Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
  • A61K31/07—Retinol compounds, e.g. vitamin A
• • C—CHEMISTRY; METALLURGY
  • C30—CRYSTAL GROWTH
  • C30B—SINGLE-CRYSTAL GROWTH; UNIDIRECTIONAL SOLIDIFICATION OF EUTECTIC MATERIAL OR UNIDIRECTIONAL DEMIXING OF EUTECTOID MATERIAL; REFINING BY ZONE-MELTING OF MATERIAL; PRODUCTION OF A HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; SINGLE CRYSTALS OR HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; AFTER-TREATMENT OF SINGLE CRYSTALS OR A HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE; APPARATUS THEREFOR
  • C30B29/00—Single crystals or homogeneous polycrystalline material with defined structure characterised by the material or by their shape
  • C30B29/02—Elements
  • C30B29/04—Diamond
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
  • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
  • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
  • A61K47/10—Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
  • A61K47/6905—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
  • A61K47/6911—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/0012—Galenical forms characterised by the site of application
  • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/10—Dispersions; Emulsions
  • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P11/00—Drugs for disorders of the respiratory system
  • A61P11/04—Drugs for disorders of the respiratory system for throat disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P27/00—Drugs for disorders of the senses
  • A61P27/16—Otologicals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/14—Antivirals for RNA viruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/18—Growth factors; Growth regulators
  • A61K38/1833—Hepatocyte growth factor; Scatter factor; Tumor cytotoxic factor II
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/18—Growth factors; Growth regulators
  • A61K38/1841—Transforming growth factor [TGF]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/18—Growth factors; Growth regulators
  • A61K38/1858—Platelet-derived growth factor [PDGF]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
  • Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
  • Y10T428/00—Stock material or miscellaneous articles
  • Y10T428/29—Coated or structually defined flake, particle, cell, strand, strand portion, rod, filament, macroscopic fiber or mass thereof
  • Y10T428/2982—Particulate matter [e.g., sphere, flake, etc.]

