biosynthetic pathway (WO2008/013432).
  • O-acetyl-L-homoserine is synthesized using L-homoserine and acetyl-CoA as substrates by homoserine O-acetyl transferase.
  • Isoleucine is a type of essential amino acid that is not synthesized in the body and is known to have effects such as growth promotion, nerve function enhancement, liver function enhancement and muscle strengthening, and is usually produced by a fermentation method using microorganisms.
  • a system that exhibits high expression efficiency in various microorganisms that is, microorganisms belonging to the genus Escheria, microorganisms belonging to the genus Corynebacterium, or microorganisms belonging to the genus Bacillus, is still required, and thus the need for development of universal promoters is still emerging.
  • a universal promoter that is not limited to a specific target substance it is expected that it can be used for the production of various substances.
  • the present application has developed a novel synthetic promoter and confirmed that it has higher expression activity for lower genes when present in the forward direction compared to known promoters, thereby producing various target substances.
  • One object of the present application is to provide a polynucleotide having promoter activity.
  • Another object of the present application is the polynucleotide; and a vector or expression cassette comprising a gene encoding a target protein operably linked to the polynucleotide.
  • Another object of the present application is the polynucleotide; Or to provide a microorganism of the genus Corynebacterium comprising the polynucleotide and a gene encoding a target protein operably linked to the polynucleotide.
  • Another object of the present application is culturing the microorganisms of the genus Corynebacterium in a medium; And to provide a method for producing a target substance, comprising the step of recovering the target substance from the medium.
  • Another object of the present application is to use a polynucleotide having promoter activity in which nucleotides 27, 28, 31, 32 and 36 in the polynucleotide sequence of SEQ ID NO: 1 are substituted with other nucleotides as a promoter provides
  • novel polynucleotide having promoter activity of the present application can be introduced into a microorganism that produces a target substance, thereby increasing the production of the target substance. Due to the improved production yield, effects such as manufacturing cost reduction and convenience of production can be expected from an industrial point of view.
  • One aspect of the present application provides a polynucleotide having promoter activity.
  • the polynucleotide having promoter activity of the present application may be a polynucleotide having promoter activity comprising at least one nucleotide substitution in the polynucleotide sequence of SEQ ID NO: 1.
  • polynucleotide is a DNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are connected in a long chain shape by covalent bonds.
  • polynucleotide having promoter activity is present near a gene to be expressed, that is, a site where transcription of a target gene including a site where RNA polymerase or an enhancer binds for the expression of the target gene. refers to a region of DNA that
  • the polynucleotide having promoter activity of the present application can be used as a universal enhanced promoter.
  • it can be used as a promoter that can enhance the expression of a polypeptide having glutamate dehydrogenase (gdh) activity.
  • the polynucleotide may be a polynucleotide involved in increasing the production or production of a target substance, specifically, lysine, threonine, O-acetyl homoserine or isoleucine.
  • polynucleotide of the present application may be included without limitation as long as it is a polynucleotide sequence having promoter activity.
  • a polynucleotide having promoter activity is a promoter comprising at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, or at least 7 nucleotide substitutions in the polynucleotide sequence of SEQ ID NO: 1 It may be a polynucleotide having an activity.
  • polynucleotide sequence of SEQ ID NO: 1 can be cited as an example of a polynucleotide having glutamate dehydrogenase promoter activity.
  • a polynucleotide in which a specific nucleotide is substituted in the polynucleotide sequence of SEQ ID NO: 1 may also be a polynucleotide having glutamate dehydrogenase promoter activity.
  • the polynucleotide sequence of SEQ ID NO: 1 may be a representative polynucleotide sequence for indicating a mutation site, and other polynucleotide sequences corresponding to it having promoter activity are also included in sequences capable of introducing mutations.
  • any polynucleotide sequence capable of serving as a promoter of glutamate dehydrogenase (gdh) or a polypeptide having an activity corresponding thereto may be included without limitation in the range of sequences capable of introducing mutations of the present application.
  • the nucleotide sequence of SEQ ID NO: 1 can be confirmed in NCBI Genbank, a known database, and the sequence corresponding to SEQ ID NO: 1 as a sequence capable of serving as a promoter of the glutamate dehydrogenase is Corynebacterium ( Corynebacterium sp.), specifically Corynebacterium glutamicum ( Corynebacterium glutamicum ) It may be a sequence, but a sequence having the same activity as or higher than the polynucleotide may be included in the promoter of the present application without limitation. can
  • the polynucleotide having promoter activity provided in the present application may be one in which a nucleotide at a specific position is substituted in an existing polynucleotide sequence having promoter activity to enhance promoter activity.
  • the polynucleotide having promoter activity of the present application may include a polynucleotide having promoter activity in which one or more nucleotides of the nucleotide sequence of SEQ ID NO: 1 are substituted with other nucleotides.
  • it may be composed of a polynucleotide having promoter activity in which one or more nucleotides of the nucleotide sequence of SEQ ID NO: 1 are substituted with other nucleotides.
  • a polynucleotide having the promoter activity may be used interchangeably with a "mutant promoter" herein.
  • the mutant promoter comprises substitution of any one or more nucleotides selected from the group consisting of nucleotides 27, 28, 31, 32 and 36 of SEQ ID NO: 1 with another nucleotide, a promoter It may be a polynucleotide having an activity. Specifically, the mutant promoter may be substituted with other nucleotides at any one or more, two or more, three or more, four or more, or all five positions or their corresponding positions at the above positions. In addition, nucleotides may be additionally substituted at positions 66 and/or 261.
  • the 'other nucleotide' is not limited as long as it is different from the nucleotide before substitution.
  • adenine (A) the 27th nucleotide of SEQ ID NO: 1 as an example, if "the 27th nucleotide in SEQ ID NO: 1 is substituted with another nucleotide", cytosine (C), thymine (T), guanine excluding adenine (G) means to be substituted.
  • cytosine (C) cytosine
  • T thymine
  • G guanine excluding adenine
  • a nucleotide even if not indicated otherwise, when a nucleotide is described as "substituted” in this application, it means that it is substituted with a nucleotide different from the nucleotide before substitution.
  • nucleotides 27, 28, 31, 32, 36, 66, and 261 of SEQ ID NO: 1 of the present application can find positions corresponding to nucleotides 27, 28, 31, 32, 36, 66, and 261 of SEQ ID NO: 1 of the present application in any polynucleotide sequence through sequence alignment known in the art. It is possible to identify the nucleotide of, and even if not separately described in this application, if "nucleotide at a specific position in a specific sequence number" is described, it means to include "nucleotide at a corresponding position" in any polynucleotide sequence is self-explanatory.
  • any polynucleotide sequence having promoter activity a group consisting of nucleotides at positions corresponding to positions 27, 28, 31, 32, 36, 66, and 261 of the polynucleotide sequence of SEQ ID NO: 1
  • Polynucleotide sequences in which any one or more nucleotides selected from are substituted with other nucleotides are also included in the scope of the present application.
  • the polynucleotide having promoter activity in the present application is selected from the group consisting of nucleotides 27, 28, 31, 32, 36, 66, and 261 in the polynucleotide sequence of SEQ ID NO: 1 Any one or more nucleotides may be substituted with other nucleotides.
  • nucleotides 27, 28, 31, 32, and 36 in the polynucleotide sequence of SEQ ID NO: 1 are substituted with other nucleotides, or nucleotides 27, 28, and 31
  • Nucleotides 32, 36, 66, and 261 may be substituted with other nucleotides, or nucleotides 27, 28, 31, 32, 36, and 66 may be substituted with other nucleotides, Not limited to this.
  • the polynucleotide having promoter activity of the present application may be one in which nucleotides 27, 28, 31, 32, and 36 in the polynucleotide sequence of SEQ ID NO: 1 are substituted with other nucleotides. Additionally, it may be a polynucleotide having promoter activity in which nucleotides 66 and 261 are substituted with other nucleotides or nucleotide 66 is substituted with another nucleotide.
  • adenine (A), nucleotide 27, is converted to thymine (T), and cytosine (C), nucleotide 28, is converted to guanine (G).
  • Cytosine (C) at nucleotide 31 is substituted with guanine (G)
  • cytosine (C) at nucleotide 32 is substituted with thymine (T)
  • adenine (A) at nucleotide 36 is substituted with cytosine (C);
  • adenine (A) at nucleotide 27 is thymine (T)
  • cytosine (C) at nucleotide 28 is guanine (G)
  • cytosine (C) at nucleotide 31 is guanine (G )
  • cytosine (C) at nucleotide 32 becomes thymine (T)
  • nucleotide 36 adenine (A) becomes cytosine (C)
  • nucleotide 66 cytosine (C) becomes thymine (T)
  • the polynucleotide having promoter activity may include or (essentially) consist of the polynucleotide sequence of SEQ ID NO: 2, 3 or 4.
  • a polynucleotide having promoter activity is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more identical to SEQ ID NO: 2, 3, or 4. It may be a polynucleotide sequence having homology or identity.
  • a nucleotide sequence having homology or identity may be a sequence having less than 100% identity or excluding sequences having 100% identity among the above categories.
  • a meaningless sequence is added to the inside or end of the nucleotide sequence of the corresponding sequence number, or a polynucleotide in which some sequence inside or at the end of the nucleotide sequence of the corresponding sequence number is deleted It is obvious that also falls within the scope of the present application.
  • Homology and identity mean the extent to which two given base sequences are related and can be expressed as a percentage.
  • Sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are usually present under moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. Hybridization is also contemplated for polynucleotides that contain degenerate codons in lieu of codons in the polynucleotide.
  • Whether any two polynucleotide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: can be determined using known computer algorithms such as the “FASTA” program using default parameters as in 2444. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453).
  • GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990);Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) Homology, similarity or identity can be determined using, for example, BLAST of the National Center for Biotechnology Information Database, or ClustalW.
  • GAP program defines the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp.
  • a probe that can be prepared from a known gene sequence for example, a polynucleotide sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the above-described polynucleotide sequence and has the same activity, may be included without limitation.
  • the "stringent condition” means a condition that allows specific hybridization between polynucleotides. These conditions are described in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York).
  • genes with high homology or identity 40% or more, specifically 70% or more, 80% or more, 85% or more, 90% or more, more specifically 95% or more, More specifically, genes having homology or identity of 97% or more, particularly specifically, 99% or more hybridize, and genes having lower homology or identity than that do not hybridize, or normal Southern hybridization (southern hybridization) hybridization) washing conditions of 60 ° C, 1XSSC, 0.1% SDS, specifically 60 ° C, 0.1XSSC, 0.1% SDS, more specifically 68 ° C, 0.1XSSC, 0.1% SDS At a salt concentration and temperature corresponding to, Conditions for washing once, specifically two to three times, can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include isolated nucleic acid fragments complementary to substantially similar nucleic acid sequences as well as the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60 ° C, 63 ° C, or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotide and the degree of complementarity, parameters well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
  • a polynucleotide having promoter activity of the present application can be used as a promoter.
  • the promoter may be located at the 5' site of the initiation site of transcription into mRNA.
  • the promoter may have increased promoter activity compared to conventional promoters. That is, it is possible to increase the expression and/or activity of a protein encoded by the gene of interest as well as the expression of the gene of interest in the host cell.
  • the gene of interest for enhancing expression may be changed depending on the product to be produced, and the promoter may be used as a universal promoter for enhancing the gene of interest.
  • target gene for the purpose of the present application, means a gene whose expression is to be controlled by the promoter sequence of the present application.
  • a protein encoded by the target gene may be referred to as “target protein”, and a gene encoding the "target protein” may be referred to as “target gene”.
  • a polynucleotide encoding a protein of interest can be varied in the coding region within a range that does not change the polypeptide sequence due to codon degeneracy or in consideration of codons preferred in organisms in which the polynucleotide is to be expressed. Transformations can be made. Description of the polynucleotide sequence is as described above.
  • the target protein may be a polypeptide having glutamate dehydrogenase (gdh) activity. That is, the target gene of the promoter may be a gene encoding a polypeptide having glutamate dehydrogenase (gdh) activity.
  • glutamate dehydrogenase (gdh)
  • glutamate dehydrogenase may also be referred to as “glutamate dehydrogenase” and the like, and the glutamate dehydrogenase is involved in the metabolism of glutamate into 2-oxoglutarate, It is possible to obtain an effect of improving the productivity of useful substances such as lysine, threonine, O-acetyl homoserine, and isoleucine through the regulation of their activity.
  • genes encoding glutamate dehydrogenase may include, but are not limited to, the gdh gene (NCgl1999) of Corynebacterium glutamicum ATCC13032. Those skilled in the art can easily obtain gene information encoding glutamate dehydrogenase from known databases (GenBank, etc.).
  • amino acid sequence constituting the glutamate dehydrogenase can be obtained from GenBank of NCBI, a known database. For example, it may be derived from Corynebacterium glutamicum.
  • polypeptide having glutamate dehydrogenase activity includes not only the wild type, non-mutated type or natural type of the glutamate dehydrogenase, but also variants having the same activity or enhanced activity.
  • variable polypeptide has the same meaning as “variant”, and one or more amino acids in the sequence listed above in conservative substitution and / or modification (the recited sequence) It is different from, but refers to a protein that retains the functions or properties of the protein.
  • a variant differs from an identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein. That is, the ability of the mutant can be increased compared to the original protein (native protein). In addition, some variants may include variants in which one or more portions such as an N-terminal leader sequence or a transmembrane domain are removed.
  • variant may include terms such as variant, modification, mutated protein, mutation (in English, modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.) The terms used are not limited thereto.
  • the variant may be one in which the activity of the mutated protein is increased compared to the natural wild-type or unmodified protein, but is not limited thereto.
  • conservative substitution means the substitution of one amino acid with another amino acid having similar structural and/or chemical properties. Such variants may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.
  • Variants may also include deletions or additions of amino acids that have minimal impact on the secondary structure and properties of the polypeptide.
  • a polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of a protein that is involved in protein transfer either co-translationally or post-translationally.
  • the polypeptide may also be conjugated with other sequences or linkers to allow identification, purification, or synthesis of the polypeptide.
  • a gene encoding a polypeptide having glutamate dehydrogenase activity of the present application may be referred to as a "gdh gene”.
  • the gene may be derived from a microorganism of the genus Corynebacterium, specifically derived from Corynebacterium glutamicum.
  • the "gdh gene” that is, a polynucleotide encoding a polypeptide having glutamate dehydrogenase activity, is a polynucleotide of a polypeptide due to codon degeneracy or considering a preferred codon in an organism to express the polypeptide.
  • Various modifications may be made to the coding region within the range of not changing the amino acid sequence.
  • Polypeptides having glutamate dehydrogenase activity of the present application also include variant sequences, and specifically, may also include protein variants mutated to exhibit enhanced activity of glutamate dehydrogenase.
  • composition for gene expression comprising the polynucleotide having promoter activity of the present application.
  • the gene expression composition means a composition capable of expressing a gene that can be expressed by a polynucleotide having promoter activity of the present application.
  • composition for gene expression includes the polynucleotide having promoter activity of the present application, and may further include a component capable of operating the polynucleotide as a promoter without limitation.
  • the polynucleotide may be in a form contained in a vector so as to express the operably linked gene in the introduced host cell.
  • Another aspect of the present application includes an expression cassette including the polynucleotide having the promoter activity, the polynucleotide and a gene encoding a target protein.
  • the term "expression "cassette” refers to a unit “cassette capable of expressing the target gene” operably linked downstream of the promoter, including the polynucleotide having the promoter activity and the gene encoding the target protein. .
  • the expression cassette may be operably linked to the gene encoding the target protein and the polynucleotide having the promoter activity.
  • operably linked means that a polynucleotide having a promoter activity to initiate and mediate the transcription of a gene encoding a target protein of the present application and the gene sequence are functionally linked.
  • the “gene” expression cassette may include a transcription termination signal, a ribosome binding site, and a translation termination signal in addition to a promoter operably linked to the target gene.
  • the target protein may be a polypeptide having glutamate dehydrogenase activity.
  • Another aspect of the present application includes a polynucleotide having the promoter activity, or a vector including the polynucleotide and a gene encoding a target protein.
  • the target protein may be a polypeptide having glutamate dehydrogenase activity.
  • vector refers to a DNA preparation containing a polynucleotide sequence encoding a protein of interest operably linked to suitable regulatory sequences to enable expression of the protein of interest in a suitable host.
  • the regulatory sequence may include a polynucleotide having the promoter activity of the present application.
  • the regulatory sequence may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector can replicate or function independently of the host genome and can integrate into the genome itself.
  • Vectors used in the present application are not particularly limited as long as they can be expressed in host cells, and host cells can be transformed using any vector known in the art. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, ⁇ LB3, ⁇ BL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, and pBluescriptII-based plasmid vectors may be used.
  • pGEM-based, pTZ-based, pCL-based, pET-based, etc. can be used.
  • an endogenous promoter in a chromosome can be replaced with a polynucleotide having promoter activity of the present application through a vector for chromosomal insertion into a host cell.
  • a vector for chromosomal insertion into a host cell For example, pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 vectors, etc. may be used, but are not limited thereto.
  • a vector of known technology may be used (Republic of Korea Patent Registration No. 10-09240675).
  • Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • a selection marker for determining whether the chromosome is inserted may be further included.
  • Selectable markers are used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule has been inserted, and to give selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface proteins. markers may be used. In an environment treated with a selective agent, only cells expressing the selectable marker survive or exhibit other expression traits, so transformed cells can be selected. For example, a wild-type polynucleotide in a chromosome can be replaced with a mutated polynucleotide through a vector for intracellular chromosomal insertion.
  • the term "transformation” may mean introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the target protein can be expressed in the host cell.
  • the transformed polynucleotide may be inserted into and located in the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide encoding the target protein may include DNA and RNA encoding the target protein.
  • the polynucleotide encoding the target protein may be introduced in any form as long as it can be introduced into a host cell and expressed.
  • the polynucleotide encoding the target protein may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements required for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide encoding the target protein, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the polynucleotide encoding the target protein may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target protein of the present application and the gene sequence are functionally linked.
  • the promoter may be a polynucleotide having the promoter activity of the present application.
  • the method of transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique as known in the art according to the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposomal method, and lithium acetate -DMSO method, etc., but is not limited thereto.
  • Another aspect of the present application is a polynucleotide having promoter activity of the present application; an expression cassette including the polynucleotide and a gene encoding the target protein; Alternatively, a microorganism comprising the polynucleotide and a vector comprising a gene encoding a target protein is provided.
  • microorganism includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, and specific mechanisms are weakened due to causes such as insertion of external genes or enhancement or weakening of the activity of endogenous genes. It is a concept that includes all microorganisms that have been enhanced or enhanced. Specifically, it may be a microorganism containing a polynucleotide having promoter activity of the present application and a target protein.
  • the target protein may be a polypeptide having glutamate dehydrogenase (gdh) activity.
  • Polynucleotides having promoter activity, target proteins, polypeptides having glutamate dehydrogenase (gdh) activity, vectors, and expression cassettes of the present application are as described above.
  • the microorganism may be a microorganism of the genus Corynebacterium, specifically Corynebacterium glutamicum .
  • the microorganism may be a microorganism expressing glutamate dehydrogenase, a microorganism expressing a polypeptide having glutamate dehydrogenase activity, or a microorganism into which a polypeptide having glutamate dehydrogenase activity has been introduced, but is not limited thereto.
  • the microorganism may include a polynucleotide having a promoter activity of the present application, and specifically may include the polynucleotide and/or a gene operably linked to the polynucleotide and encoding a target protein.
  • the microorganism may include a vector or expression cassette including the polynucleotide or gene expression control sequence and a gene encoding a target protein, but is not limited thereto.
