WO2004092211A1 - Proteine « rapporteur » non fluorescente, activable par proteolyse pour fluorescence et son utilisation pour la detection d'evenements fonction de la protease - Google Patents

Proteine « rapporteur » non fluorescente, activable par proteolyse pour fluorescence et son utilisation pour la detection d'evenements fonction de la protease Download PDF

Info

Publication number
WO2004092211A1
WO2004092211A1 PCT/EP2004/004142 EP2004004142W WO2004092211A1 WO 2004092211 A1 WO2004092211 A1 WO 2004092211A1 EP 2004004142 W EP2004004142 W EP 2004004142W WO 2004092211 A1 WO2004092211 A1 WO 2004092211A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
protease
amino acid
fluorescence
acid sequence
Prior art date
Application number
PCT/EP2004/004142
Other languages
German (de)
English (en)
Inventor
Rico Laage
Moritz Rossner
Original Assignee
Axaron Bioscience Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Axaron Bioscience Ag filed Critical Axaron Bioscience Ag
Publication of WO2004092211A1 publication Critical patent/WO2004092211A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/43504—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates
    • G01N2333/43595—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from coelenteratae, e.g. medusae
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
    • G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
    • G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
    • G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
    • G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
    • G01N2333/96466—Cysteine endopeptidases (3.4.22)

