WO2012024170A2 - RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - Google Patents

RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) Download PDF

Info

Publication number
WO2012024170A2
WO2012024170A2 PCT/US2011/047512 US2011047512W WO2012024170A2 WO 2012024170 A2 WO2012024170 A2 WO 2012024170A2 US 2011047512 W US2011047512 W US 2011047512W WO 2012024170 A2 WO2012024170 A2 WO 2012024170A2
Authority
WO
WIPO (PCT)
Prior art keywords
sina
nucleotides
nucleic acid
seq
molecules
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/047512
Other languages
English (en)
French (fr)
Other versions
WO2012024170A3 (en
Inventor
Steve Bartz
Duncan Brown
Michael Robinson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Organon Pharma UK Ltd
Merck Sharp and Dohme LLC
Original Assignee
Merck Sharp and Dohme Ltd
Merck Sharp and Dohme LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201810593037.8A priority Critical patent/CN108676800B/zh
Priority to AU2011292261A priority patent/AU2011292261B2/en
Priority to CA2807307A priority patent/CA2807307C/en
Priority to SI201131753T priority patent/SI2606134T1/sl
Application filed by Merck Sharp and Dohme Ltd, Merck Sharp and Dohme LLC filed Critical Merck Sharp and Dohme Ltd
Priority to KR1020137006656A priority patent/KR102072631B1/ko
Priority to HRP20191232 priority patent/HRP20191232T1/hr
Priority to EP19168062.8A priority patent/EP3587574B1/en
Priority to RU2013111850A priority patent/RU2624045C2/ru
Priority to EP22160316.0A priority patent/EP4079856A1/en
Priority to DK11818592.5T priority patent/DK2606134T3/da
Priority to US13/817,152 priority patent/US9029341B2/en
Priority to JP2013524886A priority patent/JP2013537423A/ja
Priority to CN201180050143.8A priority patent/CN103282497B/zh
Priority to KR1020207002596A priority patent/KR102413007B1/ko
Priority to EP11818592.5A priority patent/EP2606134B1/en
Priority to LTEP11818592.5T priority patent/LT2606134T/lt
Publication of WO2012024170A2 publication Critical patent/WO2012024170A2/en
Publication of WO2012024170A3 publication Critical patent/WO2012024170A3/en
Anticipated expiration legal-status Critical
Priority to US14/682,618 priority patent/US9464290B2/en
Priority to AU2015210336A priority patent/AU2015210336B2/en
Priority to US15/251,155 priority patent/US9879262B2/en
Priority to AU2017216560A priority patent/AU2017216560A1/en
Priority to US15/844,793 priority patent/US10407682B2/en
Priority to US16/532,245 priority patent/US10793860B2/en
Priority to AU2019264591A priority patent/AU2019264591B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/24Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/28Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • A61K9/5107Excipients; Inactive ingredients
    • A61K9/5123Organic compounds, e.g. fats, sugars
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/353Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3531Hydrogen
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Definitions