Definitions

• the present invention relates to a drug carrier used in a drug delivery system (DDS) to stellate cells, a medicament containing the same, and a preparation kit for the medicament, in particular, a drug whose active ingredient controls the activity or proliferation of stellate cells,
• a pharmaceutical and its drug that targets an extracellular matrix constituent molecule secreted by stellate cells or a drug that targets one or more molecules that function to produce or secrete an extracellular matrix constituent molecule
• Liver fibrosis is not limited to, for example, viral liver disease caused by hepatitis B or C virus, non-alcoholic steatohepatitis, malnutrition diabetes, parasite, tuberculosis or Hepatic stellate cells (HSC) are activated and excessive as a result of wound healing mechanisms such as infectious diseases such as syphilis, depressive blood in the liver due to heart disease, or tissue damage in the liver due to impaired bile passage. It is produced and secreted by multiple types of collagen molecules.
• the final image of liver fibrosis is cirrhosis, which may cause liver failure or hepatocellular carcinoma, etc., and at least suppress liver fibrosis in order to prevent them and / or suppress their progression. Development of drug carriers and drug carrier kits is desired.
• stellate cells may be an important target candidate (Fallowfield JA, Iredale JP, Expert Opin Ther Targets. 20 04 Oct; 8 (5): 423-35; Pinzani M, Rombouts K. Dig Liver Dis. 2004 Apr; 36 (4): 231-42.
• stellate cells are induced by site force in from Kupffer cells and infiltrating cells. Activated and transformed into activated cells to produce extracellular matrix (ECM) markedly.
• ECM extracellular matrix
• Astrocytes are known as vitamin A storage cells and belong to the myofibroblast family.
• stellate cells produce matrix-degrading enzyme (MMP), its inhibitory factor (TIMP), site force-in such as TGF- ⁇ and PDGF, and growth factors such as HGF, and play a central role in liver fibrosis. Fulfill. Activated stellate cells have increased contractility and are involved in blood flow regulation, and also increased the expression of various site force-in receptors and become highly sensitive to site force-in.
• MMP matrix-degrading enzyme
• TGF- ⁇ and PDGF site force-in
• HGF growth factors
• TGF ⁇ type II receptor Qi Z et al., Proc Natl Aca d Sci US A. 1999 Mar 2; 96 (5): 2345_9.
• soluble TGF ⁇ type II receptor G eorge J et al., Proc Natl Acad Sci US A. 1999 Oct 26; 96 (22): 12719-24.
• HGF Japanese Patent Publication No. 5-503076; Ueki K et al., Nat Med. 1999 Feb; 5 (2): 226_30.
• HSP47 is a collagen-specific molecular chaperone that is essential for intracellular transport and molecular maturation common to the synthesis of various types of collagen. Therefore, if the function of HSP47 can be specifically controlled in stellate cells, it may be possible to suppress liver fibrosis. However, there have been no reports on such treatments.
• siRNA small intefering RNAs
• RNAi RNA interference
• RNAi is a phenomenon that destroys the homologous part of the transcript (mRNA) of a gene that is homologous to a gene and consists of sense RNA and antisense RNA (double-strand RNA; dsRNA).
• mRNA homologous part of the transcript
• dsRNA double-strand RNA
• Patent Document 1 Japanese Patent Publication No. 5-503076
• Non-Patent Document 1 Madro A et al., Med Sci Monit. 2004 Jul; 10 (7): RA166-70
• Non-Patent Document 2 Jaster R, Mol Cancer. 2004 Oct 06; 3 (l): 26
• Non-Patent Document 3 Fallowfield JA, Iredale JP, Expert Opin Ther Targets. 2004 Oct; 8 (5): 423-35
• Non-Patent Document 4 Pinzani M, Rombouts K. Dig Liver Dis. 2004 Apr; 36 (4): 231_42
• Non-Patent Document 5 Qi Z et al., Proc Natl Acad Sci USA. 1999 Mar 2; 96 (5): 2345_9
• Patent Document 6 George J et al., Proc Natl Acad Sci U SA. 1999 Oct 26; 96 (22): 12719-24
• Non-Patent Document 7 Ueki K et al. Nat Med. 1999 Feb; 5 (2): 226-30
• Non-Patent Document 8 Iimuro Y et al., Gastroenterology 2003; 124: 445-458
• Non-Patent Document 9 Liu WB et al., World J Gastroenterol. 2003 Feb; 9 (2): 316_9
• Non-Patent Document 10 Marra F et al., Gastroenterology. 2000 Aug 19 (2): 466-78
• Non-Patent Document ll Yoshiji H et al., Hepatology. 2001 Oct; 34 (4 Pt 1): 745-50
• Non-Patent Document 12 Liu XJ et al., World J Gastroenterol. 2002 Aug; 8 (4): 739-45
• Non-Patent Document 13 Benedetti A et al., Gastroenterology.2001 Feb; 120 (2): 545_56
• Non-Patent Document 14 Wang L et al., World J Gastroenterol 2004 October 1; 10 (19): 2831_28
• Non-Patent Document 15 Orr JG et al., Hepatology. 2004 Jul; 40 (l): 232-42
• Non-Patent Document 16 Sasaki H et al., Journal of Immunology, 2002, 168: 5178-83
• Non-Patent Document 17 Hagiwara S et al., J Gene Med. 2003, 5: 784-94
• Non-Patent Document 18 Fire A et al .: Nature (1998) 391: 806-811
• Non-Patent Document 19 Ui_Tei K et al .: FEBS Lett (2000) 479: 79-82
• Non-Patent Document 20 Elbashir SM et al .: Nature (2001) 411: 494-498
• Non-Patent Document 21 Yasuhiko Tabata, Drug Delivery System New Development of DDS Technology and Its Utilization—Biomedical Research ⁇ Cutting-edge Technology Medical Dow for Advanced Medicine, IS BN: 4944157932, 2003
• Non-Patent Document 22 Mitsuhashi Hashida, Drug Delivery System—A New Challenge to Drug Discovery and Treatment, New Bioscience Series, Chemistry Dojin, ISBN: 4759803858, 1995
• DDS drug delivery system
• the present invention relates to a drug carrier and a drug carrier kit that enable specific delivery of a diagnostic and / or therapeutic drug to stellate cells.
• the drug carrier in the present invention may be in the form of any of high molecular micelles, ribosomes, emulsions, microspheres, nanoglobules, and vitamin A (VA) or retinoid derivatives such as tretinoin, adapalene, retinol palmitate.
• a force that binds a vitamin A analog, such as Fenretinide (4_HPR) allows the therapeutic drug to be delivered specifically to hepatic stellate cells.
• TGF j3 activity-inhibiting simultaneous lj such as truncated TGF j3 type II rec tor and soluble TGF j3 type II rec tor, growth factor preparation such as HGF, MMP such as adenovirus vector containing MMP gene Production promoters, PPAR y-ligana, angiotensin- II type I receptor antagonist ⁇ PDw teronkinase inhibitor, and cell activation inhibitor and / or growth inhibitor, including sodium channel inhibitors such as amidolide, and compound 861, and one or more molecules selected from among apoptosis-inducing agents such as gliotoxin Orally or non-administered to patients with force at risk of fibrosis or symptoms of fibrosis, or with various diseases associated with fibrosis such as cirrhosis, liver failure, liver cancer, or chronic knee inflammation
• apoptosis-inducing agents such as gliotoxin Orally or non-administered to patients with