  • the polynucleotide, the gene encoding the target protein, the vector, and the expression cassette may be introduced into the microorganism by transformation, but are not limited thereto. Furthermore, as long as the gene can be expressed in the microorganism, it is irrelevant whether the gene encoding the polynucleotide and the target protein is located on a chromosome or extrachromosomal.
  • the term "to/to be expressed" a protein refers to a state in which a target protein, eg, glutamate dehydrogenase or a variant thereof, is introduced into a microorganism or modified to be expressed in a microorganism.
  • a target protein eg, glutamate dehydrogenase or a variant thereof
  • the target protein may mean a state in which its activity is enhanced compared to endogenous or before modification.
  • introduction of a protein may mean exhibiting the activity of a specific protein that the microorganism does not originally have, or exhibiting an enhanced activity compared to the intrinsic activity or activity of the corresponding protein before modification.
  • a polynucleotide encoding a specific protein may be introduced into a chromosome of a microorganism, or a vector or expression cassette including a polynucleotide encoding a specific protein may be introduced into a microorganism to exhibit its activity.
  • “enhancement of activity” may mean that the activity is improved compared to the intrinsic activity of a specific protein possessed by the microorganism or the activity before modification.
  • “Intrinsic activity” may refer to the activity of a specific protein originally possessed by the parent strain prior to transformation when the character of the microorganism changes due to genetic mutation caused by natural or artificial factors.
  • the activity enhancement may be achieved by using the polynucleotide sequence having the promoter activity of the present application as an expression control sequence of the target protein.
  • the expression control sequence may be an expression control sequence of a gene encoding a protein variant or an expression control sequence of a gene encoding a natural protein on a chromosome. .
  • activity enhancement methods may also be used in combination.
  • an increase in intracellular copy number of a gene encoding a target protein, a gene encoding a natural protein on a chromosome Any method selected from the group consisting of a method of replacing a gene encoding the protein variant, a method of additionally introducing a mutation into a gene encoding the protein so as to enhance the activity of the protein variant, and a method of introducing a protein variant into a microorganism.
  • One or more methods may be used, but are not limited thereto.
  • the activity of the target protein can be enhanced by using the polynucleotide having promoter activity of the present application to control the expression of the target protein in microorganisms.
  • the activity or concentration of the corresponding protein is generally at least 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, may be increased up to 1000% or 2000%, but is not limited thereto.
  • unmodified microorganism does not exclude strains containing mutations that may occur naturally in microorganisms, and are natural strains themselves, microorganisms that do not contain polynucleotides having promoter activity of the present application, or Microorganisms that have not been transformed with a vector containing a polynucleotide having promoter activity of the present application are also included.
  • microorganisms that produce a target substance includes all microorganisms in which genetic modification has occurred naturally or artificially, and a specific mechanism is inhibited due to causes such as insertion of external genes or enhancement or inactivation of endogenous gene activity. As a weakened or enhanced microorganism, it may be a microorganism in which genetic mutation has occurred or activity has been enhanced for the production of a desired substance.
  • the microorganism producing the target substance refers to a microorganism capable of producing an excess of the desired target substance compared to a wild-type or unmodified microorganism, including a polynucleotide having promoter activity of the present application. can
  • microorganism producing the target substance may be used interchangeably with terms such as “target substance producing microorganism”, “target substance producing ability”, “target substance producing strain”, and “target substance producing ability”. have.
  • the target substance may be an amino acid, specifically lysine, threonine, O-acetyl homoserine, or isoleucine. More specifically, the lysine may be L-lysine, the threonine may be L-threonine, and the isoleucine may be L-isoleucine, but is not limited thereto.
  • the microorganism producing the target substance may have an improved ability to produce the target substance, specifically, lysine, threonine, O-acetyl homoserine, or isoleucine.
  • the target material-producing microorganism may be a wild-type microorganism or a recombinant microorganism.
  • the recombinant microorganisms are as described above.
  • the microorganisms may further include mutations such as enhancement of biosynthetic pathways for increased production of target substances, cancellation of feedback inhibition, decomposition pathways or gene inactivation that weakens biosynthetic pathways, and such mutations may be artificially, for example, It can be caused by UV irradiation, but does not exclude natural ones.
  • the target substance-producing microorganism may be mutated to produce the target substance.
  • a microorganism without the ability to produce a target substance may be a microorganism that has been mutated to have the ability to produce a target substance, or a microorganism whose productivity has been enhanced.
  • a wild-type microorganism may be a microorganism into which a protein involved in a biosynthetic pathway or a variant thereof is introduced so as to produce a target substance (KR 10-2011994, KR 10-1947959, KR 10-1996769).
  • the target substance-producing microorganism of the present application is aspartokinase (lysC), homoserine dehydrogenase (hom), pyruvate carboxylase (pyc), L-threo It may be a microorganism of the genus Corynebacterium including L-threonine dehydratase (ilvA) or a combination thereof.
  • the aspartokinase, homoserine dehydrogenase, pyruvate carboxylase, or L-threonine dehydratase is a wild-type protein, or a protein variant whose activity is weakened or enhanced so as to be advantageous for the production of a target substance. can be
  • microorganisms of the present application have at least 1%, 5%, 10%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20 %, 22%, 25%, 29%, 33%, 38%, 44%, 45%, or may have a target material production ability of 48% or more.
  • Another aspect of the present application provides a method for producing a target substance comprising culturing the microorganism in a medium.
  • the microorganisms and target substances are as described above.
  • the method for producing a target substance using a microorganism containing the polynucleotide may be performed using a method widely known in the art.
  • the culture may be cultured continuously in a batch process, injection batch or repeated injection batch process (fed batch or repeated fed batch process), but is not limited thereto.
  • the medium used for culture must meet the requirements of the particular strain in an appropriate manner.
  • Culture media for Corynebacterium strains are known (eg, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
  • any medium and other culture conditions used for culturing the strain of the present application may be used without particular limitation as long as it is a medium used for culturing common microorganisms of the genus Corynebacterium.
  • the strain of the present application may be used as a suitable carbon source, It can be cultured while controlling temperature, pH, etc. under aerobic or anaerobic conditions in a conventional medium containing a nitrogen source, phosphorus, inorganic compounds, amino acids and/or vitamins.
  • Examples of the carbon source in the present application include carbohydrates such as glucose, fructose, sucrose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamate, methionine, lysine, and the like may be included, but are not limited thereto.
  • natural organic nutritional sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sorghum and corn steep liquor can be used, as well as glucose and pasteurized pretreated molasses (i.e., molasses converted to reducing sugars).
  • Carbohydrates such as may be used, and various other carbon sources in appropriate amounts may be used without limitation. These carbon sources may be used alone or in combination of two or more.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids, peptones, NZ-amines, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysates, fish or degradation products thereof, defatted soybean cakes or degradation products thereof, and the like can be used. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • Organic nitrogen sources such as amino acids, peptones, NZ-amines, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysates, fish or degradation products thereof,
  • the number of persons may include monopotassium phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used.
  • amino acids, vitamins, and/or appropriate precursors may be included in the medium.
  • L-amino acids and the like may be added to the culture medium of the strain.
  • glycine, glutamate, and/or cysteine may be added, and if necessary, L-amino acids such as lysine may be further added, but it is not necessarily limited thereto.
  • the medium or precursor may be added to the culture in a batch or continuous manner, but is not limited thereto.
  • the pH of the culture can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. to the culture in an appropriate manner during cultivation of the strain.
  • an antifoaming agent such as a fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without injection of gas or gas to maintain the anaerobic and non-aerobic state.
  • the temperature of the culture may be 25 ° C to 40 ° C, more specifically, 28 ° C to 37 ° C, but is not limited thereto.
  • the culturing period may be continued until a desired yield of a useful substance is obtained, and specifically may be 1 hour to 160 hours, 10 hours to 100 hours, but is not limited thereto.
  • the method for preparing the target substance may further include an additional process after the culturing step.
  • the additional process may be appropriately selected according to the purpose of the target material.
  • the method for preparing the target substance is obtained from at least one material selected from among the microorganism, the medium, the dried product of the microorganism, the extract of the microorganism, the culture of the microorganism, the supernatant of the culture, and the lysate of the microorganism after the culturing step.
  • a step of recovering the target material may be included.
  • the method may further include a step of lysing microorganisms (strains) before or simultaneously with the recovering step. Lysis of the strain may be performed by a method commonly used in the art, for example, a lysis buffer, a sonicator, heat treatment, and a French press.
  • the lysis step may include, but is not limited to, enzyme reactions such as cell wall degrading enzymes, nucleic acid degrading enzymes, nucleic acid transferases, and proteolytic enzymes.
  • drying matter of microorganisms may be used interchangeably with terms such as "dry matter of strains”.
  • the dried product of the microorganism may be prepared by drying the cells in which the target substance is accumulated, and may be specifically included in a composition for feed, a composition for food, etc., but is not limited thereto.
  • the strain extract may refer to a material remaining after separating cell walls from cells of the strain. Specifically, it may refer to components obtained by lysing cells except for cell walls.
  • the strain extract includes a target substance, and components other than the target substance may include, but are not limited to, one or more components of proteins, carbohydrates, nucleic acids, and fibers.
  • the target substance which is the target substance
  • the target substance may be recovered using a suitable method known in the art.
  • the recovery step may include a purification process.
  • the purification process may be pure purification by separating only the target substance from the strain. Through the above purification process, a pure purified target material may be prepared.
  • the method for preparing the target substance may further include mixing a substance selected from among the strains obtained after the culturing step, their dried products, extracts, cultures, lysates, and the target substances recovered therefrom with an excipient. .
  • excipients may be appropriately selected and used according to the intended use or form, and for example, starch, glucose, cellulose, lactose, glycogen, D-mannitol, sorbitol, lactitol, maltodextrin, calcium carbonate, synthetic aluminum silicate, Calcium monohydrogen phosphate, calcium sulfate, sodium chloride, sodium hydrogen carbonate, purified lanolin, dextrin, sodium alginate, methylcellulose, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethylcellulose, propylene glycol, casein, calcium lactate , Primogel, and gum arabic, and specifically, may be one or more components selected from starch, glucose, cellulose, lactose, dextrin, glycogen, D-mannitol, and maltodextrin, but is not limited thereto.
  • the excipient may include, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizer, or an isotonic agent, but is not limited thereto.
  • Another aspect of the present application is the use as a promoter of a polynucleotide having promoter activity in which nucleotides 27, 28, 31, 32 and 36 in the polynucleotide sequence of SEQ ID NO: 1 are substituted with other nucleotides to provide.
  • the polynucleotide is as described above.
  • Example 1-1 gdh promoter mutation library using random mutagenesis
  • nucleotide sequence (SEQ ID NO: 1) containing the promoter region of the gdh gene (NCBI registration number NCgl1999) of wild type Corynebacterium glutamicum ATCC13032 based on the NIH GenBank of the US National Institutes of Health ) was obtained.
  • the Diversify PCR Random Mutagenesis Kit (takara) was used as a template with the promoter of the gdh gene consisting of the nucleotide sequence of SEQ ID NO: 1, and mutation was randomly induced using the primers of SEQ ID NO: 5 and SEQ ID NO: 6 according to the manufacturer's manual.
  • This other gdh promoter mutant PCR product (Pmgdh) was obtained.
  • the ORF (Open Reading Frame) of the GFP gene was subjected to PCR using the pGFPuv vector (clontech, USA) as a template and the primers of SEQ ID NOs: 7 and 8. After 30 cycles of denaturation for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, polymerization was performed at 72°C for 7 minutes to obtain a gene fragment containing an ORF of GFP.
  • pCES208 J. Microbiol. Biotechnol. 18:639-647
  • E. coli-Corynebacterium shuttle vector prepared by digesting the amplification product gdh promoter mutant PCR product (Pmgdh) and GFP with BamHI/SalI restriction enzyme , 2008
  • a recombinant vector library in which Pmgdh is linked to GFP was constructed using the In-Fusion® HD cloning kit (clontech).
  • Each vector was named from pCES_Pm1gdh_gfp to pCES_Pm100gdh_gfp.
  • a recombinant vector in which the wild-type gdh gene promoter (SEQ ID NO: 1) and GFP were linked was used.
  • wild type Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NO: 5 and SEQ ID NO: 6, a promoter gene fragment of the wild type gdh gene was obtained.
  • the ORF (Open Reading Frame) of the GFP gene was subjected to PCR using the pGFPuv vector (clontech, USA) as a template and the primers of SEQ ID NOs: 7 and 8. After 30 cycles of denaturation for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, polymerization was performed at 72°C for 7 minutes to obtain a gene fragment containing an ORF of GFP.
  • pCES208 J. Microbiol. Biotechnol. 18:639-647
  • E. coli-Corynebacterium shuttle vector prepared by digesting the amplification product gdh wild-type promoter PCR product (Pgdh) and GFP with BamHI/SalI restriction enzymes , 2008
  • a recombinant vector in which Pgdh is linked to GFP was constructed using the In-Fusion® HD cloning kit (clontech), which was named pCES_Pgdh_gfp.
  • the vector pCES208 and the recombinant vector pCES_Pmgdh_gfp library were electroporated into Corynebacterium glutamicum ATCC13032 (Appl. Microbiol. Biothcenol.
  • the transformed strains were selected in a selection medium containing 25 mg/L kanamycin, and these were respectively ATCC13032/pCES, ATCC13032/pCES_Pmgdh_gfp (ATCC13032/pCES_Pm1gdh_gfp to ATCC13032/pCES_Pm100gdh_gfp) and ATCC1303 ATCC1303. It was named pCES_Pgdh_gfp.
  • Example 1-3 Screening for gdh promoter variants
  • Corynebacterium glutamicum ATCC13032 / pCES, ATCC13032 / pCES_Pgdh_gfp and ATCC13032 / pCES_Pmgdh_gfp were cultured in the following manner, and the activity of GFP was measured.
  • the medium glucose 20 g, ammonium sulfate 5 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 150 ⁇ g, Thiamine hydrochloride 1.5 mg, calcium pantothenic acid 3 mg, nicotinamide 3 mg (based on 1 L of distilled water), pH 7.2) were inoculated with each of the transformed Corynebacterium glutamicum strains in a flask containing 25 ml, and at 30 ° C. It was cultured with shaking for 20 hours.
  • PCR products corresponding to the promoter mutations were obtained using primers of SEQ ID NO: 13 and SEQ ID NO: 14 using the vectors pCES_Pm3gdh_gfp, pCES_Pm16gdh_gfp, and pCES_Pm78gdh_gfp as templates, respectively.
  • the three amplification products were mixed with the pDCM2 vector (Korean Publication No. 10-2020-0136813) prepared by digestion with SmaI restriction enzyme in advance to construct a recombinant vector using the In-Fusion® HD cloning kit (clontech), which were respectively They were named pDCM2_Pm3gdh_gdh, pDCM2_Pm16gdh_gdh, and pDCM2_Pm78gdh_gdh.
  • the CJ3P strain is a Corynebacterium glutami with L-lysine production ability by introducing three mutations (pyc (Pro458Ser), hom (Val59Ala), lysC (Thr311Ile)) into wild strains based on previously known technology. It is a Kumbh strain.
  • the vectors prepared in Example 2 were introduced into the CJ3P strain by electroporation, and then the transformed strain was obtained in a selection medium containing 25 mg/L of kanamycin.
  • the strain into which the gdh promoter variant was introduced by the DNA fragment inserted into the chromosome by the secondary recombination process (cross-over) was selected through PCR and sequencing using primers of SEQ ID NO: 9 and SEQ ID NO: 10, and the above
  • the selected strains were named Corynebacterium glutamicum CJ3P::Pm3gdh_gdh, CJ3P::Pm16gdh_gdh, and CJ3P::Pm78gdh_gdh.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and cultured at 30° C. for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium, and incubated at 32° C. for 48 hours with shaking at 200 rpm.
  • the composition of the seed medium and production medium is as follows.
  • Table 3 shows the L-lysine concentration and concentration increase rate in the culture solution for Corynebacterium glutamicum CJ3P, CJ3P::Pm3gdh_gdh, CJ3P::Pm16gdh_gdh and CJ3P::Pm78gdh_gdh strains.
  • CJ3P concentration of L-lysine increased in the three strains into which the gdh promoter variant was introduced compared to the parent strain, CJ3P.
  • the CJ3P::gdhPm3_gdh was named CM03-1660, and It was deposited with the Korea Microbial Conservation Center, an entrusted institution, on April 5, 2021, and was given the accession number KCCM12970P.
  • a vector for introducing lysC (L377K) was first constructed.
  • PCR was performed using the primers of SEQ ID NOs: 17 and 18 and SEQ ID NOs: 19 and 20 using the chromosome of the wild-type Corynebacterium glutamicum ATCC13032 strain as a template. After denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and polymerization at 72 ° C for 30 seconds were repeated 30 times, polymerization was performed at 72 ° C for 7 minutes to obtain each PCR product. .
  • the amplification product was previously digested with SmaI restriction enzyme and mixed with the prepared pDCM2 vector to prepare a recombinant vector using the In-Fusion® HD cloning kit, and named pDCM2_lysC(L377K).
  • the pDCM2_lysC (L377K) vector prepared above was introduced into the Corynebacterium glutamicum ATCC13032 strain by electroporation, and then the transformed strain was obtained in a selective medium containing 25 mg/L of kanamycin.
  • a strain in which a nucleotide mutation was introduced into the lysC gene by a DNA fragment inserted into the chromosome by a secondary recombination process (cross-over) was selected through PCR and sequencing using primers of SEQ ID NO: 25 and SEQ ID NO: 26. , The selected strain was named ATCC13032 :: lysC (L377K).
  • PCR was performed using primers of SEQ ID NOs: 21 and 22 and primers of SEQ ID NOs: 23 and 24 using the chromosome of Corynebacterium glutamicum ATCC13032 strain as a template. PCR conditions were denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and polymerization at 72 ° C for 30 seconds were repeated 30 times, followed by polymerization at 72 ° C for 7 minutes.
  • the amplification product was previously digested with SmaI restriction enzyme and mixed with the prepared pDCM2 vector to prepare a recombinant vector using the In-Fusion® HD cloning kit, and named pDCM2_hom(R398Q).
  • the pDCM2_hom (R398Q) vector prepared above was introduced into the Corynebacterium glutamicum ATCC13032 :: lysC (L377K) strain prepared above by electroporation, and then transformed in a selective medium containing 25 mg / L of kanamycin. was obtained.
  • Strains in which a nucleotide mutation was introduced into the hom gene by a DNA fragment inserted into the chromosome by a secondary recombination process (cross-over) were selected through PCR and sequencing using primers of SEQ ID NO: 27 and SEQ ID NO: 28, , The selected strain was named Corynebacterium glutamicum ATCC13032::lysC(L377K)_hom(R398Q).
  • the transformed strain was transformed in a selection medium containing 25 mg/L of kanamycin. Acquired.
  • the strain into which the gdh promoter variant was introduced by the DNA fragment inserted into the chromosome by the secondary recombination process (cross-over) was selected through PCR and sequencing using primers of SEQ ID NO: 9 and SEQ ID NO: 10, and the above The selected strain was Corynebacterium glutamicum ATCC13032 :: lysC (L377K)_hom (R398Q) :: Pm3gdh_gdh, ATCC13032 :: lysC (L377K)_hom (R398Q) :: Pm16gdh_gdh, ATCC13032 :: lysC (L377K)_hom ( R398Q)::Pm78gdh_gdh.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and cultured at 30° C. for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium, and incubated at 32° C. for 48 hours with shaking at 200 rpm.
  • the composition of the seed medium and production medium is as follows.
  • the vectors prepared in Example 2 were introduced into a wild type strain, Corynebacterium glutamicum ATCC13032, by electroporation, and then transformed strains were obtained in a selective medium containing 25 mg/L of kanamycin.
  • the strain into which the gdh promoter variant was introduced by the DNA fragment inserted into the chromosome by the secondary recombination process (cross-over) was selected through PCR and sequencing using primers of SEQ ID NO: 9 and SEQ ID NO: 10, and the above
  • the selected strains were named Corynebacterium glutamicum ATCC13032::Pm3gdh_gdh, ATCC13032::Pm16gdh_gdh, ATCC13032::Pm78gdh_gdh.
  • Corynebacterium glutamicum ATCC13032 used as a parent strain in order to evaluate the O-acetyl homoserine production ability of ATCC13032::Pm3gdh_gdh, ATCC13032::Pm16gdh_gdh and ATCC13032::Pm78gdh_gdh strains prepared in Example 3-3-1 After culturing the strain in the same way as the following, it was analyzed.
  • One platinum strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the following medium, and cultured at 33 degrees for 20 hours with shaking at 200 rpm.
  • Table 5 shows the O-acetyl homoserine concentration and concentration increase rate in the culture medium for Corynebacterium glutamicum ATCC13032, ATCC13032::Pm3gdh_gdh, ATCC13032::Pm16gdh_gdh and ATCC13032::Pm78gdh_gdh strains.
  • the vectors prepared in Example 2 were introduced into the CJP1 strain by electroporation, and then the transformed strain was obtained in a selection medium containing 25 mg/L of kanamycin.
  • the strain into which the gdh promoter variant was introduced by the DNA fragment inserted into the chromosome by the secondary recombination process (cross-over) was selected through PCR and sequencing using primers of SEQ ID NO: 9 and SEQ ID NO: 10, and the above
  • the selected strains were named Corynebacterium glutamicum CJP1::Pm3gdh_gdh, CJP1::Pm16gdh_gdh, and CJP1::Pm78gdh_gdh.
  • Corynebacterium glutamicum CJP1/pECCG117-ilvA (V323A) used as parent strain CJP1::Pm3gdh_gdh/pECCG117-ilvA (V323A), CJP1::Pm16gdh_gdh/pECCG117-ilvA prepared in Example 3-4-1 (V323A) and CJP1::Pm78gdh_gdh/pECCG117-ilvA (V323A) strains were cultured and analyzed in the following manner to evaluate the L-isoleucine-producing ability.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and cultured at 30° C. for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium, and incubated at 32° C. for 48 hours with shaking at 200 rpm.
  • the composition of the seed medium and production medium is as follows.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