  • sequence listing submitted via EFS in compliance with 37 CFR ⁇ 1.52(e)(5), is incorporated herein by reference.
  • the sequence listing text file submitted via EFS contains the file "SequenceListingJFDIUSPSP", created on August 17, 2010, which is 455,495 bytes in size.
  • Hepatitis B is an infectious disease of the liver caused by the Hepatitis B virus (HBV).
  • HBV Hepatitis B virus
  • the illness can be acute causing liver inflammation, vomiting, jaundice and in some rare instances of severe fulminant disease, death.
  • the majority of infections result in chronic illness that can be either asymptomatic or resulting in chronic liver inflammation leading to cirrhosis of the liver and an increased incidence in the development of hepatocellular carcinoma (HCC).
  • HCC hepatocellular carcinoma
  • HBV infection is a global problem with approximately >350 million people world wide chronically infected and 600,000 die each year from HBV-related liver disease or HCC. The disease has caused epidemics in Asia and Africa and is endemic in China. Transmission of HBV is via infectious blood or body fluids.
  • vaccines for the prevention of HBV infection.
  • the vaccine is prophylatic and cannot be used to treat already infected patients.
  • hepatitis B chronic hepatitis B
  • lamivudine adefovir, entacavir and telbivudine
  • None of the treatments result in complete clearance of the virus and these treatment result in drug-resistant HBV variants developing after prolonged treatment.
  • Hepatitis B can also be treated with pegylated Interferon-alpha2a but this treatment is associated with severe side effects and is not effective in all patients.
  • HBV is a member of the Hepadanvirus family and is divided into 4 major serotyoes (adr, adw, ayr, ayw) based on antigenic epitopes.
  • the virus is also classed into eight genoypes (A-H based on genomic sequence.
  • Genotype A is common in the Americas, Africa, India and Western Europe.
  • Genotype B and C are found in Asia and the US.
  • Genotype D is most common in Southern Europe and India.
  • Genotype E is found in Western and Southern Africa.
  • Genotype F and H are commonly found in Central and Southern America.
  • Genotype G is commonly found in Europe and the U.S.
  • HBV genome consists of a circular strand of DNA that is partially double stranded.
  • the genome is ⁇ 3.3Kb in length. It encodes 4 known genes (C, X, P and S).
  • HBV is one of the few DNA viruses that utilize reverse transcriptase in the replication process.
  • HBV replication involves multiples stages including entry, uncoating and transport of the virus genome to the nucleus. Initially, replication of the HBV genome involves the generation of an RNA intermediate that is then reverse transcribed to produce the DNA viral genome.
  • RNAi RNA interference
  • siNA short interfering nucleic acids
  • siRNA messenger RNAs
  • RISC RNA-induced silencing complex
  • RNA interference can also involve small RNA ⁇ e.g., micro-RNA or miRNA) mediated gene silencing, presumably through cellular mechanisms that either inhibit translation or that regulate chromatin structure and thereby prevent transcription of target gene sequences (see for example Allshire, 2002, Science, 297: 1818-1819; Volpe et al, 2002, Science, 297: 1833-1837; Jenuwein, 2002, Science, 297:2215-2218; and Hall et al, 2002, Science, 297:2232-2237).
  • RNAi small RNA ⁇ e.g., micro-RNA or miRNA
  • the invention provides a solution to the problem of treating diseases that respond to the modulation of the HBV gene expression using novel short interfering nucleic acid (siNA) molecules to modulate HBV expression.
  • siNA short interfering nucleic acid
  • the present invention provides compounds, compositions, and methods useful for modulating the expression of HBV genes and for treating hepatitis B and such conditions that result from hepatitis B infection by RNA interference (RNAi) using small nucleic acid molecules.
  • RNAi RNA interference
  • the invention provides double-stranded short interfering nucleic acid (siNA) molecules that inhibit the expression of a HBV gene in a cell or mammal, wherein the double-stranded siNAs comprise a sense and an antisense stand.
  • the antisense strand comprises a sequence that is complementary to at least a part of an RNA associated with the expression of the HBV gene.
  • the sense strand comprises a sequence that is complementary to the antisense strand.
  • at least one strand comprises at least a 15 nucleotide sequence selected from the group of sequences consisting of SEQ ID NOS: 1-502.
  • the antisense strand comprises at least 15 nucleotides having sequence complementarity to a target sequence set forth in Table la. In other and/or in the same embodiments, the antisense strand comprises at least a 15 nucleotide sequence of one of the antisense sequences set forth in Table lb. In some embodiments, the sense strand comprises at least a 15 nucleotide sequence of a sense strand sequence as set forth in Table lb.
  • double-stranded short interfering nucleic acid (siNA) molecules wherein the antisense stand comprises a modified sequence as set forth in Table lc that has sequence complementarity to a target sequence of the invention.
  • the sense strand also comprises a modified sequence as set forth in Table lc.
  • the present invention provides a double-stranded short interfering nucleic acid (siNA) molecule that modulates the expression of HBV, wherein the siNA comprises a sense strand and an antisense strand; each strand is independently 15 to 30 nucleotides in length; and the antisense strand comprises at least 15 nucleotides having sequence complementary to any of:
  • the antisense strand of a siNA molecule comprises at least a 15 nucleotide sequence of:
  • a siNA molecule of the invention comprises any of:
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule comprising any of duplex R-008380648-000E, R-008380783- 000R, R-008380665-000N, R-008380645-000D, R-008380408-000R, R-008380633-000U, R- 008380767-000R, R-008380730-000C, R-008380777-000H, R-008380740-000V, R-008380558- 000M, R-008380406-000Y, R-008380764-000P, R-008380772-000P, R-008380389-000D, R- 008380362-000H, R-008380363-000S, R-008380340-000F, R-008380689-000H, R-008380756- 000P, R-008380
  • the invention features a composition comprising:
  • a double-stranded short interfering nucleic acid (siNA) of the invention (b) a cationic lipid compond having any of compound numbers 1-46 or any combination thereof;
  • a composition of the invention comprises (13Z,16Z)-N,N- dimethyl-3-nonyldocosa-13,16-dien-l-amine, cholesterol, DSPC, and PEG-DMG, having a molar ratio of about 50:30: 10:2 respectively.
  • a composition of the invention further comprises a cryo- protectant.
  • the cryoprotectant is Sucrose, Trehalose, Raffinose, Stachyose, Verbascose, Mannitol, Glucose, Lactose, Maltose, Maltotriose-heptaose, Dextran, Hydroxyethyl Starch, Insulin, Sorbitol, Glycerol, Arginine, Histidine, Lysine, Proline, Dimethylsulfoxide or any combination thereof.
  • the cryoprotectant is Sucrose.
  • the cryoprotectant is Trehalose.
  • the cryoprotectant is a combination of Sucrose and Trehalose.
  • modified nucleotides in the overhangs include, but are not limited to, 2'-0-alkyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, locked nucleic acid (LNA) nucleotides, or 2'-deoxy nucleotides.
  • the overhang nucleotides in the antisense strand can comprise nucleotides that are complementary to nucleotides in the HBV target sequence.
  • the overhangs in the sense stand can comprise nucleotides that are in the HBV target sequence.
  • the siNA molecules of the invention have caps (also referred to herein as "terminal caps.”
  • the cap can be present at the 5 '-terminus (5 '-cap) or at the 3'- terminus (3 '-cap) or can be present on both termini, such as at the 5' and 3' termini of the sense strand of the siNA.
  • double-stranded short interfering nucleic acid (siNA) molecules are provided, wherein the molecule has a sense strand and an antisense strand and comprises formula (A):
  • (N) represents overhanging nucleotides, each of which is independently unmodified or chemically modified
  • [N] represents nucleotides that are ribonucleotides
  • XI and X2 are independently integers from 0 to 4
  • X3 is an integer from 15 to 30
  • X4 is an integer from 9 to 30;
  • X5 is an integer from 0 to 6, provided that the sum of X4 and X5 is 15-30.
  • the invention features a double-stranded short interfering nucleic acid (siNA) of formula (A); wherein
  • one or more pyrimidine nucleotides in ⁇ 4 positions are independently 2'-deoxy- 2'-fluoro nucleotides, 2'-0-alkyl nucleotides, 2'-deoxy nucleotides, ribonucleotides, or any combination thereof;
  • one or more pyrimidine nucleotides in N X3 positions are independently 2'-deoxy- 2'-fluoro nucleotides, 2'-0-alkyl nucleotides, 2'-deoxy nucleotides, ribonucleotides, or any combination thereof; and (d) one or more purine nucleotides in ⁇ 3 positions are independently 2'-deoxy-2'- fluoro nucleotides, 2'-0-alkyl nucleotides, 2'-deoxy nucleotides, ribonucleotides,
  • nucleic acid molecules of the invention include the use of various carrier systems, reagents and vectors.
  • carrier systems suitable for use in the present invention include conjugates, nucleic-acid-lipid particles, lipid nanoparticles (LNP), liposomes, lipoplexes, micelles, virosomes, virus like particles (VLP), nucleic acid complexes, and mixtures thereof.
  • LNP lipid nanoparticles
  • VLP virus like particles
  • compositions of the invention can be in the form of an aerosol, dispersion, solution (e.g., an injectable solution), a cream, ointment, tablet, powder, suspension or the like. These compositions may be administered in any suitable way, e.g. orally, sublingually, buccally, parenterally, nasally, or topically. In some embodiments, the compositions are aerosolized and delivered via inhalation.
  • the molecules and compositions of the present invention have utility over a broad range of therapeutic applications. Accordingly another aspect of this invention relates to the use of the compounds and compositions of the invention in treating a subject.
  • the invention thus provides a method for treating a subject, such as a human, suffering from a condition which is mediated by the action of HBV, wherein the method comprises administering to the subject an effective amount of a double-stranded short interfering nucleic acid (siNA) molecule of the invention.
  • siNA double-stranded short interfering nucleic acid
  • the siNA molecules of the invention treat the hepatitis B infection and/or conditions resulting therefrom.
  • the condition is liver disease.
  • the condition is cancer.
  • An active siNA complex forms that recognizes a target RNA, resulting in degradation of the target RNA by the RISC endonuclease complex or in the synthesis of additional RNA by RNA-dependent RNA polymerase (RdRP), which can activate DICER and result in additional siNA molecules, thereby amplifying the RNAi response.
  • RdRP RNA-dependent RNA polymerase
  • Figure 2 shows non-limiting examples of chemically modified siNA constructs of the present invention using a generalized structure of a representative siNA duplex.
  • the specific modifications shown in the figure can be utilized alone or in combination with other modifications of the figure, in addition to other modifications and features described herein with reference to any siNA molecule of the invention.
  • N stands for any nucleotide or optionally a non-nucleotide as described here.
  • the upper strand, having ⁇ - ⁇ 3 -( ⁇ ) ⁇ 2 - ⁇ -3' is the sense (or passenger) strand of the siNA
  • the lower strand having ⁇ ( ⁇ ) ⁇ - ⁇ 4 -[ ⁇ ] ⁇ 5 -5' is the antisense (or guide) strand of the siNA.
  • Terminal caps are optionally present at the 5' and/or 3' end of the sense strand and further optionally present at the 3 '-end of the antisense strand.
  • each strand can independently range from about 15 to about 30 nucleotides in length, but can vary depending on the presence of any overhang nucleotides.
  • XI and X2 are independently integers from 0 to 4; X3 is an integer from 15 to 30; X4 is an integer from 9 to 30; X5 is an integer from 0 to 6, provided that the sum of X4 and X5 is 15-30.
  • Various modifications are shown for the nucleotides of the sense and antisense strands of the siNA constructs.
  • the (N) overhang nucleotide positions can be chemically modified as described herein (e.g., 2'-0-methyl, 2'- deoxy-2'-fluoro, 2'-deoxy, LNA, universal bases etc.) and can be either derived from a corresponding target nucleic acid sequence or not.
  • the constructs shown in the figure can also comprise phosphorothioate linkages as described herein.
  • phosphorothioate linkages can exist between any N, (N), and/or [N] positions.
  • Such phosphorothioate incorporation can be utilized between purine "R” and pyrimidine "Y" positions, or for stabilization of pyrimidine linkages in general.
  • the constructs shown in the figure can optionally include a ribonucleotide at the 9 th position from the 5 '-end of the sense strand or the 11 th position based on the 5'-end of the guide strand by counting 11 nucleotide positions in from the 5'-terminus of the guide strand.
  • the antisense strand can include a ribonucleotide at the 14 th position from the 5 '-end, or alternately can be selected or designed so that a 2'-0-alkyl nucleotide (e.g., a 2'-0-methyl purine) is not present at this position.
  • N X3 and 5 or more (e.g., 5, 6, 7, 8, 9, or 10 or more) N X4 pyrimidine "Y" and purine "R" nucleotides are specified, each of which can independently have specific (N) X i, and/or (N) X2 , substitutions as shown in the figure, in addition to optional phosphorothioate substitutions.
  • the 5'-terminal antisense strand [N] nucleotides are generally ribonucleotides, but can also be modified or unmodified depending on if they are purine "R" or pyrimidine "Y" nucleotides
  • Figure 4A-C shows non-limiting examples of different siNA constructs of the invention.
  • the criteria of the representative structures shown in Figures 2 and 3 can be applied to any of the structures shown in Figure 4A-C.
  • constructs 1, 2, and 3 have 19 representative base pairs; however, different embodiments of the invention include any number of base pairs described herein. Bracketed regions represent nucleotide overhangs, for example, comprising about 1, 2, 3, or 4 nucleotides in length, preferably about 2 nucleotides.
  • Constructs 1 and 2 can be used independently for RNAi activity.
  • Construct 2 can comprise a polynucleotide or non- nucleotide linker, which can optionally be designed as a biodegradable linker.
  • the loop structure shown in construct 2 can comprise a biodegradable linker that results in the formation of construct 1 in vivo and/or in vitro.
  • the examples shown in Figure 4B represent different variations of double-stranded nucleic acid molecule of the invention, such as microRNA, that can include overhangs, bulges, loops, and stem-loops resulting from partial complementarity.
  • Such motifs having bulges, loops, and stem-loops are generally characteristics of miRNA.
  • the bulges, loops, and stem-loops can result from any degree of partial complementarity, such as mismatches or bulges of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides in one or both strands of the double-stranded nucleic acid molecule of the invention.
  • the example shown in Figure 4C represents a model double-stranded nucleic acid molecule of the invention comprising a 19 base pair duplex of two 21 nucleotide sequences having dinucleotide 3 '-overhangs.
  • the top strand (1) represents the sense strand (passenger strand)
  • the middle strand (2) represents the antisense (guide strand)
  • the lower strand (3) represents a target polynucleotide sequence.
  • the dinucleotide overhangs (NN) can comprise a sequence derived from the target polynucleotide.
  • the 3'-(NN) sequence in the guide strand can be complementary to the 5'-[NN] sequence of the target polynucleotide.
  • the 5'-(NN) sequence of the passenger strand can comprise the same sequence as the 5'-[NN] sequence of the target polynucleotide sequence.
  • the overhangs (NN) are not derived from the target polynucleotide sequence, for example where the 3'-(NN) sequence in the guide strand are not complementary to the 5'-[NN] sequence of the target polynucleotide and the 5'-(NN) sequence of the passenger strand can comprise different sequence from the 5'-[NN] sequence of the target polynucleotide sequence.
  • Cleavage by Ago2 takes place between positions 10 and 11 as indicated by the arrow.
  • Figure 9 shows a non-limiting example of a cholesterol linked phosphoramidite that can be used to synthesize cholesterol conjugated siNA molecules of the invention.
  • An example is shown with the cholesterol moiety linked to the 5 '-end of the sense strand of an siNA molecule.
  • Figure 10 depicts an embodiment of 5' and 3' inverted abasic cap linked to a nucleic acid strand.
  • abasic refers to its meaning as is generally accepted in the art.
  • the term generally refers to sugar moieties lacking a nucleobase or having a hydrogen atom (H) or other non-nucleobase chemical groups in place of a nucleobase at the ⁇ position of the sugar moiety, see for example Adamic et ah, U.S. Pat. No. 5,998,203.
  • an abasic moiety of the invention is a ribose, deoxyribose, or dideoxyribose sugar.
  • acyclic nucleotide refers to its meaning as is generally accepted in the art.
  • the term generally refers to any nucleotide having an acyclic ribose sugar, for example where any of the ribose carbon/carbon or carbon/oxygen bonds are independently or in combination absent from the nucleotide.
  • alkyl refers to its meaning as is generally accepted in the art.
  • the term generally refers to a saturated or unsaturated hydrocarbons, including straight- chain, branched-chain, alkenyl, alkynyl groups and cyclic groups, but excludes aromatic groups. Notwithstanding the foregoing, alkyl also refers to non-aromatic heterocyclic groups.
  • the alkyl group has 1 to 12 carbons. More preferably, it is a lower alkyl of from 1 to 7 carbons, more preferably 1 to 4 carbons.
  • the alkyl group can be substituted or unsubstituted.
  • agents that interfere with cell cycle checkpoints refers to compounds that inhibit protein kinases that transduce cell cycle checkpoint signals, thereby sensitizing the cancer cell to DNA damaging agents.
  • RTKs receptor tyrosine kinases
  • androgen receptor modulators refers to compounds that interfere or inhibit the binding of androgens to the receptor, regardless of mechanism.
  • angiogenesis inhibitors refers to compounds that inhibit the formation of new blood vessels, regardless of mechanism.
  • aryl refers to its meaning as is generally accepted in the art.
  • the term generally refers to an aromatic group that has at least one ring having a conjugated pi electron system and includes carbocyclic aryl, heterocyclic aryl and biaryl groups, all of which can be optionally substituted.
  • the preferred substituent(s) of aryl groups are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, C1-C4 alkoxy, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, NH 2 , and NRiR 2 groups, where Ri and R 2 independently are H or C1-C4 alkyl.
  • Suitable heteroatoms include oxygen, sulfur, and nitrogen, and examples of heterocyclic aryl groups having such heteroatoms include furanyl, thienyl, pyridyl, pyrrolyl, N-lower alkyl pyrrolo, pyrimidyl, pyrazinyl, imidazolyl and the like, all optionally substituted.
  • the alkyl group is a C1-C4 alkyl group.
  • amide refers to its meaning as is generally accepted in the art.
  • the term generally refers to an -C(0)-NH-R, where R is either alkyl, aryl, alkylaryl or hydrogen.
  • antisense region refers to its meaning as is generally accepted in the art. With reference to exemplary nucleic acid molecules of the invention, the term refers to a nucleotide sequence of an siNA molecule having complementarity to a target nucleic acid sequence.
  • the antisense region of an siNA molecule can optionally comprise a nucleic acid sequence having complementarity to a sense region of the siNA molecule. In one embodiment, the antisense region of the siNA molecule is referred to as the antisense strand or guide strand.
  • biodegradable linker refers to its meaning as is generally accepted in the art. With reference to exemplary nucleic acid molecules of the invention, the term refers to a linker molecule that is designed to connect one molecule to another molecule, and which is susceptible to degradation in a biological system.
  • the linker can be a nucleic acid or non-nucleic acid based linker.
  • a biodegradable linker can be used to attach a ligand or biologically active molecule to an siNA molecule of the invention. Alternately, a biodegradable linker can be used to connect the sense and antisense strands of an siNA molecule of the invention.
  • the biodegradable linker is designed such that its stability can be modulated for a particular purpose, such as delivery to a particular tissue or cell type.
  • the stability of a nucleic acid-based biodegradable linker molecule can be modulated by using various chemistries, for example combinations of ribonucleotides, deoxyribonucleotides, and chemically modified nucleotides, such as 2'-0-methyl, 2'-fluoro, 2'-amino, 2'-0-amino, 2'-C-allyl, 2'-0-allyl, and other 2'-modified or base modified nucleotides.
  • the biodegradable nucleic acid linker molecule can be a dimer, trimer, tetramer or longer nucleic acid molecule, for example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or can comprise a single nucleotide with a phosphorus-based linkage, for example, a phosphoramidate or phosphodiester linkage.
  • the biodegradable nucleic acid linker molecule can also comprise nucleic acid backbone, nucleic acid sugar, or nucleic acid base modifications.
  • biologically active molecules include siNA molecules alone or in combination with other molecules including, but not limited to therapeutically active molecules such as antibodies, cholesterol, hormones, antivirals, peptides, proteins, chemotherapeutics, small molecules, vitamins, co-factors, nucleosides, nucleotides, oligonucleotides, enzymatic nucleic acids, antisense nucleic acids, triplex forming oligonucleotides, polyamines, polyamides, polyethylene glycol, other polyethers, 2-5A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and analogs thereof.
  • therapeutically active molecules such as antibodies, cholesterol, hormones, antivirals, peptides, proteins, chemotherapeutics, small molecules, vitamins, co-factors, nucleosides, nucleotides, oligonucleotides, enzymatic nucleic acids, antisense nucleic acids, triplex forming oligon
  • biological system refers to its meaning as is generally accepted in the art.
  • the term generally refers to material, in a purified or unpurified form, from biological sources including, but not limited to, human or animal, wherein the system comprises the components required for RNAi activity.
  • the phrase includes, for example, a cell, tissue, subject, or organism, or extract thereof.
  • the term also includes reconstituted material from a biological source.
  • cap also referred to herein as “terminal cap,” as used herein refers to its meaning as is generally accepted in the art.
  • the term refers to a moiety, which can be a chemically modified nucleotide or non-nucleotide that can be incorporated at one or more termini of one or more nucleic acid molecules of the invention. These terminal modifications protect the nucleic acid molecule from exonuclease degradation, and can help in delivery and/or localization within a cell.
  • the cap can be present at the 5 '-terminus (5 '-cap) or at the 3 '-terminal (3 '-cap) or can be present on both termini of any nucleic acid molecule of the invention.
  • a cap can be present at the 5 '-end, 3 -end and/or 5' and 3'-ends of the sense strand of a nucleic acid molecule of the invention. Additionally, a cap can optionally be present at the 3 '-end of the antisense strand of a nucleic acid molecule of the invention.
  • the 5'-cap includes, but is not limited to, LNA; glyceryl; inverted deoxy abasic residue (moiety); 4',5'-methylene nucleotide; l-(beta- D-erythrofuranosyl) nucleotide, 4'-thio nucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; t zreo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; acyclic 3,4- dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide; 3 '-3 '-inverted nucleotide moiety; 3 '-3 '-inverted
  • Non-limiting examples of the 3'-cap include, but are not limited to, LNA; glyceryl; inverted deoxy abasic residue (moiety); 4', 5'-methylene nucleotide; l-(beta-D- erythrofuranosyl) nucleotide; 4'-thio nucleotide; carbocyclic nucleotide; 5'-amino-alkyl phosphate; l,3-diamino-2 -propyl phosphate; 3 -aminopropyl phosphate; 6-aminohexyl phosphate; 1 ,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L- nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo- pentofuranosyl nucleotide;
  • Figure 5 shows some non- limiting examples of various caps.
  • the term "cell” as used herein refers to its meaning as is generally accepted in the art. With reference to exemplary nucleic acid molecules of the invention, the term is used in its usual biological sense, and does not refer to an entire multicellular organism, e.g., specifically does not refer to a human being.
  • the cell can be present in an organism, e.g., birds, plants and mammals, such as humans, cows, sheep, apes, monkeys, swine, dogs, and cats.
  • the cell can be prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian or plant cell).
  • the cell can be of somatic or germ line origin, totipotent or pluripotent, dividing or non-dividing.
  • the cell can also be derived from or can comprise a gamete or embryo, a stem cell, or a fully differentiated cell.
  • chemical modification refers to its meaning as is generally accepted in the art. With reference to exemplary nucleic acid molecules of the invention, the term refers to any modification of the chemical structure of the nucleotides that differs from nucleotides of native siRNA or RNA in general.
  • the term “chemical modification” encompasses the addition, substitution, or modification of native siRNA or RNA at the sugar, base, or internucleotide linkage, as described herein or as is otherwise known in the art.
  • the term “chemical modification” can refer to certain forms of RNA that are naturally occurring in certain biological systems, for example 2'-0-methyl modifications or inosine modifications.
  • Partial complementarity can include various mismatches or non-based paired nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mismatches, non-nucleotide linkers, or non-based paired nucleotides) within the nucleic acid molecule, which can result in bulges, loops, or overhangs that result between the sense strand or sense region and the antisense strand or antisense region of the nucleic acid molecule or between the antisense strand or antisense region of the nucleic acid molecule and a corresponding target nucleic acid molecule.
  • mismatches or non-based paired nucleotides e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mismatches, non-nucleotide linkers, or non-based paired nucleotides
  • Such partial complementarity can be represented by a % complementarity that is determined by the number of non-base paired nucleotides, i.e., about 50%, 60%, 70%, 80%, 90% etc. depending on the total number of nucleotides involved.
  • Such partial complementarity is permitted to the extent that the nucleic acid molecule (e.g., siNA) maintains its function, for example the ability to mediate sequence specific RNAi.
  • compositions or “formulation” as used herein refer to their generally accepted meaning in the art. These terms generally refer to a composition or formulation, such as in a pharmaceutically acceptable carrier or diluent, in a form suitable for administration, e.g., systemic or local administration, into a cell or subject, including, for example, a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, inhalation, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the negatively charged nucleic acid is desirable for delivery). For example, compositions injected into the blood stream should be soluble.
  • a "pharmaceutically acceptable composition” or “pharmaceutically acceptable formulation” can refer to a composition or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention to the physical location most suitable for their desired activity.
  • cytotoxic/cytostatic agents refer to compounds that cause cell death or inhibit cell proliferation primarily by interfering directly with the cell's functioning or inhibit or interfere with cell mytosis, including alkylating agents, tumor necrosis factors, intercalators, hypoxia activatable compounds, microtubule inhibitors/microtubule-stabilizing agents, inhibitors of mitotic kinesins, inhibitors of histone deacetylase, inhibitors of kinases involved in mitotic progression, antimetabolites; biological response modifiers; hormonal/anti-hormonal therapeutic agents, hematopoietic growth factors, monoclonal antibody targeted therapeutic agents, topoisomerase inhibitors, proteasome inhibitors and ubiquitin ligase inhibitors.
  • gene or "target gene” as used herein refers to their meaning as is generally accepted in the art.
  • the terms generally refer a nucleic acid (e.g., DNA or RNA) sequence that comprises partial length or entire length coding sequences necessary for the production of a polypeptide.
  • the target gene can also include the UTR or non-coding region of the nucleic acid sequence.
  • a gene or target gene can also encode a functional RNA (fRNA) or non-coding RNA (ncRNA), such as small temporal RNA (stRNA), micro RNA (miRNA), small nuclear RNA (snRNA), short interfering RNA (siRNA), small nucleolar RNA (snRNA), ribosomal RNA (rRNA), transfer RNA (fRNA) and precursor RNAs thereof.
  • fRNA functional RNA
  • ncRNA non-coding RNA
  • stRNA small temporal RNA
  • miRNA micro RNA
  • snRNA small nuclear RNA
  • siRNA small nucleolar RNA
  • rRNA ribosomal RNA
  • fRNA transfer RNA
  • siNA molecules targeting fRNA and ncRNA can also be used to manipulate or alter the genotype or phenotype of a subject, organism or cell, by intervening in cellular processes such as genetic imprinting, transcription, translation, or nucleic acid processing (e.g., transamination, methylation etc.).
  • the target gene can be a gene derived from a cell, an endogenous gene, a transgene, or exogenous genes such as genes of a pathogen, for example a virus, which is present in the cell after infection thereof.
  • the cell containing the target gene can be derived from or contained in any organism, for example a plant, animal, protozoan, virus, bacterium, or fungus.
  • Non-limiting examples of plants include monocots, dicots, or gymnosperms.
  • Non-limiting examples of animals include vertebrates or invertebrates.
  • Non-limiting examples of fungi include molds or yeasts.
  • HMG-CoA reductase inhibitors refers to inhibitors of 3-hydroxy-3- methylglutaryl-CoA reductase.
  • HMG-CoA reductase inhibitor as used herein includes all pharmaceutically acceptable lactone and open-acid forms (i.e., where the lactone ring is opened to form the free acid) as well as salt and ester forms of compounds that have HMG-CoA reductase inhibitory activity, and therefore the use of such salts, esters, open-acid and lactone forms is included within the scope of this invention.
  • HBV refers to Hepatitis B Virus, which is gene that encodes HBV proteins, HBV peptides, HBV polypeptides, HBV regulatory polynucleotides (e.g., HBV miRNAs and siNAs), mutant HBV genes, and splice variants of a HBV genes, as well as other genes involved in HBV pathways of gene expression and/or activity.
  • HBV regulatory polynucleotides e.g., HBV miRNAs and siNAs
  • mutant HBV genes e.g., HBV miRNAs and siNAs
  • highly conserved sequence region refers to a nucleotide sequence of one or more regions in a target gene that does not vary significantly from one generation to the other or from one biological system to the other.
  • homologous sequence refers to its meaning as is generally accepted in the art.
  • the term generally refers a nucleotide sequence that is shared by one or more polynucleotide sequences, such as genes, gene transcripts and/or non-coding polynucleotides.
  • a homologous sequence can be a nucleotide sequence that is shared by two or more genes encoding related but different proteins, such as different members of a gene family, different protein epitopes, different protein isoforms or completely divergent genes.
  • a homologous sequence can be a nucleotide sequence that is shared by two or more non- coding polynucleotides, such as noncoding DNA or RNA, regulatory sequences, introns, and sites of transcriptional control or regulation. Homologous sequences can also include sequence regions shared by more than one polynucleotide sequence. Homology does not need to be perfect identity (100%), as partially homologous sequences are also contemplated by and within the scope of the instant invention (e.g., at least 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80% etc.). Percent homology is the number of matching nucleotides between two sequences divided by the total length being compared, multiplied by 100.
  • RNAi activity refers to an increase in RNAi activity measured in vitro and/or in vivo, where the RNAi activity is a reflection of both the ability of the siNA to mediate RNAi and the stability of the siNAs of the invention.
  • the product of these activities can be increased in vitro and/or in vivo compared to an all RNA siNA or an siNA containing a plurality of ribonucleotides.
  • the activity or stability of the siNA molecule can be decreased (i.e., less than ten-fold), but the overall activity of the siNA molecule is enhanced in vitro and/or in vivo.
  • inhibitor refers to its meaning as is generally accepted in the art.
  • RNA molecules of the invention generally refers the reduction in the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits, below that observed in the absence of the nucleic acid molecules (e.g., siNA) of the invention.
  • Down-regulation can also be associated with post-transcriptional silencing, such as, RNAi mediated cleavage or by alteration in DNA methylation patterns or DNA chromatin structure.
  • Inhibition, down-regulation or reduction with an siNA molecule can be in reference to an inactive molecule, an attenuated molecule, an siNA molecule with a scrambled sequence, or an siNA molecule with mismatches or alternatively, it can be in reference to the system in the absence of the nucleic acid.
  • the phrase "inhibitors of cell proliferation and survival signaling pathway" refers to pharmaceutical agents that inhibit cell surface receptors and signal transduction cascades downstream of those surface receptors.
  • integrin blockers refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ⁇ 3 ⁇ 4 ⁇ 3 integrin, to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the a ⁇ s integrin, to compounds which antagonize, inhibit or counteract binding of a physiological ligand to both the ⁇ 3 ⁇ 4 ⁇ 3 integrin and the a ⁇ s integrin, and to compounds which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells.
  • the term also refers to antagonists of the a m fa a m fy ⁇ . ⁇ ⁇ 3 ⁇ 4 ⁇ ⁇ 5 ⁇ ⁇ 6 ⁇ and ⁇ 6 ⁇ 4 integrins.
  • the term also refers to antagonists of any combination of ⁇ 3 ⁇ 4 ⁇ 5, ⁇ 3 ⁇ 4 ⁇ 6 ⁇ 3 ⁇ 4 ⁇ .8 ⁇ * ⁇ ⁇ 3 ⁇ 4 ⁇ ⁇ 5 ⁇ °1 ⁇ 2 ⁇ an d ⁇ 6 ⁇ 4 integrins.
  • mammalian or “mammal” as used herein refers to its meaning as is generally accepted in the art.
  • the term generally refers to any warm blooded vertebrate species, such as a human, mouse, rat, dog, cat, hamster, guinea pig, rabbit, livestock, and the like.
  • MDI tered dose inhaler
  • MDI systems includes a suitable channeling device. Suitable channeling devices comprise for example, a valve actuator and a cylindrical or cone-like passage through which medicament can be delivered from the filled canister via the metering valve to the nose or mouth of a patient such as a mouthpiece actuator.
  • microRNA or "miRNA” as used herein refers to its meaning as is generally accepted in the art.
  • the term generally refers a small double-stranded RNA that regulates the expression of target messenger RNAs either by mRNA cleavage, translational repression/inhibition or heterochromatic silencing (see for example Ambros, 2004, Nature, 431, 350-355; Bartel, 2004, Cell, 116, 281-297; Cullen, 2004, Virus Research., 102, 3-9; He et al, 2004, Nat. Rev. Genet., 5, 522-531; Ying et al, 2004, Gene, 342, 25-28; and Sethupathy et al, 2006, RNA, 12: 192-197).
  • modulate refers to its meaning as is generally accepted in the art. With reference to exemplary nucleic acid molecules of the invention, the term refers to when the expression of a gene, or level of one or more RNA molecules (coding or non-coding), or activity of one or more RNA molecules or proteins or protein subunits, is up-regulated or down-regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the molecule that effects modulation.
  • the term “modulate” in some embodiments can refer to inhibition and in other embodiments can refer to potentiation or up-regulation, e.g., of gene expression.
  • NSAIDs that are selective COX-2 inhibitors refers to NSAIDs, which possess a specificity for inhibiting COX-2 over COX-1 of at least 100 fold as measured by the ratio of IC50 for COX-2 over IC50 for COX-1 evaluated by cell or microsomal assays.
  • non-base paired refers to nucleotides that are not base paired between the sense strand or sense region and the antisense strand or antisense region of an double- stranded siNA molecule; and can include for example, but not limitation, mismatches, overhangs, single stranded loops, etc.
  • non-nucleotide refers to any group or compound which can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, such as for example but not limitation abasic moieties or alkyl chains.
  • the group or compound is "abasic" in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine and therefore lacks a nucleobase at the l'-position.
  • nucleotide is used as is generally recognized in the art. Nucleotides generally comprise a nucleobase, a sugar, and an internucleoside linkage, e.g., a phosphate.
  • the base can be a natural bases (standard), modified bases, or a base analog, as are well known in the art. Such bases are generally located at the ⁇ position of a nucleotide sugar moiety.
  • pathway target refers to any target involved in pathways of gene expression or activity.
  • any given target can have related pathway targets that can include upstream, downstream, or modifier genes in a biologic pathway.
  • pathway target genes can provide additive or synergistic effects in the treatment of diseases, conditions, and traits herein.
  • phosphorothioate refers to an internucleotide phosphate linkage comprising one or more sulfur atoms in place of an oxygen atom.
  • phosphorothioate refers to both phosphorothioate and phosphorodithioate internucleotide linkages.
  • Prenyl-protein transferase inhibitor refers to a compound that inhibits any one or any combination of the prenyl-protein transferase enzymes, including farnesyl-protein transferase (FPTase), geranylgeranyl-protein transferase type I (GGPTase-I), and geranylgeranyl-protein transferase type-II (GGPTase-II, also called Rab GGPTase).
  • FPTase farnesyl-protein transferase
  • GGPTase-I geranylgeranyl-protein transferase type I
  • GGPTase-II geranylgeranyl-protein transferase type-II
  • retinoid receptor modulators refers to compounds that interfere or inhibit the binding of retinoids to the receptor, regardless of mechanism.
  • ribonucleotide refers to its meaning as is generally accepted in the art.
  • the term generally refers to a nucleotide with a hydroxyl group at the 2' position of a ⁇ -D-ribofuranose moiety.
  • RNA refers to its generally accepted meaning in the art.
  • RNA refers to a molecule comprising at least one ribofuranoside moiety.
  • the term can include double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siNA or internally, for example at one or more nucleotides of the RNA.
  • Nucleotides in the RNA molecules of the instant invention can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA.
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, transcriptional inhibition, or epigenetics.
  • siNA molecules of the invention can be used to epigenetically silence genes at either the post- transcriptional level or the pre-transcriptional level.
  • epigenetic modulation of gene expression by siNA molecules of the invention can result from siNA mediated modification of chromatin structure or methylation patterns to alter gene expression (see, for example, Verdel et al, 2004, Science, 303, 672-676; Pal-Bhadra et al, 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al, 2002, Science, 297, 1833- 1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al, 2002, Science, 297, 2232-2237).
  • modulation of gene expression by siNA molecules of the invention can result from siNA mediated cleavage of RNA (either coding or non-coding RNA) via RISC, or via translational inhibition, as is known in the art or modulation can result from transcriptional inhibition (see for example Janowski et al, 2005, Nature Chemical Biology, 1, 216-222).
  • RNAi inhibitor refers to any molecule that can down regulate, reduce or inhibit RNA interference function or activity in a cell or organism.
  • An RNAi inhibitor can down regulate, reduce or inhibit RNAi (e.g., RNAi mediated cleavage of a target polynucleotide, translational inhibition, or transcriptional silencing) by interaction with or interfering with the function of any component of the RNAi pathway, including protein components such as RISC, or nucleic acid components such as miRNAs or siRNAs.
  • a RNAi inhibitor can be an siNA molecule, an antisense molecule, an aptamer, or a small molecule that interacts with or interferes with the function of RISC, a miRNA, or an siRNA or any other component of the RNAi pathway in a cell or organism.
  • RNAi e.g., RNAi mediated cleavage of a target polynucleotide, translational inhibition, or transcriptional silencing
  • a RNAi inhibitor of the invention can be used to modulate (e.g., up-regulate or down regulate) the expression of a target gene.
  • sense region refers to its meaning as is generally accepted in the art. With reference to exemplary nucleic acid molecules of the invention, the term refers to a nucleotide sequence of an siNA molecule having complementarity to an antisense region of the siNA molecule.
  • the sense region of an siNA molecule can comprise a nucleic acid sequence having homology or sequence identity with a target nucleic acid sequence. In one embodiment, the sense region of the siNA molecule is also referred to as the sense strand or passenger strand.
  • subject refers to its meaning as is generally accepted in the art.
  • the term generally refers an organism to which the nucleic acid molecules of the invention can be administered.
  • a subject can be a mammal or mammalian cells, including a human or human cells.
  • the term also refers to an organism, which is a donor or recipient of explanted cells or the cells themselves.
  • target is also meant to include other sequences, such as differing isoforms, mutant target genes, splice variants of target polynucleotides, target polymorphisms, and non-coding (e.g., ncRNA, miRNA, stRNA, sRNA) or other regulatory polynucleotide sequences as described herein.
  • non-coding e.g., ncRNA, miRNA, stRNA, sRNA
  • target site refers to its meaning as is generally accepted in the art.
  • the term generally refers to a sequence within a target nucleic acid molecule, (e.g., RNA) that is “targeted”, e.g., for cleavage mediated by an siNA construct, which contains sequences within its antisense region that are complementary to the target sequence.
  • terapéuticaally effective amount refers to its meaning as is generally accepted in the art.
  • the term generally refers to the amount of the compound or composition that will elicit the biological or medical response of a cell, tissue, system, animal or human that is be sought by the researcher, veterinarian, medical doctor or other clinician. For example, if a given clinical treatment is considered effective when there is at least a 25% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is that amount necessary to effect at least a 25% reduction in that parameter.
  • universal base refers to its meaning as is generally accepted in the art.
  • the term universal base generally refers to nucleotide base analogs that form base pairs with each of the natural DNA/RNA bases with little or no discrimination between them.
  • Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carboxamides, and nitroazole derivatives such as 3- nitropyrrole, 4-nitro indole, 5 -nitro indole, and 6-nitro indole as known in the art (see for example, Loakes, 2001, Nucleic Acids Research, 29, 2437-2447).
  • up-regulate refers to its meaning as is generally accepted in the art. With reference to exemplary nucleic acid molecules of the invention, the term refers to an increase in the expression of a gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more RNAs, proteins or protein subunits, above that observed in the absence of the nucleic acid molecules (e.g., siNA) of the invention. In certain instances, up-regulation or promotion of gene expression with an siNA molecule is above that level observed in the presence of an inactive or attenuated molecule.
  • siNA nucleic acid molecules
  • up-regulation or promotion of gene expression with siNA molecules is above that level observed in the presence of, for example, an siNA molecule with scrambled sequence or with mismatches.
  • up-regulation or promotion of gene expression with a nucleic acid molecule of the instant invention is greater in the presence of the nucleic acid molecule than in its absence.
  • up-regulation or promotion of gene expression is associated with inhibition of RNA mediated gene silencing, such as RNAi mediated cleavage or silencing of a coding or non-coding RNA target that down regulates, inhibits, or silences the expression of the gene of interest to be up-regulated.
  • the down regulation of gene expression can, for example, be induced by a coding RNA or its encoded protein, such as through negative feedback or antagonistic effects.
  • the down regulation of gene expression can, for example, be induced by a non-coding RNA having regulatory control over a gene of interest, for example by silencing expression of the gene via translational inhibition, chromatin structure, methylation, RISC mediated RNA cleavage, or translational inhibition.
  • inhibition or down regulation of targets that down regulate, suppress, or silence a gene of interest can be used to up- regulate expression of the gene of interest toward therapeutic use.
  • vector refers to its meaning as is generally accepted in the art.
  • vector generally refers to any nucleic acid- and/or viral-based expression system or technique used to deliver one or more nucleic acid molecules.
  • the present invention provides compositions and methods comprising siNAs targeted to HBV that can be used to treat diseases, e.g., liver disease or malignancies and/or cancers associated with HBV expression or other conditions that result from hepatitis B infection.
  • the nucleic acid molecules of the invention comprise at least a 15 nucleotide sequence of the sequences shown in Table la and Table lb.
  • the siNAs can be provided in several forms.
  • the siNA can be isolated as one or more siNA compounds, or it may be in the form of a transcriptional cassette in a DNA plasmid.
  • the siNA may also be chemically synthesized and can include modifications as shown, for example, but not limitation, in Table lc and Table 8.
  • at least one strand or region of the nucleic acids of the invention comprises at least a 15 nucleotide sequence selected from the group of sequences consisting of SEQ ID NOS: 1-502.
  • the siNAs can be administered alone or co-administered with other siNA molecules or with conventional agents that treat a HBV related disease or condition.