• a ribozyme, antisense RNA, or siRNA that specifically suppresses collagen-specific molecular chaperone, HSP47 or MMP inhibitor, TIMP is encapsulated in the drug carrier.
• a ribozyme, antisense RNA, or siRNA that specifically suppresses collagen-specific molecular chaperone, HSP47 or MMP inhibitor, TIMP, is encapsulated in the drug carrier.
• HSP47 or MMP inhibitor, TIMP is encapsulated in the drug carrier.
• the present invention relates to a stellate cell-specific drug carrier comprising a retinoid derivative and Z or a vitamin A analog as constituents.
• the present invention also relates to the above-mentioned drug carrier, wherein the retinoid derivative contains vitamin A.
• the present invention further relates to the above-mentioned drug carrier, characterized in that it contains 0.2 to 20% by weight of a retinoid derivative and / or a vitamin A analog.
• the present invention further relates to the drug carrier in the form of any one of polymer micelles, ribosomes, emulsions, microspheres, and nanoglobules.
• the present invention also relates to a medicament for treating a disease associated with stellate cells, comprising the drug carrier described above and a drug that controls stellate cell activity or proliferation.
• the present invention provides that the disease is selected from the group consisting of hepatitis, liver fibrosis, cirrhosis, liver cancer, knee inflammation, victorious fibrosis, knee cancer, vocal cord scar formation, vocal cord mucosal fibrosis and laryngeal fibrosis, It relates to medicine.
• the drug controlling the activity or proliferation of stellate cells is a TGF / 3 activity inhibitor, an HGF active preparation, an MMP production promoter, a TIMP production inhibitor, a PPAR y ligand, an angiotensin activity inhibitor.
• PDGF activity inhibitors sodium channel inhibitors, apoptosis inducers, and molecules that target or function to produce or secrete extracellular matrix components produced by stellate cells SiRNA, ribozyme, antisense nucleic acid targeting one or more of these
• the present invention relates to the above-mentioned pharmaceutical selected from the group consisting of DNA / RNA chimeric polynucleotides and vectors expressing them.
• the present invention also relates to the aforementioned medicament, wherein the molecule that functions to produce or secrete extracellular matrix constituent molecules is HSP47.
• the present invention further relates to the above-mentioned pharmaceutical comprising a drug and a drug carrier mixed at or near the medical site.
• the present invention further includes one or more of a drug that controls stellate cell activity or proliferation, a drug carrier component, and one or more of a retinoid derivative and / or a vitamin A analog. It is related with the said pharmaceutical preparation kit containing the above containers.
• the present invention also relates to a method for treating a disease associated with stellate cells, comprising administering an effective amount of the above medicament to a subject in need thereof.
• the present invention provides that the disease is selected from the group consisting of hepatitis, liver fibrosis, cirrhosis, liver cancer, vaginitis, vaginal fibrosis, knee cancer, vocal cord scar formation, vocal cord mucosal fibrosis and laryngeal fibrosis, Regarding the method.
• the present invention relates to the above method, wherein the medicament is administered parenterally.
• the present invention also relates to the use of the above-mentioned drug carrier for the manufacture of a medicament for treating diseases related to stellate cells.
• the present invention also relates to a drug delivery method to stellate cells using the drug carrier.
• the present invention further provides a drug carrier for inhibiting fibrosis that specifically transports a stellate cell activity or proliferation-controlling drug comprising a retinoid derivative and / or a vitamin A analog as a constituent component.
• the drug carrier for suppressing fibrosis a drug that controls the activity or proliferation of stellate cells is a TGF / 3 activity inhibitor, an HGF active preparation, an MMP production promoter, a TIMP production inhibitor, a PPA ligand.
• One or more drugs selected from angiotensin activity inhibitors, PDGF activity inhibitors, sodium channel inhibitors, and apoptosis inducers
• the drug carrier for suppressing fibrosis a drug that controls the activity or proliferation of stellate cells, targets an extracellular matrix constituent molecule produced by stellate cells, or the extracellular Suppression of fibrosis, comprising siRNA, ribozyme, antisense RNA or a vector expressing them targeting one or more of the molecules that function in the production or secretion of matrix constituent molecules
• a drug carrier for suppressing fibrosis wherein the molecule that functions to produce or secrete extracellular matrix constituent molecules is HS P47.
• the present invention further includes one or more of a drug that controls stellate cell activity or proliferation, a drug carrier component, and one or more of a retinoid derivative and / or a vitamin A analog.
• a drug carrier kit for suppressing fibrosis comprising a container of the above, a drug carrier kit for suppressing fibrosis, wherein the retinoid derivative contains vitamin A, 0.2% to 20% of a retinoid derivative and / or Inhibiting fibrosis in the form of any one of the above-mentioned drug carrier kit for suppressing fibrosis, polymer micelle, ribosome, emulsion, microsphere, and nanoglobule, characterized by containing a vitamin A analog
• Drug carrier kits, drugs that control the activity or proliferation of stellate cells include TGF ⁇ activity inhibitors, HGF activity preparations, sputum production promoters, sputum production inhibitors Fibrosis characterized by comprising one or more drugs selected from PPAR y ligand,
• Diagnostic and / or therapeutic drugs can be specifically delivered to stellate cells as an effective means of preventing, suppressing or ameliorating fibrosis and / or various diseases associated therewith
• the drug carrier and drug carrier kit of the present invention it is possible to provide an epoch-making therapeutic effect as seen in the examples. That is, since the drug carrier and drug carrier kit according to the present invention specifically target stellate cells, the pathological condition expressed mainly by stellate cells, such as fibrosis, can be efficiently and effectively minimized. It can be suppressed with limited side effects.
• FIG. 1 shows a protocol for determining the effect of gp46-siRNA in vitro using NRK cells, and determining the optimal sequence, time, and concentration.
• FIG. 2 is a photographic diagram showing the results of Western blotting of gp46 and Actin (cultured for 24 hours, examination of optimal sequences).
• FIG. 3 is a photographic diagram showing the results of Western blotting of gp46 and Actin (24-hour culture, examination of optimum concentration).