본 출원은 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법에 관한 것으로서, 보다 상세하게는 프로모터 활성을 가지는 신규 폴리뉴클레오티드, 이를 포함하는 벡터 및 코리네박테리움 속 미생물, 및 상기 미생물을 이용한 목적 물질의 생산 방법에 관한 것이다.

Description

신규 프로모터 및 이의 용도
본 출원은 신규한 프로모터 및 이를 이용한 목적 물질의 생산 방법에 관한 것으로서, 보다 상세하게는 프로모터 활성을 가지는 신규 폴리뉴클레오티드, 이를 포함하는 벡터 및 코리네박테리움 속 미생물, 상기 미생물을 이용한 목적 물질의 생산 방법 및 프로모터의 용도에 관한 것이다.
미생물에서 목적 물질(예를 들어, 아미노산)을 생산하는 공정은 친환경적이고 안전한 생산 방법으로 다양한 연구가 진행되어 왔으며, 그 중 코리네박테리움 속 미생물에서 목적 물질을 다량으로 생산하기 위한 연구가 지속적으로 이루어져 왔다. 코리네박테리움(Corynebacterium sp.) 속 미생물, 특히 코리네박테리움 글루타미쿰(Corynebacteriumglutamicum)은 L-아미노산 및 기타 유용물질 생산에 많이 이용되고 있는 그람 양성의 미생물이다. 상기 L-아미노산 및 기타 유용물질을 생산하기 위하여, 고효율 생산 미생물 및 발효공정기술 개발을 위한 다양한 연구들이 수행되고 있다.
코리네박테리움속 미생물에서 생산되는 대표적인 물질인 L-라이신은 동물사료, 사람의 의약품 및 화장품 산업에 사용되고 있으며 코리네박테리움 균주를 이용한 발효에 의해 생성되고 있다. L-라이신 생합성 관련 유전자가 강화된 미생물 및 이를 이용한 L-라이신 생산 방법 등이 알려져 있다(KR 10-0924065B1).
또한, L-쓰레오닌은 필수 아미노산의 일종으로 사료 및 식품 첨가제로 널리 사용되며 의약용으로 수액제, 의약품의 합성 원료로도 사용된다. L-쓰레오닌은 식물성 단백질에 적게 들어 있어 채식 위주의 식습관을 가진 동물들에게서 부족되기 쉽기 때문에, 특히, 동물 사료용 첨가제로서 유용하게 사용되고 있다. L-쓰레오닌은 주로 인공변이법 또는 유전자 재조합 방법에 의해 개발된 대장균 또는 코리네박테리움 미생물 등을 이용한 발효법으로 생산된다. 대표적으로, 대장균 유래의 쓰레오닌 오페론을 쓰레오닌 생산 균주인 브레비박테리움 플라붐(Brevibacterium flavum)에 도입하여 L-쓰레오닌을 생산하는, 유전자 재조합 균주를 이용하는 방법(TURBA E, et al, Agric. Biol. Chem. 53:2269~2271, 1989) 등이 알려져 있다.
O-아세틸 호모세린은 메치오닌 생산의 전구체로 사용되는 물질로 메치오닌 생합성 경로상에 있는 중간체이다(WO2008/013432). O-아세틸-L-호모세린은 호모세린 O-아세틸　트랜스퍼라아제(O-acetyl transferase)에 의해 L-호모세린 및　아세틸-CoA를 기질로 하여 합성된다.
이소류신은 체내에서 합성되지 않는 필수 아미노산의 일종으로서 성장 촉진, 신경 기능 증진, 간 기능 강화 및 근육 강화 등의 효과를 갖는 것을 알려져 있고, 통상적으로 미생물을 이용한 발효 방법에 의해 생산된다.
아직까지도 다양한 미생물, 즉, 에스케리아 속 미생물, 코리네박테리움 속 미생물, 또는 바실러스 속 미생물 등에서도 높은 발현 효율을 나타내는 시스템이 필요한 바, 범용적 프로모터의 개발 필요성이 여전히 대두되고 있는 실정이다. 또한, 특정한 목적 물질에 제한되지 않는 범용적인 프로모터를 개발할 경우, 다양한 물질 생산에 활용될 수 있을 것으로 기대된다.
본 출원은 신규 합성 프로모터를 개발하여 공지된 프로모터에 비하여 정방향으로 존재 시 하위의 유전자에 대해 높은 발현 활성을 갖고, 이로 인해 다양한 목적 물질을 생산할 수 있음을 확인 하였다.
본 출원의 하나의 목적은 프로모터 활성을 가지는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는 벡터 또는 발현 카세트를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 폴리뉴클레오티드; 또는 상기 폴리뉴클레오티드 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및 상기의 배지에서 목적 물질을 회수하는 단계를 포함하는, 목적 물질을 생산하는 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 서열번호 1의 폴리뉴클레오티드 서열에서 27번, 28번, 31번, 32번 및 36번 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 갖는 폴리뉴클레오티드의, 프로모터로서의 용도를 제공한다.
본 출원의 신규한 프로모터 활성을 갖는 폴리뉴클레오티드는 목적 물질을 생산하는 미생물에 도입되어, 목적 물질의 생산량을 증가시킬 수 있다. 향상된 생산 수율로 인해, 산업적인 면에서 생산의 편의성과 함께 제조원가 절감 등의 효과를 기대할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는 프로모터 활성을 가지는 폴리뉴클레오티드를 제공한다.
구체적으로, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에 하나 이상의 뉴클레오티드 치환을 포함하는, 프로모터 활성을 가지는 폴리뉴클레오티드일 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 가닥이다.
본 출원에서 용어, "프로모터 활성을 갖는 폴리뉴클레오티드"는 발현시키고자 하는 유전자, 즉 목적 유전자의 발현을 위해 RNA 폴리머라제 또는 인핸서 등이 결합하는 부위를 포함하는 목적 유전자의 전사가 일어나는 부위 근처에 존재하는 DNA 영역을 의미한다.
본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드는 범용적 강화 프로모터로 이용될 수 있다. 일 예로, 글루탐산 탈수소효소(glutamate dehydrogenase, gdh) 활성을 갖는 폴리펩티드의 발현을 강화시킬 수 있는 프로모터로 사용될 수 있다. 또한 상기 폴리뉴클레오티드는 목적 물질, 구체적으로, 라이신, 쓰레오닌, O-아세틸 호모세린 또는 이소류신의 생산, 또는 생산량을 증가시키는 데 관여하는 폴리뉴클레오티드 일 수 있다.
본 출원의 폴리뉴클레오티드는 프로모터 활성을 갖는 폴리뉴클레오티드 서열이라면 제한 없이 포함될 수 있다. 구체적으로, 본 출원에서, 프로모터 활성을 갖는 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에 1 이상, 2 이상, 3 이상, 4 이상, 5 이상, 6 이상, 또는 7 이상의 뉴클레오티드 치환을 포함하는, 프로모터 활성을 가지는 폴리뉴클레오티드일 수 있다.
본 출원에서, 서열번호 1의 폴리뉴클레오티드 서열은 글루탐산 탈수소효소의 프로모터 활성을 갖는 폴리뉴클레오티드의 한 예로 들 수 있다. 또한, 프로모터 활성을 갖는 한, 서열번호 1의 폴리뉴클레오티드 서열에서 특정 뉴클레오티드가 치환된 폴리뉴클레오티드 역시 글루탐산 탈수소효소의 프로모터 활성을 갖는 폴리뉴클레오티드일 수 있다. 서열번호 1의 폴리뉴클레오티드 서열은 변이 위치를 표시하기 위한 대표적인 폴리뉴클레오티드 서열일 수 있으며, 프로모터 활성을 가지는 이에 상응하는 다른 폴리뉴클레오티드 서열 역시 변이를 도입할 수 있는 서열에 포함된다. 예를 들어 글루탐산 탈수소효소(glutamate dehydrogenase, gdh) 혹은 이에 상응하는 활성을 갖는 폴리펩티드의 프로모터 역할을 할 수 있는 폴리뉴클레오티드 서열이라면 본 출원의 변이를 도입할 수 있는 서열의 범위에 제한 없이 포함될 수 있다.
상기 서열번호 1의 뉴클레오티드 서열은 공지의 데이터 베이스인 NCBI Genbank에서 그 서열을 확인할 수 있으며, 상기 글루탐산 탈수소효소의 프로모터 역할을 할 수 있는 서열로 상기 서열번호 1에 상응하는 서열은 코리네박테리움 (Corynebacterium sp.) 유래일 수 있고, 구체적으로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)의 서열일 수 있으나, 상기 폴리뉴클레오티드와 동등 또는 그 이상의 활성을 갖는 서열은 본 출원의 프로모터에 제한 없이 포함될 수 있다.
본 출원에서 제공하는, 프로모터 활성을 갖는 폴리뉴클레오티드는 기존의 프로모터 활성을 갖는 폴리뉴클레오티드 서열에서, 특이적 위치의 뉴클레오티드가 치환되어 프로모터 활성이 강화된 것일 수 있다.
일 구현예로, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드는 서열번호 1의 뉴클레오티드 서열 중 하나 이상의 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 갖는 폴리뉴클레오티드를 포함하는 것일 수 있다. 구체적으로 서열번호 1의 뉴클레오티드 서열 중 하나 이상의 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 갖는 폴리뉴클레오티드로 이루어진 것일 수 있다. 상기 프로모터 활성을 갖는 폴리뉴클레오티드는 본원에서 "변이형 프로모터"와 혼용 될 수 있다.
일 구현예로, 상기 변이형 프로모터는 서열번호 1의 27번, 28번, 31번, 32번 및 36번 뉴클레오티드로 구성된 군으로부터 선택되는 어느 하나 이상의 뉴클레오티드의 다른 뉴클레오티드로의 치환을 포함하는, 프로모터 활성을 갖는 폴리뉴클레오티드 일 수 있다. 구체적으로, 상기 변이형 프로모터는 상기 위치에서 어느 하나 이상, 둘 이상, 셋 이상, 넷 이상, 또는 다섯 위치 모두 또는 이들의 상응하는 위치에서 다른 뉴클레오티드로 치환된 것일 수 있다. 또한, 66번 및/또는 261번 위치에서 뉴클레오티드가 추가적으로 치환된 것일 수 있다.
상기 '다른 뉴클레오티드' 는 치환 전의 뉴클레오티드와 다른 것이면, 제한되지 않는다. 서열번호 1의 27번 뉴클레오티드인 아데닌(A)을 예로 들면, "서열번호 1에서 27번 뉴클레오티드가 다른 뉴클레오티드로 치환되었다" 고 기재하는 경우, 아데닌을 제외한 시토신(C), 티민(T), 구아닌(G)으로 치환되는 것을 의미한다. 또한 달리 표시하지 않더라도 본 출원에서 어떤 뉴클레오티드가 "치환되었다"고 기재하는 경우, 치환 전의 뉴클레오티드와 다른 뉴클레오티드로 치환되는 것을 의미한다.
한편, 당업자라면 당업계에 알려진 서열 얼라인먼트를 통해 임의의 폴리뉴클레오티드 서열에서 본 출원의 서열번호 1의 27번, 28번, 31번, 32번, 36번, 66번, 261번 뉴클레오티드에 상응하는 위치의 뉴클레오티드를 파악할 수 있으며, 본 출원에서 별도로 기재하지 않더라도 "특정 서열번호에서 특이적 위치의 뉴클레오티드"를 기재하는 경우, 임의의 폴리뉴클레오티드 서열에서 그와 "상응하는 위치의 뉴클레오티드"까지 포함하는 의미임은 자명하다. 따라서 프로모터 활성을 갖는 임의의 폴리뉴클레오티드 서열 내에서 서열번호 1의 폴리뉴클레오티드 서열의 27번, 28번, 31번, 32번, 36번, 66번, 및 261번에 상응하는 위치의 뉴클레오티드로 구성된 군으로부터 선택되는 어느 하나 이상의 뉴클레오티드가 다른 뉴클레오티드로 치환된 폴리뉴클레오티드 서열 역시 본 출원의 범위에 포함된다.
일 구현예로, 본 출원에서 프로모터 활성을 갖는 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에서 27번, 28번, 31번, 32번, 36번, 66번, 및 261번 뉴클레오티드로 구성된 군으로부터 선택되는 어느 하나 이상의 뉴클레오티드가 다른 뉴클레오티드로 치환된 것일 수 있다.
구체적으로, 본 출원에서 프로모터 활성을 갖는 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에서 27번, 28번, 31번, 32번 및 36번 뉴클레오티드가 다른 뉴클레오티드로 치환되거나, 27번, 28번, 31번, 32번, 36번, 66번 및 261번 뉴클레오티드가 다른 뉴클레오티드로 치환되거나, 27번, 28번, 31번, 32번, 36번, 및 66번 뉴클레오티드가 다른 뉴클레오티드로 치환된 것일 수 있으나, 이에 제한되지 않는다.
일 예로, 서열번호 1의 폴리뉴클레오티드의 27번, 28번, 31번, 32번, 36번, 66번, 및 261번에 상응하는 위치 중 1 이상, 2이상, 3이상, 4이상, 5이상, 6이상, 또는 7개 뉴클레오티드를 다른 뉴클레오티드로 치환할 경우, 비치환된(비변형된) 프로모터 서열보다 더 높은 활성을 갖는 프로모터를 제공할 수 있다. 구체적으로, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에서 27번, 28번, 31번, 32번 및 36번 뉴클레오티드가 다른 뉴클레오티드로 치환된 것일 수 있다. 또한, 추가적으로, 66번 및 261번 뉴클레오티드가 다른 뉴클레오티드로 치환되거나, 66번 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 갖는 폴리뉴클레오티드 일 수 있다.
구체적인 예로, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에서 27번 뉴클레오티드인 아데닌(A)이 티민(T)으로, 28번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 31번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 32번 뉴클레오티드인 시토신(C)이 티민(T)으로, 36번 뉴클레오티드인 아데닌(A)이 시토신(C)으로 치환된 것이거나; 서열번호 1의 폴리뉴클레오티드 서열에서 27번 뉴클레오티드인 아데닌(A)이 티민(T)으로, 28번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 31번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 32번 뉴클레오티드인 시토신(C)이 티민(T)으로, 36번 뉴클레오티드인 아데닌(A)이 시토신(C)으로, 66번 뉴클레오티드인 시토신(C)이 티민(T)으로, 261번 뉴클레오티드인 아데닌(A)이 구아닌(G)으로 치환된 것이거나; 서열번호 1의 폴리뉴클레오티드 서열에서 27번 뉴클레오티드인 아데닌(A)이 티민(T)으로, 28번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 31번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 32번 뉴클레오티드인 시토신(C)이 티민(T)으로, 36번 뉴클레오티드인 아데닌(A)이 시토신(C)으로, 66번 뉴클레오티드인 시토신(C)이 티민(T)으로 치환된 폴리뉴클레오티드일 수 있다.
보다 구체적인 예로, 서열번호 2 내지 4 중 어느 하나의 폴리뉴클레오티드 서열로 표시되는 폴리뉴클레오티드 일 수 있다. 구체적으로, 본 출원에서, 프로모터 활성을 갖는 폴리뉴클레오티드는 서열번호 2, 3 또는 4의 폴리뉴클레오티드 서열을 포함하거나, (필수적으로) 구성되는 것일 수 있다.
또한 전술한 구현예에 제한되지 않고, 프로모터 활성을 크게 감소시키지 않는 범위에서 폴리뉴클레오티드 서열에 다양한 변형도 포함할 수 있다.
본 출원에서 프로모터 활성을 갖는 폴리뉴클레오티드는, 서열번호 2, 3, 또는 4와 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 폴리뉴클레오티드 서열일 수 있다. 상동성 또는 동일성을 갖는 뉴클레오티드 서열은 상기 범주 중 100% 동일성을 갖는 서열은 제외되거나, 100% 미만의 동일성을 갖는 서열일 수 있다.
한편 본 출원에서 '특정 서열번호로 기재된 뉴클레오티드 서열을 가지는 폴리뉴클레오티드', '특정 서열번호로 기재된 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드' 라고 기재되어 있다 하더라도, 해당 서열번호의 뉴클레오티드 서열로 구성된 폴리뉴클레오티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환 또는 부가된 뉴클레오티드 서열을 갖는 폴리뉴클레오티드도 본 출원에서 사용될 수 있음은 자명하다.
예를 들어, 상기 폴리뉴클레오티드와 동일 혹은 상응하는 활성을 가지는 경우라면 해당 서열번호의 뉴클레오티드 서열 내부나 말단에 무의미한 서열이 부가되거나 혹은 해당 서열번호의 뉴클레오티드 서열 내부나 말단의 일부 서열이 결실된 폴리뉴클레오티드도 본원의 범위 내에 속하는 것이 자명하다.
상동성(homology) 및 동일성(identity)은 두 개의 주어진 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다.
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48 : 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본원에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 서열들간의 관련성(relevance)를 나타낸다.
또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들어 전술한 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하고 동일한 활성을 갖는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)에 구체적으로 기재되어 있다. 예를 들어, 상동성(homology) 또는 동일성(identity)이 높은 유전자끼리, 40% 이상, 구체적으로는 70% 이상, 80% 이상, 85% 이상, 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1XSSC, 0.1% SDS, 구체적으로는 60℃, 0.1XSSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1XSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃, 또는 65℃ 일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드는, 프로모터로서 이용될 수 있다.
상기 프로모터는 mRNA로의 전사 개시부위의 5' 부위에 위치할 수 있다.
상기 프로모터는 종래의 프로모터에 비하여 증가된 프로모터 활성을 가질 수 있다. 즉, 숙주 세포에서 목적 유전자의 발현뿐만 아니라 목적 유전자에 의해 코딩되는 단백질의 발현 및/또는 활성을 증가시킬 수 있다. 본 출원의 목적상, 생산하고자 하는 산물에 따라 발현 강화를 위한 목적 유전자가 변경될 수 있고, 상기 프로모터는 목적 유전자의 강화를 위한 범용적 프로모터로서 사용될 수 있다.
상기 "목적 유전자"는, 본 출원의 목적상 본 출원의 프로모터 서열에 의해 발현을 조절하고자 하는 유전자를 의미한다. 상기 목적 유전자에 의해 코딩되는 단백질은 "목적 단백질"로 표현할 수 있고, 상기 "목적 단백질"을 코딩하는 유전자는 "목적 유전자"로 표현할 수 있다.