  • the siNA molecules of the invention can be used to mediate gene silencing, specifically HBV, via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in modulation of gene silencing either at the transcriptional level or post-transcriptional level such as, for example, but not limited to, RNAi or through cellular processes that modulate the chromatin structure or methylation patterns of the target and prevent transcription of the target gene, with the nucleotide sequence of the target thereby mediating silencing.
  • the target is any of HBV RNA, DNA, or mRNA,
  • the invention provides short interfering nucleic acid (siNA) molecules for inhibiting the expression of the HBV gene in a cell or mammal.
  • the siNA can be single- stranded or double-stranded. When double-stranded, the siNA comprising a sense and an antisense stand.
  • the antisense strand is complementary to at least a part of an mRNA formed in the expression of the HBV gene.
  • the sense strand comprises a region that is complementary to the antisense strand.
  • the antisense strand comprises at least a 15 nucleotide sequence of an antisense sequence listed in Table lb.
  • the double-stranded siNA comprises at least a 15 nucleotide sequence of the sense strand in Table lb and at least a 15 nucleotide sequence of the antisense strand in Table lb.
  • One or more of the nucleotides of the siNAs of the invention are optionally modified.
  • some siNAs of the invention comprises at least one nucleotide sequence selected from the groups of sequences provide in Table lc.
  • the siNA comprises at least two sequences selected from the group of sequences provided in Table lc, wherein one of the at least two sequences is complementary to another of the at least two sequences and one of the at least two sequences is complementary to a sequence of a mRNA generated in the expression of the HBV gene.
  • Examples of certain modified siNAs of the invention are in Table lc.
  • the double stranded RNA molecules of the invention can comprise two distinct and separate strands that can be symmetric or asymmetric and are complementary, i.e., two single- stranded RNA molecules, or can comprise one single-stranded molecule in which two complementary portions, e.g., a sense region and an antisense region, are base-paired, and are covalently linked by one or more single-stranded "hairpin" areas (i.e. loops) resulting in, for example, a single-stranded short-hairpin polynucleotide or a circular single-stranded polynucleotide.
  • two complementary portions e.g., a sense region and an antisense region
  • the linker can be polynucleotide linker or a non-nucleotide linker. In some embodiments, the linker is a non-nucleotide linker.
  • a hairpin or circular siNA molecule of the invention contains one or more loop motifs, wherein at least one of the loop portions of the siNA molecule is biodegradable.
  • a single-stranded hairpin siNA molecule of the invention is designed such that degradation of the loop portion of the siNA molecule in vivo can generate a double-stranded siNA molecule with 3'-terminal overhangs, such as 3'-terminal nucleotide overhangs comprising 1, 2, 3 or 4 nucleotides.
  • a circular siNA molecule of the invention is designed such that degradation of the loop portions of the siNA molecule in vivo can generate a double-stranded siNA molecule with 3 '-terminal overhangs, such as 3'-terminal nucleotide overhangs comprising about 2 nucleotides.
  • the antisense region or strand of the molecule is about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in length, wherein the sense region is about 3 to about 25 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.
  • each strand of the asymmetric siNA molecules of the invention is about 19-24 (e.g., about 19, 20, 21, 22, 23 or 24) nucleotides in length.
  • siNA molecules of the invention comprise single stranded hairpin siNA molecules, wherein the siNA molecules are about 25 to about 70 (e.g., about 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length.
  • siNA molecules of the invention comprise single-stranded circular siNA molecules, wherein the siNA molecules are about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length.
  • siNA molecules of the invention comprise single-stranded non-circular siNA molecules, wherein the siNA molecules are independently about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in length.
  • the siNA duplexes of the invention independently comprise about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) base pairs.
  • the duplex structure of siNAs of the invention is between 15 and 30, more generally between 18 and 25, yet more generally between 19 and 24, and most generally between 19 and 21 base pairs in length.
  • the duplex siNA molecules of the invention comprise about 3 to 25 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25) base pairs.
  • the duplex structure of siNAs of the invention is between 15 and 25, more generally between 18 and 25, yet more generally between 19 and 24, and most generally between 19 and 21 base pairs in length.
  • the siNA molecules of the invention are hairpin or circular structures
  • the siNA molecules comprise about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) base pairs.
  • the sense strand and antisense strand, or the sense region and antisense region, of the siNA molecules of the invention can be complementary.
  • the antisense strand or antisense region can be complementary to a nucleotide sequence or a portion thereof of the HBV target RNA.
  • the sense strand or sense region of the siNA can comprise a nucleotide sequence of a HBV gene or a portion thereof.
  • the sense region or sense strand of an siNA molecule of the invention is complementary to that portion of the antisense region or antisense strand of the siNA molecule that is complementary to a HBV target polynucleotide sequence, such as for example, but not limited to, those sequences represented by GENBANK Accession Nos. shown in Table 7.
  • siNA molecules of the invention have perfect complementarity between the sense strand or sense region and the antisense strand or antisense region of the siNA molecule.
  • the antisense strand of the siNA molecules of the invention are perfectly complementary to a corresponding target nucleic acid molecule.
  • siNA molecules of the invention have partial complementarity (i.e., less than 100% complementarity) between the sense strand or sense region and the antisense strand or antisense region of the siNA molecule or between the antisense strand or antisense region of the siNA molecule and a corresponding target nucleic acid molecule.
  • the double-stranded nucleic acid molecules of the invention have between about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in one strand that are complementary to the nucleotides of the other strand.
  • the molecules have between about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in the sense region that are complementary to the nucleotides of the antisense region, of the double-stranded nucleic acid molecule.
  • the double-stranded nucleic acid molecules of the invention have between about 15 to about 30 (e.g. , about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in the antisense strand that are complementary to a nucleotide sequence of its corresponding target nucleic acid molecule.
  • the siNA molecule can contain one or more nucleotide deletions, substitutions, mismatches and/or additions; provided, however, that the siNA molecule maintains its activity, for example, to mediate RNAi.
  • the deletion, substitution, mismatch and/or addition can result in a loop or bulge, or alternately a wobble or other alternative (non Watson-Crick) base pair.
  • the double-stranded nucleic acid molecules of the invention have 1 or more (e.g., 1 , 2, 3, 4, 5, or 6) nucleotides, in one strand or region that are mismatches or non-base-paired with the other strand or region.
  • the double-stranded nucleic acid molecules of the invention have 1 or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides in each strand or region that are mismatches or non-base-paired with the other strand or region.
  • the siNA of the invention contains no more than 3 mismatches. If the antisense strand of the siNA contains mismatches to a target sequence, it is preferable that the area of mismatch not be located in the center of the region of complementarity.
  • the siNA molecule can contain one or more nucleotide deletions, substitutions, mismatches and/or additions to a sequence in Table lb provided, however, that the siNA molecule maintains its activity, for example, to mediate RNAi.
  • the deletion, substitution, mismatch and/or addition can result in a loop or bulge, or alternately a wobble or other alternative (non Watson-Crick) base pair.
  • the invention also comprises double-stranded nucleic acid (siNA) molecules as otherwise described hereinabove in which the first strand and second strand are complementary to each other and wherein at least one strand is hybridisable to the polynucleotide sequence of a sequence in Table lb under conditions of high stringency, and wherein any of the nucleotides is unmodified or chemically modified.
  • siNA double-stranded nucleic acid
  • Hybridization techniques are well known to the skilled artisan (see for instance, Sambrook et ah, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)).
  • Preferred stringent hybridization conditions include overnight incubation at 42°C in a solution comprising: 50% formamide, 5xSSC (150mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 microgram/ml denatured, sheared salmon sperm DNA; followed by washing the filters in O.lx SSC at about 65°C.
  • the first strand has about 15, 16, 17, 18, 19, 20 or 21 nucleotides that are complementary to the nucleotides of the other strand and at least one strand is hybridisable to a polynucleotide sequence in Table lb.
  • the first strand has about 15, 16, 17, 18, 19, 20 or 21 nucleotides that are complementary to the nucleotides of the other strand and at least one strand is hybridisable to SEQ ID NO: 1, SEQ ID NO: 1210, SEQ ID NO: 2, SEQ ID NO: 121 1 , SEQ ID NO: 3, SEQ ID NO: 1212, SEQ ID NO: 4, or SEQ ID NO: 1213; under conditions of high stringency, and wherein any of the nucleotides is unmodified or chemically modified.
  • the siNA molecules of the invention comprise overhangs of about 1 to about 4 (e.g., about 1 , 2, 3 or 4) nucleotides.
  • the nucleotides in the overhangs can be the same or different nucleotides.
  • the overhangs occur at the 3 '-end at one or both strands of the double-stranded nucleic acid molecule.
  • a double- stranded nucleic acid molecule of the invention can comprise a nucleotide or non-nucleotide overhang at the 3 '-end of the antisense strand/region, the 3 '-end of the sense strand/region, or both the antisense strand/region and the sense strand/region of the double-stranded nucleic acid molecule.
  • the nucleotides comprising the overhang portion of an siNA molecule of the invention comprise sequences based on the HBV target polynucleotide sequence in which nucleotides comprising the overhang portion of the antisense strand/region of an siNA molecule of the invention can be complementary to nucleotides in the HBV target polynucleotide sequence and/or nucleotides comprising the overhang portion of the sense strand/region of an siNA molecule of the invention can comprise the nucleotides in the HBV target polynucleotide sequence.
  • the overhang comprises a two nucleotide overhang that is complementary to a portion of the HBV target polynucleotide sequence. In other embodiments, however, the overhang comprises a two nucleotide overhang that is not complementary to a portion of the HBV target polynucleotide sequence. In certain embodiments, the overhang comprises a 3 '-UU overhang that is not complementary to a portion of the HBV target polynucleotide sequence. In other embodiments, the overhang comprises a UU overhang at the 3' end of the antisense strand and a TT overhang at the 3' end of the sense strand. In other embodiments, the overhang comprises nucleotides as described in the examples, Tables, and Figures herein.
  • the overhangs are optionally chemically modified at one or more nucleic acid sugar, base, or backbone positions.
  • modified nucleotides in the overhang portion of a double-stranded nucleic acid (siNA) molecule of the invention include: 2'-0-alkyl (e.g., 2'-0-methyl), 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-deoxy-2'- fluoroarabino (FANA), 4'-thio, 2 '-O-trifluoro methyl, 2'-0-ethyl-trifluoromethoxy, 2'-0- difluoromethoxy-ethoxy, universal base, acyclic, or 5-C-methyl nucleotides.
  • the overhang nucleotides are each independently, a 2'-0-alkyl nucleotide, a 2'-0- methyl nucleotide, a 2'-dexoy-2-fluoro nucleotide, or a 2'-deoxy ribonucleotide. In some instances the overhang nucleotides are linked by a one or more phosphorothioate linkages.
  • siNA molecules of the invention comprise duplex nucleic acid molecules with blunt ends (i.e., without nucleotide overhangs), where both ends are blunt, or alternatively, where one of the ends is blunt.
  • the siNA molecules of the invention can comprises one blunt end, for example wherein the 5 '-end of the antisense strand and the 3 '-end of the sense strand do not have any overhanging nucleotides.
  • the siNA molecule comprises one blunt end, for example wherein the 3 '-end of the antisense strand and the 5 '-end of the sense strand do not have any overhanging nucleotides.
  • siNA molecules of the invention comprise two blunt ends, for example wherein the 3 '-end of the antisense strand and the 5 '-end of the sense strand as well as the 5 '-end of the antisense strand and 3 '-end of the sense strand do not have any overhanging nucleotides.
  • the sense strand and/or the antisense strand can further have a cap, such as described herein or as known in the art, at the 3 '-end, the 5 '-end, or both of the 3' and 5 '-ends of the sense strand and/or antisense strand.
  • the cap can be at either one or both of the terminal nucleotides of the polynucleotide.
  • the cap is at one of both of the ends of the sense strand of a double-stranded siNA molecule.
  • the cap is at the 3 '-end of antisense (guide) strand.
  • the caps are at the 3 '-end of the sense strand and the 5 '-end of the sense strand.
  • terminal caps include an inverted abasic nucleotide, an inverted deoxy abasic nucleotide, an inverted nucleotide moiety, a group shown in Figure 5, a glyceryl modification, an alkyl or cycloalkyl group, a heterocycle, or any other cap as is generally known in the art.
  • Any of the embodiments of the siNA molecules of the invention can have a 5' phosphate termini. In some embodiments, the siNA molecules lack terminal phosphates.
  • siNA molecule or construct of the invention can comprise one or more chemical modifications. Modifications can be used to improve in vitro or in vivo characteristics such as stability, activity, toxicity, immune response ⁇ e.g., prevent stimulation of an interferon response, an inflammatory or pro-inflammatory cytokine response, or a Toll-like Receptor (TIF) response), and/or bioavailability.
  • TNF Toll-like Receptor
  • RNAi activity and/or stability compared to corresponding unmodified siNA molecules.
  • Various chemically modified siNA motifs disclosed herein provide the capacity to maintain RNAi activity that is substantially similar to unmodified or minimally modified active siRNA (see for example Elbashir et al., 2001, EMBO J., 20:6877-6888) while at the same time providing nuclease resistance and pharmacokinetic properties suitable for use in therapeutic applications.
  • the siNA molecules of the invention comprise modifications wherein any ⁇ e.g., one or more or all) nucleotides present in the sense and/or antisense strand are modified nucleotides ⁇ e.g., wherein one nucleotide is modified, some nucleotides ⁇ i.e., plurality or more than one) are modified, or all nucleotides are modified nucleotides.
  • the siNA molecules of the invention are partially modified (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, or 59 nucleotides are modified) with chemical modifications.
  • an siNA molecule of the invention comprises at least about 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, or 60 nucleotides that are modified nucleotides.
  • the siNA molecules of the invention are completely modified ⁇ e.g., 100% modified) with chemical modifications, i.e., the siNA molecule does not contain any ribonucleotides.
  • one or more of the nucleotides in the sense strand of the siNA molecules of the invention are modified.
  • one or more of the nucleotides in the antisense strand of the siNA molecules of the invention are modified.
  • the chemical modification within a single siNA molecule can be the same or different.
  • at least one strand has at least one chemical modification.
  • each strand has at least one chemical modifications, which can be the same or different, such as, sugar, base, or backbone (i.e., internucleotide linkage) modifications.
  • siNA molecules of the invention contain at least 2, 3, 4, 5, or more different chemical modifications.
  • Non-limiting examples of chemical modifications that are suitable for use in the present invention are disclosed in U.S. Patent Applications Nos. 10/444,853; 10/981,966; 12/064,014 and in references cited therein and include sugar, base, and phosphate, non- nucleotide modifications, and/or any combination thereof.
  • At least one modified nucleotide is a 2'-deoxy-2-fluoro nucleotide, a 2'-deoxy nucleotide, a 2'-0-alkyl (e.g., 2'-0-methyl) nucleotide, or a locked nucleic acid (LNA) nucleotide as is generally recognized in the art.
  • LNA locked nucleic acid
  • At least one nucleotide has a ribo-like, Northern or A form helix configuration (see e.g., Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984).
  • Non-limiting examples of nucleotides having a Northern configuration include locked nucleic acid (LNA) nucleotides (e.g., 2 -0, 4 ' -C-methylene-(D- ribofuranosyl) nucleotides); 2'-methoxyethoxy (MOE) nucleotides; 2'-methyl-thio-ethyl nucleotides, 2'-deoxy-2'-fluoro nucleotides; 2'-deoxy-2'-chloro nucleotides; 2'-azido nucleotides; 2'-0-trifluoromethyl nucleotides; 2'-0-ethyl-trifluoromethoxy nucleotides; 2'-0- difluoromethoxy-ethoxy nucleotides; 4'-thio nucleotides and 2'-0-methyl nucleotides.
  • LNA locked nucleic acid
  • MOE 2'-methoxyethoxy
  • a majority (e.g., greater than 50%) of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
  • a majority (e.g., greater than 50%) of the purine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
  • the pyrimidine nucleotides in the antisense strand are 2'-0- methyl or 2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine nucleotides present in the antisense strand are 2'-0-methyl nucleotides or 2'-deoxy nucleotides.
  • the pyrimidine nucleotides in the sense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense strand are 2'-0-methyl or 2'-deoxy purine nucleotides.
  • all the pyrimidine nucleotides in the complementary region on the sense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides. In certain embodiments, all of the pyrimidine nucleotides in the complementary region of the antisense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides. In certain embodiments, all the purine nucleotides in the complementary region on the sense strand are 2'-deoxy purine nucleotides. In certain embodiments, all of the purines in the complementary region on the antisense strand are 2'-0-methyl purine nucleotides.
  • all of the pyrimidine nucleotides in the complementary regions on the sense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides; all of the pyrimidine nucleotides in the complementary region of the antisense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides; all the purine nucleotides in the complementary region on the sense strand are 2'-deoxy purine nucleotides and all of the purines in the complementary region on the antisense strand are 2'-0-methyl purine nucleotides.
  • At least 5 or more of the pyrimidine nucleotides in one or both stands are 2'-deoxy-2'-fluoro pyrimidine nucleotides. In some embodiments, at least 5 or more of the pyrimidine nucleotides in one or both stands are 2'-0-methyl pyrimidine nucleotides. In some embodiments, at least 5 or more of the purine nucleotides in one or both stands are 2'- deoxy-2'-fluoro purine nucleotides In some embodiments, at least 5 or more of the purine nucleotides in one or both stands are 2'-0-methyl purine nucleotides.
  • the purines and pyrimidines are differentially modified at the 2'-sugar position (i.e., at least one purine has a different modification from at least one pyrimidine in the same or different strand at the 2'-sugar position).
  • at least 5 or more of the pyrimidine nucleotides in one or both stands are 2'-deoxy-2'- fluoro pyrimidine nucleotides and at least 5 or more purine nucleotides in one or both strands are 2'-0-methyl purine nucleotides.
  • pyrimidine nucleotides in one or both stands are 2'-0-methyl pyrimidine nucleotides and at least 5 or more purine nucleotides in one or both strands are 2'-deoxy-2'-fluoro purine nucleotides.
  • the modified siNA molecules of the invention can comprise modifications at various locations within the siNA molecule.
  • the double-stranded siNA molecule of the invention comprises modified nucleotides at internal base paired positions within the siNA duplex.
  • a double-stranded siNA molecule of the invention comprises modified nucleotides at non-base paired or overhang regions of the siNA molecule.
  • a double-stranded siNA molecule of the invention comprises modified nucleotides at terminal positions of the siNA molecule. For example, such terminal regions include the 3'- position and/or 5 '-position of the sense and/or antisense strand or region of the siNA molecule.
  • any of the modified siNA molecules of the invention can have a modification in one or both oligonucleotide strands of the siNA duplex, for example in the sense strand, the antisense strand, or both strands.
  • each strand of the double-stranded siNA molecules of the invention can have one or more chemical modifications, such that each strand comprises a different pattern of chemical modifications.
  • each strand of a double-stranded siNA molecule of the invention comprises a different pattern of chemical modifications, such as any Stab modification chemistries described herein (see Table 8) or any combination thereof, i.e., different combinations of defined Stabilzation chemistry (Stab) sense and antisense strands.
  • Stab Stabilzation chemistry
  • the stabilization chemistries referred to in Table 8 as Stab can be combined in any combination of sense/antisense chemistries, such as Stab 7/8, Stab 7/11, Stab 8/8, Stab 18/8, Stab 18/11, Stab 12/13, Stab 7/13, Stab 18/13, Stab 7/19, Stab 8/19, Stab 18/19, Stab 7/20, Stab 8/20, Stab 18/20, Stab 7/32, Stab 8/32, or Stab 18/32 or any other combination of Stabilization chemistries.
  • one or more (for example 1, 2, 3, 4 or 5) nucleotides at the 5 '-end of the guide strand or guide region (also known as antisense strand or antisense region) of the siNA molecule are ribonucleotides.
  • the present invention provides a double-stranded short interfering nucleic acid (siNA) molecule that modulates the expression of HBV, wherein the siNA comprises a sense strand and an antisense strand; each strand is independently 15 to 30 nucleotides in length; and the antisense strand comprises at least 15 nucleotides having sequence complementary to any of:
  • the antisense strand of a siNA molecule of the invention comprises at least a 15 nucleotide sequence of:
  • the sense strand of a siNA molecule of the invention comprises at least a 15 nucleotide sequence of:
  • a siNA molecule of the invention comprises any of: 5 ' -UCGUGGUGG ACUUCUCUC A-3 (SEQ ID NO: 1) and 5'-
  • the nucleotides of the at least a 15 nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 452, SEQ ID NO: 2, SEQ ID NO: 453, SEQ ID NO: 3, SEQ ID NO: 454, SEQ ID NO: 4, or SEQ ID NO:455 form a contiguous stretch of nucleotides.
  • the siNA molecule can contain one or more nucleotide deletions, substitutions, mismatches and/or additions to the at least 15 nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 452, SEQ ID NO: 2, SEQ ID NO: 453, SEQ ID NO: 3, SEQ ID NO: 454, SEQ ID NO: 4, or SEQ ID NO:455; provided, however, that the siNA molecule maintains its activity, for example, to mediate RNAi.
  • the deletion, substitution, mismatch and/or addition can result in a loop or bulge, or alternately a wobble or other alternative (non Watson-Crick) base pair.
  • double-stranded siNA molecules wherein the molecule has a sense strand and an antisense strand and comprises the following formula (A):
  • (N) represents overhanging nucleotides, each of which is independently unmodified or chemically modified
  • [N] represents nucleotides that are ribonucleotides
  • XI and X2 are independently integers from 0 to 4
  • X3 is an integer from 15 to 30
  • X4 is an integer from 9 to 30;
  • X5 is an integer from 0 to 6, provided that the sum of X4 and X5 is 15-30.
  • nucleotides of the at least a 15 nucleotide sequence of SEQ ID NO: 452, SEQ ID NO: 453, SEQ ID NO: 454, or SEQ ID NO: 455 form a contiguous stretch of nucleotides.
  • the siNA molecule of formula A can contain one or more nucleotide deletions, substitutions, mismatches and/or additions to the at least 15 nucleotide sequence of SEQ ID NO: 452, SEQ ID NO: 453, SEQ ID NO: 454, or SEQ ID NO: 455; provided, however, that the siNA molecule maintains its activity, for example, to mediate RNAi.
  • the deletion, substitution, mismatch and/or addition can result in a loop or bulge, or alternately a wobble or other alternative (non Watson-Crick) base pair.
  • the invention features a double-stranded short interfering nucleic acid (siNA) of formula (A); wherein (a) one or more pyrimidine nucleotides in ⁇ 4 positions are independently 2'-deoxy- 2'-fluoro nucleotides, 2'-0-alkyl nucleotides, 2'-deoxy nucleotides, ribonucleotides, or any combination thereof;
  • siNA short interfering nucleic acid
  • one or more purine nucleotides in ⁇ 4 positions are independently 2'-deoxy-2'- fluoro nucleotides, 2'-0-alkyl nucleotides, 2'-deoxy nucleotides, ribonucleotides, or any combination thereof;
  • one or more pyrimidine nucleotides in ⁇ 3 positions are independently 2'-deoxy- 2'-fluoro nucleotides, 2'-0-alkyl nucleotides, 2'-deoxy nucleotides, ribonucleotides, or any combination thereof;
  • one or more purine nucleotides in N X3 positions are independently 2'-deoxy-2'- fluoro nucleotides, 2'-0-alkyl nucleotides, 2'-deoxy nucleotides, ribonucleotides, or any combination thereof.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule of formula (A); wherein
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule of formula (A); wherein
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule of formula (A); wherein
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule of formula (A) further comprising one or more phosphorothioate internucleotide linkages.
  • siNA short interfering nucleic acid
  • siNA molecules having formula A comprise a terminal phosphate group at the 5 '-end of the antisense strand or antisense region of the nucleic acid molecule.
  • siNA molecules having formula A comprise caps (B) at the 3 ' and 5 ' ends of the sense strand or sense region.
  • siNA molecules having formula A comprise caps (B) at the 3 '-end of the antisense strand or antisense region.
  • siNA molecules having formula A comprise caps (B) at the 3' and 5' ends of the sense strand or sense region and caps (B) at the 3 '-end of the antisense strand or antisense region.
  • siNA molecules having formula A comprise caps (B) only at the 5 '-end of the sense (upper) strand of the double-stranded nucleic acid molecule.
  • siNA molecules having formula A further comprise one or more phosphorothioate internucleotide linkages between the nucleotides.
  • siNA molecules having formula A comprise one or more phosphorothioate internucleotide linkages between the first terminal (N) and the adjacent nucleotide on the 3 'end of the sense strand, antisense strand, or both sense strand and antisense strands of the nucleic acid molecule.
  • one or more of the nucleotides of siNA molecules having formula A have a universal base.
  • siNA molecules having formula A have at position 14 from the 5 '-end of the antisense strand a ribonucleotide when the nucleotide at that position 14 is a purine. In other embodiments, siNA molecules having formula A have at position 14 from the 5 '-end of the antisense strand a ribonucleotide, a 2'-deoxy-2'-fluoro nucleotide or a 2'-0-methyl nucleotide when the nucleotide at that position 14 is a pyrimidine nucleotide.
  • siNA molecules having formula A comprises (N) nucleotides in the antisense strand (lower strand) that are complementary to nucleotides in a HBV target polynucleotide sequence, which also has complementarity to the N and [N] nucleotides of the antisense (lower) strand.
  • siNAs of the invention can be obtained using a number of techniques known to those of skill in the art.
  • the siNA can be chemically synthesized or may be encoded by plasmid (e.g., transcribed as sequences that automatically fold into duplexes with hairpin loops.).
  • siNA can also be generated by cleavage of longer dsRNA (e.g., dsRNA greater than about 25 nucleotides in length) by the E coli RNase II or Dicer. These enzymes process the dsRNA into biologically active siNA (see, e.g., Yang et al, PNAS USA 99:9942-9947 (2002); Calegari et al.
  • siNA of the invention are chemically synthesized.
  • Oligonucleotides ⁇ e.g., certain modified oligonucleotides or portions of oligonucleotides lacking ribonucleotides) are synthesized using protocols known in the art, for example as described in Caruthers et al., 1992, Methods in Enzymology 211, 3-19, Thompson et al., International PCT Publication No. WO 99/54459, Wincott et al, 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al, 1997, Methods Mol.
  • oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5 '-end, and phosphoramidites at the 3 '-end.
  • siNA molecules without modifications are synthesized using procedures as described in Usman et al, 1987, J Am. Chem. Soc, 109, 7845; Scaringe et al, 1990, Nucleic Acids Res., 18, 5433. These syntheses makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5 '-end, and phosphoramidites at the 3 '-end that can be used for certain siNA molecules of the invention.
  • the siNA molecules of the invention are synthesized, deprotected, and analyzed according to methods described in U.S. Patent Nos. 6,995,259, 6,686,463, 6,673,918, 6,649,751, 6,989,442, and U.S. Patent Application No. 10/190,359.
  • the siNA molecules of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al., 1992, Science 256, 9923; Draper et al, International PCT Publication No. WO 93/23569; Shabarova et al, 1991, Nucleic Acids Research 19, 4247; Bellon et al, 1997 ', Nucleosides & Nucleotides, 16, 951; Bellon et al, 1997, Bioconjugate Chem. 8, 204), or by hybridization following synthesis and/or deprotection.
  • siNA molecules of the invention can also be synthesized using the teachings of Scaringe et al, US Patent Nos. 5,889,136; 6,008,400; and 6,111,086.
  • siNA molecules of the invention that interact with and down-regulate gene encoding target HBV molecules can be expressed and delivered from transcription units (see for example Couture et al, 1996, TIG., 12, 510) inserted into DNA or RNA vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus.
  • pol III based constructs are used to express nucleic acid molecules of the invention.
  • RNA polymerase I RNA polymerase I
  • polymerase II RNA polymerase II
  • poly III RNA polymerase III
  • Transcripts from pol II or pol III promoters are expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type depends on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present nearby.
  • Prokaryotic RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Elroy-Stein and Moss, 1990, Proc. Natl. Acad. Sci. USA, 87, 6743-7; Gao and Huang 1993, Nucleic Acids Res., 21, 2867-72; Lieber et al, 1993, Methods Enzymol, 217, 47-66; Zhou et al, 1990, Mol. Cell.
  • nucleic acid molecules expressed from such promoters can function in mammalian cells ⁇ e.g. Kashani-Sabet et al, 1992, Antisense Res. Dev., 2, 3-15; Ojwang et al, 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6; Chen et al, 1992, Nucleic Acids Res., 20, 4581- 9; Yu et al, 1993, Proc. Natl. Acad. Sci. U S A, 90, 6340-4; L'Huillier et al, 1992, EMBO J., 11, 4411-8; Lisziewicz et al, 1993, Proc.
  • transcription units such as the ones derived from genes encoding U6 small nuclear (snRNA), transfer RNA (tRNA) and adenovirus VA RNA are useful in generating high concentrations of desired RNA molecules such as siNA in cells (Thompson et al, supra; Couture and Stinchcomb, 1996, supra; Noonberg et al, 1994, Nucleic Acid Res., 22, 2830; Noonberg et al, U.S. Pat. No.
  • siNA transcription units can be incorporated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated virus vectors), or viral RNA vectors (such as retroviral or alphavirus vectors) (for a review see Couture and Stinchcomb, 1996, supra).
  • viral DNA vectors such as adenovirus or adeno-associated virus vectors
  • viral RNA vectors such as retroviral or alphavirus vectors
  • Vectors used to express the siNA molecules of the invention can encode one or both strands of an siNA duplex, or a single self-complementary strand that self hybridizes into an siNA duplex.
  • the nucleic acid sequences encoding the siNA molecules of the instant invention can be operably linked in a manner that allows expression of the siNA molecule (see for example Paul et al, 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al, 2002, Nature Biotechnology, 19, 500; and Novina et al, 2002, Nature Medicine, advance online publication doi: 10.1038/nm725).
  • siNA molecules of the invention are added directly, or can be complexed with cationic lipids, packaged within liposomes, or as a recombinant plasmid or viral vectors which express the siNA molecules, or otherwise delivered to target cells or tissues.
  • Methods for the delivery of nucleic acid molecules are described in Akhtar et al, 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al, 1999, Mol. Membr. Biol, 16, 129-140; Hofiand and Huang, 1999, Handb. Exp. Pharmacol, 137, 165-192; and Lee et al, 2000, ACS Symp.
  • Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins (see for example, Gonzalez et al, 1999, Bioconjugate Chem., 10, 1068-1074; Wang et al, International PCT Publication Nos. WO 03/47518 and WO 03/46185), poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for example US Patent 6,447,796 and US Patent Application Publication No.
  • encapsulation in liposomes by iontophoresis
  • other vehicles such as biodegradable polymers, hydrogels, cyclodextrins (see for example, Gonzalez et al, 1999, Bioconjugate Chem., 10, 1068-1074; Wang et al,
  • the present invention provides carrier systems containing the siNA molecules described herein.
  • the carrier system is a lipid-based carrier system, cationic lipid, or liposome nucleic acid complexes, a liposome, a micelle, a virosome, a lipid nanoparticle or a mixture thereof.
  • the carrier system is a polymer- based carrier system such as a cationic polymer-nucleic acid complex.
  • the carrier system is a cyclodextrin-based carrier system such as a cyclodextrin polymer-nucleic acid complex.
  • the carrier system is a protein-based carrier system such as a cationic peptide-nucleic acid complex.
  • the carrier system is a lipid nanoparticle (“LNP”) formulation.
  • the siNA molecules of the invention are formulated with a lipid nanoparticle composition such as is described in U.S. Patent Application Nos. 11/353,630, 11/586,102, 61/189,295, 61/204,878, 61/235,476, 61/249,807, 61/298,022, 61/351373, 61/347640, 61/345754, 61/322054, 12/640342, and 12/617079, and PCT Applications Nos. PCT/USlO/020013 and PCT/ US09/ 053336.
  • the siNA is formulated with components and ratios described and exemplified in Example 6 herein (see also Tables 10 & 11).
  • lipid nanoparticle formulations described in Table 10 are applied to any siNA molecule or combination of siNA molecules herein.
  • the invention features a composition comprising an siNA molecule of the invention formulated as a composition including any of cationic lipid compound numbers 1-46 or a combination thereof.
  • the invention features a composition comprising an siNA molecule of the invention formulated with any of the cationic lipid formulations described in U.S. Patent Application Nos. 61/189,295, 61/204,878, 61/235,476, 61/249,807, and 61/298,022.
  • the invention features conjugates and/or complexes of siNA molecules of the invention.
  • Such conjugates and/or complexes can be used to facilitate delivery of siNA molecules into a biological system, such as a cell.
  • the conjugates and complexes provided by the instant invention can impart therapeutic activity by transferring therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules of the invention.
  • Non-limiting, examples of such conjugates are described in U.S. Publication Nos. US2008/0152661 Al and US 2004/0162260 Al (e.g., CDM-LBA, CDM-Pip-LBA, CDM-PEG, CDM-NAG, etc.) and U.S.
  • polyethylene glycol can be covalently attached to siNA compounds of the present invention.
  • the attached PEG can be any molecular weight, preferably from about 100 to about 50,000 daltons (Da).
  • the invention features compositions or formulations comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes) and siNA molecules of the invention, such as is disclosed in for example, International PCT Publication No. WO 96/10391; Ansell et al., International PCT Publication No. WO 96/10390; Holland et al, International PCT Publication No. WO 96/10392.
  • the siNA molecules of the invention can also be formulated or complexed with polyethyleneimine and derivatives thereof, such as polyethyleneimine- polyethyleneglycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine- polyethyleneglycol-tri-N-acetylgalactosamine (PEI-PEG-triGAL) derivatives.
  • polyethyleneimine- polyethyleneglycol-N-acetylgalactosamine PEI-PEG-GAL
  • PEI-PEG-triGAL polyethyleneimine- polyethyleneglycol-tri-N-acetylgalactosamine
  • siNA molecules of the invention are complexed with membrane disruptive agents such as those described in U.S. Patent Application Publication No. 20010007666.
  • the membrane disruptive agent or agents and the siNA molecule are also complexed with a cationic lipid or helper lipid molecule, such as those lipids described in U.S. Patent No. 6,235,310.
  • siNA molecules of the invention are complexed with delivery systems as described in U.S. Patent Application Publication Nos. 2003077829; 20050287551; 20050164220; 20050191627; 20050118594; 20050153919; 20050085486; and 20030158133; and International PCT Publication Nos. WO 00/03683 and WO 02/087541.
  • a liposomal formulation of the invention comprises an siNA molecule of the invention (e.g., siNA) formulated or complexed with compounds and compositions described in U.S. Patent Nos. 6,858,224; 6,534,484; 6,287,591; 6,835,395; 6,586,410; 6,858,225; 6,815,432; 6,586,001; 6,120,798; 6,977,223; 6,998,115; 5,981,501; 5,976,567; 5,705,385; and U.S. Patent Application Publication Nos.
  • siNA siNA
  • siNA molecule expressing vectors can be systemic, such as by intravenous or intra-muscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al, 1996, TIG., 12, 510).
  • Such recombinant plasmids can also be administered directly or in conjunction with a suitable delivery reagents, including, for example, the Minis Transit LT1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes lipid-based carrier system, cationic lipid, or liposome nucleic acid complexes, a micelle, a virosome, a lipid nanoparticle.
  • a suitable delivery reagents including, for example, the Minis Transit LT1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes lipid-based carrier system, cationic lipid, or liposome nucleic acid complexes, a micelle, a virosome, a lipid nanoparticle.
  • the present invention also provides nucleic acids in kit form.
  • the kit may comprise a container.
  • the kit typically contains a nucleic acid of the invention with instructions for its administration.
  • the nucleic acids may have a targeting moiety attached. Methods of attaching targeting moieties (e.g. antibodies, proteins) are known to those of skill in the art.
  • the nucleic acids are chemically modified.
  • the kit contains more than one siNA molecule of the invention.
  • the kits may comprise an siNA molecule of the invention with a pharmaceutically acceptable carrier or diluent.
  • the kits may further comprise excipients.
  • nucleic acid molecules of the present invention can be used in assays to diagnose disease state related of HBV levels.
  • nucleic acid molecules and pharmaceutical compositions can be used to treat disease states related to HBV RNA levels.
  • liver disease and cancer diseases that can be associated with HBV expression modulation include liver disease and cancer.
  • diseases include cirrhosis of the liver and heptocellular carcinoma.
  • the siNA molecules of the invention can degrade the target HBV mRNA (and thus inhibit the diseases stated above). Inhibition of a disease can be evaluated by directly measuring the progress of the disease in a subject. It can also be inferred through observing a change or reversal in a condition associated with the disease. Additionally, the siNA molecules of the invention can be used as a prophylaxis. Thus, the use of the nucleic acid molecules and pharmaceutical compositions of the invention can be used to ameliorate, treat, prevent, and/or cure these diseases and others associated with regulation of HBV gene expression.
  • siNA molecules of the instant invention provide useful reagents and methods for a variety of therapeutic, prophylactic, cosmetic, veterinary, diagnostic, target validation, genomic discovery, genetic engineering, and pharmacogenomic applications. a. Formulations
  • compositions of the siNA molecules described i.e., compositions in a pharmaceutically acceptable carrier or diluent.
  • pharmaceutical compositions include salts, esters, or salts of such esters, of the above compounds, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, hydroiodic, acetic acid, and benzene sulfonic acid.
  • Other salts include for example, sodium, potassium, manganese, ammonium, and calcium salts.
  • formulations or compositions can comprise a pharmaceutically acceptable carrier or diluent as is generally known in the art.
  • the invention features a pharmaceutical composition comprising an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 1. In another embodiment, the invention features a pharmaceutical composition comprising an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 452. In yet another embodiment, the invention features a pharmaceutical composition comprising an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 2. In still another embodiment, the invention features a pharmaceutical composition comprising an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 453.
  • the invention features a pharmaceutical composition comprising an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 3. In another embodiment, the invention features a pharmaceutical composition comprising an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 454. In another embodiment, the invention features a pharmaceutical composition comprising an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 4. In yet another embodiment, the invention features a pharmaceutical composition comprising an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 455. In still another embodiment, the invention features a pharmaceutical composition comprising an siNA molecule comprising formula (A).
  • the siNA molecules of the invention are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art.
  • Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art for example as described in Remington's Pharmaceutical Science, 17 th ed., Mack Publishing Company, Easton, Pa. (1985).
  • pharmaceutical compositions of the invention e.g. siNA and/or LNP formulations thereof
  • pharmaceutical compositions of the invention further comprise conventional pharmaceutical excipients and/or additives.
  • Suitable pharmaceutical excipients include preservatives, flavoring agents, stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • Suitable additives include physiologically biocompatible buffers (e.g., trimethylamine hydrochloride), addition of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate).
  • chelants such as, for example, DTPA or DTPA-bisamide
  • calcium chelate complexes as for example calcium DTPA, CaNaDTPA-bisamide
  • calcium or sodium salts for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate.
  • antioxidants and suspending agents can be used.
  • Non-limiting examples of various types of formulations for local administration include ointments, lotions, creams, gels, foams, preparations for delivery by transdermal patches, powders, sprays, aerosols, capsules or cartridges for use in an inhaler or insufflator or drops (for example eye or nose drops), solutions/suspensions for nebulization, suppositories, pessaries, retention enemas and chewable or suckable tablets or pellets (for example for the treatment of aphthous ulcers) or liposome or microencapsulation preparations.
  • Ointments, creams and gels can, for example, can be formulated with an aqueous or oily base with the addition of suitable thickening and/or gelling agent and/or solvents.
  • suitable thickening and/or gelling agent and/or solvents can thus, for example, include water and/or an oil such as liquid paraffin or a vegetable oil such as arachis oil or castor oil, or a solvent such as polyethylene glycol.
  • Various thickening agents and gelling agents can be used depending on the nature of the base.
  • Non-limiting examples of such agents include soft paraffin, aluminum stearate, cetostearyl alcohol, polyethylene glycols, woolfat, beeswax, carboxypolymethylene and cellulose derivatives, and/or glyceryl monostearate and/or non-ionic emulsifying agents.
  • lotions can be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents or thickening agents.
  • powders for external application can be formed with the aid of any suitable powder base, for example, talc, lactose or starch.
  • Drops can be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents, suspending agents or preservatives.
  • compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations.
  • Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets.
  • excipients can be, for example, inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc.
  • the tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.
  • Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
  • water or an oil medium for example peanut oil, liquid paraffin or olive oil.
  • Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate; or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monoo
  • the aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
  • preservatives for example ethyl, or n-propyl p-hydroxybenzoate
  • coloring agents for example ethyl, or n-propyl p-hydroxybenzoate
  • flavoring agents for example ethyl, or n-propyl p-hydroxybenzoate
  • sweetening agents such as sucrose or saccharin.
  • Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
  • the oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol.
  • Sweetening agents and flavoring agents can be added to provide palatable oral preparations.
  • These compositions can be preserved by the addition of an antioxidant such as ascorbic acid
  • compositions of the invention can also be in the form of oil-in-water emulsions.
  • the oily phase can be a vegetable oil or a mineral oil or mixtures of these.
  • Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions can also contain sweetening and flavoring agents.
  • Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents.
  • the pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above.
  • the sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol.
  • Suitable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil can be employed including synthetic mono-or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • the nucleic acid molecules of the invention can also be administered in the form of suppositories, e.g., for rectal administration of the drug.