• FIG. 4 is a photograph showing the results of Western blotting of gp46 and Actin (concentration 50 ⁇ 50, examination of optimum culture time).
• FIG. 5 shows a protocol for evaluating suppression of collagen expression by gp46-siRNA in NRK cells.
• FIG. 6 is a graph showing suppression of collagen synthesis by siRNA.
• FIG. 7 is a photograph showing introduction of HSC-specific siRNA.
• FIG. 8 is a photograph showing the rate of introduction of HSC-specific siRNA.
• FIG. 9 is a photographic diagram evaluating the suppression of gp46 expression by siRNA.
• FIG. 10 is a photograph showing Azan staining of DMN-treated rat liver.
• FIG. 11 shows a treatment protocol for LC rat.
• FIG. 12 is a photograph showing Azan staining of the liver of LC rats administered with VA_Lip_gp46siRNA.
• FIG. 13 is a diagram showing a method for extracting a portion to be stained by NIH image. Six images were taken at random from Azan stained images.
• FIG. 14 is a graph showing the area ratio (collagen area ratio,%) occupied by fibrosis in liver tissue images.
• FIG. 15 is a graph showing the amount of hydroxyproline in liver tissue.
• FIG. 16 is a graph showing the survival curve of cirrhotic rats to which VA-Lip-gp46siRNA was administered intraportally.
• FIG. 17 is a photographic diagram showing Azan staining of liver tissue of cirrhotic rats to which VA_Lip_gp46siRNA was administered intraportally.
• the VA_Lip_g P 46siRNA is a graph showing the survival curve cirrhosis rats administered intraportally.
• FIG. 19 is a photographic view showing Azan staining of liver tissue of cirrhotic rats to which VA_Lip_gp46siRNA was administered intraportally.
• FIG. 20 is a graph showing a survival curve of cirrhotic rats intravenously administered with VA_Lip_gp46siRNA.
• FIG. 21 is a graph showing the survival curve of cirrhotic rats administered intravenously with VA_Lip_gp46siRNA.
• FIG. 22 is a photographic diagram showing Azan staining of liver tissue of cirrhotic rats intravenously administered with VA-Lip-gp46siRNA.
• FIG. 23 is a graph showing improvement in the introduction efficiency of VA-Lip-gp46siRNA by RBP.
• FIG. 24 is a view showing suppression of VA-Lip-gp46siRNA introduction by an anti-RBP antibody.
• the retinoid derivative and / or vitamin A analog in the present invention includes vitamin A, and also includes a retinoid derivative or a vitamin A analog in a state in which the retinoid derivative and / or vitamin A analog is dissolved or mixed in a medium capable of dissolving or retaining the same. .
• the retinoid derivative and / or vitamin A analog in the present invention may be any as long as it is positively accumulated by stellate cells.
• the retinoid derivative is not limited, but tretinoin. , Adapalene, retinoyl normitate, or vitamin A (retinoic acid) in particular, and vitamin A analogs include, but are not limited to, for example, Fenretinide (4-HPR) That power S.
• the present invention utilizes the property that stellate cells actively take up retinoid derivatives and / or vitamin A analogs, and these retinoid derivatives and The ability to specifically transport a desired substance or object to a star cell by combining or including the ability to use a vitamin A analog as a drug carrier, or other drug carrier components. It is.
• the drug carrier of the present invention may contain a drug carrier component other than a retinoid derivative and / or a vitamin A analog.
• a drug carrier component is not particularly limited, and can be any force known in the field of medicine and pharmacy.
• Such components include lipids, such as phospholipids such as glyce mouth phospholipids, sphingolipids such as sphingomyelin, sterols such as cholesterol, vegetable oils such as soybean oil and poppy oil, lecithins such as mineral oil and egg yolk lecithin. Such as, but not limited to these.
• those that can constitute ribosomes such as natural phospholipids such as lecithin, semisynthetic phospholipids such as dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), and distearoyl phosphatidylcholine (DSPC), cholesterol, etc. preferable.
• natural phospholipids such as lecithin
• semisynthetic phospholipids such as dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), and distearoyl phosphatidylcholine (DSPC), cholesterol, etc.
• DMPC dimyristoyl phosphatidylcholine
• DPPC dipalmitoyl phosphatidylcholine
• DSPC distearoyl phosphatidylcholine
• the drug carrier of the present invention may contain a substance that improves uptake into stellate cells, such as retinol binding protein (RBP).
• a substance that improves uptake into stellate cells such as retinol binding protein (RBP).
• the binding or inclusion of the retinoid derivative and / or vitamin A analog to the drug carrier of the present invention may be achieved by combining the retinoid derivative and / or vitamin A analog with other drug carriers by chemical and / or physical methods. This can also be achieved by the force or inclusion of the component.
• the binding or inclusion of the retinoid derivative and / or vitamin A analog to the drug carrier of the present invention may be carried out at the time of preparation of the drug carrier with a retinoid derivative and / or having a formation affinity with a basic drug carrier component. It is also possible by mixing vitamin A analogs into the constituents of the drug carrier.
• the amount of retinoid derivative and Z or vitamin A analog bound or included in the drug carrier of the present invention is from 0.01% to 100%, preferably 0.2% by weight in the drug carrier component. . / ⁇ ⁇ 20. / ⁇ , more preferably 1-5. / 0 can be set.
• the form of the drug carrier of the present invention may be any form as long as the desired substance or object can be transported to the target stellate cell.
• the form of the drug carrier is not limited. Lipo It can take any form of somes, emulsions, microspheres, nanospheres, etc.
• the drug carrier of the present invention can be used as long as the retinoid derivative and / or vitamin A analog contained therein is at least partially exposed to the outside of the preparation before reaching the star cell at the latest. May be attached to the outside of the transported material, or may be mixed with the transported material.
• the drug carrier of the present invention targets a stellate cell specifically, and efficiently transports a desired substance or substance, such as a drug that controls the activity or proliferation of the stellate cell, to the stellate cell. By doing so, it is possible to suppress or prevent a desired effect, for example fibrosis, with maximum effect and minimum side effects.
• a desired substance or substance such as a drug that controls the activity or proliferation of the stellate cell
