WO2003092623A2 - Calicheamicin derivative-carrier conjugates - Google Patents
Calicheamicin derivative-carrier conjugates Download PDFInfo
- Publication number
- WO2003092623A2 WO2003092623A2 PCT/US2003/013910 US0313910W WO03092623A2 WO 2003092623 A2 WO2003092623 A2 WO 2003092623A2 US 0313910 W US0313910 W US 0313910W WO 03092623 A2 WO03092623 A2 WO 03092623A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- prednisone
- vincristine
- cyclophosphamide
- doxorubicin
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/17—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine
- A61K31/175—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine having the group, >N—C(O)—N=N— or, e.g. carbonohydrazides, carbazones, semicarbazides, semicarbazones; Thioanalogues thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
- A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
- A61K47/6807—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug or compound being a sugar, nucleoside, nucleotide, nucleic acid, e.g. RNA antisense
- A61K47/6809—Antibiotics, e.g. antitumor antibiotics anthracyclins, adriamycin, doxorubicin or daunomycin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/54—F(ab')2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
Definitions
- the present invention relates to methods for the production of monomeric cytotoxic drug/carrier conjugates (the "conjugates") with higher drug loading and substantially reduced low conjugate fraction (LCF). Particularly, the invention relates to anti-CD22 antibody-monomeric calicheamicin conjugates. The invention also relates to the conjugates of the invention, to methods of purification of the conjugates, to pharmaceutical compositions comprising the conjugates, and to uses of the conjugates.
- Drug conjugates developed for systemic pharmacotherapy are target-specific cytotoxic agents.
- the concept involves coupling a therapeutic agent to a carrier molecule with specificity for a defined target cell population.
- Antibodies with high affinity for antigens are a natural choice as targeting moieties. With the availability of high affinity monoclonal antibodies, the prospects of antibody-targeting therapeutics have become promising.
- Toxic substances that have been conjugated to monoclonal antibodies include toxins, low-molecular-weight cytotoxic drugs, biological response modifiers, and radionuclides.
- Antibody-toxin conjugates are frequently termed immunotoxins, whereas immunoconjugates consisting of antibodies and low- molecular-weight drugs such as methothrexate and Adriamycin are called chemoimmunoconjugates.
- Immunomoduiators contain biological response modifiers that are known to have regulatory functions such as lymphokines, growth factors, and complement-activating cobra venom factor (CVF).
- Radioimmunoconjugates consist of radioactive isotopes, which may be used as therapeutics to kill cells by their radiation or used for imaging.
- the present invention relates to immunoconjugates comprising an antibody as a targeting vehicle and having specificity for antigenic determinants on the surface of malignant cells conjugated to a cytotoxic drug.
- the invention relates to cytotoxic drug-antibody conjugates, wherein the antibody has specificity for antigenic determinants on B-malignancies, lymphoproliferative disorders and chronic inflammatory diseases.
- the present invention also relates to methods for producing immunoconjugates and to their therapeutic use(s).
- a number of antibody-based therapeutics for treating a variety of diseases including cancer and rheumatoid arthritis have been approved for clinical use or are in clinical trials for a variety of malignancies including B-cell malignancies such as Non-Hodgkin's lymphoma.
- One such antibody-based therapeutic is rituximab (RituxanTM), an unlabelled chimeric human ⁇ 1 (+m ⁇ 1V-region) antibody, which is specific for cell surface antigen CD20, which is expressed on B-cells.
- Immunoconjugates comprising a member of the potent family of antibacterial and antitumor agents, known collectively as the calicheamicins or the LL-E33288 complex, (see U.S. Patent No. 4,970,198 (1990)), were developed for use in the treatment of myelomas.
- the most potent of the calicheamicins is designated ⁇ t , which is herein referenced simply as gamma.
- These compounds contain a methyltrisulfide that can be reacted with appropriate thiols to form disulfides, at the same time introducing a functional group such as a hydrazide or other functional group that is useful in attaching a calicheamicin derivative to a carrier.
- the presence of aggregated protein which may be nonspecifically toxic and immunogenic, and therefore must be removed for therapeutic applications, makes the scale-up process for the production of these conjugates more difficult and decreases the yield of the products.
- the amount of calicheamicin loaded on the carrier protein (the drug loading), the amount of aggregate that is formed in the conjugation reaction, and the yield of final purified monomeric conjugate that can be obtained are all related. A compromise must therefore be made between higher drug loading and the yield of the final monomer by adjusting the amount of the reactive calicheamicin derivative that is added to the conjugation reaction.
- the present invention relates to methods for the production of monomeric cytotoxic drug derivative/carrier conjugates (the "conjugates") with higher loading and substantially reduced low conjugate fraction (LCF).
- the invention relates to the production of monomeric calicheamicin derivative-carrier conjugates, to the conjugates, to compositions, to a method of purification of the conjugates, and to use of the conjugates.
- the invention relates to methods for producing a monomeric calicheamicin derivative-anti-CD22 antibody conjugate (CMC-544).
- the present invention discloses an improved conjugation process for the production of the conjugates that resulted in significantly lower levels of the LCF (below 10 percent) without any significant alteration of the physical or chemical properties.
- the invention also discloses a further improvement to the conjugation process which results in not only a significant reduction in the levels of the LCF, but also results in a significant reduction in aggregation from previously disclosed processes, and produces substantially increased drug loading.
- the conjugates of the present invention have the formula:
- Pr(-X-W) m wherein: Pr is a proteinaceous carrier,
- X is a linker that comprises a product of any reactive group that can react with a proteinaceous carrier
- W is a cytotoxic drug
- m is the average loading for a purified conjugation product such that the cytotoxic drug constitutes 7 - 9% of the conjugate by weight
- (-X-W ) m is a cytotoxic drug derivative.
- the conjugates of the present invention are generated by the method of the invention comprising the steps of: (1) adding the cytotoxic drug derivative to the proteinaceous carrier wherein the cytotoxic drug derivative is 4.5 - 11% by weight of the proteinaceous carrier; (2) incubating the cytotoxic drug derivative and a proteinaceous carrier in a non-nucleophilic, protein-compatible, buffered solution having a pH in a range from about 7 to 9 to produce a monomeric cytotoxic drug/carrier conjugate, wherein the solution further comprises (a) an organic cosolvent, and (b) an additive comprising at least one C 6 -C 18 carboxylic acid or its salt, and wherein the incubation is conducted at a temperature ranging from about 30°C to about 35°C for a period of time ranging from about 15 minutes to 24 hours; and (3) subjecting the conjugate produced in step (2) to a chromatographic separation process to separate the monomeric cytotoxic drug derivative/ proteinaceous carrier conjugates with a loading in the range of 4
- the proteinaceous carrier is an antibody.
- the antibody is selected from a group consisting of a monoclonal antibody, a chimeric antibody, a human antibody, a humanized antibody, a single chain antibody, a Fab fragment and a F(ab)2 fragment.
- the humanized antibody is directed against the cell surface antigen CD22.
- the humanized anti-CD22 antibody is a CDR- grafted antibody, and comprises a light chain variable region 5/44-gL1 (SEQ ID NO:19), and a heavy chain variable region 5/44-gH7 (SEQ ID NO:27).
- the humanized anti-CD22 antibody is a CDR-grafted antibody comprising a light chain having a sequence set forth in SEQ ID NO: 28.
- the humanized anti-CD22 antibody is a CDR-grafted antibody comprising a heavy chain having a sequence set forth in SEQ ID NO:30.
- the humanized anti-CD22 antibody is a CDR-grafted antibody comprising a light chain having a sequence set forth in SEQ ID NO: 28 and a heavy chain having a sequence set forth in SEQ ID NO: 30.
- the humanized anti-CD22 antibody is a CDR-grafted antibody that is a variant antibody obtained by an affinity maturation protocol and has increased specificity for human CD22.
- the cytotoxic drug used to generate the monomeric cytotoxic drug/carrier conjugate of the present invention is either an inhibitor of tubulin polymerization, an alkylating agent that binds to and disrupts DNA, an inhibitor protein synthesis, or an inhibitor of tyrosine kinases.
- the cytotoxic drug is selected from calicheamicins, thiotepa, taxanes, vincristine, daunorubicin, doxorubicin, epirubicin, esperamicins, actinomycin, authramycin, azaserines, bleomycins, tamoxifen, idarubicin, dolastatins/auristatins, hemiasterlins, and maytansinoids.
- the cytotoxic drug is calicheamicin.
- the calicheamicin is gamma calicheamicin or N- acetyl gamma calicheamicin derivative.
- the cytotoxic drug is functionalized with 3-mercapto-3- methyl butanoyl hydrazide and conjugated to a proteinaceous carrier via a hydrolyzable linker that is capable of releasing the cytotoxic drug from the conjugate after binding and entry into target cells.
- the hydrolyzable linker is 4-(4- acetylphenoxy) butanoic acid (AcBut).
- octanoic acid or its salt, or decanoic acid or its salt is used as an additive during the conjugation process to decrease aggregation and increase drug loading.
- the conjugates of the invention are purified by a chromatographic separation process.
- the chromatographic separation process used to separate the monomeric drug derivative-carrier conjugate is size exclusion chromatography (SEC). In another embodiment, the chromatographic separation process used to separate the monomeric drug derivative-carrier conjugate is HPLC, FPLC or Sephacryl S-200 chromatography.
- the chromatographic separation process used to separate the monomeric drug derivative-carrier conjugate is hydrophobic interaction chromatography (HIC).
- HIC is carried out using Phenyl Sepharose 6 Fast Flow chromatographic medium, Butyl Sepharose 4 Fast Flow chromatographic medium, Octyl Sepharose 4 Fast Flow chromatographic medium, Toyopearl Ether-650M chromatographic medium, Macro-Prep methyl HIC medium or Macro-Prep t-Butyl HIC medium.
- HIC is carried out using Butyl Sepharose 4 Fast Flow chromatographic medium.
- the invention is directed to a monomeric cytotoxic drug derivative/carrier conjugate produced by the method of the invention.
- the cytotoxic drug used is calicheamicin and the carrier used is an antibody.
- the antibody is selected from a group consisting of a monoclonal antibody, a chimeric antibody, a human antibody, a humanized antibody, a single chain antibody, a Fab fragment and a F(ab)2 fragment.
- a humanized antibody directed against the cell surface antigen CD22 is used.
- the humanized anti-CD22 antibody is a CDR-grafted antibody, and comprises a light chain variable region 5/44-gL1 (SEQ ID NO:19), and a heavy chain variable region 5/44-gH7 (SEQ ID NO:27).
- the humanized anti-CD22 antibody is a CDR-grafted antibody comprising a light chain having a sequence set forth in SEQ ID NO: 28.
- the humanized anti-CD22 antibody is a CDR- grafted antibody comprising a heavy chain having a sequence set forth in SEQ ID NO: 30. In another preferred embodiment, the humanized anti-CD22 antibody is a
- the humanized anti-CD22 antibody is a CDR- grafted antibody that is a variant antibody obtained by an affinity maturation protocol which has increased specificity for human CD22.
- the calicheamicin is gamma calicheamicin or N- acetyl gamma calicheamicin.
- the calicheamicin derivative is functionalized with 3- mercapto-3-methyl butanoyl hydrazide.
- the linker used to conjugate the drug to the carrier is a hydrolyzable linker that is capable of releasing the cytotoxic drug from the conjugate after binding and entry into target cells.
- the hydrolyzable linker is 4-(4-acetylphenoxy) butanoic acid (AcBut).
- Another aspect of the invention is directed to a monomeric calicheamicin dehvative/anti-CD22 antibody conjugate having the formula, Pr(-X-S-S-W) m wherein: Pr is an anti-CD22 antibody; X is a hydrolyzable linker that comprises a product of any reactive group that can react with an antibody; W is a calicheamicin radical; m is the average loading for a purified conjugation product such that the calicheamicin constitutes 4 - 10% of the conjugate by weight; and (-X-S-S-W) m is a calicheamicin derivative generated by the process of the invention.
- the antibody is selected from a group consisting of a monoclonal antibody, a chimeric antibody, a human antibody, a humanized antibody, a single chain antibody, a Fab fragment and a F(ab)2 fragment.
- the antibody is an anti-CD22 antibody that has specificity for human CD22, and comprises a heavy chain wherein the variable domain comprises a CDR having at least one of the sequences given as H1 in Figure 1 (SEQ ID NO:1) for CDR-H1 , as H2 in Figure 1 (SEQ ID NO:2) or H2' (SEQ ID NO:13) or H2" (SEQ ID NO:15) or H2'" (SEQ ID NO:16) for CDR-H2, or as H3 in Figure 1 (SEQ ID NO:3) for CDR-H3, and comprises a light chain wherein the variable domain comprises a CDR having at least one of the sequences given as L1 in Figure 1 (SEQ ID NO:4) for CDR-L1, as L2 in Figure 1 (SEQ ID NO:5) for CDR-L2, or as L3 in Figure 1 (SEQ ID NO:6) for CDR-L3.
- the anti-CD22 antibody comprises a heavy chain wherein the variable domain comprises a CDR having at least one of the sequences given in SEQ ID NO:1 for CDR-H1 , SEQ ID NO:2 or SEQ ID NO:13 or SEQ ID NO: 15 or SEQ ID NO: 16 for CDR-H2, or SEQ ID NO:3 for CDR-H3, and a light chain wherein the variable domain comprises a CDR having at least one of the sequences given in SEQ ID NO:4 for CDR-L1 , SEQ ID NO:5 for CDR-L2, or SEQ ID
- the anti-CD22 antibody comprises SEQ ID NO:6 for CDR-L3.
- the anti-CD22 antibody comprises SEQ ID NO:6 for CDR-L3.
- the humanized anti-CD22 antibody is a CDR-grafted anti-CD22 antibody and comprises a variable domain comprising human acceptor framework regions and non-human donor CDRs.
- the humanized anti-CD22 antibody has a human acceptor framework wherein regions of the variable domain of the heavy chain of the antibody are based on a human sub-group I consensus sequence and comprise non- human donor residues at positions 1 , 28, 48, 71 and 93. In another embodiment, the humanized antibody further comprises non-human donor residues at positions 67 and 69.
- the CDR-grafted humanized antibody comprises a variable domain of the light chain comprising a human acceptor framework region based on a human sub-group I consensus sequence and further comprising non-human donor residues at positions 2, 4, 37, 38, 45 and 60. In another embodiment, the CDR-grafted antibody further comprises a non-human donor residue at position 3.
- the CDR-grafted antibody comprises a light chain variable region 5/44-gL1 (SEQ ID NO:19) and a heavy chain variable region 5/44- gH7 (SEQ ID NO:27).
- the CDR-grafted antibody comprises a light chain having the sequence as set forth in SEQ ID NO: 28 and a heavy chain having the sequence as set forth in SEQ ID NO:30. In yet another embodiment, the CDR-grafted antibody comprises a light chain having the sequence as set forth in SEQ ID NO: 28 and a heavy chain having the sequence as set forth in SEQ ID NO: 30. In one embodiment, the anti-CD22 CDR-grafted antibody is a variant antibody obtained by an affinity maturation protocol and has increased specificity for human CD22.
- the anti-CD22 antibody is a chimeric antibody comprising the sequences of the light and heavy chain variable domains of the monoclonal antibody set forth in SEQ ID NO:7 and SEQ ID NO:8, respectively.
- the anti-CD22 antibody comprises a hybrid CDR with a truncated donor CDR sequence wherein the missing portion of the donor CDR is replaced by a different sequence and forms a functional CDR.
- the cytotoxic drug derivative is either a gamma calicheamicin or a N-acetyl gamma calicheamicin derivative.
- the invention is directed to a method for the preparation of a stable lyophilized composition of a monomeric cytotoxic drug derivative/carrier conjugate.
- the stable lyophilized composition of the monomeric cytotoxic drug derivative/carrier conjugate is prepared by (a) dissolving the monomeric cytotoxic drug derivative/carrier conjugate to a final concentration of 0.5 to 2 mg/ml in a solution comprising a cryoprotectant at a concentration of 1.5%- 5% by weight, a polymeric bulking agent at a concentration of 0.5-1.5% by weight, electrolytes at a concentration of 0.01 M to 0.1M, a solubility facilitating agent at a concentration of 0.005-0.05% by weight, buffering agent at a concentration of 5-50 mM such that the final pH of the solution is 7.8-8.2, and water; (b) dispensing the above solution into vials at a temperature of +5°C to +10°C; (c) freezing the solution at a freezing temperature
- cryoprotectant used in the lyophilization of the cytotoxic drug/carrier conjugate is selected from alditol, mannitol, sorbitol, inositol, polyethylene glycol, aldonic acid, uronic acid, aldaric acid, aldoses, ketoses, amino sugars, alditols, inositols, glyceraldehydes, arabinose, lyxose, pentose, ribose, xylose, galactose, glucose, hexose, idose, mannose, talose, heptose, glucose, fructose, gluconic acid, sorbitol, lactose, mannitol, methyl ⁇ -glucopyranoside, maltose, isoascorbic acid, ascorbic acid, lactone, sorbose, glucahc acid, erythrose, thre
- cryoprotectant is sucrose, which is present at a concentration of 1.5% by weight.
- the polymeric bulking agent used during the lyophilization process is selected from Dextran 40 or hydroxyethyl starch 40, and is at a concentration of 0.9% by weight.
- the electrolyte used in the lyophilization solution is sodium chloride, which is present at a concentration of 0.05 M.
- a solubility-facilitating agent is used during the lyophilization process.
- this solubility-facilitating agent is a surfactant.
- the surfactant is polysorbate 80, which is present at a concentration of 0.01% by weight.
- the buffering agent used is tromethamine, which is present at a concentration of 0.02 M. It is preferable for the pH of the solution to be
- the solution containing the cytotoxic drug/carrier conjugate is dispensed into vials at a temperature of +5°C prior to the start of the process.
- the solution in the vials is frozen at a temperature of -45°C; the frozen solution is subjected to an initial freeze drying step at a primary drying pressure of 60 microns and at a shelf temperature of -30°C for 60 hours; and the freeze-dried product is subjected to a secondary drying step at a drying pressure of 60 microns at a shelf temperature of +25°C for 24 hours.
- Another aspect of the invention is directed to a composition comprising a therapeutically effective dose of a monomeric cytotoxic drug derivative/carrier conjugate prepared by a method of the invention.
- the carrier in the monomeric cytotoxic drug derivative/carrier conjugate is a proteinaceous carrier selected from hormones, growth factors, antibodies and antibody mimics.
- the proteinaceous carrier is a human monoclonal antibody, a chimeric antibody, a human antibody or a humanized antibody.
- the humanized antibody is directed against the cell surface antigen CD22.
- the anti-CD22 antibody has specificity for human CD22, and comprises a heavy chain wherein the variable domain comprises a CDR having at least one of the sequences given as H1 in Figure 1 (SEQ ID NO:1) for CDR-H1 , as H2 in Figure 1 (SEQ ID NO:2) or H2' (SEQ ID NO:13) or H2" (SEQ ID NO:15) or H2'" (SEQ ID NO:16) for CDR-H2, or as H3 in Figure 1 (SEQ ID NO:3) for CDR-H3, and comprises a light chain wherein the variable domain comprises a CDR having at least one of the sequences given as L1 in Figure 1 (SEQ ID NO:4) for CDR-L1 , as L2 in Figure 1 (SEQ ID NO:5) for CDR-L2, or as L3 in Figure 1 (SEQ ID NO:6) for CDR-L3.
- anti-CD22 antibody has a heavy chain wherein the variable domain comprises a CDR having at least one of the sequences given in SEQ ID NO:1 for CDR-H1 , SEQ ID NO:2 or SEQ ID NO:13 or SEQ ID NO:15 or SEQ ID NO:16 for CDR-H2, or SEQ ID NO:3 for CDR-H3, and a light chain wherein the variable domain comprises a CDR having at least one of the sequences given in SEQ ID NO:4 for CDR-L1 , SEQ ID NO:5 for CDR-L2, or SEQ ID NO:6 for CDR-L3.
- the anti-CD22 antibody comprises SEQ ID NO:1 for CDR-H1 , SEQ ID NO: 2 or SEQ ID NO:13 or SEQ ID NO:15 or SEQ ID NO:16 for CDR-H2, SEQ ID NO:3 for CDR-H3, SEQ ID NO:4 for CDR-L1 , SEQ ID NO:5 for CDR-L2, and SEQ ID NO:6 for CDR-L3.
- the humanized anti-CD22 antibody is a CDR-grafted humanized anti-CD22 antibody and comprises a light chain variable region 5/44-gL1 (SEQ ID NO: 19), and a heavy chain variable region 5/44-gH7 (SEQ ID NO:27).