  • suppositories e.g., for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • Such materials include cocoa butter and polyethylene glycols.
  • Nucleic acid molecules of the invention can be administered parenterally in a sterile medium.
  • the drug depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle.
  • adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
  • the siNA and LNP compositions and formulations provided herein for use in pulmonary delivery further comprise one or more surfactants.
  • Suitable surfactants or surfactant components for enhancing the uptake of the compositions of the invention include synthetic and natural as well as full and truncated forms of surfactant protein A, surfactant protein B, surfactant protein C, surfactant protein D and surfactant Protein E, di- saturated phosphatidylcholine (other than dipalmitoyl), dipalmitoylphosphatidylcholine, phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol, phosphatidylethanolamine, phosphatidylserine; phosphatidic acid, ubiquinones, lysophosphatidylethanolamine, lysophosphatidylcholine, palmitoyl-lysophosphatidylcholine, dehydroepiandrosterone,
  • siNAs and pharmaceutical formulations according to the invention can be administered to a subject alone or used in combination with or include one or more other therapeutic agents, for example, antiviral or anticancer agents.
  • other therapeutic agents for example, antiviral or anticancer agents.
  • combinations of the presently disclosed compounds with other antiviral or anti-cancer or chemotherapeutic agents are within the scope of the invention
  • anti-cancer or chemotherapeutic agents can be found in Cancer Principles and Practice of Oncology by V.T. Devita and S. Hellman (editors), 6 th edition (February 15, 2001), Lippincott Williams & Wilkins Publishers. A person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the cancer involved.
  • Such anti-cancer agents include, but are not limited to, the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic/cytostatic agents, antiproliferative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors and other angiogenesis inhibitors, inhibitors of cell proliferation and survival signaling, apoptosis inducing agents and agents that interfere with cell cycle checkpoints.
  • the siNAs of the invention are also useful in combination with any therapeutic agent used in the treatment of HCC, for example, but not limitation sorafenib.
  • the invention provides a combination comprising an siNA molecule of the invention, such as for example, but not limitation, an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 1210, SEQ ID NO: 2, SEQ ID NO: 1211, SEQ ID NO: 3, SEQ ID NO: 1212, SEQ ID NO: 4, or SEQ ID NO: 1213; or formula (A) or a pharmaceutically acceptable salt, solvate or physiologically functional derivative thereof together with one or more antiviral agents.
  • the antiviral is another HBV inhibitor.
  • the instant siNA molecules of the invention are useful in combination with known HBV antiviral agents including the following: Lamivudine (2',3'- dideoxy-3'-thiacytidine, commonly called 3TC), PegInterferon-alpha2a, tenofovir, entecavir, telbivudine, adefovir.
  • the invention provides a combination comprising an siNA molecule of the invention, such as for example, but not limitation, an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 452, SEQ ID NO: 2, SEQ ID NO: 453, SEQ ID NO: 3, SEQ ID NO: 454, SEQ ID NO: 4, or SEQ ID NO:455; or formula (A) or a pharmaceutically acceptable salt, solvate or physiologically functional derivative thereof together with one or more anti-cancer or chemotherapeutic agents.
  • an siNA molecule of the invention such as for example, but not limitation, an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 452, SEQ ID NO: 2, SEQ ID NO: 453, SEQ ID NO: 3, SEQ ID NO: 454, SEQ ID NO: 4, or SEQ ID NO:455; or formula (A) or a pharmaceutically acceptable salt, solvate or physiologically functional derivative thereof together with
  • the instant siNA molecules of the invention are useful in combination with known anti-cancer agents including the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic agents, antiproliferative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors, HIV protease inhibitors, reverse transcriptase inhibitors, and other angiogenesis inhibitors.
  • known anti-cancer agents including the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic agents, antiproliferative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors, HIV protease inhibitors, reverse transcriptase inhibitors, and other angiogenesis inhibitors.
  • estrogen receptor modulators examples include, but are not limited to, tamoxifen, raloxifene, idoxifene, LY353381, LY117081, toremifene, fulvestrant, 4-[7-(2,2-dimethyl-l-oxopropoxy-4-methyl-2- [4-[2-(l -piperidinyl)ethoxy]phenyl]-2H- 1 -benzopyran-3-yl]-phenyl-2,2-dimethylpropanoate, 4,4'-dihydroxybenzophenone-2,4-dinitrophenyl-hydrazone, and SH646.
  • Examples of androgen receptor modulators that can be used in combination with the compounds of the invention include, but are not limited to, finasteride and other 5a-reductase inhibitors, nilutamide, flutamide, bicalutamide, liarozole, and abiraterone acetate.
  • retinoid receptor modulators examples include, but are not limited to, bexarotene, tretinoin, 13-cis- retinoic acid, 9-cis-retinoic acid, a-difluoromethylornithine, ILX23-7553, trans-N-(4'- hydroxyphenyl) retinamide, and N-4-carboxyphenyl retinamide.
  • cytotoxic agents that can be used in combination with the compounds of the invention include, but are not limited to, sertenef, cachectin, ifosfamide, tasonermin, lonidamine, carboplatin, altretamine, prednimustine, dibromodulcitol, ranimustine, fotemustine, nedaplatin, oxaliplatin, temozolomide, heptaplatin, estramustine, improsulfan tosilate, trofosfamide, nimustine, dibrospidium chloride, pumitepa, lobaplatin, satraplatin, profiromycin, cisplatin, irofulven, dexifosfamide, cis-aminedichloro(2-methyl-pyridine)platinum, benzylguanine, glufosfamide, GPX100, (trans, trans, trans)-bis-mu
  • hypoxia activatable compound that can be used in combination with the compounds of the invention is tirapazamine.
  • proteasome inhibitors examples include, but are not limited to, lactacystin and bortezomib.
  • microtubule inhibitors/microtubule-stabilising agents that can be used in combination with the compounds of the invention include, but are not limited to, paclitaxel, vindesine sulfate, 3',4'-didehydro-4'-deoxy-8'-norvincaleukoblastine, docetaxol, rhizoxin, dolastatin, mivobulin isethionate, auristatin, cemadotin, RPRl 09881, BMS 184476, vinflunine, cryptophycin, 2,3,4,5, 6-pentafluoro-N-(3-fluoro-4-methoxyphenyl) benzene sulfonamide, anhydrovinblastine, N,N-dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-prolyl-L-proline-t- butylamide, TDX258, the epothilones (
  • topoisomerase inhibitors that can be used in combination with the compounds of the invention include, but are not limited to, are topotecan, hycaptamine, irinotecan, rubitecan, 6-ethoxypropionyl-3',4'-0-exo-benzylidene-chartreusin, 9-methoxy-N,N- dimethyl-5-nitropyrazolo[3,4,5-kl]acridine-2-(6H) propanamine, l-amino-9-ethyl-5-fluoro-2,3- dihydro-9-hydroxy-4-methyl-lH,12H-benzo[de]pyrano[3 4':b,7]-indolizino[l,2b]quinoline- 10,13(9H,15H)dione, lurtotecan, 7-[2-(N-isopropylamino)ethyl]-(20S)camptothecin, BNP1350, BN
  • inhibitors of mitotic kinesins include, but are not limited to, inhibitors described in PCT Publications WO 01/30768, WO 01/98278, WO 03/050,064, WO 03/050,122, WO 03/049,527, WO 03/049,679, WO 03/049,678, WO04/039774, WO03/079973, WO03/099211, WO03/105855, WO03/106417, WO04/037171, WO04/058148, WO04/058700, WO04/126699, WO05/018638, WO05/019206, WO05/019205, WO05/018547, WO05/017190, US2005/0176776.
  • inhibitors of mitotic kinesins include, but are not limited to inhibitors of KSP, inhibitors of MKLPl, inhibitors of CENP-E, inhibitors of MCAK, inhibitors of Kifl4, inhibitors of Mphosphl and inhibitors of Rab6-KIFL.
  • histone deacetylase inhibitors examples include, but are not limited to, TSA, oxamflatin, PXD101, MG98, valproic acid and scriptaid. Further reference to other histone deacetylase inhibitors may be found in the following manuscript; Miller, T.A. et al. J. Med. Chem. 46(24):5097-5116 (2003).
  • Inhibitors of kinases involved in mitotic progression include, but are not limited to, inhibitors of aurora kinase, inhibitors of Polo-like kinases (PLK) (in particular inhibitors of PLK-1), inhibitors of bub- 1 and inhibitors of bub-Rl .
  • PLK Polo-like kinases
  • Antiproliferative agents that can be used in combination with the compounds of the invention include, but are not limited to, antisense RNA and DNA oligonucleotides such as G3139, ODN698, RVASKRAS, GEM231, and INX3001, and antimetabolites such as enocitabine, carmofur, tegafur, pentostatin, doxifluridine, trimetrexate, fludarabine, capecitabine, galocitabine, cytarabine ocfosfate, fosteabine sodium hydrate, raltitrexed, paltitrexid, emitefur, tiazofurin, decitabine, nolatrexed, pemetrexed, nelzarabine, 2'-deoxy-2'-methylidenecytidine, 2'- fluoromethylene-2'-deoxycytidine, N-[5-(2,3-dihydro-benzofuryl)sulf
  • Examples of monoclonal antibody targeted therapeutic agents that can be used in combination with the compounds of the invention include those therapeutic agents which have cytotoxic agents or radioisotopes attached to a cancer cell specific or target cell specific monoclonal antibody, such as, for example, Bexxar.
  • HMG-CoA reductase inhibitors that may be used that can be used in combination with the compounds of the invention include, but are not limited to, lovastatin
  • prenyl-protein transferase inhibitors examples include, but are not limited to, can be found in the following publications and patents: WO 96/30343, WO 97/18813, WO 97/21701, WO 97/23478, WO 97/38665, WO 98/28980, WO 98/29119, WO 95/32987, U.S. Pat. No. 5,420,245, U.S. Pat. No. 5,523,430, U.S. Pat. No. 5,532,359, U.S. Pat. No. 5,510,510, U.S. Pat. No. 5,589,485, U.S. Pat. No.
  • angiogenesis inhibitors examples include, but are not limited to, tyrosine kinase inhibitors, such as inhibitors of the tyrosine kinase receptors Fit- 1 (VEGFR1) and Flk-l/KDR (VEGFR2), inhibitors of epidermal-derived, fibroblast-derived, or platelet derived growth factors, MMP (matrix metalloprotease) inhibitors, integrin blockers, interferon-a, interleukin-12, pentosan polysulfate, cyclooxygenase inhibitors, including nonsteroidal anti-inflammatories (NSAIDs) like aspirin and ibuprofen as well as selective cyclooxy-genase-2 inhibitors like celecoxib and rofecoxib (PNAS, Vol.
  • NSAIDs nonsteroidal anti-inflammatories
  • steroidal anti-inflammatories such as corticosteroids, mineralocorticoids, dexamethasone, prednisone, prednisolone, methylpred, betamethasone
  • carboxyamidotriazole combretastatin A-4, squalamine, 6-0- chloroacetyl-carbonyl)-fumagillol, thalidomide, angiostatin, troponin- 1, angiotensin II antagonists (see Fernandez et al., J Lab. Clin. Med.
  • Other therapeutic agents that modulate or inhibit angiogenesis may also be used in combination with the compounds of the instant invention and include agents that modulate or inhibit the coagulation and fibrinolysis systems (see review in Clin. Chem. La. Med. 38:679-692 (2000)).
  • agents that modulate or inhibit the coagulation and fibrinolysis pathways that can be used in combination with the compounds of the invention include, but are not limited to, heparin (see Thromb. Haemost. 80: 10-23 (1998)), low molecular weight heparins and carboxypeptidase U inhibitors (also known as inhibitors of active thrombin activatable fibrinolysis inhibitor [TAFIa]) (see Thrombosis Res. 101 :329-354 (2001)).
  • TAFIa inhibitors have been described in PCT Publication WO 03/013,526 and U.S. Ser. No. 60/349,925 (filed January 18, 2002).
  • Agents that interfere with cell cycle checkpoints that can be used in combination with the compounds of the invention include, but are not limited to, inhibitors of ATR, ATM, the Chkl and Chk2 kinases and cdk and cdc kinase inhibitors and are specifically exemplified by 7- hydroxystaurosporin, flavopiridol, CYC202 (Cyclacel) and BMS-387032.
  • RTKs receptor tyrosine kinases
  • agents that interfere with receptor tyrosine kinases (RTKs) include, but are not limited to, inhibitors of c- Kit, Eph, PDGF, Flt3 and HBV. Further agents include inhibitors of RTKs as described by Bume- Jensen and Hunter, Nature, 411 :355-365, 2001.
  • Inhibitors of cell proliferation and survival signaling pathway that can be used in combination with the compounds of the invention include, but are not limited to, inhibitors of EGFR (for example gefitinib and erlotinib), inhibitors of ERB-2 (for example trastuzumab), inhibitors of IGFR, inhibitors of cytokine receptors, inhibitors of HBV, inhibitors of PI3K (for example LY294002), serine/threonine kinases (including but not limited to inhibitors of Akt such as described in WO 02/083064, WO 02/083139, WO 02/083140, US 2004-01 16432, WO 02/083138, US 2004-0102360, WO 03/086404, WO 03/086279, WO 03/086394, WO 03/084473, WO 03/086403, WO 2004/041 162, WO 2004/096131 , WO 2004/096129, WO 2004/096135, WO
  • Apoptosis inducing agents that can be used in combination with the compounds of the invention include, but are not limited to, activators of TNF receptor family members (including the TRAIL receptors).
  • NSAIDs that are selective COX-2 inhibitors that can be used in combination with the compounds of the invention include, but are not limited to, those NSAIDs disclosed in U.S. Pat. 5,474,995, U.S. Pat. 5,861 ,419, U.S. Pat. 6,001 ,843, U.S. Pat. 6,020,343, U.S. Pat. 5,409,944, U.S. Pat. 5,436,265, U.S. Pat. 5,536,752, U.S. Pat. 5,550,142, U.S. Pat. 5,604,260, U.S. 5,698,584, U.S. Pat. 5,710,140, WO 94/15932, U.S. Pat.
  • Inhibitors of COX-2 that are particularly useful in combination with the compounds of the invention include: 3-phenyl-4-(4-(methylsulfonyl)phenyl)-2-(5H)-furanone; and 5-chloro- 3-(4-methylsulfonyl)-phenyl-2-(2-methyl-5-pyridinyl)pyridine; or a pharmaceutically acceptable salt thereof.
  • Angiogenesis inhibitors that can be used in combination with the compounds of the invention include, but are not limited to, endostatin, ukrain, ranpirnase, IM862, 5-methoxy-4-[2- methyl-3-(3-methyl-2-butenyl)oxiranyl]-l-oxaspiro[2,5]oct-6-yl(chloroacetyl)carbamate, acetyldinanaline, 5-amino-l-[[3,5-dichloro-4-(4-chlorobenzoyl)-phenyl]methyl]-lH-l,2,3- triazole-4-carboxamide,CM101, squalamine, combretastatin, RPI4610, NX31838, sulfated mannopentaose phosphate, 7,7-(carbonyl-bis[imino-N-methyl-4,2-pyrrolocarbonylimino[N- methyl-4,2-pyrrol
  • Tyrosine kinase inhibitors that can be used in combination with the compounds of the invention include, but are not limited to, N-(trifluoromethylphenyl)-5-methylisoxazol-4- carboxamide, 3-[(2,4-dimethylpyrrol-5-yl)methylidenyl)indolin-2-one, 17-(allylamino)-17- demethoxygeldanamycin, 4-(3-chloro-4-fluorophenylamino)-7-methoxy-6-[3-(4- morpholinyl)propoxyl]quinazoline, N-(3-ethynylphenyl)-6,7-bis(2-methoxyethoxy)-4- quinazolinamine, BIBX 1382, 2,3,9,10,11,12-hexahydro- 10-(hydroxymethyl)- 10-hydroxy-9- methyl-9,12-epoxy-lH-diindolo[l,2,3-fg:3
  • Combinations with compounds other than anti-cancer compounds are also encompassed in the instant compositions and methods.
  • combinations of the instantly claimed compounds with PPAR- ⁇ (i.e., PPAR-gamma) agonists and PPAR- ⁇ (i.e., PPAR-delta) agonists are useful in the treatment of certain malignancies.
  • PPAR- ⁇ and PPAR- ⁇ are the nuclear peroxisome proliferator-activated receptors ⁇ and ⁇ .
  • the expression of PPAR- ⁇ on endothelial cells and its involvement in angiogenesis has been reported in the literature (see J Cardiovasc. Pharmacol. 31 :909-913 (1998); J Biol. Chem.
  • Examples of PPAR- ⁇ agonists and PPAR- ⁇ / ⁇ agonists that can be used in combination with the compounds of the invention include, but are not limited to, thiazolidinediones (such as DRF2725, CS-011, troglitazone, rosiglitazone, and pioglitazone), fenofibrate, gemfibrozil, clofibrate, GW2570, SB219994, AR-H039242, JTT-501, MCC-555, GW2331, GW409544, NN2344, KRP297, NP0110, DRF4158, NN622, GI262570, PNU182716, DRF552926, 2-[(5,7- dipropyl-3-trifluoromethyl-l,2-benzisoxazol-6-yl)oxy]-2-methylpropionic acid (disclosed in USSN 09/782,856), and 2(R)-7-(3-(2-chloro-4
  • Another embodiment of the instant invention is the use of the presently disclosed compounds in combination with gene therapy for the treatment of cancer.
  • Gene therapy can be used to deliver any tumor suppressing gene. Examples of such genes include, but are not limited to, p53, which can be delivered via recombinant virus-mediated gene transfer (see U.S. Pat. No.
  • a uPA/uPAR antagonist (Adenovirus-Mediated Delivery of a uPA/uPAR Antagonist Suppresses Angiogenesis-Dependent Tumor Growth and Dissemination in Mice," Gene Therapy, August 5(8): 1105-13 (1998)), and interferon gamma (J Immunol 164:217-222 (2000)).
  • the compounds of the instant invention may also be administered in combination with an inhibitor of inherent multidrug resistance (MDR), in particular MDR associated with high levels of expression of transporter proteins.
  • MDR inhibitors include inhibitors of p- glycoprotein (P-gp), such as LY335979, XR9576, OC144-093, R101922, VX853 and PSC833 (valspodar).
  • a compound of the present invention may be employed in conjunction with antiemetic agents to treat nausea or emesis, including acute, delayed, late-phase, and anticipatory emesis, which may result from the use of a compound of the present invention, alone or with radiation therapy.
  • a compound of the present invention may be used in conjunction with other anti-emetic agents, especially neurokinin- 1 receptor antagonists, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.S. Patent Nos.
  • neurokinin- 1 receptor antagonists especially 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.S. Patent Nos.
  • an antidopaminergic such as the phenothiazines (for example prochlorperazine, fluphenazine, thioridazine and mesoridazine), metoclopramide or dronabinol.
  • an anti-emesis agent selected from a neurokinin- 1 receptor antagonist, a 5HT3 receptor antagonist and a corticosteroid is administered as an adjuvant for the treatment or prevention of emesis that may result upon administration of the instant compounds.
  • Neurokinin- 1 receptor antagonists of use in conjunction with the compounds of the present invention are fully described, for example, in U.S. Pat. Nos. 5,162,339, 5,232,929, 5,242,930, 5,373,003, 5,387,595, 5,459,270, 5,494,926, 5,496,833, 5,637,699, 5,719,147; European Patent Publication Nos.
  • the neurokinin- 1 receptor antagonist for use in conjunction with the compounds of the present invention is selected from: 2-(R)-(l-(R)-(3,5-bis(trifluoromethyl)- phenyl)ethoxy)-3-(S)-(4-fluorophenyl)-4-(3-(5-oxo-lH,4H-l,2,4-triazolo)methyl)morpholine, or a pharmaceutically acceptable salt thereof, which is described in U.S. Pat. No. 5,719,147.
  • a compound of the instant invention may also be administered with an agent useful in the treatment of anemia.
  • an anemia treatment agent is, for example, a continuous eythropoiesis receptor activator (such as epoetin alfa).
  • a compound of the instant invention may also be administered with an agent useful in the treatment of neutropenia.
  • a neutropenia treatment agent is, for example, a hematopoietic growth factor which regulates the production and function of neutrophils such as a human granulocyte colony stimulating factor, (G-CSF).
  • G-CSF human granulocyte colony stimulating factor
  • Examples of a G-CSF include filgrastim and PEG-filgrastim.
  • a compound of the instant invention may also be administered with an immunologic- enhancing drug, such as levamisole, isoprinosine and Zadaxin.
  • an immunologic- enhancing drug such as levamisole, isoprinosine and Zadaxin.
  • a compound of the instant invention may also be useful for treating or preventing liver disease or cancer in combination with other siNA therapeutics.
  • the compounds of the instant invention may also be administered in combination with ⁇ -secretase inhibitors and/or inhibitors of NOTCH signaling.
  • Such inhibitors include compounds described in WO 01/90084, WO 02/30912, WO 01/70677, WO 03/013506, WO 02/36555, WO 03/093252, WO 03/093264, WO 03/093251, WO 03/093253, WO 2004/039800, WO 2004/039370, WO 2005/030731, WO 2005/014553, USSN 10/957,251, WO 2004/089911, WO 02/081435, WO 02/081433, WO 03/018543, WO 2004/031137, WO 2004/031139, WO 2004/031138, WO 2004/101538, WO 2004/101539 and WO 02/47671 (including LY-450139).
  • a compound of the instant invention may also be useful for treating or preventing cancer in combination with PARP inhibitors.
  • a compound of the instant invention may also be useful for treating cancer in combination with the following therapeutic agents: abarelix (Plenaxis depot®); aldesleukin (Prokine®); Aldesleukin (Proleukin®); Alemtuzumabb (Campath®); alitretinoin (Panretin®); allopurinol (Zyloprim®); altretamine (Hexalen®); amifostine (Ethyol®); anastrozole (Arimidex®); arsenic trioxide (Trisenox®); asparaginase (Elspar®); azacitidine (Vidaza®); bendamustine hydrochloride (Treanda®); bevacuzimab (Avastin®); bexarotene capsules (Targretin®); bexarotene gel (Targretin®); bleomycin (Blenoxane®); bortezomib (Velcade®);
  • compositions comprising a combination as defined above together with a pharmaceutically acceptable diluent or carrier represent a further aspect of the invention.
  • the individual compounds of such combinations can be administered either sequentially or simultaneously in separate or combined pharmaceutical formulations. In one embodiment, the individual compounds will be administered simultaneously in a combined pharmaceutical formulation.
  • the described molecules could be used in combination with one or more known compounds, treatments, or procedures to prevent or treat diseases, disorders, conditions, and traits described herein in a subject or organism as are known in the art, such as other HBV inhibitors.
  • one aspect of the invention comprises a method of treating a subject including, but not limited to, a human suffering HBV infection or a condition which is mediated by the action of HBV gene expression, which method comprises administering to said subject an effective amount of a double-stranded siNA molecule of the invention.
  • the siNA molecules comprises at least a 15 nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 452, SEQ ID NO: 2, SEQ ID NO: 453, SEQ ID NO: 3, SEQ ID NO: 454, SEQ ID NO: 4, or SEQ ID NO:455; or formula (A).
  • the condition is cancer.
  • the molecules and compositions of the instant invention are useful in a method for treating cancer, and in particular, in treating hepatocellular carcinoma (HCC).
  • HCC hepatocellular carcinoma
  • the condition is liver disease.
  • the molecules and compositions of the instant invention are useful in a method for treating liver disease, and, in particular, in treating cirrhosis of the liver.
  • the administration of the siNA molecule is via local administration or systemic administration.
  • the invention features contacting the subject or organism with an siNA molecule of the invention via local administration to relevant tissues or cells, such as lung cells and tissues, such as via pulmonary delivery.
  • the invention features contacting the subject or organism with an siNA molecule of the invention via systemic administration (such as via intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as liver or cancerous tissues or cells in a subject or organism.
  • siNA molecules of the invention are also used as reagents in ex vivo applications.
  • siNA reagents are introduced into tissue or cells that are transplanted into a subject for therapeutic effect.
  • the cells and/or tissue can be derived from an organism or subject that later receives the explant, or can be derived from another organism or subject prior to transplantation.
  • the siNA molecules can be used to modulate the expression of one or more genes in the cells or tissue, such that the cells or tissue obtain a desired phenotype or are able to perform a function when transplanted in vivo.
  • certain HBV target cells from a patient are extracted.
  • HBV siNAs targeting a specific nucleotide sequence within the cells under conditions suitable for uptake of the siNAs by these cells ⁇ e.g., using delivery reagents such as cationic lipids, liposomes and the like or using techniques such as electroporation to facilitate the delivery of siNAs into cells).
  • delivery reagents such as cationic lipids, liposomes and the like or using techniques such as electroporation to facilitate the delivery of siNAs into cells.
  • the cells are then reintroduced back into the same patient or other patients.
  • a pharmaceutically effective dose of the siNA molecules or pharmaceutical compositions of the invention is administered to the subject.
  • a pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) a disease state.
  • One skilled in the art can readily determine a therapeutically effective dose of the siNA of the invention to be administered to a given subject, by taking into account factors, such as the size and weight of the subject, the extent of the disease progression or penetration, the age, health, and sex of the subject, the route of administration, and whether the administration is regional or systemic.
  • an amount between 0.1 ⁇ g/kg and 100 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
  • Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient.
  • the siNA molecules of the invention can be administered in a single dose or in multiple doses.
  • siNA molecules of the instant invention can be administered once monthly, once weekly, once daily (QD), or divided into multiple monthly, weekly, or daily doses, such as, for example, but not limitation, twice daily (BID), three times daily (TID), once every two weeks.
  • BID twice daily
  • TID three times daily
  • Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
  • the administration can be continuous, i.e., every day, or intermittently.
  • intermittent administration of a compound of the instant invention may be administration one to six days per week or it may mean administration in cycles (e.g. daily administration for two to eight consecutive weeks, then a rest period with no administration for up to one week) or it may mean administration on alternate days.
  • compositions or formulations can be administered in a variety of ways.
  • administration methods of the invention include oral, buccal, sublingual, parenteral (i.e., intraarticularly, intravenously, intraperitoneally, subcutaneously, or intramuscularly), local rectal administration or other local administration.
  • the composition of the invention can be administered by insufflation and inhalation. Administration can be accomplished via single or divided doses.
  • the pharmaceutical compositions are administered intravenously or intraperitoneally by a bolus injection (see, e.g., U.S. Pat. No. 5,286,634).
  • Lipid nucleic acid particles can be administered by direct injection at the site of disease or by injection at a site distal from the site of disease (see, e.g., Culver, HUMAN GENE THERAPY, MaryAnn Liebert, Inc., Publishers, New York. pp. 70-71(1994)).
  • the siNA molecules of the invention and formulations or compositions thereof are administered to a cell, subject, or organism as is described herein and as is generally known in the art.
  • the siNA can be administered to the subject systemically as described herein or otherwise known in the art, either alone as a monotherapy or in combination with additional therapies described herein or as are known in the art.
  • Systemic administration can include, for example, pulmonary (inhalation, nebulization etc.) intravenous, subcutaneous, intramuscular, catheterization, nasopharangeal, transdermal, or oral/gastro intestinal administration as is generally known in the art.
  • the siNA can be administered to the subject locally or to local tissues as described herein or otherwise known in the art, either alone as a monotherapy or in combination with additional therapies as are known in the art.
  • Local administration can include, for example, inhalation, nebulization, catheterization, implantation, direct injection, dermal/transdermal application, patches, stenting, ear/eye drops, or portal vein administration to relevant tissues, or any other local administration technique, method or procedure, as is generally known in the art.
  • the siNA molecules of the invention and formulations or compositions thereof are administered to the liver as is generally known in the art (see for example Wen et al, 2004, World J Gastroenterol., 10, 244-9; Murao et al., 2002, Pharm Res., 19, 1808-14; Liu et al, 2003, gene Ther., 10, 180-7; Hong et al, 2003, J Pharm Pharmacol, 54, 51-8; Herrmann et al, 2004, Arch Virol, 149, 1611-7; and Matsuno et al, 2003, gene Ther., 10, 1559-66).
  • the invention features the use of methods to deliver the siNA molecules of the instant invention to hematopoietic cells, including monocytes and lymphocytes. These methods are described in detail by Hartmann et al, 1998, J Phamacol. Exp. Ther., 285(2), 920-928; Kronenwett et al, 1998, Blood, 91(3), 852-862; Filion and Phillips, 1997, Biochim. Biophys. Acta., 1329(2), 345-356; Ma and Wei, 1996, Leuk. Res., 20(11/12), 925-930; and Bongartz et al, 1994, Nucleic Acids Research, 22(22), 4681-8.
  • the siNA molecules of the invention and formulations or compositions thereof are administered directly or topically ⁇ e.g., locally) to the dermis or follicles as is generally known in the art (see for example Brand, 2001, Curr. Opin. Mol. Ther., 3, 244-8; Regnier et al, 1998, J Drug Target, 5, 275-89; Kanikkannan, 2002, BioDrugs, 16, 339-47; Wraight et al, 2001, Pharmacol. Ther., 90, 89-104; and Preat and Dujardin, 2001, STP PharmaSciences, 11, 57-68).
  • the siNA molecules of the invention and formulations or compositions thereof are administered directly or topically using a hydroalcoholic gel formulation comprising an alcohol ⁇ e.g., ethanol or isopropanol), water, and optionally including additional agents such isopropyl myristate and carbomer 980.
  • a hydroalcoholic gel formulation comprising an alcohol ⁇ e.g., ethanol or isopropanol), water, and optionally including additional agents such isopropyl myristate and carbomer 980.
  • the siNA are formulated to be administered topically to the nasal cavity.
  • Topical preparations can be administered by one or more applications per day to the affected area; over skin areas occlusive dressings can advantageously be used. Continuous or prolonged delivery can be achieved by an adhesive reservoir system.
  • an siNA molecule of the invention is administered iontophoretically, for example to a particular organ or compartment ⁇ e.g., the eye, back of the eye, heart, liver, kidney, bladder, prostate, tumor, CNS etc.).
  • a particular organ or compartment e.g., the eye, back of the eye, heart, liver, kidney, bladder, prostate, tumor, CNS etc.
  • iontophoretic delivery are described in, for example, WO 03/043689 and WO 03/030989, which are incorporated by reference in their entireties herein.
  • the siNA molecules of the invention and formulations or compositions thereof are administered to the lung as is described herein and as is generally known in the art.
  • the siNA molecules of the invention and formulations or compositions thereof are administered to lung tissues and cells as is described in U.S. Patent Publication Nos. 2006/0062758; 2006/0014289; and 2004/0077540.
  • Aerosols and Delivery Devices a. Aerosol Formulations
  • compositions of the present invention can be made into aerosol formulations ⁇ i.e., they can be "nebulized" to be administered via inhalation (e.g., intranasally or intratracheally) (see, Brigham et al., Am. J. Sci., 298:278 (1989)). Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
  • the siNA molecules of the invention and formulations thereof are administered via pulmonary delivery, such as by inhalation of an aerosol or spray dried formulation administered by an inhalation device or nebulizer, providing rapid local uptake of the nucleic acid molecules into relevant pulmonary tissues.
  • Solid particulate compositions containing respirable dry particles of micronized nucleic acid compositions can be prepared by grinding dried or lyophilized nucleic acid compositions, and then passing the micronized composition through, for example, a 400 mesh screen to break up or separate out large agglomerates.
  • a solid particulate composition comprising the siNA compositions of the invention can optionally contain a dispersant which serves to facilitate the formation of an aerosol as well as other therapeutic compounds.
  • a suitable dispersant is lactose, which can be blended with the nucleic acid compound in any suitable ratio, such as a 1 to 1 ratio by weight.
  • Spray compositions comprising siNA molecules or compositions of the invention can, for example, be formulated as aqueous solutions or suspensions or as aerosols delivered from pressurized packs, such as a metered dose inhaler, with the use of a suitable liquefied propellant.
  • aerosol compositions of the invention suitable for inhalation can be either a suspension or a solution and generally contain an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 1 , SEQ ID NO: 452, SEQ ID NO: 2, SEQ ID NO: 453, SEQ ID NO: 3, SEQ ID NO: 454, SEQ ID NO: 4, or SEQ ID NO:455; or formula (A), and a suitable propellant such as a fluorocarbon or hydrogen-containing chlorofluorocarbon or mixtures thereof, particularly hydrofluoroalkanes, especially 1 ,1 , 1 ,2-tetrafluoroethane, 1 ,1 , 1 ,2,3,3,3- heptafluoro-n-propane or a mixture thereof.
  • a suitable propellant such as a fluorocarbon or hydrogen-containing chlorofluorocarbon or mixtures thereof, particularly hydrofluoroalkanes, especially 1 ,1 , 1 ,2-tetrafluor
  • the aerosol composition can optionally contain additional formulation excipients well known in the art such as surfactants.
  • additional formulation excipients well known in the art such as surfactants.
  • Non-limiting examples include oleic acid, lecithin or an oligolactic acid or derivative such as those described in W094/21229 and W098/34596 and co-solvents for example ethanol.
  • a pharmaceutical aerosol formulation of the invention comprising a compound of the invention and a fluorocarbon or hydrogen-containing chlorofluorocarbon or mixtures thereof as propellant, optionally in combination with a surfactant and/or a co-solvent.
  • aerosol formulations of the invention can be buffered by the addition of suitable buffering agents.
  • Aerosol formulations can include optional additives including preservatives if the formulation is not prepared sterile.
  • preservatives include, methyl hydroxybenzoate, anti-oxidants, flavorings, volatile oils, buffering agents and emulsifiers and other formulation surfactants.
  • fluorocarbon or perfluorocarbon carriers are used to reduce degradation and provide safer biocompatible non-liquid particulate suspension compositions of the invention (e.g., siNA and/or LNP formulations thereof).
  • a device comprising a nebulizer delivers a composition of the invention (e.g., siNA and/or LNP formulations thereof) comprising fluorochemicals that are bacteriostatic thereby decreasing the potential for microbial growth in compatible devices.
  • a composition of the invention e.g., siNA and/or LNP formulations thereof
  • Capsules and cartridges comprising the composition of the invention for use in an inhaler or insufflator, of for example gelatine, can be formulated containing a powder mix for inhalation of a compound of the invention and a suitable powder base such as lactose or starch.
  • each capsule or cartridge contains an siNA molecule comprising at least a 15 nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 452, SEQ ID NO: 2, SEQ ID NO: 453, SEQ ID NO: 3, SEQ ID NO: 454, SEQ ID NO: 4, or SEQ ID NO:455; or formula (A), and one or more excipients.
  • the compound of the invention can be presented without excipients such as lactose
  • the aerosol compositions of the present invention can be administered into the respiratory system as a formulation including particles of respirable size, e.g. particles of a size sufficiently small to pass through the nose, mouth and larynx upon inhalation and through the bronchi and alveoli of the lungs.
  • respirable particles range from about 0.5 to 10 microns in size.
  • the particulate range can be from 1 to 5 microns.
  • the particulate range can be from 2 to 3 microns. Particles of non- respirable size which are included in the aerosol tend to deposit in the throat and be swallowed, and the quantity of non-respirable particles in the aerosol is thus minimized.
  • a particle size in the range of 10-500 um is preferred to ensure retention in the nasal cavity.
  • an siNA composition of the invention is administered topically to the nose for example, for the treatment of rhinitis, via pressurized aerosol formulations, aqueous formulations administered to the nose by pressurized pump or by nebulization.
  • Suitable formulations contain water as the diluent or carrier for this purpose.
  • the aqueous formulations for administration of the composition of the invention to the lung or nose can be provided with conventional excipients such as buffering agents, tonicity modifying agents and the like.
  • siNA molecules of the invention can be formulated and delivered as particles and/or aerosols as discussed above and dispensed from various aerosolization devices known by those of skill in the art.
  • Aerosols of liquid or non-liquid particles comprising an siNA molecule or formulation of the invention can be produced by any suitable means, such as with a device comprising a nebulizer (see for example U.S. Pat. 4,501,729) such as ultrasonic or air jet nebulizers.
  • a nebulizer see for example U.S. Pat. 4,501,729
  • ultrasonic or air jet nebulizers such as ultrasonic or air jet nebulizers.
  • Solid particle aerosols comprising an siNA molecule or formulation of the invention and surfactant can be produced with any solid particulate aerosol generator.
  • One type of solid particle aerosol generator used with the siNA molecules of the invention is an insufflator.
  • a second type of illustrative aerosol generator comprises a metered dose inhaler ("MDI"). MDIs containing siNA molecules or formulations taught herein can be prepared by methods of the art (for example, see Byron, above and WO96/32099).
  • siNA molecules can also be formulated as a fluid formulation for delivery from a fluid dispenser, such as those described and illustrated in WO05/044354.
  • nebulizer devices are used in applications for conscious, spontaneously breathing subjects, and for controlled ventilated subjects of all ages.
  • the nebulizer devices can be used for targeted topical and systemic drug delivery to the lung.
  • a device comprising a nebulizer is used to deliver an siNA molecule or formulation of the invention locally to lung or pulmonary tissues.
  • a device comprising a nebulizer is used to deliver a an siNA molecule or formulation of the invention systemically.
  • siNA molecules of the invention can also be used for diagnostic applications, research applications, and/or manufacture of medicants.
  • the invention features a method for diagnosing a disease, trait, or condition in a subject comprising administering to the subject a composition of the invention under conditions suitable for the diagnosis of the disease, trait, or condition in the subject.
  • siNA molecules of the invention are used to down regulate or inhibit the expression of HBV proteins arising from haplotype polymorphisms that are associated with a trait, disease or condition in a subject or organism.
  • Analysis of HBV genes, or HBV protein or RNA levels can be used to identify subjects with such polymorphisms or those subjects who are at risk of developing traits, conditions, or diseases described herein. These subjects are amenable to treatment, for example, treatment with siNA molecules of the invention and any other composition useful in treating diseases related to target gene expression.
  • analysis of HBV protein or RNA levels can be used to determine treatment type and the course of therapy in treating a subject.
  • HBV protein e.g., hepatitis B core antigen, or HbcAg
  • HBV surface antigen e.g., HBsAg
  • RNA levels can be used to predict treatment outcome and to determine the efficacy of compounds and compositions that modulate the level and/or activity of certain HBV proteins associated with a trait, disorder, condition, or disease.
  • the invention comprises use of a double-stranded nucleic acid according to the invention for use in the manufacture of a medicament.
  • the medicament is for use in treating HBV infection or a condition that is mediated by the action of HBV.
  • the medicant is for use in treating HBV infection.
  • the medicament is for use in the treatment of cancer.
  • the compounds of the instant invention are useful for treating hepatocellular carcinoma.
  • the medicament is for use in the treatment of liver disease.
  • the compounds of the instant invention are useful for treating cirrhosis of the liver.
  • SEQ ID NO: 1 SEQ ID NO: 452, SEQ ID NO: 2, SEQ ID NO: 453, SEQ ID NO: 3, SEQ ID NO: 454, SEQ ID NO: 4, or SEQ ID NO:455; or formula (A)
  • HBV sequences were designed and selected by selecting all possible 19 nucleotide sequences from HBV genome serotype adw2 (Accession Number X02763) and then comparing these sequences to the genome sequences of 22 other HBV subtypes shown in Table 7. 19 nucleotide sequences having perfect matches to all 22 genomes, or perfect matches in 21 of the 22 genomes and 1 or 2 mismatches to the remaining genome, were retained. These sequences were subjected to standard filters (e.g., off-target to human genome, runs of same base, matches to human miRNA seed sequences) (See also U.S. Application No. 60/182,605 for sequence design methods and standard filters). The remaining candidates were sorted by a proprietary silencing prediction score and certain sequences were selected.
  • standard filters e.g., off-target to human genome, runs of same base, matches to human miRNA seed sequences
  • the primary criteria for design for the HBV sequences for human siNAs were (i) homology between multiple HBV genotypes and serotypes and (ii) high efficacy scores as determined by a proprietary algorithm.
  • the target sequences of the siNAs that were selected are set forth in Table la (target sequences).
  • the sense and antisense strands of the siNA sequences corresponding to the target sequences in Table la are set forth in Table lb.
  • Various chemically modified siNAs that were synthesized are set forth in Table lc.
  • Table la HBV Target Sequences, noting target sites.
  • the two individual, complementary strands of the siNA were synthesized separately using solid phase synthesis, then purified separately by reversed phase solid phase extraction (SPE).
  • SPE reversed phase solid phase extraction
  • the complementary strands were annealed to form the double strand (duplex) and delivered in the desired concentration and buffer of choice.
  • the single strand oligonucleotides were synthesized using phosphoramidite chemistry on an automated solid-phase synthesizer, using procedures as are generally known in the art (see for example U.S. Application No. 12/064,014).
  • a synthesis column was packed with solid support derivatized with the first nucleoside residue (natural or chemically modified). Synthesis was initiated by detritylation of the acid labile 5'-0-dimethoxytrityl group to release the 5'-hydroxyl.
  • a suitably protected phosphoramidite and a suitable activator in acetonitrile were delivered simultaneously to the synthesis column resulting in coupling of the amidite to the 5'-hydroxyl.
  • the column was then washed with a solvent, such as acetonitrile.
  • An oxidizing solution such as an iodine solution was pumped through the column to oxidize the phosphite triester linkage P(III) to its phosphotriester P(V) analog.
  • Unreacted 5'-hydroxyl groups were capped using reagents such as acetic anhydride in the presence of 2,6-lutidine and N- methylimidazole.
  • the elongation cycle was resumed with the detritylation step for the next phosphoramidite incorporation. This process was repeated until the desired sequence was synthesized.
  • the synthesis concluded with the final 5 '-terminus protecting group (trityl or 5'-0- dimethoxytrity 1) .
  • the trityl-on solution of each crude single strand was purified using chromatographic purification, such as SPE RPC purification.
  • the hydrophobic nature of the trityl group permits stronger retention of the desired full-length oligo than the non-tritylated truncated failure sequences.
  • the failure sequences were selectively washed from the resin with a suitable solvent, such as low percent acetonitrile. Retained oligonucleotides were then detritylated on-column with trifluoroacetic acid to remove the acid-labile trityl group. Residual acid was washed from the column, a salt exchange was performed, and a final desalting of the material commenced .
  • the full-length oligo was recovered in a purified form with an aqueous-organic solvent. The final product was then analyzed for purity (HPLC), identity (Maldi-TOF MS), and yield (UV A 2 6o)- The oligos were dried via lyophilization or vacuum condensation.
  • Annealing Based on the analysis of the product, the dried oligos were dissolved in appropriate buffers followed by mixing equal molar amounts (calculated using the theoretical extinction coefficient) of the sense and antisense oligonucleotide strands. The solution was then analyzed for purity of duplex by chromatographic methods and desired final concentration. If the analysis indicated an excess of either strand, then the additional non-excess strand was titrated until duplexing was complete. When analysis indicated that the target product purity has been achieved the material was delivered and ready for use.
  • Table lc HBV siNA Strands Synthesized (Antisense sequences are readily identified as having com lete or artial com lementarit to the tar et se uence shown .
  • R-008351240-000Y 1820 20 UCCUGCUGCUAUGCCUCAU B UCCUGCUGCUAUGCCUCAU7TB 100
  • R-008351240-000Y 1820 20 UCCUGCUGCUAUGCCUCAU AUGAGGCAUAGCAGCAGGAUU 101
  • R-008351223-000P 456 34 GAGUGUGGAUUCGCACUCC GGAGUGCGAAUCCACACUCUU 135
  • R-008351235-000Z 53 30 CAAGCCUCCAAGCUGUGCC B CAAGCCUCCAAGCUGUGCC7T B 140
  • R-008351235-000Z 53 30 CAAGCCUCCAAGCUGUGCC GGCACAGCUUGGAGGCUUGUU 141
  • R-008351294-000V 1820 20 UCCUGCUGCUAUGCCUCAU AUGAGGcAuAGcAGcAGGAUU 173
  • R-008351315-000Z 54 26 AAGCCUCCAAGCUGUGCCU AGGCACAGCUUGGAGGCUUUU 179
  • R-008351320-000Y 566 27 AGAAGAACUCCCUCGCCUC B AGAAGAAcacccacGccucTT B 180
  • R-008351320-000Y 566 27 AGAAGAACUCCCUCGCCUC GAGGcGAGGGAGuucuucuUU 181
  • R-008351345-000B 1654 37 AGUCUAGACUCGUGGUGGA B AGUCUAGACUCGUGGUGGA7TB 190
  • R-008351345-000B 1654 37 AGUCUAGACUCGUGGUGGA UCCACCACGAGUCUAGACUUU 191
  • R-008351383-000D 456 34 GAGUGUGGAUUCGCACUCC B GAGuGuGGAxmcGcAcuccTT B 208
  • R-008351401-000G 565 33 AAGAAGAACUCCCUCGCCU AGGCGAGGGAGUUCUUCUUUU 217
  • R-008380308-000F 2670 4 CCGAUCCAUACUGCGGAAC GuuccGcAGuAuGGAucGGUsU 223
  • R-008380316-000F 2669 3 GCCGAUCCAUACUGCGGAA UUCCgCagUaUggaUCggCUsU 227
  • R-008380353-000Z 2669 3 GCCGAUCCAUACUGCGGAA UUCCgCagUaUggaUCggCUsU 227
  • R-008380383-000B 2670 4 CCGAUCCAUACUGCGGAAC GUUCCgCagUaUggaUCggUsU 255
  • R-008380401-000E 2669 3 GCCGAUCCAUACUGCGGAA UUCCGCAGUAUGGAUCGGCUsU 267
  • R-008380468-000V 2669 3 GCCGAUCCAUACUGCGGAA B GCCGAuCCAUaCuGCgGaaUsU B 291
  • R-008380504-000R 2670 4 CCGAUCCAUACUGCGGAAC B CCGaZ7CC4£/ACUGCgg ⁇ L4CUsU B 315
  • R-008380507-000S 2669 3 GCCGAUCCAUACUGCGGAA B GCQgaUCCAUACUgCGGaa ⁇ s ⁇ B 316 -008380507-000S 2669 3 GCCGAUCCAUACUGCGGAA UUCCgcAGUaUggauCGGcUsU 317
  • R-008380525-000J 2669 3 GCCGAUCCAUACUGCGGAA B GccgaC/CCaC/ACUGCgG 4UsU B 329
  • R-008380579-000F 1663 1 UCGUGGUGGACUUCUCUCA B C/CGC/GgUggAC3 ⁇ 4JCUCC/C4UsU B 364
  • R-008380588-000P 2670 4 CCGAUCCAUACUGCGGAAC B CCgAC/cCAiL4CUGCgG ⁇ L4CUsU B 371
  • R-008380615-000B 2670 4 CCGAUCCAUACUGCGGAAC B CCgaC/CCaC/aCC/gCggaaCUsU B 389