• the drug carrier of the present invention includes not only substances such as atoms, molecules, compounds, proteins, and nucleic acids, but also objects such as vectors, virus particles, cells, drug release systems composed of one or more elements, and micromachines. Can be transported.
• the substance or object preferably has a property of affecting the stellate cells, and includes, for example, one that labels stellate cells and one that controls the activity or proliferation of stellate cells.
• the drug carrier delivers a “drug that controls stellate activity or proliferation”, which is a physicochemical study of stellate cells involved in promoting fibrosis. It is not limited to any drug that directly or indirectly suppresses the action of the TGF ⁇ , such as truncated TGF j3 type II receptor, soluble TGF j3 type II receptor, HGF Growth factor preparations and their expression vectors, MMP production promoters such as MMP gene-containing adenoviral vectors, TIMP production inhibitors such as antisense TIMP nucleic acids, ⁇ ligands, angiotensin activity inhibitors, PDGF activity inhibitors, Cell activation inhibitors and / or cell growth inhibitors including sodium channel inhibitors, and apoptosis inducers such as compound 861, gliotoxin, Ponectin (see Japanese Patent Application Laid-Open No.
• the “drug that controls the activity or proliferation of stellate cells” in the present invention is any drug that directly or indirectly promotes the physicochemical actions of stellate cells that are directly or indirectly related to fibrosis inhibition.
• drugs that promote the collagen degradation system such as MMP production promoters such as MMP expression vectors, and HGF-like activities such as HGF, HGF analogs, or these expression vectors. Includes drugs with.
• Another example of the "drug that controls the activity or proliferation of stellate cells” in the present invention includes an extracellular matrix, for example, an extracellular matrix configuration produced by a drug that controls metabolism of collagen, for example, stellate cells.
• RNA, DNA, PNA targeting molecules or targeting one or more of the molecules that function to produce or secrete the extracellular matrix constituents
• a substance that has an effect of suppressing the expression of a target molecule such as a complex thereof, or a substance that has a dominant negative effect, or a vector that expresses these substances.
• siRNA is a double-stranded RNA having a sequence specific to a target molecule such as mRNA.
• a target molecule such as mRNA.
• RNA interference a substance formed by the target molecule, such as a protein. Since the principle was published by Fire et al. (Nature, 391: 806-811, 1998), extensive studies have already been conducted on siRNA optimization, and those skilled in the art are familiar with powerful techniques. In addition to the siRNA, vigorous research has been conducted on substances that cause RNA interference or other gene expression inhibition reactions, and many such substances are now born.
• Japanese Patent Application Laid-Open No. 2003-219893 describes a double-stranded polynucleotide comprising DNA and RNA that inhibit the expression of a target gene.
• This polynucleotide can be a DNAZRNA hybrid in which one of the two strands is DNA and the other is RNA, or a DNA / RNA chimera in which part of the same strand is DNA and the other part is RNA.
• the polynucleotide is preferably 19-25, more preferably 19-23, and even more preferably 19-21 nucleotides.
• the sense strand is DNA and the antisense strand is Those that are RNA are preferred.
• RNAZRNA chimera those in which part of the upstream side of the double-stranded polynucleotide is RNA are preferred.
• a strong polynucleotide can be prepared having an arbitrary sequence according to a conventional method by a chemical synthesis method known per se.
• Examples of the target molecule include, but are not limited to, HSP47 as an example of such a molecule that is preferably a molecule that can suppress secretion of extracellular matrix constituent molecules to a single net.
• HSP47 as an example of such a molecule that is preferably a molecule that can suppress secretion of extracellular matrix constituent molecules to a single net.
• the gene sequence of HSP47 or a homologue thereof is disclosed as, for example, GenBank accession No. AB010273 (human), X60676 (mouse), M69246 (rat, gp46).
• preferable substances that the drug carrier of the present invention carries include siRNA targeting HSP47, DNAZRNA hybrid or chimeric polynucleotide, antisense nucleic acid, and the like.
• the drug carrier delivery product of the present invention also includes an agent that suppresses fibrosis, such as G-CSF (see WO 2005/082402), thrombomodulin-like protein (see JP 2002-371006), keratan sulfate oligosaccharide ( JP-A-11-269076).
• G-CSF see WO 2005/082402
• thrombomodulin-like protein see JP 2002-371006
• JP-A-11-269076 keratan sulfate oligosaccharide
• the substance or object delivered by the drug carrier of the present invention may or may not be labeled.
• the labeling makes it possible to monitor the success or failure of transportation and the increase / decrease of stellate cells, which is particularly useful at the test / research level.
• the label should be selected from any of those known to those skilled in the art, for example, any radioisotope, substance that binds to the labeling substance (for example, an antibody), fluorescent substance, fluorophore, chemiluminescent substance, and enzyme. Can do.
• the present invention also provides a medicament for treating a disease associated with stellate cells, comprising the drug carrier and a drug that controls the activity or proliferation of the stellate cells, and the stellate cell of the drug carrier. It relates to the use in the manufacture of a medicament for the treatment of diseases related to the disease.
• a stellate cell-related disease refers to a disease in which the stellate cell is directly or indirectly involved in the disease process, that is, onset, exacerbation, improvement, remission, healing, etc.
• hepatitis especially chronic hepatitis, liver fibrosis, liver diseases such as cirrhosis and liver cancer, knee disease, especially knee diseases such as chronic vaginitis, knee fibrosis and vaginal cancer.
• liver diseases such as cirrhosis and liver cancer
• knee disease especially knee diseases such as chronic vaginitis, knee fibrosis and vaginal cancer.
• Vocal cord-laryngeal disorders such as fibrosis and laryngeal fibrosis are also included.
• the drug carrier is used.
• the drug may be contained inside, may be attached to the outside of the drug-containing body, or may be mixed with the drug. Therefore, depending on the route of administration, drug release mode, etc., the drug may be coated with an appropriate material, for example, a S-soluble coating or a time-disintegrating material. It can be built into the system.