또한, 목적 단백질을 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리뉴클레오티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 폴리뉴클레오티드 서열에 대한 설명은 전술한 바와 같다.
일 구현예로, 상기 목적 단백질은, 글루탐산 탈수소효소(glutamate dehydrogenase, gdh) 활성을 갖는 폴리펩티드일 수 있다. 즉, 상기 프로모터의 목적 유전자는 글루탐산 탈수소효소(glutamate dehydrogenase, gdh) 활성을 갖는 폴리펩티드를 코딩하는 유전자일 수 있다.
본 출원에서 "글루탐산 탈수소효소(glutamate dehydrogenase, gdh)"는, "글루타메이트 디하이드로게나제" 등으로도 칭해질 수 있으며, 상기 글루탐산 탈수소효소는 글루타메이트의 2-옥소글루타레이트로의 대사에 관여하며 이의 활성 조절을 통해 라이신, 쓰레오닌, O-아세틸 호모세린, 이소류신 등의 유용 물질 생산성 향상 효과를 얻을 수 있다.
글루탐산 탈수소효소를 코딩하는 유전자의 예로는, 코리네박테리움 글루타미쿰 ATCC13032의 gdh 유전자(NCgl1999) 등이 있을 수 있으나, 이에 제한되는 것은 아니다. 당업자는 공지의 데이터 베이스(GenBank 등)에서 글루탐산 탈수소효소를 코딩하는 유전자 정보를 쉽게 얻을 수 있다.
또한 상기 글루탐산 탈수소효소를 구성하는 아미노산 서열은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 일 예로, 코리네박테리움 글루타미쿰 유래일 수 있다.
또한, 본 출원의 "글루탐산 탈수소효소 활성을 갖는 폴리펩티드" 는 상기 글루탐산 탈수소효소의 야생형, 비변이형 혹은 자연형뿐만 아니라, 이와 동일한 활성을 갖거나, 이보다 활성이 강화된 변이체 또한 포함한다.
본 출원에서, "변이형 폴리펩티드" 는 "변이체(variant)"와 동일한 의미로, 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)에 있어서 상기 열거된 서열 (the recited sequence)과 상이하나, 상기 단백질의 기능(functions) 또는 특성(properties)이 유지되는 단백질을 지칭한다.
변이체는 수 개의 아미노산 치환, 결실 또는 부가에 의해 식별되는 서열(identified sequence)과 상이하다. 이러한 변이체는 일반적으로 상기 단백질의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 단백질의 특성을 평가하여 식별될 수 있다. 즉, 변이체의 능력은 본래 단백질(native protein)에 비하여 증가될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다.
상기 용어 "변이체"는 변이형, 변형, 변이된 단백질, 변이 등의 용어(영문 표현으로는 modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant 등)가 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다. 본 출원의 목적상, 상기 변이체는 천연의 야생형 또는 비변형 단백질 대비 변이된 단백질의 활성이 증가된 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 상기 변이체는 하나 이상의 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널(또는 리더) 서열과 컨쥬게이트 할 수 있다. 또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원의 글루탐산 탈수소효소 활성을 갖는 폴리펩티드를 코딩하는 유전자는 "gdh 유전자"로 칭할 수 있다.
상기 유전자는 코리네박테리움 속 미생물 유래, 구체적으로는 코리네박테리움 글루타미쿰 유래일 수 있다.
본 출원에서 "gdh 유전자" 즉 글루탐산 탈수소효소 활성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드는, 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다.
본 출원의 글루탐산 탈수소효소 활성을 갖는 폴리펩티드는 변이체 서열도 포함하며, 구체적으로는 글루탐산 탈수소효소의 강화된 활성을 나타내도록 변이된 단백질 변이체도 포함할 수 있다.
본 출원의 다른 하나의 양태는, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 포함하는 유전자 발현용 조성물을 제공한다.
상기 유전자 발현용 조성물은 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드에 의해 발현시킬 수 있는 유전자를 발현할 수 있는 조성물을 의미한다.
그 예로, 상기 유전자 발현용 조성물은 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 포함하며, 추가로 상기 폴리뉴클레오티드를 프로모터로 작동시킬 수 있는 구성을 제한없이 포함할 수 있다.
본 출원의 유전자 발현용 조성물에서, 상기 폴리뉴클레오티드는 도입된 숙주 세포에서 작동가능하게 연결된 유전자를 발현시킬 수 있게 벡터내에 포함된 형태일 수 있다.
본 출원의 다른 하나의 양태는 상기 프로모터 활성을 갖는 폴리뉴클레오티드, 상기 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자를 포함하는 발현 카세트를 포함한다.
본 출원에서 용어 "발현　카세트"란, 상기 프로모터 활성을 갖는 폴리뉴클레오티드와 목적 단백질을 코딩하는 유전자를 포함하고 있어서, 프로모터 하류에 작동 가능하게 연결되어 있는 목적　유전자를　발현시킬 수 있는 단위　카세트를 의미한다. 구체적으로, 상기 발현 카세트는 상기 프로모터 활성을 갖는 폴리뉴클레오티드와 목적 단백질을 코딩하는 유전자가 작동 가능하게 연결된 것일 수 있다. 본 출원에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 단백질을 코딩하는 유전자의 전사를 개시 및 매개하도록 하는 프로모터 활성을 갖는 폴리뉴클레오티드와 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
이와 같은　유전자　발현　카세트의 내부 또는 외부에는 상기 목적　유전자의 효율적인　발현을 도울 수 있는 다양한 인자가 추가로 포함될 수 있다. 상기　유전자　발현　카세트는 통상 상기 목적　유전자에 작동 가능하게 연결되어 있는 프로모터(promoter) 외에 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다.
일 구현예로, 상기 목적 단백질은 글루탐산 탈수소효소 활성을 갖는 폴리펩티드 일 수 있다.
본 출원의 다른 하나의 양태는 상기 프로모터 활성을 갖는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 포함한다.
일 구현예로, 상기 목적 단백질은 글루탐산 탈수소효소 활성을 갖는 폴리펩티드 일 수 있다.
본 출원에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드 서열을 함유하는 DNA 제조물을 의미한다.
본 출원의 목적 상, 상기 조절 서열에는, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드가 포함될 수 있다.
한편 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열 등의 구성을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 숙주세포 내에서 발현 가능한 것이면 특별히 제한되지 않으며, 당업계에 알려진 임의의 벡터를 이용하여 숙주세포를 형질전환시킬 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다.
예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λLB3, λBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다.
또한, 숙주세포 내 염색체 삽입용 벡터를 통해 염색체 내에 내재적 프로모터를 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드로 교체시킬 수 있다. 예를 들면, pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 벡터 등을 사용할 수 있으나, 이에 제한되지 않는다. 또는, 공지된 기술의 벡터를 이용할 수 있다 (대한민국 등록특허 제10-09240675호).
상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다. 일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 야생형 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다.
본 출원에서 용어 "형질전환"은 목적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 목적 단백질이 발현할 수 있도록 하는 것 일 수 있다.
형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 목적 단백질을 코딩하는 폴리뉴클레오티드는, 목적 단백질을 코딩하는 DNA 및 RNA를 포함할 수 있다. 상기 목적 단백질을 코딩하는 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 목적 단백질을 코딩하는 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태로 숙주세포에 도입될 수 있다.
상기 발현 카세트는 통상 상기 목적 단백질을 코딩하는 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 또한, 상기 목적 단백질을 코딩하는 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 목적 상, 상기 프로모터는, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드 일 수 있다.
본 출원의 벡터를 형질전환시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드; 상기 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자를 포함하는 발현 카세트; 또는 상기 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 포함하는 미생물을 제공한다.
본 출원에서 용어 "미생물"은 야생형 미생물이나, 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 약화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물을 모두 포함하는 개념이다. 구체적으로는, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드와 목적 단백질을 포함하는 미생물일 수 있다.
상기 목적 단백질은 글루탐산 탈수소효소(glutamate dehydrogenase, gdh) 활성을 갖는 폴리펩티드일 수 있다. 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드, 목적 단백질, 글루탐산 탈수소효소(glutamate dehydrogenase, gdh) 활성을 갖는 폴리펩티드, 벡터, 및 발현 카세트에 대해서는 전술한 바와 같다.
상기 미생물은 코리네박테리움 속 미생물일 수 있고, 구체적으로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있다.
상기 미생물은 글루탐산 탈수소효소를 발현하는 미생물, 또는 글루탐산 탈수소효소 활성을 갖는 폴리펩티드를 발현하는 미생물, 또는 글루탐산 탈수소효소 활성을 갖는 폴리펩티드가 도입된 미생물 일 수 있으나 이에 제한되지 않는다.
본 출원에서, 상기 미생물은 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 포함할 수 있고, 구체적으로 상기 폴리뉴클레오티드 및/또는 상기 폴리뉴클레오티드와 작동 가능하게 연결되고 목적 단백질을 코딩하는 유전자를 포함할 수 있다. 또는, 상기 미생물은 상기 폴리뉴클레오티드 또는 유전자 발현 조절 서열 및 목적 단백질을 코딩하는 유전자를 포함하는 벡터 또는 발현 카세트를 포함할 수 있으나, 이에 제한되지 않는다. 또한, 상기 폴리뉴클레오티드, 상기 목적 단백질을 코딩하는 유전자, 벡터, 및 발현 카세트는 형질전환에 의해 상기 미생물에 도입될 수 있으나, 이에 제한되지 않는다. 나아가, 상기 미생물은 상기 유전자가 발현될 수 있다면, 상기 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자가, 염색체 상에 위치하거나 염색체 외에 위치하는 것과는 무관하다.
본 출원에서 용어, 단백질이 "발현되도록/되는"은 목적 단백질, 예를 들어 글루탐산 탈수소효소 혹은 이의 변이체가 미생물 내에 도입되거나, 미생물 내에서 발현되도록 변형된 상태를 의미한다. 상기 목적 단백질이 미생물 내 존재하는 단백질인 경우 내재적 또는 변형 전에 비하여 그 활성이 강화된 상태를 의미할 수 있다.
구체적으로, "단백질의 도입"은, 미생물이 본래 가지고 있지 않았던 특정 단백질의 활성을 나타나게 되는 것 또는 해당 단백질의 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타나게 되는 것일 수 있다. 예를 들어, 특정 단백질을 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터 또는 발현 카세트가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다.
또한, "활성의 강화"는 미생물이 가진 특정 단백질의 내재적 활성 또는 변형 전 활성에 비하여 활성이 향상된 것일 수 있다. "내재적 활성"은 자연적, 또는 인위적 요인에 의한 유전적 변이로 미생물의 형질이 변화하는 경우, 형질 변화 전 모균주가 본래 가지고 있던 특정 단백질의 활성을 의미하는 것일 수 있다.
본 출원의 목적 상, 상기 활성 강화는 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드 서열을 목적 단백질의 발현 조절 서열로 사용하여 이루어 지는 것일 수 있다. 상기 목적 단백질은 전술한 바와 같이 자연형 혹은 변이형 일 수 있으므로, 상기 발현 조절 서열은 단백질 변이체를 암호화하는 유전자의 발현 조절 서열이거나, 염색체 상의 자연형 단백질을 코딩하는 유전자의 발현 조절 서열일 수 있다.
그 밖에, 다른 활성 강화 방법 또한 조합하여 사용할 수 있다. 예를 들어, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드 서열을 목적 단백질의 발현 조절 서열로 사용하는 것 이외에도, 목적 단백질을 코딩하는 유전자의 세포 내 카피수 증가, 염색체 상의 자연형 단백질을 코딩하는 유전자를 상기 단백질 변이체를 암호화하는 유전자로 대체하는 방법, 상기 단백질 변이체의 활성이 강화되도록 상기 단백질을 암호화하는 유전자에 변이를 추가적으로 도입시키는 방법, 및 미생물에 단백질 변이체를 도입하는 방법으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법을 사용할 수 있으나 이에 제한되지 않는다.
본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 미생물에서 목적 단백질의 발현 조절로 사용함으로써, 목적 단백질의 활성이 강화될 수 있다.
예를 들어, 상응하는 단백질의 활성 또는 농도가 야생형이나 비변형 미생물 균주에서의 단백질의 활성 또는 농도를 기준으로 하여 일반적으로 최소 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% 또는 500%, 최대 1000% 또는 2000%까지 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어 "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 균주 자체이거나, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 포함하지 않는 미생물, 또는 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되지 않은 미생물도 포함한다.
본 출원에서 "목적 물질을 생산하는 미생물"은 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 물질 생산을 위한 유전적 변이가 일어나거나 활성을 강화시킨 미생물일 수 있다. 본 출원의 목적상 상기 목적 물질을 생산하는 미생물은, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 포함하여, 야생형이나 비변형 미생물과 비교하여 목적하는 목적하는 물질을 과량으로 생산할 수 있는 미생물을 의미할 수 있다.
상기 "목적 물질을 생산하는 미생물" 은 "목적 물질 생산 미생물", "목적 물질 생산능을 갖는 미생물, "목적 물질 생산 균주", "목적 물질 생산능을 갖는 균주" 등의 용어와 혼용되어 사용될 수 있다.
상기 목적 물질은 아미노산, 구체적으로 라이신, 쓰레오닌, O-아세틸 호모세린, 또는 이소류신일 수 있다. 보다 구체적인 예로, 상기 라이신은 L-라이신, 상기 쓰레오닌은 L-쓰레오닌, 상기 이소류신은 L-이소류신일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 목적상, 상기 목적 물질을 생산하는 미생물은 목적 물질, 구체적으로, 라이신, 쓰레오닌, O-아세틸 호모세린, 또는 이소류신의 생산능이 향상된 것일 수 있다.
한편, 상기 목적 물질 생산 미생물은 야생형 미생물일 수 있고, 또는 재조합 미생물일 수 있다. 상기 재조합 미생물은 전술한 바와 같다. 상기 미생물은 추가로 목적 물질 생산능 증가를 위한 생합성경로 강화, 피드백 저해 해제, 분해경로 혹은 생합성 경로를 약화시키는 유전자 불활성화 등의 변이를 포함하는 것일 수 있고, 이러한 변이는 인공적으로, 예를 들어 UV 조사에 의해 일어날 수 있으나, 자연적인 것을 배제하는 것은 아니다.
구체적으로, 상기 목적 물질 생산 미생물은 상기 목적 물질을 생산할 수 있도록 변이된 것일 수 있다. 예를 들어, 목적 물질의 생산능이 없는 미생물을 목적 물질의 생산능을 갖도록 변이되거나, 생산능을 강화시킨 미생물일 수 있다. 하나의 예로, 야생형 미생물에 목적 물질을 생산할 수 있도록 생합성 경로에 관여하는 단백질 또는 그의 변이체가 도입된 미생물일 수 있다(KR 10-2011994, KR 10-1947959, KR 10-1996769).