Definitions

  • Non-fluorescent reporter proteins that can be activated by proteolysis for fluorescence and their use for the detection of protease-dependent proteins
  • the invention relates to a nucleic acid coding for a non-fluorescent protein which can be activated proteolytically for fluorescence and which comprises at its N-terminus at least one Stor amino acid sequence flanked on one or both sides by protease cleavages, and the protein encoded by this nucleic acid or one of its fusion proteins.
  • the invention further relates to a nucleic acid coding for a non-fluorescent protein which can be activated proteolytically for fluorescence and which comprises at least one Stor amino acid sequence flanked on one or both sides by protease cleavage sites, which has the position 1, 2, 3, 4 in the protein after the amino acid , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, counted from the N-terminus of the protein, and the protein encoded by this nucleic acid or one of its fusion proteins.
  • the invention relates to a vector which comprises one of the nucleic acids mentioned and a kit which comprises one of these vectors or a protein which is encoded by one of these vectors.
  • the invention comprises a method for the detection or characterization of a protease activity in a cell, comprising the following method steps: a) Transfection of a cell with a recombinant vector, coding for a non-fluorescent but proteolytically activatable protein for fluorescence, which protein comprises at least one or interfering amino acid sequence flanked on both sides by protease cleavage sites is attached to the N-terminus or comprises by insertion, b) activation of a previously inactive protease in the cell or activation of the expression of a protease in the cell, the protease cleavage site comprising a) substrates thereof Represent protease, c) Generation of a fluorescent protein by proteolytic removal of the at least one Stor amino acid sequence from a) flanked on one or both sides by protease interfaces from the non-fluorescent protein from a), d) detection of the fluorescence of the fluorescent protein from c).
  • proteases take on a wide range of tasks in cellular systems beyond pure protein degradation. Numerous proteases have intracellularly localized substrates. For example, the proteasome, a multienzyme complex, plays a central role in the breakdown of ubiquitin-labeled proteins. Apoptotic signal cascades are also initiated and controlled by proteases, the caspases and calpaines. Furthermore, proteolytic activities for regulating the cell cycle are necessary, the activity of the separase.
  • Extracellular or secreted proteases for example, regulate processes in embryonic development (romboid), are important for the growth of cell processes (in particular metalloproteases), serve to activate enzymes and signal cascades (in particular plasminogen, thrombin and renin) or catalyze food digestion (in particular trypsin, chymotrypsin).
  • Proteases are also important targets for pharmaceutical substances.
  • the caspases the inhibition of which prevents cell death, or the family of secretases, which play a role in the development of Alzheimer's disease, are important physiological targets for therapeutically active substances.
  • viral proteases are interesting targets for the therapy of crane profits like AIDS or hepatitis.
  • proteases For the reasons mentioned above, the specific analysis and diagnosis of proteases is of particular importance.
  • the in vivo detection of proteolytic activities is often carried out via the deteldione of the corresponding cleaved substrate of the protease in question.
  • fluorescence-based detection methods have become established (Twining, SS; Anal Biochem 1984 No.v 15; 143 (l): 30-4). These are mostly based on the coupling of a peptide, which comprises the specific recognition and / or interface for the protease, and one or more fluorescent dyes. The dyes change their fluorescent properties due to the cleavage of the peptide. These modified fluorescence properties can then be detected by an appropriate fluorescence measurement.
  • the simplest variant of this method is the direct coupling of synthetic dye molecules to the C or N terminus of a short substrate peptide.
  • the resulting fluorescence resonance energy transfer (FRET) or a "self-quenching effect" is eliminated by cleavage of the peptide substrate and can be measured by a comparative fluorescence measurement before and after the proteolytic cleavage of the substrate peptide (e.g. Jones, LJ et al .; Anal Biochem 1997 Sep 5; 251 (2): 144-52).
  • fluorescent fusion proteins with different spectral properties are expressed in a cell.
  • the fusion proteins include in particular the "green fluorescent protein” (GFP) or one of its variants and a specific substrate interface for a protease.
  • GFP green fluorescent protein
  • the cleavage of the substrate interface abolishes a FRET effect and thus allows the proteolytic activity to be measured ( Pollok, BA; Trends Cell Biol 1999 Feb; 9 (2): 57-60).
  • the detection substrate can or cannot pass through the membrane. If the detection substrate cannot penetrate the membrane, the substrate of the protease must be added to a cell lysate or an analysis sample. The activity is then determined in vitro.
  • the protease substrates to be detected can be applied directly to the cells. In this case, the protease substrates are taken up by the cells and are implemented in vivo in the cell. The proteolytic activity can thus also be measured in vivo - and without the addition of chemical substances or artificially synthesized peptides - which is a great advantage for many questions.
  • GFP green fluorescent protein of the jellyfish is Aequorea victoria 238 amino acids long.
  • the wild-type variant of the protein (GFP) absorbs at 395 nm and 475 nm and emits at 508 nm.
  • the fluorescence is caused by the internal Ser-Tyr-Gly sequence at the amino acid position 65-67, which forms a p - Forms hydroxybenzylidene imidazole structure.
  • GFP has a very stable "ß-barrel structure", in the center of which is the fluorophore.
  • the rigid structure of the GFP largely from “ß-sheet structures” is responsible for the great stability of the GFP ,
  • variants of the GFP including color variants, have been developed by introducing mutations into the wild-type form of the GFP protein.
  • variants with different spectral properties such as in particular the YFP (Yellow Fluorescent Protein), the CFP (Cyan Fluorescent Protein) and the BFP (Blue Fluorescent Protein), as well as variants of the GFP with different levels of expression and Lifetime, such as in particular EGFP (Enhanced green fluorescent protein), EYFP (Enhanced yellow fluorescent protein), ECFP (Enhanced cyan fluorescent protein), and pH-sensitive variants (EP804457B; EP886644; EP851874B).
  • EGFP Enhanced green fluorescent protein
  • EYFP Enhanced yellow fluorescent protein
  • ECFP Enhanced cyan fluorescent protein
  • pH-sensitive variants EP804457B; EP886644; EP851874B.
  • GFP and its variants are also used as reporter genes for the detection of protein-protein interactions and by coupling to corresponding sensor molecules as calcium indicators (EP949269; WO9830715; WO0071565).
  • GFPs can also be used to analyze the activity of proteases.
  • the methods known for this are based on the FRET effect.
  • two variants of the GFP are generally used, in which the emission and absorption spectrum overlap. If both GFP variants are in close proximity, then variant A (e.g. CFP) is excited by FRET and variant B (e.g. YFP).
  • variant A e.g. CFP
  • variant B e.g. YFP
  • the amino acid sequences for both variants are linked to one another by a corresponding protease interface, so that a permanent FRET effect occurs. If this connection is separated by proteolysis, the ratio of the emission maxima of the two GFP variants changes, which can then be measured (WO0073437).
  • BRET bioluminescence resonance energy transfer
  • protease activity using fluorescent proteins is made possible by a method in which protease cleavage sites are inserted into the otherwise very proteolysis-stable GFP. These insertions are chosen so that the fluorescence is lost during proteolysis (Chiang, CF et al .; Arch. Biochem. Biophys. 2001, 394, 229).
  • this method requires a very strong and long-lasting protease activity in order to detect a significant decrease in the fluorescence of the permanently re-synthesized GFP. This severely limits the variety of protease activities that can be analyzed. In particular, short-term, transient and weak protease activities cannot be detected and analyzed using this method.
  • Another method in which GFP is used for detection is based on changing the location of a fluorescent protein.
  • a fusion protein is expressed that comprises GFP or one of its variants.
  • the GFP is fused to a nuclear export signal at the N-terminus via a specific protease interface and a nuclear import signal is located at the C-terminus of the fusion protein.
  • the occurrence of protease activity leads to the cleavage of the nuclear export signal. This leads to the accumulation of fluorescence in the nucleus (BD-Bioscience ApoAlert Caspase-3-sensor; Clontechniques, 2002, 4).
  • the disadvantage of this method is that it requires a correspondingly strong protease activity in order to obtain a clearly positive signal.
  • the sensitivity of the method is therefore limited.
  • the automatic detection of the change in the location of the fluorescent protein is very complex and inaccurate, which is why the method is only of limited suitability for high-throughput screening.
  • a method that allows the variable use of reporter genes is the protease based gene switching system, which is described in WO 99/11801.
  • a transcription activator is anchored to a transmembrane domain via a specific protease interface and thus inactivated. Proteolytic cleavage leads to the release of the activator, which then switches on the transcription of a previously inserted reporter gene.
  • a disadvantage of the method is the stable localization of the substrate on the cell membrane: the localization of the protease interface on the membrane requires that the protease is also localized on or in the membrane Proximity.
  • the detection of reporter gene expression means in many cases an undesirable time delay between the event to be analyzed, ie the proteolysis-dependent event in the cell, and the detection signal.
  • the basis of the system is the heterologous expression of a non-fluorescent variant of a protein fluorescent in its wild-type version, in particular the heterologous expression of a variant of the GFP family which is a short one, flanked on one or both sides by protease interfaces in the N-terminal domain Area of the protein includes.
  • This domain preferably has an ⁇ -helical spatial structure.
  • the preferably ⁇ -helical interfering domain flanked on one or both sides by protease cleavages is located either at the immediate N-terminus of the protein or at the N-terminus of one of its N-terminally truncated fragments or is in position 1 after the amino acid , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, but preferably after the amino acid with the position 2, 3, 4, 5, 6, 7, 8 , 9, counted from the N-terminus of the protein, inserted into the protein.
  • the protein Due to the presence of the sturgeon domain flanked on one or both sides by protease interfaces at the immediate N-terminus (appending the sturgeon domain) or in the area of the N-terminus (insertion of the sturgeon domain), the protein loses its fluorescent properties or its fluorescence is reduced in intensity in such a way that cells which express this protein can no longer be distinguished by standard methods from cells which do not express this protein.
  • the protein modified in this way thus appears - in comparison to the wild-type protein - like a non-fluorescent protein.
  • the fluorescence intensity increases drastically again or the protein regains its fluorescent properties.
  • the fluorescence of the protein can thus be detected depending on the occurrence of protease activity in the cell in question.
  • This method allows the immediate detection of proteolytic activity in living cells, tissues or organisms in vivo. Furthermore, such a method allows a relatively simple detection of the fluorescence signal against a low background noise by the protease-dependent “switching” of a non-fluorescent protein into a fluorescent protein, in particular in comparison to the fluorescence change in the FRET measurements, which is quite complex to measure.
  • the method according to the invention is also suitable for the detection of transient protease-dependent events, which is of great advantage
  • the non-fluorescent but proteolytically activatable protein for fluorescence can be located anywhere in and outside the cell, e.g. through nuclear import and export signals, as well as through membrane-bound domains or pre-sequences for secretory .proteins. The fluorescence detection of these sensor proteins is therefore not restricted to a specific compartment of the cell.
  • the object of the invention is also achieved by providing those nucleic acids and proteins which are necessary for carrying out the method according to the invention.
  • the object is achieved in particular by providing a nucleic acid which codes for a protein which is not fluorescent but can be activated proteolytically for fluorescence and which comprises at its N-terminus at least one interfering amino acid sequence flanked on one or both sides by protease interfaces.
  • the protein which is not fluorescent but can be activated proteolytically for fluorescence preferably comprises a sequence according to SEQ ID No. 1 or according to SEQ ID No. 2 or one of its fragments with a length of at least 5 amino acids, at whose N-terminus the interfering amino acid sequence flanked on one or both sides by protease clusters is fused.