- the humanized anti-CD22 antibody is a CDR-grafted antibody having specificity for human CD22 and comprises a light chain having a sequence set forth in SEQ ID NO: 28 and a heavy chain having a sequence set forth in SEQ ID NO:30.
- the CDR-grafted antibody is a variant antibody which has increased specificity for human CD22, and the antibody is obtained by an affinity maturation protocol.
- the monomeric cytotoxic drug is calicheamicin and is preferably selected from gamma calicheamicin or N-acetyl calicheamicin.
- the composition may optionally contain an additional bioactive agent.
- a bioactive agent may be a cytotoxic drug, a growth factor or a hormone.
- Yet another aspect of the invention is directed to a method of treating a subject with a proliferative disorder by administering to the subject a therapeutically effective dose of the composition of the invention.
- the composition may be administered subcutaneously, intraperitoneally, intravenously, intraarterially, intramedullarly, intrathecally, transdermally, transcutaneously, intranasally, topically, entereally, intravaginally, sublingually or rectally.
- the composition of the invention is administered intravenously.
- the composition is administered to a human subject suffering from a proliferative disorder such as cancer.
- a proliferative disorder such as cancer.
- the cancer is a B-cell malignancy.
- the B-cell malignancy may be a leukemia or lymphoma that express cell surface antigen CD22.
- the cancer is a carcinoma or a sarcoma.
- Another aspect of the present invention is directed to a method of treating a
- the B-cell malignancy by administering to a patient with such malignancy a therapeutically effective composition comprising a cytotoxic drug-anti-CD22-antibody conjugate of the invention.
- the B-cell malignancy is a lymphoma, particularly Non-Hodgkin's lymphoma.
- the cytotoxic drug used to prepare the conjugates of the present invention is selected from the group consisting of calicheamicins, thiotepa, taxanes, vincristine, daunorubicin, doxorubicin, epirubicin, actinomycin, authramycin, azaserines, bleomycins, tamoxifen, idarubicin, dolastatins/auristatins, hemiasterlins, maytansinoids, and esperamicins.
- the cytotoxic drug is gamma calicheamicin or N- acetyl calicheamicin.
- the treatment comprises administering the cytotoxic drug conjugate of the invention with one or more bioactive agents selected from antibodies, growth factors, hormones, cytokines, anti-hormones, xanthines, interleukins, interferons, and cytotoxic drugs.
- the bioactive agent is an antibody, and is directed against a cell surface antigen expressed on B-cell malignancies.
- the antibody directed against cell surface antigens expressed on B-cell malignancies is selected from a group consisting of anti-CD19, anti-CD20 and anti-CD33 antibodies.
- Such antibodies include the anti-CD20 antibody, rituximab (RituxanTM).
- the bioactive agents are cytokines or growth factors and include, but are not limited to, interleukin 2 (IL-2), TNF, CSF, GM-CSF and G- CSF.
- IL-2 interleukin 2
- TNF tumor necrosis factor 2
- CSF GM-CSF
- G- CSF G- CSF
- bioactive agents are hormones and include estrogens, androgens, progestins, and corticosteroids.
- the bioactive agent is a cytotoxic drug selected from doxorubicin, daunorubicin, idarubicin, aclarubicin, zorubicin, mitoxantrone, epirubicin, carubicin, nogalamycin, menogaril, pitarubicin, valrubicin, cytarabine, gemcitabine, thfluridine, ancitabine, enocitabine, azacitidine, doxifluridine, pentostatin, broxuridine, capecitabine, cladhbine, decitabine, floxuridine, fludarabine, gougerotin, puromycin, tegafur, tiazofurin, adhamycin, cisplatin, carboplatin, cyclophosphamide, dacarbazine, vinblastine, vincristine, mitoxantrone, bleomycin, mechlorethamine, prednisone, proc
- the therapeutically effective composition of the cytotoxic drug-anti-CD22-antibody conjugate is administered together with one or more combinations of cytotoxic agents as a part of a treatment regimen, wherein the combination of cytotoxic agents is selected from: CHOPP (cyclophosphamide, doxorubicin, vincristine, prednisone, and procarbazine); CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone); COP (cyclophosphamide, vincristine, and prednisone); CAP-BOP (cyclophosphamide, doxorubicin, procarbazine, bleomycin, vincristine, and prednisone); m-BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone, and leucovorin); ProMACE-MOPP
- the therapeutically effective composition of the cytotoxic drug-anti-CD22-antibody conjugate is administered prior to the administration of one or more of the above combinations of cytotoxic drugs. In another preferred embodiment, the therapeutically effective composition of the cytotoxic drug-anti-CD22-antibody conjugate is administered subsequent to the administration of one or more of the above combinations of cytotoxic drugs as a part of a treatment regimen.
- Another aspect of the invention is directed to a method of treating aggressive lymphomas comprising administering to a patient in need of said treatment a therapeutically effective composition of a monomeric calicheamicin dehvative-anti- CD22-antibody conjugate together with one or more bioactive agents.
- the cancer is a B-cell malignancy that expresses CD22 antigen on the cell surface.
- the B-cell malignancy is either a leukemia or a lymphoma.
- the cancer is a carcinoma or a leukemia.
- a therapeutically effective dose of the composition is administered subcutaneously, intraperitoneally, intravenously, intraarterially, intramedullarly, intrathecally, transdermally, transcutaneously, intranasally, topically, entereally, intravaginally, sublingually or rectally.
- the therapeutically effective dose of the pharmaceutical composition of the invention is administered intravenously.
- Another aspect of the invention is directed to the use of a monomeric calicheamicin derivative/anti-CD22 antibody conjugate of the present invention for use in the treatment of a subject with a B-cell malignancy such as Non-Hodgkin's lymphoma.
- the monomeric calicheamicin dehvative/anti-CD22 antibody conjugate of the present invention is administered with one or more bioactive agents.
- the bioactive agents are selected from a group consisting of antibodies, growth factors, hormones, cytokines, anti-hormones, xanthines, interleukins, interferons, and cytotoxic drugs.
- the bioactive agent is an antibody directed against a cell surface antigen expressed on B-cell malignancies, such as anti-CD19, anti-CD20 and anti-CD33 antibodies.
- the anti-CD20 antibody is rituximab (RituxanTM).
- the bioactive agents include cytokines or growth factors such as interleukin 2 (IL-2), TNF, CSF, GM-CSF and G-CSF or hormones, which include estrogens, androgens, progestins, and corticosteroids.
- IL-2 interleukin 2
- TNF interleukin 2
- CSF CSF
- GM-CSF GM-CSF
- G-CSF G-CSF
- hormones which include estrogens, androgens, progestins, and corticosteroids.
- the bioactive agent is a cytotoxic drug selected from doxorubicin, daunorubicin, idarubicin, aclarubicin, zorubicin, mitoxantrone, epirubicin, carubicin, nogalamycin, menogaril, pitarubicin, valrubicin, cytarabine, gemcitabine, trifluhdine, ancitabine, enocitabine, azacitidine, doxifluridine, pentostatin, broxuridine, capecitabine, cladhbine, decitabine, floxuridine, fludarabine, gougerotin, puromycin, tegafur, tiazofuhn, adriamycin, cisplatin, carboplatin, cyclophosphamide, dacarbazine, vinblastine, vincristine, mitoxantrone, bleomycin, mechlorethamine, predn
- the therapeutically effective dose of the monomeric calicheamicin dehvative/anti-CD22 antibody conjugate is administered together with one or more combinations of cytotoxic agents as a part of a treatment regimen, wherein the combination of cytotoxic agents is selected from: CHOPP (cyclophosphamide, doxorubicin, vincristine, prednisone, and procarbazine); CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone); COP (cyclophosphamide, vincristine, and prednisone); CAP-BOP (cyclophosphamide, doxorubicin, procarbazine, bleomycin, vincristine, and prednisone); m-BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone, and leucovorin); Pro
- CHOPP
- cyclophosphamide, doxorubicin, vincristine, prednisone, and bleomycin cyclophosphamide, doxorubicin, vincristine, prednisone, and bleomycin
- CEPP-B cyclophosphamide, etoposide, procarbazine, and bleomycin
- P/DOCE epirubicin or doxorubicin, vincristine, cyclophosphamide, and prednisone
- the monomeric calicheamicin dehvative/anti- CD22 antibody conjugate is administered prior to the administration of one or more combinations of cytotoxic agents as a part of a treatment regimen.
- the therapeutically effective dose of the monomeric calicheamicin derivative/anti-CD22 antibody conjugate is administered subsequent to the administration of one or more combinations of cytotoxic agents as part of a treatment regimen.
- the therapeutically effective dose of the monomeric calicheamicin derivative/anti-CD22 antibody conjugate is administered together with an antibody directed against a cell surface antigen on B-cell malignancies, and optionally comprising one or more combinations of cytotoxic agents as part of a treatment regimen.
- the invention is directed to the use of the monomeric calicheamicin derivative/anti-CD22 antibody conjugate of the present invention in the manufacture of a medicament for the treatment of a proliferative disorder. Such a medicament can be used to treat B-cell proliferative disorders either alone or in combination with other bioactive agents.
- Figure 1 shows the amino acid sequence of the CDRs of mouse monoclonal antibody 5/44 (SEQ ID NOS:1 to 6).
- Figure 2 shows the DNA and protein sequence of the light chain variable (V L) domain of mouse monoclonal antibody 5/44.
- FIG 3 shows the complete sequence of the heavy chain variable domain (V H ) of mouse monoclonal antibody 5/44.
- Figure 4 shows the strategy for removal of the glycosylation site and reactive lysine in CDR-H2.
- Figure 5 shows the graft design for the 5/44 light chain sequence.
- DPK-9 is the human germ-line acceptor framework sequence. Vertical lines indicate differences between mouse and human residues. Sequences underlined indicate donor residues which have been retained in the graft. CDRs are indicated in bold italicized letters (not shown for DPK-9). Graft gL1 has 6 donor framework residues, gL2 has 7.
- Figure 6 shows the graft design for the 5/44 heavy chain sequence
- DP7 is the human germ-line acceptor framework sequence. Vertical lines indicate differences between mouse and human residues. Sequences underlined indicate donor residues which have been retained in the graft. CDRs are indicated initalicized, bold letters (not shown for DP7). Grafts gH4 and gH6 have 6 donor framework residues. Grafts gH5 and gH7 have 4 donor framework residues.
- Figure 7 shows the map of vector pMRR14.
- Figure 8 shows the map of vector pMRR10.1.
- Figure 9 shows the Biacore assay results of the chimeric 5/44 mutants.
- Figure 10 shows the oligonucleotides for 5/44 gH1 and gL1 gene assemblies.
- Figurel 1 shows the plasmid map of intermediate vector pCR2.1(544gH1).
- Figure 12 shows the plasmid map of intermediate vector pCR2.1(544gL1).
- Figure 13 shows the oligonucleotide cassettes used to make further grafts.
- Figure 14 is a graph which shows a competition assay between fluorescently labeled mouse 5/44 antibody and grafted variants.
- Figure 15 is a graph which shows a competition assay between fluorescently labeled mouse 5/44 antibody and grafted variants.
- Figure 16 shows the full DNA and protein sequence of the grafted heavy and light chains.
- Figure 17 is a schematic representation of an antibody-NAc-gamma calicheamicin DMH conjugate.
- Figure 18 is a graph which shows the effect of CMC-544 on growth of
- Figure 19 is a graph which shows the effect of CMC-544 on large B-cell lymphomas in an in vivo xenograft model in nude mice.
- Figure 20 is a graph which compares the effects of CMC-544 made with the CMA-676 conjugation process and the CMC-544 conjugation process on the growth of RL lymphoma.
- Figure 21 is a graph which shows that rituximab (Rituxan TM)-treated large RL lymphoma is susceptible to CMC-544 treatment.
- Figure 22 is a graph which shows the effect of rituximab (RituxanTM) on the cytotoxic effect of CMC-544.
- Figure 23 is a graph which shows the effect of CMC-544, rituximab (RituxanTM), and CMA-676 on the survival of SCID mice with disseminated early RAMOS B lymphoma.
- Figure 24 is a graph which shows the effect of CMC-544, rituximab (RituxanTM), and CMA-676 on the survival of SCID mice with disseminated late RAMOS B lymphoma.
- Figure 25 is a graph which shows the effect of CMC-544, rituximab (RituxanTM), and CMA-676 on the survival of SCID mice with disseminated late RAMOS B lymphoma.
- Figure 26 is a graph which shows the effect of CMC-544, rituximab (RituxanTM), and CMA-676 on the survival of SCID mice with disseminated late RAMOS B lymphoma.
- Figure 27 is a graph which shows the effect of CMC-544, rituximab
- Figure 28 is a graph which shows the anti-tumor activity of CMC-544 with and without rituximab (RituxanTM) on RL Non-Hodgkin's lymphoma.
- Figure 29 is a graph which shows the antitumor activity of CMC-544 and
- the conjugates of the present invention comprise a cytotoxic drug derivatized with a linker that includes any reactive group that reacts with a proteinaceous carrier to form a cytotoxic drug de vative-proteinaceous carrier conjugate.
- the conjugates of the present invention comprise a cytotoxic drug derivatized with a linker that includes any reactive group which reacts with an antibody used as a proteinaceous carrier to form a cytotoxic drug derivative-antibody conjugate.
- the antibody reacts against a cell surface antigen on B-cell malignancies. Described below is an improved process for making and purifying such conjugates.
- the use of particular cosolvents, additives, and specific reaction conditions together with the separation process results in the formation of a monomeric cytotoxic drug derivative/ antibody conjugate with a significant reduction in the LCF.
- the monomeric form as opposed to the aggregated form has significant therapeutic value, and minimizing the LCF and substantially reducing aggregation results in the utilization of the antibody starting material in a therapeutically meaningful manner by preventing the LCF from competing with the more highly conjugated fraction (HCF).
- the carriers/targeting agents of the present invention are preferably proteinaceous carriers/targeting agents. Included as carrier/targeting agents are hormones, growth factors, antibodies, antibody fragments, antibody mimics, and their genetically or enzymatically engineered counterparts, hereinafter referred to singularly or as a group as "carriers".
- carrier/targeting agents include hormones, growth factors, antibodies, antibody fragments, antibody mimics, and their genetically or enzymatically engineered counterparts, hereinafter referred to singularly or as a group as "carriers”.
- carriers include hormones, growth factors, antibodies, antibody fragments, antibody mimics, and their genetically or enzymatically engineered counterparts, hereinafter referred to singularly or as a group as "carriers”.
- the essential property of a carrier is its ability to recognize and bind to an antigen or receptor associated with undesired cells and to be subsequently internalized. Examples of carriers that are applicable in the present invention are disclosed in U.S. Patent No. 5,05
- non-immunoglobulin protein scaffolds have been used for generating antibody mimics that bind to antigenic epitopes with the specificity of an antibody (PCT publication No. WO 00/34784).
- a "minibody” scaffold which is related to the immunoglobulin fold, has been designed by deleting three beta strands from a heavy chain variable domain of a monoclonal antibody (Tramontano et al., J. Mol. Recognit. 7:9, 1994).
- This protein includes 61 residues and can be used to present two hypervariable loops. These two loops have been randomized and products selected for antigen binding, but thus far the framework appears to have somewhat limited utility due to solubility problems.
- tendamistat a protein that specifically inhibits mammalian alpha- amylases and is a 74 residue, six-strand beta-sheet sandwich held together by two disulfide bonds, (McConnell and Hoess, J. Mol. Biol. 250:460, 1995).
- This scaffold includes three loops, but, to date, only two of these loops have been examined for randomization potential.
- antibody carriers examples include monoclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies and biologically active fragments thereof.
- such antibodies are directed against cell surface antigens expressed on target cells and/or tissues in proliferative disorders such as cancer.
- specific antibodies directed against cell surface antigens on target cells include without limitation, antibodies against CD22 antigen which is over-expressed on most B-cell lymphomas; G5/44, a humanized form of a murine anti-CD22 monoclonal antibody; antibodies against cell surface antigen CD33, which is prevalent on certain human myeloid tumors especially acute myeloid leukemia; hP67.6, a humanized form of the anti-CD33 murine antibody (see U.S. Patent No.
- Rituximab is a chimeric anti-CD20 antibody used to treat various B-call lymphomas and trastuzumab (HerceptinTM) is a humanized anti-Her2 antibody used to treat breast cancer.
- trastuzumab HerceptinTM
- G5/44 CDR- grafted humanized antibody molecule directed against cell surface antigen CD22
- This antibody is a humanized form of a murine anti-CD22 monoclonal antibody that is directed against the cell surface antigen CD22, which is prevalent on certain human lymphomas.
- a CDR-grafted antibody molecule refers to an antibody molecule wherein the heavy and/or light chain contains one or more complementarity determining regions (CDRs) including, if desired, a modified CDR (hereinafter CDR) from a donor antibody (e.g., a murine monoclonal antibody) grafted into a heavy and/or light chain variable region framework of an acceptor antibody (e.g., a human antibody).
- CDR complementarity determining regions
- a donor antibody e.g., a murine monoclonal antibody
- acceptor antibody e.g., a human antibody
- a CDR-grafted antibody has a variable domain comprising human acceptor framework regions as well as one or more of the donor CDRs referred to above.
- any appropriate acceptor variable region framework sequence may be used having regard to the class/type of the donor antibody from which the CDRs are derived, including mouse, primate and human framework regions.
- human frameworks which can be used in the present invention are KOL, NEWM, REI, EU, TUR, TEI, LAY and POM (Kabat et al. Seq. of Proteins of Immunol. Interest, 1:310-334 (1994)).
- KOL and NEWM can be used for the heavy chain
- REI can be used for the light chain and EU
- LAY and POM can be used for both the heavy chain and the light chain.
- acceptor antibody In a CDR-grafted antibody of the present invention, it is preferred to use as the acceptor antibody one having chains which are homologous to the chains of the donor antibody.
- the acceptor heavy and light chains do not necessarily need to be derived from the same antibody and may, if desired, comprise composite chains having framework regions derived from different chains.
- the framework regions need not have exactly the same sequence as those of the acceptor antibody. For instance, unusual residues may be changed to more frequently occurring residues for that acceptor chain class or type. Alternatively, selected residues in the acceptor framework regions may be changed so that they correspond to the residue found at the same position in the donor antibody or to a residue that is a conservative substitution for the residue found at the same position in the donor antibody. Such changes should be kept to the minimum necessary to recover the affinity of the donor antibody.
- a protocol for selecting residues in the acceptor framework regions which may need to be changed is set forth in PCT Publication No. WO 91/09967, which is incorporated herein in its entirety.
- Donor residues are residues from the donor antibody, i.e., the antibody from which the CDRs were originally derived.
- the antibody of the present invention may comprise a heavy chain wherein the variable domain comprises as CDR-H2 (as defined by Kabat et al., (supra)) an H2' in which a potential glycosylation site sequence has been removed in order to increase the affinity of the antibody for the antigen.
- the antibody of the present invention may comprise a heavy chain wherein the variable domain comprises as CDR-H2 (as defined by Kabat et al., (supra)) an H2" in which a lysine residue is at position 60. This lysine residue, which is located at an exposed position within CDR-H2, and is considered to have the potential to react with conjugation agents resulting in a reduction of antigen binding affinity, is substituted with an alternative amino acid.
- the antibody of the present invention may comprise a heavy chain wherein the variable domain comprises as CDR-H2 (as defined by Kabat et al., (supra)) an H2'" in which both the potential glycosylation site sequence and the lysine residue at position 60, are substituted with alternative amino acids.
- the antibody of the present invention may comprise: a complete antibody having full length heavy and light chains; a biologically active fragment thereof, such as a Fab, modified Fab, Fab', F(ab') 2 or Fv fragment; a light chain or heavy chain monomer or dimer; or a single chain antibody, e.g., a single chain Fv in which the heavy and light chain variable domains are joined by a peptide linker.
- the heavy and light chain variable regions may be combined with other antibody domains as appropriate.
- the antibody of the present invention may also include a modified Fab fragment wherein the modification is the addition of one or more amino acids to allow for the attachment of an effector or reporter molecule to the C-terminal end of its heavy chain.
- the additional amino acids form a modified hinge region containing one or two cysteine residues to which the effector or reporter molecule may be attached.
- the constant region domains of the antibody of the present invention if present, may be selected having regard to the proposed function of the antibody, and in particular the effector functions which may or may not be required.
- the constant region domains may be human IgA, IgD, IgE, IgG or IgM domains.
- human IgG constant region domains may be used, especially of the lgG1 and lgG3 isotypes when the antibody is intended for therapeutic uses and antibody effector functions are required.
- lgG2 and lgG4 isotypes may be used or the lgG1 Fc region may be mutated to abrogate the effector function when the antibody is intended for therapeutic purposes and antibody effector functions are not required or desired.