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Optics & Photonics (AREA)
  • Nanotechnology (AREA)
  • Inorganic Chemistry (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
PCT/US2011/047512 2010-08-17 2011-08-12 RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) Ceased WO2012024170A2 (en)

Priority Applications (23)

Application Number Priority Date Filing Date Title
JP2013524886A JP2013537423A (ja) 2010-08-17 2011-08-12 低分子干渉核酸(siNA)を用いたB型肝炎ウイルス(HBV)遺伝子発現のRNA干渉媒介性阻害
CA2807307A CA2807307C (en) 2010-08-17 2011-08-12 Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)
SI201131753T SI2606134T1 (sl) 2010-08-17 2011-08-12 RNA-INTERFERENČNO POSREDOVANO ZAVIRANJE IZRAŽANJA GENA VIRUSA HEPATITISA B (HBV) Z UPORABO KRATKE INTERFERENČNE NUKLEINSKE KISLINE (siNA)
KR1020207002596A KR102413007B1 (ko) 2010-08-17 2011-08-12 짧은 간섭 핵산 (siNA)을 사용한 B형 간염 바이러스 (HBV) 유전자 발현의 RNA 간섭 매개 억제
KR1020137006656A KR102072631B1 (ko) 2010-08-17 2011-08-12 짧은 간섭 핵산 (siNA)을 사용한 B형 간염 바이러스 (HBV) 유전자 발현의 RNA 간섭 매개 억제
HRP20191232 HRP20191232T1 (hr) 2010-08-17 2011-08-12 Inhibicija, posredovana rna interferencijom, ekspresije gena virusa hepatitisa b (hbv) korištenjem kratkih interferirajućih nukleinskih kiselina (sina)
EP19168062.8A EP3587574B1 (en) 2010-08-17 2011-08-12 Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)
RU2013111850A RU2624045C2 (ru) 2010-08-17 2011-08-12 ОПОСРЕДУЕМОЕ РНК-ИНТЕРФЕРЕНЦИЕЙ ИНГИБИРОВАНИЕ ЭКСПРЕССИИ ГЕНОВ ВИРУСА ГЕПАТИТА B (HBV) С ПРИМЕНЕНИЕМ МАЛОЙ ИНТЕРФЕРИРУЮЩЕЙ НУКЛЕИНОВОЙ КИСЛОТЫ (миНК)
EP22160316.0A EP4079856A1 (en) 2010-08-17 2011-08-12 Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)
DK11818592.5T DK2606134T3 (da) 2010-08-17 2011-08-12 RNA-Interferens-formidlet inhibering af hepatitis-B-virus (HBV)-genekspression ved hjælp af kort interfererende nukleinsyre (siNA)
AU2011292261A AU2011292261B2 (en) 2010-08-17 2011-08-12 RNA interference mediated inhibition of Hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)
CN201180050143.8A CN103282497B (zh) 2010-08-17 2011-08-12 使用短干扰核酸(siNA)的乙型肝炎病毒(HBV)基因表达的RNA干扰介导的抑制
US13/817,152 US9029341B2 (en) 2010-08-17 2011-08-12 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)
CN201810593037.8A CN108676800B (zh) 2010-08-17 2011-08-12 使用短干扰核酸(siNA)的乙型肝炎病毒(HBV)基因表达的RNA干扰介导的抑制
EP11818592.5A EP2606134B1 (en) 2010-08-17 2011-08-12 RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
LTEP11818592.5T LT2606134T (lt) 2010-08-17 2011-08-12 Hepatito b viruso (hbv) geno raiškos slopinimas, tarpininkaujant rnr interferencijai naudojant mažą interferuojančią nukleorūgštį (sina)
US14/682,618 US9464290B2 (en) 2010-08-17 2015-04-09 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)
AU2015210336A AU2015210336B2 (en) 2010-08-17 2015-08-04 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)
US15/251,155 US9879262B2 (en) 2010-08-17 2016-08-30 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)
AU2017216560A AU2017216560A1 (en) 2010-08-17 2017-08-18 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)
US15/844,793 US10407682B2 (en) 2010-08-17 2017-12-18 RNA interference mediated inhibition of hepatitis B Virus (HBV) gene expression using short interfering nucleic acid (siNA)
US16/532,245 US10793860B2 (en) 2010-08-17 2019-08-05 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (SINA)
AU2019264591A AU2019264591B2 (en) 2010-08-17 2019-11-13 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US37455510P 2010-08-17 2010-08-17
US61/374,555 2010-08-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/817,152 A-371-Of-International US9029341B2 (en) 2010-08-17 2011-08-12 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)
US14/682,618 Continuation US9464290B2 (en) 2010-08-17 2015-04-09 RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)

Publications (2)

Publication Number Publication Date
WO2012024170A2 true WO2012024170A2 (en) 2012-02-23
WO2012024170A3 WO2012024170A3 (en) 2012-05-18

Family

ID=45605615

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/047512 Ceased WO2012024170A2 (en) 2010-08-17 2011-08-12 RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)

Country Status (14)

Country Link
US (5) US9029341B2 (enExample)
EP (3) EP3587574B1 (enExample)
JP (5) JP2013537423A (enExample)
KR (2) KR102413007B1 (enExample)
CN (2) CN108676800B (enExample)
AU (1) AU2011292261B2 (enExample)
CA (1) CA2807307C (enExample)
DK (1) DK2606134T3 (enExample)
HR (1) HRP20191232T1 (enExample)
HU (1) HUE044815T2 (enExample)
LT (1) LT2606134T (enExample)
RU (2) RU2624045C2 (enExample)
SI (1) SI2606134T1 (enExample)
WO (1) WO2012024170A2 (enExample)

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9034841B2 (en) 2011-04-21 2015-05-19 Isis Pharmaceuticals, Inc. Modulation of hepatitis B virus (HBV) expression
WO2016077321A1 (en) * 2014-11-10 2016-05-19 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
EP3144015A3 (en) * 2010-09-20 2017-04-19 Sirna Therapeutics, Inc. Novel low molecular weight cationic lipids for oligonucleotide delivery
WO2017157899A1 (en) 2016-03-14 2017-09-21 F. Hoffmann-La Roche Ag Oligonucleotides for reduction of pd-l1 expression
JP2017169568A (ja) * 2011-06-30 2017-09-28 アローヘッド ファーマシューティカルズ インコーポレイテッド B型肝炎ウイルスの遺伝子発現を阻害するための組成物および方法
EP2512491B1 (en) 2009-10-16 2017-10-11 Glaxo Group Limited Hbv antisense inhibitors
WO2017216391A1 (en) 2016-06-17 2017-12-21 F. Hoffmann-La Roche Ag Papd5 and papd7 inhibitors for treating a hepatitis b infection
WO2018106980A1 (en) * 2016-12-08 2018-06-14 Mallinckrodt Llc Liposomal elinafide formulations and uses thereof
WO2018195165A1 (en) 2017-04-18 2018-10-25 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (hbv) infection
EP3292202A4 (en) * 2015-05-06 2019-04-10 Benitec Biopharma Limited REAGENTS FOR THE TREATMENT OF HEPATITIS B VIRUS INFECTION AND USE THEREOF
WO2019076842A1 (en) 2017-10-16 2019-04-25 F. Hoffmann-La Roche Ag NUCLEIC ACID MOLECULE FOR THE REDUCTION OF PAPD5 AND PAPD7 MRNA FOR THE TREATMENT OF HEPATITIS B INFECTION
EP3395363A4 (en) * 2015-11-09 2019-08-28 IDAC Theranostics, Inc. ANTIVIRAL MEDICINAL PRODUCT
US10415037B2 (en) * 2014-10-02 2019-09-17 Arbutus Biopharma Corporation Compositions and methods for silencing hepatitis B virus gene expression
US10421967B2 (en) 2014-05-15 2019-09-24 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
WO2019193165A1 (en) 2018-04-05 2019-10-10 F. Hoffmann-La Roche Ag Use of fubp1 inhibitors for treating hepatitis b virus infection
WO2020011902A1 (en) 2018-07-13 2020-01-16 F. Hoffmann-La Roche Ag Oligonucleotides for modulating rtel1 expression
WO2020038377A1 (zh) * 2018-08-21 2020-02-27 苏州瑞博生物技术有限公司 一种核酸、含有该核酸的药物组合物和缀合物及其用途
US10961535B2 (en) 2015-07-17 2021-03-30 Arcturus Therapeutics, Inc. Compositions and agents against hepatitis B virus and uses thereof
WO2021122993A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of saraf inhibitors for treating hepatitis b virus infection
WO2021122869A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of scamp3 inhibitors for treating hepatitis b virus infection
WO2021122735A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of sept9 inhibitors for treating hepatitis b virus infection
WO2021122921A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of cops3 inhibitors for treating hepatitis b virus infection
WO2021122910A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of sbds inhibitors for treating hepatitis b virus infection
CN113038955A (zh) * 2018-11-16 2021-06-25 公益财团法人东京都医学总合研究所 用于抑制乙型肝炎病毒复制的组合物
EP3718572A4 (en) * 2017-12-01 2021-09-08 Suzhou Ribo Life Science Co., Ltd. NUCLEIC ACID, COMPOSITION AND CONJUGATE WITH NUCLEIC ACID, METHOD FOR PRODUCING IT AND USING IT
EA039127B1 (ru) * 2015-03-24 2021-12-08 Элнилэм Фармасьютикалз, Инк. КОМПОЗИЦИИ НА ОСНОВЕ iRNA ПРОТИВ ВИРУСА ГЕПАТИТА В (HBV) И СПОСОБЫ ИХ ПРИМЕНЕНИЯ
WO2022038211A2 (en) 2020-08-21 2022-02-24 F. Hoffmann-La Roche Ag Use of a1cf inhibitors for treating hepatitis b virus infection
US11279929B2 (en) 2018-07-03 2022-03-22 Hoffmann-La Roche, Inc. Oligonucleotides for modulating Tau expression
US11324820B2 (en) 2017-04-18 2022-05-10 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (HBV) infection
WO2022167456A1 (en) 2021-02-02 2022-08-11 F. Hoffmann-La Roche Ag Enhanced oligonucleotides for inhibiting rtel1 expression
US11414661B2 (en) 2017-12-01 2022-08-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
US11492623B2 (en) 2018-08-13 2022-11-08 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) dsRNA agent compositions and methods of use thereof
US11492620B2 (en) 2017-12-01 2022-11-08 Suzhou Ribo Life Science Co., Ltd. Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method thereof and use thereof
US11517584B2 (en) 2016-08-04 2022-12-06 Arrowhead Pharmaceuticals, Inc. RNAi agents for Hepatitis B virus infection
US11534453B2 (en) 2015-08-07 2022-12-27 Arrowhead Pharmaceuticals, Inc. RNAi therapy for hepatitis B virus infection
US11633482B2 (en) 2017-12-29 2023-04-25 Suzhou Ribo Life Science Co., Ltd. Conjugates and preparation and use thereof
US11660347B2 (en) 2017-12-01 2023-05-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing same, preparation method, and use thereof
WO2023111210A1 (en) 2021-12-17 2023-06-22 F. Hoffmann-La Roche Ag Combination of oligonucleotides for modulating rtel1 and fubp1
US11685921B2 (en) 2015-07-17 2023-06-27 Arcturus Therapeutics, Inc. Molecules and agents for treating hepatitis B virus
US11896674B2 (en) 2018-09-30 2024-02-13 Suzhou Ribo Life Science Co., Ltd. SiRNA conjugate, preparation method therefor and use thereof
US12083142B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US12497622B2 (en) 2019-05-22 2025-12-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8575327B2 (en) 2003-06-12 2013-11-05 Alnylam Pharmaceuticals, Inc. Conserved HBV and HCV sequences useful for gene silencing
EP3587574B1 (en) 2010-08-17 2022-03-16 Sirna Therapeutics, Inc. Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)
CA2928568A1 (en) 2013-07-26 2015-01-29 Update Pharma Inc. Combinatorial methods to improve the therapeutic benefit of bisantrene
US10821175B2 (en) * 2014-02-25 2020-11-03 Merck Sharp & Dohme Corp. Lipid nanoparticle vaccine adjuvants and antigen delivery systems
SG10202007937SA (en) * 2015-09-02 2020-09-29 Alnylam Pharmaceuticals Inc PROGRAMMED CELL DEATH 1 LIGAND 1 (PD-L1) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
KR20180120675A (ko) * 2016-01-08 2018-11-06 아뷰터스 바이오파마 코포레이션 B형 간염을 치료하기 위한 치료 조성물 및 방법
JPWO2018199338A1 (ja) * 2017-04-27 2020-03-12 国立大学法人広島大学 B型肝炎治療用核酸分子
SG11202003488WA (en) 2017-10-20 2020-05-28 Dicerna Pharmaceuticals Inc Methods for treating hepatitis b infection
WO2019240503A1 (ko) * 2018-06-12 2019-12-19 주식회사 에이엠사이언스 B형 간염 예방 또는 치료용 조성물
WO2019240504A1 (en) * 2018-06-12 2019-12-19 Am Sciences Co., Ltd. Modified oligonucleotides for inhibition of target gene expression
WO2021232052A1 (en) * 2020-05-11 2021-11-18 Texas Biomedical Research Institute Microencapsulated delivery system for release of anti-inflammatory agents into the lung
EP4265724A4 (en) * 2020-12-18 2025-11-19 Olix Pharmaceuticals Inc ARNI AGENT TO INHIBIT THE EXPRESSION AND USE OF HBV
IL315396A (en) * 2022-03-08 2024-11-01 Mastery Biotech Co Ltd Pharmaceutical composition including retinoic acid and carbohydrate and use thereof
WO2025240243A1 (en) * 2024-05-13 2025-11-20 Gilead Sciences, Inc. Combination therapies with bulevirtide and an inhibitory nucleic acid targeting hepatitis b virus

Citations (198)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2789118A (en) 1956-03-30 1957-04-16 American Cyanamid Co 16-alpha oxy-belta1, 4-pregnadienes
US2990401A (en) 1958-06-18 1961-06-27 American Cyanamid Co 11-substituted 16alpha, 17alpha-substituted methylenedioxy steroids
US3048581A (en) 1960-04-25 1962-08-07 Olin Mathieson Acetals and ketals of 16, 17-dihydroxy steroids
US3126375A (en) 1964-03-24 Chioacyl
US3749712A (en) 1970-09-25 1973-07-31 Sigma Tau Ind Farmaceuti Triamcinolone acetonide esters and process for their preparation
US3928326A (en) 1972-05-19 1975-12-23 Bofors Ab Process for the separation of stereoisomeric mixtures into their components and components obtained hereby
US3929768A (en) 1972-05-19 1975-12-30 Bofors Ab Steroids, processes for their manufacture and preparations containing same
US3996359A (en) 1972-05-19 1976-12-07 Ab Bofors Novel stereoisomeric component A of stereoisomeric mixtures of 2'-unsymmetrical 16,17-methylenedioxy steroid 21-acylates, compositions thereof, and method of treating therewith
US4231938A (en) 1979-06-15 1980-11-04 Merck & Co., Inc. Hypocholesteremic fermentation products and process of preparation
US4294926A (en) 1979-06-15 1981-10-13 Merck & Co., Inc. Hypocholesteremic fermentation products and process of preparation
US4319039A (en) 1979-06-15 1982-03-09 Merck & Co., Inc. Preparation of ammonium salt of hypocholesteremic fermentation product
US4346227A (en) 1980-06-06 1982-08-24 Sankyo Company, Limited ML-236B Derivatives and their preparation
US4444784A (en) 1980-08-05 1984-04-24 Merck & Co., Inc. Antihypercholesterolemic compounds
US4537859A (en) 1981-11-20 1985-08-27 Sankyo Company, Limited Process for preparing 3-hydroxy-ML-236B derivatives known as M-4 and M-4'
US4681893A (en) 1986-05-30 1987-07-21 Warner-Lambert Company Trans-6-[2-(3- or 4-carboxamido-substituted pyrrol-1-yl)alkyl]-4-hydroxypyran-2-one inhibitors of cholesterol synthesis
US4782084A (en) 1987-06-29 1988-11-01 Merck & Co., Inc. HMG-COA reductase inhibitors
US4820850A (en) 1987-07-10 1989-04-11 Merck & Co., Inc. Process for α-C-alkylation of the 8-acyl group on mevinolin and analogs thereof
US4885314A (en) 1987-06-29 1989-12-05 Merck & Co., Inc. Novel HMG-CoA reductase inhibitors
US4911165A (en) 1983-01-12 1990-03-27 Ethicon, Inc. Pliabilized polypropylene surgical filaments
US4916239A (en) 1988-07-19 1990-04-10 Merck & Co., Inc. Process for the lactonization of mevinic acids and analogs thereof
US4929437A (en) 1989-02-02 1990-05-29 Merck & Co., Inc. Coenzyme Q10 with HMG-CoA reductase inhibitors
US5030447A (en) 1988-03-31 1991-07-09 E. R. Squibb & Sons, Inc. Pharmaceutical compositions having good stability
US5118853A (en) 1988-10-13 1992-06-02 Sandoz Ltd. Processes for the synthesis of 3-disubstituted aminoacroleins
US5134142A (en) 1989-09-22 1992-07-28 Fujisawa Pharmaceutical Co., Ltd. Pyrazole derivatives, and pharmaceutical composition comprising the same
US5180589A (en) 1988-03-31 1993-01-19 E. R. Squibb & Sons, Inc. Pravastatin pharmaceuatical compositions having good stability
US5189164A (en) 1989-05-22 1993-02-23 Sandoz Ltd. Processes for the synthesis of syn-(E)-3,5-dihydroxy-7-substituted hept-6-enoic and heptanoic acids and derivatives and intermediates thereof
US5273995A (en) 1989-07-21 1993-12-28 Warner-Lambert Company [R-(R*R*)]-2-(4-fluorophenyl)-β,δ-dihydroxy-5-(1-methylethyl-3-phenyl-4-[(phenylamino) carbonyl]- 1H-pyrrole-1-heptanoic acid, its lactone form and salts thereof
WO1994002595A1 (en) 1992-07-17 1994-02-03 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of animal diseases
US5290946A (en) 1988-10-13 1994-03-01 Sandoz Ltd. Processes for the synthesis of 3-(substituted indolyl-2-yl)propenaldehydes
EP0604181A1 (en) 1992-12-21 1994-06-29 Eli Lilly And Company Antitumor compositions and method of treatment
WO1994015932A1 (en) 1993-01-15 1994-07-21 G.D. Searle & Co. Novel 3,4-diaryl thiophenes and analogs thereof having use as antiinflammatory agents
US5342952A (en) 1993-03-03 1994-08-30 Warner-Lambert Company Process for trans-6-[2-(substituted-pyrrol-1-yl)alkyl]pyran-2-one inhibitors of cholesterol synthesis
WO1994019357A1 (en) 1993-02-23 1994-09-01 Merrell Dow Pharmaceuticals Inc. Farnesyl:protein transferase inhibitors as anticancer agents
US5344991A (en) 1993-10-29 1994-09-06 G.D. Searle & Co. 1,2 diarylcyclopentenyl compounds for the treatment of inflammation
EP0618221A2 (en) 1993-04-02 1994-10-05 Bristol-Myers Squibb Company Heterocyclic inhibitors of farnesyl protein transferase
US5354772A (en) 1982-11-22 1994-10-11 Sandoz Pharm. Corp. Indole analogs of mevalonolactone and derivatives thereof
US5356896A (en) 1991-12-12 1994-10-18 Sandoz Ltd. Stabilized pharmaceutical compositions comprising an HMG-CoA reductase inhibitor compound
US5380738A (en) 1993-05-21 1995-01-10 Monsanto Company 2-substituted oxazoles further substituted by 4-fluorophenyl and 4-methylsulfonylphenyl as antiinflammatory agents
US5393790A (en) 1994-02-10 1995-02-28 G.D. Searle & Co. Substituted spiro compounds for the treatment of inflammation
WO1995008542A1 (en) 1993-09-22 1995-03-30 Kyowa Hakko Kogyo Co., Ltd. Farnesyltransferase inhibitor
WO1995010515A1 (en) 1993-10-15 1995-04-20 Schering Corporation Tricyclic carbamate compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1995010516A1 (en) 1993-10-15 1995-04-20 Schering Corporation Tricyclic amide and urea compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1995010514A1 (en) 1993-10-15 1995-04-20 Schering Corporation Tricyclic sulfonamide compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
US5409944A (en) 1993-03-12 1995-04-25 Merck Frosst Canada, Inc. Alkanesulfonamido-1-indanone derivatives as inhibitors of cyclooxygenase
WO1995011917A1 (en) 1993-10-25 1995-05-04 Parke, Davis & Company Substituted tetra- and pentapeptide inhibitors of protein:farnesyl transferase
WO1995012612A1 (en) 1993-11-05 1995-05-11 Warner-Lambert Company Substituted di- and tripeptide inhibitors of protein:farnesyl transferase
WO1995012572A1 (en) 1993-11-04 1995-05-11 Abbott Laboratories Cyclobutane derivatives as inhibitors of squalene synthetase and protein farnesyltransferase
US5420245A (en) 1990-04-18 1995-05-30 Board Of Regents, The University Of Texas Tetrapeptide-based inhibitors of farnesyl transferase
US5436265A (en) 1993-11-12 1995-07-25 Merck Frosst Canada, Inc. 1-aroyl-3-indolyl alkanoic acids and derivatives thereof useful as anti-inflammatory agents
WO1995024612A1 (de) 1994-03-07 1995-09-14 International Business Machines Corporation Verfahren und vorrichtung zur schnellen interpolation von zwischenwerten aus periodischen phasenverschobenen signalen und zur erkennung von defekten in einem drehkörper
WO1995025086A1 (en) 1994-03-15 1995-09-21 Eisai Co., Ltd. Isoprenyl transferase inhibitors
EP0675112A1 (en) 1994-03-31 1995-10-04 Bristol-Myers Squibb Company Imidazole-containing inhibitors of farnesyl protein transferase
US5466823A (en) 1993-11-30 1995-11-14 G.D. Searle & Co. Substituted pyrazolyl benzenesulfonamides
WO1995032987A1 (en) 1994-05-31 1995-12-07 Isis Pharmaceuticals, Inc. ANTISENSE OLIGONUCLEOTIDE MODULATION OF raf GENE EXPRESSION
US5474995A (en) 1993-06-24 1995-12-12 Merck Frosst Canada, Inc. Phenyl heterocycles as cox-2 inhibitors
WO1995034535A1 (fr) 1994-06-10 1995-12-21 Rhone-Poulenc Rorer S.A. Nouveaux inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1996000736A1 (en) 1994-06-30 1996-01-11 Warner-Lambert Company Histidine and homohistidine derivatives as inhibitors of protein farnesyltransferase
EP0696593A2 (en) 1994-08-11 1996-02-14 Bristol-Myers Squibb Company Inhibitors of farnesyl protein transferase
WO1996005529A1 (en) 1994-08-09 1996-02-22 Micron Optics, Inc. Temperature compensated fiber fabry-perot filters
WO1996005169A1 (en) 1994-08-12 1996-02-22 Banyu Pharmaceutical Co., Ltd. N,n-disubstituted amic acid derivative
WO1996005168A1 (en) 1994-08-11 1996-02-22 Banyu Pharmaceutical Co., Ltd. Substituted amide derivative
WO1996006138A1 (de) 1994-08-19 1996-02-29 Skw Trostberg Aktiengesellschaft Verfahren zur extraktion natürlicher carotinoid-farbstoffe
WO1996006193A1 (de) 1994-08-20 1996-02-29 Anton More Konverter und verfahren zum frischen von metallschmelzen im gegenstrom, insbesondere von roheisen zu stahl
US5510510A (en) 1994-05-10 1996-04-23 Bristol-Meyers Squibb Company Inhibitors of farnesyl protein transferase
WO1996016443A1 (en) 1994-11-22 1996-05-30 Philips Electronics N.V. Semiconductor device with a carrier body on which a substrate with a semiconductor element is fastened by means of a glue layer and on which a pattern of conductor tracks is fastened
US5523430A (en) 1994-04-14 1996-06-04 Bristol-Myers Squibb Company Protein farnesyl transferase inhibitors
WO1996017861A1 (en) 1994-12-09 1996-06-13 Warner-Lambert Company Substituted tetra- and pentapeptide inhibitors of protein:farnesyl transferase
US5532359A (en) 1993-05-14 1996-07-02 Genentech, Inc. Ras farnesyl transferase inhibitors
WO1996021701A2 (en) 1995-01-09 1996-07-18 Magla International Ltd. Wear resistant image printing on latex surfaces
WO1996021456A1 (en) 1995-01-12 1996-07-18 University Of Pittsburgh Inhibitors of prenyl transferases
WO1996022278A1 (fr) 1995-01-18 1996-07-25 Rhone-Poulenc Rorer S.A. Nouveaux inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1996024611A1 (fr) 1995-02-09 1996-08-15 Rhone-Poulenc Rorer S.A. Inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1996024612A1 (fr) 1995-02-09 1996-08-15 Rhone-Poulenc Rorer S.A. Inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1996030363A1 (en) 1995-03-24 1996-10-03 Schering Corporation Tricyclic amide and urea compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996030018A1 (en) 1995-03-24 1996-10-03 Schering Corporation Tricyclic carbamate compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996030343A1 (en) 1995-03-29 1996-10-03 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
WO1996030362A1 (en) 1995-03-24 1996-10-03 Schering Corporation Tricyclic amide and urea compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996030017A1 (en) 1995-03-24 1996-10-03 Schering Corporation Tricyclic compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996031111A1 (en) 1995-04-07 1996-10-10 Schering Corporation Tricyclic compounds useful in the treatment of cell proliferative disorders
WO1996031501A1 (en) 1995-04-07 1996-10-10 Schering Corporation Carbonyl-piperazinyl and piperidinil compounds which inhibit farnesyl protein transferase
WO1996031478A1 (en) 1995-04-07 1996-10-10 Schering Corporation Tricyclic compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996031477A1 (en) 1995-04-07 1996-10-10 Schering Corporation Tricyclic compounds useful for inhibition of farnesyl protein transferase
WO1996033159A1 (en) 1995-04-21 1996-10-24 Abbott Laboratories Cyclobutane derivatives as inhibitors of squalene synthase and protein farnesyltransferase
WO1996034851A1 (en) 1995-05-03 1996-11-07 Abbott Laboratories Benzene, pyridine, naphtalene or benzophenone derivatives as inhibitors of squalene synthetase and protein farnesyltransferase
WO1996034850A1 (en) 1995-05-03 1996-11-07 Abbott Laboratories Cyclobutane derivatives and their use as inhibitors of protein farnesyltransferase
US5589485A (en) 1993-12-09 1996-12-31 Abbott Laboratories Dorrigocin antitumor agents
WO1997000252A1 (en) 1995-06-16 1997-01-03 Warner-Lambert Company Tricyclic inhibitors of protein farnesyltransferase
WO1997003047A1 (fr) 1995-07-12 1997-01-30 Rhône-Poulenc Rorer S.A. Nouveaux inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1997002920A1 (de) 1995-07-11 1997-01-30 Datacon Schweitzer & Zeindl Gmbh Anlage zum automatisierten, hermetischen verschliessen von gehäusen
WO1997003050A1 (fr) 1995-07-10 1997-01-30 Rhone-Poulenc Rorer S.A. DERIVES DE 4,9-ETHANO-BANZO(f)ISOINDOLE COMME INHIBITEURS DE FARNESYL TRANSFERASE
US5602098A (en) 1993-05-18 1997-02-11 University Of Pittsburgh Inhibition of farnesyltransferase
WO1997004785A1 (en) 1995-07-28 1997-02-13 Symphar S.A. Use of phenol substituted diphosphonates as antineoplastic agents
US5604260A (en) 1992-12-11 1997-02-18 Merck Frosst Canada Inc. 5-methanesulfonamido-1-indanones as an inhibitor of cyclooxygenase-2
WO1997017070A1 (en) 1995-11-06 1997-05-15 University Of Pittsburgh Inhibitors of protein isoprenyl transferases
US5633272A (en) 1995-02-13 1997-05-27 Talley; John J. Substituted isoxazoles for the treatment of inflammation
WO1997018813A1 (en) 1995-11-22 1997-05-29 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
WO1997021701A1 (en) 1995-12-08 1997-06-19 Janssen Pharmaceutica N.V. Farnesyl protein transferase inhibiting (imidazol-5-yl)methyl-2-quinolinone derivatives
WO1997023478A1 (en) 1995-12-22 1997-07-03 Schering Corporation Tricyclic amides useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1997026246A1 (en) 1996-01-16 1997-07-24 Warner-Lambert Company Substituted histidine inhibitors of protein farnesyltransferase
WO1997030053A1 (en) 1996-02-16 1997-08-21 Biomeasure Incorporated Farnesyl transferase inhibitors
US5661152A (en) 1993-10-15 1997-08-26 Schering Corporation Tricyclic sulfonamide compounds useful for inhibition of G-protein function and for treatment of proliferative diseases
WO1997038665A2 (en) 1996-04-03 1997-10-23 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
WO1997044350A1 (en) 1996-05-22 1997-11-27 Warner-Lambert Company Inhibitors of protein farnesyl transferase
US5698584A (en) 1996-02-13 1997-12-16 Merck Frosst Canada, Inc. 3,4-diaryl-2-hydroxy-2,5-dihydrofurans as prodrugs to COX-2 inhibitors
WO1998002436A1 (en) 1996-07-15 1998-01-22 Bristol-Myers Squibb Company Thiadioxobenzodiazepine inhibitors of farnesyl protein transferase
WO1998029119A1 (en) 1996-12-30 1998-07-09 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
WO1998028980A1 (en) 1996-12-30 1998-07-09 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
US5861419A (en) 1996-07-18 1999-01-19 Merck Frosst Canad, Inc. Substituted pyridines as selective cyclooxygenase-2 inhibitors
WO1999007409A1 (fr) 1997-08-04 1999-02-18 Societe De Conseils De Recherches Et D'applications Scientifiques (S.C.R.A.S.) Produit comprenant au moins un arn double brin en association avec au moins un agent anti-viral
WO1999032619A1 (en) 1997-12-23 1999-07-01 The Carnegie Institution Of Washington Genetic inhibition by double-stranded rna
US5932598A (en) 1996-04-12 1999-08-03 G. D. Searle & Co. Prodrugs of benzenesulfonamide-containing COX-2 inhibitors
US5998203A (en) 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
WO2000001846A2 (en) 1998-07-03 2000-01-13 Devgen N.V. Characterisation of gene function using double stranded rna inhibition
US6020343A (en) 1995-10-13 2000-02-01 Merck Frosst Canada, Inc. (Methylsulfonyl)phenyl-2-(5H)-furanones as COX-2 inhibitors
WO2000044895A1 (de) 1999-01-30 2000-08-03 Roland Kreutzer Verfahren und medikament zur hemmung der expression eines vorgegebenen gens
WO2000044914A1 (en) 1999-01-28 2000-08-03 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
WO2000044777A1 (en) 1999-01-29 2000-08-03 Imclone Systems Incorporated Antibodies specific to kdr and uses thereof
WO2000050032A1 (en) 1999-02-25 2000-08-31 Pharmacia & Upjohn S.P.A. Antitumour synergistic composition
WO2000053722A2 (en) 1999-03-10 2000-09-14 Phogen Limited Delivery of nucleic acids and proteins to cells
WO2000061186A1 (en) 1999-04-08 2000-10-19 Arch Development Corporation Use of anti-vegf antibody to enhance radiation in cancer therapy
WO2001029058A1 (en) 1999-10-15 2001-04-26 University Of Massachusetts Rna interference pathway genes as tools for targeted genetic interference
WO2001030768A1 (en) 1999-10-27 2001-05-03 Cytokinetics, Inc. Methods and compositions utilizing quinazolinones
WO2001036646A1 (en) 1999-11-19 2001-05-25 Cancer Research Ventures Limited Inhibiting gene expression with dsrna
US6284781B1 (en) 1996-12-03 2001-09-04 Sloan-Kettering Institute For Cancer Research Synthesis of epothilones, intermediates thereto, analogues and uses thereof
US6288237B1 (en) 1995-11-17 2001-09-11 Gesellschaft Fur Biotechnologische Forschung Mbh (Gbf) Epothilons C and D, preparation and compositions
WO2001070677A1 (en) 2000-03-20 2001-09-27 Merck Sharp & Dohme Limited Sulphonamido-substituted bridged bicycloalkyl derivatives
WO2001090084A1 (en) 2000-05-24 2001-11-29 Merck Sharp & Dohme Limited Benzodiazepine derivatives as app modulators
WO2001098278A1 (en) 2000-06-21 2001-12-27 Cytokinetics, Inc. Methods and compositions utilizing quinazolinones
WO2002030912A1 (en) 2000-10-13 2002-04-18 Merck Sharp & Dohme Limited Benzodiazepine derivatives as inhibitors of gamma secretase
WO2002036555A1 (en) 2000-11-02 2002-05-10 Merck Sharp & Dohme Limited Sulfamides as gamma-secretase inhibitors
US6395713B1 (en) 1997-07-23 2002-05-28 Ribozyme Pharmaceuticals, Inc. Compositions for the delivery of negatively charged molecules
WO2002047671A2 (en) 2000-11-17 2002-06-20 Eli Lilly And Company Lactam compound to inhibit beta-amyloid peptide release or synthesis
US6447796B1 (en) 1994-05-16 2002-09-10 The United States Of America As Represented By The Secretary Of The Army Sustained release hydrophobic bioactive PLGA microspheres
US20020130430A1 (en) 2000-12-29 2002-09-19 Castor Trevor Percival Methods for making polymer microspheres/nanospheres and encapsulating therapeutic proteins and other products
WO2002081435A1 (en) 2001-04-05 2002-10-17 Merck Sharp & Dohme Limited Sulphones which modulate the action of gamma secretase
WO2002081433A1 (en) 2001-04-05 2002-10-17 Merck Sharp & Dohme Limited Sulphones which modulate the action of gamma secretase
WO2002083138A1 (en) 2001-04-10 2002-10-24 Merck & Co., Inc. Inhibitors of akt activity
WO2002083064A2 (en) 2001-04-10 2002-10-24 Merck & Co., Inc. A method of treating cancer
WO2002083140A1 (en) 2001-04-10 2002-10-24 Merck & Co., Inc. Inhibitors of akt activity
WO2002083139A1 (en) 2001-04-10 2002-10-24 Merck & Co., Inc. Inhibitors of akt activity
WO2003013506A1 (en) 2001-08-06 2003-02-20 Merck Sharp & Dohme Limited Sulphonamides for control of beta-amyloid production
WO2003013526A1 (en) 2001-08-08 2003-02-20 Merck & Co. Inc. Anticoagulant compounds
WO2003018543A1 (en) 2001-08-21 2003-03-06 Merck Sharp & Dohme Limited Novel cyclohexyl sulphones
WO2003046185A1 (en) 2001-11-28 2003-06-05 Genta Salus Llc Polycationic water soluble copolymer and method for transferring polyanionic macromolecules across biological barriers
WO2003047518A2 (en) 2001-11-30 2003-06-12 Genta Salus Llc Cyclodextrin grafted biocompatible amphiphilic polymer and methods of preparation and use thereof
WO2003049679A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003050064A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003049527A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003049678A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003050122A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003079973A2 (en) 2002-03-08 2003-10-02 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003084473A2 (en) 2002-04-08 2003-10-16 Merck & Co., Inc. Method of treating cancer
WO2003086279A2 (en) 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
WO2003086394A1 (en) 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
WO2003086403A1 (en) 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
WO2003086404A1 (en) 2002-04-08 2003-10-23 Merck & Co., Inc. Fused quinoxaline derivatives as inhibitors of akt activity
WO2003093264A1 (en) 2002-05-01 2003-11-13 Merck Sharp & Dohme Limited Oxadiazole derivatives for inhibition of gamma secretase
WO2003093253A1 (en) 2002-05-01 2003-11-13 Merck Sharp & Dohme Limited Alkynyl-substituted spirocyclic sulfamides for the treatment of alzheimer's disease
WO2003093252A1 (en) 2002-05-01 2003-11-13 Merck Sharp & Dohme Limited Heteroaryl substituted spirocyclic sulfamides for inhibition of gamma secretase
WO2003093251A1 (en) 2002-05-01 2003-11-13 Merck Sharp & Dohme Limited Alkenyl-substituted spirocyclic sulfamides as inhibitors of gamma-secretase
WO2003099211A2 (en) 2002-05-23 2003-12-04 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003106417A1 (en) 2002-06-14 2003-12-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003105855A1 (en) 2002-01-11 2003-12-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004012669A2 (en) 2002-08-01 2004-02-12 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory arthropathies with suppressors of cpg oligonucleotides
WO2004031137A1 (en) 2002-10-04 2004-04-15 Merck Sharp & Dohme Limited Cyclohexyl sulphone derivatives as gamma-secretase inhibitors
WO2004031138A1 (en) 2002-10-04 2004-04-15 Merck Sharp & Dohme Limited Novel sulphones for inhibition of gamma secretase
WO2004031139A1 (en) 2002-10-04 2004-04-15 Merck Sharp & Dohme Limited Cyclohexyl sulphones as gamma-secretase inhibitors
WO2004037171A2 (en) 2002-10-18 2004-05-06 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004039774A2 (en) 2002-05-23 2004-05-13 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004039800A1 (en) 2002-11-01 2004-05-13 Merck Sharp & Dohme Limited Cyclic sulfamides for inhibition of gamma-secretase
WO2004039370A1 (en) 2002-11-01 2004-05-13 Merck Sharp & Dohme Limited Sulfonamides, sulfamates and sulfamides as gamma-secretase inhibitors
WO2004041162A2 (en) 2002-10-30 2004-05-21 Merck & Co., Inc. Inhibitors of akt activity
US20040102360A1 (en) 2002-10-30 2004-05-27 Barnett Stanley F. Combination therapy
US20040116432A1 (en) 2001-04-10 2004-06-17 Carling William Robert Inhibitors of akt activity
WO2004058148A2 (en) 2002-12-20 2004-07-15 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004058700A2 (en) 2002-12-20 2004-07-15 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004089911A1 (en) 2003-04-10 2004-10-21 Merck Sharp & Dohme Limited Pyrazole derivatives as gamma-secretase inhibitors useful in the treatment of alzheimer’s disease
WO2004096131A2 (en) 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
WO2004096129A2 (en) 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
WO2004096130A2 (en) 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
WO2004096135A2 (en) 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
WO2004101539A1 (en) 2003-05-16 2004-11-25 Merck Sharp & Dohme Limited Cyclic sulfonamides for inhibition of gamma-secretase
WO2005014553A1 (en) 2003-08-05 2005-02-17 Merck Sharp & Dohme Limited Novel gamma-secretase inhibitors
WO2005017190A2 (en) 2003-08-15 2005-02-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005019205A1 (en) 2003-08-15 2005-03-03 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005018547A2 (en) 2003-08-15 2005-03-03 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005019206A1 (en) 2003-08-15 2005-03-03 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005018638A1 (en) 2003-08-13 2005-03-03 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005030731A1 (en) 2003-09-24 2005-04-07 Merck Sharp & Dohme Limited Gamma-secretase inhibitors
US20050176776A1 (en) 2004-02-06 2005-08-11 Coleman Paul J. Mitotic kinesin inhibitors
WO2005100356A1 (en) 2004-04-09 2005-10-27 Merck & Co., Inc. Inhibitors of akt activity
WO2005100344A1 (en) 2004-04-09 2005-10-27 Merck & Co., Inc. Inhibitors of akt activity
WO2009127060A1 (en) 2008-04-15 2009-10-22 Protiva Biotherapeutics, Inc. Novel lipid formulations for nucleic acid delivery
WO2010042877A1 (en) 2008-10-09 2010-04-15 Tekmira Pharmaceuticals Corporation Improved amino lipids and methods for the delivery of nucleic acids
WO2010048536A2 (en) 2008-10-23 2010-04-29 Alnylam Pharmaceuticals, Inc. Processes for preparing lipids
WO2010054401A1 (en) 2008-11-10 2010-05-14 Alnylam Pharmaceuticals, Inc. Novel lipids and compositions for the delivery of therapeutics
WO2010088537A2 (en) 2009-01-29 2010-08-05 Alnylam Pharmaceuticals, Inc. Improved lipid formulation
WO2010144740A1 (en) 2009-06-10 2010-12-16 Alnylam Pharmaceuticals, Inc. Improved lipid formulation