  • a natural or artificial variant of the GFP family from ⁇ equorea victoria in particular EGFP (Acc. No. U76561), EYFP (Acc. No. AJ510163, coded by the region) is particularly preferred as the non-fluorescent protein that can be proteolytically activated to fluoresce 6103-6822), ECFP (Acc. No. AJ510158, encoded by the region 6058-6780), GFP (Acc. No. X83959), YFP (Acc. No. AY189981, encoded by the region 1603-2331) or CFP ( Acc. No. BD136947), this variant of the GFP family comprising at its N-terminus an interfering amino acid sequence flanked on one or both sides by protease cleavage sites.
  • U76561 (SEQ ID NO: 13) denotes the DNA for the vector pEGFP in which the cDNA coding for the preferred EGFP is inserted (nucleotides 289 to 1008).
  • AJ510163 (SEQ ID NO: 14) denotes the DNA for the vector pDXA-MCS-YFP in which the cDNA coding for the preferred YFP is inserted (nucleotides 6103 to 6822)
  • AJ510158 (SEQ ID NO: 15) denotes the DNA for the vector pDXA-CFP in which the cDNA coding for the preferred CFP is inserted (nucleotides 6058 to 6780, preferably 6028 to 6780)
  • X83959 (SEQ ID NO: 16) denotes the cDNA encoding the preferred GFP.
  • AY189981 (SEQ ID NO: 17) denotes the DNA for the vector pBS-35S-YFP, in which the cDNA coding for the preferred YFP is inserted (nucleotides 1603 to 2331).
  • BDI 36947 (SEQ ID NO: 18) denotes the cDNA coding for the preferred CFP.
  • nucleic acid which codes for a protein which is not fluorescent but can be activated proteolytically for fluorescence and which comprises at least one interfering amino acid sequence flanked on one or both sides by protease interfaces, which follows the amino acid with the position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, but preferably after the amino acid with the position 2, 3, 4, 5, 6, 7, 8, 9, counted from the N-terminus of the protein, is inserted in the protein.
  • the nucleic acid according to the invention codes for a protein which is not fluorescent but can be activated proteolytically for fluorescence and which has an amino acid sequence according to the sequence according to SEQ ID no. 1 and in which at least one interfering amino acid sequence flanked on one or both sides by protease cleavages after the amino acid with the position 1, 2, 3, 4, 5, 6,
  • the nucleic acid according to the invention codes for a non-fluorescent protein which can be activated proteolytically for fluorescence and which has an amino acid sequence at its N-terminus according to the sequence according to SEQ ID No. 2 and in which at least one interfering amino acid sequence flanked on one or both sides by protease interfaces is inserted after the amino acid with the position 2, 3, 4, 5, 6, 7, 8 or 9, counted from the N-terminus of the protein is.
  • nucleic acids which code for a protein which is not fluorescent but can be proteolytically activated for fluorescence
  • this protein being a natural or artificial variant of the GFP family from Aequorea victoria which has at least one StorAmino acid sequence flanked on one or both sides by protease interfaces comprising, after the amino acid with the position 1, 2, 3, 4, 5, 6, 7,
  • the natural or artificial variants of the GFP family from Aequorea victoria are in particular the GFP variants: EGFP (Acc. No. U76561), EYFP (Acc. No. AJ510163, coded by the region 6103-6822), ECFP (Acc. No AJ510158, encoded by region 6058-6780), GFP (Acc. No. X83959), YFP (Acc. No. AY189981, encoded by region 1603-2331) or CFP (Acc. No. BD136947).
  • the interference amino acid sequence can generally have any length greater than 3 amino acids, preferably greater than 5 amino acids, more preferably more than 7 amino acids, in particular greater than 10 amino acids. In a particularly preferred embodiment, the interfering amino acid sequence has a length between 5 and 100 amino acids.
  • the interfering amino acid sequence can generally have any amino acid sequence.
  • the interfering amino acid sequence preferably has an amino acid sequence which tends to form ⁇ -helix structures.
  • the sturgeon amino acid sequence preferably comprises those amino acids which are “helix formers”, such as, in particular, leucine and methionine, and polar or charged amino acids, such as, in particular, glutamate, aspartate, arginine and lysine. The latter are intended to reduce the overall hydrophobicity and the development prevent a transmembrane domain.
  • the interfering amino acid sequence can be an amino acid sequence according to SEQ ID No. 3 or a fragment of this amino acid sequence according to SEQ ID No. 5 that is at least 5 amino acids long. Own 3.
  • interfering amino acid sequences are flanked on one or both sides by protease cleavage sites in the non-fluorescent but proteolytically activatable proteins for fluorescence according to the invention.
  • a "short amino acid sequence is defined as the" protease interface ", which is recognized and specifically cut by a specific protease.
  • the protease interface" ENLYFQG is specifically identified by the Ni protease of the Tobacco Etch Virus ⁇ hereinafter" TEV protease "or” TEV ") recognized and cut between Q and G specifically from the TEV protease.
  • Other proteases on the other hand, have other specific protease interfaces, most of which are known to those skilled in the art. In the context of the present invention, all known specific protease interfaces which are known to the person skilled in the art can generally be used as protease interfaces.
  • the protease interface will be used for flanking the interference amino acid sequence on one or both sides, the associated protease activity of which is to be detected or characterized in the course of the method.
  • the specific interfaces of the serine / threonine proteases, the cysteine proteases, the aspartate proteases, the metalloproteases and the unclassified proteases can preferably be used as the protease interface.
  • the recognition and interfaces of the proteases from Table 1 can be used as protease interfaces to flank the interfering amino acid sequence. Many of the corresponding interfaces of the proteases from Table 1 are known to the person skilled in the art from the specialist literature. Table 1:
  • the invention furthermore relates to those nucleic acids which code for a fusion protein of one of the abovementioned non-fluorescent but proteolytically activatable proteins for fluorescence.
  • a fusion protein comprises a non-fluorescent protein which can be activated proteolytically for fluorescence and which has at least one Stor amino acid sequence flanked on one or both sides by protease cleavages either attached to the N-terminus or as an insertion after the amino acid with the position 1, 2, 3, 4 , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, fused with another protein or with another protein domain.
  • the additional protein or the additional protein domain can usually be located both at the N-terminus and at the C-terminus of the fusion protein.
  • the fusion at the C-terminus is preferred only to the extent that a further protein domain located at the N-terminus also leads to the cleavage of the further protein domain by the protease activity, which cleaves the interfering amino acid sequence flanked by protease cleavage sites would.
  • “Other protein domains” in the sense of the above definition of the fusion protein can preferably be different localization domains which are responsible for the compartmentalization of the fusion protein in the cell, such as in particular a nuclear localization signal (“nuclear localization signal” NLS), a nuclear export signal (“nuclear export signal”) NES), a membrane domain containing predominantly hydrophobic amino acids, a classic presequence that characterizes the protein as a "secretory protein”, and other known localization signals for various cell compartments.
  • NLS nuclear localization signal
  • NES nuclear export signal
  • membrane domain containing predominantly hydrophobic amino acids a classic presequence that characterizes the protein as a "secretory protein”
  • other known localization signals for various cell compartments such as in particular a nuclear localization signal (“nuclear localization signal” NLS), a nuclear export signal (“nuclear export signal”) NES), a membrane domain containing predominantly hydrophobic amino acids, a classic presequence that characterizes the protein as
  • Another object of the invention is an expression cassette which comprises one of the above-mentioned nucleic acids or nucleic acid sequences under the control of a promoter.
  • the promoter can be any known promoter which is active in the host cell into which the expression cassette is to be inserted, ie which activates the transcription of the downstream reporter gene in this host cell.
  • the promoter can be a constitutive promoter that continuously expresses the downstream reporter gene, or a non-constitutive promoter that only expresses at defined points in the course of development or under certain circumstances (in particular under the influence of a transcription activator or in the absence of a transcription repressor).
  • Expression cassettes according to the invention which contain, for example, the CMV promoter as a promoter, are suitable for the expression of the downstream non-fluorescent, but proteolytically activatable reporter protein for fluorescence in eukaryotic, especially in mammalian and yeast host cells.
  • Expression cassettes according to the invention which contain, for example, the lac promoter as a promoter, are suitable for the expression of the downstream non-fluorescent, but proteolytically activatable for fluorescence reporter protein in prokaryotic, in particular in bacterial, host cells.
  • control sequence is understood to mean any nucleotide sequence which influences the expression of the non-fluorescent, but proteolytically activatable reporter protein for fluorescence, such as in particular the promoter, an operator sequence, ie the DNA binding site for a transcription activator or a transcription repressor, a terminator sequence, a polyadenylation sequence or a ribosome binding site.
  • Another object of the invention is a recombinant vector which comprises one of the above expression cassettes according to the invention containing a non-fluorescent protein which can be activated proteolytically for fluorescence.
  • Such a recombinant vector can additionally contain a nucleotide sequence through which the vector can replicate in the host cell in question.
  • nucleotide sequences are generally called “origin of replication”. Examples of such nucleotide sequences are the SV40 origin of replication, which is used in mammalian host cells, and the yeast plasmid 2 ⁇ replication genes REP 1 in yeast host cells -3.
  • the recombinant vector can also contain one or more selection markers.
  • a selection marker is a gene which is under the control of a promoter and which codes for a protein which complements a physiological defect in the host cell. Selection markers in particular represent the gene coding for dihydrofolate reductase (DHFR), or also a gene which brings about resistance to antibiotics, such as, in particular, ampicillin, kanamycin, tetracycline, blasticidin, gentamycin, chloramphenicol, neomycin or hygromycin.
  • DHFR dihydrofolate reductase
  • a large number of recombinant vectors for expressing a target protein in prokaryotic or eukaryotic host cells are known in the art and many are also commercially available.
  • Another object of the invention is a host cell which has been transformed transiently or stably with the recombinant vector according to the invention.
  • the selection of the suitable host cell depends on a large number of factors known to the person skilled in the art. These factors include in particular the type of Velctor selected, the toxicity of the expressed protein for the host cell in question, the question to be answered, the expression characteristics and physiological interactions of the target protein in question in the host cell, the safety risks and costs. In general, any pro- or eukaryotic cell or organism can be used as the host cell.
  • prokaryotic host cells examples include gram-positive bacteria such as in particular Bacillus subtilis, Bacillus licheniformis, Bacillus brevis, Streptomyces lividans etc. or gram-negative bacteria such as in particular E. coli.
  • Suitable eukaryotic host cells are the species of Saccharomyces or Schizosaccharomyces, in particular Saccharomyces cerevisae.
  • cell lines that come from mammals and that are also suitable as host cells are in particular the cell lines COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO Kl (ATCC CCL 61), NIH 3T3 ( ATCC CRL 1658), HeLa (ATCCL 2), MRC-5 (ATCC CCL 171), HEK 293 (ATCC CRL1573).
  • COS-1 ATCC CRL 1650
  • COS-7 ATCC CRL 1651
  • CHO Kl ATCC CCL 61
  • NIH 3T3 ATCC CRL 1658
  • HeLa ATCCL 2
  • MRC-5 ATCC CCL 171
  • HEK 293 ATCC CRL1573
  • the recombinant vector can be introduced into the host cell in question by any transfection, transformation or injection technique known to those skilled in the art.
  • the recombinant vector can be introduced into the host cell in question by one of the following techniques: calcium phosphate precipitation, electroporation, protoplast fusion, nucleic acid injection, lipofection, “gene gun”-assisted techniques, infection with virus particles or virus-derived particles and Protein transduction with TAT or TAT-like sequences.
  • the host cell can either have been transformed transiently or stably.
  • the vector introduced in the cell generally remains autonomous, ie it does not integrate into the host cell genome.
  • the vector is not also transmitted. This leads to the after several growth cycles of the transformed cells, the introduced vector "dilutes" until most of the cells have no vector. included more. Even with transiently transformed cells, the loss of the Disable the vector after multiple growth cycles by maintaining the selection pressure on the presence of the recombinant vector comprising a selection marker as defined above.
  • the introduced vector which is usually introduced in a linearized form, integrates into the host genome of the cell.
  • the original vector sequences are therefore also transferred as part of the host genome