- the antibody of the present invention has a binding affinity of at least 5x10 "8 M, preferably at least 1x10 ⁇ 9 M, more preferably at least 0.75x10 "10 M, and most preferably at least 0.5x10 "10 M.
- the present invention relates to immunotoxin conjugates and methods for making these conjugates using antibody variants or antibody mimics.
- variants of the antibody of the present invention are directed against CD22 and display improved affinity for CD22.
- affinity maturation protocols including mutating the CDRs (Yang et al., J. Mol. Biol., 254, 392-403, 1995), chain shuffling (Marks et al., Bio/Technology, 10, 779-783, 1992), use of mutator strains of E. coli (Low et al., J. Mol. Biol., 250, 359-368, 1996), DNA shuffling (Patten et al., Curr.
- Any suitable host cell/vector system may be used for expression of the DNA sequences encoding the carrier including antibodies of the present invention.
- Bacterial, for example E. coli, and other microbial systems may be used, in part, for expression of antibody fragments such as Fab and F(ab') 2 fragments, and especially Fv fragments and single chain antibody fragments, for example, single chain Fvs.
- Eukaryotic, e.g. mammalian, host cell expression systems may be used for production of larger antibody, including complete antibody molecules.
- Suitable mammalian host cells include CHO, myeloma, yeast cells, insect cells, hybridoma cells, NSO, VERO or PER C6 cells.
- Suitable expression systems also include transgenic animals and plants. II. THERAPEUTIC AGENTS
- the therapeutic agents suitable for use in the present invention are cytotoxic drugs that inhibit or disrupt tubulin polymerization, alkylating agents that bind to and disrupt DNA, and agents which inhibit protein synthesis or essential cellular proteins such as protein kinases, enzymes and cyclins.
- cytotoxic drugs include, but are not limited to thiotepa, taxanes, vincristine, daunorubicin, doxorubicin, epirubicin, actinomycin, authramycin, azaserines, bleomycins, tamoxifen, idarubicin, dolastatins/auristatins, hemiasterlins, calicheamicins, esperamicins and maytansinoids.
- Preferred cytotoxic drugs are the calicheamicins, which are an example of the methyl trisulfide antitumor antibiotics. Examples of calicheamicins suitable for use in the present invention are disclosed, for example, in U.S. Patent No.
- calicheamicins are the gamma-calicheamicin derivatives or the N-acetyl gamma-calicheamicin derivatives.
- the conjugates of the present invention have the formula Pr(-X-W) m wherein: Pr is a proteinaceous carrier,
- X is a linker that comprises a product of any reactive group that can react with a proteinaceous carrier
- W is the cytotoxic drug ;
- m is the average loading for a purified conjugation product such that the calicheamicin constitutes 4 - 10% of the conjugate by weight; and
- (-X-W) m is a cytotoxic drug
- R' is a branched or unbranched (C C 5 ) chain optionally substituted by one or two groups of -OH, (C C 4 ) alkoxy, (C C 4 ) thioalkoxy, halogen, nitro, (C C 3 ) dialkylamino, or (C C 3 ) trialkylammonium -A " where A " is a pharmaceutically acceptable anion completing a salt;
- Ar is 1 ,2-, 1 ,3-, or 1 ,4-phenylene optionally substituted with one, two, or three groups of (C C 6 ) alkyl, (C C 5 ) alkoxy, (C C 4 ) thioalkoxy, halogen, nitro, -COOR', -CONHR', -O(CH 2 ) n COOR', -S(CH 2 ) n COOR', -O(CH 2 ) n CONHR', or -S(CH 2 ) n CONHR' wherein n and R' are as hereinbefore defined or a 1 ,2-, 1 ,3-, 1,4-, 1 ,5-, 1 ,6-, 1,7-, 1 ,8-, 2,3-, 2,6-, or 2,7-naphthylidene or
- each naphthylidene or phenothiazine optionally substituted with one, two, three, or four groups of (C C 6 ) alkyl, (C C 5 ) alkoxy, (C C 4 ) thioalkoxy, halogen, nitro, -COOR',
- n and R' are as defined above, with the proviso that when Ar is phenothiazine, Sp 1 is a bond only connected to nitrogen;
- Sp 2 is a bond, -S-, or -O-, with the proviso that when Alk 2 is a bond, Sp 2 is a bond;
- Z 1 is H, (C C 5 ) alkyl, or phenyl optionally substituted with one, two, or three groups of (C C 5 ) alkyl, (C C 5 ) alkoxy, (C C 4 ) thioalkoxy, halogen, nitro, -COOR',
- Sp is a straight or branched-chain divalent or trivalent (C C 18 ) radical, divalent or trivalent aryl or heteroaryl radical, divalent or trivalent (C 3 -C ⁇ 8 ) cycloalkyl or heterocycloalkyl radical, divalent or trivalent aryl- or heteroaryl-aryl (CrC ⁇ 8 ) radical, divalent or trivalent cycloalkyl- or heterocycloalkyl-alkyl (d-C 18 ) radical or divalent or trivalent (C 2 -C 18 ) unsaturated alkyl radical, wherein heteroaryl is preferably furyl, thienyl, N-methylpyrrolyl, pyridinyl, N
- Alk 1 is a branched or unbranched (C C 10 ) alkylene chain
- Sp' is a bond, -S-, -O-, -CONH-, -NHCO-, or -NR' wherein R' is as hereinbefore defined, with the proviso that when Alk 1 is a bond, Sp 1 is a bond;
- Ar is 1 ,2-, 1 ,3-, or 1 ,4-phenylene optionally substituted with one, two, or three groups of (C C 6 ) alkyl, (C C 5 ) alkoxy, (C C 4 ) thioalkoxy, halogen, nitro, -COOR', -CONHR', -O(CH 2 ) n COOR', -S(CH 2 ) n COOR', -O(CH 2 ) n CONHR', or -S(CH 2 ) n CONHR' wherein n and R' are as hereinbefore defined, or Ar is a 1 ,2-, 1 ,3-, 1 ,4-, 1,5-, 1 ,6-, 1 ,7-, 1 ,8-, 2,3-, 2,6-, or 2,7- naphthylidene each optionally substituted with one, two, three, or four groups of (C C 6 ) alkyl, (C- ⁇ -C 5 )
- Z 1 is (CrC 5 ) alkyl, or phenyl optionally substituted with one, two, or three groups of (C 1 -C 5 ) alkyl, (C C 4 ) alkoxy, (G C 4 ) thioalkoxy, halogen, nitro, -COOR', -CONHR', -O(CH 2 ) n COOR', -S(CH 2 ) n COOR', -O(CH 2 ) n CONHR', or -S(CH 2 ) n CONHR'; Alk 2 and Sp 2 are together a bond; and Sp and Q are as immediately defined above.
- linkers that can be used with nucleophilic derivatives, particularly hydrazides and related nucleophiles, prepared from the calicheamicins. These linkers are especially useful in those cases where better activity is obtained when the linkage formed between the drug and the linker is hydrolyzable. These linkers contain two functional groups. One group typically is a carboxylic acid that is utilized to react with the carrier. The acid functional group, when properly activated, can form an amide linkage with a free amine group of the carrier, such as, for example, the amine in the side chain of a lysine of an antibody or other proteinaceous carrier.
- the other functional group commonly is a carbonyl group, i.e., an aldehyde or a ketone, which will react with the appropriately modified therapeutic agent.
- the carbonyl groups can react with a hydrazide group on the drug to form a hydrazone linkage. This linkage is hydrolyzable, allowing for release of the therapeutic agent from the conjugate after binding to the target cells.
- a most preferred bifunctional linker for use in the present invention is 4-(4- acetylphenoxy) butanoic acid (AcBut), which results in a preferred product wherein the conjugate consists of ⁇ -calicheamicin, ⁇ -calicheamicin or N-acetyl ⁇ calicheamicin functionalized by reacting with 3-mercapto-3-methyl butanoyl hydrazide, the AcBut linker, and a human or humanized IgG antibody targeting carrier.
- AcBut 4-(4- acetylphenoxy) butanoic acid
- Preferred buffered solutions for conjugates made from N-hydroxysuccinimide (OSu) esters or other comparably activated esters were phosphate-buffered saline (PBS) or N- 2-hydroxyethyl piperazine-N'-2-ethanesulfonic acid (HEPES buffer).
- PBS phosphate-buffered saline
- HEPES buffer N- 2-hydroxyethyl piperazine-N'-2-ethanesulfonic acid
- the buffered solution used in those conjugation reactions cannot contain free amines or nucleophiles.
- acceptable buffers can be readily determined.
- the use of a non-nucleophilic, protein-compatible, buffered solution containing t-butanol without the additional additive was also found to produce monomeric calicheamicin derivative/carrier conjugates with higher drug loading/yield and decreased aggregation.
- the amount of cosolvent needed to form a monomeric conjugate varies somewhat from protein to protein and can be determined by those of ordinary skill in the art without undue experimentation.
- the amount of additive necessary to effectively form a monomeric conjugate also varies from antibody to antibody. This amount can also be determined by one of ordinary skill in the art without undue experimentation.
- additions of propylene glycol in amounts ranging from 10% to 60%, preferably 10% to 40%, and most preferably about 30% by volume of the total solution, and an additive comprising at least one C 6 -C 8 carboxylic acid or its salt, preferably caprylic acid or its salt, in amounts ranging from 20 mM to 100 mM, preferably from 40 mM to 90 mM, and most preferably about 60 mM to 90 mM were added to conjugation reactions to produce monomeric cytotoxic drug derivative/carrier conjugates with higher drug loading/yield and decreased aggregation.
- the concentration of the C 6 -C 8 carboxylic acid or its salt could be increased to 150-300 mM and the cosolvent dropped to 1-10%.
- the carboxylic acid was octanoic acid or its salt.
- the carboxylic acid was decanoic acid or its salt.
- the carboxylic acid was caprylic acid or its salt, which was present at a concentration of 200 mM caprylic acid together with 5% propylene glycol or ethanol.
- t-butanol at concentrations ranging from 10% to 25%, preferably 15%, by volume of the total solution could be added to the conjugation reaction to produce monomeric cytotoxic drug derivative/carrier conjugates with higher drug loading/yield and decreased aggregation.
- CMA- 676 Gamtuzumab Ozogamicin
- MylotargTM MylotargTM
- calicheamicin Most of the calicheamicin is on approximately half of the antibody, while the other half exists in a LCF that contains only small amounts of calicheamicin. Consequently, there is a critical need to improve the methods for conjugating cytotoxic drugs such as calicheamicins to carriers which minimize the amount of aggregation and allow for a higher uniform drug loading with a significantly improved yield of the conjugate product.
- CMC-544 G5/44-NAc-gamma-calicheamicin DMH AcBut conjugate
- Figure 17 A specific example is that of the G5/44-NAc-gamma-calicheamicin DMH AcBut conjugate, which is referred to as CMC-544 and is generically shown in Figure 17.
- the reduction of the amount of the LCF to ⁇ 10% of the total antibody was desired for development of CMC-544, and various options for reduction of the levels of the LCF were considered.
- Other attributes of the immunoconjugate, such as antigen binding and cytotoxicity, must not be affected by the ultimate solution.
- the concentrations of protein carrier (antibody) and cosolvent (ethanol) were similarly of lesser importance (compared to calicheamicin input and additive concentration) in controlling LCF and aggregate levels.
- the calicheamicin derivative input was increased from 3% to 8.5% (w/w) relative to the amount of antibody in the reaction.
- the additive was changed from octanoic acid or its salt at a concentration of 200 mM (CMA-676 process) to decanoic acid or its salt at a concentration of 37.5 mM.
- the conjugation reaction proceeded better at slightly elevated temperature (30-35°C) and pH (8.2-8.7).
- CMC-544 Process Condition A comparison of the results obtained with the CMA-676 and CMC-544 Process Conditions is shown in Table 1.
- the concentration of antibody can range from 1 to 15 mg/ml and the concentration of the calicheamicin derivative, e.g., N-Acetyl gamma-calicheamicin DMH AcBut OSu ester (used to make the conjugates shown in Figure 17), ranges from about 4.5-11% by weight of the antibody.
- the cosolvent was ethanol, for which good results have been demonstrated at concentrations ranging from 6 to 11.4% (volume basis).
- the monomeric conjugates may be separated from the unconjugated reactants (such as proteinaceous carrier and free cytotoxic drug/calicheamicin) and/or the aggregated form of the conjugates by conventional methods, for example, size exclusion chromatography (SEC), hydrophobic interaction chromatography (HIC), ion exchange chromatography (IEC), or chromatofocusing (CF).
- SEC size exclusion chromatography
- HIC hydrophobic interaction chromatography
- IEC ion exchange chromatography
- CF chromatofocusing
- the purified conjugates are monomeric, and usually contain from 4 to 10% by weight cytotoxic drug/calicheamicin.
- the conjugates are purified using hydrophobic interaction chromatography (HIC).
- SEC size exclusion chromatography
- HIC hydrophobic interaction chromatography
- HIC media suitable for production scale use such as Butyl, Phenyl and Octyl Sepharose 4 Fast Flow (Amersham Biosciences, Piscataway, NJ), can effectively separate unconjugated components and aggregates of the conjugate from monomeric conjugated components following the conjugation process.
- the present invention also provides a process for the preparation of a therapeutic or diagnostic composition/formulation comprising admixing the monomeric cytotoxic drug derivative/carrier conjugate of the present invention together with a pharmaceutically acceptable excipient, diluent or carrier.
- the monomeric cytotoxic drug derivative/carrier conjugate may be the sole active ingredient in the therapeutic or diagnostic composition/formulation or may be accompanied by other active ingredients including other antibody ingredients, for example anti-CD19, anti-CD20, anti-CD33, anti-T cell, anti-IFN ⁇ or anti-LPS antibodies, or non-antibody ingredients such as cytokines, growth factors, hormones, anti-hormones, cytotoxic drugs and xanthines.
- Cytokines and growth factors that may be used to treat proliferative disorders such as cancer, and which may be used together with the cytotoxic drug derivative/ carrier conjugates of the present invention include interferons, interleukins such as interleukin 2 (IL-2), TNF, CSF, GM-CSF and G-CSF.
- interleukins such as interleukin 2 (IL-2), TNF, CSF, GM-CSF and G-CSF.
- Hormones commonly used to treat proliferative disorders such as cancer and which may be used together with the cytotoxic drug derivative/ carrier conjugates of the present invention include estrogens such as diethylstilbestrol and estradiol, androgens such as testosterone and Halotestin, progestins such as Megace and Provera, and corticosteroids such as prednisone, dexamethasone, and hydrocortisone.
- estrogens such as diethylstilbestrol and estradiol
- androgens such as testosterone and Halotestin
- progestins such as Megace and Provera
- corticosteroids such as prednisone, dexamethasone, and hydrocortisone.
- Antihormones such as antiestrogens, i.e., tamoxifen, antiandrogens i.e., flutamide and antiadrenal agents are commonly used to treat proliferative disorders such as cancer, and may be used together with the cytotoxic drug derivative/ carrier conjugate of the present invention.
- Chemotherapeutic/antineoplastic agents commonly used to treat proliferative disorders such as cancer, and which may be used together with the cytotoxic drug derivative/ carrier conjugate of the present invention include, but are not limited to, Adriamycin, cisplatin, carboplatin, vinblastine, vincristine, bleomycin, methotrexate, doxorubicin, flurouracils, etoposide, taxol and its various analogs, and mitomycin.
- compositions should preferably comprise a therapeutically effective amount of a conjugate of the invention.
- therapeutically effective amount refers to an amount of a therapeutic agent needed to treat, ameliorate or prevent a targeted disease or condition, or to exhibit a detectable therapeutic or preventative effect.
- the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually in rodents, rabbits, dogs, pigs or primates. The animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
- an effective amount for a human subject will depend upon the severity of the disease state, the general health of the subject, the age, weight and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities and tolerance/response to therapy. This amount can be determined by routine experimentation and is within the judgment of the clinician.
- an effective dose will be from 0.1 mg/m 2 to 50 mg/m 2 , preferably 0.4 mg/m 2 to 30 mg/m 2 , more preferably 2 mg/m 2 to 9 mg/m 2 , which dose is calculated on the basis of the proteinaceous carrier.
- compositions may be administered individually to a patient or may be administered in combination with other agents, drugs or hormones.
- the dose at which the monomeric cytotoxic drug derivative/ antibody conjugate of the present invention is administered depends on the nature of the condition to be treated, the grade of the malignant lymphoma or leukemia and on whether the conjugate is being used prophylactically or to treat an existing condition.
- the frequency of dose will depend on the half-life of the conjugate and the duration of its effect. If the conjugate has a short half-life (e.g., 2 to 10 hours) it may be necessary to give one or more doses per day. Alternatively, if the conjugate molecule has a long half-life (e.g., 2 to 15 days) it may only be necessary to give a dosage once per day, once per week or even once every 1 or 2 months.
- a composition may also contain a pharmaceutically acceptable carrier for administration of the antibody conjugate.
- the carrier should not itself induce the production of antibodies harmful to the individual receiving the composition and should not be toxic.
- Suitable carriers may be large, slowly metabolized macromolecules such as proteins, polypeptides, liposomes, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactive virus particles.
- salts can be used, for example mineral acid salts, such as hydrochlorides, hydrobromides, phosphates and sulfates, or salts of organic acids, such as acetates, propionates, malonates and benzoates.
- mineral acid salts such as hydrochlorides, hydrobromides, phosphates and sulfates
- organic acids such as acetates, propionates, malonates and benzoates.
- compositions may additionally contain liquids such as water, saline, glycerol, and ethanol. Additionally, auxiliary substances, such as wetting or emulsifying agents or pH buffering substances, may be present in such compositions. Such carriers enable the compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries or suspensions, for ingestion by the patient.
- Preferred forms for administration include forms suitable for parenteral administration, e.g., by injection or infusion, for example by bolus injection or continuous infusion. Where the product is for injection or infusion, it may take the form of a suspension, solution or emulsion in an oily or aqueous vehicle and it may contain formulatory agents, such as suspending, preserving, stabilizing and/or dispersing agents.
- the antibody-drug conjugate may be lyophilized to a dry form, for reconstitution before use with an appropriate sterile liquid.
- the problems associated with lyophilization of a protein solution are well documented. Loss of secondary, tertiary and quaternary structure can occur during freezing and drying processes. Consequently, cryoprotectants may have to be included to act as an amorphous stabilizer of the conjugate and to maintain the structural integrity of the protein during the lyophilization process.
- the cryoprotectant useful in the present invention is a sugar alcohol, such as alditol, mannitol, sorbitol, inositol, polyethylene glycol, and combinations thereof.
- the cryoprotectant is a sugar acid, including an aldonic acid, an uronic acid, an aldaric acid, and combinations thereof.
- the cryoprotectant of this invention may also be a carbohydrate. Suitable carbohydrates are aldehyde or ketone compounds containing two or more hydroxyl groups.
- the carbohydrates may be cyclic or linear and include, for example, aldoses, ketoses, amino sugars, alditols, inositols, aldonic acids, uronic acids, or aldaric acids, or combinations thereof.
- the carbohydrate may also be a mono-, a di-, or a poly-carbohydrate, such as for example, a disaccharide or polysaccharide.
- Suitable carbohydrates include for example, glyceraldehydes, arabinose, lyxose, pentose, ribose, xylose, galactose, glucose, hexose, idose, mannose, talose, heptose, glucose, fructose, gluconic acid, sorbitol, lactose, mannitol, methyl ⁇ - glucopyranoside, maltose, isoascorbic acid, ascorbic acid, lactone, sorbose, glucaric acid, erythrose, threose, arabinose, allose, altrose, gulose, idose, talose, erythrulose, ribulose, xylulose, psicose, tagatose, glucuronic acid, gluconic acid, glucaric acid, galacturonic acid, mannuronic acid, glucos
- Suitable polycarbohydrates include, for example, arabinans, fructans, fucans, galactans, galacturonans, glucans, mannans, xylans (such as, for example, inulin), levan, fucoidan, carrageenan, galactocarolose, pectins, pectic acids, amylose, pullulan, glycogen, amylopectin, cellulose, dextran, pustulan, chitin, agarose, keratin, chondroitin, dermatan, hyaluronic acid, alginic acid, xanthin gum, or starch.
- particularly useful carbohydrates are sucrose, glucose, lactose, trehalose, and combinations thereof.
- Sucrose is a particularly useful cryoprotectant.
- the cryoprotectant of the present invention is a carbohydrate or "sugar" alcohol, which may be a polyhydric alcohol.
- Polyhydric compounds are compounds that contain more than one hydroxyl group.
- the polyhydric compounds are linear. Suitable polyhydric compounds include, for example, glycols such as ethylene glycol, polyethylene glycol, and polypropylene glycol, glycerol, or pentaerythritol; or combinations thereof.