• the medicament of the present invention can be used in various routes including both oral and parenteral, such as, without limitation, oral, intravenous, intramuscular, subcutaneous, topical, rectal, intraarterial, intraportal, intraventricular, It may be formulated into a dosage form suitable for each administration route, such as transmucosal, transdermal, intranasal, intraperitoneal, intrapulmonary, and intrauterine routes. Any known methods can be adopted as appropriate for the strength, dosage form and formulation method (see, for example, Standard Pharmacy, Watanabe Yoshimitsu, Nankodo, 2003).
• dosage forms suitable for oral administration include powders, granules, tablets, capsules, solutions, suspensions, emulsions, gels, syrups and the like without limitation, and are suitable for parenteral administration.
• examples of the dosage form include injections such as solution injections, suspension injections, emulsion injections, pre-prepared injections and the like.
• Formulations for parenteral administration can be in the form of aqueous or non-aqueous isotonic sterile solutions or suspensions.
• the drug carrier or medicament of the present invention may be supplied in any form, but from the viewpoint of storage stability, it is preferably in a form that can be prepared at the time of use, for example, at or near the medical site. And / or provided in a form that can be prepared by a pharmacist, nurse, or other paramedic.
• the drug carrier or medicament of the present invention is provided as one or more containers containing at least one of the essential components, and is used before use, for example, within 24 hours, preferably 3 Prepared within an hour, and more preferably just before use. In the preparation, reagents, solvents, dispensing devices and the like that are usually available at the place of preparation can be appropriately used.
• the present invention also includes drug carrier constituents, and retinoid derivatives and Z or vitamin A analogs, and one or more of Z or drugs 1 Including a drug carrier or pharmaceutical preparation kit comprising one or more containers, including the necessary drug carriers or pharmaceutical components provided in the form of such a kit.
• the kit of the present invention may contain instructions and the like on which the drug carrier of the present invention and a method for preparing and administering a medicament are described.
• the kit of the present invention may contain all of the components for completing the drug carrier or medicament of the present invention, but may not necessarily contain all of the components. Therefore, the kit of the present invention may or may not contain reagents and solvents that are usually available at medical sites and experimental facilities such as sterile water, physiological saline, and sugar solution. ,.
• the present invention further relates to a method for treating a disease associated with stellate cells, comprising administering an effective amount of said medicament to a subject in need thereof.
• the effective amount is an amount that reduces the onset of the target disease, reduces symptoms, or prevents progression, and preferably an amount that prevents the onset of the target disease or cures the target disease. is there.
• An amount that does not cause adverse effects exceeding the benefits of administration is preferred.
• Such an amount can be appropriately determined by an in vitro test using cultured cells, or a test in a model animal such as mouse, rat, inu or pig, and such a test method is well known to those skilled in the art. ing.
• the dose of the pharmaceutical agent administered in the method of the present invention varies depending on the drug used and the type of retinoid derivative and / or vitamin A analog.
• siRNA against HSP47 is used as the drug
• 0 ⁇ 0 l ⁇ 45mg / kg / ⁇ preferably ⁇ 0 ⁇ :! ⁇ 30mg / kg / ⁇ , more preferably ⁇ :! ⁇ 20mg / kg / day, most preferably 4-6mg / kg / day .
• vitamin A is typically administered at a dose of 10 to 20 mg / kg / day.
• the doses of the retinoid derivative and / or vitamin A analog contained in the drug carrier and the drug used in the method of the present invention are known to those skilled in the art or can be appropriately determined by the above-described tests and the like.
• the specific dose of the medicament to be administered in the method of the present invention depends on various conditions relating to the subject requiring treatment, such as severity of symptoms, general health status of the subject, age, weight, Gender, diet, timing and frequency of administration, drugs used in combination, responsiveness to treatment, These methods are still within the scope of the present invention, even if they may be different from the above-mentioned typical doses, because they can be determined taking into account and compliance with treatment.
• the routes of administration include various routes including both oral and parenteral, such as oral, intravenous, intramuscular, subcutaneous, topical, rectal, intraarterial, intraportal, intraventricular, transmucosal, transdermal. Intranasal, intraperitoneal, intrapulmonary and intrauterine routes are included.
• the frequency of administration depends on the nature of the drug used and the conditions of the subject as described above. For example, many times a day (ie, 2, 3, 4 or more times a day), once a day, It may be every few days (ie every 2, 3, 4, 5, 6, 7 days, etc.), every week, every few weeks (ie every 2, 3, 4 weeks, etc.).
• the term "subject” means any living individual, preferably an animal, more preferably a mammal, more preferably a human individual.
• the subject may be healthy or may suffer from some kind of disease.
• the subject typically suffers from the same disease.
• treatment is intended to encompass all medically acceptable types of prophylactic and / or therapeutic interventions intended to cure, temporarily ameliorate or prevent disease.
• the term ⁇ treatment '' includes a variety of terms, including slowing or stopping the progression of fibrosis, regression or disappearance of the lesion, prevention of fibrosis, or prevention of recurrence. Including the intended medically acceptable intervention.
• the present invention also relates to a drug delivery method to stellate cells using the drug carrier.
• This method is not limited, and includes, for example, a step of loading a delivery product on the drug carrier and a drug carrier carrying the delivery product applied or added to an organism or medium containing stellate cells, such as a culture medium. Including the step of. These steps can be appropriately achieved according to any known method or the method described in the present specification.