  • An expression cassette located in a recombinant vector is therefore permanently expressed in the daughter cells, ie over a large number of growth cycles, and transients and stable transformation techniques are known to the person skilled in the art and can be found in common reference works (Freshney, IR; Culture of Animal Cells, 2000, 4th Ed.Wiley-Liss).
  • kits for the detection and / or analysis of protease activities or of protease-dependent events which comprises at least one of the following components: a) encoding a nucleic acid for a non-fluorescent, but proteolytically activatable for fluorescence Reporter protein, which has at least one interfering amino acid sequence flanked on one or both sides by protease cleavages either attached to the N-terminus or as an insertion after the amino acid with the position 1, 2, 3,
  • nucleic acid coding for a fusion protein of this reporter protein b) an expression cassette comprising a nucleic acid according to a) under the control a promoter, c) a recombinant vector which comprises at least one of the expression cassettes according to b), d) a host cell which has been transiently or stably transformed with at least one recombinant vector according to c), e) a protein which is derived from a nucleic acid a), is encoded by an expression cassette according to b) or by a recombinant vector according to c) or which is expressed by a host cell according to d).
  • the detection and / or analysis of protease activities or of protease-dependent events is preferably carried out in vitro in the cell extract of a cell which contains a recombinant vector according to the invention has been transformed, but in particular in vivo in a cell which has been transformed with a recombinant vector according to the invention.
  • the detection and / or analysis of protease activities or of protease-dependent events is preferably carried out by means of fluorescence microscopy of cells which have been transformed with a recombinant vector according to the invention.
  • the detection and / or analysis of protease activities or of protease-dependent events can furthermore be carried out by means of fluorescence spectroscopy or by means of fluorescence-aided cell sorting (“FACS”).
  • FACS fluorescence-aided cell sorting
  • Any protease can be obtained with the aid of the method according to the invention or with the aid of the kit according to the invention -Activities in cells, cell extracts, cell supernatants, in fractions of cell extracts or cell supernatants are detected and analyzed.
  • protease activities can be detected and analyzed which are only transient in the cell, i.e. occur temporarily and only for short periods. Since even a briefly occurring protease activity in the cell leads to the proteolytic removal of the interfering amino acid sequences from the reporter protein - and thus ultimately to the switching from a non-fluorescent reporter to a fluorescent reporter - the method according to the invention can also preferably be used transiently occurring and weak protease activities are measured.
  • Various physiologically significant cellular events or signal transduction pathways include the occurrence of protease activities, in particular the occurrence of transients, i.e. short-term protease activity in the cell.
  • Apoptosis in particular is such a physiologically relevant cellular event, which is associated with the occurrence of protease activity, in particular with the activity of the caspases and the calpaine.
  • apoptotic cells in particular could therefore be detected as fluorescent cells by means of the method according to the invention.
  • any desired protease-dependent events in the cell can be detected with the kits and / or methods according to the invention.
  • kits and / or methods according to the invention can be used not only to detect and analyze not only protease reactivities or protease-dependent events themselves but also those cellular events which are the cause of the occurrence of protease activity in the cell or a consequence of the occurrence of protease activity in the cell.
  • the cause of the occurrence of a certain protease reactivity in the cell can in particular also be the occurrence of a specific protein-protein interaction.
  • Another object of the invention is a non-fluorescent, but proteolytically activatable for fluorescence protein or fusion protein, which is encoded by one of the nucleic acids defined above.
  • reporter proteins or reporter fusion proteins which contain a derivative of a natural or artificial variant of the GFP family from Aequorea victoria, in particular a derivative of the variants EGFP (Acc. No. U76561), EYFP (Acc. No. AJ510163, encoded by Region 6103-6822), ECFP (Acc. No. AJ510158, encoded by Region 6058-6780), GFP (Acc. No. X83959), YFP (Acc. No. AY189981 encoded by Region 1603-2331 ) or CFP (Acc. No. BD136947).
  • the invention further relates to a method for the detection and / or characterization of a protease activity in a cell, which comprises the following method steps: a) Transfection of a cell with the above-mentioned recombinant vector for the recombinant expression of a non-fluorescent protein or fusion protein, which at least an interfering amino acid sequence flanked on one or both sides by protease cleavages is attached to the N-terminus or comprises insertion into the above-mentioned protein positions, b) activating a previously inactive protease in the cell or activating the expression of a protease in the cell, wherein the protease interfaces mentioned in step a) represent substrates of this protease, c) generation of a fluorescent protein or fusion protein by proteolytic removal of the at least one interfering amino acid sequence from step a) flanked on one or both sides by protease interfaces from the not fluorescent
  • Protein or fusion protein from a d) detection of the fluorescence of the fluorescent protein or fusion protein from c).
  • a suitable host cell is transformed with a recombinant vector according to the invention for the recombinant expression of a non-fluorescent protein, but reporter protein which can be activated proteolytically for fluorescence, either transiently or stably.
  • the non-fluorescent protein has either at least one interfering amino acid sequence flanked on one or both sides by protease cleavage sites, which is attached directly to the N-terminus of the protein, or at least one interfering amino acid sequence flanked by protease cleavage sites on one or both sides after an amino acid with the position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 is inserted in the protein.
  • the non-fluorescent protein can also be fused to another protein domain at its N-terminus or preferably at its C-terminus.
  • the transformation can be carried out using all transformation and transfection techniques known to the person skilled in the art, in particular by calcium phosphate precipitation, electroporation, protoplast usion, nucleic acid injection, lipofection, “gene gun”-assisted techniques, infection with virus particles or with virus-derived particles and protein transduction with TAT or TAT-like sequences.
  • the recombinant vector preferably has the properties already explained above.
  • step b) the activation of a previously inactive protease in the cell or the activation of the expression of a protease in the cell optionally takes place
  • the protease interfaces mentioned in step a) represent substrates of this activated or expressed protease from step b).
  • the activation of a previously inactive protease in the cell or the activation of the expression of a protease in the cell is preferably carried out by transforming rte cell from step a) is exposed to conditions under which the protease activity to be detected in the cell or the protease-dependent event to be detected can occur in the cell.
  • Such conditions include, in particular, the expression or activation of a further component (in particular a further protein) in the cell, which may possibly lead directly or indirectly to the protease activity in question, the addition of substances for the direct or indirect inhibition or activation of the protease in question.
  • a further component in particular a further protein
  • the method according to the invention is preferably used for the detection and characterization of apoptosis-relevant protease activity.
  • the transformed cells from step a) in step b) could be exposed to conditions that are known to cause apoptosis.
  • the method according to the invention is preferably used for the detection and characterization of protease activities which occur as a result of a specific protein-protein interaction in the cell in question.
  • the transformed cells from step a) could be transformed in the context of step b) with one or with two expression vectors which code for two different, possibly interacting, fusion proteins.
  • step c) the at least one interfering amino acid sequence flanked on one or both sides by protease cleavages from step a) is proteolytically removed from the non-fluorescent protein or fusion protein from step a) depending on the occurrence of a protease activity in step b) ,
  • Successful proteolytic removal of the interfering amino acid sequence in the initially non-fluorescent reporter protein or fusion protein leads to the generation of a fluorescent reporter protein or fusion protein whose fluorescence is detectable.
  • step d the fluorescence of the reporter protein or the reporter fusion protein which occurs as a function of the protease activity is detected by means of suitable measurement methods.
  • suitable measurement methods In general, all methods known to the person skilled in the art which include the following steps are suitable for the detection of the fluorescence signal:
  • fluorescence microscopy is particularly suitable for detecting the fluorescence signal.
  • Fluorescence spectroscopy and the detection of fluorescent cells using FACS are also suitable for the detection of the fluorescence signal.
  • both endogenous proteases and exogenous proteases which are expressed in the host cell with the aid of a recombinant expression vector, can be detected and characterized.
  • the recombinant expression vector here comprises a nucleic acid sequence which encodes the protease in question under the control of a promoter.
  • An “endogenous protease” is understood in the following to mean a protease which is itself expressed in the host cell in question either constitutively, ie continuously, or non-constitutively, ie only at specific times or under specific conditions.
  • an “exogenous protease” is used understood a protease that is not expressed by the host genome itself, but is expressed in the host cell in question with the aid of an expression vector introduced from outside by transformation.
  • a protease-dependent cellular event preferably also includes "naturally occurring protease-dependent signal cascades", such as, in particular, apoptosis, blood coagulation, certain development-specific signal cascades Understand protein breakdown in the cell.
  • a protease-dependent cellular event is preferably also to be understood to mean “artificial protease-dependent events”, which take place in particular when the occurrence of protease activity is experimentally dependent on the occurrence of another cellular event, such as, for example, a specific protein-protein interaction depends.
  • a particularly preferred modification of the method according to the invention can be used for the detection of protein-protein interactions and comprises the following method steps:
  • the methods according to the invention are suitable not only for the pure detection of protease activity, but also for the more precise characterization of protease activity or of protease-dependent events.
  • Such inhibitors or activators of defined, physiologically relevant, in particular crane-relevant protease-dependent events could have a significant importance in the development of new drugs.
  • the invention therefore also relates to a screening method for identifying or characterizing inhibitors or activators of protease-dependent events in the cell.
  • a screening method could include method steps a) to d) which are carried out in a first test batch in the presence and in a second test batch in the absence of at least one test substance which potentially inhibits or could have activator properties related to the protease-dependent event being tested.
  • the fluorescence can be compared quantitatively as a measure of the protease activity occurring in the cell between the first and the second test batch in order to assess the actual inhibitor or activator properties of the at least one test substance.
  • the invention also relates to a screening method for identifying or characterizing inhibitors or activators of defined protein-protein interactions in the cell.
  • a screening method could include method steps A) to D), which are present in a first test batch in the presence and in a second test batch in the absence of one or more test substances, the potential inhibitor or activator properties with respect to a particular protein protein -Interaction could have been done.
  • the fluorescence can be compared quantitatively as a measure of the intensity of the protein-protein interactions occurring in the cell between the first and the second test batch in order to assess the actual inhibitor or activator properties of the test substance (s).
  • Another object of the invention is a transgenic non-human animal which has permanently integrated one of the above-mentioned expression cassettes according to the invention in its genome.
  • This transgenic, non-human animal is preferably a mouse or a rat.
  • Such a transgenic, non-human animal can preferably be used for the investigation of proteolytic processes in vivo, in particular for the analysis of caspase activities as an indicator of apoptotic processes.
  • sequence listing which comprises the following sequences:
  • SEQ ID NO. 1 contains a fragment of the Enhanced Yellow Fluorescent Protein (EYFP), which is the first 15 amino acids of the protein