구체적인 예로, 본 출원의 목적 물질 생산 미생물은 아스파토키나제(aspartokinase, lysC), 호모세린 디하이드로게나제(homoserine dehydrogenase, hom), 파이루베이트 카르복실라제(pyruvate carboxylase, pyc), L-쓰레오닌 디하이드라타제(L-threonine dehydratase, ilvA) 또는 이들의 조합을 포함하는 코리네박테리움 속 미생물일 수 있다. 상기 아스파토키나제, 호모세린 디하이드로게나제, 파이루베이트 카르복실라제, 또는 L-쓰레오닌 디하이드라타제는 야생형 단백질이거나, 활성이 약화 또는 강화되어 목적 물질 생산에 이롭도록 변이된 단백질 변이체일 수 있다.
본 출원의 미생물은 프로모터 활성을 갖는 폴리뉴클레오티드를 포함하지 않는 미생물에 비해 최소 1%, 5%, 10%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 22%, 25%, 29%, 33%, 38%, 44%, 45%, 또는 48% 이상의 목적 물질 생산능을 갖는 것일 수 있다.
본 출원의 다른 하나의 양태는 상기 미생물을 배지에서 배양하는 단계를 포함하는 목적 물질 제조방법을 제공한다. 상기 미생물, 목적 물질에 대해서는 전술한 바와 같다.
본 출원에서 상기 폴리뉴클레오티드를 포함하는 미생물을 이용하여 목적 물질을 생산하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되는 것은 아니다. 배양에 사용되는 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 코리네박테리움 균주에 대한 배양 배지는 공지되어 있다(예를 들면, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
본 출원의 균주의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 코리네박테리움 속 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용될 수 있으며, 구체적으로는 본 출원의 균주를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 또는 혐기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루타메이트, 메티오닌, 라이신 등과 같은 아미노산 등이 포함될 수 있으나, 이에 제한되지 않는다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있고, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으나, 이에 제한되지 않는다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있다.
그 외에 상기 배지에는 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 구체적으로, 상기 균주의 배양 배지에는 L-아미노산 등이 첨가될 수 있다. 구체적으로는 글리신(glycine), 글루타메이트(glutamate), 및/또는 시스테인(cysteine) 등이 첨가될 수 있고, 필요에 따라서는 라이신(lysine) 등의 L-아미노산 이 더 첨가될 수 있으나 반드시 이에 제한되지 않는다.
상기 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있으며, 이에 제한되지 않는다.
본 출원에서, 균주의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다.
배양물의 온도는 25℃ 내지 40℃일 수 있으며, 보다 구체적으로는 28℃ 내지 37℃ 일 수 있으나 이에 제한되지 않는다. 배양 기간은 원하는 유용 물질의 생산량이 수득될 때까지 계속될 수 있으며, 구체적으로는 1 시간 내지 160 시간, 10 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
상기 목적 물질 제조방법은, 상기 배양 단계 이후, 추가적인 공정을 더 포함할 수 있다. 상기 추가 공정은 목적 물질 용도에 따라 적절히 선택될 수 있다.
구체적으로, 상기 목적 물질 제조방법은 상기 배양 단계 이후 상기 미생물, 상기 배지, 상기 미생물의 건조물, 상기 미생물의 추출물, 상기 미생물의 배양물, 상기 배양물의 상등액, 상기 미생물의 파쇄물 중에서 선택된 하나 이상의 물질로부터 목적 물질을 회수하는 단계를 포함할 수 있다.
상기 방법은 상기 회수 단계 이전, 혹은 동시에 미생물(균주)를 용균시키는 단계를 추가로 포함할 수 있다. 균주의 용균은 본 출원이 속하는 기술 분야에서 통상적으로 사용되는 방법, 예를 들어, 용균용 완충용액, 소니케이터, 열 처리 및 후렌치 프레서 등에 의해 실시할 수 있다. 또한 상기 용균 단계는 세포벽 분해 효소, 핵산 분해 효소, 핵산 전이 효소, 단백질 분해 효소 등 효소반응을 포함할 수 있으나 이에 제한되지 않는다.
본 출원에서 "미생물의 건조물"은 "균주 건조물" 등의 용어와 교환적으로 사용될 수 있다. 상기 미생물의 건조물은 목적 물질을 축적한 균체를 건조시켜 제조할 수 있으며, 구체적으로 사료용 조성물, 식품용 조성물 등에 포함될 수 있으나, 이에 제한되지 않는다.
본 출원에서 미생물의 추출물은 "균주 추출물" 등의 용어와 상호 교환적으로 사용될 수 있다. 상기 균주 추출물은, 상기 균주의 균체에서 세포벽을 분리하고 남은 물질을 의미할 수 있다. 구체적으로, 균체를 용균시켜 수득한 성분에서 세포벽을 제외한 나머지 성분을 의미할 수 있다. 상기 균주 추출물은 목적 물질을 포함하며, 목적 물질 외의 성분으로는 단백질, 탄수화물, 핵산, 섬유질 중 하나 이상의 성분이 포함되어 있을 수 있으나 이에 제한되지 않는다.
상기 회수 단계는 당해 기술 분야에 공지된 적합한 방법을 이용하여, 목적 물질인 목적 물질을 회수할 수 있다.
상기 회수 단계는 정제 공정을 포함할 수 있다. 상기 정제 공정은 균주로부터 목적 물질만을 분리하여 순수 정제하는 것일 수 있다. 상기 정제 공정을 통해, 순수 정제된 목적 물질이 제조될 수 있다.
필요에 따라, 상기 목적 물질 제조방법은, 상기 배양 단계 이후 수득된 균주, 이의 건조물, 추출물, 배양물, 파쇄물 및 이들로부터 회수된 목적 물질 중에서 선택된 물질과 부형제를 혼합하는 단계를 더 포함할 수 있다.
상기 부형제는 목적하는 용도나 형태에 따라 적절히 선택하여 사용할 수 있으며, 예를 들어, 전분, 글루코오스, 셀룰로오스, 락토오스, 글리코겐, D-만니톨, 소르비톨, 락티톨, 말토덱스트린, 탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 덱스트린, 알긴산나트륨, 메틸셀룰로오스, 콜로이드성실리카겔, 하이드록시프로필스타치, 하이드록시프로필메틸셀루로오스, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤, 아라비아 검 중에서 선택되는 것일 수 있으며, 구체적으로는 전분, 글루코오스, 셀룰로오스, 락토오스, 덱스트린, 글리코겐, D-만니톨, 말토덱스트린 중에서 선택되는 하나 이상의 성분일 수 있으나 이에 제한되지 않는다.
상기 부형제는, 예를 들어, 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 다른 하나의 양태는 서열번호 1의 폴리뉴클레오티드 서열에서 27번, 28번, 31번, 32번 및 36번 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 갖는 폴리뉴클레오티드의, 프로모터로서의 용도를 제공한다.
상기 폴리뉴클레오티드에 대해서는 전술한 바와 같다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 신규 프로모터의 목적 유전자 발현 유도 활성 확인
실시예 1-1. 무작위 돌연변이법을 이용한 gdh 프로모터 변이 라이브러리
먼저, 미국 국립 보건원의 유전자은행(NIH GenBank)을 근거로 하여 야생형(wild type) 코리네박테리움 글루타미쿰 ATCC13032의 gdh 유전자(NCBI 등록번호 NCgl1999)의 프로모터 부위를 포함하는 염기서열(서열번호 1)을 확보하였다. 서열번호 1의 염기서열로 이루어진 gdh 유전자의 프로모터를 주형으로 Diversify PCR Random Mutagenesis Kit(takara)를 이용하였고, 서열번호 5 및 서열번호 6의 프라이머를 이용하여 제조사의 매뉴얼대로 랜덤으로 돌연변이를 유발시켜 서열이 다른 gdh 프로모터 변이 PCR 산물(Pmgdh)을 수득하였다. 또한, GFP 유전자의 ORF(Open Reading Frame)는 pGFPuv 벡터(clontech, 미국)를 주형으로, 서열번호 7 및 8의 프라이머를 이용하여 PCR을 수행하였으며, PCR은 94℃에서 5 분간 변성 후, 94℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 1분 중합을 30 회 반복한 후, 72℃에서 7 분간 중합반응을 수행하여, GFP의 ORF를 포함하는 유전자 절편을 수득하였다.
상기 증폭 산물인 gdh 프로모터 변이 PCR 산물(Pmgdh) 및 GFP를 BamHⅠ/SalI 제한효소로 절단하여 준비한 대장균-코리네박테리움 셔틀벡터(shuttle vector)인 pCES208(J.Microbiol. Biotechnol. 18:639-647, 2008)와 혼합하여, In-Fusion® HD 클로닝 키트(clontech)를 이용해 Pmgdh가 GFP와 연결되어 있는 재조합 벡터 라이브러리를 제작하였다. 각 벡터는 pCES_Pm1gdh_gfp 부터 pCES_Pm100gdh_gfp까지로 명명하였다.
Pmgdh 라이브러리의 활성을 확인하기 위한 대조군으로는 야생형 gdh 유전자의 프로모터(서열번호 1)와 GFP가 연결되어 있는 재조합 벡터를 사용하였다. 야생형(wild type) 코리네박테리움 글루타미쿰 ATCC13032를 주형으로, 서열번호 5와 서열번호 6의 프라이머를 이용하여 야생형 gdh 유전자의 프로모터 유전자 절편을 수득하였다. 또한, GFP 유전자의 ORF(Open Reading Frame)는 pGFPuv 벡터(clontech, 미국)를 주형으로, 서열번호 7 및 8의 프라이머를 이용하여 PCR을 수행하였으며, PCR은 94℃에서 5 분간 변성 후, 94℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 1분 중합을 30 회 반복한 후, 72℃에서 7 분간 중합반응을 수행하여, GFP의 ORF를 포함하는 유전자 절편을 수득하였다.
상기 증폭 산물인 gdh 야생형 프로모터 PCR 산물(Pgdh) 및 GFP를 BamHⅠ/SalⅠ 제한효소로 절단하여 준비한 대장균-코리네박테리움 셔틀벡터(shuttle vector)인 pCES208(J.Microbiol. Biotechnol. 18:639-647, 2008)와 혼합하여, In-Fusion® HD 클로닝 키트(clontech)를 이용해 Pgdh가 GFP와 연결되어 있는 재조합 벡터를 제작하였고, 이를 pCES_Pgdh_gfp라 명명하였다.
실시예 1-2. 형질전환 균주의 제작
벡터 pCES208 및 상기 실시예 1-1에서 제작된 재조합 벡터 pCES_Pmgdh_gfp 라이브러리(pCES_Pm1gdh_gfp 부터 pCES_Pm100gdh_gfp) 및 pCES_Pgdh_gfp를 코리네박테리움 글루타미쿰 ATCC13032에 전기천공법(Appl. Microbiol. Biothcenol.(1999) 52:541-545)으로 형질전환한 후, 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에서 형질전환된 균주를 선별하여, 이를 각각 ATCC13032/pCES, ATCC13032/pCES_Pmgdh_gfp(ATCC13032/pCES_Pm1gdh_gfp 부터 ATCC13032/pCES_Pm100gdh_gfp) 및 ATCC13032/pCES_Pgdh_gfp로 명명하였다.
실시예 1-3. gdh 프로모터 변이 선별
gdh 프로모터 변이체의 활성을 확인하기 위해, 상기 실시예 1-2에서 획득한 형질전환 균주인 코리네박테리움 글루타미쿰 ATCC13032/pCES, ATCC13032/pCES_Pgdh_gfp 및 ATCC13032/pCES_Pmgdh_gfp(ATCC13032/pCES_Pm1gdh_gfp 부터 ATCC13032/pCES_Pm100gdh_gfp)를 하기와 같은 방법으로 배양하고, GFP의 활성을 측정하였다.
구체적으로, 배지(포도당 20 g, 황산암모늄 5 g, 효모 추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, 바이오틴 150 ㎍, 티아민 염산염 1.5 mg, 칼슘 판토테인산 3 mg, 니코틴아마이드 3 mg (증류수 1 L 기준), pH 7.2) 25 ml가 담긴 플라스크에 형질전환된 코리네박테리움 글루타미쿰 균주들을 각각 접종하고 30℃에서 20 시간 동안 진탕 배양하였다. 원심분리(5,000 rpm, 15분)를 통하여 배양액으로부터 균체를 수거하여, 50mM Tris-HCl(pH 8.0) 완충용액으로 2회 세척한 후, 동 완충용액으로 현탁하였다. 현탁액 1.5ml 당 1.25g의 글래스 비드(glass bead)를 첨가한 후, 비드 비터 (bead beater)를 이용하여, 6분간 균체를 파쇄한 다음, 원심분리(15,000 rpm, 20분)를 통하여 상층액을 수거하여, 브레드포드 방법에 의한 단백질 농도를 정량하였다. 동일양의 균체 추출물에 대하여 Laure Gory 등의 방법 (FEMS Microbiology Letters 194, 127-133, 2001)을 이용하여 488nm에서 여기광을 조사하고, 511nm 발출광을 LS-50B spectrophotometer(Perkin-Elmer) 기기를 이용하여 측정함으로써, GFP 유전자의 발현 정도를 측정하였다. 대조군 ATCC13032/pCES_Pgdh_gfp 균주의 GFP 유전자 발현 정도와 비교하여, 가장 GFP 유전자 발현 정도가 높은 균주 상위 3종을 선별하였다(표 1).
균주 형광 감도
ATCC13032/pCES 0
ATCC13032/pCES_Pgdh_gfp 583
ATCC13032/pCES_Pm3gdh_gfp 1217
ATCC13032/pCES_Pm16gdh_gfp 1205
ATCC13032/pCES_Pm78gdh_gfp 1198
상기 표 1에 나타난 바와 같이, Pm3gdh, Pm16gdh, Pm78gdh 프로모터는 코리네박테리움 글루타미쿰에서 프로모터 활성을 나타내며, 야생형 gdh 프로모터보다 높은 형광 감도를 나타내는 것을 확인하였다. 상기에서 선별된 4종 균주들의 gdh 프로모터에 도입된 변이를 확인하기 위하여, gdh 프로모터 변이체의 서열을 분석하였다. 서열을 결정하기 위해 서열 번호 9 및 서열번호 10의 프라이머를 이용하여 PCR을 수행한 후, 서열 분석을 진행하였다. 야생형 gdh 프로모터 서열인 서열번호 1의 서열과 비교하였으며, 이를 통해 변이형 gdh 프로모터의 서열을 확인하였다. 선별된 균주의 gdh 프로모터 서열은 하기 표 2와 같다(표 2).
서열번호 변이체 서열
2 Pm3gdh ATTCTTTGTGGTCATATCTGTGCGACTGTGGTATACTTGAACGTGAGCATTTACCAGCCTAAATGCCCGCAGTGAGTTAAGTCTCAAAGCAAGAAGTTGCTCTTTAGGGCATCCGTAGTTTAAAACTATTAACCGTTAGGTATGACAAGCCGGTTGATGTGAACGCAGTTTTTAAAAGTTTCAGGATCAGATTTTTCACAGGCATTTTGCTCCAGCAAACGCCTAGGATGTACATGGTGCCCTCAATGGGAACCACCAACATCACTAAATGGCCCAGGTACACACTTTAAAATCGTGCGCGCATGCAGCCGAGATGGGAACGAGGAAATC
3 Pm16gdh ATTCTTTGTGGTCATATCTGTGCGACTGTGGTATACTTGAACGTGAGCATTTACCAGCCTAAATGTCCGCAGTGAGTTAAGTCTCAAAGCAAGAAGTTGCTCTTTAGGGCATCCGTAGTTTAAAACTATTAACCGTTAGGTATGACAAGCCGGTTGATGTGAACGCAGTTTTTAAAAGTTTCAGGATCAGATTTTTCACAGGCATTTTGCTCCAGCAAACGCCTAGGATGTACATGGTGCCCTCAATGGGAACCACCAACGTCACTAAATGGCCCAGGTACACACTTTAAAATCGTGCGCGCATGCAGCCGAGATGGGAACGAGGAAATC
4 Pm78gdh ATTCTTTGTGGTCATATCTGTGCGACTGTGGTATACTTGAACGTGAGCATTTACCAGCCTAAATGTCCGCAGTGAGTTAAGTCTCAAAGCAAGAAGTTGCTCTTTAGGGCATCCGTAGTTTAAAACTATTAACCGTTAGGTATGACAAGCCGGTTGATGTGAACGCAGTTTTTAAAAGTTTCAGGATCAGATTTTTCACAGGCATTTTGCTCCAGCAAACGCCTAGGATGTACATGGTGCCCTCAATGGGAACCACCAACATCACTAAATGGCCCAGGTACACACTTTAAAATCGTGCGCGCATGCAGCCGAGATGGGAACGAGGAAATC
실시예 2. Pm3gdh, Pm16gdh, Pm78gdh 프로모터 변이 도입 벡터 제작
상기 Pm3gdh, Pm16gdh, Pm78gdh 프로모터 변이를 도입하기 위한 벡터를 제작하기 위하여, 서열번호 13 및 서열번호 14의 프라이머를 이용하여 각각 pCES_Pm3gdh_gfp, pCES_Pm16gdh_gfp, pCES_Pm78gdh_gfp의 벡터를 주형으로 프로모터 변이에 해당하는 PCR 산물을 수득 하였다. 서열번호 11 및 서열번호 12, 서열번호 15 및 서열번호 16의 프라이머 세트를 이용하여 야생형 코리네박테리움 글루타미쿰 ATCC13032 균주의 염색체를 주형으로 gdh 프로모터 업스트림(upstream) 영역과 gdh의 ORF 일부를 포함하는 유전자 절편을 수득하였다. PCR은 94 ℃에서 5분간 변성 후, 94℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 1분 중합을 30회 반복한 후, 72℃에서 5분간 중합 반응을 수행하여, 각각의 PCR 산물을 수득하였다. 상기 세 증폭 산물을 미리 SmaI 제한효소로 절단하여 준비한 pDCM2 벡터(대한민국 공개번호 제10-2020-0136813호)와 혼합하여 In-Fusion® HD 클로닝 키트(clontech)를 이용해 재조합 벡터를 제작하였고, 이를 각각 pDCM2_Pm3gdh_gdh, pDCM2_Pm16gdh_gdh, pDCM2_Pm78gdh_gdh라 명명하였다.
실시예3. 목적산물 생산능 평가
3-1. 라이신 생산능 평가
3-1-1. gdh 프로모터 변이체가 도입된 L-라이신 생산 균주의 제작
실시예 2에서 제작된 pDCM2_Pm3gdh_gdh, pDCM2_Pm16gdh_gdh, pDCM2_Pm78gdh_gdh 벡터를 이용하여 gdh 프로모터 변이체가 형질전환된 균주를 제작하기 위하여, L-라이신 생산 균주인 코리네박테리움 글루타미쿰 CJ3P(Binder et al. Genome Biology 2012, 13:R40) 균주에 상기 벡터들을 형질전환시켜, 염색체 내로 gdh 프로모터 변이체 서열을 도입하였다. CJ3P 균주는 기 공지된 기술을 바탕으로 야생주에 3종의 변이(pyc(Pro458Ser), hom(Val59Ala), lysC(Thr311Ile))를 도입하여 L-라이신 생산능을 갖게된 코리네박테리움 글루타미쿰 균주이다.