• the above delivery methods can also be combined with other delivery methods, such as other delivery methods that target an organ in which stellate cells are present.
• array C uses siRNA arget ⁇ (1 ⁇ 1: ⁇ : / ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ & ⁇ A 19-base sequence that becomes a target for gp46 (human HSP47 homolog, GenBank Accession No. M69246) was selected and created.In the design, 1) start from 75 to 100 bases downstream from the start codon, 2) first Noted that the AA dimer was positioned at 3) and the GC content was 30% to 70%.
• GUUCCACCAUAAGAUGGUAGACAAC 25-base forward strand siRNA starting from the 757th position on the sequence, SEQ ID NO: 1
• Example 2 Suppression of gp46 expression by the produced siRNA
• 3 H-proline was added to the culture supernatant of rat fibroblasts (NRK cells) to examine the amount of collagen synthesis under the conditions described above (siRNA concentration 50 nM, time 48 hours). The amount of 3 H in the secreted protein after transfection was examined (Fig. 5). The amount of collagen synthesis was determined by culturing gp46siRNA-introduced fibroblasts in the presence of 3 H-proline based on the report of Peterkofsky et al. (Peterkofsky et al., Biochemistry. 1971 Mar 16; 10 (6): 988_94). It was calculated from the ratio of the amount of protein secreted into the protein and the amount of protein degraded by collagenase.
• Example 4 Specific introduction of nucleic acid into hepatic stellate cells (HSC)
• Emulsion (VA-Lip-GFP) was prepared by mixing 10% VA and ribosome, VA-encapsulated ribosome, and GFP expression plasmid. After administration into the rat portal vein, the liver tissue was recovered and fixed. . Emulsion was prepared so that the blood volume of VA and GFP in portal vein blood would be ⁇ / i M, assuming that the plasma volume of a 200 g rat was about 10 ml. Specifically, 25 mg of al-trans-retinol (VA) was first dissolved in 87 ⁇ l of DMS to prepare a stock solution of lOOmM.
• VA al-trans-retinol
• Example 5 Quantification of nucleic acid introduction rate Except for using FITC-labeled gp46siRNA instead of GFP-expressing plasmid, in the same manner as in Example 4, an emulsion containing VA-encapsulated ribosome and FITC-labeled gp46siRNA (VA-Lip-gp46siRNA (FITC)) was used. And was administered intraportally to SD rats (10 siRN 8 doses). 1). 48 hours after administration, liver tissue was collected and expressed specifically in HSC compared to other hepatocytes. SMA (smooth muscle actin) was Alexa Fluor568 labeled anti-SMA antibody and the cell nucleus was DAPI.
• VA-Lip-gp46siRNA FITC-Lip-gp46siRNA
• Example 6 Suppression of gp46 expression by VA-Lip-gp46siRNA
• gp46 was stained with Alexa Fluor568-labeled anti-HS P47 antibody, the cell nucleus was stained with DAPI, and the fluorescence was observed with a confocal laser scanning microscope.
• gp46 expression that is recognized as red fluorescence (right side of the figure) is a control administered with VA-Lip-random siRNA containing random siRNA that is not specific to gp46 Compared to the group (left side of the figure), it was observed that the level was significantly reduced.
• Expression inhibition rate for 6 field average of the control group was assayed fluorescence micrographs any 10 fields election beauty g p46 number negative cells xlOOO similarly by NIH image as in Example 7, is extremely high as 75% there were.
• LC model rat was prepared using Dime thylnitrosamine (DMN) (FIG. 10). Specifically, 1 for 5-week-old SD rat (male) was administered 3 times a week for a daily dose of 11111713 ⁇ 4 (intraperitoneal administration). As previously reported, fiber increase was observed from the 2nd week, and the 4th week. Showed significant fibrosis, disruption of hepatic lobule architecture, and recurrent nodule formation (Fig. 11).
• gp46siRNA was ribosomed by the same method as in Example 4, and then Emulsion (VA-Lip-gp46siRNA) mixed with 10% VA was administered.
• VA_Lip_gp46siRNA was started from the third week when sufficient fibrosis was observed, and evaluation was performed at the fourth and fifth weeks. Since it was confirmed that the effect was observed up to 48 hours in the in vitro mouth according to Example 2, administration was performed twice a week (Fig. 11). Based on the previous report (McCaffery et al., Nature. 2002 Jul 4; 418 (6893): 38-9) in which siRNA was directly injected, the total amount of siRNA was 40 ⁇ g.
• liver tissue was hydrolyzed with HC1 for 24 hours, and then the reaction solution was centrifuged. The supernatant was treated with a reagent such as Ehrlich's solution and centrifuged. The supernatant was collected, and the amount of hydroxyproline in liver tissue was measured by measuring absorbance at 560 awakening (H mark atology 1998 Nov; vol.28: 1247-1252). As shown in FIG. 15, in the gp46siRNA administration group, the amount of hydroxyproline was extremely low.
• LC model rats were prepared using increased amounts of Dimethylnitrosamine (DMN).
• DNN Dimethylnitrosamine
• a total of four intraportal administrations were performed during the first and second weeks.
• Each dose was administered with PBS in a total volume of 200 / l.
• groups 10-4 were administered until the 7th week, and groups 10-10 were administered until the 6th week except for the administration until the death.
• VA-Lip-gp46 siRNA VA 200 nmol s l iposome 100 nmol gp46s i
• VA-Lip-gp46siRNA VA 200 nmol l iposome 100 nmok gp46si
• RNA ⁇ 50 ⁇ g As a result, all six animals died within 45 days after the start of DMN administration except for the groups (treatment groups 10-4 and 10-10) to which the medicament of the present invention was administered. In the group receiving the drug, all individuals survived for more than 70 days from the start of DMN administration, except that 2 animals died on Day 45 in Treatment Group 4 ( Figures 20 and 21).
• the amount of liver fiber was quantified in the same manner as in Example 7 for dead individuals, the increase in the amount of liver fiber was markedly suppressed by administration of VA_Lip_gp46siRNA (FIG. 22).
• VA_Lip_g p46siRNA 100 nM prepared in Example 5 was cultured in various concentrations (ie, 0, 0.1, 0.5, 1, 2, 4 or 10%) of FBS (Ushi Fetal Serum). After incubating for 48 hours in addition to LI90, fluorescence images were observed with LSM, and the amount of siRNA incorporated into individual cells was quantified with FACS.
• FBS contains RBP force S of about 0.7 mg / dl. As shown in FIG.
• FBS increased the amount of siRNA introduced in a concentration-dependent manner.
• 10 (21,476 nmol) anti-RBP antibody was added to LI90 in culture together with 100 ⁇ M VA-Lip-gp46siRNA (FITC) and 4% FBS, and siRNA introduction efficiency was similarly evaluated.
• the amount of introduction increased by RBP. I can see that it ’s a little bit. The above results indicate that RBP is effective in further improving the introduction of the medicament of the present invention.