- the cryoprotectant agent is sucrose, trehalose, mannitol, or sorbitol.
- compositions of the invention can be administered directly to the subject.
- the subjects to be treated can be animals. However, it is preferred that the compositions are adapted for administration to human subjects.
- compositions of the present invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra- arterial, intramedullary, intrathecal, intraventricular, transdermal, transcutaneous (see PCT Publication No. WO98/20734), subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, intravaginal or rectal routes. Hyposprays may also be used to administer the compositions of the invention.
- the compositions may be prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared.
- Direct delivery of the compositions will generally be accomplished by injection, subcutaneously, intraperitoneally, intravenously or intramuscularly, or delivered to the interstitial space of a tissue.
- the compositions can also be administered into a lesion. Dosage treatment may be a single dose schedule or a multiple dose schedule.
- the active ingredient in the composition will be a cytotoxic drug/proteinaceous carrier conjugate. As such, it will be susceptible to degradation in the gastrointestinal tract.
- the composition if the composition is to be administered by a route using the gastrointestinal tract, the composition will need to contain agents which protect the conjugate from degradation, but which release the conjugate once it has been absorbed from the gastrointestinal tract.
- the present invention in particular provides a monomeric calicheamicin derivative/ humanized anti-CD22 antibody (G5/44), CMC-544, for use in treating proliferative disorders characterized by cells expressing CD22 antigen on their surface.
- the present invention further provides the use of CMC-544 in the manufacture of a composition or a medicament for the treatment of a proliferative disorder characterized by cells expressing CD22.
- CMC-544 may also be utilized in any therapy where it is desired to reduce the level of cells expressing CD22 that are present in the subject being treated with the composition or a medicament disclosed herein.
- the composition or medicament is used to treat humans or animals with proliferative disorders namely lymphomas and leukemias, which express CD22 antigen on the cell surface.
- CD22-expressing cells may be circulating in the body or be present in an undesirably large number localized at a particular site in the body.
- CMC-544 may also be preferably used for treatment of malignancies of B- lymphocyte lineage including lymphomas and leukemias, most preferably Non- Hodgkin's Lymphoma (NHL), acute lymphocytic leukemia (ALL), multiple myeloma, acute lymphocyte leukemia (ALL) and chronic lymphocytic leukemia (CLL).
- CMC- 544 can be used alone or in combination with other bioactive agents to treat subjects suffering from B-cell malignancies.
- Bioactive agents commonly used include growth factors, cytokines, and cytotoxic drugs.
- Cytotoxic drugs commonly used to treat proliferative disorders such as cancer, and which may be used together with CMC-544 include an anthracycline such as doxorubicin, daunorubicin, idarubicin, aclarubicin, zorubicin, mitoxantrone, epirubicin, carubicin, nogalamycin, menogaril, pitarubicin, and valrubicin for up to three days; and a pyrimidine or purine nucleoside such as cytarabine, gemcitabine, trifluridine, ancitabine, enocitabine, azacitidine, doxifluridine, pentostatin, broxuridine, capecitabine, cladribine, decitabine, floxuridine, fludarabine, gougerotin, puromycin, tegafur, tiazofurin.
- chemotherapeutic/antineoplastic agents that may be administered in combination with CMC-544 include Adriamycin, cisplatin, carboplatin, cyclophosphamide, dacarbazine, vinblastine, vincristine, mitoxantrone, bleomycin, mechlorethamine, prednisone, procarbazine, methotrexate, flurouracils, etoposide, taxol and its various analogs, and mitomycin.
- CMC-544 may be administered concurrently with one or more of these therapeutic agents. Alternatively, CMC-544 may be administered sequentially with one or more of these therapeutic agents.
- CMC-544 may also be administered alone, concurrently, or sequentially with a combination of other bioactive agents such as growth factors, cytokines, steroids, antibodies such as anti-CD20 antibody, rituximab (RituxanTM), and chemotherapeutic agents as a part of a treatment regimen.
- bioactive agents such as growth factors, cytokines, steroids, antibodies such as anti-CD20 antibody, rituximab (RituxanTM), and chemotherapeutic agents as a part of a treatment regimen.
- Established treatment regimens for the treatment of malignant lymphoproliferative disorders include CHOPP (cyclophosphamide, doxorubicin, vincristine, prednisone, and procarbazine), CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone), COP (cyclophosphamide, vincristine, and prednisone), CAP-BOP (cyclophosphamide, doxorubicin, procarbazine, bleomycin, vincristine, and prednisone), m-BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone, and leucovorin), ProMACE-MOPP (prednisone, methotrexate, doxorubicin, cyclophosphamide, etoposide, leucovorin, mechl
- CMC-544 may also be administered alone, concurrently, or sequentially with any of the above identified therapy regimens as a part of induction therapy phase, a consolidation therapy phase and a maintenance therapy phase.
- the conjugates of the present invention may also be administered together with other bioactive and chemotherapeutic agents as a part of combination chemotherapy regimen for the treatment of relapsed aggressive lymphomas.
- a treatment regimen includes IMVP-16 (ifosfamide, methotrexate, and etoposide), MIME (methyl-gag, ifosfamide, methotrexate, and etoposide), DHAP (dexamethasone, high-dose cytaribine, and cisplatin), ESHAP (etoposide, methylpredisolone, high-dose cytarabine, and cisplatin), EPOCH (etoposide, vincristine, and doxorubicin for 96 hours with bolus doses of cyclophosphamide and oral prednisone), CEPP(B) (cyclophosphamide, etoposide, procarbazine, prednisone, and bleomycin), CAMP (
- Additional treatment regimens for aggressive lymphomas may include in phase 1 a first line of treatment with CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone)-rituximab (RituxanTM)- CMC-544, followed in phase 2 and phase 3 with CHOP-rituximab (RituxanTM), CHOP-CMC-544 or CHOP-rituximab (RituxanTM)-CMC-544.
- CHOP cyclophosphamide, doxorubicin, vincristine, prednisone
- CHOP cyclophosphamide, doxorubicin, vincristine, and prednisone
- CHOP cyclophosphamide, doxorubicin, vincristine, and prednisone
- CHOP cyclophosphamide, doxorubicin, vincristine, and prednisone
- phase 1 may have a first line of treatment with COP (cyclophosphamide, vincristine, and prednisone)-rituximab (Rituxan TM)-CMC-544, followed in phase 2 and phase 3 with COP-rituximab (RituxanTM), COP-CMC-544 or COP-rituximab (RituxanTM)-CMC-544.
- COP cyclophosphamide, vincristine, and prednisone
- treatment of aggressive lymphomas may include a first or second line of treatment with the antibody drug conjugate CMC-544 in phase 1 , followed in phase 2 and 3 with CMC-544 and CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone), CMC-544 and COP (cyclophosphamide, vincristine, and prednisone), CMC-544 with rituximab (RituxanTM) or rituximab (RituxanTM) alone.
- the treatment of aggressive lymphomas may include a first or line of treatment with the antibody drug conjugate CMC-544 followed in phase 2 and 3 with CMC-544 alone or in combination with other treatment regimens including, but not limited to, ESHOP (etoposide, methylpredisolone, high-dose cytarabine, vincristine and cisplatin), EPOCH (etoposide, vincristine, and doxorubicin for 96 hours with bolus doses of cyclophosphamide and oral prednisone), IMVP-16 (ifosfamide, methotrexate, and etoposide), ASHAP (Adriamycin, solumedrol, Ara-C, and cisplatin), MIME (methyl- gag, ifosfamide, methotrexate, and etoposide) and ICE (ifosfamide, cyclophosphamide, and etoposide).
- ESHOP etopo
- the present invention also provides a method of treating human or animal subjects suffering from or at risk of a proliferative disorder characterized by cells expressing CD22, the method comprising administering to the subject an effective amount of CMC-544 of the present invention.
- a panel of antibodies against CD22 were selected from hybridomas using the following selection criteria: binding to Daudi cells, internalization on Daudi cells, binding to peripheral blood mononuclear cells (PBMC), internalization on PBMC, affinity (greater than 10 "9 M), mouse ⁇ 1 and production rate. 5/44 was selected as the preferred antibody.
- Hybridoma 5/44 was generated by conventional hybridoma technology following immunization of mice with human CD22 protein.
- RNA was prepared from 5/44 hybridoma cells using a RNEasy kit (Qiagen, Crawley, UK; Catalogue No. 74106). The RNA obtained was reverse transcribed to cDNA, as described below. b) Distribution of CD22 on NHL Tumors
- PCR Cloning of 5/44 V H and V L cDNA sequences coding for the variable domains of 5/44 heavy and light chains were synthesized using reverse transcriptase to produce single stranded cDNA copies of the mRNA present in the total RNA. This was then used as the template for amplification of the murine V-region sequences using specific oligonucleotide primers by the Polymerase Chain Reaction (PCR).
- cDNA Synthesis cDNA was synthesized in a 20 ⁇ l reaction volume containing the following reagents: 50mM Tris-HCl pH 8.3, 75 mM KCI, 10 mM dithiothreitol, 3 mM MgCI 2 , 0.5 mM of dATP, dTTP, dCTP, and dGTP, 20 units RNAsin, 75 ng random hexanucleotide primer, 2 ⁇ g 5/44 RNA and 200 units Moloney Murine Leukemia Virus reverse transcriptase. After incubation at 42°C for 60 minutes, the reaction was terminated by heating at 95°C for 5 minutes, ii) PCR
- the 3' primers are designed to span the framework 4 J-C junction of the antibody and contain a restriction site for the enzyme BsiWI to facilitate cloning of the V PCR fragment.
- the heavy chain 3' primers are a mixture designed to span the J-C junction of the antibody.
- the 3' primer includes an Apal restriction site to facilitate cloning.
- the 3 J region " of the primers contains a mixed sequence based on those found in known mouse antibodies (Kabat et al., 1991 , supra).
- the combinations of primers described above enable the PCR products for V H and V L to be cloned directly into an appropriate expression vector (see below) to produce chimeric (mouse-human) heavy and light chains and for these genes to be expressed in mammalian cells to produce chimeric antibodies of the desired isotype.
- Incubations (100 ⁇ l) for the PCR were set up as follows. Each reaction contained 10 mM Tris-HCl pH 8.3, 1.5 mM MgCI 2 , 50 mM KCI, 0.01% w/v gelatin, 0.25 mM of dATP, dTTP, dCTP, and dGTP, 10 pmoles 5' primer mix, 10 pmoles 3' primer, 1 ⁇ l cDNA and 1 unit Taq polymerase. Reactions were incubated at 95°C for
- the murine V-region sequences were then cloned into the expression vectors pMRR10.1 and pMRR14 ( Figures 7 and 8). These are vectors for the expression of light and heavy chain containing DNA encoding constant regions of human kappa light chain and human gamma-4 heavy chain.
- the VL region was sub- cloned into the expression vector by restriction digest and ligation from the sequencing vector, using Sful and BsiWI restriction sites, creating plasmid pMRR10(544cL) ( Figure 8).
- the heavy chain DNA was amplified by PCR using a 5' primer to introduce a signal peptide, since this was not obtained in the cloning strategy - a mouse heavy chain antibody leader from a different in-house hybridoma (termed 162) was employed.
- the 5' primer had the following sequence: 5'GCGCGCAAGCTTGCCGCCACCATGGACTTCGGATTCTCTCTCGTGTTCCTGG CACTCATTCTCAAGGGAGTGCAGTGTGAGGTGCAGCTCGTCGAGTCTGG3' (SEQ ID NO:51).
- the reverse primer was identical to that used in the original V H gene cloning.
- the resultant PCR product was digested with enzymes Hindi 11 and Apal, was sub- cloned, and its DNA sequence was confirmed, creating plasmid pMRR14(544cH) ( Figure 7).
- Transient co-transfection of both expression vectors into CHO cells generated chimeric c5/44 antibody. This was achieved using the Lipofectamine reagent according to the manufacturer's protocols (InVitrogen ife Technology, Groningen, The Netherlands. Catalogue no. 11668-027).
- N-linked glycosylation site sequence was observed in CDR-H2, having the amino acid sequence N-Y-T ( Figure 3). SDS-PAGE, Western blotting and carbohydrate staining of gels of 5/44 and its fragments (including Fab) indicated that this site was indeed glycosylated (not shown). In addition, a lysine residue was observed at an exposed position within CDR-H2, which had the potential to reduce the binding affinity of the antibody by providing an additional site for conjugation with an agent with which the antibody may be conjugated.
- a PCR strategy was used to introduce amino acid substitutions into the CDR- H2 sequence in an attempt to remove the glycosylation site and/or the reactive lysine, as shown in Figure 4.
- Forward primers encoding the mutations N55Q, T57A or T57V were used to remove the glycosylation site ( Figure 4) and a fourth forward primer containing the substitution K60R, was generated to remove the reactive lysine residue ( Figure 4).
- a framework 4 reverse primer was used in each of these PCR amplifications.
- the PCR products were digested with the enzymes Xbal and Apal and were inserted into pMRR14(544cH) (also cleaved with Xbal and Apal) to generate expression plasmids encoding these mutants.
- the N55Q, T57A and T57V mutations ablate the glycosylation site by changing the amino acid sequence away from the consensus N-X-T/S while the K60R mutation replaces the potentially reactive lysine with the similarly positively charged residue arginine.
- the resultant cH variant plasmids were co-transfected with the cL plasmid to generate expressed chimeric antibody variants.
- CDR-grafting of the 5/44 heavy chain was accomplished using the same strategy as described for the light chain.
- the V-domain of the 5/44 heavy chain was found to be homologous to human heavy chains belonging to sub-group I (70% sequence identity) and therefore the sequence of the human sub-group I germline framework VH1-3.DP7 was used as an acceptor framework.
- the framework 4 acceptor sequences were derived from human J-region germline sequence JH4. A comparison of the 5/44 heavy chain with the framework regions is shown in
- Reaction volumes of 100 ⁇ l were set up containing 10 mM Tris-HCl pH8.3, 1.5 mM MgCI2, 50 mM KCI, 0.001 % gelatin, 0.25 mM of dATP, dTTP, dCTP, and dGTP, 1 pmole each of the 'internal' primers (T1 , T2, T3, B1 , B2, B3), 10 pmole each of the 'external' primers (F1 , R1), and 1 unit of Taq polymerase (AmpliTaq, Applied BioSystems, catalogue no. N808-0171).
- PCR cycle parameters were 94 °C for 1 minute, 55 °C for 1 minute and 72 °C for 1 minute, for 30 cycles.
- the reaction products were then run on a 1.5 % agarose gel, excised and recovered using QIAGEN spin columns (QIAquick gel extraction kit, cat no. 28706).
- the DNA was eluted in a volume of 30 ⁇ l.
- Aliquots (1 ⁇ l) of the gH1 and gL1 DNA were then cloned into the InVitrogen TOPO TA cloning vector pCR2.1 TOPO (catalogue no. K4500-01) according to the manufacturer's instructions.
- This non-expression vector served as a cloning intermediate to facilitate sequencing of a large number of clones.
- DNA sequencing using vector-specific primers was used to identify correct clones containing gH1 and gL1, creating plasmids pCR2.1 (544gH1) and pCR2.1(544gL1) ( Figures 11 and 12).
- An oligonucleotide cassette replacement method was used to create the humanized grafts gH4, 5, 6 and 7, and gL2.
- Figure 13 shows the design of the oligonucleotide cassettes.
- the vector pCR2.1(544gH1) or pCR2.1 (544gL1)) was cut with the restriction enzymes shown (Xmal/Sacll for the heavy chain, Xmal/BstEII for the light chain).
- the large vector fragment was gel purified from agarose and was used in ligation with the oligonucleotide cassette.
- These cassettes are composed of 2 complementary oligonucleotides (shown in Figure 13), mixed at a concentration of 0.5 pmoles/ ⁇ l in a volume of 200 ⁇ l 12.5 mM Tris-HCl pH 7.5, 2.5 mM MgCI 2 , 25 mM NaCl, 0.25 mM dithioerythritol. Annealing was achieved by heating to 95 °C for 3 minutes in a water bath (volume 500 ml) then allowing the reaction to slow-cool to room temperature.
- the annealed oligonucleotide cassette was then diluted ten-fold in water before ligation into the appropriately cut vector.
- DNA sequencing was used to confirm the correct sequence, creating plasmids pCR2.1 (5/44-gH4-7) and pCR2.1 (5/44-gL2).
- the verified grafted sequences were then sub-cloned into the expression vectors pMRR14 (heavy chain) and pMR10.1 (light chain).
- CD22 BINDING ACTIVITY OF CDR-GRAFTED SEQUENCES The vectors encoding grafted variants were co-transfected into CHO cells in a variety of combinations, together with the original chimeric antibody chains. Binding activity was compared in a competition assay, competing the binding of the original mouse 5/44 antibody for binding to Ramos cells (obtained from ATCC, a Burkitt's lymphoma lymphoblast human cell line expressing surface CD22). This assay was considered the best way to compare the grafts in their ability to bind to cell surface CD22. The results are shown in Figures 14 and 15.
- the graft combination with the least number of murine residues gL1gH7 was selected.
- the light chain graft gL1 has 6 donor residues.
- Residues V2, V4, L37 and Q45 are potentially important packing residues.
- Residue H38 is at the V H /V L interface.
- Residue D60 is a surface residue close to the CDR-L2 and may directly contribute to antigen binding. Of these residues, V2, L37, Q45 and D60 are found in germline sequences of human kappa genes from other sub-groups.
- the heavy chain graft gH7 has 4 donor framework residues (Residue R28 is considered to be part of CDR-H1 under the structural definition used in CDR-grafting (see Adair et al. (1991), PCT application No. WO91/09967)).
- Residues E1 and A71 are surface residues close to the CDRs.
- Residue I48 is a potential packing residue.
- Residue T93 is present at the V H /V interface. Of these residues, E1 and A71 are found in other germline genes of human sub-group I.
- Residue I48 is found in human germline subgroup 4, and T73 is found in human germline sub-group 3.
- ANTI-CD22 ANTIBODY (G5/44)
- humanized anti-CD22 antibody (G5/44) was conjugated to NAc-gamma calicheamicin DMH AcBut OSu (calicheamicin derivative) (see Figure 17), where the target protein concentration was 7.5 mg/ml and the target calicheamicin derivative loading was 8.5 percent by weight of the protein.
- the target reaction pH was 8.5 ⁇ 0.2, and the target concentrations of the other reaction components were as follows: 50 mM N-(2-Hydroxyethyl)piperazine-N'-(4- butanesulfonic acid) (HEPBS), 37.5 mM sodium decanoate, and 9% v/v total ethanol.
- Butyl Sepharose 4 Fast Flow was identified as the best HIC media, acceptable results can be obtained with slight alterations in the chromatographic conditions using other resins such as Octyl Sepharose Fast Flow, PPG-600C (Tosoh Biosep), Fractogel EMD Propyl (EM Processing) and Source 15ISO (Amersham
- the starting material for the purification was a conjugation reaction mixture containing 7.2 mg/mL protein at a calicheamicin derivative loading of 83 ⁇ g/mg, with an aggregate content of 10.1% (area percent by HPLC), and an LCF content of 5.6% (area percent by HPLC)
- the reaction mixture was diluted four-fold by the addition of potassium phosphate solution to a final phosphate concentration of 0.7 M (pH 8.2). After mixing, this solution was filtered through 0.45- micron filters. The diluted solution was loaded on a Butyl Sepharose 4 Fast Flow column. The total amount of protein loaded on the column was 29 mg per ml bed volume. After a wash with 0.7 M potassium phosphate, the column was eluted using a step gradient from 0.7 M to 4 mM potassium phosphate, pH 8.2. The fractions eluted in the step gradient were pooled for further processing, with the pool consisting of monomeric conjugate with less than 1 area percent each of aggregate and LCF.
- This pool was loaded on a Sephadex G-25 (Amersham Biosciences) desalting column for exchange to a buffer appropriate for formulation, consisting of 20 mM Tris-CI and 100 mM sodium chloride at pH 8.0.
- the purified, buffer- exchanged CMC-544 preparation had the following properties: Calicheamicin Loading: 81 ⁇ g/mg; Aggregate: 0.4% (area percent by HPLC) LCF: 0.8% (area percent by HPLC).
- Biosensor analyses were carried out using a BIAcore 2000 (BIAcore AB,
- CD22mFc was covalently immobilized on the N- hydroxysuccinimide-activated carboxymethyl dextran-coated biosensor chip (CM5) using a standard amine-coupling chemistry at a protein density of approximately
- Samples of CMC-544 or G5/44 were diluted in the HBS buffer (10 mM HEPES, pH 7.4, containing 150 mM NaCl, 3 mM EDTA and 0.005% polysorbate 20 (v/v)) and injected in the concentration range of 1 to 100 nM over the CD22mFc-coated biosensor chip surface at a flow rate of 30 ⁇ l/min for 3 min to allow binding. After the binding phase, dissociation of the bound antibody was monitored by washing the chip with the HBS buffer over a 15 minute period.