구체적으로, 상기 실시예 2에서 제작한 벡터들을 전기천공법으로 CJ3P 균주에 도입한 후 카나마이신 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 gdh 프로모터 변이체가 도입된 균주를 서열번호 9 및 서열번호 10의 프라이머를 이용하여 PCR 및 염기서열 분석을 통해 선별하였고, 상기 선별된 균주를 코리네박테리움 글루타미쿰 CJ3P::Pm3gdh_gdh, CJ3P::Pm16gdh_gdh, CJ3P::Pm78gdh_gdh라 명명하였다.
3-1-2. gdh 프로모터 변이체가 도입된 균주의 L-라이신 생산능 평가
모균주로 이용한 코리네박테리움 글루타미쿰 CJ3P 균주 및 실시예 3-1-1에서 제작된 코리네박테리움 글루타미쿰 CJ3P::Pm3gdh_gdh, CJ3P::Pm16gdh_gdh, CJ3P::Pm78gdh_gdh 균주의 L-라이신 생산능을 평가하기 위해 하기와 같은 방법으로 균주를 배양한 후, 분석하였다.
먼저, 종 배지 25ml를 함유하는 250ml 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20시간 동안 200rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24ml를 함유하는 250ml 코너-바플 플라스크에 1ml의 종 배양액을 접종하고, 32℃에서 48시간 동안, 200rpm으로 진탕 배양하였다. 상기 종 배지 및 생산 배지의 조성은 하기와 같다.
<종 배지(pH 7.0)>
포도당 20g, 펩톤 10g, 효모추출물 5g, 요소 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, 바이오틴 100㎍, 티아민 염산염 1000㎍, 칼슘-판토텐산 2000㎍, 니코틴아미드 2000㎍ (증류수 1 리터 기준)
<생산 배지(pH 7.0)>
포도당 45g, 대두 단백질 10g, 당밀 10g, (NH4)2SO4 15 g, KH2PO4 0.55 g, MgSO4·7H2O 0.6 g, FeSO4·7H2O 9mg, MnSO4·5H2O 9mg, 바이오틴 0.9mg, 티아민 염산염 4.5mg, CaCO3 30 g, 칼슘-판토텐산 4.5mg, 니코틴아미드 30mg, ZnSO4 0.45mg, CuSO4 0.45mg (증류수 1 리터 기준)
배양 종료 후 HPLC를 이용해 L-라이신의 생산량을 측정하였다. 코리네박테리움 글루타미쿰 CJ3P, CJ3P::Pm3gdh_gdh, CJ3P::Pm16gdh_gdh 및 CJ3P::Pm78gdh_gdh 균주에 대한 배양액 중의 L-라이신 농도 및 농도 증가율은 하기 표 3과 같다.
균주명 L-라이신 농도(g/L) L-라이신 농도 증가율(%)
CJ3P 4.12 -
CJ3P::gdhPm3_gdh 4.96 20.39%
CJ3P::gdhPm16_gdh 4.84 17.48%
CJ3P::gdhPm78_gdh 4.79 16.26%
상기 표 3에 나타난 바와 같이 gdh 프로모터 변이체가 도입된 세 균주가 모균주인 CJ3P에 비해 L-라이신의 농도가 증가하는 것을 확인하였다.상기 CJ3P::gdhPm3_gdh는 CM03-1660으로 명명하였으며, 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2021년 4월 5일자로 기탁하여 수탁번호 KCCM12970P를 부여받았다.
실시예 3-2. 쓰레오닌 생산능 평가
3-2-1. 쓰레오닌 생산 균주의 제작
실시예 2에서 제작된 pDCM2_Pm3gdh_gdh, pDCM2_Pm16gdh_gdh, pDCM2_Pm78gdh_gdh 벡터를 이용하여 gdh 프로모터 변이체로 형질전환된 균주를 제작하기 위하여, 우선 코리네박테리움 글루타미쿰 ATCC13032 균주를 기반으로 lysC(L377K) 변이체(대한민국 등록특허 제10-2011994호)와 hom(R398Q) 변이체(대한민국 등록특허 제10-1947959호)를 도입한 L-쓰레오닌 생산 균주를 제작하였다.
구체적으로, L-쓰레오닌 생산 균주를 제작하기 위해 먼저, lysC(L377K)를 도입하기 위한 벡터를 제작하였다. 벡터를 제작하기 위해 야생형 코리네박테리움 글루타미쿰 ATCC13032 균주의 염색체를 주형으로 하여 서열번호 17 및 18, 서열번호 19 및 20의 프라이머를 이용하여 PCR을 수행하였다. 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하여, 각각의 PCR 산물을 수득하였다. 상기 증폭 산물을 미리 SmaI 제한효소로 절단하여 준비한 pDCM2 벡터와 혼합하여 In-Fusion® HD 클로닝 키트를 이용해 재조합 벡터를 제작한 후, 이를 pDCM2_lysC(L377K)라 명명하였다.
상기에서 제작한 pDCM2_lysC(L377K) 벡터를 코리네박테리움 글루타미쿰 ATCC13032 균주에 전기천공법으로 도입한 후 카나마이신 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 lysC 유전자에 뉴클레오티드 변이가 도입된 균주를 서열번호 25 및 서열번호 26의 프라이머를 이용하여 PCR 및 염기서열 분석을 통해 선별하였고, 상기 선별된 균주를 ATCC13032::lysC(L377K)라 명명하였다.
또한 hom(R398Q)를 도입하는 벡터를 제작하기 위하여 코리네박테리움 글루타미쿰 ATCC13032 균주의 염색체를 주형으로 서열번호 21 및 22의 프라이머, 서열번호 23 및 24의 프라이머를 이용하여 PCR을 진행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 상기 증폭 산물을 미리 SmaI 제한효소로 절단하여 준비한 pDCM2 벡터와 혼합하여 In-Fusion® HD 클로닝 키트를 이용해 재조합 벡터를 제작한 후, 이를 pDCM2_hom(R398Q)라 명명하였다.
상기에서 제작한 pDCM2_hom(R398Q) 벡터를 상기에서 제작한 코리네박테리움 글루타미쿰 ATCC13032::lysC(L377K) 균주에 전기천공법으로 도입한 후 카나마이신 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 hom 유전자에 뉴클레오티드 변이가 도입된 균주를 서열번호 27 및 서열번호 28의 프라이머를 이용하여 PCR 및 염기서열 분석을 통해 선별하였고, 상기 선별된 균주를 코리네박테리움 글루타미쿰 ATCC13032::lysC(L377K)_hom(R398Q)라 명명하였다.
3-2-2. gdh 프로모터 변이체가 도입된 L-쓰레오닌 생산 균주의 제작
상기 실시예 2에서 제작한 벡터들을 전기천공법으로 코리네박테리움 글루타미쿰 ATCC13032::lysC(L377K)_hom(R398Q) 균주에 도입한 후 카나마이신 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 gdh 프로모터 변이체가 도입된 균주를 서열번호 9 및 서열번호 10의 프라이머를 이용하여 PCR 및 염기서열 분석을 통해 선별하였고, 상기 선별된 균주를 코리네박테리움 글루타미쿰 ATCC13032:: lysC(L377K)_hom(R398Q)::Pm3gdh_gdh, ATCC13032:: lysC(L377K)_hom(R398Q)::Pm16gdh_gdh, ATCC13032:: lysC(L377K)_hom(R398Q)::Pm78gdh_gdh라 명명하였다.
3-2-3. gdh 프로모터 변이체가 도입된 균주의 L-쓰레오닌 생산능 평가
모균주로 이용한 코리네박테리움 글루타미쿰 ATCC13032::lysC(L377K)_hom(R398Q), 실시예 3-2-2에서 제작된 ATCC13032:: lysC(L377K)_hom(R398Q)::Pm3gdh_gdh, ATCC13032:: lysC(L377K)_hom(R398Q)::Pm16gdh_gdh 및 ATCC13032:: lysC(L377K)_hom(R398Q)::Pm78gdh_gdh 균주의 L-쓰레오닌 생산능을 평가하기 위해 하기와 같은 방법으로 균주를 배양한 후, 분석하였다.
먼저, 종 배지 25ml를 함유하는 250ml 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20시간 동안 200rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24ml를 함유하는 250ml 코너-바플 플라스크에 1ml의 종 배양액을 접종하고, 32℃에서 48시간 동안, 200rpm으로 진탕 배양하였다. 상기 종 배지 및 생산 배지의 조성은 하기와 같다.
<종 배지(pH 7.0)>
포도당 20g, 펩톤 10g, 효모추출물 5g, 요소 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, 바이오틴 100㎍, 티아민 염산염 1000㎍, 칼슘-판토텐산 2000㎍, 니코틴아미드 2000㎍ (증류수 1 리터 기준)
<생산 배지(pH 7.0)>
포도당 45g, 대두 단백질 10g, 당밀 10g, (NH4)2SO4 15 g, KH2PO4 0.55 g, MgSO4·7H2O 0.6 g, FeSO4·7H2O 9mg, MnSO4·5H2O 9mg, 바이오틴 0.9mg, 티아민 염산염 4.5mg, CaCO3 30 g, 칼슘-판토텐산 4.5mg, 니코틴아미드 30mg, ZnSO4 0.45mg, CuSO4 0.45mg (증류수 1 리터 기준)
배양 종료 후 HPLC를 이용해 L-쓰레오닌의 생산량을 측정하였다. 코리네박테리움 글루타미쿰 ATCC13032::lysC(L377K)_hom(R398Q), ATCC13032:: lysC(L377K)_hom(R398Q)::Pm3gdh_gdh, ATCC13032:: lysC(L377K)_hom(R398Q)::Pm16gdh_gdh 및 ATCC13032:: lysC(L377K)_hom(R398Q)::Pm78gdh_gdh 균주에 대한 배양액 중의 L-쓰레오닌 농도 및 농도 증가율은 하기 표 4와 같다.
균주명 L-쓰레오닌 농도(g/L) L-쓰레오닌 농도 증가율(%)
ATCC13032::lysC(L377K)_hom(R398Q) 0.83 -
ATCC13032:: lysC(L377K)_hom(R398Q)::Pm3gdh_gdh 1.11 33.73%
ATCC13032:: lysC(L377K)_hom(R398Q)::Pm16gdh_gdh 0.95 14.46%
ATCC13032:: lysC(L377K)_hom(R398Q)::Pm78gdh_gdh 1.02 22.89%
상기 표 4에 나타난 바와 같이 gdh 프로모터 변이체가 도입된 세 균주가 모균주인 ATCC13032::lysC(L377K)_hom(R398Q)에 비해 L-쓰레오닌의 농도가 증가하는 것을 확인하였다.
실시예 3-3. O-아세틸 호모세린 생산능 평가
3-3-1. gdh 프로모터 변이체가 도입된 O-아세틸 호모세린 생산 균주의 제작
상기 실시예 2에서 제작한 벡터들을 전기천공법으로 야생형 균주인 코리네박테리움 글루타미쿰 ATCC13032에 도입한 후 카나마이신 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 gdh 프로모터 변이체가 도입된 균주를 서열번호 9 및 서열번호 10의 프라이머를 이용하여 PCR 및 염기서열 분석을 통해 선별하였고, 상기 선별된 균주를 코리네박테리움 글루타미쿰 ATCC13032::Pm3gdh_gdh, ATCC13032::Pm16gdh_gdh, ATCC13032::Pm78gdh_gdh라 명명하였다.
3-3-2. gdh 프로모터 변이체가 도입된 균주의 O-아세틸 호모세린 생산능 평가
모균주로 이용한 코리네박테리움 글루타미쿰 ATCC13032, 실시예 3-3-1에서 제작된 ATCC13032::Pm3gdh_gdh, ATCC13032::Pm16gdh_gdh 및 ATCC13032::Pm78gdh_gdh 균주의 O-아세틸 호모세린 생산능을 평가하기 위해 하기와 같은 방법으로 균주를 배양한 후, 분석하였다.
하기의 배지 25㎖을 함유하는 250㎖ 코너-바플 플라스크에 균주를 1백금이 접종하고, 33도에서 20시간 동안, 200 rpm으로 진탕 배양하였다.
<생산 배지(pH 7.2)>
포도당 30g, KH2PO4　2g, 요소 3g, (NH4)2SO4　40g, 펩톤 2.5g, CSL(Corn steep liquor, Sigma) 5g(10ml), MgSO4·7H2O 0.5g, CaCO3　20g (증류수 1 리터 기준)
배양 종료 후 HPLC로 O-아세틸 호모세린의 생산능을 측정하였다. 코리네박테리움 글루타미쿰 ATCC13032, ATCC13032::Pm3gdh_gdh, ATCC13032::Pm16gdh_gdh 및 ATCC13032::Pm78gdh_gdh 균주에 대한 배양액 중의 O-아세틸 호모세린 농도 및 농도 증가율은 하기 표 5와 같다.
균주명 O-아세틸 호모세린 농도(g/L) O-아세틸 호모세린
농도 증가율(%)
ATCC13032 0.31 -
ATCC13032::Pm3gdh_gdh 0.45 45.16%
ATCC13032::Pm16gdh_gdh 0.39 25.80%
ATCC13032::Pm78gdh_gdh 0.43 38.70%
상기 표 5에 나타난 바와 같이 gdh 프로모터 변이체가 도입된 세 균주가 모균주인 야생형 균주 ATCC13032에 비해 O-아세틸 호모세린의 농도가 증가하는 것을 확인하였다.
실시예 3-4. L-이소류신 생산능 평가
3-4-1. gdh 프로모터 변이체가 도입된 L-이소류신 생산 균주의 제작
실시예 2에서 제작된 pDCM2_Pm3gdh_gdh, pDCM2_Pm16gdh_gdh, pDCM2_Pm78gdh_gdh 벡터를 이용하여 gdh 프로모터 변이체가 형질전환된 균주를 제작하기 위하여, 우선 코리네박테리움 글루타미쿰 CJP1(대한민국 등록특허 제10-1996769호) 균주에 상기 벡터들을 형질전환시켜, 염색체 내로 gdh 프로모터 변이체 서열을 도입하였다. 이후, 기 공지된 L-쓰레오닌 디하이드라타제(L-threonine dehydratase)를 코딩하는 ilvA 유전자의 323번째 아미노산인 발린이 알라닌으로 변이된 ilvA 유전자(V323A)(Appl. Enviro. Microbiol., Dec. 1996, p.4345-4351)를 포함하는 벡터를 추가로 도입하여 L-이소류신 생산 균주를 제작하였다(대한민국 등록특허 제10-1996769호).
구체적으로, 상기 실시예 2에서 제작한 벡터들을 전기천공법으로 CJP1 균주에 도입한 후 카나마이신 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였다. 2차 재조합과정(cross-over)으로 염색체상에 삽입된 DNA 단편에 의하여 gdh 프로모터 변이체가 도입된 균주를 서열번호 9 및 서열번호 10의 프라이머를 이용하여 PCR 및 염기서열 분석을 통해 선별하였고, 상기 선별된 균주를 코리네박테리움 글루타미쿰 CJP1::Pm3gdh_gdh, CJP1::Pm16gdh_gdh, CJP1::Pm78gdh_gdh라 명명하였다.
상기 제작된 균주에 pECCG117-ilvA(V323A)벡터(대한민국 등록특허 제10-1996769호)를 전기천공법으로 도입한 후, 카나마이신 25mg/L를 함유한 선별배지에서 형질전환 균주를 획득하였고, 상기 선별된 균주를 각각 코리네박테리움 글루타미쿰 CJP1::Pm3gdh_gdh/pECCG117-ilvA(V323A), CJP1::Pm16gdh_gdh/pECCG117-ilvA(V323A) 및 CJP1::Pm78gdh_gdh/pECCG117-ilvA(V323A)라 명명하였다.
3-4-2. gdh 프로모터 변이체가 도입된 균주의 L-이소류신 생산능 평가
모균주로 이용한 코리네박테리움 글루타미쿰 CJP1/pECCG117-ilvA(V323A), 실시예 3-4-1에서 제작된 CJP1::Pm3gdh_gdh/pECCG117-ilvA(V323A), CJP1::Pm16gdh_gdh/pECCG117-ilvA(V323A) 및 CJP1::Pm78gdh_gdh/pECCG117-ilvA(V323A) 균주의 L-이소류신 생산능을 평가하기 위해 하기와 같은 방법으로 균주를 배양한 후, 분석하였다.
먼저, 종 배지 25ml를 함유하는 250ml 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20시간 동안 200rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24ml를 함유하는 250ml 코너-바플 플라스크에 1ml의 종 배양액을 접종하고, 32℃에서 48시간 동안, 200rpm으로 진탕 배양하였다. 상기 종 배지 및 생산 배지의 조성은 하기와 같다.
<종 배지(pH 7.0)>
포도당 20g, 펩톤 10g, 효모추출물 5g, 요소 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, 바이오틴 100㎍, 티아민 염산염 1000㎍, 칼슘-판토텐산 2000㎍, 니코틴아미드 2000㎍ (증류수 1 리터 기준)
<생산 배지(pH 7.0)>
포도당 45g, 대두 단백질 10g, 당밀 10g, (NH4)2SO4 15 g, KH2PO4 0.55 g, MgSO4·7H2O 0.6 g, FeSO4·7H2O 9mg, MnSO4·5H2O 9mg, 바이오틴 0.9mg, 티아민 염산염 4.5mg, CaCO3 30 g, 칼슘-판토텐산 4.5mg, 니코틴아미드 30mg, ZnSO4 0.45mg, CuSO4 0.45mg (증류수 1 리터 기준)
배양 종료 후 HPLC를 이용해 L-이소류신의 생산량을 측정하였다. 코리네박테리움 글루타미쿰 CJP1/pECCG117-ilvA(V323A), CJP1::Pm3gdh_gdh/pECCG117-ilvA(V323A), CJP1::Pm16gdh_gdh/pECCG117-ilvA(V323A) 및 CJP1::Pm78gdh_gdh/pECCG117-ilvA(V323A) 균주에 대한 배양액 중의 L-이소류신 농도 및 농도 증가율은 하기 표 6과 같다.
균주명 L-이소류신 농도(g/L) L-이소류신
농도 증가율(%)
CJP1/pECCG117-ilvA(V323A) 0.74 -
CJP1::Pm3gdh_gdh/pECCG117-ilvA(V323A) 1.10 48.65%
CJP1::Pm16gdh_gdh/pECCG117-ilvA(V323A) 0.96 29.73%
CJP1::Pm78gdh_gdh/pECCG117-ilvA(V323A) 1.07 44.59%
상기 표 6에 나타난 바와 같이 gdh 프로모터 변이체가 도입된 세 균주가 모균주인 야생형 균주 CJP1/pECCG117-ilvA(V323A)에 비해 L-이소류신의 농도가 증가하는 것을 확인하였다. 이상의 결과를 통해, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 포함하는 재조합 미생물이 산업에 유용한 L-라이신, L-쓰레오닌, O-아세틸 호모세린 및 L-이소류신의 생산성을 증가시키는 것을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2022002984-appb-img-000001