Family Cites Families (251)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4501729A (en) 1982-12-13 1985-02-26 Research Corporation Aerosolized amiloride treatment of retained pulmonary secretions
EP0360390A1 (en) 1988-07-25 1990-03-28 Glaxo Group Limited Spirolactam derivatives
MX18467A (es) 1988-11-23 1993-07-01 Pfizer Agentes terapeuticos de quinuclidinas
US5164372A (en) 1989-04-28 1992-11-17 Fujisawa Pharmaceutical Company, Ltd. Peptide compounds having substance p antagonism, processes for preparation thereof and pharmaceutical composition comprising the same
US5286634A (en) 1989-09-28 1994-02-15 Stadler Joan K Synergistic method for host cell transformation
FI97540C (fi) 1989-11-06 1997-01-10 Sanofi Sa Menetelmä terapeuttisesti käyttökelpoisten, aromaattisesti substituoitujen piperidiini- ja piperatsiinijohdannaisten valmistamiseksi
FR2654725B1 (fr) 1989-11-23 1992-02-14 Rhone Poulenc Sante Nouveaux derives de l'isoindolone, leur preparation et les compositions pharmaceutiques qui les contiennent.
FR2654726B1 (fr) 1989-11-23 1992-02-14 Rhone Poulenc Sante Nouveaux derives de l'isoindolone et leur preparation.
GB8929070D0 (en) 1989-12-22 1990-02-28 Fujisawa Pharmaceutical Co Peptide compounds,processes for preparation thereof and pharmaceutical composition comprising the same
US5232929A (en) 1990-11-28 1993-08-03 Pfizer Inc. 3-aminopiperidine derivatives and related nitrogen containing heterocycles and pharmaceutical compositions and use
WO1991009844A1 (en) 1990-01-04 1991-07-11 Pfizer Inc. Substance p antagonists
US6153737A (en) 1990-01-11 2000-11-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
EP0515681A4 (en) 1990-02-15 1993-12-29 Fujisawa Pharmaceutical Co., Ltd. Peptide compound
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5451586A (en) 1990-06-01 1995-09-19 Pfizer Inc. 3-amino-2-aryl quinuclidines
US5422354A (en) 1990-07-23 1995-06-06 Pfizer Inc Quinuclidine derivatives
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
ES2071334T3 (es) 1990-09-28 1995-06-16 Pfizer Analogos de anillos fusionados de nitrogeno conteniendo heterociclos no aromaticos.
GB9023116D0 (en) 1990-10-24 1990-12-05 Fujisawa Pharmaceutical Co Peptide compounds,processes for preparation thereof and pharmaceutical composition comprising the same
DK0498069T3 (da) 1990-12-21 1995-12-04 Fujisawa Pharmaceutical Co Ny anvendelse af peptidderivat
FI933167A7 (fi) 1991-01-10 1993-07-09 Pfizer N-alkyylikinuklidiniumsuolat aineen P antagonisteina
EP0499313B1 (en) 1991-02-11 1997-06-11 MERCK SHARP & DOHME LTD. Azabicyclic compounds, pharmaceutical compositions containing them and their use in therapy
DE69200921T2 (de) 1991-03-01 1995-05-04 Pfizer 1-azabicyclo[3.2.2]nonan-3-aminderivate.
US5747469A (en) 1991-03-06 1998-05-05 Board Of Regents, The University Of Texas System Methods and compositions comprising DNA damaging agents and p53
PL169993B1 (pl) 1991-03-26 1996-09-30 Pfizer Sposób wytwarzania podstawionych piperydyn PL PL PL PL
FR2677361A1 (fr) 1991-06-04 1992-12-11 Adir Nouveaux peptides et pseudopeptides, derives de tachykinines, leur procede de preparation et les compositions pharmaceutiques qui les contiennent.
FR2676053B1 (fr) 1991-05-03 1993-08-27 Sanofi Elf Nouveaux composes dialkylenepiperidino et leurs enantiomeres, procede pour leur preparation et compositions pharmaceutiques les contenant.
FR2676055B1 (fr) 1991-05-03 1993-09-03 Sanofi Elf Composes polycycliques amines et leurs enantiomeres, procede pour leur preparation et compositions pharmaceutiques les contenant.
FR2676442B1 (fr) 1991-05-17 1993-08-06 Rhone Poulenc Rorer Sa Nouveau derives de perhydroisoindole, leur preparation et les compositions pharmaceutiques qui les contiennent.
FR2676443B1 (fr) 1991-05-17 1993-08-06 Rhone Poulenc Rorer Sa Nouveaux derives de perhydroisoindole et leur preparation.
FR2676447B1 (fr) 1991-05-17 1993-08-06 Rhone Poulenc Rorer Sa Nouveaux derives du thiopyranopyrrole et leur preparation.
FR2676446B1 (fr) 1991-05-17 1993-08-06 Rhone Poulenc Rorer Sa Nouveaux derives du thiopyranopyrrole, leur preparation et les compositions pharmaceutiques qui les contiennent.
RU2092486C1 (ru) 1991-05-22 1997-10-10 Пфайзер Инк. Замещенные 3-аминохинуклидины
US5292726A (en) 1991-05-22 1994-03-08 Merck & Co., Inc. N,N-diacylpiperazines
DE122006000066I2 (de) 1991-05-31 2007-12-06 Pfizer Chinuclidinderivate
GB9113219D0 (en) 1991-06-19 1991-08-07 Fujisawa Pharmaceutical Co Peptide compound,processes for preparation thereof and pharmaceutical composition comprising the same
BR9206161A (pt) 1991-06-20 1995-10-31 Pfizer Derivados fluoroalcoxibenzilamino de heterociclos contendo nitrogénio
TW202432B (enExample) 1991-06-21 1993-03-21 Pfizer
US5288730A (en) 1991-06-24 1994-02-22 Merck Sharp & Dohme Limited Azabicyclic compounds, pharmaceutical compositions containing them and their use in therapy
EP0536817A1 (en) 1991-07-05 1993-04-14 MERCK SHARP & DOHME LTD. Azabicyclic compounds as tachykinin antagonists
WO1993001169A2 (en) 1991-07-05 1993-01-21 Merck Sharp & Dohme Limited Aromatic compounds, pharmaceutical compositions containing them and their use in therapy
DE69208088T2 (de) 1991-07-05 1996-11-14 Merck Sharp & Dohme Aromatische verbindungen, diese enthaltende pharmazeutische zusammensetzungen und ihre therapeutische anwendung
JPH06509090A (ja) 1991-07-10 1994-10-13 メルク シヤープ エンド ドーム リミテツド 芳香族化合物、それらを含む組成物、及び治療におけるそれらの使用
WO1993001159A1 (en) 1991-07-10 1993-01-21 Merck Sharp & Dohme Limited Fused tricyclic compounds, pharmaceutical compositions containing them and their use in therapy
MY110227A (en) 1991-08-12 1998-03-31 Ciba Geigy Ag 1-acylpiperindine compounds.
WO1993004040A1 (en) 1991-08-20 1993-03-04 Merck Sharp & Dohme Limited Azacyclic compounds, processes for their preparation and pharmaceutical compositions containing them
PT533280E (pt) 1991-09-20 2001-01-31 Glaxo Group Ltd Novas utilizacoes medicas para antagonistas de taquiquinina
CZ59394A3 (en) 1991-09-26 1994-11-16 Pfizer Condensed tricyclic heterocycles containing nitrogen as antagonists of p substance receptor, process of their preparation, intermediates, pharmaceutical preparations in which they are comprised and use
US6335434B1 (en) 1998-06-16 2002-01-01 Isis Pharmaceuticals, Inc., Nucleosidic and non-nucleosidic folate conjugates
WO1993009116A1 (fr) 1991-11-07 1993-05-13 Yoshitomi Pharmaceutical Industries, Ltd. Compose a base de quinuclidine et utilisation dudit compose en medecine
DK0613458T3 (da) 1991-11-12 1998-02-09 Pfizer Acykliske ethylendiaminderivater som substans P receptorantagonister
CA2083891A1 (en) 1991-12-03 1993-06-04 Angus Murray Macleod Heterocyclic compounds, compositions containing them and their use in therapy
GB9200535D0 (en) 1992-01-10 1992-02-26 Fujisawa Pharmaceutical Co New compound
GB9201179D0 (en) 1992-01-21 1992-03-11 Glaxo Group Ltd Chemical compounds
US5328927A (en) 1992-03-03 1994-07-12 Merck Sharpe & Dohme, Ltd. Hetercyclic compounds, processes for their preparation and pharmaceutical compositions containing them
JP2656702B2 (ja) 1992-03-23 1997-09-24 ファイザー製薬株式会社 ペプチド性キヌクリジン
FR2689888B1 (fr) 1992-04-10 1994-06-10 Rhone Poulenc Rorer Sa Nouveaux derives de perhydroisoindole, leur preparation et les compositions pharmaceutiques qui les contiennent.
CA2133077A1 (en) 1992-04-15 1993-10-28 Raymond Baker Azacyclic compounds
GB2266529A (en) 1992-05-01 1993-11-03 Merck Sharp & Dohme Tetrahydroisoquinoline derivatives
AU687736B2 (en) 1992-05-11 1998-03-05 Ribozyme Pharmaceuticals, Inc. Method and reagent for inhibiting viral replication
US5977343A (en) 1992-05-14 1999-11-02 Ribozyme Pharmaceuticals, Inc. Synthesis, deprotection, analysis and purification of RNA and ribozymes
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
CA2134964C (en) 1992-05-18 1997-12-30 Manoj C. Desai Bridged aza-bicyclic derivatives as substance p antagonists
GB9211193D0 (en) 1992-05-27 1992-07-08 Merck Sharp & Dohme Therapeutic agents
CA2099233A1 (en) 1992-06-29 1993-12-30 Conrad P. Dorn Morpholine and thiomorpholine tachykinin receptor antagonists
US5637699A (en) 1992-06-29 1997-06-10 Merck & Co., Inc. Process for preparing morpholine tachykinin receptor antagonists
US5719147A (en) 1992-06-29 1998-02-17 Merck & Co., Inc. Morpholine and thiomorpholine tachykinin receptor antagonists
US5612336A (en) 1992-07-13 1997-03-18 Merck, Sharp & Dohme Ltd. Heterocyclic amide derivatives as tachykinin antagonists
GB2268931A (en) 1992-07-22 1994-01-26 Merck Sharp & Dohme Azabicyclic tachykinin-receptor antagonists
AU675447B2 (en) 1992-07-28 1997-02-06 Merck Sharp & Dohme Limited Carboxamidomethyl piperidine and analogues
GB2269170A (en) 1992-07-29 1994-02-02 Merck Sharp & Dohme Azatricyclic tachykinin antagonists
AU4718093A (en) 1992-07-31 1994-03-03 Merck Sharp & Dohme Limited Substituted amines as tachykinin receptor antagonists
CA2141051A1 (en) 1992-08-04 1994-02-17 Terry J. Rosen Substituted nitrogen-containing heterocycles
GB9216911D0 (en) 1992-08-10 1992-09-23 Merck Sharp & Dohme Therapeutic agents
DK0655055T3 (da) 1992-08-13 2001-01-02 Warner Lambert Co Tachykininantagonister
EP1114823A3 (en) 1992-08-19 2001-07-18 Pfizer Inc. Substituted benzylamino nitrogen containing non-aromatic heterocycles
US5387595A (en) 1992-08-26 1995-02-07 Merck & Co., Inc. Alicyclic compounds as tachykinin receptor antagonists
NO179904C (no) 1992-09-04 1997-01-08 Takeda Chemical Industries Ltd Kondenserte heterocykliske forbindelser og deres anvendelse
AU4973693A (en) 1992-09-10 1994-03-29 Merck Sharp & Dohme Limited Alcohols and ethers with aromatic substituents as tachykinin-antagonists
US6235886B1 (en) 1993-09-03 2001-05-22 Isis Pharmaceuticals, Inc. Methods of synthesis and use
GB9220286D0 (en) 1992-09-25 1992-11-11 Merck Sharp & Dohme Therapeutic agents
JP2656699B2 (ja) 1992-10-21 1997-09-24 ファイザー製薬株式会社 置換ベンジルアミノキヌクリジン
GB9222262D0 (en) 1992-10-23 1992-12-09 Merck Sharp & Dohme Therapeutic agents
GB9222486D0 (en) 1992-10-26 1992-12-09 Merck Sharp & Dohme Therapeutic agents
WO1994010165A1 (en) 1992-10-28 1994-05-11 Merck Sharp & Dohme Limited 4-arylmethyloxymethyl piperidines as tachykinin antagonists
JP2656700B2 (ja) 1992-10-28 1997-09-24 ファイザー製薬株式会社 置換キヌクリジン誘導体
US5554627A (en) 1992-10-30 1996-09-10 Merck, Sharp & Dohme Ltd. Tachykinin antagonists
ES2096312T3 (es) 1992-11-12 1997-03-01 Pfizer Derivado de quinuclidina como antagonista de la sustancia p.
US5261188A (en) 1992-11-23 1993-11-16 The Standard Products Company Belt weatherstrip with bulb
PT675886E (pt) 1992-12-10 2000-12-29 Pfizer Heterociclos nao aromaticos com substituintes aminometileno e sua utilizacao como antagonistas da substancia p
JPH08504435A (ja) 1992-12-14 1996-05-14 メルク シヤープ エンド ドーム リミテツド タキキニン受容体拮抗剤としての4−アミノメチル/チオメチル/スルホニルメチル−4−フェニルピペリジン
GB9226581D0 (en) 1992-12-21 1993-02-17 Merck Sharp & Dohme Therapeutic agents
GB9300051D0 (en) 1993-01-04 1993-03-03 Merck Sharp & Dohme Therapeutic agents
EP0610793A1 (en) 1993-02-08 1994-08-17 Takeda Chemical Industries, Ltd. Tetracyclic morpholine derivatives and their use or analgesics
JPH08506823A (ja) 1993-02-18 1996-07-23 メルク シヤープ エンド ドーム リミテツド アザ環式化合物、該化合物を含む組成物及びタキキニン拮抗剤としての該化合物の使用
AU6140694A (en) 1993-02-22 1994-09-14 Merck Sharp & Dohme Limited Aromatic compounds, compositions containing them and their use in therapy
US5688806A (en) 1993-03-04 1997-11-18 Pfizer Inc. Spiroazacyclic derivatives as substance P antagonists
NZ263686A (en) 1993-03-17 1997-09-22 Minnesota Mining & Mfg Medicinal aerosol with dispersing aid derived from a hydroxy acid, an amino acid and/or a mercapto acid
US5496833A (en) 1993-04-13 1996-03-05 Merck Sharp & Dohme Limited Piperidine tachykinin receptor antagonists
EP0696280B1 (en) 1993-05-06 1997-09-24 Merrell Pharmaceuticals Inc. Substituted pyrrolidin-3-yl-alkyl-piperidines useful as tachykinin antagonists
IL109646A0 (en) 1993-05-19 1994-08-26 Pfizer Heteroatom substituted alkyl benzylamino-quinuclidines
AU680020B2 (en) 1993-06-07 1997-07-17 Merck & Co., Inc. Spiro-substituted azacycles as neurokinin antagonists
EP0634402A1 (en) 1993-07-14 1995-01-18 Takeda Chemical Industries, Ltd. Isochinolinone derivatives, their production and use
ES2121213T3 (es) 1993-07-15 1998-11-16 Pfizer Benciloxiquinuclidinas como antagonistas de la sustancia p.
TW365603B (en) 1993-07-30 1999-08-01 Rhone Poulenc Rorer Sa Novel perhydroisoindole derivatives, their preparation and pharmaceutical compositions which contain them
GB9315808D0 (en) 1993-07-30 1993-09-15 Merck Sharp & Dohme Therapeutic agents
GB9317987D0 (en) 1993-08-26 1993-10-13 Glaxo Group Ltd Chemical compounds
DE69433036T2 (de) 1993-09-03 2004-05-27 Isis Pharmaceuticals, Inc., Carlsbad Aminoderivatisierte nukleoside und oligonukleoside
DE69433744T2 (de) 1993-09-17 2004-10-14 Pfizer Inc. 3-amino-5-carboxy-substituierte piperidine und 3-amino-4-carboxy-substituierte pyrrolidine als tachykinin-antagonisten
EP0719266A1 (en) 1993-09-17 1996-07-03 Pfizer Inc. Heteroarylamino and heteroarylsulfonamido substituted 3-benzylaminomethyl piperidines and related compounds
IS4208A (is) 1993-09-22 1995-03-23 Glaxo Group Limited 3-(tetrazólýl-benzyl)amínó-piperadidín afleiður
US5624803A (en) 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
AU7947594A (en) 1993-10-27 1995-05-22 Merck Sharp & Dohme Limited Substituted amides as tachykinin antagonists
US6403577B1 (en) 1993-11-17 2002-06-11 Eli Lilly And Company Hexamethyleneiminyl tachykinin receptor antagonists
IT1271462B (it) 1993-12-03 1997-05-28 Menarini Farma Ind Antagonisti delle tachichinine,procedimento per la loro preparazione e loro impiego in formulazioni farmaceutiche.
IL111960A (en) 1993-12-17 1999-12-22 Merck & Co Inc Morpholines and thiomorpholines their preparation and pharmaceutical compositions containing them
JPH09506898A (ja) 1993-12-21 1997-07-08 イーライ・リリー・アンド・カンパニー 非ペプチドタキキニン受容体アンタゴニスト
DE69416869T2 (de) 1993-12-29 1999-07-01 Pfizer Inc., New York, N.Y. Diazabicyclische neurokinin antagonisten
KR100286412B1 (ko) 1993-12-29 2001-04-16 더블유. 지. 콜 치환된 모르폴린 유도체, 이의 제조방법 및 이를 포함하는 약제학적 조성물
JPH09507500A (ja) 1994-01-13 1997-07-29 メルク シヤープ エンド ドーム リミテツド gem二置換アザシクロ系のタキキニン拮抗薬
WO1995020575A1 (en) 1994-01-28 1995-08-03 Merck Sharp & Dohme Limited Aralkylamino substituted azacyclic therapeutic agents
GB9402688D0 (en) 1994-02-11 1994-04-06 Merck Sharp & Dohme Therapeutic agents
US5610165A (en) 1994-02-17 1997-03-11 Merck & Co., Inc. N-acylpiperidine tachykinin antagonists
US5902880A (en) 1994-08-19 1999-05-11 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
IL112778A0 (en) 1994-03-04 1995-05-26 Merck & Co Inc Substituted heterocycles, their preparation and pharmaceutical compositions containing them
FR2718136B1 (fr) 1994-03-29 1996-06-21 Sanofi Sa Composés aromatiques aminés, procédé pour leur obtention et compositions pharmaceutiques les contenant.
US5610145A (en) 1994-04-15 1997-03-11 Warner-Lambert Company Tachykinin antagonists
PE27997A1 (es) 1994-04-29 1997-09-20 Lilly Co Eli Antagonistas de receptores de taquicininas
US5747491A (en) 1994-05-05 1998-05-05 Merck Sharp & Dohme Ltd. Morpholine derivatives and their use as antagonists of tachikinins
JPH09512806A (ja) 1994-05-07 1997-12-22 ベーリンガー インゲルハイム コマンディトゲゼルシャフト 新規なアミノ酸誘導体、その製造方法及びこれらの化合物を含む医薬組成物(ii)
JPH10501228A (ja) 1994-06-06 1998-02-03 ワーナー−ランバート・コンパニー タキキニン(nk▲下1▼)受容体アンタゴニスト
EP0686629A3 (en) 1994-06-10 1999-02-10 Eli Lilly And Company Cyclohexyl tachykinine receptor antagonists
CZ288434B6 (en) 1994-07-12 2001-06-13 Lilly Co Eli Dihydrochloride trihydrate of (R)-3-(1H-indol-3-yl)-1-[N-(2-methoxybenzyl)acetylamino]-2-[N-/2-(4-piperid-1-yl)piperid-1-yl)acetyl/-amino]propane, pharmaceutical preparation in which it is comprised and use thereof
CA2154116A1 (en) 1994-07-22 1996-01-23 Philip Arthur Hipskind 1-aryl-2-acetamidopentanone derivatives for use as tachykinin receptor antagonists
GB9415996D0 (en) 1994-08-08 1994-09-28 Merck Sharp & Dohme Therapeutic agents
GB9415997D0 (en) 1994-08-08 1994-09-28 Merck Sharp & Dohme Therapeutic agents
TW432061B (en) 1994-08-09 2001-05-01 Pfizer Res & Dev Lactams
WO1996005181A1 (en) 1994-08-15 1996-02-22 Merck Sharp & Dohme Limited Morpholine derivatives and their use as therapeutic agents
US6146886A (en) 1994-08-19 2000-11-14 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
WO1996006094A1 (en) 1994-08-25 1996-02-29 Merrell Pharmaceuticals Inc. Novel substituted piperidines useful for the treatment of allergic diseases
ATE158568T1 (de) 1994-08-29 1997-10-15 Akzo Nobel Nv Verfahren zur herstellung von quaternären diestern
GB9417956D0 (en) 1994-09-02 1994-10-26 Merck Sharp & Dohme Therapeutic agents
GB9418545D0 (en) 1994-09-15 1994-11-02 Merck Sharp & Dohme Therapeutic agents
US5457107A (en) 1994-09-16 1995-10-10 Merck & Co., Inc. Polymorphic form of a tachykinin receptor antagonist
US5753613A (en) 1994-09-30 1998-05-19 Inex Pharmaceuticals Corporation Compositions for the introduction of polyanionic materials into cells
CA2198382A1 (en) 1994-09-30 1996-04-11 Novartis Ag 1-acyl-4-aliphatylaminopiperidine compounds
US5820873A (en) 1994-09-30 1998-10-13 The University Of British Columbia Polyethylene glycol modified ceramide lipids and liposome uses thereof
US5885613A (en) 1994-09-30 1999-03-23 The University Of British Columbia Bilayer stabilizing components and their use in forming programmable fusogenic liposomes
TW397825B (en) 1994-10-14 2000-07-11 Novartis Ag Aroyl-piperidine derivatives
FR2725986B1 (fr) 1994-10-21 1996-11-29 Adir Nouveaux derives de piperidine, leur procede de preparation et les compositions pharmaceutiques qui les contiennent
EP0709375B1 (en) 1994-10-25 2005-05-18 AstraZeneca AB Therapeutic heterocycles
GB9421709D0 (en) 1994-10-27 1994-12-14 Zeneca Ltd Therapeutic compounds
EP0714891A1 (en) 1994-11-22 1996-06-05 Eli Lilly And Company Heterocyclic tachykinin receptor antagonists
FR2727411B1 (fr) 1994-11-30 1997-01-03 Rhone Poulenc Rorer Sa Nouveaux derives de perhydroisoindole, leur preparation et les compositions pharmaceutiques qui les contiennent
CA2207593A1 (en) 1994-12-13 1996-06-20 John Gustofson Method and reagent for treatment of arthritic conditions, induction of graft tolerance and reversal of immune responses
IL116323A0 (en) 1994-12-13 1996-03-31 Sandoz Ag Tachykinin antagonists their preparation and pharmaceutical compositions containing them
GB9426103D0 (en) 1994-12-23 1995-02-22 Merck Sharp & Dohme Therapeutic agents
ATE279406T1 (de) 1995-01-12 2004-10-15 Glaxo Group Ltd Piperidinderivate mit tachykinin-antagonistischer wirkung
FR2729951B1 (fr) 1995-01-30 1997-04-18 Sanofi Sa Nouveaux composes heterocycliques, procede pour leur preparation et compositions pharmaceutiques en contenant
GB9505491D0 (en) 1995-03-18 1995-05-03 Merck Sharp & Dohme Therapeutic agents
GB9505492D0 (en) 1995-03-18 1995-05-03 Merck Sharp & Dohme Therapeutic agents
US5554641A (en) 1995-03-20 1996-09-10 Horwell; David C. Nonpeptides as tachykinin antagonists
GB9505692D0 (en) 1995-03-21 1995-05-10 Glaxo Group Ltd Chemical compounds
TW394773B (en) 1995-03-24 2000-06-21 Takeda Chemical Industries Ltd Cyclic compounds for antagonizing tachykinin receptor, substance p receptor and neurokinin a receptor, their production and pharmaceutical composition
US5565568A (en) 1995-04-06 1996-10-15 Eli Lilly And Company 2-acylaminopropanamides as tachykinin receptor antagonists
AU700693B2 (en) 1995-04-13 1999-01-14 Aventis Pharmaceuticals Inc. Novel substituted piperazine derivatives having tachykinin receptor antagonists activity
BR9604976A (pt) 1995-04-14 1998-06-09 Glaxo Wellcome Inc Inalador de dose medida sistema inalador de dose medida e uso do mesmo
HUP9900822A3 (en) 1995-05-25 1999-11-29 Fujisawa Pharmaceutical Co Piperazine derivatives, process for producing them, pharmaceutical compositions containing them and method for treating tachykinin-mediated diseases
DE69634084T2 (de) 1995-06-07 2005-12-08 Inex Pharmaceuticals Corp. Herstellung von lipid-nukleinsäure partikeln duch ein hydrophobische lipid-nukleinsäuree komplexe zwischenprodukt und zur verwendung in der gentransfer
US7422902B1 (en) 1995-06-07 2008-09-09 The University Of British Columbia Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5981501A (en) 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US5705385A (en) 1995-06-07 1998-01-06 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5889136A (en) 1995-06-09 1999-03-30 The Regents Of The University Of Colorado Orthoester protecting groups in RNA synthesis
GB9513118D0 (en) 1995-06-28 1995-08-30 Merck Sharp & Dohme Therapeutic agents
GB9513121D0 (en) 1995-06-28 1995-08-30 Merck Sharp & Dohme Therapeutic agents
GB9513117D0 (en) 1995-06-28 1995-08-30 Merck Sharp & Dohme Therapeutic agents
US6180647B1 (en) 1995-07-07 2001-01-30 Pfizer Inc. Substituted benzolactam compounds as substance P antagonists
TW340842B (en) 1995-08-24 1998-09-21 Pfizer Substituted benzylaminopiperidine compounds
JP2002534955A (ja) 1995-10-18 2002-10-15 メルク エンド カンパニー インコーポレーテッド シクロペンチルタキキニン受容体アンタゴニスト
DE19541283A1 (de) 1995-11-06 1997-05-07 Boehringer Ingelheim Kg Neue Aminosäurederivate, Verfahren zu ihrer Herstellung und diese Verbindungen enthaltende pharmazeutische Zusammensetzungen
GB9523244D0 (en) 1995-11-14 1996-01-17 Merck Sharp & Dohme Therapeutic agents
US6060469A (en) 1995-11-23 2000-05-09 Merck Sharp & Dohme Ltd. Spiro-piperidine derivatives and their use as tachykinin antagonists
GB9524157D0 (en) 1995-11-25 1996-01-24 Pfizer Ltd Therapeutic agents
HU224225B1 (hu) 1995-12-01 2005-06-28 Sankyo Co. Ltd. Tachikinin receptor antagonista hatású heterociklusos vegyületek, ezek előállítási eljárása és alkalmazásuk gyógyszerkészítmények előállítására
GB9525296D0 (en) 1995-12-11 1996-02-07 Merck Sharp & Dohme Therapeutic agents
AUPO434196A0 (en) * 1996-12-24 1997-01-23 Crown In The Right Of The Queensland Department Of Health, The An improved therapeutic
US6001311A (en) 1997-02-05 1999-12-14 Protogene Laboratories, Inc. Apparatus for diverse chemical synthesis using two-dimensional array
US6126919A (en) 1997-02-07 2000-10-03 3M Innovative Properties Company Biocompatible compounds for pharmaceutical drug delivery systems
US6235310B1 (en) 1997-04-04 2001-05-22 Valentis, Inc. Methods of delivery using cationic lipids and helper lipids
DE69841002D1 (de) 1997-05-14 2009-09-03 Univ British Columbia Hochwirksame verkapselung von nukleinsäuren in lipidvesikeln
US6835395B1 (en) 1997-05-14 2004-12-28 The University Of British Columbia Composition containing small multilamellar oligodeoxynucleotide-containing lipid vesicles
DE69820465T2 (de) 1997-06-23 2004-09-16 Alza Corp., Mountain View Liposomen-umschlossene polynukleotidzusammensetzung sowie verfahren
US6054576A (en) 1997-10-02 2000-04-25 Ribozyme Pharmaceuticals, Inc. Deprotection of RNA
EP2138191A1 (en) 1998-01-05 2009-12-30 University Of Washington Enhanced transport using membrane disruptive agents
US6111086A (en) 1998-02-27 2000-08-29 Scaringe; Stephen A. Orthoester protecting groups
EP1071753A2 (en) 1998-04-20 2001-01-31 Ribozyme Pharmaceuticals, Inc. Nucleic acid molecules with novel chemical compositions capable of modulating gene expression
EP1096921B1 (en) 1998-07-20 2003-04-16 Protiva Biotherapeutics Inc. Liposomal encapsulated nucleic acid-complexes
US6995259B1 (en) 1998-10-23 2006-02-07 Sirna Therapeutics, Inc. Method for the chemical synthesis of oligonucleotides
RU2250911C2 (ru) 1999-07-14 2005-04-27 Элзэ Копэрейшн Липосомальная композиция, нейтральный липополимер и способ увеличения времени циркуляции липосомы
US20050032733A1 (en) * 2001-05-18 2005-02-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SiNA)
US8273866B2 (en) 2002-02-20 2012-09-25 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA)
US6401406B1 (en) 2000-02-11 2002-06-11 Domald K. Komara Retainment device for concrete block inspection plates
AU8695901A (en) 2000-09-01 2002-03-13 Ribozyme Pharm Inc Methods for synthesizing nucleosides, nucleoside derivatives and non-nucleoside derivatives
US6998115B2 (en) 2000-10-10 2006-02-14 Massachusetts Institute Of Technology Biodegradable poly(β-amino esters) and uses thereof
WO2004028341A2 (en) 2001-03-19 2004-04-08 Decode Genetics Ehf. Susceptibility gene for human stroke; methods of treatment
US20050164220A1 (en) 2001-03-19 2005-07-28 Decode Genetics Ehf. Susceptibility gene for human stroke: method of treatment
WO2002087541A1 (en) 2001-04-30 2002-11-07 Protiva Biotherapeutics Inc. Lipid-based formulations for gene transfer
US20080161256A1 (en) * 2001-05-18 2008-07-03 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
DE60237696D1 (de) 2001-08-01 2010-10-28 Univ Utah Am n-terminus trunkierte isoformen von zyklischen phosphodiesterasen pde3a
US20050191627A1 (en) 2001-09-28 2005-09-01 Incyte Corporation Enzymes
FR2830767B1 (fr) 2001-10-12 2004-03-12 Optis France Sa Dispositif de delivrance de medicaments par iontophorese ou electroporation introculaire
FR2830766B1 (fr) 2001-10-12 2004-03-12 Optis France Sa Dispositif de delivrance de medicaments par iontophorese transpalpebrale
EP1506303A2 (en) 2001-12-14 2005-02-16 Incyte Genomics, Inc. Enzymes
US7662952B2 (en) * 2002-02-20 2010-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA)
AU2003207708A1 (en) 2002-02-20 2003-09-09 Sirna Therapeutics, Inc. Rna interference mediated inhibition of map kinase genes
JP2005537244A (ja) 2002-06-28 2005-12-08 ナステック・ファーマシューティカル・カンパニー・インコーポレーテッド 療法化合物の粘膜搬送を増進させるための、上皮接合部接着分子の生理機能を調節する組成物および方法
US6989442B2 (en) 2002-07-12 2006-01-24 Sirna Therapeutics, Inc. Deprotection and purification of oligonucleotides and their derivatives
CA2884658A1 (en) * 2002-07-26 2004-02-05 Novartis Vaccines And Diagnostics, Inc. Modified small interfering rna molecules and methods of use
US8216609B2 (en) 2002-08-05 2012-07-10 Torrent Pharmaceuticals Limited Modified release composition of highly soluble drugs
US8133903B2 (en) 2003-10-21 2012-03-13 Los Angeles Biomedical Research Institute at Harbor—UCLA Medical Center Methods of use of inhibitors of phosphodiesterases and modulators of nitric oxide, reactive oxygen species, and metalloproteinases in the treatment of peyronie's disease, arteriosclerosis and other fibrotic diseases
US7816337B2 (en) 2003-02-18 2010-10-19 Roche Madison Inc. Reversible attachment of a membrane active polymer to a polynucleotide
WO2004080887A1 (en) 2003-03-07 2004-09-23 Massachusetts Institute Of Technology Three dimensional mecrofabrication
BRPI0411219A (pt) * 2003-06-12 2006-07-18 Nucleonics Inc seqüências de hbv e hcv conservadas úteis para silenciamento de gene
CN101579529A (zh) 2003-09-29 2009-11-18 托皮根药品公司 治疗包括炎症状况的疾病的寡核苷酸组合物和方法
CN102028994B (zh) 2003-11-03 2013-04-24 葛兰素集团有限公司 流体分配装置
US20100145038A1 (en) * 2003-11-24 2010-06-10 Merck & Co., Inc. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2005060697A2 (en) 2003-12-19 2005-07-07 Chiron Corporation Cell transfecting formulations of small interfering rna, related compositions and methods of making and use
EP1773998A2 (en) 2004-04-20 2007-04-18 Nastech Pharmaceutical Company Inc. Methods and compositions for enhancing delivery of double-stranded rna or a double-stranded hybrid nucleic acid to regulate gene expression in mammalian cells
CA2566559C (en) 2004-05-17 2014-05-06 Inex Pharmaceuticals Corporation Liposomal formulations comprising dihydrosphingomyelin and methods of use thereof
US20060019258A1 (en) 2004-07-20 2006-01-26 Illumina, Inc. Methods and compositions for detection of small interfering RNA and micro-RNA
WO2006033756A2 (en) * 2004-08-23 2006-03-30 Nucleonics, Inc. Multiple rna polymerase iii promoter expression constructs
US20060062758A1 (en) 2004-09-21 2006-03-23 Nastech Pharmaceutical Comapny Inc. Tight junction modulator peptide PN159 for enhanced mucosal delivery of therapeutic compounds
EP1796732B1 (en) * 2004-10-01 2013-10-30 Novartis Vaccines and Diagnostics, Inc. Modified small interfering rna molecules and methods of use
WO2006069064A2 (en) 2004-12-22 2006-06-29 Nucleonics, Inc. Conserved hbv and hcv sequences useful for gene silencing
US7404969B2 (en) * 2005-02-14 2008-07-29 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
US20080096839A1 (en) * 2005-03-09 2008-04-24 Mogam Biotechnology Research Institute Small Interfering Rna and Pharmaceutical Composition for Treatment of Hepatitis B Comprising the Same
CN102827841A (zh) * 2005-09-12 2012-12-19 索马根尼科斯公司 利用小干扰rna抑制病毒基因表达
BRPI0715375A2 (pt) 2006-08-18 2013-06-18 Hoffmann La Roche policonjugados para distribuiÇço in vivo de polinucleotÍdeos
US20100015218A1 (en) * 2007-02-16 2010-01-21 Vasant Jadhav Compositions and methods for potentiated activity of biologically active molecules
US20100209491A1 (en) * 2007-09-17 2010-08-19 Mogam Biotechnology Research Institute Method for enhancing serum stability and lowering immune response of sirna down-regulating gene expression of hbv or hcv
CN101603042B (zh) * 2008-06-13 2013-05-01 厦门大学 可用于乙型肝炎病毒感染治疗的rna干扰靶点
CN101322847A (zh) * 2008-06-23 2008-12-17 淮安市第四人民医院 基于siRNA池干扰的复合载体介导的抗乙肝病毒基因药物
WO2010012244A1 (zh) * 2008-08-01 2010-02-04 苏州瑞博生物技术有限公司 乙型肝炎病毒基因的小核酸干扰靶位点序列和小干扰核酸及组合物和应用
WO2010080724A1 (en) * 2009-01-12 2010-07-15 Merck Sharp & Dohme Corp. Novel lipid nanoparticles and novel components for delivery of nucleic acids
EP2512491B1 (en) 2009-10-16 2017-10-11 Glaxo Group Limited Hbv antisense inhibitors
EP2525929B1 (en) 2010-01-20 2020-03-18 Magna International Inc. Method of making a bi-metallic component
EP3587574B1 (en) * 2010-08-17 2022-03-16 Sirna Therapeutics, Inc. Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)
CN101948827A (zh) * 2010-08-19 2011-01-19 中国人民解放军第三〇二医院 一种低载量乙型肝炎病毒全基因组克隆的方法
JP6042871B2 (ja) * 2011-04-21 2016-12-14 アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. B型肝炎ウイルス(hbv)発現の調節
CN106434665B (zh) 2011-06-30 2021-06-08 箭头药业股份有限公司 用于抑制乙型肝炎病毒的基因表达的组合物和方法
CN102559657A (zh) * 2011-11-09 2012-07-11 中国人民解放军第三〇二医院 两片段连接法进行hbv全基因组克隆的方法