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Pharmacology & Pharmacy (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Animal Behavior & Ethology (AREA)
• Epidemiology (AREA)
• Engineering & Computer Science (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Dispersion Chemistry (AREA)
• Molecular Biology (AREA)
• Virology (AREA)
• Dermatology (AREA)
• Pulmonology (AREA)
• Oil, Petroleum & Natural Gas (AREA)
• Communicable Diseases (AREA)
• Oncology (AREA)
• Gastroenterology & Hepatology (AREA)
• Otolaryngology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Materials Engineering (AREA)
• Metallurgy (AREA)
• Medicinal Preparation (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (26)

Applications Claiming Priority (2)

Related Parent Applications (1)

Related Child Applications (3)

Publications (1)

Family

ID=36601829

Family Applications (1)

Country Status (16)

Cited By (28)

Families Citing this family (23)

Citations (5)

Family Cites Families (118)

• 2005
  • 2005-12-22 SI SI200532301T patent/SI2727583T1/sl unknown
  • 2005-12-22 HU HUE13189691A patent/HUE056941T2/hu unknown
  • 2005-12-22 AU AU2005320014A patent/AU2005320014B2/en not_active Ceased
  • 2005-12-22 SI SI200532274T patent/SI2730277T1/sl unknown
  • 2005-12-22 CN CN2011103164813A patent/CN102343092A/zh active Pending
  • 2005-12-22 EP EP05819552.0A patent/EP1842557B1/en not_active Expired - Lifetime
  • 2005-12-22 EP EP21207976.8A patent/EP4005601A1/en active Pending
  • 2005-12-22 US US11/793,736 patent/US8173170B2/en not_active Expired - Lifetime
  • 2005-12-22 LT LTEP13193438.2T patent/LT2730277T/lt unknown
  • 2005-12-22 DK DK13193438.2T patent/DK2730277T3/da active
  • 2005-12-22 PL PL13189691T patent/PL2727583T3/pl unknown
  • 2005-12-22 CA CA2595517A patent/CA2595517C/en not_active Expired - Lifetime
  • 2005-12-22 EP EP13189691.2A patent/EP2727583B1/en not_active Expired - Lifetime
  • 2005-12-22 KR KR1020137020266A patent/KR101454286B1/ko not_active Expired - Fee Related
  • 2005-12-22 PT PT131934382T patent/PT2730277T/pt unknown
  • 2005-12-22 DK DK13189691.2T patent/DK2727583T3/da active
  • 2005-12-22 HU HUE13193438A patent/HUE048419T2/hu unknown
  • 2005-12-22 ES ES13193438T patent/ES2784554T3/es not_active Expired - Lifetime
  • 2005-12-22 ES ES13189691T patent/ES2900801T3/es not_active Expired - Lifetime
  • 2005-12-22 LT LTEP13189691.2T patent/LT2727583T/lt unknown
  • 2005-12-22 ES ES05819552.0T patent/ES2443229T3/es not_active Expired - Lifetime
  • 2005-12-22 PT PT131896912T patent/PT2727583T/pt unknown
  • 2005-12-22 WO PCT/JP2005/023619 patent/WO2006068232A1/ja not_active Ceased
  • 2005-12-22 PT PT58195520T patent/PT1842557E/pt unknown
  • 2005-12-22 CA CA2820728A patent/CA2820728C/en not_active Expired - Lifetime
  • 2005-12-22 EP EP13193438.2A patent/EP2730277B1/en not_active Expired - Lifetime
  • 2005-12-22 DK DK05819552.0T patent/DK1842557T3/da active
  • 2005-12-22 PL PL13193438T patent/PL2730277T3/pl unknown
  • 2005-12-22 PL PL05819552T patent/PL1842557T3/pl unknown
  • 2005-12-22 CN CN2005800444800A patent/CN101102795B/zh not_active Expired - Fee Related
  • 2005-12-22 JP JP2006549061A patent/JP4121537B2/ja not_active Expired - Lifetime
• 2007
  • 2007-07-10 KR KR1020077015733A patent/KR101342971B1/ko not_active Expired - Fee Related
• 2010
  • 2010-03-05 JP JP2010049297A patent/JP5172880B2/ja not_active Expired - Fee Related
• 2011
  • 2011-04-28 JP JP2011102395A patent/JP5421322B2/ja not_active Expired - Fee Related
  • 2011-09-29 US US13/249,072 patent/US8178124B2/en not_active Expired - Lifetime
• 2012
  • 2012-04-04 US US13/439,330 patent/US8652526B2/en not_active Expired - Lifetime
• 2013
  • 2013-02-12 JP JP2013025037A patent/JP2013100350A/ja active Pending
  • 2013-11-21 CY CY20131101038T patent/CY1114945T1/el unknown
• 2014
  • 2014-04-21 JP JP2014087058A patent/JP5808064B2/ja not_active Expired - Lifetime
• 2015
  • 2015-06-01 JP JP2015111038A patent/JP2015187137A/ja active Pending
• 2016
  • 2016-09-08 JP JP2016175393A patent/JP6433079B2/ja not_active Expired - Fee Related
• 2020
  • 2020-04-02 CY CY20201100310T patent/CY1122963T1/el unknown
• 2021
  • 2021-12-22 CY CY20211101128T patent/CY1125035T1/el unknown

Patent Citations (5)

Non-Patent Citations (30)

Also Published As

Similar Documents

Legal Events