Claims (18)

  1. 서열번호 1의 폴리뉴클레오티드 서열에서 27번, 28번, 31번, 32번 및 36번 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 갖는 폴리뉴클레오티드.
  2. 제1항에 있어서, 추가적으로 66번 및 261번 뉴클레오티드가 다른 뉴클레오티드로 치환된 것인, 폴리뉴클레오티드.
  3. 제1항에 있어서, 추가적으로 66번 뉴클레오티드가 다른 뉴클레오티드로 치환된 것인, 폴리뉴클레오티드.
  4. 제1항에 있어서, 상기 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에서 27번 뉴클레오티드인 아데닌(A)이 티민(T)으로, 28번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 31번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 32번 뉴클레오티드인 시토신(C)이 티민(T)으로, 36번 뉴클레오티드인 아데닌(A)이 시토신(C)으로 치환된 것인, 폴리뉴클레오티드.
  5. 제4항에 있어서, 상기 폴리뉴클레오티드는 서열번호 2로 표시되는 것인, 폴리뉴클레오티드.
  6. 제2항에 있어서, 상기 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에서 27번 뉴클레오티드인 아데닌(A)이 티민(T)으로, 28번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 31번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 32번 뉴클레오티드인 시토신(C)이 티민(T)으로, 36번 뉴클레오티드인 아데닌(A)이 시토신(C)으로, 66번 뉴클레오티드인 시토신(C)이 티민(T)으로, 261번 뉴클레오티드인 아데닌(A)이 구아닌(G)으로 치환된 것인, 폴리뉴클레오티드.
  7. 제6항에 있어서, 상기 폴리뉴클레오티드는 서열번호 3으로 표시되는 것인, 폴리뉴클레오티드.
  8. 제3항에 있어서, 상기 폴리뉴클레오티드는 서열번호 1의 폴리뉴클레오티드 서열에서 27번 뉴클레오티드인 아데닌(A)이 티민(T)으로, 28번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 31번 뉴클레오티드인 시토신(C)이 구아닌(G)으로, 32번 뉴클레오티드인 시토신(C)이 티민(T)으로, 36번 뉴클레오티드인 아데닌(A)이 시토신(C)으로, 66번 뉴클레오티드인 시토신(C)이 티민(T)으로 치환된 것인, 폴리뉴클레오티드.
  9. 제8항에 있어서, 상기 폴리뉴클레오티드는 서열번호 4로 표시되는 것인, 폴리뉴클레오티드.
  10. 제1항 내지 제9항 중 어느 한 항에 있어서, 상기 폴리뉴클레오티드는 목적 단백질을 코딩하는 유전자와 작동 가능하게 연결되는, 폴리뉴클레오티드.
  11. 제1항 내지 제9항 중 어느 한 항의 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는 발현 카세트.
  12. 제10항에 있어서, 상기 목적 단백질은 글루탐산 탈수소효소(glutamate dehydrogenase, gdh)인, 발현 카세트.
  13. 제1항 내지 제9항 중 어느 한 항의 폴리뉴클레오티드; 또는 제1항 내지 제9항 중 어느 한 항의 폴리뉴클레오티드 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는, 코리네박테리움 속 미생물.
  14. 제13항에 있어서, 상기 목적 단백질은 글루탐산 탈수소효소(glutamate dehydrogenase, gdh)인, 코리네박테리움 속 미생물.
  15. 제13항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, 미생물.
  16. 제13항의 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및 상기의 배지에서 목적 물질을 회수하는 단계를 포함하는, 목적 물질을 생산하는 방법.
  17. 제16항에 있어서, 상기 목적 물질은 라이신, 쓰레오닌, O-아세틸 호모세린, 또는 이소류신인, 방법.
  18. 서열번호 1의 폴리뉴클레오티드 서열에서 27번, 28번, 31번, 32번 및 36번 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 갖는 폴리뉴클레오티드의, 프로모터로서의 용도.
PCT/KR2022/002984 2021-05-12 2022-03-03 신규 프로모터 및 이의 용도 WO2022239942A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA3218818A CA3218818A1 (en) 2021-05-12 2022-03-03 Novel promoter and use thereof
US18/560,239 US20240229049A1 (en) 2021-05-12 2022-03-03 Novel promoter and use thereof
EP22807591.7A EP4324924A1 (en) 2021-05-12 2022-03-03 Novel promoter and use thereof
JP2023569978A JP2024520928A (ja) 2021-05-12 2022-03-03 新規なプロモーター及びその使用
BR112023023665A BR112023023665A2 (pt) 2021-05-12 2022-03-03 Promotor inovador e uso do mesmo
AU2022271753A AU2022271753A1 (en) 2021-05-12 2022-03-03 Novel promoter and use thereof
CN202280049017.9A CN117980477A (zh) 2021-05-12 2022-03-03 新型启动子及其用途
MX2023013442A MX2023013442A (es) 2021-05-12 2022-03-03 Novedoso promotor y uso del mismo.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210061306A KR102377745B1 (ko) 2021-05-12 2021-05-12 신규 프로모터 및 이의 용도
KR10-2021-0061306 2021-05-12