Patent Citations (206)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3126375A (en) 1964-03-24 Chioacyl
US2789118A (en) 1956-03-30 1957-04-16 American Cyanamid Co 16-alpha oxy-belta1, 4-pregnadienes
US2990401A (en) 1958-06-18 1961-06-27 American Cyanamid Co 11-substituted 16alpha, 17alpha-substituted methylenedioxy steroids
US3048581A (en) 1960-04-25 1962-08-07 Olin Mathieson Acetals and ketals of 16, 17-dihydroxy steroids
US3749712A (en) 1970-09-25 1973-07-31 Sigma Tau Ind Farmaceuti Triamcinolone acetonide esters and process for their preparation
US3928326A (en) 1972-05-19 1975-12-23 Bofors Ab Process for the separation of stereoisomeric mixtures into their components and components obtained hereby
US3929768A (en) 1972-05-19 1975-12-30 Bofors Ab Steroids, processes for their manufacture and preparations containing same
US3996359A (en) 1972-05-19 1976-12-07 Ab Bofors Novel stereoisomeric component A of stereoisomeric mixtures of 2'-unsymmetrical 16,17-methylenedioxy steroid 21-acylates, compositions thereof, and method of treating therewith
US4231938A (en) 1979-06-15 1980-11-04 Merck & Co., Inc. Hypocholesteremic fermentation products and process of preparation
US4294926A (en) 1979-06-15 1981-10-13 Merck & Co., Inc. Hypocholesteremic fermentation products and process of preparation
US4319039A (en) 1979-06-15 1982-03-09 Merck & Co., Inc. Preparation of ammonium salt of hypocholesteremic fermentation product
US4346227A (en) 1980-06-06 1982-08-24 Sankyo Company, Limited ML-236B Derivatives and their preparation
US4410629A (en) 1980-06-06 1983-10-18 Sankyo Company Limited ML-236B Derivatives and their preparation
US4444784A (en) 1980-08-05 1984-04-24 Merck & Co., Inc. Antihypercholesterolemic compounds
US4537859A (en) 1981-11-20 1985-08-27 Sankyo Company, Limited Process for preparing 3-hydroxy-ML-236B derivatives known as M-4 and M-4'
US5354772A (en) 1982-11-22 1994-10-11 Sandoz Pharm. Corp. Indole analogs of mevalonolactone and derivatives thereof
US4911165A (en) 1983-01-12 1990-03-27 Ethicon, Inc. Pliabilized polypropylene surgical filaments
US4681893A (en) 1986-05-30 1987-07-21 Warner-Lambert Company Trans-6-[2-(3- or 4-carboxamido-substituted pyrrol-1-yl)alkyl]-4-hydroxypyran-2-one inhibitors of cholesterol synthesis
US4885314A (en) 1987-06-29 1989-12-05 Merck & Co., Inc. Novel HMG-CoA reductase inhibitors
US4782084A (en) 1987-06-29 1988-11-01 Merck & Co., Inc. HMG-COA reductase inhibitors
US4820850A (en) 1987-07-10 1989-04-11 Merck & Co., Inc. Process for α-C-alkylation of the 8-acyl group on mevinolin and analogs thereof
US5030447A (en) 1988-03-31 1991-07-09 E. R. Squibb & Sons, Inc. Pharmaceutical compositions having good stability
US5180589A (en) 1988-03-31 1993-01-19 E. R. Squibb & Sons, Inc. Pravastatin pharmaceuatical compositions having good stability
US4916239A (en) 1988-07-19 1990-04-10 Merck & Co., Inc. Process for the lactonization of mevinic acids and analogs thereof
US5290946A (en) 1988-10-13 1994-03-01 Sandoz Ltd. Processes for the synthesis of 3-(substituted indolyl-2-yl)propenaldehydes
US5118853A (en) 1988-10-13 1992-06-02 Sandoz Ltd. Processes for the synthesis of 3-disubstituted aminoacroleins
US4929437A (en) 1989-02-02 1990-05-29 Merck & Co., Inc. Coenzyme Q10 with HMG-CoA reductase inhibitors
US5189164A (en) 1989-05-22 1993-02-23 Sandoz Ltd. Processes for the synthesis of syn-(E)-3,5-dihydroxy-7-substituted hept-6-enoic and heptanoic acids and derivatives and intermediates thereof
US5273995A (en) 1989-07-21 1993-12-28 Warner-Lambert Company [R-(R*R*)]-2-(4-fluorophenyl)-β,δ-dihydroxy-5-(1-methylethyl-3-phenyl-4-[(phenylamino) carbonyl]- 1H-pyrrole-1-heptanoic acid, its lactone form and salts thereof
US5134142A (en) 1989-09-22 1992-07-28 Fujisawa Pharmaceutical Co., Ltd. Pyrazole derivatives, and pharmaceutical composition comprising the same
US5420245A (en) 1990-04-18 1995-05-30 Board Of Regents, The University Of Texas Tetrapeptide-based inhibitors of farnesyl transferase
US5356896A (en) 1991-12-12 1994-10-18 Sandoz Ltd. Stabilized pharmaceutical compositions comprising an HMG-CoA reductase inhibitor compound
WO1994002595A1 (en) 1992-07-17 1994-02-03 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of animal diseases
US5604260A (en) 1992-12-11 1997-02-18 Merck Frosst Canada Inc. 5-methanesulfonamido-1-indanones as an inhibitor of cyclooxygenase-2
EP0604181A1 (en) 1992-12-21 1994-06-29 Eli Lilly And Company Antitumor compositions and method of treatment
WO1994015932A1 (en) 1993-01-15 1994-07-21 G.D. Searle & Co. Novel 3,4-diaryl thiophenes and analogs thereof having use as antiinflammatory agents
WO1994019357A1 (en) 1993-02-23 1994-09-01 Merrell Dow Pharmaceuticals Inc. Farnesyl:protein transferase inhibitors as anticancer agents
US5342952A (en) 1993-03-03 1994-08-30 Warner-Lambert Company Process for trans-6-[2-(substituted-pyrrol-1-yl)alkyl]pyran-2-one inhibitors of cholesterol synthesis
US5489691A (en) 1993-03-03 1996-02-06 Warner-Lambert Company Process for trans-6-(2-(substituted-pyrrol-1-yl)alkyl)pyran-2-one inhibitors of cholesterol synthesis
US5409944A (en) 1993-03-12 1995-04-25 Merck Frosst Canada, Inc. Alkanesulfonamido-1-indanone derivatives as inhibitors of cyclooxygenase
EP0618221A2 (en) 1993-04-02 1994-10-05 Bristol-Myers Squibb Company Heterocyclic inhibitors of farnesyl protein transferase
US5532359A (en) 1993-05-14 1996-07-02 Genentech, Inc. Ras farnesyl transferase inhibitors
US5602098A (en) 1993-05-18 1997-02-11 University Of Pittsburgh Inhibition of farnesyltransferase
US5380738A (en) 1993-05-21 1995-01-10 Monsanto Company 2-substituted oxazoles further substituted by 4-fluorophenyl and 4-methylsulfonylphenyl as antiinflammatory agents
US5710140A (en) 1993-06-24 1998-01-20 Merck Frosst Canada, Inc. Phenyl heterocycles as COX-2 inhibitors
US5474995A (en) 1993-06-24 1995-12-12 Merck Frosst Canada, Inc. Phenyl heterocycles as cox-2 inhibitors
US5536752A (en) 1993-06-24 1996-07-16 Merck Frosst Canada Inc. Phenyl heterocycles as COX-2 inhibitors
US5550142A (en) 1993-06-24 1996-08-27 Merck Frosst Canada Inc. Phenyl heterocycles as cox-2 inhibitors
WO1995008542A1 (en) 1993-09-22 1995-03-30 Kyowa Hakko Kogyo Co., Ltd. Farnesyltransferase inhibitor
WO1995010514A1 (en) 1993-10-15 1995-04-20 Schering Corporation Tricyclic sulfonamide compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1995010516A1 (en) 1993-10-15 1995-04-20 Schering Corporation Tricyclic amide and urea compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
US5661152A (en) 1993-10-15 1997-08-26 Schering Corporation Tricyclic sulfonamide compounds useful for inhibition of G-protein function and for treatment of proliferative diseases
WO1995010515A1 (en) 1993-10-15 1995-04-20 Schering Corporation Tricyclic carbamate compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1995011917A1 (en) 1993-10-25 1995-05-04 Parke, Davis & Company Substituted tetra- and pentapeptide inhibitors of protein:farnesyl transferase
US5344991A (en) 1993-10-29 1994-09-06 G.D. Searle & Co. 1,2 diarylcyclopentenyl compounds for the treatment of inflammation
WO1995012572A1 (en) 1993-11-04 1995-05-11 Abbott Laboratories Cyclobutane derivatives as inhibitors of squalene synthetase and protein farnesyltransferase
WO1995012612A1 (en) 1993-11-05 1995-05-11 Warner-Lambert Company Substituted di- and tripeptide inhibitors of protein:farnesyl transferase
US5436265A (en) 1993-11-12 1995-07-25 Merck Frosst Canada, Inc. 1-aroyl-3-indolyl alkanoic acids and derivatives thereof useful as anti-inflammatory agents
US5466823A (en) 1993-11-30 1995-11-14 G.D. Searle & Co. Substituted pyrazolyl benzenesulfonamides
US5589485A (en) 1993-12-09 1996-12-31 Abbott Laboratories Dorrigocin antitumor agents
US5393790A (en) 1994-02-10 1995-02-28 G.D. Searle & Co. Substituted spiro compounds for the treatment of inflammation
WO1995024612A1 (de) 1994-03-07 1995-09-14 International Business Machines Corporation Verfahren und vorrichtung zur schnellen interpolation von zwischenwerten aus periodischen phasenverschobenen signalen und zur erkennung von defekten in einem drehkörper
WO1995025086A1 (en) 1994-03-15 1995-09-21 Eisai Co., Ltd. Isoprenyl transferase inhibitors
EP0675112A1 (en) 1994-03-31 1995-10-04 Bristol-Myers Squibb Company Imidazole-containing inhibitors of farnesyl protein transferase
US5523430A (en) 1994-04-14 1996-06-04 Bristol-Myers Squibb Company Protein farnesyl transferase inhibitors
US5510510A (en) 1994-05-10 1996-04-23 Bristol-Meyers Squibb Company Inhibitors of farnesyl protein transferase
US6447796B1 (en) 1994-05-16 2002-09-10 The United States Of America As Represented By The Secretary Of The Army Sustained release hydrophobic bioactive PLGA microspheres
WO1995032987A1 (en) 1994-05-31 1995-12-07 Isis Pharmaceuticals, Inc. ANTISENSE OLIGONUCLEOTIDE MODULATION OF raf GENE EXPRESSION
WO1995034535A1 (fr) 1994-06-10 1995-12-21 Rhone-Poulenc Rorer S.A. Nouveaux inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1996000736A1 (en) 1994-06-30 1996-01-11 Warner-Lambert Company Histidine and homohistidine derivatives as inhibitors of protein farnesyltransferase
US5571792A (en) 1994-06-30 1996-11-05 Warner-Lambert Company Histidine and homohistidine derivatives as inhibitors of protein farnesyltransferase
WO1996005529A1 (en) 1994-08-09 1996-02-22 Micron Optics, Inc. Temperature compensated fiber fabry-perot filters
EP0696593A2 (en) 1994-08-11 1996-02-14 Bristol-Myers Squibb Company Inhibitors of farnesyl protein transferase
WO1996005168A1 (en) 1994-08-11 1996-02-22 Banyu Pharmaceutical Co., Ltd. Substituted amide derivative
WO1996005169A1 (en) 1994-08-12 1996-02-22 Banyu Pharmaceutical Co., Ltd. N,n-disubstituted amic acid derivative
WO1996006138A1 (de) 1994-08-19 1996-02-29 Skw Trostberg Aktiengesellschaft Verfahren zur extraktion natürlicher carotinoid-farbstoffe
WO1996006193A1 (de) 1994-08-20 1996-02-29 Anton More Konverter und verfahren zum frischen von metallschmelzen im gegenstrom, insbesondere von roheisen zu stahl
WO1996016443A1 (en) 1994-11-22 1996-05-30 Philips Electronics N.V. Semiconductor device with a carrier body on which a substrate with a semiconductor element is fastened by means of a glue layer and on which a pattern of conductor tracks is fastened
WO1996017861A1 (en) 1994-12-09 1996-06-13 Warner-Lambert Company Substituted tetra- and pentapeptide inhibitors of protein:farnesyl transferase
WO1996021701A2 (en) 1995-01-09 1996-07-18 Magla International Ltd. Wear resistant image printing on latex surfaces
WO1996021456A1 (en) 1995-01-12 1996-07-18 University Of Pittsburgh Inhibitors of prenyl transferases
WO1996022278A1 (fr) 1995-01-18 1996-07-25 Rhone-Poulenc Rorer S.A. Nouveaux inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1996024612A1 (fr) 1995-02-09 1996-08-15 Rhone-Poulenc Rorer S.A. Inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1996024611A1 (fr) 1995-02-09 1996-08-15 Rhone-Poulenc Rorer S.A. Inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
US5633272A (en) 1995-02-13 1997-05-27 Talley; John J. Substituted isoxazoles for the treatment of inflammation
WO1996030017A1 (en) 1995-03-24 1996-10-03 Schering Corporation Tricyclic compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996030362A1 (en) 1995-03-24 1996-10-03 Schering Corporation Tricyclic amide and urea compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996030018A1 (en) 1995-03-24 1996-10-03 Schering Corporation Tricyclic carbamate compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996030363A1 (en) 1995-03-24 1996-10-03 Schering Corporation Tricyclic amide and urea compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996030343A1 (en) 1995-03-29 1996-10-03 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
WO1996031477A1 (en) 1995-04-07 1996-10-10 Schering Corporation Tricyclic compounds useful for inhibition of farnesyl protein transferase
WO1996031478A1 (en) 1995-04-07 1996-10-10 Schering Corporation Tricyclic compounds useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1996031111A1 (en) 1995-04-07 1996-10-10 Schering Corporation Tricyclic compounds useful in the treatment of cell proliferative disorders
WO1996031501A1 (en) 1995-04-07 1996-10-10 Schering Corporation Carbonyl-piperazinyl and piperidinil compounds which inhibit farnesyl protein transferase
WO1996033159A1 (en) 1995-04-21 1996-10-24 Abbott Laboratories Cyclobutane derivatives as inhibitors of squalene synthase and protein farnesyltransferase
WO1996034850A1 (en) 1995-05-03 1996-11-07 Abbott Laboratories Cyclobutane derivatives and their use as inhibitors of protein farnesyltransferase
WO1996034851A1 (en) 1995-05-03 1996-11-07 Abbott Laboratories Benzene, pyridine, naphtalene or benzophenone derivatives as inhibitors of squalene synthetase and protein farnesyltransferase
WO1997000252A1 (en) 1995-06-16 1997-01-03 Warner-Lambert Company Tricyclic inhibitors of protein farnesyltransferase
WO1997003050A1 (fr) 1995-07-10 1997-01-30 Rhone-Poulenc Rorer S.A. DERIVES DE 4,9-ETHANO-BANZO(f)ISOINDOLE COMME INHIBITEURS DE FARNESYL TRANSFERASE
WO1997002920A1 (de) 1995-07-11 1997-01-30 Datacon Schweitzer & Zeindl Gmbh Anlage zum automatisierten, hermetischen verschliessen von gehäusen
WO1997003047A1 (fr) 1995-07-12 1997-01-30 Rhône-Poulenc Rorer S.A. Nouveaux inhibiteurs de farnesyl transferase, leur preparation et les compositions pharmaceutiques qui les contiennent
WO1997004785A1 (en) 1995-07-28 1997-02-13 Symphar S.A. Use of phenol substituted diphosphonates as antineoplastic agents
US6020343A (en) 1995-10-13 2000-02-01 Merck Frosst Canada, Inc. (Methylsulfonyl)phenyl-2-(5H)-furanones as COX-2 inhibitors
WO1997017070A1 (en) 1995-11-06 1997-05-15 University Of Pittsburgh Inhibitors of protein isoprenyl transferases
US6288237B1 (en) 1995-11-17 2001-09-11 Gesellschaft Fur Biotechnologische Forschung Mbh (Gbf) Epothilons C and D, preparation and compositions
WO1997018813A1 (en) 1995-11-22 1997-05-29 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
WO1997021701A1 (en) 1995-12-08 1997-06-19 Janssen Pharmaceutica N.V. Farnesyl protein transferase inhibiting (imidazol-5-yl)methyl-2-quinolinone derivatives
WO1997023478A1 (en) 1995-12-22 1997-07-03 Schering Corporation Tricyclic amides useful for inhibition of g-protein function and for treatment of proliferative diseases
WO1997026246A1 (en) 1996-01-16 1997-07-24 Warner-Lambert Company Substituted histidine inhibitors of protein farnesyltransferase
US5698584A (en) 1996-02-13 1997-12-16 Merck Frosst Canada, Inc. 3,4-diaryl-2-hydroxy-2,5-dihydrofurans as prodrugs to COX-2 inhibitors
WO1997030053A1 (en) 1996-02-16 1997-08-21 Biomeasure Incorporated Farnesyl transferase inhibitors
WO1997038665A2 (en) 1996-04-03 1997-10-23 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
US5932598A (en) 1996-04-12 1999-08-03 G. D. Searle & Co. Prodrugs of benzenesulfonamide-containing COX-2 inhibitors
US5998203A (en) 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
WO1997044350A1 (en) 1996-05-22 1997-11-27 Warner-Lambert Company Inhibitors of protein farnesyl transferase
WO1998002436A1 (en) 1996-07-15 1998-01-22 Bristol-Myers Squibb Company Thiadioxobenzodiazepine inhibitors of farnesyl protein transferase
US5861419A (en) 1996-07-18 1999-01-19 Merck Frosst Canad, Inc. Substituted pyridines as selective cyclooxygenase-2 inhibitors
US6001843A (en) 1996-07-18 1999-12-14 Merck & Co., Inc. Substituted pyridines as selective cyclooxygenase-2 inhibitors
US6284781B1 (en) 1996-12-03 2001-09-04 Sloan-Kettering Institute For Cancer Research Synthesis of epothilones, intermediates thereto, analogues and uses thereof
WO1998028980A1 (en) 1996-12-30 1998-07-09 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
WO1998029119A1 (en) 1996-12-30 1998-07-09 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
US6395713B1 (en) 1997-07-23 2002-05-28 Ribozyme Pharmaceuticals, Inc. Compositions for the delivery of negatively charged molecules
WO1999007409A1 (fr) 1997-08-04 1999-02-18 Societe De Conseils De Recherches Et D'applications Scientifiques (S.C.R.A.S.) Produit comprenant au moins un arn double brin en association avec au moins un agent anti-viral
WO1999032619A1 (en) 1997-12-23 1999-07-01 The Carnegie Institution Of Washington Genetic inhibition by double-stranded rna
WO2000001846A2 (en) 1998-07-03 2000-01-13 Devgen N.V. Characterisation of gene function using double stranded rna inhibition
WO2000044914A1 (en) 1999-01-28 2000-08-03 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
WO2000044777A1 (en) 1999-01-29 2000-08-03 Imclone Systems Incorporated Antibodies specific to kdr and uses thereof
WO2000044895A1 (de) 1999-01-30 2000-08-03 Roland Kreutzer Verfahren und medikament zur hemmung der expression eines vorgegebenen gens
WO2000050032A1 (en) 1999-02-25 2000-08-31 Pharmacia & Upjohn S.P.A. Antitumour synergistic composition
WO2000053722A2 (en) 1999-03-10 2000-09-14 Phogen Limited Delivery of nucleic acids and proteins to cells
WO2000061186A1 (en) 1999-04-08 2000-10-19 Arch Development Corporation Use of anti-vegf antibody to enhance radiation in cancer therapy
WO2001029058A1 (en) 1999-10-15 2001-04-26 University Of Massachusetts Rna interference pathway genes as tools for targeted genetic interference
WO2001030768A1 (en) 1999-10-27 2001-05-03 Cytokinetics, Inc. Methods and compositions utilizing quinazolinones
WO2001036646A1 (en) 1999-11-19 2001-05-25 Cancer Research Ventures Limited Inhibiting gene expression with dsrna
WO2001070677A1 (en) 2000-03-20 2001-09-27 Merck Sharp & Dohme Limited Sulphonamido-substituted bridged bicycloalkyl derivatives
WO2001090084A1 (en) 2000-05-24 2001-11-29 Merck Sharp & Dohme Limited Benzodiazepine derivatives as app modulators
WO2001098278A1 (en) 2000-06-21 2001-12-27 Cytokinetics, Inc. Methods and compositions utilizing quinazolinones
WO2002030912A1 (en) 2000-10-13 2002-04-18 Merck Sharp & Dohme Limited Benzodiazepine derivatives as inhibitors of gamma secretase
WO2002036555A1 (en) 2000-11-02 2002-05-10 Merck Sharp & Dohme Limited Sulfamides as gamma-secretase inhibitors
WO2002047671A2 (en) 2000-11-17 2002-06-20 Eli Lilly And Company Lactam compound to inhibit beta-amyloid peptide release or synthesis
US20020130430A1 (en) 2000-12-29 2002-09-19 Castor Trevor Percival Methods for making polymer microspheres/nanospheres and encapsulating therapeutic proteins and other products
WO2002081435A1 (en) 2001-04-05 2002-10-17 Merck Sharp & Dohme Limited Sulphones which modulate the action of gamma secretase
WO2002081433A1 (en) 2001-04-05 2002-10-17 Merck Sharp & Dohme Limited Sulphones which modulate the action of gamma secretase
WO2002083138A1 (en) 2001-04-10 2002-10-24 Merck & Co., Inc. Inhibitors of akt activity
WO2002083064A2 (en) 2001-04-10 2002-10-24 Merck & Co., Inc. A method of treating cancer
WO2002083140A1 (en) 2001-04-10 2002-10-24 Merck & Co., Inc. Inhibitors of akt activity
WO2002083139A1 (en) 2001-04-10 2002-10-24 Merck & Co., Inc. Inhibitors of akt activity
US20040116432A1 (en) 2001-04-10 2004-06-17 Carling William Robert Inhibitors of akt activity
WO2003013506A1 (en) 2001-08-06 2003-02-20 Merck Sharp & Dohme Limited Sulphonamides for control of beta-amyloid production
WO2003013526A1 (en) 2001-08-08 2003-02-20 Merck & Co. Inc. Anticoagulant compounds
WO2003018543A1 (en) 2001-08-21 2003-03-06 Merck Sharp & Dohme Limited Novel cyclohexyl sulphones
WO2003046185A1 (en) 2001-11-28 2003-06-05 Genta Salus Llc Polycationic water soluble copolymer and method for transferring polyanionic macromolecules across biological barriers
WO2003047518A2 (en) 2001-11-30 2003-06-12 Genta Salus Llc Cyclodextrin grafted biocompatible amphiphilic polymer and methods of preparation and use thereof
WO2003050122A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003049678A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003050064A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003049679A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003049527A2 (en) 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003105855A1 (en) 2002-01-11 2003-12-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003079973A2 (en) 2002-03-08 2003-10-02 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003086279A2 (en) 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
WO2003086403A1 (en) 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
WO2003086404A1 (en) 2002-04-08 2003-10-23 Merck & Co., Inc. Fused quinoxaline derivatives as inhibitors of akt activity
WO2003084473A2 (en) 2002-04-08 2003-10-16 Merck & Co., Inc. Method of treating cancer
WO2003086394A1 (en) 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
WO2003093252A1 (en) 2002-05-01 2003-11-13 Merck Sharp & Dohme Limited Heteroaryl substituted spirocyclic sulfamides for inhibition of gamma secretase
WO2003093251A1 (en) 2002-05-01 2003-11-13 Merck Sharp & Dohme Limited Alkenyl-substituted spirocyclic sulfamides as inhibitors of gamma-secretase
WO2003093253A1 (en) 2002-05-01 2003-11-13 Merck Sharp & Dohme Limited Alkynyl-substituted spirocyclic sulfamides for the treatment of alzheimer's disease
WO2003093264A1 (en) 2002-05-01 2003-11-13 Merck Sharp & Dohme Limited Oxadiazole derivatives for inhibition of gamma secretase
WO2003099211A2 (en) 2002-05-23 2003-12-04 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004039774A2 (en) 2002-05-23 2004-05-13 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003106417A1 (en) 2002-06-14 2003-12-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004012669A2 (en) 2002-08-01 2004-02-12 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory arthropathies with suppressors of cpg oligonucleotides
WO2004031137A1 (en) 2002-10-04 2004-04-15 Merck Sharp & Dohme Limited Cyclohexyl sulphone derivatives as gamma-secretase inhibitors
WO2004031138A1 (en) 2002-10-04 2004-04-15 Merck Sharp & Dohme Limited Novel sulphones for inhibition of gamma secretase
WO2004031139A1 (en) 2002-10-04 2004-04-15 Merck Sharp & Dohme Limited Cyclohexyl sulphones as gamma-secretase inhibitors
WO2004037171A2 (en) 2002-10-18 2004-05-06 Merck & Co., Inc. Mitotic kinesin inhibitors
US20040102360A1 (en) 2002-10-30 2004-05-27 Barnett Stanley F. Combination therapy
WO2004041162A2 (en) 2002-10-30 2004-05-21 Merck & Co., Inc. Inhibitors of akt activity
WO2004039370A1 (en) 2002-11-01 2004-05-13 Merck Sharp & Dohme Limited Sulfonamides, sulfamates and sulfamides as gamma-secretase inhibitors
WO2004039800A1 (en) 2002-11-01 2004-05-13 Merck Sharp & Dohme Limited Cyclic sulfamides for inhibition of gamma-secretase
WO2004058148A2 (en) 2002-12-20 2004-07-15 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004058700A2 (en) 2002-12-20 2004-07-15 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004089911A1 (en) 2003-04-10 2004-10-21 Merck Sharp & Dohme Limited Pyrazole derivatives as gamma-secretase inhibitors useful in the treatment of alzheimer’s disease
WO2004096131A2 (en) 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
WO2004096129A2 (en) 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
WO2004096130A2 (en) 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
WO2004096135A2 (en) 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
WO2004101539A1 (en) 2003-05-16 2004-11-25 Merck Sharp & Dohme Limited Cyclic sulfonamides for inhibition of gamma-secretase
WO2004101538A1 (en) 2003-05-16 2004-11-25 Merck Sharp & Dohme Limited Cyclohexyl sulphones as gamma-secretase inhibitors
WO2005014553A1 (en) 2003-08-05 2005-02-17 Merck Sharp & Dohme Limited Novel gamma-secretase inhibitors
WO2005018638A1 (en) 2003-08-13 2005-03-03 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005019205A1 (en) 2003-08-15 2005-03-03 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005018547A2 (en) 2003-08-15 2005-03-03 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005019206A1 (en) 2003-08-15 2005-03-03 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005017190A2 (en) 2003-08-15 2005-02-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2005030731A1 (en) 2003-09-24 2005-04-07 Merck Sharp & Dohme Limited Gamma-secretase inhibitors
US20050176776A1 (en) 2004-02-06 2005-08-11 Coleman Paul J. Mitotic kinesin inhibitors
WO2005100356A1 (en) 2004-04-09 2005-10-27 Merck & Co., Inc. Inhibitors of akt activity
WO2005100344A1 (en) 2004-04-09 2005-10-27 Merck & Co., Inc. Inhibitors of akt activity
WO2009127060A1 (en) 2008-04-15 2009-10-22 Protiva Biotherapeutics, Inc. Novel lipid formulations for nucleic acid delivery
WO2010042877A1 (en) 2008-10-09 2010-04-15 Tekmira Pharmaceuticals Corporation Improved amino lipids and methods for the delivery of nucleic acids
WO2010048536A2 (en) 2008-10-23 2010-04-29 Alnylam Pharmaceuticals, Inc. Processes for preparing lipids
WO2010054401A1 (en) 2008-11-10 2010-05-14 Alnylam Pharmaceuticals, Inc. Novel lipids and compositions for the delivery of therapeutics
WO2010088537A2 (en) 2009-01-29 2010-08-05 Alnylam Pharmaceuticals, Inc. Improved lipid formulation
WO2010144740A1 (en) 2009-06-10 2010-12-16 Alnylam Pharmaceuticals, Inc. Improved lipid formulation