- HBS buffer 10 mM HEPES, pH 7.4, containing 150 mM NaCl, 3 mM EDTA and 0.005% polysorbate 20 (v/v)
- the antigenic surface was regenerated by washing the Biosensor chip with 15 ⁇ l of the regeneration buffer (10 mM NaOH and 200 mM NaCl) for 30 seconds, followed by a stabilization time of 2 minutes before the next cycle.
- Kinetic constants were calculated by nonlinear least square regression analysis using a 1:1 Langmuir binding curve fitting model and BIAevaluation program (version 3.0, BIAcore).
- the antigen binding of CMC-544 was evaluated by surface plasmon resonance analysis using CD22mFc covalently immobilized on a biosensor chip.
- CMC-544 and G5/44 were also examined by flow cytometry.
- Anti-CD33 mAb gemtuzumab (hP67.6) and its calicheamicin conjugate CMA-676 (gemtuzumab ozogamicin) were used as isotype-matched controls in this evaluation.
- Rituximab (RituxanTM) a chimeric human lgG1 anti-human CD20 mAb, was used as a positive control.
- Purified human polyclonal lgG1 and lgG4 were also used as negative controls.
- CMC-544 specifically recognizes CD22 on human B cells, but not on murine, rat, canine, porcine or primate (cynomolgus and rhesus) B cells (data not shown).
- CMA-676 An isotype-matched calicheamicin conjugate targeted at human CD33
- Table 4 shows the results of these evaluations based on the calicheamicin equivalence and Table 5 shows these results expressed as the concentrations of conjugated antibody protein.
- CD22-mediated delivery of calicheamicin to the CD22 + cells was at least 10 times more efficient in killing the target cells than the unconjugated drug itself.
- the isotype- matched control conjugate (CMA-676) showed cytotoxicity that was either less than or similar to the unconjugated calicheamicin derivative. It is apparent from Table 4 that conjugate made by the CMC-544 conjugation process can generate equivalent cytotoxic effect at lower antibody concentrations than conjugate made by the CMA- 676 conjugation process.
- CMC-544 made by the CMC-544 process was further evaluated in B-cell lymphoma xenografts.
- two B-cell lymphoma tumors, RAMOS and RL were used.
- RL lymphoma is a non-Burkitt's NHL-derived cell line whereas RAMOS was originally derived from a Burkitt's lymphoma.
- CMC-544 and its murine antibody counterpart were shown to be efficacious in inhibiting, in a dose-dependent manner, the growth of RAMOS B-cell lymphoma.
- the conjugate of the humanized antibody was shown to be more potent than its murine counterpart.
- the lowest dose of calicheamicin conjugate capable of causing significant growth inhibition of lymphoma was 10 ⁇ g/kg of conjugated NAc-gamma calicheamicin DMH.
- the unconjugated antibody, G5/44, at 10 mg/Kg administered intraperitoneal on a similar schedule as conjugates had no effect on tumor growth.
- CMC-544 made by the new procedure to inhibit growth of large established B-cell lymphoma xenografts using both the RAMOS and RL lymphoma models was also investigated.
- the tumors were allowed to grow and staged to 1.5 or 2 g of tumor mass after which CMC-544 or an isotype-matched negative control conjugate (CMA-676) were administered intraperitoneally at the dose of 160 ⁇ g/Kg of conjugated calicheamicin keeping the original schedule of dosing on days 1 , 5 and 9.
- CMA-676 isotype-matched negative control conjugate
- CMC- 544 administration of CMC- 544 to large RAMOS lymphoma-bearing mice caused gradual regression of the preexisting lymphoma mass and by day 20, 3 out of 4 tumor-bearing mice were tumor-free. Monitoring these tumor-freed mice up to day 50 did not indicate any re- growth of regressed RAMOS lymphoma. In contrast, an isotype matched control, CMA-676, had no effect on the tumor growth. Four out of five CMA-676-treated large tumor-bearing mice had to be sacrificed before day 15 because their tumor burden reached close to 15% of their body weight. A similar experiment using CMC-544 was carried out in the RL lymphoma model.
- CMC-544 Intraperitoneal administration of CMC-544 at a dose of 160 ⁇ g/kg on a similar schedule as described before caused >90% regression of the pre-existing mass of RL lymphoma within 30 days. However by day 45, 2 mice in this group with shrunken lymphomas showed re-growth of the tumors. These results indicate that CMC-544 is able to cause regression of small, as well as large, established lymphomas. In a small number of studies not shown here, RL lymphomas that re- grew sporadically after the initial CMC-544-induced regression were retreated with CMC-544 again. These studies showed that the RL tumors were still responsive to the second course of the treatment with CMC-544 and regressed again. Thus, the treatment with CMC-544 can be effective against both small and large masses of B- cell lymphomas with the potential for repeat therapy.
- Figure 20 shows the results of a representative experiment in which staged RL lymphoma-bearing mice received two different doses (80 and 320 ⁇ g/kg of conjugated calicheamicin) of CMC-544 made using the CMA-676 conjugation process and the CMC-544 conjugation process using the standard dosing schedule.
- the observed anti-tumor efficacy was dose-dependent as expected and there was no difference in the efficacies of either of the two CMC-544 preparations.
- unconjugated N Acetyl-gamma calicheamicin DMH administered intraperitoneally at 160 ⁇ g/kg was inactive.
- RL lymphomas Upon cessation of rituximab (RituxanTM) therapy, RL lymphomas grew rapidly to the size of ⁇ 1 g mass at which time they were treated with CMC-544 at the intraperitoneal dose of 160 ⁇ g/Kg. As shown in Figures 21 and 22, these RL lymphomas were still responsive to CMC-544 with 80% of mice becoming tumor-free by day 60. Thus, CMC-544 is able to cause regression of B- cell lymphomas with three doses that could only be inhibited by the continuous dosing of rituximab (RituxanTM).
- CMC-544 was evaluated for its binding to CD22 and also for its activity in in vitro and in vivo models.
- CMC-544 was also compared to CMA-676, an isotype- matched control conjugate of hP67.6 (lgG4) with AcBut linked calicheamicin, and to rituximab (RituxanTM), a chimeric lgG1 anti-CD 20 mAb, (IDEC Pharmceuticals, San Diego, CA.), which is commercially available and was purchased from Medworld Pharmacy (Chestnut Ridge, NY).
- the following antibodies were used in the G5/44 binding domain studies: BU12 (Celltech, Slough, UK); BLCAM, HD239 (Santa Cruz Biotech, Santa Cruz, CA); RFB-4 (Ancell Corp, Bayport, MN); SHCL-1 , Leu 14 (Becton Dickinson, Franklin Lakes, NJ); 4KB128 and To 15 (Dako Corp, Carpinteria, CA); M6/13 and M5/44 (Celltech, Slough, UK). Additional antibodies used in the blocking studies were SJ10 (Immunotech, Fullerton, CA) and M17.1.1 , M19.1.1 , M38.1.1 (Celltech, Slough, UK).
- Cell lines for the studies including Burkitt's lymphoma cell line Ramos (CRL-1923) and the Non-Hodgkin's lymphoma (NHL) cell line RL (CRL-2261) were all obtained from the American Type Culture Collection.
- the cell lines were determined to be mycoplasma free by a polymerase chain reaction mycoplasma detection assay (ATCC, Manassas, VA).
- the cell lines were maintained as suspension cultures in RPMI medium plus 10% FBS, 10 mM HEPES, 1 mM sodium pyruvate, 0.2% glucose, Penicillin G sodium 100 U/ml, and streptomycin sulfate 100 ⁇ g/ml.
- G5/44 can inhibit the binding of murine mAbs of known specificity to CD22 was evaluated by BIAcore analysis using Fc-CD22 immobilized to a BIAcore CM5 chip.
- the surface plasmon resonance units (RU) obtained with and without prior saturation of the immobilized Fc-CD22 with G5/44 were compared.
- Biomolecular interaction analysis was performed using a BIACORE 2000.
- Antibodies were passed over a blank control surface (flowcell 1 , serves as a control, no protein was coupled) and the test surface of Fc-CD22 (flowcell 2) immobilized on a CM5 sensor chip via amine coupling chemistry to a level of 9,042 RU.
- the resultant sensorgram was the response (RU) on flowcell 2 minus the response (RU) on flowcell 1.
- a second sensorgram was obtained by first saturating the flowcells with G5/44 (100 ⁇ g/ml) before the introduction of murine mAbs against CD22 that had been previously characterized for their binding. Immediately upon measuring the G5/44 response, murine anti-CD22 mAbs were individually perfused without removing G544. The second combined response generated due to the binding of murine anti-CD22 mAb to G5/44-coated CD22 was also recorded. If the murine antibody bound to CD22 at sites unrelated to those occupied by G5/44, then the combined responses would be additive. If the binding of G5/44 to CD22 interfered with or prevented the binding of the second antibody, then the combined responses would not be additive. Each of the second combined measurements were corrected for the "off-rate" of the G5/44:CD22 interaction.
- G5/44 blocked the binding of only those antibodies that bound to epitope A / Ig-like domain 1 of CD22 (SHCL1 Leu 14 and HD239), indicating that G5/44 also binds in this domain of CD22.
- Anti-CD19 antibody BU12 serves as a negative control in these evaluations. The results are summarized in Table 7.
- B cells were pelleted and washed with PBS-1 % BSA and the appropriate secondary antibody was added (either FITC-goat anti-human (heavy and light chain) or FITC- goat anti-mouse (heavy and light chain)) at 100 ⁇ l of a 1 :100 dilution in PBS-1% BSA for 30 minutes at 4° C.
- Cells were again pelleted, washed, and resuspended in PBS- 1% BSA and added to a tube containing 250 ⁇ l of PBS-1 % formaldehyde. Fluorescence intensity associated with cells was measured by flow cytometry using BD FACSort flow cytometer.
- IC 50 Median inhibitory concentrations (IC 50 ) were also computed and the effectiveness of each treatment relative to the treatment with CMC-544 alone was recorded. The statistical analysis was conducted using the PROBIT procedure in SAS version 8.2. The results of the study showed that CMC-544 caused a dose-dependent inhibition of Ramos cell growth over the dose range of 0.01 to 3 ng calicheamicin DMH/ml. The median inhibitory concentration (IC 50 ) of CMC-544 alone was 0.029 ng/ml.
- rituximab The concentrations of 2, 20, and 200 ⁇ g/ml of rituximab (RituxanTM) were added to CMC-544 treated cells to determine whether the interaction of rituximab (RituxanTM) with the cytotoxicity activity of CMC-544 is statistically significant.
- Rituximab added at 20 and 200 ⁇ g/ml without CMC-544, had no significant effect on cell growth by itself (111.7% and 94.0% of vehicle growth, respectively).
- all three concentrations of (RituxanTM) produced statistically significant (p ⁇ 0.05) shifts to the left in the slope and intercept of the CMC-544 dose-response curve.
- the combination with 2 and 200 ⁇ g/ml of rituximab produced the largest shifts in the dose-response curves. These 2 curves were not statistically different from each other but were significantly different (p ⁇ 0.05) from the 20 ⁇ g/ml dose combination.
- a second study confirmed the results observed in the first study.
- the median inhibitory concentrations for the combinations of 2, 20, and 200 ⁇ g/ml of rituximab (RituxanTM) plus CMC-544 are 0.0072, 0.0081, and 0.0072 ng/ml, respectively.
- the median inhibitory concentrations of CMC-544 plus rituximab (RituxanTM) are approximately four-fold more potent than the IC 50 of CMC-544 alone.
- mice Female, athymic nude mice, 18-22 g, were given total body irradiation (400 rads). Irradiation further suppressed the immune system of the mice to enhance tumor take. Three days after irradiation, mice were injected subcutaneously with 107 RL cells in Matrigel (Collaborative Biomedical Products, Belford, MA, diluted 1 :1 in RPMI medium) in the dorsal, right flank. When the tumors reached the appropriate size, (0.3g, typically 21 days later), CMC-544, rituximab (RituxanTM) or CHOP therapy (see below) was administered in sterile saline, 0.2 ml/mouse ip. The initial day of drug administration was considered day 1.
- CHOP therapy consisted of cyclophosphamide (C), (CytoxanTM, Bristol-Meyers Squibb Co., Princeton, NJ) 40 mg/kg ip; doxorubicin HCI (H), (Sigma-Aldrich, Co., St Louis, MO) 3.3 mg/kg ip; vincristine (O), (GensiaSicor Pharmaceuticals, Irvine, CA 0.5 mg/kg ip; and prednisone (P), (Roxane Labs., Columbia, OH) 0.2 mg/kg po.
- C cyclophosphamide
- H doxorubicin HCI
- O vincristine
- P prednisone
- CHO was administered according to the same dosing schedule as both CMC-544 and rituximab (RituxanTM) (q4Dx3) while prednisone was administered orally every other day for 5 doses (q2Dx5).
- Group means SEM were calculated and compared to the vehicle-treated group for statistical significance using multiple T-tests. Group means were recorded up to 50 days or until either a mouse died (which disrupted the group mean) or the tumor grew too large (>3.5g) and the mouse had to be euthanized. After this time, tumor mass was reported only for each individual mouse in all treatment groups. The number of tumor free mice at the end of each study for each treatment group was also recorded.
- mice Male, SCID mice (CB17 SCID), 20-25g, were injected with 106 Ramos cells through the tail vein (0.2 ml). Either 3 or 9 days after cell injection, the mice were administered vehicle, conjugates (CMC-544 or CMC-676), or rituximab (RituxanTM), ip, for a total of 3 doses. For the day 3 treatment schedule, mice were dosed on days 3, 7, and 11. For the day 9 treatment schedule, mice were dosed on days 9, 13 and 17.
- mice were monitored daily for the presence of hind limb paralysis at which time they were killed. Seven to 10 mice per treatment group were used. The group average survival time (+SD), median, minimum, and maximum survival times were all calculated. The difference in survival distribution between groups was determined by using a nonparametric Log-rank test with significance reported at the 0.05 level. The survival curves were constructed using the Kaplan-Meier method.
- the initial study examined the effect of two different dosing schedules on survival times of the SCID mice with the disseminated lymphoma.
- the first study looked at initiating drug dosing 3 days after the tumor cells were injected intravenously (developing model), while the second study delayed drug dosing until 9 days post tumor cell injection (established model).
- CMC-544 160 ⁇ g/kg
- CMA-676 160 ⁇ g/kg
- rituximab (RituxanTM) (20 mg/kg) were administered 3 doses ip, 4 days apart (Q4Dx3).
- vehicle-treated mice had an average survival time of 27 days ( Figure 23, Table 8).
- CMA-676 the isotype- matched control for CMC-544, did not increase survival time significantly (p>0.05).
- CMA-676 again had no significant effect on survival times (Figure 24, Table 8).
- Rituximab (RituxanTM) increased the average survival time to 62.6 days while CMC-544 improved the average survival time to 83.5 days. There was no significant difference between the effects of CMC- 544 and rituximab (RituxanTM) in the established model.
- CMC-544 (160 ⁇ g/kg) was administered with and without rituximab (RituxanTM) (20 mg/kg, labeled the high dose drug combination (HD)).
- rituximab (RituxanTM) (20 mg/kg, labeled the high dose drug combination (HD)
- lower doses of CMC-544 80 ⁇ g/kg were co-administered with lower doses of rituximab (RituxanTM) (10 mg/kg).
- the compounds were not given separately at the respective 80 ⁇ g/kg or 10 mg/kg doses due to the limited number of mice in the study.
- CMC- 544 80 ⁇ g/kg with rituximab (RituxanTM) (10 mg/kg), was labeled the medium dose combination (MD) and was run to determine the feasibility of lower dose combinations of drugs on SCID mouse survival.
- CMC-544 160 ⁇ g/kg
- rituximab 20 mg/kg
- Each prolonged average survival times to 58.5 and 50.5 days, respectively ( Figure 25, Table 9).
- the average survival time was slightly (though not statistically significant, p>0.05) improved to 64.4 days for the high-dose combination.
- CMC MD CMC544 medium dose
- CMC HD CMC-544 high dose
- Ritux MD Rituximab medium dose
- CMC-544 and rituximab were run. The following treatment groups were run: CMC-544 at 40, 80 and 160 ⁇ g/kg; rituximab (RituxanTM) at 5, 10, and 20 mg/kg; and CMC-544 at 40 ⁇ g/kg plus rituximab (RituxanTM) 5 mg/kg, CMC-544 at 80 ⁇ g/kg plus rituximab (RituxanTM) 10 mg/kg, and CMC-544 at 160 ⁇ g/kg plus rituximab (RituxanTM) 20 mg/kg.
- CMC-544 co-administered with rituximab (RituxanTM)
- rituximab rituximab
- CMC-544 was used at 20 or 80 ⁇ g/kg Q4Dx3 with or without rituximab (RituxanTM) (20 mg/kg Q4Dx3).
- rituximab (RituxanTM) neither enhanced nor inhibited significantly (p>0.05) the therapeutic efficacy of CMC-544 (Figure 28).
- Rituximab (RituxanTM) administered alone, inhibited RL B lymphoma growth (57% inhibition of tumor growth at day 20, p ⁇ 0.05 vs vehicle-treated) in this study, similar to that observed with the lower dosage of CMC-544.
- CHOP cyclophosphamide, doxorubicin, vincristine, and prednisone
- CHOP cyclophosphamide, doxorubicin, vincristine, and prednisone
- CMC-544 was administered IP, Q4Dx3 at a dosage of 160 ⁇ g/kg calicheamicin equivalents.
- the CHOP treatment initially caused a significant inhibition of the RL B lymphoma growth ( Figure 29). However, 3 weeks later, tumors re-grew with similar growth rates as the vehicle-treated group. In contrast, the antitumor effect of CMC-544 was complete and lasted throughout the experimental period.
- rituximab (RituxanTM)
- rituximab added to CMC-544 caused a significant increase in CMC-544's cytotoxic activity observed with Ramos B lymphoma cells.
- a synergistic growth inhibition in 4 of 8 additional cell lines was observed with rituximab (RituxanTM) when given in combination with 10 ⁇ M dexamethasone.
- Rituximab (RituxanTM) by itself, 0.4 to 10 ⁇ g/ml, was reported to cause a significant, though small (18%) maximum) inhibition of Ramos cell growth. Additionally, it was active in 6 of 8 B-cell non-Hodgkin lymphoma cell lines when incubated at 10 ⁇ g/ml (48 h incubation). Ghetie et al, showed that rituximab (RituxanTM), 10 ⁇ g/ml, caused a 6.2% increase in apoptosis (versus 3.5% in vehicle- treated cells) after 24 hours incubation with Ramos cells.
- rituximab (RituxanTM)
- mice there was no evidence of any interaction between CMC-544 and rituximab (RituxanTM) in either the disseminated model or the subcutaneous xenograft model.
- the drug combinations tested did not interfere with each other's effects nor enhance them. Whether reducing the doses of each drug in the disseminated model will change this observation needs to be determined.
- Rituximab being of the lgG1 isotype, most likely works through the mouse host effector mechanisms. These mechanisms include complement-mediated cytotoxicity and/ or antibody dependent cellular cytotoxicity through recruitment of natural killer cells that are present in SCID mice.
- the injected Ramos tumor cells are probably more susceptible early on to the host immune mechanisms that are activated by rituximab (RituxanTM), before the cells have an opportunity to infiltrate into the affected organs.
- the unconjugated G5/44 antibody (the targeting molecule in CMC-544) had not yet been tested in the disseminated tumor model in SCID mice, but it had no effect when administered in subcutaneous xenografts.
- G5/44 being of the lgG4 isotype, would not be expected to activate the host effector mechanisms and, therefore, would not produce anti-tumor activity.
- CMC-544 Calicheamicin conjugated G5/44 (CMC-544) behaved in the opposite fashion than rituximab (RituxanTM), producing better results when administered in the established phase of the disease.
- the reason for CMC-544 performing better in the established phase is not clear, but the established phase more closely represents the clinical situation.
- CMA-676 the isotype matched, nonbonding control conjugate, did no have any significant effects on the average survival times.
- the results in the disseminated SCID model clearly suggest that the doses of CMC-544 need to be reduced to determine the maximum efficacious dose (MED).
- MED maximum efficacious dose
- the 160 ⁇ g/kg dose was less active than the lower doses of 80 and 40 ⁇ /kg. It is not clear why this is so but the 160 ⁇ g/kg dose may be well over the MED. Further studies are planned to address this issue.