  • Aequorea victoria includes, SEQ ID NO. 2 contains a fragment of the Enhanced Yellow Fluorescent Protein
  • EYFP which comprises the first 9 amino acids of the protein from Aequorea victoria
  • SEQ ID NO. 3 contains an example of a functional interfering amino acid sequence that tends to form ⁇ -helix structures and at the same time predominantly comprises hydrophilic amino acids (such as in particular glutamate, aspartate, arginine and lysine),
  • SEQ ID NO. 4 contains an example of a functional Stor amino acid sequence flanked on both sides by cloning sites and TEV protease interfaces,
  • SEQ ID NO. 5 contains the complete nucleotide sequence coding for the enhanced yellow fluorescent protein (EYFP),
  • SEQ ID NO. 6 contains the complete amino acid sequence of the enhanced yellow fluorescent protein (EYFP),
  • SEQ ID NO. 7 contains the complete nucleotide sequence of the SwitchEYFP clone swYFP-C5 (insertion between amino acids 6 and 7 of EYFP),
  • SEQ ID NO. 8 contains the complete amino acid sequence of the SwitchEYFP clone swYFP-C5 (insertion between amino acids 6 and 7 of EYFP),
  • SEQ ID NO. 9 contains the complete nucleotide sequence of the SwitchEYFP clone swYFP-H3 (insertion between amino acids 9 and 10 of EYFP),
  • SEQ ID NO. 10 contains the complete amino acid sequence of the SwitchEYFP clone swYFP-H3 (insertion between amino acids 9 and 10 of EYFP),
  • SEQ ID NO. 11 contains the sense strand of the adapter from example 1,
  • SEQ ID NO. 12 contains the counter-sense strand of the adapter from example 1.
  • SEQ ID NO. 13 contains the nucleotide sequence of pEGFP
  • SEQ ID NO. 14 contains the nucleotide sequence of pDXA-MCS-YFP
  • SEQ ID NO. 15 contains the nucleotide sequence of pDXA-CFP
  • SEQ ID NO. 16 contains the nucleotide sequence of the GFP cDNA
  • SEQ ID NO. 17 contains the nucleotide sequence of pBS-35S-YFP
  • SEQ ID NO. 18 contains the nucleotide sequence of the CFP cDNA
  • Fig. 1 describes the cloning strategy for producing the insertion mutagenesis library
  • hl Step 1 is a nucleic acid fragment coding for EYFP in the
  • the second step is the random insertion of the transposon flanked by Pmel interfaces (TN1-CmR-TN2, where CmR stands for the gene which mediates resistance to chloramphenicol).
  • the selection is based on the resistance of the transposon-containing vectors to chloramphenicol (Cm) and ampicillin (Amp.).
  • the vectors modified by random mutagenesis are cut with the restriction endonuclease Pmel, whereby the transposon is removed.
  • An adapter comprising the Stor amino acid sequence flanked on both sides by TEV protease interfaces is cloned into the vector linearized in this way at a random point.
  • Cells are selected with such vectors which no longer show EYFP fluorescence and which have resistance to Zeocin.
  • the vectors selected in this way are co-transfected together with expression vectors which express the TEV protease in PC12 cells. Cells are selected that fluoresce again due to the proteolytic removal of the interfering amino acid sequence from the EYFP.
  • FIG. 2 shows the first selection phase of the insertion mutagenesis.
  • expression vectors which express EYFP under the control of a promoter are produced, the nucleotide sequence of EYFP being interrupted at a random position by a nucleotide sequence coding for a disruptive amino acid sequence flanked on both sides by TEV protease cleavage sites (T stands here for a TEV protease interface and S stands for the Stor amino acid sequence).
  • T stands here for a TEV protease interface
  • S stands for the Stor amino acid sequence
  • FIG. 3 shows the second selection phase of the insertion mutagenesis.
  • the expression vectors selected in the first selection phase as non-fluorescent due to their insertion position are co-transfected into PC12 cells together with an expression vector expressing the TEV protease.
  • the TEV protease provided
  • HEK cells 4A and 4B being phase contrast images and 4C and 4D fluorescence images of the same cells.
  • 4E to H show CHO cells, 4E and 4F being phase contrast images and 4G and 4H being fluorescence images of the same cells.
  • 4 I and J show COS cells, 41 being a phase contrast image and 4J one
  • the switchEYFPs according to the invention can also be coupled to defined cell compartments.
  • the top row of figures show phase contrast images of PC12 cells, which are co-transfected with a switchEYFP expression vector and with an expression vector which expresses the TEV protease.
  • the lower row of pictures shows the corresponding fluorescence images.
  • the SwitchEYFP expression vector with which the cells from column A had been transfected is the expression vector from the clone swYFP-C5. As can be seen from the comparison of the phase contrast and the fluorescence image from A, the entire cell fluoresces in column A, as would be expected.
  • the SwitchEYFP expression vector with which the cells from column B had been transfected corresponds to the expression vector from the clone swYFP-C5 with the exception that the SwitchEYFP protein comprises a nuclear localization domain (nuc).
  • the SwitchEYFP protein comprises a nuclear localization domain (nuc).
  • the SwitchEYFP expression vector with which the cells from column C had been transfected corresponds to the expression vector from the clone swYFP-C5 with the
  • SwitchEYFP protein comprises a membrane lolization domain from the membrane protein syntaxin (Syx).
  • Syx membrane protein syntaxin
  • FIG. 6 shows that non-fluorescent EYFPs (ie switchEYFPs) that can be activated proteolytically for fluorescence are functional even in prokaryotic cells.
  • E.coli-Z ÜQn of type DH5a pBAD TEV were co-transfected with expression vectors coding for switchEYFPs under the control of a minimal promoter and with a vector which expresses the TEV protease under the control of a promoter which can be induced with arabinose. The expression of the TEV protease was then induced by adding arabinose to the cells.
  • Fig. 6 shows that only those cells that were grown on arabinose-containing medium (FIG '.
  • FIG. 7 shows the deletion mutants A to D of the expression vector from the clone swYFP-C5 (insertion point between amino acids 6 and 7 of EYFP), and fluorescence images of cells which had been • transcribed with these “deleted expression vectors” (in the absence of the TEV-
  • the expression vector E corresponds to the expression vector from the clone swYFP-C5 (insertion site between amino acids 6 and 7 of EYFP).
  • the expression vector D comprises the nucleotide sequence for an EYFP protein under the control of a promoter, this EYFP protein only starting with the 7th
  • Amino acid begins and additionally comprises the following amino acid sequence at its N-terminus: the 11 amino acids "RLMMALLTIHL” of the interfering amino acid sequence according to SEQ ID No. 3, a TEV protease interface (amino acids "ENLYFQ'G” ) and the amino acids "SGKHE” resulting from the cloning.
  • the expression vector C comprises the nucleotide sequence for an EYFP protein under the control of a promoter, this EYFP protein only beginning with the 7th amino acid (E at position 7) and additionally comprising the following amino acid sequence at its N-terminus: a TEV Protease interface (amino acids "ENLYFQ'G") and those resulting from the cloning
  • the expression vector B comprises the nucleotide sequence for an EYFP protein under the control of a promoter, this EYFP protein only beginning with the 7th amino acid (E at position 7) and additionally at its N-terminus with an amino acid sequence comprising only that from the Cloning resulting amino acids "SGKHE 1 " is fused.
  • Expression vector A comprises the nucleotide sequence for an EYFP protein under the control of a promoter, this EYFP protein only beginning with the 7th amino acid (E at position 7) and having no additional amino acid sequences appended to its N-terminus. Only PC12 cells that had been transfected with the expression vector E or D showed no fluorescence (FIGS. 7D and 7E). However, PC12 cells that had been transfected with expression vectors A, B or C still showed fluorescence ( Figures 7A, 7B, 7C). From this it can be concluded that the loss of the fluorescence of the switchEYFPs requires the presence of an interfering amino acid sequence, the minimum length of which is 10
  • Interaction domain expresses GCN4, and wherein the second expression vector expresses a fragment of the TEV protease, comprising amino acids 119 to 243, fused to a further interaction domain GCN4,
  • C for those cells that have been transfected with a first and a second expression vector, the first expression vector being a fragment of the TEV
  • Protease comprising amino acids 1 to 118 expressed, and wherein the second expression vector expresses a fragment of the TEV protease comprising amino acids 119 to 243.
  • All cells K, A, B, C are, in addition to the protease vectors described above, also co-transfected with an expression vector which expresses a switchEYFP according to the invention.
  • FIG. 8 shows that the activity of a protease - and the restoration of fluorescence caused by proteolytic removal of that of TEV-
  • Protease sites flanked by interfering amino acid sequence - can be provided both by an intact, complete TEV protease (see A from FIG. 8) and by a protein-protein interalction-dependent transcomplementation of a functional TEV protease (see B from FIG . 8th).
  • the method according to the invention can thus also be used for the detection and characterization of
  • FIG. 9 shows the determination of the fluorescence of a switchEYFP with caspase 3/7 interface (DEVD) between the interference sequence and the EYFP component.
  • the construct was expressed in CHO cells. The cells were first applied to 24-well plates (approx. 200,000 cells per well) and the next day with 0.2 ⁇ g plasmid using Lipofectamine 2000 (Invitrogen). transfected. After 24 h, the cells were stimulated with 20 ⁇ M freshly diluted camptothecin (Calbiochem) (B) or medium as control (A). The total fluorescence is shown (product of the number of positive cells and the value of the mean fluorescence of the positive cells)
  • Example 1 Production or screening for non-fluorescent, but proteolytically activatable for fluorescence EYFP variants by insertion mutagenesis
  • EYFP reporter proteins was the open reading frame of the Enhanced Yellow Fluorescent Protein (EYFP) with the oligonucleotide primers EYFP XlioI-sense (SEQ: gggctcgagaccatggtgagcaagggcgagga) and EYFP-XhoI antisense (Seq: gggctcgagcttgtacagctcgtccatgccga ) amplified by PCR and in the recombinant Vector pCMV-EM7-Zeo-ßGal cloned.
  • EYFP XlioI-sense SEQ: gggctcgagaccatggtgagcaagggcgagga
  • EYFP-XhoI antisense Seq: gggctcgagcttgtacagctcgtccatgccga
  • the recombinant vector resulting from this cloning is referred to below as pCMV-EYZG.
  • the vector contains the C promoter, an SFW polyadenylation sequence and the bacterial minimal promoter EM7 for the expression of downstream genes in E. coli and in higher eukaryotic cells.
  • the transcript of the pCMV-EYZG codes for a fusion protein from three domains, namely from EYFP, from the ZeoR protein, a protein which confers resistance to Zeocin, and from the ⁇ -galactosidase protein from E. coli.
  • the interfaces used for cloning were chosen so that a continuous reading frame was generated for all three domains of the fusion protein. (see Fig. 1).
  • the functionality of all three individual components of the fusion protein was provided by analysis of the epifluorescence in bacteria and in eukaryotic cells, by selection with Zeocin and by a colorimetric ß-Gal detection. Furthermore, an EYFP reading frame was cloned into the vector pCMV-EM7-Zeo-ßGal in opposite orientation with respect to the ZeoR-ßGal reading frame as a control vector.
  • a transposon-determined random mutagenesis was carried out with the plasmid pCMV-EYZG using the GPS-LS kit from New England Biolabs (NEB) according to the manufacturer's instructions. E.co/z cells were first transformed with the target plasmid pCMV-EYZG and with the transprimer-donor plasmid from the kit. The actual mutagenesis resulted in the presence of the TnsABC transposase in the cell. The mutagenesis gave rise to about 500 ampicillin, zeocin and chloromphenicol-resistant recombinant bacterial clones and were amplified on appropriate LB selection plates after cultivation. About 1000 Balcony colonies of the amplified recombinant bacterial clones were pooled and the plasmid DNA was isolated by standard methods (Qiaprep, Qiagen).
  • the selection for ampicillin resistance guarantees that the target plasmid is present in the cell.
  • the selection for Zeocin resistance guarantees that the insertion of the transposon has not led to a shift in the reading frame.
  • the selection for chloramphenicol resistance guarantees that a transposon is present in the target plasmid.
  • step 2 The complex plasmid-DNA mixture obtained in step 1 was digested with the restriction enzyme Xhol (NEB). After gel-electric separation, a 1.9 kb fragment comprising the EYFP together with the randomly inserted transposon was eluted from the gel (Qiaprep, Qiagen) and then ligated with an Xh ⁇ l-linearized, dephosphorylated pCMV-EM7 ZeoR-ßGa -ector. The ligation products were transformed into E. co / z cells and selected for ampicillin and chloramphenicol resistance. About 5000 successfully selected bacterial colonies were pooled. Plasmid DNA was then isolated from these colonies using standard methods (Qiaprep, Qiagen).
  • step 3 The complex plasmid-DNA mixture obtained in step 2 was digested with the restriction enzyme Pmel (NEB). This restriction cut removes a large fragment from the transposon, so that after the Pmel restriction cut only a few flanking bases of the transposon, namely 15 bp (5 amino acids at the protein level, see product description of the manufacturer, GPS-LS Kit, NEB) remain at the insertion site.
  • the products were then treated with alkaline phosphatase and separated by gel electrophoresis.