Non-Patent Citations (72)

* Cited by examiner, † Cited by third party
Title
"Delivery Strategies for Antisense Oligonucleotide Therapeutics", 1995
"The Guide for Care and Use of Laboratory Animals", 1996, NATIONAL ACADEMY PRESS
AKHTAR ET AL., TRENDS CELL BIO., vol. 2, 1992, pages 139
ALDRIAN-HERRADA ET AL., NUCLEIC ACIDS RES., vol. 26, 1998, pages 4910 - 4916
ALLSHIRE, SCIENCE, vol. 297, 2002, pages 1818 - 1819
AMBROS, NATURE, vol. 431, 2004, pages 350 - 355
ANAT. REC., vol. 238, 1994, pages 68
ARCH. OPHTHAMOL., vol. 119, 2001, pages 709 - 717
ARCH. OPTHALMOL., vol. 108, 1990, pages 573
BARTEL, CELL, vol. 116, 2004, pages 281 - 297
BASS, NATURE, vol. 411, 2001, pages 428 - 429
BOADO ET AL., J. PHARM. SCI., vol. 87, 1998, pages 1308 - 1315
BOADO, ADV. DRUG DELIVERY REV., vol. 15, 1995, pages 73 - 107
BUME-JENSEN; HUNTER, NATURE, vol. 411, 2001, pages 355 - 365
CANCER RES., vol. 57, 1997, pages 1625
CELL, vol. 93, 1998, pages 705
CLIN, ORTHOP., vol. 313, 1995, pages 76
CLIN. CHEM. LA. MED., vol. 38, 2000, pages 679 - 692
CULLEN, VIRUS RESEARCH., vol. 102, 2004, pages 3 - 9
ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188
ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 498
EMERICH, DF ET AL., CELL TRANSPLANT, vol. 8, 1999, pages 47 - 58
EUROPEAN J. OF CANCER, vol. 35, no. 9, 1999, pages 1394 - 1401
FEBS LETTERS, vol. 372, 1995, pages 83
FERNANDEZ ET AL., J. LAB. CLIN. MED., vol. 105, 1985, pages 141 - 145
FRIER ET AL., PROC. NAT. ACAD. SCI. USA, vol. 83, 1986, pages 9373 - 9377
GONZALEZ ET AL., BIOCONJUGATE CHEM., vol. 10, 1999, pages 1068 - 1074
HALL ET AL., SCIENCE, vol. 297, 2002, pages 2232 - 2237
HE ET AL., NAT. REV. GENET., vol. 5, 2004, pages 522 - 531
HOFLAND; HUANG, HANDB. EXP. PHARMACOL., vol. 137, 1999, pages 165 - 192
HUTVAGNER; ZAMORE, SCIENCE, vol. 297, 2002, pages 2056 - 60
INTL. J. MOL. MED., vol. 2, 1998, pages 715
INVEST. OPHTHALMOL VIS. SCI., vol. 41, 2000, pages 2309 - 2317
J. BIOL. CHEM., vol. 274, 1999, pages 9116
J. BIOL. CHEM., vol. 274, 1999, pages 9116 - 9121
J. CARDIOVASC. PHARMACOL., vol. 31, 1998, pages 909 - 913
J. MOL. ENDOCRINOL., vol. 16, 1996, pages 107
JANOWSKI ET AL., NATURE CHEMICAL BIOLOGY, vol. 1, 2005, pages 216 - 222
JENUWEIN, SCIENCE, vol. 297, 2002, pages 2215 - 2218
JNCI, vol. 69, 1982, pages 475
JPN. J. PHARMACOL., vol. 75, 1997, pages 105
KIM ET AL., NATURE, vol. 362, 1993, pages 841 - 844
LEE ET AL., ACS SYMP. SER., vol. 752, 2000, pages 184 - 192
LOAKES, NUCLEIC ACIDS RESEARCH, vol. 29, 2001, pages 2437 - 2447
M. YALPANI: "Cholesterol Lowering Drugs", CHEMISTRY & INDUSTRY, 5 February 1996 (1996-02-05), pages 85 - 89, XP001525979
MARTINEZ ET AL., CELL, vol. 110, 2002, pages 563 - 574
MAURER ET AL., MOL. MEMBR. BIOL., vol. 16, 1999, pages 129 - 140
MCMANUS ET AL., RNA, vol. 8, 2002, pages 842 - 850
MILLER, T.A. ET AL., J. MED. CHEM., vol. 46, no. 24, 2003, pages 5097 - 5116
NATURE BIOTECHNOLOGY, vol. 17, October 1999 (1999-10-01), pages 963 - 968
NATURE BIOTECHNOLOGY, vol. 28, 2010, pages 172 - 176
PAL-BHADRA ET AL., SCIENCE, vol. 303, 2004, pages 669 - 672
PARDRIDGE ET AL., PNAS USA, vol. 92, 1995, pages 5592 - 5596
PNAS, vol. 89, 1992, pages 7384
REINHART ET AL., GENE & DEV., vol. 16, 2002, pages 1616 - 1626
REINHART; BARTEL, SCIENCE, vol. 297, 2002, pages 1831
SCHWARZ ET AL., MOLECULAR CELL, vol. 10, 2002, pages 537 - 568
SEMPLE ET AL., NAT BIOTECHNOL., vol. 28, no. 2, February 2010 (2010-02-01), pages 172 - 6
SETHUPATHY ET AL., RNA, vol. 12, 2006, pages 192 - 197
SNYDER; GERSTEIN, SCIENCE, vol. 300, 2003, pages 258 - 260
THROMB. HAEMOST., vol. 80, 1998, pages 10 - 23
THROMBOSIS RES., vol. 101, 2001, pages 329 - 354
TURNER ET AL., CSH SYMP. QUANT. BIOL., vol. LII, 1987, pages 123 - 133
TURNER ET AL., J. AM. CHEM. SOC., vol. 109, 1987, pages 3783 - 3785
TYLER ET AL., FEBS LETT., vol. 421, 1999, pages 280 - 284
TYLER ET AL., PNAS USA, vol. 96, 1999, pages 7053 - 7058
VAUGHN; MARTIENSSEN, SCIENCE, vol. 309, 2005, pages 1525 - 1526
VERDEL ET AL., SCIENCE, vol. 303, 2004, pages 672 - 676
VOLPE ET AL., SCIENCE, vol. 297, 2002, pages 1833 - 1837
YING ET AL., GENE, vol. 342, 2004, pages 25 - 28
ZAMORE ET AL., CELL, vol. 101, 2000, pages 25 - 33
ZAMORE; HALEY, SCIENCE, vol. 309, 2005, pages 1519 - 1524

Cited By (97)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2512491B1 (en) 2009-10-16 2017-10-11 Glaxo Group Limited Hbv antisense inhibitors
AU2016202433B2 (en) * 2010-09-20 2018-01-18 Sirna Therapeutics, Inc. Novel low molecular weight cationic lipids for oligonucleotide delivery
EP3144015A3 (en) * 2010-09-20 2017-04-19 Sirna Therapeutics, Inc. Novel low molecular weight cationic lipids for oligonucleotide delivery
US11413348B2 (en) 2010-09-20 2022-08-16 Sirna Therepeutics, Inc. Low molecular weight cationic lipids for oligonucleotide delivery
US11911475B2 (en) 2010-09-20 2024-02-27 Sirna Therapeutics, Inc. Low molecular weight cationic lipids for oligonucleotide delivery
US20180000939A1 (en) * 2010-09-20 2018-01-04 Sirna Therapeutics, Inc. Novel low molecular weight cationic lipids for oligonucleotide delivery
US10576155B2 (en) * 2010-09-20 2020-03-03 Sirna Thereapeutics, Inc. Low molecular weight cationic lipids for oligonucleotide delivery
EP3943114A1 (en) * 2010-09-20 2022-01-26 Sirna Therapeutics, Inc. Novel low molecular weight cationic lipids for oligonucleotide delivery
US9034841B2 (en) 2011-04-21 2015-05-19 Isis Pharmaceuticals, Inc. Modulation of hepatitis B virus (HBV) expression
US9677076B2 (en) 2011-04-21 2017-06-13 Ionis Pharmaceuticals, Inc. Modulation of hepatitis B virus (HBV) expression
US9127278B2 (en) 2011-04-21 2015-09-08 Isis Pharmaceuticals, Inc. Modulation of hepatitis B virus (HBV) expression
USRE48345E1 (en) 2011-06-30 2020-12-08 Arrowhead Pharmaceuticals Inc. Compositions and methods for inhibiting gene expression of hepatitis B virus
JP2017169568A (ja) * 2011-06-30 2017-09-28 アローヘッド ファーマシューティカルズ インコーポレイテッド B型肝炎ウイルスの遺伝子発現を阻害するための組成物および方法
JP2019141077A (ja) * 2011-06-30 2019-08-29 アローヘッド ファーマシューティカルズ インコーポレイテッド B型肝炎ウイルスの遺伝子発現を阻害するための組成物および方法
US10767181B2 (en) 2014-05-15 2020-09-08 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US11591598B2 (en) 2014-05-15 2023-02-28 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US12281307B2 (en) 2014-05-15 2025-04-22 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US10421967B2 (en) 2014-05-15 2019-09-24 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US10415037B2 (en) * 2014-10-02 2019-09-17 Arbutus Biopharma Corporation Compositions and methods for silencing hepatitis B virus gene expression
EP3647424A1 (en) * 2014-11-10 2020-05-06 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
TWI769565B (zh) * 2014-11-10 2022-07-01 美商阿尼拉製藥公司 B型肝炎病毒(HBV)iRNA組成物及其用途方法
US11060091B2 (en) 2014-11-10 2021-07-13 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) iRNA compositions and methods of use thereof
US10513703B2 (en) 2014-11-10 2019-12-24 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) iRNA compositions and methods of use thereof
AU2015346566B2 (en) * 2014-11-10 2021-09-09 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) iRNA compositions and methods of use thereof
AU2021277625B2 (en) * 2014-11-10 2024-02-29 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) iRNA compositions and methods of use thereof
US10640770B2 (en) 2014-11-10 2020-05-05 Alnylam Pharmaceuticals, Inc. Hepatitis D virus (HDV) iRNA compositions and methods of use thereof
WO2016077321A1 (en) * 2014-11-10 2016-05-19 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
KR20170077250A (ko) * 2014-11-10 2017-07-05 알닐람 파마슈티칼스 인코포레이티드 B형 간염 바이러스(hbv) irna 조성물 및 그의 이용 방법
KR20230088857A (ko) * 2014-11-10 2023-06-20 알닐람 파마슈티칼스 인코포레이티드 B형 간염 바이러스(hbv) irna 조성물 및 그의 이용 방법
EA039127B1 (ru) * 2015-03-24 2021-12-08 Элнилэм Фармасьютикалз, Инк. КОМПОЗИЦИИ НА ОСНОВЕ iRNA ПРОТИВ ВИРУСА ГЕПАТИТА В (HBV) И СПОСОБЫ ИХ ПРИМЕНЕНИЯ
EP3292202A4 (en) * 2015-05-06 2019-04-10 Benitec Biopharma Limited REAGENTS FOR THE TREATMENT OF HEPATITIS B VIRUS INFECTION AND USE THEREOF
AU2016257150B2 (en) * 2015-05-06 2022-03-31 Benitec IP Holdings Inc. Reagents for treatment of hepatitis B virus (HBV) infection and use thereof
US10898505B2 (en) 2015-05-06 2021-01-26 Benitec Biopharma Limited Reagents for treatment of hepatitis B virus (HBV) infection and use thereof
US11685921B2 (en) 2015-07-17 2023-06-27 Arcturus Therapeutics, Inc. Molecules and agents for treating hepatitis B virus
US10961535B2 (en) 2015-07-17 2021-03-30 Arcturus Therapeutics, Inc. Compositions and agents against hepatitis B virus and uses thereof
US11534453B2 (en) 2015-08-07 2022-12-27 Arrowhead Pharmaceuticals, Inc. RNAi therapy for hepatitis B virus infection
US10709727B2 (en) 2015-11-09 2020-07-14 Idac Theranostics, Inc. Antiviral drugs
EP3395363A4 (en) * 2015-11-09 2019-08-28 IDAC Theranostics, Inc. ANTIVIRAL MEDICINAL PRODUCT
WO2017157899A1 (en) 2016-03-14 2017-09-21 F. Hoffmann-La Roche Ag Oligonucleotides for reduction of pd-l1 expression
US10829555B2 (en) 2016-03-14 2020-11-10 Hoffman-La Roche Inc. Oligonucleotides for reduction of PD-L1 expression
US10745480B2 (en) 2016-03-14 2020-08-18 Hoffmann-La Roche, Inc. Oligonucleotides for reduction of PD-L1 expression
US11466081B2 (en) 2016-03-14 2022-10-11 Hoffmann-La Roche Inc. Oligonucleotides for reduction of PD-L1 expression
EP3786297A1 (en) 2016-03-14 2021-03-03 F. Hoffmann-La Roche AG Oligonucleotides for reduction of pd-l1 expression
EP4219767A1 (en) 2016-06-17 2023-08-02 F. Hoffmann-La Roche AG Papd5 and papd7 inhibitors for treating a hepatitis b infection
WO2017216390A1 (en) 2016-06-17 2017-12-21 F. Hoffmann-La Roche Ag Nucleic acid molecules for reduction of papd5 or papd7 mrna for treating hepatitis b infection
US11191775B2 (en) 2016-06-17 2021-12-07 Hoffmann-La Roche Inc. PAPD5 and PAPD7 inhibitors for treating a hepatitis B infection
WO2017216391A1 (en) 2016-06-17 2017-12-21 F. Hoffmann-La Roche Ag Papd5 and papd7 inhibitors for treating a hepatitis b infection
US11534452B2 (en) 2016-06-17 2022-12-27 Hoffmann-La Roche Inc. Nucleic acid molecules for reduction of PAPD5 or PAPD7 mRNA for treating hepatitis B infection
US11590156B2 (en) 2016-08-04 2023-02-28 Arrowhead Pharmaceuticals, Inc. RNAi agents for hepatitis B virus infection
US11517584B2 (en) 2016-08-04 2022-12-06 Arrowhead Pharmaceuticals, Inc. RNAi agents for Hepatitis B virus infection
WO2018106980A1 (en) * 2016-12-08 2018-06-14 Mallinckrodt Llc Liposomal elinafide formulations and uses thereof
IL269927B2 (en) * 2017-04-18 2025-04-01 Alnylam Pharmaceuticals Inc Methods of treating patients with hepatitis B virus infection
WO2018195165A1 (en) 2017-04-18 2018-10-25 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (hbv) infection
US11324820B2 (en) 2017-04-18 2022-05-10 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (HBV) infection
WO2019076842A1 (en) 2017-10-16 2019-04-25 F. Hoffmann-La Roche Ag NUCLEIC ACID MOLECULE FOR THE REDUCTION OF PAPD5 AND PAPD7 MRNA FOR THE TREATMENT OF HEPATITIS B INFECTION
US12303525B2 (en) 2017-10-16 2025-05-20 Hoffman-La Roche Inc. Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection
US11484546B2 (en) 2017-10-16 2022-11-01 Hoffman-La Roche Inc. Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection
US10953034B2 (en) 2017-10-16 2021-03-23 Hoffmann-La Roche Inc. Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection
US11660347B2 (en) 2017-12-01 2023-05-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing same, preparation method, and use thereof
US11414661B2 (en) 2017-12-01 2022-08-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
US12083142B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US11414665B2 (en) 2017-12-01 2022-08-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US12428642B2 (en) 2017-12-01 2025-09-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, preparation method and use thereof
US12084661B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US11492620B2 (en) 2017-12-01 2022-11-08 Suzhou Ribo Life Science Co., Ltd. Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method thereof and use thereof
EP3718572A4 (en) * 2017-12-01 2021-09-08 Suzhou Ribo Life Science Co., Ltd. NUCLEIC ACID, COMPOSITION AND CONJUGATE WITH NUCLEIC ACID, METHOD FOR PRODUCING IT AND USING IT
US12274752B2 (en) 2017-12-01 2025-04-15 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing same, preparation method, and use thereof
US11633482B2 (en) 2017-12-29 2023-04-25 Suzhou Ribo Life Science Co., Ltd. Conjugates and preparation and use thereof
US11732262B2 (en) 2018-04-05 2023-08-22 Hoffmann—La Roche, Inc. Use of FUBP1 inhibitors for treating hepatitis B virus infection
WO2019193165A1 (en) 2018-04-05 2019-10-10 F. Hoffmann-La Roche Ag Use of fubp1 inhibitors for treating hepatitis b virus infection
US11279929B2 (en) 2018-07-03 2022-03-22 Hoffmann-La Roche, Inc. Oligonucleotides for modulating Tau expression
US12163131B2 (en) 2018-07-03 2024-12-10 Hoffmann-La Roche Inc. Oligonucleotides for modulating Tau expression
US11753640B2 (en) 2018-07-03 2023-09-12 Hoffmann-La Roche Inc. Oligonucleotides for modulating Tau expression
EP4512407A2 (en) 2018-07-13 2025-02-26 F. Hoffmann-La Roche AG Oligonucleotides for modulating rtel1 expression
WO2020011902A1 (en) 2018-07-13 2020-01-16 F. Hoffmann-La Roche Ag Oligonucleotides for modulating rtel1 expression
US12497621B2 (en) 2018-07-13 2025-12-16 Hoffmann-La Roche Inc. Oligonucleotides for modulating RTEL1 expression
US12173289B2 (en) 2018-08-13 2024-12-24 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) dsRNA agent compositions and methods of use thereof
US11492623B2 (en) 2018-08-13 2022-11-08 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) dsRNA agent compositions and methods of use thereof
US11918600B2 (en) 2018-08-21 2024-03-05 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition and conjugate containing nucleic acid, and use thereof
WO2020038377A1 (zh) * 2018-08-21 2020-02-27 苏州瑞博生物技术有限公司 一种核酸、含有该核酸的药物组合物和缀合物及其用途
US11896674B2 (en) 2018-09-30 2024-02-13 Suzhou Ribo Life Science Co., Ltd. SiRNA conjugate, preparation method therefor and use thereof
US20220016155A1 (en) * 2018-11-16 2022-01-20 Tokyo Metropolitan Institute Of Medical Science Composition for Inhibiting Replication of Hepatitis B Virus
US12458658B2 (en) 2018-11-16 2025-11-04 Tokyo Metropolitan Institute Of Medical Science Composition for inhibiting replication of hepatitis B virus
EP3881850A4 (en) * 2018-11-16 2022-08-24 Tokyo Metropolitan Institute of Medical Science COMPOSITION FOR INHIBITING HEPATITIS B VIRUS REPLICATION
CN113038955A (zh) * 2018-11-16 2021-06-25 公益财团法人东京都医学总合研究所 用于抑制乙型肝炎病毒复制的组合物
US12496347B2 (en) 2018-12-28 2025-12-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
US12497622B2 (en) 2019-05-22 2025-12-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
WO2021122869A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of scamp3 inhibitors for treating hepatitis b virus infection
WO2021122993A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of saraf inhibitors for treating hepatitis b virus infection
WO2021122735A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of sept9 inhibitors for treating hepatitis b virus infection
WO2021122910A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of sbds inhibitors for treating hepatitis b virus infection
WO2021122921A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of cops3 inhibitors for treating hepatitis b virus infection
WO2022038211A2 (en) 2020-08-21 2022-02-24 F. Hoffmann-La Roche Ag Use of a1cf inhibitors for treating hepatitis b virus infection
WO2022038211A3 (en) * 2020-08-21 2022-04-28 F. Hoffmann-La Roche Ag Use of a1cf inhibitors for treating hepatitis b virus infection
US11898145B2 (en) 2021-02-02 2024-02-13 Hoffmann-La Roche Inc. Enhanced oligonucleotides for inhibiting RTEL1 expression
WO2022167456A1 (en) 2021-02-02 2022-08-11 F. Hoffmann-La Roche Ag Enhanced oligonucleotides for inhibiting rtel1 expression
WO2023111210A1 (en) 2021-12-17 2023-06-22 F. Hoffmann-La Roche Ag Combination of oligonucleotides for modulating rtel1 and fubp1

Also Published As

Publication number Publication date
CN103282497A (zh) 2013-09-04
DK2606134T3 (da) 2019-07-22
KR20130137156A (ko) 2013-12-16
RU2013111850A (ru) 2014-09-27
JP6529481B2 (ja) 2019-06-12
KR20200013083A (ko) 2020-02-05
US10407682B2 (en) 2019-09-10
RU2624045C2 (ru) 2017-06-30
US9879262B2 (en) 2018-01-30
KR102072631B1 (ko) 2020-02-03
CA2807307A1 (en) 2012-02-23
CN103282497B (zh) 2018-07-10
US9029341B2 (en) 2015-05-12
JP2019141101A (ja) 2019-08-29
US20200199596A1 (en) 2020-06-25
US20180195071A1 (en) 2018-07-12
HRP20191232T1 (hr) 2019-11-01
RU2017121299A (ru) 2019-01-29
CN108676800B (zh) 2022-11-11
CA2807307C (en) 2021-02-09
JP2013537423A (ja) 2013-10-03
JP6921144B2 (ja) 2021-08-18
US10793860B2 (en) 2020-10-06
AU2011292261A1 (en) 2013-02-07
EP2606134A2 (en) 2013-06-26
HUE044815T2 (hu) 2019-11-28
US20130150433A1 (en) 2013-06-13
JP2017079759A (ja) 2017-05-18
RU2745848C2 (ru) 2021-04-01
SI2606134T1 (sl) 2019-08-30
WO2012024170A3 (en) 2012-05-18
KR102413007B1 (ko) 2022-06-24
JP2021176318A (ja) 2021-11-11
US20160076034A1 (en) 2016-03-17
EP2606134A4 (en) 2015-04-22
EP2606134B1 (en) 2019-04-10
EP3587574A1 (en) 2020-01-01
AU2011292261B2 (en) 2015-05-14
LT2606134T (lt) 2019-07-25
US9464290B2 (en) 2016-10-11
CN108676800A (zh) 2018-10-19
RU2017121299A3 (enExample) 2021-01-26
US20160369279A1 (en) 2016-12-22
EP4079856A1 (en) 2022-10-26
JP2023052480A (ja) 2023-04-11
EP3587574B1 (en) 2022-03-16

Similar Documents

Publication Publication Date Title
US10793860B2 (en) RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (SINA)
US20240247271A1 (en) Rna interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (ctnnb1) gene expression using short interfering nucleic acid (sina)
WO2011130065A1 (en) RNA INTERFERENCE MEDIATED INHIBITION OF MET GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
AU2019264591B2 (en) RNA interference mediated inhibition of hepatitis B virus (HBV) gene expression using short interfering nucleic acid (siNA)
HK40020778A (en) Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11818592

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2807307

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2011292261

Country of ref document: AU

Date of ref document: 20110812

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013524886

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13817152

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011818592

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20137006656

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013111850

Country of ref document: RU

Kind code of ref document: A