- CHOP therapy Cyclophosphamide (C) 40 mg/kg IV, doxorubicin (H) 3.3 mg/kg IV, vincristine (O) 0.5 mg/kg IV, and prednisone (P) 0.2 mg/kg PO
- C Cyclophosphamide
- H doxorubicin
- O vincristine
- P prednisone
- CMC LD CMC-544 low dose, 40 ⁇ g/kg
- Ritux LD Rituximab low dose, 5 mg/kg
- CMC MD CMC-544 medium dose
- Ritux MD Rituximab medium dose
- CMC HD CMC-544 high dose
- Ritux HD Rituximab high dose, 20 mg/kg
- Stable formulations of CMC-544 for in vivo administration were prepared by adding diluents, excipients, carriers and stabilizers. Following HIC chromatography, the chromatographic fractions are assayed by SEC-HPLC and multiwavelength UV analysis. Appropriate fractions were selected for pooling on the basis of the above analysis, which provided information on aggregate content, protein concentration, and calicheamicin loading. Excipients, stabilizers, bulking agents and buffering agents were added to stabilize the solution. Since CMC-544 can undergo degradation via a number of degradation pathways, physical instabilities need to be considered in the development of formulations.
- tromethamine was chosen as a buffering agent to maintain a pH of 8.0.
- An alternative buffer could include dibasic sodium or potassium phosphate.
- the range of buffer concentration can be 5 to 50 mM.
- a preferred pH range of 7.5 to 8.5 is suggested for optimum stability/solubility.
- the current pH specification for the finished product is 7.0-9.0.
- lyophilization is used to improve the shelf life of the conjugates.
- the problems associated with lyophilization of a protein solution are well documented, and the loss of secondary, tertiary and quaternary structure can occur during freezing and drying processes.
- Sucrose is included in the formulation to act as an amorphous stabilizer of the conjugate and maintain the structural integrity of the antibody during freezing and drying. Concentrations of 1.5- 5.0% w/v sucrose have been used.
- a polymeric bulking agent such as Dextran 40 or hydroxyethyl starch can be incorporated to enhance the appearance and physical rigidity of the lyophilized cakes at a concentration of 0.5-1.5% by weight.
- the final CMC-544 solution comprises 1.5% sucrose (by weight), 0.9% Dextran 40 (by weight), 0.01% tween 80, 50 mM sodium chloride, 0.01% polysorbate 80 (by weight) and 20 mM tromethamine.
- the solution is dispensed into amber vials at a temperature of +5°C to 10°C, (optimally at +5°C); the solution is frozen at a freezing temperature of -35°C to -50°C, (optimally at -45°C); the frozen solution is subjected to an initial freeze drying step at a primary drying pressure of 20 to 80 microns, (optimally at 60 microns); the freeze-dried product is held at a shelf temperature at -10 °C to -40°C, (optimally at -30°C), for 24 to 72 hours, (optimally for 60 hours); and finally the freeze-dried product is subjected to a secondary drying step at a drying pressure of 20-80 microns, (optimally at 60 microns) at a shelf temperature of +10°C to +35°C, (optimally +25°C), for 15 to 30 hours (optimally for 24 hours).
- a pressure rise test is used to determine the end of primary drying.
- Table 11 sets out the differences in the formulation used for CMC-544 and the formulation used for CMC-676.
- Significant differences between the CMA-676 formulation and the formulation used for CMC-544 include reduced protein concentration in the new formulation (0.5 mg/mL), the use of tromethamine as a buffer and the presence of 0.01% tween 80. This results in the reconstituted CMC- 544 in the new formulation being clear as opposed to the turbidity seen in the reconstituted CMA-676 formulation (see Tables 12 and 13).
- TABLE 11 COMPARISON OF THE CMA-676 FORMULATION AND CMC-544
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Pain & Pain Management (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Physical Education & Sports Medicine (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Neurology (AREA)
- Rheumatology (AREA)
- Plant Pathology (AREA)
Priority Applications (26)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL413302A PL228741B1 (pl) | 2002-05-02 | 2003-05-02 | Koniugaty pochodna kalicheamycyny/przeciwciało przeciwko CD22 oraz ich zastosowanie |
| JP2004500808A JP5153057B2 (ja) | 2002-05-02 | 2003-05-02 | カリチェアミシン誘導体−キャリアコンジュゲート |
| DK03724432.4T DK1507556T3 (en) | 2002-05-02 | 2003-05-02 | Calicheamicin derivative-carrier conjugates |
| CA002483552A CA2483552A1 (en) | 2002-05-02 | 2003-05-02 | Calicheamicin derivative-carrier conjugates |
| AU2003231293A AU2003231293A1 (en) | 2002-05-02 | 2003-05-02 | Calicheamicin derivative-carrier conjugates |
| LTEP03724432.4T LT1507556T (lt) | 2002-05-02 | 2003-05-02 | Kalicheamicino darinio ir nešiklio konjugatai |
| SI200332489A SI1507556T1 (sl) | 2002-05-02 | 2003-05-02 | Konjugati kaliheamicinski derivat-nosilec |
| BR122019027966A BR122019027966B8 (pt) | 2002-05-02 | 2003-05-02 | conjugado monomérico de derivado de caliqueamicina/anti-corpo anti-cd22 e uso dos mesmos |
| BRPI0309868A BRPI0309868B8 (pt) | 2002-05-02 | 2003-05-02 | métodos de preparação de uma composição de reduzida fração conjugada inferior |
| HK05103600.1A HK1070825B (en) | 2002-05-02 | 2003-05-02 | Calicheamicin derivative-carrier conjugates |
| BR122019027974-8A BR122019027974B1 (pt) | 2002-05-02 | 2003-05-02 | Composição compreendendo conjugado monomérico de derivado de caliqueamicina/anticorpo anti-cd22 e seu uso |
| MXPA04010792A MXPA04010792A (es) | 2002-05-02 | 2003-05-02 | Conjugados portadores de derivados de caliqueamicina. |
| ES03724432.4T ES2593304T3 (es) | 2002-05-02 | 2003-05-02 | Conjugados de transportador derivado de caliqueamicina |
| EP03724432.4A EP1507556B1 (en) | 2002-05-02 | 2003-05-02 | Calicheamicin derivative-carrier conjugates |
| EP16180729.2A EP3127553B1 (en) | 2002-05-02 | 2003-05-02 | Calicheamicin derivative-carrier conjugates |
| KR1020047017670A KR101062628B1 (ko) | 2002-05-02 | 2003-05-02 | 칼리치아미신 유도체-운반체 접합체 |
| KR1020117009631A KR101125524B1 (ko) | 2002-05-02 | 2003-05-02 | 칼리치아미신 유도체-운반체 접합체 |
| NO20044663A NO339730B1 (no) | 2002-05-02 | 2004-10-28 | Et monomer calicheamicin derivat/anti-CD22 antistoff konjugat samt anvendelse derav. |
| IL164946A IL164946A (en) | 2002-05-02 | 2004-11-01 | Derivative of Clichamycin-bore attached |
| PH12013501158A PH12013501158A1 (en) | 2002-05-02 | 2013-06-06 | Calicheamicin derivative-carrier conjugates |
| PH12013501159A PH12013501159A1 (en) | 2002-05-02 | 2013-06-06 | Calicheamicin derivative-carrier conjugates |
| IL230659A IL230659A (en) | 2002-05-02 | 2014-01-26 | Calicheamicin derivative-carrier conjugates |
| CY20161100872T CY1117973T1 (el) | 2002-05-02 | 2016-09-05 | Συζευγματα παραγωγου καλιχεαμυκινης-φορεα |
| NO20161431A NO344509B1 (no) | 2002-05-02 | 2016-09-08 | Fremgangsmåte for fremstilling av et preparat omfattende monomer calicheamicin derivat/anti-CD22 antistoff konjugat, preparat fremstilt derved samt anvendelse av preparatet. |
| NO2017061C NO2017061I1 (no) | 2002-05-02 | 2017-11-21 | inotuzumab ozogamicin |
| CY20221100035T CY1124900T1 (el) | 2002-05-02 | 2022-01-14 | Συζευγματα παραγωγου καλιχεαμυκινης-φορεα |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US37744002P | 2002-05-02 | 2002-05-02 | |
| US60/377,440 | 2002-05-02 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003092623A2 true WO2003092623A2 (en) | 2003-11-13 |
| WO2003092623A3 WO2003092623A3 (en) | 2004-03-18 |
Family
ID=29401497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2003/013910 Ceased WO2003092623A2 (en) | 2002-05-02 | 2003-05-02 | Calicheamicin derivative-carrier conjugates |
Country Status (33)
| Country | Link |
|---|---|
| US (6) | US8153768B2 (https=) |
| EP (3) | EP1507556B1 (https=) |
| JP (5) | JP5153057B2 (https=) |
| KR (2) | KR101125524B1 (https=) |
| CN (1) | CN100482277C (https=) |
| AU (2) | AU2003231293A1 (https=) |
| BE (1) | BE2017C049I2 (https=) |
| BR (3) | BR122019027966B8 (https=) |
| CA (2) | CA2483552A1 (https=) |
| CR (3) | CR7557A (https=) |
| CY (4) | CY1116634T1 (https=) |
| DK (3) | DK3127553T3 (https=) |
| EC (1) | ECSP045445A (https=) |
| ES (3) | ES2916174T3 (https=) |
| FR (1) | FR17C1054I2 (https=) |
| HU (4) | HUE030806T2 (https=) |
| IL (2) | IL164946A (https=) |
| LT (3) | LT3127553T (https=) |
| LU (1) | LUC00044I2 (https=) |
| MX (1) | MXPA04010792A (https=) |
| NL (1) | NL300903I2 (https=) |
| NO (3) | NO339730B1 (https=) |
| NZ (2) | NZ573563A (https=) |
| PH (2) | PH12013501158A1 (https=) |
| PL (5) | PL224150B1 (https=) |
| PT (3) | PT3127553T (https=) |
| RU (3) | RU2422157C3 (https=) |
| SG (3) | SG187991A1 (https=) |
| SI (3) | SI2371392T1 (https=) |
| TW (2) | TWI379693B (https=) |
| UA (1) | UA88599C2 (https=) |
| WO (1) | WO2003092623A2 (https=) |
| ZA (2) | ZA200409752B (https=) |
Cited By (41)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005089809A3 (en) * | 2004-03-15 | 2006-05-04 | Wyeth Corp | Calicheamicin conjugation by antibody deglycosylation |
| WO2007005690A1 (en) * | 2005-07-01 | 2007-01-11 | Wyeth | Methods of determining pharmacokinetics of targeted therapies |
| WO2007067602A1 (en) * | 2005-12-06 | 2007-06-14 | Wyeth | Interleukin-11 compositions and methods of use |
| US7250416B2 (en) | 2005-03-11 | 2007-07-31 | Supergen, Inc. | Azacytosine analogs and derivatives |
| US7276228B2 (en) | 2001-04-24 | 2007-10-02 | Supergen, Inc. | Methods for treating hematological disorders through inhibition of DNA methylation and histone deacetylase |
| EP2117601A2 (en) * | 2006-12-22 | 2009-11-18 | The Regents of the University of California | Macromolecular conjugates of cystic fibrosis transmembrane conductance regulator protein inhibitors and uses thereof |
| US7700567B2 (en) | 2005-09-29 | 2010-04-20 | Supergen, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| EP1759582A4 (en) * | 2004-05-26 | 2010-05-19 | Univ Kagawa Nat Univ Corp | PRESERVATIVE SOLUTION FOR CELLS, TISSUE AND ORGANS CONTAINING RARE SUGAR, AND CONSERVATION PROCESSES USING THIS SOLUTION |
| EP2097097A4 (en) * | 2006-12-01 | 2011-03-09 | Medarex Inc | CD22 Binding Human Antibodies and Their Use |
| US7919606B2 (en) | 2002-05-02 | 2011-04-05 | Ucb Pharma S.A. | Biological products |
| US8153768B2 (en) | 2002-05-02 | 2012-04-10 | Wyeth Holdings Corporation | Calicheamicin derivative-carrier conjugates |
| US9376500B2 (en) | 2009-06-03 | 2016-06-28 | Immunogen, Inc. | Conjugation methods |
| US9381205B2 (en) | 2013-11-04 | 2016-07-05 | Pfizer, Inc. | Anti-EFNA4 antibody-drug conjugates |
| US9381207B2 (en) | 2011-08-30 | 2016-07-05 | Astex Pharmaceuticals, Inc. | Drug formulations |
| US9393215B2 (en) | 2005-12-02 | 2016-07-19 | Novartis Ag | Nanoparticles for use in immunogenic compositions |
| US9428543B2 (en) | 2011-03-29 | 2016-08-30 | Immunogen, Inc. | Preparation of maytansinoid antibody conjugates by a one-step process |
| US9789204B2 (en) | 2005-08-24 | 2017-10-17 | Immunogen, Inc. | Process for preparing purified drug conjugates |
| RU2640197C1 (ru) * | 2013-11-04 | 2017-12-27 | Пфайзер Инк. | Промежуточные соединения и способы синтеза производных калихеамицина |
| US10035817B2 (en) | 2012-10-04 | 2018-07-31 | Immunogen, Inc. | Method of purifying cell-binding agent-cytotoxic agent conjugates with a PVDF membrane |
| US10485764B2 (en) | 2015-07-02 | 2019-11-26 | Otsuka Pharmaceutical Co., Ltd. | Lyophilized pharmaceutical compositions |
| WO2019232241A1 (en) * | 2018-05-30 | 2019-12-05 | Abbvie Stemcentrx Llc | Anti-sez6 antibody drug conjugates and methods of use |
| US10519190B2 (en) | 2017-08-03 | 2019-12-31 | Otsuka Pharmaceutical Co., Ltd. | Drug compound and purification methods thereof |
| EP3322485B1 (en) * | 2015-07-16 | 2020-07-01 | Case Western Reserve University | Plant virus particles for delivery of antimitotic agents |
| US10828366B2 (en) | 2015-04-22 | 2020-11-10 | Ucb Biopharma Sprl | Method of monomerisation of recombinant antibody molecules |
| US11167047B2 (en) | 2014-08-05 | 2021-11-09 | Case Western Reserve University | Coated plant virus imaging agents |
| US11260121B2 (en) | 2014-11-07 | 2022-03-01 | Case Western Reserve University | Cancer immunotherapy using virus particles |
| US11390853B2 (en) | 2019-04-26 | 2022-07-19 | Case Western Reserve University | Freeze dried viral nanoparticle constructs |
| US11433123B2 (en) | 2016-07-21 | 2022-09-06 | Case Western Reserve University | Sustained release cowpea mosaic virus or virus-like particle therapeutic constructs for the treatment of cancer |
| US11590183B2 (en) | 2017-03-10 | 2023-02-28 | Case Western Reserve University | Cancer immunotherapy using virus particles |
| US11654117B2 (en) | 2016-11-03 | 2023-05-23 | Case Western Reserve University | Melt processed viral nanoparticle constructs |
| US11672840B2 (en) | 2017-05-17 | 2023-06-13 | Case Western Reserve University | Anticancer trail-targeted plant virus particles |
| US11739301B2 (en) | 2017-10-27 | 2023-08-29 | Case Western Reserve University | Tymovirus virus and virus-like particles as nanocarriers for imaging and therapeutic agents |
| US11883505B2 (en) | 2015-06-29 | 2024-01-30 | Case Western Reserve University | Anticancer drug-containing plant virus particles |
| US11896676B2 (en) | 2019-08-07 | 2024-02-13 | Case Western Reserve University | Targeting cancer cells and tissue using filamentous plant virus particles |
| US11998594B2 (en) | 2014-04-02 | 2024-06-04 | Case Western Reserve University | Anti-cancer plant virus particles linked to HER2 antigens |
| US12203073B2 (en) | 2019-12-20 | 2025-01-21 | Case Western Reserve University | Plant viral RNA delivery nanoparticles and uses thereof |
| US12239721B2 (en) | 2019-12-20 | 2025-03-04 | Case Western Reserve University | Polydopamine decorated tobacco mosaic theranostic virus nanoparticles |
| US12359175B2 (en) | 2013-01-17 | 2025-07-15 | Case Western Reserve University | Viral nanoparticle multimers |
| US12433840B2 (en) | 2016-11-03 | 2025-10-07 | Case Western Reserve University | Melt processed viral nanoparticle constructs |
| US12465624B2 (en) | 2018-05-08 | 2025-11-11 | Case Western Reserve University | Cancer immunotherapy using virus particles and immune checkpoint therapy |
| US12599141B2 (en) | 2016-06-03 | 2026-04-14 | Case Western Reserve University | Rod-shaped plant viral nanoparticles or virus-like particles for agricultural applications |
Families Citing this family (114)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110045005A1 (en) * | 2001-10-19 | 2011-02-24 | Craig Crowley | Compositions and methods for the treatment of tumor of hematopoietic origin |
| TW200621282A (en) * | 2004-08-13 | 2006-07-01 | Wyeth Corp | Stabilizing formulations |
| US7335491B2 (en) | 2004-08-27 | 2008-02-26 | Wyeth Research Ireland Limited | Production of anti-abeta |
| TWI364458B (en) | 2004-08-27 | 2012-05-21 | Wyeth Res Ireland Ltd | Production of tnfr-lg |
| TWI384069B (zh) | 2004-08-27 | 2013-02-01 | Pfizer Ireland Pharmaceuticals | 多胜肽之製法 |
| CA2486285C (en) * | 2004-08-30 | 2017-03-07 | Viktor S. Goldmakher | Immunoconjugates targeting syndecan-1 expressing cells and use thereof |
| SV2007002227A (es) * | 2004-09-10 | 2007-03-20 | Wyeth Corp | Anticuerpos anti-5t4 humanizados y conjugados anticuerpo anti-5t4/calicheamicina ref. 040000-0317637 |
| EP1661584A1 (en) * | 2004-11-26 | 2006-05-31 | Heinz Dr. Faulstich | Use of conjugates of amatoxins and phallotoxins with macromolecules for cancer and inflammation therapy |
| US20110166319A1 (en) * | 2005-02-11 | 2011-07-07 | Immunogen, Inc. | Process for preparing purified drug conjugates |
| US7678832B2 (en) | 2005-08-16 | 2010-03-16 | Synta Pharmaceuticals Corp. | Bis(thio-hydrazide amide) formulation |
| DK2368914T3 (en) | 2006-03-10 | 2019-03-04 | Wyeth Llc | Anti-5T4 antibodies and uses thereof |
| ES2371085T3 (es) * | 2006-05-27 | 2011-12-27 | Faulstich, Heinz, Dr. | Utilización de conjugados de amatoxinas o falotoxinas con macromoléculas para la terapia tumoral y de la inflamación. |
| EP3255141B1 (en) | 2006-07-13 | 2021-12-01 | Wyeth LLC | Production of antibodies with improved glycosylation pattern |
| RU2475478C2 (ru) | 2006-08-21 | 2013-02-20 | Синта Фармасьютиклз Корп. | Соединения для лечения пролиферативных расстройств |
| EP2076287A2 (en) * | 2006-10-12 | 2009-07-08 | Wyeth | Methods and compositions with reduced opalescence |
| ES2541546T3 (es) | 2006-11-03 | 2015-07-21 | Wyeth Llc | Sustancias que inhiben la glucólisis en cultivo celular |
| EP2121750A2 (en) * | 2007-01-16 | 2009-11-25 | Wyeth | Inflammation treatment, detection and monitoring via trem-1 |
| AU2008223133A1 (en) | 2007-03-02 | 2008-09-12 | Wyeth | Use of copper and glutamate in cell culture for production of polypeptides |
| KR101547705B1 (ko) * | 2007-05-22 | 2015-08-26 | 와이어쓰 엘엘씨 | 히드라지드의 개선된 제조 방법 |
| PE20090309A1 (es) * | 2007-06-04 | 2009-04-18 | Wyeth Corp | Conjugado portador-caliqueamicina y un metodo de deteccion de caliqueamicina |
| DK2211904T3 (en) * | 2007-10-19 | 2016-10-24 | Seattle Genetics Inc | Cd19-binding agents and uses thereof |
| WO2009086072A2 (en) * | 2007-12-21 | 2009-07-09 | Genentech, Inc. | Therapy of rituximab-refractory rheumatoid arthritis patients |