Publications (1)

Publication Number Publication Date
WO2022239942A1 true WO2022239942A1 (ko) 2022-11-17

Family

ID=80963409

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/002984 WO2022239942A1 (ko) 2021-05-12 2022-03-03 신규 프로모터 및 이의 용도

Country Status (11)

Country Link
US (1) US20240229049A1 (ko)
EP (1) EP4324924A1 (ko)
JP (1) JP2024520928A (ko)
KR (1) KR102377745B1 (ko)
CN (1) CN117980477A (ko)
AR (1) AR125848A1 (ko)
AU (1) AU2022271753A1 (ko)
BR (1) BR112023023665A2 (ko)
CA (1) CA3218818A1 (ko)
MX (1) MX2023013442A (ko)
WO (1) WO2022239942A1 (ko)

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010032426A (ko) * 1998-09-25 2001-04-16 에가시라 구니오 아미노산 생산균의 작제 방법 및 작제된 아미노산생산균을 사용하는 발효법에 의한 아미노산의 제조 방법
WO2008013432A1 (en) 2006-07-28 2008-01-31 Cj Cheiljedang Corporation Microorganism producing l-methionine precursor and method of producing l-methionine and organic acid from the l-methionine precursor
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR100924067B1 (ko) 2003-03-28 2009-10-27 한라공조주식회사 자동차용 증발기
US8110672B2 (en) * 2005-04-27 2012-02-07 Massachusetts Institute Of Technology Promoter engineering and genetic control
US8637295B1 (en) * 2009-02-20 2014-01-28 Evonik Degussa Gmbh Process for the production of L-lysine
KR20160072278A (ko) * 2014-12-12 2016-06-23 한국외국어대학교 연구산학협력단 합성 글루탐산 탈수소효소 프로모터를 이용한 목적단백질의 생산 방법
KR101947959B1 (ko) 2018-05-28 2019-02-13 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
KR102011994B1 (ko) 2017-06-30 2019-08-20 씨제이제일제당 주식회사 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법
KR101996769B1 (ko) 2018-12-21 2019-10-01 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
KR102028554B1 (ko) * 2018-03-27 2019-10-04 씨제이제일제당 주식회사 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010032426A (ko) * 1998-09-25 2001-04-16 에가시라 구니오 아미노산 생산균의 작제 방법 및 작제된 아미노산생산균을 사용하는 발효법에 의한 아미노산의 제조 방법
KR100924067B1 (ko) 2003-03-28 2009-10-27 한라공조주식회사 자동차용 증발기
US8110672B2 (en) * 2005-04-27 2012-02-07 Massachusetts Institute Of Technology Promoter engineering and genetic control
WO2008013432A1 (en) 2006-07-28 2008-01-31 Cj Cheiljedang Corporation Microorganism producing l-methionine precursor and method of producing l-methionine and organic acid from the l-methionine precursor
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
US8637295B1 (en) * 2009-02-20 2014-01-28 Evonik Degussa Gmbh Process for the production of L-lysine
KR20160072278A (ko) * 2014-12-12 2016-06-23 한국외국어대학교 연구산학협력단 합성 글루탐산 탈수소효소 프로모터를 이용한 목적단백질의 생산 방법
KR102011994B1 (ko) 2017-06-30 2019-08-20 씨제이제일제당 주식회사 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법
KR102028554B1 (ko) * 2018-03-27 2019-10-04 씨제이제일제당 주식회사 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
KR101947959B1 (ko) 2018-05-28 2019-02-13 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
KR101996769B1 (ko) 2018-12-21 2019-10-01 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
"Atlas of Protein Sequence and Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
"NCBI", Database accession no. NCgl1999
APPL. ENVIRO. MICROBIOL., December 1996 (1996-12-01), pages 4345 - 4351
APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545
ATSCHUL, S. F. ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
BINDER ET AL., GENOME BIOLOGY, 2012
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
F. M. AUSUBEL ET AL.: "Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
J. MICROBIOL. BIOTECHNOL., vol. 18, 2008, pages 639 - 647
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
LAURE GORY ET AL., FEMS MICROBIOLOGY LETTERS, vol. 194, 2001, pages 127 - 133
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL., TRENDS GENET., vol. 16, 2000, pages 276 - 277
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
TURBA E ET AL., AGRIC. BIOL. CHEM., vol. 53, 1989, pages 2269 - 2271

Also Published As

Publication number Publication date
CA3218818A1 (en) 2022-11-17
JP2024520928A (ja) 2024-05-27
AR125848A1 (es) 2023-08-16
MX2023013442A (es) 2023-12-12
US20240229049A1 (en) 2024-07-11
CN117980477A (zh) 2024-05-03
BR112023023665A2 (pt) 2024-02-06
EP4324924A1 (en) 2024-02-21
AU2022271753A1 (en) 2023-12-21
KR102377745B1 (ko) 2022-03-23

Similar Documents

Publication Publication Date Title
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2020027362A1 (ko) 신규 아데닐로석시네이트 신세타아제 및 이를 이용한 퓨린 뉴클레오티드 생산방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2019135639A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2020218736A1 (ko) L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2018230978A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2019013532A2 (ko) 아세토하이드록시산 신타아제 변이체, 이를 포함하는 미생물 또는 이를 이용하는 l-분지쇄 아미노산 생산 방법
WO2021177731A1 (ko) 글루타민 신테타아제 변이형 폴리펩티드 및 이를 이용한 l-글루타민 생산 방법
WO2020218737A1 (ko) L-쓰레오닌 생산능이 강화된 미생물 및 이를 이용한 쓰레오닌 생산방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022108383A1 (ko) L-글루타민 생산능이 향상된 미생물 및 이를 이용한 l-글루타민 생산 방법
WO2022239942A1 (ko) 신규 프로모터 및 이의 용도
WO2021101000A1 (ko) 아세토하이드록시산 신타제 신규 변이체 및 이를 포함하는 미생물
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2023048343A1 (ko) 신규한 글루타민 가수분해 gmp 합성효소 변이체 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2022186487A1 (ko) 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2022265130A1 (ko) 신규 프로모터 및 이의 용도
WO2022124511A1 (ko) 변이형 atp-의존적 프로테아제 및 이를 이용한 l-아미노산의 생산 방법
WO2024035191A1 (ko) 케톨산 리덕토아이소머라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2021235775A1 (ko) 신규한 폴리펩티드 및 이를 이용한 l-류신의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22807591

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 12023553093

Country of ref document: PH

Ref document number: 18560239

Country of ref document: US

Ref document number: 2023569978

Country of ref document: JP

Ref document number: 3218818

Country of ref document: CA

Ref document number: 2301007391

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/013442

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2022807591

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023023665

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2022807591

Country of ref document: EP

Effective date: 20231117

WWE Wipo information: entry into national phase

Ref document number: 2022271753

Country of ref document: AU

Ref document number: AU2022271753

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 202317082695

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2023129749

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022271753

Country of ref document: AU

Date of ref document: 20220303

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 11202308513P

Country of ref document: SG

WWE Wipo information: entry into national phase

Ref document number: 202280049017.9

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 112023023665

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20231110