  • the vectors linearized at random locations on the EYFP reading frame were isolated from the gel by standard methods (Qiaquick, Qiagen).
  • flanking "TEV protease interfaces" represent specific recognition and cleavage sites of the NIa TEV protease.
  • the sturgeon fragment codes in the given orientation for a rigid, partially charged ⁇ -helix flanked by TEV interfaces.
  • the Predator (EMBL) program was used to analyze the presumed secondary structure of the sturgeon fragment.
  • the linearized, dephosphorylated vectors from step 3 were ligated with the 5'-phosphorylated adapter with the interfering nucleotide sequence flanked by TEV protease interfaces, hereinafter referred to as the 'interfering fragment' (see Example 1, No. 4).
  • the ligation products were transformed into E. coli cells. Recombinant clones were selected with ampicillin and zeocin. 480 successfully selected bacterial colonies were amplified individually. The plasmid DNA of the individual clones was then isolated using standard methods (Qiaprep, Qiagen).
  • the plasmid DNA of the single cell clones from step 4 was then analyzed in PC12 cells.
  • Two transformation approaches were carried out for each individual clone.
  • 1 ⁇ l of the plasmid preparations were transfected with Lipofectamin 2000 (Invitrogen) in C./2 cells.
  • 1 ⁇ l each of the plasmid preparations and 0.1 ⁇ g of an expression vector which can express the TEV protease under the control of a promoter (pCMV-TEV) were transfected with Lipofectamin 2000 (Invitrogen) in C72 cells. It was then checked whether the transformed PC72 cells of the first and second transformation approaches fluoresce or not.
  • the EYFP protein resulting from the clone swYFP-C5 has one of TEV protease
  • the EYFP protein resulting from the clone swYFP-H3 has one Interfering amino acid sequence flanked by TEV protease cleavage inserted between amino acids 9 and 10.
  • the N-terminus of the EYFP thus appears to be suitable for the insertion or for the attachment of a Stor amino acid sequence for generating a non-fluorescent, but proteolytically activatable reporter protein for fluorescence activation.
  • a Stor amino acid sequence for generating a non-fluorescent, but proteolytically activatable reporter protein for fluorescence activation Such an interfering amino acid sequence insertion, which acts as a proteolytic switch between fluorescence or non-fluorescence of a reporter protein, can be used for numerous assay variants for the detection and / or for the characterization of protease activities or of protease-dependent events.
  • Example 2 Fine analysis of the insertion site and the length of the killer sequence
  • the critical area for the insertion of the switch sequence is the N-tennine of EYFP.
  • the interfering amino acid sequence flanked by TEV protease interfaces was inserted in separate experiments after each of the first 12 amino acids of the protein EYFP EYFP variants produced in this way were then tested in PCI 2 cells by cotransfection with a vector which expresses the TEV protease.
  • switchEYFP_l_Störseq._2 stands for an expression vector which comprises a switchEYFP under the control of a promoter, the switchEYFP being an insertion of an interfering amino acid sequence according to SEQ FD flanked by TEV protease interfaces on both sides No. 3.
  • the result which is summarized in Table 2, shows that, in principle, all insertions between amino acids 2 and 9 result in EYFP variants which are proteolytically “switchable” with regard to their fluorescence, ie these variants do not lead to fluorescence in the absence of protease activity, but to fluorescence in the presence of protease activity.
  • Amino acid sequence can also simply be attached to the N-terminus of the EYFP.
  • the first 1 to 9 amino acids of the EYFP can also be deleted and the flanked interfering amino acid sequence can be fused directly to the N-terminus of the corresponding remaining EYFP fragment.
  • Example 3 Different localized variants of non-fluorescent, but proteolytically activatable reporter proteins for fluorescence
  • Non-fluorescent, but proteolytically activatable for fluorescence reporter proteins which have an interfering amino acid sequence flanked on one or two sides by protease cleavage sites attached to the N-terminus or inserted at the above positions, can also be fused to other proteins or protein domains at different positions localize within the cell.
  • a switch EYFP variant with core localization and a switch-EYFP variant with membrane anchoring in PC72 cells was successfully tested.
  • Example 3.1 Non-fluorescent EYFP with nuclear localization that can be activated proteolytically for fluorescence
  • switchEYFPnuc A nuclear localization signal was fused in frame at the C-terminus of a switch EYFP (hereinafter referred to as "switchEYFPnuc"). This resulted in the protein being transported preferentially into the nucleus of eukaryotic cells.
  • FIG. 5B PC / 2- Cells which were co-transfected with an expression vector which expresses switchEYFPnuc and with an expression vector which expresses the TEV protease, a fluorescence in the nucleus which was dependent on the presence of the TEV protease could be observed.
  • Example 3.2 Non-fluorescent EYFP with membrane localization that can be activated proteolytically for fluorescence
  • a switchEYFP was fused to the N-terminus of a fragment of the synaptic membrane protein Syntaxin 1A (amino acid 1-147) (hereinafter referred to as "switchEYFPsyx"). Due to the C-terninal transmembrane domain, the fusion protein is anchored to the cell membrane of eukaryotic cells.
  • Fig " 5C shows C / 2 cells which have been co-transfected with an expression vector which expresses switchEYFPsyx and with an expression vector which expresses the TEV protease. A fluorescence dependent on the presence of the TEV protease could mainly be found on the This variant switchEYFPsyx can be activated particularly well by cotransfection of a membrane-anchored TEV protease (data not shown).
  • Example 4 Expression of non-fluorescent EYFP which can be activated proteolytically for fluorescence in further eukaryotic cells
  • the functions of the switchEYFPs were also tested in other cell lines. 4 shows that the fluorescence of the EYFPs which can be switched on by proteolysis also in CHO cells ⁇ Chinese hamster and in HEK293 cells (human embryonic kidney) Cells) can be observed. In all cell lines tested, the switchEYFPs tested were non-fluorescent and only recovered their fluorescence by co-transfecting an expression vector coding for the TEV protease.
  • non-fluorescent EYFPs ie switchEYFPs
  • E.co/z ' cells of the type DH5apBAD ⁇ TEV were transformed with expression vectors coding for switchEYFPs.
  • This plasmid also has a “pl5A origin”, so that co-transformation with “ColEl origin vectors” is possible.
  • E.co/z ' cells were transformed with an expression vector coding for a switchEYFP under the control of the E 7 minimal promoter.
  • the expression of the TEV protease was then induced by adding arabinose to the cells.
  • Fig. 6 it is shown that only those cells that had grown on medium containing arabinose fluoresce clearly green. This means that the non-fluorescent switchEYFPs according to the invention can also be “switched on” by proteolysis for fluorescence in the prokaryotic E.co/z cells.
  • Example 6 Minimum length of the Stor amino acid sequence flanked by TEV protease interfaces
  • the variant E from FIG. 7 corresponds to the expression vector from the clone swYFP-C5, i.e. in this expression vector the entire interfering amino acid sequence according to SEQ ID No. 3, inserted together with a TEV protease interface and the GPS linker sequence after amino acid 6 of the EYFP amino acid sequence.
  • FIG. 7E cells which were transformed with an expression vector of variant E show no fluorescence at all.
  • variant D of the expression vector from FIG. 7 only one amino acid sequence comprising the last 11 amino acids of the interfering amino acid sequence according to SEQ YD No. 3, the TEV interface and the GPS-Lincer sequence N-te ⁇ ninal appended to an EYFP fragment which begins only with the 7th amino acid of the EYFP sequence. 7 D shows that cells which were transformed with an expression vector of variant D likewise do not fluoresce.
  • variant C of the expression vector only the TEV interface with the GPS linker sequence and in variant B of the expression vector, only the GPS linker sequence alone was cloned N-te ⁇ ninal to an EYFP fragment which only with the 7th amino acid of the EYFP Sequence begins. Furthermore, a variant A of the expression vector was produced which does not carry any additional sequence, but which only starts at amino acid E7 (FIG. 7).
  • a SwitchEYFP according to the invention can in particular also be used as an indicator for protein-protein interactions.
  • the specific interaction between two proteins, between a protein and a substance or between two proteins and a substance should lead to the activation of a proteolytic activity.
  • This coupling between a protein-protein interaction and a proteolytic activity can preferably be achieved by the protein-protein interaction-dependent transcomplementation of a functional protease, as described in the earlier priority and subsequent publication (internal name DE 102 11 063.8).
  • two potentially interacting proteins are fused to a non-functional fragment of a protease, in particular the TEV protease (243 amino acids long), with the generation of two fusion proteins. Through the interaction of these proteins, the protease fragments are brought into close proximity to one another so that the lost protease activity is recovered.
  • the first fusion protein can in particular comprise a fragment comprising amino acids 1 to 118 of the TEV protease and a first potentially interacting protein
  • the second fusion protein can in particular comprise a fragment comprising amino acids 119 to 243 of the TEV protease and a second potentially interacting protein
  • a division of the TEV protease between amino acids 118 and 119 for transcomplementation has proven experimentally to be favorable, ie the one here TEV protease fragments generated are all non-functional in themselves, but form a functional TEV protease, provided that these interact spatially due to the interaction of the interacting domains of the fusion proteins.
  • fusion proteins with protease fragments other than those described above or fusion proteins with overlapping protease fragments are also capable of providing protease activity by transcomplementation.
  • the protease activity recovered after transcomplementation of two protease fragments was to be detected as a detector using a switchEYFP according to the invention.
  • the interaction domains of the GCN4 leucine zipper protein were used as a model, at whose C-terminus the protease fragments amino acid 1 to 118 and amino acid 119 to 243 had been fused.
  • the interaction domains of the GCN4 leucine zipper protein are known to form homodimers.
  • Example 8 shows the result after evaluation of the fluorescence by means of FACS analysis.
  • the cotransfection of the entire (“undivided”) TEV protease and a switchEYFP leads to protease reactivity in the cell, to the proteolytic removal of the Stor amino acid sequence and thus ultimately to the fluorescence of the cell.
  • the cotransfection of a switchEYFP and partial fragments of the TEV protease in each case fused to the interaction domains of GCN4 also leads to protease activity in the cell, proteolytic removal of the interfering amino acid sequence and ultimately to fluorescence of the cell. No activation takes place when a switchEYFP and an empty vector or the vector comprising the TEV are co-transfected. Fragments alone without the interaction domains of GCN4 (negative controls).
  • Example 8 Use of a non-fluorescent EYFP that can be activated proteolytically for fluorescence for the detection of caspase activity
  • the following example should show that the alctivity of endogenous proteases can also be detected by expression of one of the sensor proteins according to the invention.
  • EYFP amino acid 6-238
  • the interference sequence was cloned.
  • a nuclear localization signal was fused at the C-th pin of EYFP, which leads to an accumulation of fluorescence in the cell nucleus. The latter makes detection easier.
  • CHO Choinese Hamster Ovary
  • DEVD motif caspase 3 interface
  • apoptosis was triggered by the addition of a cell poison (Campto hecin).
  • An essential characteristic of apoptosis is the specific activation of proteases, the so-called caspases. 20 hours after stimulation, the cells were analyzed microscopically, and there was a clear increase in fluorescent cells in the dishes treated with camptofhecin (data not shown). For exact quantification, the cells were harvested with colorless trypsin EDTA (Gibco) and their number and fluorescence were determined in the FACS analyzer (FACScalibur; BD-Bioscience). The result is shown in FIG. 9, it shows that due to the caspase 3 alctivity induced by camptothecin, the fluorescence signal increases significantly. Fluorescence is also detectable in the non-stimulated control. This was to be expected, since cells in the cultures are constantly dying.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un acide nucléique codant pour une protéine non fluorescente mais activable par voie protéolytique aux fins de fluorescence. Cette protéine contient à son extrémité N au moins une séquence d'acides aminés perturbateur flanquée d'un côté ou des deux côtés d'une interface de protéase. L'invention concerne également la protéine codée par cet acide nucléique ou une de ses protéines de fusion.
PCT/EP2004/004142 2003-04-17 2004-02-19 Proteine « rapporteur » non fluorescente, activable par proteolyse pour fluorescence et son utilisation pour la detection d'evenements fonction de la protease WO2004092211A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10318048.6 2003-04-17
DE2003118048 DE10318048A1 (de) 2003-04-17 2003-04-17 Nicht fluoreszierende, durch Proteolyse zur Fluoreszenz aktivierbare Reporterproteine und ihre Verwendung zur Detektion Protease-abhängiger Ereignisse