| WO2009080832A1 (en) * | 2007-12-26 | 2009-07-02 | Biotest Ag | Methods and agents for improving targeting of cd138 expressing tumor cells |
| CN101965366B (zh) * | 2007-12-26 | 2016-04-27 | 生物测试股份公司 | 靶向cd138的免疫缀合物及其应用 |
| US9221914B2 (en) | 2007-12-26 | 2015-12-29 | Biotest Ag | Agents targeting CD138 and uses thereof |
| WO2009080831A1 (en) * | 2007-12-26 | 2009-07-02 | Biotest Ag | Method of decreasing cytotoxic side-effects and improving efficacy of immunoconjugates |
| US20090186026A1 (en) * | 2008-01-18 | 2009-07-23 | Wyeth | Ephrin and eph receptor agonists for modulation of bone formation and resorption |
| WO2009124109A1 (en) | 2008-04-04 | 2009-10-08 | The Government Of The U.S. A. As Represented By The Secretary Of The Dept. Of Health &Human Services | Human monoclonal antibodies specific for cd22 |
| FR2930443B1 (fr) | 2008-04-29 | 2010-06-25 | Oreal | Produit extemporane de soin a base d'un lyophilisat de microorganisme et de tensioactif(s) de hlb superieur ou egal a 12 |
| NZ610239A (en) * | 2008-04-30 | 2014-11-28 | Immunogen Inc | Cross-linkers and their uses |
| EP2533814A2 (en) * | 2010-02-11 | 2012-12-19 | Ablynx N.V. | Delivery of immunoglobulin variable domains and constructs thereof |
| WO2012019168A2 (en) | 2010-08-06 | 2012-02-09 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| JP2013535981A (ja) | 2010-08-20 | 2013-09-19 | ワイス・エルエルシー | 成長因子不含適合細胞の細胞培養 |
| EP2625189B1 (en) | 2010-10-01 | 2018-06-27 | ModernaTX, Inc. | Engineered nucleic acids and methods of use thereof |
| EP2637692A4 (en) | 2010-11-12 | 2014-09-10 | Scott & White Healthcare | ANTIBODIES TO THE ENDOTHELIAL TUMOR MARKER 8 |
| US8512679B2 (en) * | 2011-03-04 | 2013-08-20 | Elwha Llc | Glassy compositions |
| AU2012236099A1 (en) | 2011-03-31 | 2013-10-03 | Moderna Therapeutics, Inc. | Delivery and formulation of engineered nucleic acids |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| DE19216461T1 (de) | 2011-10-03 | 2021-10-07 | Modernatx, Inc. | Modifizierte nukleoside, nukleotide und nukleinsäuren und verwendungen davon |
| RU2663794C2 (ru) | 2011-10-21 | 2018-08-09 | Пфайзер Инк. | Добавление железа для улучшения культивирования клеток |
| KR20140100571A (ko) | 2011-12-08 | 2014-08-14 | 바이오테스트 아게 | Cd138을 타겟팅하는 면역접합체의 용도 |
| CA3018046A1 (en) | 2011-12-16 | 2013-06-20 | Moderna Therapeutics, Inc. | Modified nucleoside, nucleotide, and nucleic acid compositions |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| WO2013151665A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins associated with human disease |
| SG10201708959WA (en) | 2012-07-03 | 2017-11-29 | Univ Washington | Antibodies to tau |
| US8883979B2 (en) | 2012-08-31 | 2014-11-11 | Bayer Healthcare Llc | Anti-prolactin receptor antibody formulations |
| CA2891280C (en) | 2012-11-24 | 2018-03-20 | Hangzhou Dac Biotech Co., Ltd. | Hydrophilic linkers and their uses for conjugation of drugs to cell binding molecules |
| PL2922554T3 (pl) | 2012-11-26 | 2022-06-20 | Modernatx, Inc. | Na zmodyfikowany na końcach |
| US9089614B2 (en) | 2012-12-21 | 2015-07-28 | Bioalliance C.V. | Hydrophilic self-immolative linkers and conjugates thereof |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| BR112015027474A8 (pt) * | 2013-05-02 | 2018-01-23 | Hoffmann La Roche | anticorpo, composição, método de tratamento do paciente que sofre de câncer e uso de um anticorpo. |
| WO2015048744A2 (en) | 2013-09-30 | 2015-04-02 | Moderna Therapeutics, Inc. | Polynucleotides encoding immune modulating polypeptides |
| EP3052521A1 (en) | 2013-10-03 | 2016-08-10 | Moderna Therapeutics, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| US10464955B2 (en) | 2014-02-28 | 2019-11-05 | Hangzhou Dac Biotech Co., Ltd. | Charged linkers and their uses for conjugation |
| US10544395B2 (en) | 2014-03-19 | 2020-01-28 | Pfizer Inc. | Method of cell culture |
| US9950077B2 (en) | 2014-06-20 | 2018-04-24 | Bioalliance C.V. | Anti-folate receptor alpha (FRA) antibody-drug conjugates and methods of using thereof |
| TWI734975B (zh) | 2014-06-27 | 2021-08-01 | 美商C2N醫療診斷有限責任公司 | 人類化抗-tau抗體 |
| GB201412658D0 (en) | 2014-07-16 | 2014-08-27 | Ucb Biopharma Sprl | Molecules |
| JP6869187B2 (ja) | 2015-04-07 | 2021-05-12 | メモリアル スローン ケタリング キャンサー センター | ナノ粒子イムノコンジュゲート |
| KR20170139110A (ko) * | 2015-04-21 | 2017-12-18 | 애브비 스템센트알엑스 엘엘씨 | 칼리케아마이신 구성체 및 사용 방법 |
| US9708412B2 (en) | 2015-05-21 | 2017-07-18 | Harpoon Therapeutics, Inc. | Trispecific binding proteins and methods of use |
| NZ739830A (en) | 2015-07-12 | 2021-12-24 | Hangzhou Dac Biotech Co Ltd | Bridge linkers for conjugation of cell-binding molecules |
| US9839687B2 (en) | 2015-07-15 | 2017-12-12 | Suzhou M-Conj Biotech Co., Ltd. | Acetylenedicarboxyl linkers and their uses in specific conjugation of a cell-binding molecule |
| GB201601075D0 (en) | 2016-01-20 | 2016-03-02 | Ucb Biopharma Sprl | Antibodies molecules |
| GB201601077D0 (en) | 2016-01-20 | 2016-03-02 | Ucb Biopharma Sprl | Antibody molecule |
| GB201601073D0 (en) | 2016-01-20 | 2016-03-02 | Ucb Biopharma Sprl | Antibodies |
| JP7001585B2 (ja) | 2015-09-23 | 2022-02-04 | ファイザー・インク | 細胞および細胞培養の方法 |
| WO2017083224A1 (en) | 2015-11-09 | 2017-05-18 | Bristol-Myers Squibb Company | Methods to manipulate quality attributes of polypeptides produced in cho cells |
| IL260289B (en) | 2016-01-08 | 2022-08-01 | Bioalliance Cv | Tetravalent anti-psgl-1 antibodies and uses thereof |
| WO2017172907A1 (en) * | 2016-03-29 | 2017-10-05 | Sorrento Therapeutics, Inc. | Calicheamicin antibody drug conjugates linking an amidoacetyl group to a sugar moiety on calicheamicin |
| WO2017175086A1 (en) | 2016-04-05 | 2017-10-12 | Pfizer Inc. | Cell culture process |
| EP3493844A4 (en) | 2016-05-20 | 2021-03-24 | Harpoon Therapeutics Inc. | SINGLE DOMAIN SERUM ALBUMIN BINDING PROTEIN |
| US11623958B2 (en) | 2016-05-20 | 2023-04-11 | Harpoon Therapeutics, Inc. | Single chain variable fragment CD3 binding proteins |
| GB201610512D0 (en) | 2016-06-16 | 2016-08-03 | Autolus Ltd | Chimeric antigen receptor |
| KR20220150408A (ko) | 2016-11-14 | 2022-11-10 | 항저우 디에이씨 바이오테크 씨오, 엘티디 | 결합 링커, 그러한 결합 링커를 함유하는 세포 결합 분자-약물 결합체, 링커를 갖는 그러한 결합체의 제조 및 사용 |
| WO2018167621A1 (en) | 2017-03-16 | 2018-09-20 | Pfizer Inc. | Tyrosine prototrophy |
| EP3621994A4 (en) | 2017-05-12 | 2020-12-30 | Harpoon Therapeutics, Inc. | MESOTHELIN BINDING PROTEINS |
| JP2020533983A (ja) | 2017-09-15 | 2020-11-26 | ブリストル−マイヤーズ スクイブ カンパニーBristol−Myers Squibb Company | 目的のポリペプチドのラージスケールの製造間のオンラインバイオマス静電容量モニタリング |
| IL315737A (en) | 2017-10-13 | 2024-11-01 | Harpoon Therapeutics Inc | B-cell maturation antigen-binding proteins |
| MX2020003915A (es) | 2017-10-13 | 2020-10-08 | Harpoon Therapeutics Inc | Proteinas trispecificas y metodos de uso. |
| JP7462566B2 (ja) | 2018-03-16 | 2024-04-05 | ブリストル-マイヤーズ スクイブ カンパニー | タンパク質生産の間の代謝酵素活性およびジスルフィド結合還元 |
| CN110507824A (zh) * | 2018-05-21 | 2019-11-29 | 荣昌生物制药(烟台)有限公司 | 一种抗间皮素抗体及其抗体药物缀合物 |
| US12195544B2 (en) | 2018-09-21 | 2025-01-14 | Harpoon Therapeutics, Inc. | EGFR binding proteins and methods of use |
| US10815311B2 (en) | 2018-09-25 | 2020-10-27 | Harpoon Therapeutics, Inc. | DLL3 binding proteins and methods of use |
| JP7699542B2 (ja) | 2018-11-20 | 2025-06-27 | コーネル ユニバーシティー | 放射線核種の大環状錯体およびがんの放射線療法におけるそれらの使用 |
| EP3891292A1 (en) | 2018-12-06 | 2021-10-13 | Pfizer Inc. | Cells with reduced inhibitor production and methods of use thereof |
| AU2020221271A1 (en) * | 2019-02-13 | 2021-10-07 | Coimmune, Inc. | Cancer immunotherapy using combinations of cells expressing chimeric antigen receptors and monoclonal antibodies |
| CN113795264A (zh) | 2019-03-19 | 2021-12-14 | 瓦尔希伯伦私人肿瘤研究基金会 | 采用Omomyc和结合PD-1或CTLA-4的抗体治疗癌症的联合疗法 |
| US20220288219A1 (en) * | 2019-07-08 | 2022-09-15 | Mythic Therapeutics, Inc. | Antigen-binding protein constructs and uses thereof |
| WO2021024020A1 (en) | 2019-08-06 | 2021-02-11 | Astellas Pharma Inc. | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer |
| US20230071019A1 (en) * | 2019-12-04 | 2023-03-09 | The Research Foundation For The State University Of New York | Compositions and methods for reducing off-target toxicity of antibody drug conjugates |
| KR20230035576A (ko) | 2020-07-07 | 2023-03-14 | 비온테크 에스이 | Hpv 양성 암 치료용 rna |
| WO2022135666A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Treatment schedule for cytokine proteins |
| TW202245808A (zh) | 2020-12-21 | 2022-12-01 | 德商拜恩迪克公司 | 用於治療癌症之治療性rna |
| WO2022135667A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| CN112724263B (zh) * | 2021-04-02 | 2021-08-03 | 上海偌妥生物科技有限公司 | 改造抗cd20单克隆抗体以提高其药物疗效的方法及其应用 |
| CA3225254A1 (en) | 2021-07-13 | 2023-01-19 | BioNTech SE | Multispecific binding agents against cd40 and cd137 in combination therapy for cancer |
| TW202333802A (zh) | 2021-10-11 | 2023-09-01 | 德商拜恩迪克公司 | 用於肺癌之治療性rna(二) |
| EP4426727A2 (en) | 2021-11-03 | 2024-09-11 | Hangzhou Dac Biotech Co., Ltd. | Specific conjugation of an antibody |
| WO2023148598A1 (en) | 2022-02-02 | 2023-08-10 | Pfizer Inc. | Cysteine prototrophy |
| CN119855620A (zh) * | 2022-09-16 | 2025-04-18 | 国立研究开发法人量子科学技术研究开发机构 | 放射性医药组合物的中间体的制造方法、放射性医药组合物的中间体的纯化用试剂盒 |
| EP4608429A1 (en) | 2022-10-25 | 2025-09-03 | Peptomyc, S.L. | Combination therapy for the treatment of cancer |
| JP2026501506A (ja) | 2022-12-14 | 2026-01-16 | アステラス・ファーマ・ヨーロッパ・ベスローデン・フェンノートシャップ | Cldn18.2及びcd3に結合する二重特異性結合剤並びに免疫チェックポイント阻害剤を含む併用療法 |
| WO2024218706A1 (en) | 2023-04-21 | 2024-10-24 | Pfizer Inc. | Improved cells and cell cultures |
| IL324909A (en) | 2023-06-07 | 2026-01-01 | Fundaci? Privada Inst Dinvestigaci? Oncol?Gica De Vall Hebron | Combination therapy with mek inhibitors for the treatment of cancer |
| IL325025A (en) | 2023-06-07 | 2026-01-01 | Fundaci? Privada Inst Dinvestigaci? Oncol?Gica De Vall Hebron | Combination therapy with BRAF inhibitors for cancer treatment |
| EP4473974A1 (en) | 2023-06-07 | 2024-12-11 | Peptomyc, S.L. | Omomyc and kras inhibitors combination therapy for the treatment of cancer |
| KR20250043317A (ko) * | 2023-09-21 | 2025-03-28 | 주식회사 피노바이오 | 운반체-약물 접합체 및 dnmt-1 저해제의 병용 요법 |
| WO2026033885A1 (en) | 2024-08-08 | 2026-02-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2025120867A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and anti-vegfr2 antibodies |
| WO2025120866A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| TW202541837A (zh) | 2023-12-08 | 2025-11-01 | 日商安斯泰來製藥公司 | 含有結合至cldn18.2和cd3之雙特異性結合劑和穩定或增加cldn18.2表現之藥劑之組合療法 |
Family Cites Families (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4671958A (en) | 1982-03-09 | 1987-06-09 | Cytogen Corporation | Antibody conjugates for the delivery of compounds to target sites |
| US4970198A (en) | 1985-10-17 | 1990-11-13 | American Cyanamid Company | Antitumor antibiotics (LL-E33288 complex) |
| US5225539A (en) * | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US4771128A (en) * | 1986-10-10 | 1988-09-13 | Cetus Corporation | Method of purifying toxin conjugates using hydrophobic interaction chromatography |
| US5079233A (en) | 1987-01-30 | 1992-01-07 | American Cyanamid Company | N-acyl derivatives of the LL-E33288 antitumor antibiotics, composition and methods for using the same |
| US5037651A (en) | 1987-01-30 | 1991-08-06 | American Cyanamid Company | Dihydro derivatives of LL-E33288 antibiotics |
| US5053394A (en) | 1988-09-21 | 1991-10-01 | American Cyanamid Company | Targeted forms of methyltrithio antitumor agents |
| US5530101A (en) * | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5134075A (en) * | 1989-02-17 | 1992-07-28 | Oncogen Limited Partnership | Monoclonal antibody to novel antigen associated with human tumors |
| GB8928874D0 (en) * | 1989-12-21 | 1990-02-28 | Celltech Ltd | Humanised antibodies |
| DK0489149T3 (da) | 1990-06-27 | 2001-12-27 | Univ Princeton | Prober til påvisning af mutant P53 |
| CA2082160C (en) * | 1991-03-06 | 2003-05-06 | Mary M. Bendig | Humanised and chimeric monoclonal antibodies |
| US5714350A (en) * | 1992-03-09 | 1998-02-03 | Protein Design Labs, Inc. | Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region |
| US5686072A (en) * | 1992-06-17 | 1997-11-11 | Board Of Regents, The University Of Texas | Epitope-specific monoclonal antibodies and immunotoxins and uses thereof |
| US5484892A (en) * | 1993-05-21 | 1996-01-16 | Dana-Farber Cancer Institute, Inc. | Monoclonal antibodies that block ligand binding to the CD22 receptor in mature B cells |
| US6180377B1 (en) * | 1993-06-16 | 2001-01-30 | Celltech Therapeutics Limited | Humanized antibodies |
| US5436265A (en) * | 1993-11-12 | 1995-07-25 | Merck Frosst Canada, Inc. | 1-aroyl-3-indolyl alkanoic acids and derivatives thereof useful as anti-inflammatory agents |
| US5712474A (en) * | 1993-09-29 | 1998-01-27 | Canon Kabushiki Kaisha | Image processing apparatus for correcting blurring of an image photographed by a video camera |
| US6310185B1 (en) | 1994-03-08 | 2001-10-30 | Memorial Sloan Kettering Cancer Center | Recombinant human anti-Lewis Y antibodies |
| US5773001A (en) | 1994-06-03 | 1998-06-30 | American Cyanamid Company | Conjugates of methyltrithio antitumor agents and intermediates for their synthesis |
| ATE201445T1 (de) | 1994-08-12 | 2001-06-15 | Myriad Genetics Inc | Mutationen des mit 17q verbundenen ovarial- und brustkrebs empfindlichkeitsgens |
| DE69534530T2 (de) * | 1994-08-12 | 2006-07-06 | Immunomedics, Inc. | Für b-zell-lymphom und leukämiezellen spezifische immunkonjugate und humane antikörper |
| US5714586A (en) | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
| US5712374A (en) * | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
| US6267958B1 (en) * | 1995-07-27 | 2001-07-31 | Genentech, Inc. | Protein formulation |
| US7147851B1 (en) * | 1996-08-15 | 2006-12-12 | Millennium Pharmaceuticals, Inc. | Humanized immunoglobulin reactive with α4β7 integrin |
| US20020141990A1 (en) * | 1996-11-01 | 2002-10-03 | Smithkline Beecham Corporation | Anti-RSV human monoclonal antibodies |
| US5980898A (en) | 1996-11-14 | 1999-11-09 | The United States Of America As Represented By The U.S. Army Medical Research & Material Command | Adjuvant for transcutaneous immunization |
| US7541034B1 (en) * | 1997-03-20 | 2009-06-02 | The United States Of America As Represented By The Department Of Health And Human Services | Recombinant antibodies and immunoconjugates targeted to CD-22 bearing cells and tumors |
| US6306393B1 (en) * | 1997-03-24 | 2001-10-23 | Immunomedics, Inc. | Immunotherapy of B-cell malignancies using anti-CD22 antibodies |
| US6183744B1 (en) * | 1997-03-24 | 2001-02-06 | Immunomedics, Inc. | Immunotherapy of B-cell malignancies using anti-CD22 antibodies |
| CA2635352C (en) * | 1997-06-13 | 2012-09-11 | Genentech, Inc. | Stabilized antibody formulation |
| AT408613B (de) * | 1998-06-17 | 2002-01-25 | Immuno Ag | Pharmazeutisches faktor vii-präparat |
| US6183477B1 (en) * | 1998-09-04 | 2001-02-06 | Smith & Nephew, Inc. | Attachment tool for drill guide |
| KR100345463B1 (ko) * | 1998-11-19 | 2003-01-08 | 주)녹십자 | B형간염바이러스의표면항원프리-s1에대한인간화항체및이의제조방법 |
| JP2000226336A (ja) * | 1998-11-30 | 2000-08-15 | Sankyo Co Ltd | 免疫グロブリン製剤 |
| DK1137941T4 (da) | 1998-12-10 | 2014-01-06 | Brystol Myers Squibb Company | Protein-scaffolds til antistof-mimetika og andre bindingsproteiner |
| DE60042785D1 (de) * | 1999-06-09 | 2009-10-01 | Immunomedics Inc | Immuntherapie von autoimmunerkrankungen durch die verwendung von b-zell spezifischen antikörpern |
| DE60009926T2 (de) * | 1999-08-17 | 2005-04-07 | Novo Nordisk Health Care Ag | Stabilisierung von gefriergetrocknetem kuchen |
| SI1232392T1 (en) * | 1999-10-12 | 2003-10-31 | Connex Gesellschaft Zur Optimierung Von Forschung Und | Improved method for the detection of acid resistant bacteria of the genus helicobacter in stool |
| US20010046496A1 (en) * | 2000-04-14 | 2001-11-29 | Brettman Lee R. | Method of administering an antibody |
| GB0013810D0 (en) * | 2000-06-06 | 2000-07-26 | Celltech Chiroscience Ltd | Biological products |
| GB0210121D0 (en) * | 2002-05-02 | 2002-06-12 | Celltech R&D Ltd | Biological products |
| SG187991A1 (en) * | 2002-05-02 | 2013-03-28 | Wyeth Corp | Calicheamicin derivative-carrier conjugates |
-
2003
- 2003-05-02 SG SG2011035912A patent/SG187991A1/en unknown
- 2003-05-02 SI SI200332437T patent/SI2371392T1/sl unknown
- 2003-05-02 ES ES16180729T patent/ES2916174T3/es not_active Expired - Lifetime
- 2003-05-02 CA CA002483552A patent/CA2483552A1/en not_active Abandoned
- 2003-05-02 PT PT161807292T patent/PT3127553T/pt unknown
- 2003-05-02 BR BR122019027966A patent/BR122019027966B8/pt not_active IP Right Cessation
- 2003-05-02 NZ NZ573563A patent/NZ573563A/en not_active IP Right Cessation
- 2003-05-02 CA CA2871117A patent/CA2871117A1/en not_active Abandoned
- 2003-05-02 RU RU2004135101A patent/RU2422157C3/ru active Protection Beyond IP Right Term
- 2003-05-02 LT LTEP16180729.2T patent/LT3127553T/lt unknown
- 2003-05-02 PL PL410219A patent/PL224150B1/pl unknown
- 2003-05-02 WO PCT/US2003/013910 patent/WO2003092623A2/en not_active Ceased
- 2003-05-02 UA UA20041209865A patent/UA88599C2/ru unknown
- 2003-05-02 SI SI200332489A patent/SI1507556T1/sl unknown
- 2003-05-02 EP EP03724432.4A patent/EP1507556B1/en not_active Expired - Lifetime
- 2003-05-02 PL PL374523A patent/PL222725B1/pl unknown
- 2003-05-02 LT LTEP03724432.4T patent/LT1507556T/lt unknown
- 2003-05-02 SI SI200332621T patent/SI3127553T1/sl unknown
- 2003-05-02 NZ NZ586071A patent/NZ586071A/en not_active IP Right Cessation
- 2003-05-02 HU HUE03724432A patent/HUE030806T2/hu unknown
- 2003-05-02 PT PT37244324T patent/PT1507556T/pt unknown
- 2003-05-02 HU HUE11157981A patent/HUE027590T2/hu unknown
- 2003-05-02 ES ES03724432.4T patent/ES2593304T3/es not_active Expired - Lifetime
- 2003-05-02 EP EP16180729.2A patent/EP3127553B1/en not_active Expired - Lifetime
- 2003-05-02 KR KR1020117009631A patent/KR101125524B1/ko not_active Expired - Lifetime
- 2003-05-02 BR BR122019027974-8A patent/BR122019027974B1/pt not_active IP Right Cessation
- 2003-05-02 JP JP2004500808A patent/JP5153057B2/ja not_active Expired - Lifetime
- 2003-05-02 AU AU2003231293A patent/AU2003231293A1/en not_active Abandoned
- 2003-05-02 PL PL411824A patent/PL224844B1/pl unknown
- 2003-05-02 HU HUE16180729A patent/HUE057124T2/hu unknown
- 2003-05-02 TW TW092112147A patent/TWI379693B/zh not_active IP Right Cessation
- 2003-05-02 DK DK16180729.2T patent/DK3127553T3/da active
- 2003-05-02 PT PT111579819T patent/PT2371392E/pt unknown
- 2003-05-02 MX MXPA04010792A patent/MXPA04010792A/es active IP Right Grant
- 2003-05-02 SG SG10201700289RA patent/SG10201700289RA/en unknown
- 2003-05-02 EP EP11157981.9A patent/EP2371392B1/en not_active Expired - Lifetime
- 2003-05-02 DK DK11157981.9T patent/DK2371392T3/en active
- 2003-05-02 CN CNB038152606A patent/CN100482277C/zh not_active Expired - Lifetime
- 2003-05-02 TW TW101100850A patent/TWI438010B/zh not_active IP Right Cessation
- 2003-05-02 DK DK03724432.4T patent/DK1507556T3/en active
- 2003-05-02 US US10/428,894 patent/US8153768B2/en active Active
- 2003-05-02 SG SG200607459-5A patent/SG165158A1/en unknown
- 2003-05-02 BR BRPI0309868A patent/BRPI0309868B8/pt not_active IP Right Cessation
- 2003-05-02 ES ES11157981.9T patent/ES2545745T3/es not_active Expired - Lifetime
- 2003-05-02 KR KR1020047017670A patent/KR101062628B1/ko not_active Expired - Lifetime
- 2003-05-02 PL PL413302A patent/PL228741B1/pl unknown
- 2003-05-02 PL PL410218A patent/PL224001B1/pl unknown
- 2003-11-03 US US10/699,874 patent/US8747857B2/en active Active
-
2004
- 2004-10-28 NO NO20044663A patent/NO339730B1/no not_active IP Right Cessation
- 2004-10-28 CR CR7557A patent/CR7557A/es not_active Application Discontinuation
- 2004-11-01 IL IL164946A patent/IL164946A/en active Protection Beyond IP Right Term
- 2004-11-22 EC EC2004005445A patent/ECSP045445A/es unknown
- 2004-12-01 ZA ZA200409752A patent/ZA200409752B/xx unknown
-
2009
- 2009-06-26 AU AU2009202609A patent/AU2009202609B2/en active Active
-
2010
- 2010-05-31 ZA ZA2010/03874A patent/ZA201003874B/en unknown
-
2011
- 2011-03-09 RU RU2011108928A patent/RU2602878C3/ru active Protection Beyond IP Right Term
- 2011-09-29 JP JP2011215042A patent/JP5441971B2/ja not_active Expired - Lifetime
-
2012
- 2012-02-13 US US13/372,172 patent/US8835611B2/en not_active Expired - Lifetime
- 2012-07-02 CR CR20120364A patent/CR20120364A/es unknown
-
2013
- 2013-03-26 JP JP2013064065A patent/JP5756489B2/ja not_active Expired - Lifetime
- 2013-06-06 PH PH12013501158A patent/PH12013501158A1/en unknown
- 2013-06-06 PH PH12013501159A patent/PH12013501159A1/en unknown
- 2013-08-09 CR CR20130390A patent/CR20130390A/es unknown
-
2014
- 2014-01-26 IL IL230659A patent/IL230659A/en active IP Right Grant
- 2014-03-07 US US14/201,184 patent/US9351986B2/en not_active Expired - Fee Related
- 2014-12-18 JP JP2014256667A patent/JP2015061875A/ja active Pending
-
2015
- 2015-08-21 CY CY20151100732T patent/CY1116634T1/el unknown
-
2016
- 2016-05-03 US US15/145,238 patent/US20160303252A1/en not_active Abandoned
- 2016-09-05 CY CY20161100872T patent/CY1117973T1/el unknown
- 2016-09-08 NO NO20161431A patent/NO344509B1/no not_active IP Right Cessation
- 2016-10-24 RU RU2016141576A patent/RU2678818C2/ru active
-
2017
- 2017-01-26 JP JP2017011948A patent/JP6872376B2/ja not_active Expired - Lifetime
- 2017-10-25 HU HUS1700038C patent/HUS1700038I1/hu unknown
- 2017-10-25 LU LU00044C patent/LUC00044I2/fr unknown
- 2017-10-31 NL NL300903C patent/NL300903I2/nl unknown
- 2017-11-03 CY CY2017035C patent/CY2017035I1/el unknown
- 2017-11-08 LT LTPA2017036C patent/LTC2371392I2/lt unknown
- 2017-11-16 BE BE2017C049C patent/BE2017C049I2/fr unknown
- 2017-11-21 NO NO2017061C patent/NO2017061I1/no unknown
- 2017-11-30 FR FR17C1054C patent/FR17C1054I2/fr active Active
-
2018
- 2018-07-30 US US16/048,511 patent/US20180339058A1/en not_active Abandoned
-
2022
- 2022-01-14 CY CY20221100035T patent/CY1124900T1/el unknown
Non-Patent Citations (1)
| Title |
|---|
| None |
Cited By (77)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7276228B2 (en) | 2001-04-24 | 2007-10-02 | Supergen, Inc. | Methods for treating hematological disorders through inhibition of DNA methylation and histone deacetylase |
| US8153768B2 (en) | 2002-05-02 | 2012-04-10 | Wyeth Holdings Corporation | Calicheamicin derivative-carrier conjugates |
| US8747857B2 (en) | 2002-05-02 | 2014-06-10 | Wyeth Holdings Llc | Calicheamicin derivative-carrier conjugates |
| US7919606B2 (en) | 2002-05-02 | 2011-04-05 | Ucb Pharma S.A. | Biological products |
| US8895714B2 (en) | 2002-05-02 | 2014-11-25 | Ucb Pharma S.A. | Biological products |
| WO2005089808A3 (en) * | 2004-03-15 | 2006-08-03 | Wyeth Corp | Antibody calicheamicin conjugates |
| WO2005089809A3 (en) * | 2004-03-15 | 2006-05-04 | Wyeth Corp | Calicheamicin conjugation by antibody deglycosylation |
| WO2005089807A3 (en) * | 2004-03-15 | 2006-09-14 | Wyeth Corp | Antibody calicheamicin conjugates for passive targeting |
| EP1759582A4 (en) * | 2004-05-26 | 2010-05-19 | Univ Kagawa Nat Univ Corp | PRESERVATIVE SOLUTION FOR CELLS, TISSUE AND ORGANS CONTAINING RARE SUGAR, AND CONSERVATION PROCESSES USING THIS SOLUTION |
| US7250416B2 (en) | 2005-03-11 | 2007-07-31 | Supergen, Inc. | Azacytosine analogs and derivatives |
| WO2007005690A1 (en) * | 2005-07-01 | 2007-01-11 | Wyeth | Methods of determining pharmacokinetics of targeted therapies |
| US9789204B2 (en) | 2005-08-24 | 2017-10-17 | Immunogen, Inc. | Process for preparing purified drug conjugates |
| US11471536B2 (en) | 2005-08-24 | 2022-10-18 | Immunogen, Inc. | Process for preparing purified drug conjugates |
| US8461123B2 (en) | 2005-09-29 | 2013-06-11 | Astex Pharmaceuticals, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| US9358248B2 (en) | 2005-09-29 | 2016-06-07 | Astex Pharmaceuticals, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| US10933079B2 (en) | 2005-09-29 | 2021-03-02 | Astex Pharmaceuticals, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| US7700567B2 (en) | 2005-09-29 | 2010-04-20 | Supergen, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| US10456415B2 (en) | 2005-09-29 | 2019-10-29 | Astex Pharmaceuticals, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| US9480698B2 (en) | 2005-09-29 | 2016-11-01 | Astex Pharmaceuticals, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| US9393215B2 (en) | 2005-12-02 | 2016-07-19 | Novartis Ag | Nanoparticles for use in immunogenic compositions |
| WO2007067602A1 (en) * | 2005-12-06 | 2007-06-14 | Wyeth | Interleukin-11 compositions and methods of use |
| US8481683B2 (en) | 2006-12-01 | 2013-07-09 | Medarex, Inc. | Human antibodies that bind CD22 and uses thereof |
| EP2097097A4 (en) * | 2006-12-01 | 2011-03-09 | Medarex Inc | CD22 Binding Human Antibodies and Their Use |
| US9499632B2 (en) | 2006-12-01 | 2016-11-22 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind CD22 and uses thereof |
| EP2117601A2 (en) * | 2006-12-22 | 2009-11-18 | The Regents of the University of California | Macromolecular conjugates of cystic fibrosis transmembrane conductance regulator protein inhibitors and uses thereof |
| US9771432B2 (en) | 2009-06-03 | 2017-09-26 | Immunogen, Inc. | Conjugation methods |
| US9376500B2 (en) | 2009-06-03 | 2016-06-28 | Immunogen, Inc. | Conjugation methods |
| US10815309B2 (en) | 2009-06-03 | 2020-10-27 | Immunogen, Inc. | Methods for preparing antibody-drug conjugates |
| US10233257B2 (en) | 2009-06-03 | 2019-03-19 | Immunogen, Inc. | Methods for preparing antibody-drug conjugates |
| RU2765240C2 (ru) * | 2009-06-03 | 2022-01-27 | Иммьюноджен, Инк. | Способы конъюгации |
| US11498979B2 (en) | 2009-06-03 | 2022-11-15 | Immunogen, Inc. | Methods for preparing a purified maytansinoid conjugate in a solution |
| US9428543B2 (en) | 2011-03-29 | 2016-08-30 | Immunogen, Inc. | Preparation of maytansinoid antibody conjugates by a one-step process |
| US11090390B2 (en) | 2011-03-29 | 2021-08-17 | Immunogen, Inc. | Preparation of maytansinoid antibody conjugates by a one-step process |
| US9914748B2 (en) | 2011-03-29 | 2018-03-13 | Immunogen, Inc. | Preparation of maytansinoid antibody conjugates by a one-step process |
| US11744900B2 (en) | 2011-03-29 | 2023-09-05 | Immunogen, Inc. | Preparation of maytansinoid antibody conjugates by a one-step process |
| US10435432B2 (en) | 2011-03-29 | 2019-10-08 | Immunogen, Inc. | Preparation of maytansinoid antibody conjugates by a one-step process |
| US9913856B2 (en) | 2011-08-30 | 2018-03-13 | Astex Pharmaceuticals, Inc. | Drug formulations |
| US10517886B2 (en) | 2011-08-30 | 2019-12-31 | Astex Pharmaceuticals, Inc. | Drug formulations |
| US9381207B2 (en) | 2011-08-30 | 2016-07-05 | Astex Pharmaceuticals, Inc. | Drug formulations |
| US10035817B2 (en) | 2012-10-04 | 2018-07-31 | Immunogen, Inc. | Method of purifying cell-binding agent-cytotoxic agent conjugates with a PVDF membrane |
| US12359175B2 (en) | 2013-01-17 | 2025-07-15 | Case Western Reserve University | Viral nanoparticle multimers |
| US9381205B2 (en) | 2013-11-04 | 2016-07-05 | Pfizer, Inc. | Anti-EFNA4 antibody-drug conjugates |
| US9872922B2 (en) | 2013-11-04 | 2018-01-23 | Pfizer Inc. | Anti-EFNA4 antibody-drug conjugates |
| RU2640197C1 (ru) * | 2013-11-04 | 2017-12-27 | Пфайзер Инк. | Промежуточные соединения и способы синтеза производных калихеамицина |
| US11998594B2 (en) | 2014-04-02 | 2024-06-04 | Case Western Reserve University | Anti-cancer plant virus particles linked to HER2 antigens |
| US11167047B2 (en) | 2014-08-05 | 2021-11-09 | Case Western Reserve University | Coated plant virus imaging agents |
| US11730833B2 (en) | 2014-08-05 | 2023-08-22 | Case Western University | Coated plant virus imaging agents |
| US11260121B2 (en) | 2014-11-07 | 2022-03-01 | Case Western Reserve University | Cancer immunotherapy using virus particles |
| US11730803B2 (en) | 2014-11-07 | 2023-08-22 | Case Western Reserve University | Cancer immunotherapy using virus particles |
| US11786593B2 (en) | 2015-04-22 | 2023-10-17 | UCB Biopharma SRL | Method of monomerisation of recombinant antibody molecules |
| US10828366B2 (en) | 2015-04-22 | 2020-11-10 | Ucb Biopharma Sprl | Method of monomerisation of recombinant antibody molecules |
| US11883505B2 (en) | 2015-06-29 | 2024-01-30 | Case Western Reserve University | Anticancer drug-containing plant virus particles |
| US10485764B2 (en) | 2015-07-02 | 2019-11-26 | Otsuka Pharmaceutical Co., Ltd. | Lyophilized pharmaceutical compositions |
| EP3322485B1 (en) * | 2015-07-16 | 2020-07-01 | Case Western Reserve University | Plant virus particles for delivery of antimitotic agents |
| EP3725332A1 (en) * | 2015-07-16 | 2020-10-21 | Case Western Reserve University | Plant virus particles for delivery of antimitotic agents |
| US11738090B2 (en) | 2015-07-16 | 2023-08-29 | Case Western Reserve University | Plant virus particles for delivery of antimitotic agents |
| US11253610B2 (en) | 2015-07-16 | 2022-02-22 | Case Western Reserve University | Plant virus particles for delivery of antimitotic agents |
| US12599141B2 (en) | 2016-06-03 | 2026-04-14 | Case Western Reserve University | Rod-shaped plant viral nanoparticles or virus-like particles for agricultural applications |
| US11433123B2 (en) | 2016-07-21 | 2022-09-06 | Case Western Reserve University | Sustained release cowpea mosaic virus or virus-like particle therapeutic constructs for the treatment of cancer |
| US12186279B2 (en) | 2016-07-21 | 2025-01-07 | Case Western Reserve University | Sustained release cowpea mosaic virus or virus-like particle therapeutic constructs for the treatment of cancer |
| US11654117B2 (en) | 2016-11-03 | 2023-05-23 | Case Western Reserve University | Melt processed viral nanoparticle constructs |
| US12433840B2 (en) | 2016-11-03 | 2025-10-07 | Case Western Reserve University | Melt processed viral nanoparticle constructs |
| US12156947B2 (en) | 2016-11-03 | 2024-12-03 | Case Western Reserve University | Melt processed viral nanoparticle constructs |
| US11590183B2 (en) | 2017-03-10 | 2023-02-28 | Case Western Reserve University | Cancer immunotherapy using virus particles |
| US12251410B2 (en) | 2017-05-17 | 2025-03-18 | Case Western Reserve University | Anticancer trail-targeted plant virus particles |
| US11672840B2 (en) | 2017-05-17 | 2023-06-13 | Case Western Reserve University | Anticancer trail-targeted plant virus particles |
| US10519190B2 (en) | 2017-08-03 | 2019-12-31 | Otsuka Pharmaceutical Co., Ltd. | Drug compound and purification methods thereof |
| US11739301B2 (en) | 2017-10-27 | 2023-08-29 | Case Western Reserve University | Tymovirus virus and virus-like particles as nanocarriers for imaging and therapeutic agents |
| US12465624B2 (en) | 2018-05-08 | 2025-11-11 | Case Western Reserve University | Cancer immunotherapy using virus particles and immune checkpoint therapy |
| EP3858863A1 (en) * | 2018-05-30 | 2021-08-04 | AbbVie Stemcentrx LLC | Anti-sez6 antibody drug conjugates and methods of use |
| WO2019232241A1 (en) * | 2018-05-30 | 2019-12-05 | Abbvie Stemcentrx Llc | Anti-sez6 antibody drug conjugates and methods of use |
| US11077203B2 (en) | 2018-05-30 | 2021-08-03 | Abbvie Stemcentrx Llc | Anti-SEZ6 antibody drug conjugates and methods of use |
| US11390853B2 (en) | 2019-04-26 | 2022-07-19 | Case Western Reserve University | Freeze dried viral nanoparticle constructs |
| US11896676B2 (en) | 2019-08-07 | 2024-02-13 | Case Western Reserve University | Targeting cancer cells and tissue using filamentous plant virus particles |
| US12433955B2 (en) | 2019-08-07 | 2025-10-07 | Case Western Reserve University | Targeting cancer cells and tissue using filamentous plant virus particles |
| US12239721B2 (en) | 2019-12-20 | 2025-03-04 | Case Western Reserve University | Polydopamine decorated tobacco mosaic theranostic virus nanoparticles |
| US12203073B2 (en) | 2019-12-20 | 2025-01-21 | Case Western Reserve University | Plant viral RNA delivery nanoparticles and uses thereof |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2371392B1 (en) | Calicheamicin derivative-carrier conjugates | |
| AU2017204487B2 (en) | Calicheamicin derivative-carrier conjugates | |
| AU2012244218C1 (en) | Calicheamicin derivative-carrier conjugates | |
| HK1233519A (en) | Calicheamicin derivative-carrier conjugates | |
| HK1233519A1 (en) | Calicheamicin derivative-carrier conjugates | |
| HK1233519B (en) | Calicheamicin derivative-carrier conjugates | |
| HK1162926B (en) | Calicheamicin derivative-carrier conjugates | |
| HK1070825B (en) | Calicheamicin derivative-carrier conjugates | |
| NZ734179A (en) | Calicheamicin derivative-carrier conjugates |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 1-2004-501761 Country of ref document: PH |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2483552 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2004/010792 Country of ref document: MX Ref document number: 04109443 Country of ref document: CO |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004500808 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 374523 Country of ref document: PL Ref document number: 1020047017670 Country of ref document: KR |
|
| REEP | Request for entry into the european phase |
Ref document number: 2003724432 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003724432 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1802/KOLNP/2004 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200409752 Country of ref document: ZA Ref document number: 2003231293 Country of ref document: AU Ref document number: 536928 Country of ref document: NZ |
|
| ENP | Entry into the national phase |
Ref document number: 2004135101 Country of ref document: RU Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1200401282 Country of ref document: VN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20038152606 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020047017670 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003724432 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: PI0309868 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: CR2012-000364 Country of ref document: CR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: CR2013-000390 Country of ref document: CR Ref document number: CR2013-000391 Country of ref document: CR Ref document number: CR2013-000388 Country of ref document: CR |