Publications (1)

Publication Number Publication Date
WO2004092211A1 true WO2004092211A1 (fr) 2004-10-28

Family

ID=33103529

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2004/004142 WO2004092211A1 (fr) 2003-04-17 2004-02-19 Proteine « rapporteur » non fluorescente, activable par proteolyse pour fluorescence et son utilisation pour la detection d'evenements fonction de la protease

Country Status (2)

Country Link
DE (1) DE10318048A1 (fr)
WO (1) WO2004092211A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1792181A2 (fr) * 2004-06-21 2007-06-06 Progenra Inc. Methode de diagnostic et de criblage, et trousses associees a une activite proteolytique
WO2018035451A1 (fr) 2016-08-19 2018-02-22 Calimmune, Inc. Méthodes et compositions pour le traitement d'affections à l'aide d'un virus adéno-associé recombinant auto-complémentaire
CN110628801A (zh) * 2019-10-09 2019-12-31 武汉博欧特生物科技有限公司 一种蛋白表达及纯化的方法
CN112813017A (zh) * 2019-11-18 2021-05-18 广东省农业科学院环境园艺研究所 国兰原生质体瞬时表达系统及其构建方法与应用
US11958886B2 (en) 2016-12-07 2024-04-16 University Of Florida Research Foundation, Incorporated IL-1RA cDNAs

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000073437A1 (fr) * 1999-05-27 2000-12-07 Merck Frosst Canada & Co. Analyses permettant de detecter l'activite de caspases a l'aide de proteines fluorescentes vertes
FR2830020A1 (fr) * 2001-09-25 2003-03-28 Univ Victor Segalen Bordeaux 2 Acide nucleique pour l'obtention d'un polynucleotide codant une proteine de detection et d'isolement d'un ligand "proie" et applications de cet acide nucleique

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6197928B1 (en) * 1997-03-14 2001-03-06 The Regents Of The University Of California Fluorescent protein sensors for detection of analytes
EP0928968A1 (fr) * 1998-01-12 1999-07-14 Universität Basel Méthode pour le screening de l'apoptose, et de la nécrose
AU3931699A (en) * 1998-05-04 1999-11-23 Fraunhofer-Gesellschaft Zur Forderung Der Angewandten Forschung E.V. Method and device for isolating nucleic acids
DE19819889A1 (de) * 1998-05-04 1999-11-11 Fraunhofer Ges Forschung Verfahren zur Isolierung von Nucleinsäuren
US6495664B1 (en) * 1998-07-24 2002-12-17 Aurora Biosciences Corporation Fluorescent protein sensors of post-translational modifications
US6410255B1 (en) * 1999-05-05 2002-06-25 Aurora Biosciences Corporation Optical probes and assays
EP1295121B1 (fr) * 1999-12-22 2006-03-08 PerkinElmer BioSignal Inc. Systeme de transfert d'energie par resonance bioluminescente (bret) a resolution spectrale large entre des longueurs d'ondes d'emission de donneur et d'accepteur, et utilisation associee

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000073437A1 (fr) * 1999-05-27 2000-12-07 Merck Frosst Canada & Co. Analyses permettant de detecter l'activite de caspases a l'aide de proteines fluorescentes vertes
FR2830020A1 (fr) * 2001-09-25 2003-03-28 Univ Victor Segalen Bordeaux 2 Acide nucleique pour l'obtention d'un polynucleotide codant une proteine de detection et d'isolement d'un ligand "proie" et applications de cet acide nucleique

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
CHIESA A ET AL: "Recombinant aequorin and green fluorescent protein as valuable tools in the study of cell signalling.", THE BIOCHEMICAL JOURNAL. ENGLAND 1 APR 2001, vol. 355, no. Pt 1, 1 April 2001 (2001-04-01), pages 1 - 12, XP002286469, ISSN: 0264-6021 *
DANTUMA N P ET AL: "SHORT-LIVED GREEN FLUORESCENT PROTEINS FOR QUANTIFYING UBIQUITIN/PROTEASOME-DEPENDENT PROTEOLYSIS IN LIVING CELLS", NATURE BIOTECHNOLOGY, NATURE PUBLISHING, US, vol. 18, May 2000 (2000-05-01), pages 538 - 543, XP002945558, ISSN: 1087-0156 *
DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; 2003, LAAGE R ET AL: "Generation and characterisation of proteolytically activatable fluorescent protein derivatives and their application as reporter in neuronal cells.", XP002286471, Database accession no. PREV200400199770 *
FEILMEIER BRADLEY J ET AL: "Green fluorescent protein functions as a reporter for protein localization in Escherichia coli", JOURNAL OF BACTERIOLOGY, WASHINGTON, DC, US, vol. 182, no. 14, July 2000 (2000-07-01), pages 4068 - 4076, XP002263489, ISSN: 0021-9193 *
FURUTANI Y ET AL: "A simple assay and histochemical localization of transglutaminase activity using a derivative of green fluorescent protein as substrate.", THE JOURNAL OF HISTOCHEMISTRY AND CYTOCHEMISTRY: OFFICIAL JOURNAL OF THE HISTOCHEMISTRY SOCIETY. UNITED STATES FEB 2001, vol. 49, no. 2, February 2001 (2001-02-01), pages 247 - 258, XP002286468, ISSN: 0022-1554 *
LINDSTEN K ET AL: "Cell-based fluorescence assay for human immunodeficiency virus type 1 protease activity", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, AMERICAN SOCIETY FOR MICROBIOLOGY, WASHINGTON, DC, US, vol. 45, no. 9, September 2001 (2001-09-01), pages 2616 - 2622, XP002248748, ISSN: 0066-4804 *
MARCH J C ET AL: "Biotechnological applications of green fluorescent protein.", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 62, no. 4, September 2003 (2003-09-01), pages 303 - 315, XP002286470, ISSN: 0175-7598 *
MITRA R D ET AL: "Fluorescence resonance energy transfer between blue-emitting and red-shifted excitation derivatives of the green fluorescent protein", GENE, ELSEVIER BIOMEDICAL PRESS. AMSTERDAM, NL, vol. 173, no. 1, 1996, pages 13 - 17, XP004042847, ISSN: 0378-1119 *
SCHAUER-VUKASINOVIC VESNA ET AL: "Purification method for recombinant proteins based on a fusion between the target protein and the C-terminus of calmodulin.", ANALYTICAL AND BIOANALYTICAL CHEMISTRY. GERMANY JUL 2002, vol. 373, no. 6, July 2002 (2002-07-01), pages 501 - 507, XP002286467, ISSN: 1618-2642 *
SOCIETY FOR NEUROSCIENCE ABSTRACT VIEWER AND ITINERARY PLANNER, vol. 2003, 2003, 33rd Annual Meeting of the Society of Neuroscience;New Orleans, LA, USA; November 08-12, 2003, pages Abstract No. 427.6 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1792181A2 (fr) * 2004-06-21 2007-06-06 Progenra Inc. Methode de diagnostic et de criblage, et trousses associees a une activite proteolytique
EP1792181A4 (fr) * 2004-06-21 2008-02-20 Progenra Inc Methode de diagnostic et de criblage, et trousses associees a une activite proteolytique
US7842460B2 (en) 2004-06-21 2010-11-30 Progenra Inc. Method for assessing proteolytic enzyme activity using ubiquitin fusion substrate
WO2018035451A1 (fr) 2016-08-19 2018-02-22 Calimmune, Inc. Méthodes et compositions pour le traitement d'affections à l'aide d'un virus adéno-associé recombinant auto-complémentaire
US11207382B2 (en) 2016-08-19 2021-12-28 University Of Florida Research Foundation, Incorporated Compositions for treating conditions using recombinant self-complementary adeno-associated virus
US11958886B2 (en) 2016-12-07 2024-04-16 University Of Florida Research Foundation, Incorporated IL-1RA cDNAs
CN110628801A (zh) * 2019-10-09 2019-12-31 武汉博欧特生物科技有限公司 一种蛋白表达及纯化的方法
CN112813017A (zh) * 2019-11-18 2021-05-18 广东省农业科学院环境园艺研究所 国兰原生质体瞬时表达系统及其构建方法与应用
CN112813017B (zh) * 2019-11-18 2023-03-28 广东省农业科学院环境园艺研究所 国兰原生质体瞬时表达系统及其构建方法与应用

Also Published As

Publication number Publication date
DE10318048A1 (de) 2004-11-04

Similar Documents

Publication Publication Date Title
DE69928255T2 (de) Biolumineszentes resonanz-energie-transfersystem (bret) und seine anwendung
EP1483576B1 (fr) Procede de detection et d'analyse d'interactions proteiques in vivo
DE60026603T2 (de) Biolumineszenz-Resonanz-Energie-Transfer(BRET)-System mit großer spektraler Auflösung zwischen der Donator- und der Akzeptoremissionswellenlänge sowie dessen Verwendun
DE69936103T2 (de) Fusionsproteine bestehend aus proteingerüst und bibliotheken von zufälligen peptiden
DE60203123T2 (de) Photoprotein mit verbesserter Biolumineszenz
DE60032927T2 (de) Verfahren and zusammenstellungen, die renilla gfp enthalten
EP1137810B1 (fr) Analyse selective peptidiques pour détecter l'activité de gamma-sécrétase
DE60033551T2 (de) Sonde zum analysieren von protein-protein-wechselwirkungen und entsprechendes verfahren dafür
US20200010513A1 (en) Light-gated signaling modulation
EP1307482B1 (fr) Test fluorometrique bichrome servant a determiner l'activite de proteases
EP1381624A2 (fr) Detection specifique d'enzymes proteolytiques au moyen d'un protein hybride
WO2004092211A1 (fr) Proteine « rapporteur » non fluorescente, activable par proteolyse pour fluorescence et son utilisation pour la detection d'evenements fonction de la protease
DE60210266T2 (de) Verfahren zum nachweis von modulatoren einer sekretaseaktivität
DE60104019T2 (de) Zusammensetzungen, Verfahren und Reagentiensätze zur Erkennung von Protein-Protein Wechselwirkung störenden Substanzen
DE60221550T2 (de) Methode zur bestimmung der zellzyklusposition
WO2005033706A1 (fr) Procede de detection et d'analyse d'interactions proteine-proteine
US8236937B2 (en) Methods and compositions for the detection and isolation of ligands
US20040042961A1 (en) Development of an in vivo functional assay for proteases
EP1007968B1 (fr) Procede et kit pour identifier des interactions entre des proteines ou des peptides
DE10257354A1 (de) Isoliertes fluoreszierendes Protein CGFP, sowie dessen Verwendung
DE602004013320T2 (de) Verfahren zur demonstration eines molekularen ereignisses in einer zelle mittels fluoreszenzmarkerproteinen
WO2008095623A2 (fr) Luciférase sécrétée lu164m3 et son utilisation
DE69635355T2 (de) Verfahren zum Nachweis von biologisch aktiven Substanzen
DE10328775B4 (de) In vivo-Testsystem zum Nachweis von HIV-Proteaseaktivität
DE19715683C2 (de) Neue Reportervektoren für One-Hybrid und Two-Hybrid Systeme

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase