WO2002094202A2 - Methods for protecting allogeneic islet transplant using soluble ctla4 mutant molecules - Google Patents
Methods for protecting allogeneic islet transplant using soluble ctla4 mutant molecules Download PDFInfo
- Publication number
- WO2002094202A2 WO2002094202A2 PCT/US2002/016708 US0216708W WO02094202A2 WO 2002094202 A2 WO2002094202 A2 WO 2002094202A2 US 0216708 W US0216708 W US 0216708W WO 02094202 A2 WO02094202 A2 WO 02094202A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ctla4
- cells
- subject
- molecule
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70521—CD28, CD152
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
- A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39541—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against normal tissues, cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/12—Keratolytics, e.g. wart or anti-corn preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2866—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
Definitions
- the present invention relates generally to the field of inhibiting islet cell transplant rejection, h particular, the invention relates to methods for treating diabetes, including type-1 and type-2 diabetes, by administering to a subject an effective amount of soluble CTLA4 mutant molecules.
- Organ transplantation has emerged as a preferred method of treatment for many forms of life-threatening diseases that involve organ damage. Improved results in clinical transplantation have been achieved primarily through the development of increasingly potent non-specific immunosuppressive drugs to inhibit rejection responses (Lancet, 345:1321-1325 (1995)). While short-term results have improved, long-term outcomes remain inadequate. Currently, life-long immunosuppressive agents are required to combat chronic rejection of the transplanted organ, and the use of these agents dramatically increases the risks of cardiovascular disease, infections and malignancies.
- IDDM Insulin-dependent diabetes mellitus
- IDDM insulin replacement
- a steroid-free immunosuppressive protocol (“Edmonton protocol”) that includes sirolimus, low dose Tarcolimus, and a monoclonal antibody (mAb) against IL-2 receptor has been used in a trial of islet transplantation alone for patients with type-1 diabetes (Shapiro, A.M.J. et al, (2000), N. Eng. J. Med., 343: 230-238). '
- the present invention provides methods for treating immune system diseases, by administering to a subject soluble CTLA4 mutant molecules, which bind to CD80 and/or CD86 molecules on CD80 and or CD86-positive cells, thereby inhibiting endogenous CD80 and/or CD86 molecules from binding CTLA4 and/or CD28 on T cells, and thus, blocking key T cell costimulatory signals, in particular the CD28 pathway.
- Soluble CTLA4 mutant molecules include, but are not limited to, L104EA29Y, a molecule having mutations in the extracellular domain of CTLA4 at alanine at position +29 and/or at leucine at position +104, wherein alanine at position 29 is substituted with tyrosine, and leucine at position 104 is substituted with glutamic acid.
- the CTLA4 mutant molecules further comprise a moiety, such as an immunoglobulin molecule, that renders the mutant protein soluble.
- the L104EA29Y is L104EA29YIg ( Figure 3).
- the present invention further provides methods for inhibiting islet cell transplant rejection in a subject by administering L104EA29Y (e.g., L104EA29YIg) to the subject undergoing islet cell transplant.
- L104EA29Y e.g., L104EA29YIg
- the invention also provides methods for treating diabetes in a subject, by administering an immunosuppressive regimen comprising L104EA29Y (e.g., L104EA29YIg) to the subject diagnosed with diabetes and transplanting islet cells.
- an immunosuppressive regimen comprising L104EA29Y (e.g., L104EA29YIg) to the subject diagnosed with diabetes and transplanting islet cells.
- the present invention further provides pharmaceutical compositions for treating diabetes, the compositions comprising a pharmaceutically acceptable carrier and soluble CTLA4 mutant, e.g., L104EA29Y.
- Figure 1 depicts the complete nucleotide (SEQ ID NO.: 1) and amino acid sequence (SEQ ID NO.: 2) for human CTLA4 receptor fused to the oncostatin M signal peptide.
- the oncostatin M signal peptide is indicated at position -25 to -1.
- Figure 2 depicts a nucleotide (SEQ ID NO.: 3) and amino acid sequence (SEQ ID NO.: 4) of a CTLA4Ig having a signal peptide; a wild type amino acid sequence of the extracellular domain of CTLA4 starting at methionine at position +1 to aspartic acid at position +124, or starting at alanine at position -1 to aspartic acid at position +124; and an Ig region.
- Figure 3 depicts a nucleotide (SEQ ID NO.: 5) and amino acid sequence (SEQ ID NO.: 6) of a CTLA4 mutant molecule (L104EA29YIg) comprising a signal peptide; a mutated extracellular domain of CTLA4 starting at methionine at position +1 and ending at aspartic acid at position +124, or starting at alanine at position -1 and ending at aspartic acid at position +124; and an Ig region as described in Example 1, infra.
- Figure 4 is a line graph illustrating fasting plasma glucose level in a normal subject, as described in Example 3, infra.
- Figure 5 is a line graph illustrating fasting plasma glucose level in pancreatectomized subjects with transplanted pancreatic islet cells as described in Example 3.
- the ammals were transplanted with islet cells on day 0, and either treated with an immunosuppressive regimen containing L104EA29YIg, and a base immunosuppressive regimen (treated), or only a base immunosuppressive regimen (control).
- the base immnuosuppressive regimen contained rapamycin and anti-human IL2R.
- Figure 6 is a line graph illustrating insulin requirement in subjects with transplanted islet cells as described in Example 3.
- the animals were transplanted with islet cells on day 0, and were treated with an immunosuppressive regimen containing L104EA29YIg and a base immunosuppressive regimen (treated), or only a base immunosuppressive regimen (control).
- Figure 7 is a line graph illustrating blood glucose level in an intravenous glucose tolerance test pre- and post- islet transplant, as described in Example 3.
- Figure 8 depicts a schematic diagram of a vector, piLN-L104EA29Y, having the L104EA29YIg insert.
- Figures 9A & 9B illustrate data from FACS assays showing binding of L104EA29YIg, L104EIg, and CTLA4Ig to human CD80- or CD86-transfected CHO cells as described in Example 2, infra.
- Figures 10A & 10B depicts inhibition of proliferation of CD80-positive and CD86- positive CHO cells as described in Example 2, infra.
- Figures 11A & 11B shows that L104EA29YIg is more effective than CTLA4Ig at inhibiting proliferation of primary and secondary allostimulated T cells as described in Example 2, infra.
- Figures 12A-C illustrate that L104EA29YIg is more effective than CTLA4Ig at inhibiting IL-2 (FIG. 12A), J -4 (FIG. 12B), and ⁇ -interferon (FIG. 12C) cytokine production of allostimulated human T cells as described in Example 2, infra.
- Figure 13 demonstrates that L104EA29YIg is more effective than CTLA4Ig at inhibiting proliferation of phytohemaglutmin- (PHA) stimulated monkey T cells as described in Example 2, infra.
- PHA phytohemaglutmin-
- Figures 14A-C are an SDS gel (FIG. 14A) for CTLA4Ig (lane 1), L104EIg (lane 2), and L104EA29YIg (lane 3A); and size exclusion chromatographs of CTLA4Ig (FIG. 14B) and L104EA29YIg (FIG. 14C).
- FIG. 15A and 15B illustrate a ribbon diagram of the CTLA4 extracellular Ig V-like fold generated from the solution structure determined by NMR spectroscopy.
- FIG. 15B shows an expanded view of the S25-R33 region and the MYPPPY region indicating the location and side-chain orientation of the avidity enhancing mutations, LI 04 and A29.
- Figure 16 depicts fasting blood glucose for LEA29YIg treated (A) and control (B) recipients of allogeneic islets (representative animals) before and after transplantation. All animals underwent surgical pancreatectomy at least 2 weeks before transplantation (mean pretransplant insulin requirement of 8.76 + 0.18 units/day)
- C After intraportal infusion of allogeneic islets, recipients quickly became euglycemic requiring no exogenous insulin posttransplant.
- D Diabetes induction and posttransplant islet function was confirmed by intravenous glucose tolerance test before transplantation and at 1 month and 3 months posttransplant, as described in Example 3, infra.
- Figure 17 depicts (A) immunohistology of functional transplanted islet confirmed by positive staining for insulin.
- B islet from an animal receiving control regimen surrounded by mononuclear infiltrate, indicating rejection, as described in Example 3, infra.
- Figure 18 depicts suppression of anti-donor T- and B- cell responses by L104EA29Y regimen.
- A Anti-donor IFN- ⁇ -ELISpot response corresponds to timing of rejection in the controls ( ⁇ 1 week posttransplant).
- B L104EA29Y regimen effectively suppresses the generation of anti-donor T cell response.
- C animals receiving rapamycin anti-IL-2R mAb quickly produce detectable anti-donor antibody, as measured by flow cytometric methods at the time of rejection.
- islet recipients receiving the L104EA29Y- containing regimen fail to generate a detectable anti-donor antibody response while treated, as described in Example 3, infra.
- Figure 19 shows the nucleotide and amino acid sequences of L104EIg (SEQ ID NOs.: 7- 8), as described in Example 2, infra.
- Figure 20 shows the nucleotide and amino acid sequence of L104EA29LIg (SEQ ID NOs.: 9-10).
- Figure 21 shows the nucleotide and amino acid sequences of L104EA29TIg (SEQ ID NOs.: 11-12).
- Figure 22 shows the nucleotide and amino acid sequences of L104EA29WIg (SEQ ID NOs.: 13-14).
- Figure 23 shows the nucleotide sequence of a CTLA4Ig (SEQ ID NO.: 15) having a signal peptide; a wild type amino acid sequence of the extracellular domain of CTLA4 starting at methionine at position +1 to aspartic acid at position +124, or starting at alanine at position -1 to aspartic acid at position +124; and an Ig region.
- Figure 24 shows the amino acid sequence of a CTLA4Ig (SEQ ID NO.: 16) having a signal peptide; a wild type amino acid sequence of the extracellular domain of CTLA4 starting at methionine at position +1 to aspartic acid at position +124, or starting at alanine at position -1 to aspartic acid at position +124; and an Ig region.
- wild type CTLA4 has the amino acid sequence of naturally occurring, full length CTLA4 (U.S. Patent Nos. 5,434,131, 5,844,095, 5,851,795), or any portion thereof which binds a B7 molecule (CD80 and/or CD86), or interferes with a B7 molecule (e.g., CD80 and/or CD86) so that it blocks their binding to their ligand, or blocks their binding to the extracellular domain of CTLA4 or portions thereof.
- wild type CTLA4 begins with methionine at position +1 and ends at aspartic acid at position +124, or wild type CTLA4 begins with alanine at position -1 and ends at aspartic acid at position +124.
- wild type CTLA4 consists of the 187 amino acids of the CTLA4 receptor as disclosed in FIG. 3 of U.S. Pat. Nos. 5,434,131, 5,844,095, 5,851,795, and shown here as Figure 1.
- Wild type CTLA4 is a cell surface protein, having an N-terminal extracellular domain, a transmembrane domain, and a C-terminal cytoplasmic domain. The extracellular domain binds to target antigens, such as CD80 and CD86.
- target antigens such as CD80 and CD86.
- the naturally occurring, wild type CTLA4 protein is translated as an immature polypeptide, which includes a signal peptide at the N-terminal end.
- the immature polypeptide undergoes post-translational processing, which includes cleavage and removal of the signal peptide to generate a CTLA4 cleavage product having a newly generated N-terminal end that differs from the N-terminal end in the immature form.
- post-translational processing includes cleavage and removal of the signal peptide to generate a CTLA4 cleavage product having a newly generated N-terminal end that differs from the N-terminal end in the immature form.
- additional post-translational processing may occur, which removes one or more of the amino acids from the newly generated N-terminal end of the CTLA4 cleavage product.
- the mature form of the CTLA4 molecule includes the extracellular domain of CTLA4, or any portion thereof, which binds to CD80 and/or CD86.
- the extracellular domain of CTLA4 is the portion of the CTLA4 receptor that extends outside the cell membrane, and includes any portion of CTLA4 that extends outside the cell membrane that recognizes and binds CTLA4 ligands, such as a B7 molecule (e.g., CD80 and/or CD86 molecules).
- a B7 molecule e.g., CD80 and/or CD86 molecules.
- an extracellular domain of CTLA4 comprises methiomne at position +1 to aspartic acid at position +124 ( Figure 2).
- an extracellular domain of CTLA4 comprises alanine at position +1 to aspartic acid at position +125 ( Figure 1).
- the extracellular domain includes fragments or derivatives of CTLA4 that bind a B7 molecule (e.g., CD80 and/or CD86).
- non-CTLA4 protein sequence or “non-CTLA4 molecule” is defined as any molecule that does not bind CD80 and/or CD86 and does not interfere with the binding of CTLA4 to its target.
- An example includes, but is not limited to, an immunoglobulin (Ig) constant region or portion thereof.
- the Ig constant region is a human or monkey Ig constant region, e.g., human C(gamma)l, including the hinge, CH2 and CH3 regions.
- the Ig constant region can be mutated to reduce its effector functions (U.S. Patent Nos: 5,637,481; and 6,090,914).
- soluble refers to any molecule, or fragments and derivatives thereof, not bound or attached to a cell, i.e., circulating.
- CTLA4, L104EA29YIg, B7 or CD28 can be made soluble by attaching an immunoglobulin (Ig) moiety to the extracellular domain of CTLA4, B7 or CD28, respectively.
- Other molecules can be papillomavirus E7 gene product (E7), melanoma-associated antigen p97 (p97) or HIV env protein (env gpl20).
- E7 papillomavirus E7 gene product
- p97 melanoma-associated antigen p97
- env gpl20 HIV env protein
- a molecule such as CTLA4 can be rendered soluble by removing its transmembrane domain.
- CTLA4Ig is a soluble fusion protein comprising an extracellular domain of CTLA4, or a portion thereof that binds CD80 and/or CD86, joined to an Ig tail.
- a particular embodiment comprises the extracellular domain of wild type CTLA4 starting at methionine at position +1 and ending at aspartic acid at position +124; or starting at alanine at position -1 to aspartic acid at position +124; a junction amino acid residue glutamine at position +125; and an immunoglobulin portion encompassing glutamic acid at position +126 through lysine at position +357 ( Figure 2).
- CTLA4Ig DNA encoding CTLA4Ig was deposited on May 31, 1991 with the American Type Culture Collection (ATCC), 10801 University Boulevard., Manassas, VA 20110-2209 under the provisions of the Budapest Treaty, and has been accorded ATCC accession number ATCC 68629; Linsley, P., et al., 1994 Immunity 1:793-80).
- CTLA4Ig-24 a Chinese Hamster Ovary (CHO) cell line expressing CTLA4Ig was deposited on May 31, 1991 with ATCC identification number CRL-10762).
- the soluble CTLA4Ig molecules used in the methods and/or kits of the invention may or may not include a signal (leader) peptide sequence. Typically, in the methods and/or kits of the invention, the molecules do not include a signal peptide sequence.
- soluble CTLA4 molecules means non-cell-surface-bound (i.e., circulating) CTLA4 molecules (wildtype or mutant) or any functional portion of a CTLA4 molecule that binds B7 including, but not limited to: CTLA4Ig fusion proteins (e.g., ATCC 68629), wherein the extracellular domain of CTLA4 is fused to an immunoglobulin (Ig) moiety rendering the fusion molecule soluble, or fragments and derivatives thereof; proteins with the extracellular domain of CTLA4 fused or joined with a portion of a biologically active or chemically active protein such as the papillomavirus E7 gene product (CTLA4-E7), melanoma-associated antigen p97 (CTLA4-p97) or HIV env protein (CTLA4-env gpl20), or fragments and derivatives thereof; hybrid (chimeric) fusion proteins such as CD28/CTLA4Ig, or fragments and derivatives thereof; CTLA4 molecules
- soluble CTLA4 molecules also include fragments, portions or derivatives thereof, and soluble CTLA4 mutant molecules having CTLA4 binding activity.
- the soluble CTLA4 molecules used in the methods of the invention may or may not include a signal (leader) peptide sequence. Typically, in the methods of the invention, the molecules do not include a signal peptide sequence.
- fusion protein is defined as one or more amino acid sequences joined together using methods well known in the art and as described in U.S. Pat. No. 5,434,131 or 5,637,481. The joined amino acid sequences thereby form one fusion protein.
- CTLA4 mutant molecule is a molecule that can be full length CTLA4 or portions thereof (derivatives or fragments) that have a mutation or multiple mutations in CTLA4 (preferably in the extracellular domain of CTLA4) so that it is similar but not identical to the wild type CTLA4 molecule.
- CTLA4 mutant molecules bind a B7 molecule (e.g., either CD80 or CD86, or both).
- Mutant CTLA4 molecules may include a biologically or chemically active non-CTLA4 molecule therein or attached thereto.
- the mutant molecules may be soluble (i.e., circulating) or bound to a surface.
- CTLA4 mutant molecules can include the entire extracellular domain of CTLA4 or portions thereof, e.g., fragments or derivatives.
- CTLA4 mutant molecules can be made synthetically or recombinantly.
- the term "mutation" is a change in the nucleotide or amino acid sequence of a wild-type polypeptide.
- the present invention provides a mutation or a change in the wild type CTLA4 extracellular domain.
- the changes in the wild type CTLA4 sequence include conservative and non-conservative changes.
- the change can be an amino acid change which includes substitutions, deletions, additions, or truncations.
- a mutant molecule can have one or more mutations. Mutations in a nucleotide sequence may or may not result in a mutation in the amino acid sequence as is well understood in the art. In that regard, certain nucleotide codons encode the same amino acid.
- a protein can be encoded by one or more nucleic acid molecules that differ in their specific nucleotide sequence, but still encode protein molecules having identical sequences.
- the amino acid coding sequence is as follows:
- L104EA29YIg is a fusion protein that is a soluble CTLA4 mutant molecule comprising an extracellular domain of wildtype CTLA4 having amino acid changes A29Y (a tyrosine amino acid residue substituting for an alanine at position 29) and L104E (a glutamic acid amino acid residue substituting for a leucine at position +104), or a portion thereof that binds a B7 molecule, joined to an Ig tail (included in Figure 3; DNA encoding L104EA29YIg was deposited with the American Type Culture Collection on June 20, 2000 and assigned ATCC number PTA-2104).
- the soluble L104EA29YIg molecules used in the methods and/or kits of the invention may or may not include a signal (leader) peptide sequence. Typically, in the methods and/or kits of the invention, the molecules do not include a signal peptide sequence.
- the mutant molecule may have one or more mutations.
- a "non-CTLA4 protein sequence" or “non-CTLA4 molecule” means any protein molecule that does not bind B7 and does not interfere with the binding of CTLA4 to its target.
- An example includes, but is not limited to, an immunoglobulin (Ig) constant region or portion thereof.
- the Ig constant region is a human or monkey Ig constant region, e.g., human C(gamma)l, including the hinge, CH2 and CH3 regions.
- the Ig constant region can be mutated to reduce its effector functions (U.S. Patents 5,637,481, 5,844,095 and 5,434,131).
- a "fragment” or “portion” is any part or segment of a molecule e.g. CTLA4 or CD28, preferably the extracellular domain of CTLA4 or CD28 or a part or segment thereof, that recognizes and binds its target, e.g., a B7 molecule.
- B7 refers to the B7 family of molecules including, but not limited to, B7-1 (CD80) (Freeman et al, 1989, J Immunol. 143:2714-2722, herein incorporated by reference in its entirety), B7-2 (CD86) (Freeman et al, 1993, Science 262:909-911 herein incorporated by reference in its entirety; Azuma et al, 1993, Nature 366:76-79 herein incorporated by reference in its entirety) that may recognize and bind CTLA4 and/or CD28.
- CD28 refers to the molecule that recognizes and binds B7 as described in U.S. Serial No. 5,580,756 and 5,521,288 (herein incorporated by reference in their entirety).
- B7-positive cells are any cells with one or more types of B7 molecules expressed on the cell surface.
- a “derivative” is a molecule that shares sequence similarity and activity of its parent molecule.
- a derivative of CTLA4 includes a soluble CTLA4 molecule having an amino acid sequence at least 70% similar to the extracellular domain of wildtype CTLA4, and which recognizes and binds B7 e.g. CTLA4Ig or soluble CTLA4 mutant molecule LI 04EA29YTg.
- a receptor, signal or molecule means to interfere with the activation of the receptor, signal or molecule, as detected by an art-recognized test. For example, blockage of a cell-mediated immune response can be detected by determining reduction of Rheumatic Disease associated symptoms. Blockage or inhibition may be partial or total.
- blocking B7 interaction means to interfere with the binding of B7 to its ligands, such as CD28 and/or CTLA4, thereby obstructing T-cell and B7-positive cell interactions.
- agents that block B7 interactions include, but are not limited to, molecules such as an antibody (or portion or derivative thereof) that recognizes and binds to the any of CTLA4, CD28 or B7 molecules (e.g.
- the blocking agent is a soluble CTLA4 molecule, such as CTLA4Ig (ATCC 68629) or L104EA29YIg (ATCC PTA-2104), a soluble CD28 molecule such as CD28Ig (ATCC 68628), a soluble B7 molecule such as B7Ig (ATCC 68627), an anti-B7 monoclonal antibody (e.g.
- an anti-CTLA4 monoclonal antibody e.g. ATCC HB-304, and monoclonal antibodies as described in references 82-83
- an anti-CD28 monoclonal antibody e.g. ATCC HB 11944 and mAb 9.3 as described by Hansen (Hansen e
- immune system disease means any disease mediated by T-cell interactions with B7-positive cells including, but not limited to, autoimmune diseases, graft related disorders and immunoproliferative diseases.
- immune system diseases include graft versus host disease (GVHD) (e.g., such as may result from bone marrow transplantation, or in the induction of tolerance), immune disorders associated with graft transplantation rejection, chronic rejection, and tissue or cell allo- or xenografts, including solid : organs, skin, islets, muscles, hepatocytes, neurons.
- GVHD graft versus host disease
- immunoproliferative diseases include, but are not limited to, psoriasis, T-cell lymphoma, T-cell acute lymphoblastic leukemia, testicular angiocentric T-cell lymphoma, benign lymphocytic angiitis, lupus (e.g. lupus erythematosus, lupus nephritis), Hashimoto's thyroiditis, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes (e.g.
- insulin dependent diabetes mellitis type I diabetes mellitis, type II diabetes mellitis
- good pasture's syndrome myasthenia gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic action hepatitis, ulceratis colitis, Sjogren's syndrome, rheumatic diseases (e.g. rheumatoid arthritis), polymyositis, scleroderma, and mixed connective tissue disease.
- subject includes but is not limited to human, non-human primates (e.g., monkey, ape), sheep, rabbit, pig, dog, cat, mouse, or rat.
- non-human primates e.g., monkey, ape
- sheep rabbit
- pig dog
- cat cat
- mouse or rat.
- tissue transplant is defined as a tissue of all, or part of, an organ that is transplanted to a recipient subject.
- the tissue is from one or more solid organs.
- tissues or organs include, but are not limited to, skin, heart, lung, pancreas, kidney, liver, bone marrow, pancreatic islet cells, pluripotent stem cells, cell suspensions, and genetically modified cells.
- the tissue can be removed from a donor subject, or can be grown in vitro.
- the transplant can be an autograft, isograft, allograft, or xenograft, or a combination thereof.
- transplant rejection is defined as the nearly complete, or complete, loss of viable graft tissue from the recipient subject.
- encapsulation is defined as a process that immunoisolates cells and/or cell clusters, which produce and secrete therapeutic substances, e.g. insulin, and to the medical use of these formulations.
- the encapsulation process involves the placement of the cells and/or cell clusters within a semipermeable membrane barrier prior to transplantation in order to avoid rejection by the immune system.
- the molecular weight cut-off of the encapsulating membrane can be controlled by the encapsulation procedure so as to exclude inward diffusion of immunoglobulin and lytic factors of the complement system, but allow the passage of smaller molecules such as glucose and insulin.
- Encapsulation permits the islet cells to respond physiologically to changes in blood glucose but prevents contact with components of the immune system. Methods of encapsulation of pancreatic islet cells are described in U.S. Patent 6,080,412.
- ligand refers to a molecule that specifically recognizes and binds another molecule, for example, a ligand for CTLA.4 is a CD80 and/or CD86 molecule.
- a soluble ligand which recognizes and binds CD80 and/or CD86 antigen includes ligands such as CTLA4Ig, CD28Ig or other soluble forms of CTLA4 and CD28; recombinant CTLA4 and CD28; mutant CTLA4 molecules such as L104EA29YIg; and any antibody molecule, fragment thereof or recombinant binding protein that recognizes and binds a CD80 and/or CD86 antigen. These agents are also considered “immunosuppressive agents”.
- costimulatory pathway is defined as a biochemical pathway resulting from interaction of costimulatory signals on T cells and antigen presenting cells (APCs). Costimulatory signals help determine the magnitude of an immuno logical response to an antigen.
- One costimulatory signal is provided by the interaction with T cell receptors CD28 and CTLA4 with CD80 and/or CD86 molecules on APCs.
- CD80 and or CD86 includes B7-1 (also called CD80).
- B7-2 also called CD86
- B7-3 also called CD74
- B7 family e.g., a combination of B7-1, B7-2, and/or B7-3.
- costimulatory blockade is defined as a protocol of administering to a subject, one or more agents that interfere or block a costimulatory pathway, as described above.
- agents that interfere with the costimulatory blockade include, but are not limited to, soluble CTLA4, mutant CTLA4, soluble CD28, anti-B7 monoclonal antibodies (mAbs), soluble CD40, and anti-gp39 mAbs.
- L104EA29YIg is a preferred agent that interferes with the costimulatory blockade.
- T cell depleted bone marrow is defined as bone marrow removed from bone that has been exposed to an anti-T cell protocol.
- An anti-T cell protocol is defined as a procedure for removing T cells from bone marrow. Methods of selectively removing T cells are well known in the art.
- An example of an anti-T cell protocol is exposing bone marrow to T cell specific antibodies, such as anti-CD3, anti-CD4, anti-CD5, anti-CD8, and anti-CD90 monoclonal antibodies, wherein the antibodies are cytotoxic to the T cells.
- the antibodies can be coupled to magnetic particles to permit removal of T cells from bone marrow using magnetic fields.
- Another example of an anti-T cell protocol is exposing bone marrow T cells to anti-lymphocyte serum or anti-thyrnocyte globulin.
- tolerizing dose of T cell depleted bone marrow is defined as an initial dose of T cell depleted bone marrow that is administered to a subject for the purpose of inactivating potential donor reactive T cells.
- engrafting dose of T cell depleted bone marrow is defined as a subsequent dose of T cell depleted bone marrow that is administered to a subject for the purpose of establishing mixed hematopoietic chimerism.
- the engrafting dose of T cell depleted bone marrow will accordingly be administered after the tolerizing dose of T cell depleted bone marrow.
- mixed hematopoietic chimerism is defined as the presence of donor and recipient blood progenitor and mature cells (e.g., blood deriving cells) in the absence (or undetectable presence) of an immune response.
- Donor-recipient pairings are defined based on molecular typing using a panel of previously defined major histocompatibilty alleles (8 class I and 12 class II) (Lobashevsky A, et al., Tissue Antigens 54:254 -263, (1999); Knapp LA, et al., Tissue Antigens 50:657-661, (1997); Watkins D.I., Crit Rev Immunol 15:1-29, (1995)). Pairings maximized disparity at both class I and II loci.
- administer or “administering” to a subject includes but not limited to intravenous (i.v.) administration, intraperitoneal (i.p.) administration, intramuscular (i.m.) administration, subcutaneous administration, oral administration, administration by injection, as a suppository, or the implantation of a slow-release device such as a miniosmotic pump, to the subject.
- i.v. intravenous
- i.p. intraperitoneal
- intramuscular i.m.
- subcutaneous administration i.m.
- oral administration administration by injection, as a suppository, or the implantation of a slow-release device such as a miniosmotic pump, to the subject.
- pharmaceutically acceptable carrier includes any material which, when combined with the reactive agent, retains the reactive agent's biological activity, e.g., binding specificity and is non-reactive with the subject's immune system.
- examples include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution, water, emulsions such as oil/water emulsion, and various types of wetting agents.
- Other carriers may also include sterile solutions, tablets, including coated tablets and capsules.
- such carriers typically contain excipients, such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or salts, thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients.
- excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or salts, thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients.
- Such carriers may also include flavor and color additives or other ingredients.
- Compositions comprising such carriers are formulated by well-known conventional methods.
- immunosuppressive agents are defined as a composition having one or more types of molecules that prevent the occurrence of an immune response, or weaken a subject's immune system.
- the agents reduce or prevent T cell proliferation.
- Some agents may inhibit T cell proliferation by inhibiting interaction of T cells with other antigen presenting cells (APCs).
- APCs are B cells.
- agents that interfere with T cell interactions with APCs, and thereby inhibit T cell proliferation include, but are not limited to, ligands for CD80 and/or CD86 antigens, ligands for CTLA4 antigen, and ligands for CD28 antigen.
- ligands for CD80 and/or CD86 antigens include, but are not limited to, soluble CTLA4, soluble CTLA4 mutant, soluble CD28, or monoclonal antibodies that recognize and bind CD80 and/or CD86 antigens, or fragments thereof.
- One preferred agent is L104EA29YIg.
- Ligands for CTLA4 or CD28 antigens include monoclonal antibodies that recognize and bind CTLA4 and/or CD28, or fragments thereof.
- Other ligands for CTLA4 or CD28 include soluble CD80 and/or CD86 molecules, such as CD80 and/or CD86Ig.
- CD80 and/or CD86Ig soluble CD80 and/or CD86 molecules
- CD80 and/or CD86Ig soluble CD80 and/or CD86 molecules
- Immunosuppressive agents include, but are not limited to, methotrexate, cyclophosphamide, cyclosporine, cyclosporin A, chloroquine, hydroxychloroquine, sulfasalazine (sulphasalazopyrine), gold salts, D-penicillamine, leflunomide, azathioprine, anakinra, infliximab (REMICADE R ), etanercept, TNF ⁇ blockers, a biological agent that targets an inflammatory cytokine, and Non-Steroidal Anti- Inflammatory Drug (NSAIDs).
- methotrexate cyclophosphamide
- cyclosporine cyclosporin A
- chloroquine hydroxychloroquine
- sulfasalazine sulphasalazopyrine
- gold salts gold salts
- D-penicillamine leflunomide
- azathioprine anakin
- NSAIDs include, but are not limited to acetyl salicylic acid, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tohnetin, acetaminophen, ibuprofen, Cox-2 inhibitors and tramadol.
- COMPOSITIONS OF THE INVENTION COMPOSITIONS OF THE INVENTION
- the present invention provides compositions for treating immune diseases, such as diabetes, comprising soluble CTLA4 molecules.
- the invention further provides compositions for inhibiting transplant rejections, e.g. islet cell transplant rejection for treating diabetes.
- compositions comprising a biological agent that inhibits T-cell function but not T-cell depletion in a human by contacting B7-positive cells in the human with a soluble CTLA4.
- soluble CTLA4 include CTLA4Ig and soluble CTLA4 mutant molecules such as L104EA29YIg, L104EA29LIg, L104EA29TIg, and L104EA29WIg
- CTLA4 molecules with mutant or wildtype sequences, may be rendered soluble by deleting the CTLA4 transmembrane segment (Oaks, M. K., et al., 2000 Cellular Immunology 201:144-153).
- soluble CTLA4 molecules with mutant or wildtype sequences, maybe fusion proteins, wherein the CTLA4 molecules are fused to non-CTLA4 moieties such as immunoglobulin (Ig) molecules that render the CTLA4 molecules soluble.
- a CTLA4 fusion protein may include the extracellular domain of CTLA4 fused to an immunoglobulin constant domain, resulting in the CTLA4Ig molecule ( Figure 2) (Linsley, P. S., et al, 1994 Immunity 1:793-80).
- the immunoglobulin moiety does not elicit a detrimental immune response in a subject.
- the preferred moiety is the immunoglobulin constant region, including the human or monkey immunoglobulin constant regions.
- One example of a suitable immunoglobulin region is human C ⁇ l, including the hinge, CH2 and CH3 regions which can mediate effector functions such as binding to Fc receptors, mediating complement-dependent cytotoxicity (CDC), or mediate antibody-dependent cell-mediated cytotoxicity (ADCC).
- the immunoglobulin moiety may have one or more mutations therein, (e.g., in the CH2 domain, to reduce effector functions such as CDC or ADCC) where the mutation modulates the binding capability of the immunoglobulin to its ligand, by increasing or decreasing the binding capability of the immunoglobulin to Fc receptors.
- mutations in the immunoglobulin moiety may include changes in any or all its cysteine residues within the hinge domain, for example, the cysteines at positions +130, +136, and +139 are substituted with serine ( Figure 24).
- the immunoglobulin moiety may also include the proline at position +148 substituted with a serine, as shown in Figure 24.
- the mutations in the immunoglobulin moiety may include having the leucine at position +144 substituted with phenylalanine, leucine at position +145 substituted with glutamic acid, or glycine at position +147 substituted with alanine.
- Additional non-CTLA4 moieties for use in the soluble CTLA4 molecules or soluble CTLA4 mutant molecules include, but are not limited to, p97 molecule, env gpl20 molecule, E7 molecule, and ova molecule (Dash, B. et al. 1994 J Gen. Virol. 75 (Pt 6):1389-97; lkeda, T., et al. 1994 Gene 138(1-2): 193-6; Falk, K., et al. 1993 Cell. Immunol. 150(2):447-52; Fujisaka, K. et al. 1994 Virology 204(2):789-93).
- Other molecules are also possible (Gerard, C. et al. 1994 Neuroscience 62(3):721; Byrn, R. et al. 1989 63(10):4370; Smith, D. et al. 1987 Science 238:1704; Lasky, L. 1996 Science 233:209).
- the present invention provides soluble CTLA4 molecules including a signal peptide sequence linked to the N-terminal end of the extracellular domain of the CTLA4 portion of the molecule.
- the signal peptide can be any sequence that will permit secretion of the mutant molecule, including the signal peptide from oncostatin M (Malik, et al., 1989 Molec. Cell. Biol. 9: 2847-2853), or CD5 (Jones, N. H. et al, 1986 Nature 323:346-349), or the signal peptide from any extracellular protein.
- the soluble CTLA4 molecule of the invention can include the oncostatin M signal peptide linked at the N-terminal end of the extracellular domain of CTLA4, and the human immunoglobulin molecule (e.g., hinge, CH2 and CH3) linked to the C-terminal end of the extracellular domain (wildtype or mutated) of CTLA4.
- This molecule includes the oncostatin M signal peptide encompassing an amino acid sequence having methionine at position -26 through alanine at position —1, the CTLA4 portion encompassing an amino acid sequence having methionine at position +1 through aspartic acid at position +124, a junction amino acid residue glutamine at position +125, and the immunoglobulin portion encompassing an amino acid sequence having glutamic acid at position +126 through lysine at position
- the soluble CTLA4 mutant molecules of the invention comprising the mutated CTLA4 sequences described infra, are fusion molecules comprising human IgC(gamma)l (i.e. IgC ⁇ l) moieties fused to the mutated CTLA4 fragments.
- the soluble CTLA4 mutant molecules can comprise one or more mutations (e.g., amino acid substitutions, deletions, or insertions) in the extracellular domain of CTLA4.
- the soluble CTLA4 mutant molecules can include a mutation or mutations within or in close proximity to the region encompassed by serine at position +25 through arginine at position +33 (e.g., S25-R33, using standard single-letter amino acid symbols).
- the mutant CTLA4 molecules can include an ammo acid substitution at any one or more of the following positions: S25, P26, G27, K28, A29, T30, E31, or R33.
- the soluble CTLA4 mutant molecules can include a mutation or mutations within or in close proximity to the region encompassed by glutamic acid at position +95 to glycine at position +107 (e.g., E95-G107)
- the mutant CTLA4 molecules can include an amino acid substitution at any one or more of the following positions: K93, L96, M97, Y98, P99, P100, P101, Y102, Y103, L104, G105, 1106, and G107.
- the invention provides soluble CTLA4 mutant molecules having a mutation or mutations within or in close proximity to the region encompassed by asparagine +108 to isoleucine at position +115 (e.g., N108-I115).
- the mutant CTLA4 molecule can include an amino acid substitution at any one or more of the following positions: LI 04, G105, 1106, G107, Q111, Y113, or 1115.
- the soluble CTLA4 mutant molecules comprise IgC ⁇ l fused to a CTLA4 fragment comprising a single-site mutation in the extracellular domain.
- the extracellular domain of CTLA4 comprises methionine at position +1 through aspartic acid at position +124 (e.g., Figure 1).
- the extracellular portion of the CTLA4 can comprise alanine at position -1 through aspartic acid at position +124 (e.g., Figure 1).
- single-site mutations include the following wherein the leucine at position +104 is changed to any other amino acid:
- mutant molecules having the extracellular domain of CTLA4 with two mutations, fused to an Ig C ⁇ l moiety include the following wherein the leucine at position +104 is changed to another amino acid (e.g. glutamic acid) and the glycine at position +105, the serine at position +25, the threonine at position +30 or the alanine at position +29 is changed to any other amino acid:
- mutant molecules having the extracellular domain of CTLA4 comprising three mutations, fused to an Ig C ⁇ l moiety.
- Examples include the following wherein the leucine at position +104 is changed to another amino acid (e.g. glutamic acid), the alanine at position +29 is changed to another amino acid (e.g. tyrosine) and the serine at position +25 is changed to another amino acid:
- Soluble CTLA4 mutant molecules may have a junction amino acid residue which is located between the CTLA4 portion and the Ig portion of the molecule.
- the junction amino acid can be any amino acid, including glutamine.
- the junction amino acid can be introduced by molecular or chemical synthesis methods known in the art.
- the invention provides soluble CTLA4 mutant molecules comprising a single-site mutation in the extracellular domain of CTLA4 such as L104EIg (as included in Figure 19) or L104SIg, wherein L104EIg and L104SIg are mutated in their CTLA4 sequences so that leucine at position +104 is substituted with glutamic acid or serine, respectively.
- the single-site mutant molecules further include CTLA4 portions encompassing methionine at position +1 through aspartic acid at position +124, a junction amino acid residue glutamine at position +125, and an immunoglobulin portion encompassing glutamic acid at position +126 through lysine at position +357.
- the immunoglobulin portion of the mutant molecule may also be mutated so that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine.
- the single-site soluble CTLA4 mutant molecule may have a CTLA4 portion encompassing alanine at position -1 through aspartic acid at position +124.
- the invention provides soluble CTLA4 mutant molecules comprising a double-site mutation in the extracellular domain of CTLA4, such as L104EA29YIg, L104EA29LIg, L104EA29TIg or L104EA29WIg, wherein leucine at position +104 is substituted with a glutamic acid and alanine at position +29 is changed to tyrosine, leucine, threonine and tryptophan, respectively.
- soluble CTLA4 mutant molecules comprising a double-site mutation in the extracellular domain of CTLA4, such as L104EA29YIg, L104EA29LIg, L104EA29TIg or L104EA29WIg, wherein leucine at position +104 is substituted with a glutamic acid and alanine at position +29 is changed to tyrosine, leucine, threonine and tryptophan, respectively.
- the sequences for L104EA29YIg, L104EA29LIg, L104EA29TIg and L104EA29WIg, starting at methionine at position +1 and ending with lysine at position +357, plus a signal (leader) peptide sequence are included in the sequences as shown in Figures 3 and 20-22 respectively.
- the double-site mutant molecules further comprise CTLA4 portions encompassing methionine at position +1 through aspartic acid at position +124, a junction amino acid residue glutamine at position +125, and an immunoglobulin portion encompassing glutamic acid at position +126 through lysine at position +357.
- the immunoglobulin portion of the mutant molecule may also- be mutated, so that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine.
- these mutant molecules can have a CTLA4 portion encompassing alanine at position -1 through aspartic acid at position +124.
- the invention provides soluble CTLA4 mutant molecules comprising a double-site mutation in the extracellular domain of CTLA4, such as L104EG105FIg, L104EG105WIg and L104EG105LIg, wherein leucine at position +104 is substituted with a glutamic acid and glycine at position +105 is substituted with phenylalanine, tryptophan and leucine, respectively.
- the double-site mutant molecules further comprise CTLA4 portions encompassing methionine at position +1 through aspartic acid at position +124, a junction amino acid residue glutamine at position +125, and an immunoglobulin portion encompassing glutamic acid at position +126 through lysine at position +357.
- the immunoglobulin portion of the may also be mutated, so that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine.
- these mutant molecules can have a CTLA4 portion encompassing alanine at position -1 through aspartic acid at position +124.
- L104ES25RIg which is a double-site mutant molecule including a CTLA4 portion encompassing methionine at position +1 through aspartic acid at position +124, a junction amino acid residue glutamine at position +125, and the immunoglobulin portion encompassing glutamic acid at position +126 through lysine at position +357.
- the portion having the extracellular domain of CTLA4 is mutated so that serine at position +25 is substituted with arginine, and leucine at position +104 is substituted with glutamic acid.
- L104ES25RIg can have a CTLA4 portion encompassing alanine at position -1 through aspartic acid at position +124.
- the invention provides soluble CTLA4 mutant molecules comprising a double-site mutation in the extracellular domain of CTLA4, such as L104ET30GIg and L104ET30NIg, wherein leucine at position +104 is substituted with a glutamic acid and threonine at position +30 is substituted with glycine and asparagine, respectively.
- the double-site mutant molecules further comprise CTLA4 portions encompassing methionine at position +1 through aspartic acid at position +124, a junction amino acid residue glutamine at position +125, and an immunoglobulin portion encompassing glutamic acid at position +126 through lysine at position +357.
- the immunoglobulin portion of the mutant molecule may also be mutated, so that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine.
- these mutant molecules can have a CTLA4 portion encompassing alanine at position -1 through aspartic acid at position +124.
- the invention provides soluble CTLA4 mutant molecules comprising a triple-site mutation in the extracellular domain of CTLA4, such as L104EA29YS25KIg, L104EA29YS25NIg, L104EA29YS25RIg, wherein leucine at position +104 is substituted with a glutamic acid, alanine at position +29 is changed to tyrosine and serine at position +25 is changed to lysine, asparagine and arginine, respectively.
- a triple-site mutation in the extracellular domain of CTLA4 such as L104EA29YS25KIg, L104EA29YS25NIg, L104EA29YS25RIg, wherein leucine at position +104 is substituted with a glutamic acid, alanine at position +29 is changed to tyrosine and serine at position +25 is changed to lysine, asparagine and arginine, respectively.
- the triple-site mutant molecules further comprise CTLA4 portions encompassing methionine at position +1 through aspartic acid at position +124, a junction amino acid residue glutamine at position +125, and an immunoglobulin portion encompassing glutamic acid at position +126 through lysine at position +357.
- the immunoglobulin portion of the mutant molecule may also be mutated, so that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine.
- these mutant molecules can have a CTLA4 portion encompassing alanine at position -1 through aspartic acid at position +124.
- soluble CTLA4 mutant molecules include chimeric CTLA4/CD28 homologue mutant molecules that bind a B7 (Peach, R. J., et al., 1994 J Exp Med 180:2049-2058).
- chimeric CTLA4/CD28 mutant molecules include HS1, HS2, HS3, HS4, HS5, HS6, HS4A, HS4B, HS7, HS8, HS9, HS10, HSU, HS12, HS13 and HS14 (U.S. patent number 5,773,253)
- Preferred embodiments of the invention are soluble CTLA4 molecules such as CTLA4Ig (as shown in Figure 2, starting at methionine at position +1 and ending at lysine at position +357) and soluble CTLA4 mutant L104EA29YIg (as shown in Figure 3, starting at methionine at position +1 and ending at lysine at position +357).
- CTLA4Ig as shown in Figure 2, starting at methionine at position +1 and ending at lysine at position +357
- L104EA29YIg as shown in Figure 3, starting at methionine at position +1 and ending at lysine at position +357.
- the invention further provides nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequences corresponding to the soluble CTLA4 molecules of the invention.
- the nucleic acid molecule is a DNA (e.g., cDNA) or a hybrid thereof.
- DNA encoding CTLA4Ig Figure 2 was deposited on May 31, 1991with the American Type Culture Collection (ATCC), 10801 University Boulevard., Manassas, VA 20110-2209 and has been accorded ATCC accession number ATCC 68629.
- DNA encoding L104EA29YIg (sequence included in Figure 3) was deposited on June 19, 2000 with ATCC and has been accorded ATCC accession number PTA-2104.
- the nucleic acid molecules are RNA or a hybrid thereof.
- the present invention provides soluble CTLA4 mutant molecules comprising at least the extracellular domain of CTLA4 or portions thereof that bind CD80 and/or CD86.
- the extracellular portion of CTLA4 comprises methionine at position +1 through aspartic acid at position +124 (e.g., Figure 1).
- the extracellular portion of the CTLA4 can comprise alanine at position -1 through aspartic acid at position +124 (e.g., Figure 1).
- the extracellular portion of the CTLA4 can comprise glutamic acid at position +95 through cysteine at position +120.
- the extracellular portion of the CTLA4 can comprise methionine at position +1 through cysteine at position +21 and glutamic acid at position +95 through aspartic acid at position +122.
- the extracellular portion of the CTLA4 can comprise methionine at position +1 through tyrosine at position +23 and valine at position +32 through aspartic acid at position +122.
- the extracellular portion of the CTLA4 can comprise alanine at position +24 through glutamic acid at position +31 and glutamic acid at position +95 through aspartic acid at position +122.
- the extracellular portion of the CTLA4 can comprise alanine at position +24 through glutamic acid at position +31 and glutamic acid at position +95 through isoleucine at position +112.
- the extracellular portion of the CTLA4 can comprise alanine at position +24 through glutamic acid at position +31 and tyrosine at position +113 through aspartic acid at position +122.
- the extracellular portion of the CTLA4 can comprise alanine at position +50 through glutamic acid at position +57 and glutamic acid at position +95 through aspartic acid at position +122.
- the extracellular portion of the CTLA4 can comprise alanine at position +24 through glutamic acid at position +31; alanine at position +50 through glutamic acid at position +57; and glutamic acid at position +95 through aspartic acid at position +122.
- the extracellular portion of the CTLA4 can comprise alanine at position +50 through glutamic acid at position +57 and glutamic acid at position +95 through isoleucine at position +112.
- the extracellular portion of the CTLA4 can comprise alanine at position +24 through glutamic acid at position +31; alanine at position +50 through glutamic acid at position +57; and glutamic acid at position +95 through aspartic acid at position +122.
- the extracellular portion of CTLA4 can comprise alanine at position +24 through valine at position +94.
- the extracellular portion of CTLA4 can comprise alanine at position -1 through cysteine at position +21.
- the extracellular portion of CTLA4 can comprise methionine at position +1 through cysteine at position +21.
- the extracellular portion of CTLA4 can comprise glutamic acid at position +95 through aspartic acid at position +122.
- the extracellular portion of CTLA4 can comprise alanine at position -1 through valine at position +94.
- the extracellular portion of CTLA4 can comprise methiomne at position +1 through valine at position +94.
- the extracellular portion of CTLA4 can comprise alanine at position +24 through glutamic acid at position +31.
- the extracellular portion of CTLA4 can comprise alanine at position -1 through tyrosine at position +23.
- the extracellular portion of CTLA4 can comprise methionine at position +1 through tyrosine at position +23.
- the extracellular portion of CTLA4 can comprise valine at position +32 through aspartic acid at position +122.
- the extracellular portion of CTLA4 can comprise tyrosine at position +113 through aspartic acid at position +122.
- the extracellular portion of CTLA4 can comprise glutamic acid at position +95 through isoleucine at position +112.
- the extracellular portion of CTLA4 can comprise alanine at position +50 through glutamic acid at position +57.
- CTLA4 mutant molecules can be in prokaryotic cells. Prokaryotes most frequently are represented by various strains of bacteria. The bacteria may be a gram positive or a gram negative. Other microbial strains may also be used. Nucleotide sequences encoding CTLA4 mutant molecules can be inserted into a vector designed for expressing foreign sequences in prokaryotic cells such as E. coli.
- These vectors can include commonly used prokaryotic control sequences which are defined herein to include promoters for transcription initiation, optionally with an operator, along with ribosome binding site sequences, include such commonly used promoters as the beta-lactamase (penicillinase) and lactose (lac) promoter systems (Chang, et al., (1977) Nature 198:1056), the tryptophan (trp) promoter system (Goeddel, et al., (1980) Nucleic Acids Res. 8:4057) and the lambda derived P L promoter and N-gene ribosome binding site (Shimatake, et al., (1981) Nature 292:128).
- promoters as the beta-lactamase (penicillinase) and lactose (lac) promoter systems (Chang, et al., (1977) Nature 198:1056)
- trp tryptophan
- trp lambda
- Such expression vectors will also include origins of replication and selectable markers, such as a beta-lactamase or neomycin phosphotransferase gene conferring resistance to antibiotics, so that the vectors can replicate in bacteria and cells carrying the plasmids can be selected for when grown in the presence of antibiotics, such as ampicillin or kanamycin.
- origins of replication such as a beta-lactamase or neomycin phosphotransferase gene conferring resistance to antibiotics, so that the vectors can replicate in bacteria and cells carrying the plasmids can be selected for when grown in the presence of antibiotics, such as ampicillin or kanamycin.
- the expression plasmid can be introduced into prokaryotic cells via a variety of standard methods, including but not limited to CaCl 2 -shock (Cohen, (1972) Proc. Natl. Acad. Sci. USA 69:2110. and Sambrook et al. (eds.), "Molecular Cloning: A Laboratory Manual", 2nd Edition, Cold Spring Harbor Press, (1989)) and electroporation.
- eukaryotic cells are also suitable host cells.
- eukaryotic cells include any animal cell, whether primary or immortalized, yeast (e.g., Saccharomyces cerevisiae, Schizosaccharomvces pombe, and Pichia pastoris , and plant cells.
- yeast e.g., Saccharomyces cerevisiae, Schizosaccharomvces pombe, and Pichia pastoris
- Myeloma, COS and CHO cells are examples of animal cells that may be used as hosts.
- Particular CHO cells include, but are not limited to, DG44 (Chasin, et al., 1986 Som. Cell. Molec. Genet. 12:555-556; Kolkekar 1997 Biochemistry 36:10901-10909), CHO-K1 (ATCC No.
- CHO-K1 Tet-On cell line CCL-61
- CHO designated ECACC 85050302 (CAMR, Salisbury, Wiltshire, UK)
- CHO clone 13 (GEIMG, Genova, IT)
- CHO clone B (GEIMG, Genova, IT)
- CHO-Kl/SF designated ECACC 93061607 (CAMR, Salisbury, Wiltshire, UK)
- RR-CHOK1 designated ECACC 92052129 (CAMR, Salisbury, Wiltshire, UK).
- Exemplary plant cells include tobacco (whole plants, cell culture, or callus), corn, soybean, and rice cells. Corn, soybean, and rice seeds are also acceptable.
- Nucleotide sequences encoding the CTLA4 mutant molecules can also be inserted into a vector designed for expressing foreign sequences in a eukaryotic host.
- the regulatory elements of the vector can vary according to the particular eukaryotic host.
- the nucleic acid molecule that encodes L104EA29YIg is contained in pD16 L104EA29YIg and was deposited on June 19, 2000 with the American Type Culture Collection (ATCC), 10801 University Boulevard., Manasas, VA 20110-2209 (ATCC No. PTA-2104).
- the pD16 L104EA29YIg vector is a derivative of the pcDNA3 vector (INVITROGEN).
- Commonly used eukaryotic control sequences for use in expression vectors include promoters and control sequences compatible with mammalian cells such as, for example, CMV promoter (CDM8 vector) and avian sarcoma virus (ASV) ( ⁇ LN vector).
- CMV promoter CDM8 vector
- ASV avian sarcoma virus
- Other commonly used promoters include the early and late promoters from Simian Virus 40 (SV40) (Fiers, et al., (1973) Nature 273:113), or other viral promoters such as those derived from polyoma, Adenovirus 2, and bovine papilloma virus.
- An inducible promoter such as hMTII (Karin, et al., (1982) Nature 299:797-802) may also be used.
- Vectors for expressing CTLA4 mutant molecules in eukaryotes may also carry sequences called enhancer regions. These are important in optimizing gene expression and are found either upstream or downstream of the promoter region.
- expression vectors for eukaryotic host cells include, but are not limited to, vectors for mammalian host cells (e.g., BPV-1, pHyg, pRSV, pSV2, pTK2 (Maniatis); pIRES (Clontech); pRc/CMV2, pRc/RSV, pSFVl (Life Technologies); pVPakc Vectors, pCMV vectors, pSG5 vectors (Stratagene)), retroviral vectors (e.g., pFB vectors (Stratagene)), pCDNA-3 (Invitrogen) or modified forms thereof, adenoviral vectors; Adeno-associated virus vectors, baculovirus vectors, yeast vectors (e.g., pESC vectors (Stratagene)).
- mammalian host cells e.g., BPV-1, pHyg, pRSV, pSV2, pTK2 (Maniatis); p
- Nucleotide sequences encoding CTLA4 mutant molecules can integrate into the genome of the eukaryotic host cell and replicate as the host genome replicates.
- the vector carrying CTLA4 mutant molecules can contain origins of replication allowing for extrachromosomal replication.
- the origin of replication from the endogenous yeast plasmid can be used.
- the 2 ⁇ circle can be used.
- sequences from the yeast genome capable of promoting autonomous replication can be used (see, for example, Stinchcomb et al., (1979) Nature 282:39); Tschemper et al, (1980) Gene 10:157; and Clarke et al, (1983) Meth. Enz. 101:300).
- Transcriptional control sequences for yeast vectors include promoters for the synthesis of glycolytic enzymes (Hess et al., (1968) J. Adv. Enzyme Reg. 7:149; Holland et al., (1978) Biochemistry 17:4900). Additional promoters known in the art include the CMV promoter provided in the CDM8 vector (Toyama and Okayama, (1990) FEBS 268:217- 221); the promoter for 3-phosphoglycerate kinase (Hitzeman et al., (1980) J. Biol. Chem. 255:2073), and those for other glycolytic enzymes.
- promoters are inducible because they can be regulated by environmental stimuli or the growth medium of the cells. These inducible promoters include those from the genes for heat shock proteins, alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, enzymes associated with nitrogen catabolism, and enzymes responsible for maltose and galactose utilization.
- Regulatory sequences may also be placed at the 3' end of the coding sequences. These sequences may act to stabilize messenger RNA. Such terminators are found in the 3' untranslated region following the coding sequences in several yeast-derived and mammalian genes.
- Exemplary vectors for plants and plant cells include, but are not limited to, Agrobacterium Tj plasmids, cauliflower mosaic virus (CaMV), and tomato golden mosaic virus (TGMV).
- Mammalian cells can be transformed by methods including but not limited to, transfection in the presence of calcium phosphate, microinjection, electroporation, or via transduction with viral vectors.
- Methods for introducing foreign DNA sequences into plant and yeast genomes include (1) mechanical methods, such as microinjection of DNA into single cells or protoplasts, vortexing cells with glass beads in the presence of DNA, or shooting DNA-coated tungsten or gold spheres into cells or protoplasts; (2) introducing DNA by making cell membranes permeable to macromolecules through polyethylene glycol treatment or subjection to high voltage electrical pulses (electroporation); or (3) the use of liposomes (containing cDNA) which fuse to cell membranes.
- CTLA4 mutant molecules can be detected by methods known in the art.
- the mutant molecules can be detected by Coomassie staining SDS-PAGE gels and immunoblotting using antibodies that bind CTLA4.
- Protein recovery can be performed using standard protein purification means, e.g., affinity chromatography or ion-exchange chromatography, to yield substantially pure product (R. Scopes in: "Protein Purification, Principles and Practice", Third Edition, Springer-Verlag (1994)).
- the invention further provides soluble CTLA4 mutant protein molecules produced by the methods herein.
- site-directed mutagenesis and a novel screening procedure were used to identify several mutations in the extracellular domain of CTLA4 that improve binding avidity for CD86.
- mutations were carried out in residues in the regions of the extracellular domain of CTLA4 from serine 25 to arginine 33, the C strand (alanine 49 and threonine 51), the F strand (lysine 93, glutamic acid 95 and leucine 96), and in the region from methionine 97 through tyrosine 102, tyrosine 103 through glycine 107 and in the G strand at positions glutamine 111, tyrosine 113 and isoleucine 115.
- test molecule can then be injected into the chamber containing the sensor chip and the amount of complementary protein that binds can be assessed based on the change in molecular mass which is physically associated with the dextran-coated side of the sensor chip; the change in molecular mass can be measured by the detector system.
- the invention includes pharmaceutical compositions for use in the treatment of immune system diseases comprising pharmaceutically effective amounts of soluble CTLA4 mutant molecules.
- the immune system diseases are mediated by CD28- and/or CTLA4-positive cell interactions with CD80 and/or CD86 positive cells.
- the soluble CTLA4 molecules are preferably soluble CTLA4 molecules with wildtype sequence and/or soluble CTLA4 molecules having one or more mutations in the extracellular domain of CTLA4.
- the pharmaceutical composition can include soluble CTLA4 or CTLA4 mutant protein molecules and/or nucleic acid molecules, and/or vectors encoding the molecules.
- the soluble CTLA4 mutant molecule has the amino acid sequence of the extracellular domain of CTLA4 as shown in either Figures 3 (L104EA29Y).
- the soluble CTLA4 mutant molecule is L104EA29YIg as disclosed herein shown in Figure 3.
- the compositions may additionally include other therapeutic agents, including, but not limited to, immunosuppressive agents, NSAIDs, corticosteroids, glucococoticoids, drugs, toxins, enzymes, antibodies, or conjugates.
- An embodiment of the pharmaceutical composition comprises an effective amount of a soluble CTLA4 molecule alone or in combination with an effective amount of at least one other therapeutic agent, including an immunosuppressive agent, or NSAJD.
- Effective amounts of soluble CTLA4 in the pharmaceutical composition can range about 0.1 to 100 mg/kg weight of the subject.
- the effective amount can be an amount about 0.5 to 5 mg/kg weight of a subject, about 5 to 10 mg/kg weight of a subject, about 10 to 15 mg/kg weight of a subject, about 15 to 20 mg/kg weight of a subject, about 20 to 25 mg/kg weight of a subject, about 25 to 30 mg/kg weight of a subject, about 30 to 35 mg/kg weight of a subject, about 35 to 40 mg/kg weight of a subject, about 40 to 45 mg/kg of a subject, about 45 to 50 mg/kg weight of a subject, about 50 to 55 mg/kg weight of a subject, about 55 to 60 mg/kg weight of a subject, about 60 to 65 mg/kg weight of a subject, about 65 to 70 mg/kg weight of a subject, about 70 to 75 mg/kg weight of a subject, about 75 to 80 mg/kg weight of a subject, about 80 to 85 mg/kg weight of
- the effective amount is 2 mg/kg weight of a subject. In another embodiment, the effective amount is 10 mg/kg weight of a subject. In an embodiment, the effective amount of a soluble CTLA4 molecule is 2 mg/kg weight of a subject. In an embodiment, the effective amount of a soluble CTLA4 molecule is 10 mg/kg weight of a subject.
- the amount of an immunosuppressive agent administered to a subject varies depending on several factors including the efficacy of the drug on a specific subject and the toxicity (i.e. the tolerability) of a drug to a specific subject.
- Methotrexate is commonly administered in an amount about 0.1 to 40 mg per week with a common dosage ranging about 5 to 30 mg per week. Methotrexate may be administered to a subject in various increments: about 0.1 to 5 mg/week, about 5 to 10 mg/week, about 10 to 15 mg/week, about 15 to 20 mg/week, about 20 to 25 mg/week, about 25 to 30 mg/week, about 30 to 35 mg/week, or about 35 to 40 mg/ week.
- an effective amount of an immunosuppressive agent, including methotrexate is an amount about 10 to 30 mg/week.
- Effective amounts of methotrexate range about 0.1 to 40 mg/week. In one embodiment, the effective amount is ranges about 0.1 to 5 mg/week, about 5 to 10 mg/week, about 10 to 15 mg/week, about 15 to 20 mg/week, about 20 to 25 mg/week, about 25 to 30 mg/week, about 30 to 35 mg/week, or about 35 to 40 mg/ week, hi one embodiment, methotrexate is administered in an amount ranging about 10 to 30 mg/week.
- Cyclophosphamide an alkylating agent
- Cyclophosphamide may be administered in dosages ranging about 1 to 10 mg/kg body weight per day.
- Cyclosporine e.g. NEORAL R
- Cyclosporin A is commonly administered in dosages ranging from about 1 to 10 mg/kg body weight per day. Dosages ranging about 2.5 to 4 mg per body weight per day are commonly used.
- Chloroquine or hydroxychloroquine is commonly administered in dosages ranging about 100 to 1000 mg daily. Preferred dosages range about 200-600 mg administered daily.
- Sulfasalazine e.g., AZULFIDINE EN-tabs R
- Sulfasalazine is commonly administered in amounts ranging about 50 to 5000 mg per day, with a common dosage of about 2000 to 3000 mg per day for adults. Dosages for children are commonly about 5 to 100 mg/kg of body weight, up to 2 grams per day.
- Gold salts are formulated for two types of administration: injection or oral. Injectable gold salts are commonly prescribed in dosages about 5 to 100 mg doses every two to four weeks. Orally administered gold salts are commonly prescribed in doses ranging about 1 to 10 mg per day.
- D-penicillamine or penicillamine (CUPRIMINE R ) is commonly administered in dosages about 50 to 2000 mg per day, with preferred dosages about 125 mg per day up to 1500 mg per day.
- Azatbioprine is commonly administered in dosages of about 10 to 250 mg per day. Preferred dosages range about 25 to 200 mg per day.
- Anakinra e.g. KLNERET R
- a common dosage range for anakinra is about 10 to 250 mg per day, with a recommended dosage of about 100 mg per day.
- Infliximab (REMICADE R ) is a chimeric monoclonal antibody that binds to tumor necrosis factor alpha (TNF ⁇ ). Infliximab is commonly administered in dosages about 1 to 20 mg/kg body weight every four to eight weeks. Dosages of about 3 to 10 mg/kg body weight may be administered every four to eight weeks depending on the subject.
- Etanercept is a dimeric fusion protein that binds the tumor necrosis factor (TNF) and blocks its interactions with TNF receptors.
- Commonly administered dosages of etanercept are about 10 to 100 mg per week for adults with a preferred dosage of about 50 mg per week. Dosages for juvenile subjects range about 0.1 to 50 mg/kg body weight per week with a maximum of about 50 mg per week.
- Leflunomide (ARAVA R ) is commonly administered at dosages about 1 and 100 mg per day. A common daily dosage is about 10 to 20 mg per day.
- the phannaceutical compositions also preferably include suitable carriers and adjuvants which include any material which when combined with the molecule of the invention (e.g., a soluble CTLA4 mutant molecule, e.g., L104EA29YIg) retains the molecule's activity and is non-reactive with the subject's immune system.
- suitable carriers and adjuvants include, but are not limited to, human serum albumin; ion exchangers; alumina; lecithin; buffer substances, such as phosphates; glycine; sorbic acid; potassium sorbate; and salts or electrolytes, such as protamine sulfate.
- compositions comprising such carriers are formulated by well known conventional methods. Such compositions may also be formulated within various lipid compositions, such as, for example, liposomes as well as in various polymeric compositions, such as polymer microspheres.
- compositions of the invention can be administered using conventional modes of administration including, but not limited to, intravenous (i.v.) administration, intraperitoneal (i.p.) administration, intramuscular (i.m.) administration, subcutaneous administration, oral administration, administration as a suppository, or as a topical contact, or the implantation of a slow-release device such as a miniosmotic pump, to the subject.
- i.v. intravenous
- i.p. intraperitoneal
- i.m. intramuscular
- subcutaneous administration oral administration
- administration administration as a suppository, or as a topical contact
- a slow-release device such as a miniosmotic pump
- compositions of the invention may be in a variety of dosage forms, which include, but are not limited to, liquid solutions or suspensions, tablets, pills, powders, suppositories, polymeric microcapsules or microvesicles, liposomes, and injectable or infusible solutions; The preferred form depends upon the mode of administration and the therapeutic application.
- compositions of this invention The most effective mode of administration and dosage regimen for the compositions of this invention depends upon the severity and course of the disease, the patient's health and response to treatment and the judgment of the treating physician. Accordingly, the dosages of the compositions should be titrated to the individual patient.
- the soluble CTLA4 mutant molecules may be administered to a subject in an amount and for a time (e.g. length of time and/or multiple times) sufficient to block endogenous B7 (e.g., CD80 and/or CD86) molecules from binding their respective ligands, in the subject.
- Blockage of endogenous B7/ligand binding thereby inhibits interactions between B7- positive cells (e.g., CD80- and/or CD86-positive cells) with CD28- and/or CTLA4- positive cells.
- Dosage of a therapeutic agent is dependent upon many factors including, but not limited to, the type of tissue affected, the type of autoimmune disease being treated, the severity of the disease, a subject's health, and a subject's response to the treatment with the agents.
- dosages of the agents can vary depending on the subject and the mode of administration.
- the soluble CTLA4 mutant molecules may be administered in an amount between 0.1 to 20.0 mg/kg weight of the patient/day, preferably between 0.5 to 10.0 mg/kg/day.
- Administration of the pharmaceutical compositions of the invention can be performed over various times.
- the pharmaceutical composition of the invention can be administered for one or more hours.
- the administration can be repeated depending on the severity of the disease as well as other factors as understood in the art.
- the present invention provides methods for treating immune system diseases and autoimmune diseases in a subject comprising administering to the subject an effective amount of a soluble CTLA4 or a CTLA4 mutant molecule which binds CD80 and/or CD86 molecules on CD80 and/or CD86-positive cells so as to inhibit binding of CD80 and/or CD86 to CTLA4 and/or CD28.
- the methods comprise administering a therapeutic composition, comprising soluble CTLA4 or CTLA4 mutant molecules of the invention, to a subject in an amount effective to relieve at least one of the symptoms associated with immune system diseases.
- the invention may provide long-term therapy for immune system diseases by blocking the T-cell/B7-positive cell interactions, thereby blocking T-cell activation/stimulation by co-stimulatory signals such as B7 binding to CD28, leading to induction of T-cell anergy or tolerance.
- the soluble CTLA4 or CTLA4 mutant molecules of the invention exhibit inhibitory properties in vivo. Under conditions where T-cell/B7-positive cell interactions, for example T cell/B cell interactions, are occurring as a result of contact between T cells and B7-positive cells, binding of introduced CTLA4 molecules to react to B7- ⁇ ositive cells, for example B cells, may interfere, i.e., inhibit, the T cell/ B7-positive cell interactions resulting in regulation of immune responses. Inhibition of T cell responses by administering a soluble CTLA4 molecule may also be useful for treating autoimmune disorders.
- L104EA29YIg molecule in a subject suffering from or susceptible to an autoimmune disorder may prevent the activation of autoreactive T cells and may reduce or eliminate disease symptoms.
- This method may also comprise administering to the subject L104EA29YIg molecule of the invention, alone or together, with additional ligands, such as those reactive with IL-2, IL-4, or ⁇ -interferon.
- the invention provides methods for regulating immune responses.
- Immune responses may be down-regulated (reduced) by the soluble CTLA4 or CTLA4 mutant molecules of the invention may be by way of inhibiting or blocking an immune response already in progress or may involve preventing the induction of an immune response.
- the soluble CTLA4 or CTLA4 mutant molecules of the invention may inhibit the functions of activated T cells, such as T lymphocyte proliferation and cytokine secretion, by suppressing T cell responses or by inducing specific tolerance in T cells, or both.
- the soluble CTLA4 or CTLA4 mtant molecules of this invention interfering with the CTLA4/CD28/B7 pathway may inhibit T-cell proliferation and/or cytokine secretion, and thus result in reduced tissue destruction and induction of T-cell unresponsiveness or anergy.
- the invention further provides methods for inhibiting rejection of organ or tissue transplants in subjects comprising administering an effective amount of at least one soluble CTLA4 or CTLA4 molecule, e.g., L104EA29YIg, to the subject before, during and/or after transplantation.
- the method of the invention include administering to a subject at least one soluble CTLA4 or a CTLA4 mutant molecule in combination with at least one other therapeutic agent, including, but not limited to a drug, a toxin, an enzyme, an antibody, or a conjugate.
- the organ or tissue transplant can be from any type of organ or tissue amenable to transplantation.
- the transplanted tissue can be a pancreatic tissue, hi a preferred embodiment, the transplant tissue is pancreatic islet cells.
- the invention also provides methods for treating type 1 and/or type 2 diabetes in subjects by inhibiting islet cell transplant rejection.
- the present invention further provides a method for inhibiting pancreatic islet transplant rejection in a subject, the subject being a recipient of transplant tissue.
- rejection of the graft is initiated through its recognition as foreign by T cells, followed by an immune response that destroys the graft.
- Administration of a soluble CTLA4 molecule in the method of this invention inhibits T lymphocyte proliferation and/or cytokine secretion, resulting in reduced tissue destruction and induction of antigen-specific T cell unresponsiveness that may result in long-term graft acceptance, without the need for generalized immunosuppression.
- a preferred embodiment of the invention comprises use of the soluble CTLA4 mutant molecule L104EA29YIg to regulate functional CTLA4- and CD28- positive cell interactions with B7-positive cells, to treat immune system diseases such as diabetes and/or to downregulate immune responses.
- the L104EA29YIg of the invention is a soluble CTLA4 mutant molecule comprising at least the two amino acid changes, the leucine (L) to glutamic acid (E) at position +104 and the alanine (A) to tyrosine (Y) change at position +29.
- the L104EA29YIg molecule may encompass further mutations beyond the two specified herein.
- the method can further comprise administering with the soluble CTLA4 mutant molecules, a base immunosuppressive regimen to the subject.
- the base immunosuppressive regimen can include (but is not limited to): cyclosporin, azathioprine, methotrexate, cyclophosphamide, lymphocyte immune globulin, anti-CD3 antibodies, Rho (D) immune globulin, adrenocorticosteroids, sulfasalzine, FK-506.
- base immunosuppressive regimen is steroid free. More preferably, the base immunosuppressive regimen comprises rapamycin and anti- human IL-2 R mAb.
- An embodiment of the invention comprises use of a molecule to block the interaction between B7 and CTLA4 in conjunction with an immunosuppressive agent to regulate an immune response in order to treat an immune system disease such as diabetes.
- the molecule used to block the B7/CTLA4 interaction may be a soluble CTLA4 such as CTLA4Ig, CTLA4Ig/CD28Ig or L104EA29YIg, a soluble CD28 such as CD28Ig, a soluble B7 (B7-1 or B7-2) such as B7Ig, anti-CTLA4 monoclonal antibodies, anti-CD28 monoclonal antibodies or anti-B7 monoclonal antibodies.
- the subjects treated by the present invention include mammalian subjects, including, human, monkey, ape, dog, cat, cow, horse, goat, pig, rabbit, mouse and rat.
- the present invention provides various methods, local or systemic, for administering the therapeutic compositions of the invention such as soluble CTLA4 molecule alone or in conjunction with an immunosuppressive agent and/or other therapeutic drug.
- the methods include intravenous, intramuscular, intraperitoneal, oral, inhalation and subcutaneous methods, as well as implantable pump, continuous infusion, gene therapy, liposomes, suppositories, topical contact, vesicles, capsules and injection methods.
- the therapeutic agent, compounded with a carrier is commonly lyophilized for storage and is reconstituted with water or a buffered solution with a neutral pH (about pH 7-8, e.g., pH 7.5) prior to administration.
- compositions of the invention may be administered to the subject in any pharmaceutically acceptable form.
- the methods comprise administering to a subject the soluble CTLA4 molecules of the invention to regulate CD28- and/or CTLA4- positive cell interactions with B7-positive cells.
- the B7-positive cells are contacted with an effective amount of the soluble CTLA4 molecules of the invention, or fragments or derivatives thereof, so as to form soluble CTLA4/B7 complexes.
- the complexes interfere with interaction between endogenous CTLA4 and CD28 molecules with B7 family molecules.
- the soluble CTLA4 molecules may be administered to a subject in an amount and for a time (e.g., length of time and/or multiple times) sufficient to block endogenous B7 molecules from binding their respective ligands, in the subject. Blockage of endogenous B7/ligand binding thereby inhibiting interactions between B7-positive cells with CD28- and/or CTLA4-positive cells.
- Dosage of a therapeutic agent is dependant upon many factors including, but not limited to, the type of tissue affected, the type of autoimmune disease being treated, the severity of the disease, a subject's health and response to the treatment with the agents. Accordingly, dosages of the agents can vary depending on each subject and the mode of administration.
- the soluble CTLA4 molecules may be administered in an amount from about 0.1 to 100 mg/kg weight of the patient/day.
- the invention also encompasses the use of the compositions of the invention together with other pharmaceutical agents to treat immune system diseases.
- diabetes may be treated with molecules of the invention in conjunction with, but not limited to, immunosuppressive agents such as corticosteroids, cyclosporin (Mathiesen 1989 Cancer Jett. 44(2):151-156), prednisone, azathioprine, (R. Handschumacher, in: "Drugs Used for Immunosuppression” pages 1264-1276), TNF ⁇ blockers or antagonists (New England Journal of Medicine, vol. 340: 253-259, 1999; The Lancet vol. 354: 1932-39, 1999, Annals of Internal Medicine, vol.
- immunosuppressive agents such as corticosteroids, cyclosporin (Mathiesen 1989 Cancer Jett. 44(2):151-156), prednisone, azathioprine, (R. Handschumacher, in: "Drugs Used for Immunosuppression” pages 1264-1276), TNF ⁇ block
- the soluble CTLA4 molecules can also be used in combination with one or more of the following agents to regulate an immune response: soluble gp39 (also known as CD40 ligand (CD40L), CD154, T-BAM, TRAP), soluble CD29, soluble CD40, soluble CD80 (e.g. ATCC 68627), soluble CD86, soluble CD28 (e.g. 68628), soluble CD56, soluble Thy-1, soluble CD3, soluble TCR, soluble VLA-4, soluble VCAM-1, soluble LECAM-1, soluble ELAM-1, soluble CD44, antibodies reactive with gp39 (e.g.
- ATCC HB-10916, ATCC HB-12055 and ATCC HB-12056 antibodies reactive with CD40 (e.g. ATCC HB-9110), antibodies reactive with B7 (e.g. ATCC HB-253, ATCC CRL-2223, ATCC CRL-2226, ATCC HB-301, ATCC HB- 11341, etc), antibodies reactive with CD28 (e.g. ATCC HB- 11944 or mAb 9.3 as described by Martin et al (J. Clin. Immun. 4(l):18-22, 1980), antibodies reactive with LFA-1 (e.g.
- antibodies reactive with LFA-2 antibodies reactive with IL-2, antibodies reactive with IL-12, antibodies reactive with IFN-gamma, antibodies reactive with CD2, antibodies reactive with CD48, antibodies reactive with any ICAM (e.g., ICAM-1 (ATCC CRL-2252), ICAM-2 and ICAM-3), antibodies reactive with CTLA4 (e.g. ATCC HB-304),, antibodies reactive with Thy-1, antibodies reactive with CD56, antibodies reactive with CD3, antibodies reactive with CD29, antibodies reactive with TCR, antibodies reactive with VLA-4, antibodies reactive with VCAM-1, antibodies reactive with LECAM-1, antibodies reactive with ELAM-1, antibodies reactive with CD44.
- monoclonal antibodies are preferred.
- antibody fragments are preferred.
- the combination can include the soluble CTLA4 molecules of the invention and one other immunosuppressive agent, the soluble CTLA4 molecules with two other immunosuppressive agents, the soluble CTLA4 molecules with three other immunosuppressive agents, etc.
- the determination of the optimal combination and dosages can be determined and optimized using methods well known in the art.
- L104EA29YIg and CD80 monoclonal antibodies mAbs
- L104EA29YIg and CD86 mAbs L104EA29YIg, CD80 mAbs, and CD86 mAbs
- L104EA29YIg and gp39 mAbs L104EA29YIg and CD40 mAbs
- L104EA29YIg and CD28 mAbs L104EA29YIg, CD80 and CD86 mAbs, and g ⁇ 39 mAbs
- L104EA29YIg, CD80 and CD86 mAbs and CD40 mAbs and L104EA29YIg, anti-LFAl mAb, and anti-gp39 mAb.
- a specific example of a gp39 mAb is MR1.
- Other combinations will be readily appreciated and understood by persons skilled in the art.
- the soluble CTLA4 molecules of the invention may be administered as the sole active ingredient or together with other drugs in immunomodulating regimens or other anti-inflammatory agents e.g., for the treatment or prevention of allo- or xenograft acute or chronic rejection or inflammatory or autoimmune disorders, or to induce tolerance.
- a calcineurin inhibitor e.g. cyclosporin A or FK506
- an immunosuppressive macrolide e.g. rapamycine or a derivative thereof (e.g. 40-O-(2- hydroxy)ethyl-rapamycin
- a lymphocyte homing agent e.g.
- FTY720 or an analog thereof corticosteroids; cyclophosphamide; azathioprene; methotrexate; leflunomide or an analog thereof; mizoribine; mycophenolic acid; mycophenolate mofetil; 15- deoxyspergualine or an analog thereof; immunosuppressive monoclonal antibodies, e.g., monoclonal antibodies to leukocyte receptors, e.g., MHC, CD2, CD3, CD4, CD lla/CD18, CD7, CD25, CD 27, B7, CD40, CD45, CD58, CD 137, ICOS, CD150 (SLAM), OX40, 4-1BB or their ligands; or other immunomodulatory compounds, e.g.
- immunosuppressive monoclonal antibodies e.g., monoclonal antibodies to leukocyte receptors, e.g., MHC, CD2, CD3, CD4, CD lla/CD18, CD7, CD25, CD 27, B7, CD40,
- CTLA4/CD28-Ig or other adhesion molecule inhibitors, e.g. mAbs or low molecular weight inhibitors including LFA-1 antagonists, Selectin antagonists and VLA-4 antagonists.
- the compound is particularly useful in combination with a compound that interferes with CD40 and its ligand, e.g. antibodies to CD40 and antibodies to CD40-L.
- soluble CTLA4 mutant molecules of the invention are administered in conjunction with other immunosuppressive/immunomodulatory or anti-inflammatory therapy, e.g. as hereinabove specified
- dosages of the co-administered immunosuppressive, immunomodulatory or anti-inflammatory compound will of course vary depending on the type of co-drug employed, e.g. whether it is a steroid or a cyclosporin, on the specific drug employed, on the condition being treated and so forth.
- the present invention provides in a yet further aspect methods as defined above comprising co-administration, e.g. concomitantly or in sequence, of a therapeutically effective amount of soluble CTLA4 molecules of the invention, e.g. CTLA4Ig and or L104EA29YIg, in free form or in pharmaceutically acceptable salt form, and a second drug substance, said second drug substance being an immunosuppressive, immunomodulatory or anti-inflammatory drug, e.g. as indicated above.
- a therapeutically effective amount of soluble CTLA4 molecules of the invention e.g. CTLA4Ig and or L104EA29YIg
- a second drug substance being an immunosuppressive, immunomodulatory or anti-inflammatory drug, e.g. as indicated above.
- therapeutic combinations e.g.
- kits comprising a soluble CTLA4 molecule, in free form or in pharmaceutically acceptable salt form, to be used concomitantly or in sequence with at least one pharmaceutical composition comprising an immunosuppressive, immunomodulatory or anti-inflammatory drug e.g., NSAID, glucocorticoid or corticosteroid.
- the kit may comprise instructions for its administration.
- the kits of the invention can be used in any method of the present invention.
- rejection of tissue or organ transplant is inhibited by administering to a subject soluble CTLA4 and T cell depleted bone marrow cells to the subject.
- Administration of T cell depleted bone marrow can occur at approximately the same time that the subject receives the tissue or organ transplant or at a different time.
- Administration of bone marrow at approximately the same time indicates that the bone marrow is administered to the subject as part of the preparation for the procedures for administering the tissue or organ transplant. It is not required that the bone marrow be transplanted at exactly the same time (i.e., within minutes of) as the organ transplant.
- the T cell depleted bone marrow is administered before the organ transplant.
- Particular embodiments include administering the T cell depleted bone marrow within a day, within twelve hours, or within six hours of the solid organ transplant.
- the T cell depleted bone marrow can be administered earlier, so long as the resulting effects of the T cell depleted bone marrow are still achieved in connection with the organ or tissue transplant.
- it may be desired to administer T cell depleted bone marrow after the organ transplant.
- the method comprises administering a dose of T cell depleted bone marrow cells (tolerizing dose) to a subject, and subsequently admimstering an additional dose of T cell depleted bone marrow cells (engrafting dose) to the subject.
- the immunosuppressive agent comprises at least one or more types of ligands that interfere with the binding of CD28 antigen to CD80 and/or CD86 antigen.
- the ligand is preferably a mutant CTLA4 molecule, such as L104EA29YIg.
- the amount of T cell depleted bone marrow may be determined by routine experimentation and optimized empirically. For example, the amount of T cell depleted bone marrow can be titrated during routine experimentation to determine the amount sufficient to achieve the desired effects.
- the methods of the invention may also be practiced by administering, in addition to the soluble CTLA4 mutant molecule, two or more doses of T cell depleted bone marrow to the subject, alone, or in combination with, one or more immunosuppressive agents.
- admimsfration of a soluble CTLA4 or mutant CTLA4 molecule can be accomplished in many different ways including local or systemic administration routes.
- soluble CTLA4 mutant molecules can be administered intravenously, intramuscularly, or intraperitoneally.
- mutant CTLA4 may be administered orally or subcutaneously.
- Other methods of administration will be recognized by those skilled in the art.
- T cell depleted bone marrow can administered in many different ways as known by persons skilled in the art. One example is by way of intravenous infusion.
- the immunosuppressive agent(s) can be administered before or after administration of soluble CTLA4 mutant and/or before or after the organ/tissue transplant.
- the bone marrow and immunosuppressive agent are administered before administration of soluble CTLA4 mutant molecule.
- a first dose of T cell depleted bone marrow (tolerizing dose) and the immunosuppressive agent is administered at approximately the same time as the organ transplant.
- This example provides a description of the methods used to generate the nucleotide sequences encoding the soluble CTLA4 mutant molecules of the invention.
- a single-site mutant L104EIg was generated and tested for binding kinetics to CD80 and/or CD86.
- the L104EIg nucleotide sequence was used as a template to generate the double-site mutant CTLA4 sequence, L104EA29YIg, which was tested for binding kinetics to CD80 and/or CD86.
- Mutagenic oligonucleotide PCR primers were designed for random mutagenesis of a specific cDNA codon by allowing any base at positions 1 and 2 of the codon, but only guanine or thymine at position 3 (XXG/T; also known as NNG/T). hi this manner, a specific codon encoding an amino acid could be randomly mutated to code for each of the 20 amino acids. In that regard, XXG/T mutagenesis yields 32 potential codons encoding each of the 20 amino acids.
- PCR products encoding mutations in close proximity to -M97-G107 of CTLA4Ig were digested with Sacl/Xbal and subcloned into similarly cut CTLA4Ig ⁇ LN expression vector. This method was used to generate the single-site CTLA4 mutant molecule L104EIg. For mutagenesis in proximity to S25-R33 of CTLA4Ig, a silent Nhel restriction site was first introduced 5' to this loop, by PCR primer-directed mutagenesis. PCR products were digested with Nhel/Xbal and subcloned into similarly cut CTLA4Ig or L104EIg expression vectors.
- This method was used to generate the double-site CTLA4 mutant molecule L104EA29YIg ( Figure 3).
- the nucleic acid molecule encoding the single-site CTLA4 mutant molecule, L104EIg was used as a template to generate the double-site CTLA4 mutant molecule, L104EA29YIg.
- the following provides a description of the screening methods used to identify the single- and double-site mutant CTLA4 polypeptides, expressed from the constructs described in Example 1, that exhibited a higher binding avidity for CD80 and CD86 antigens, compared to non-mutated CTLA4Ig molecules.
- CTLA4Ig by itself is unable to completely block the priming of antigen specific activated T cells.
- In vitro studies with CTLA4Ig and either monoclonal antibody specific for CD80 or CD86 measuring inhibition of T cell proliferation indicate that anti-CD80 monoclonal antibody did not augment CTLA4Ig inhibition.
- anti-CD86 monoclonal antibody did augment the inhibition, indicating that CTLA4Ig was not as effective at blocking CD86 interactions.
- the soluble CTLA4 mutant molecules described in Example 1 above were screened using a novel screening procedure to identify several mutations in the extracellular domain of CTLA4 that improve binding avidity for CD80 and CD86.
- This screening strategy provided an effective method to directly identify mutants with apparently slower "off rates without the need for protein purification or quantitation since "off rate determination is concentration independent (O'Shannessy et al., (1993) Anal. Biochem., 212:457-468).
- COS cells were transfected with individual miniprep purified plasmid DNA and propagated for several days.
- Three day conditioned culture media was applied to BIAcore biosensor chips (Pharmacia Biotech AB, Uppsala, Sweden) coated with soluble CD80Ig or CD86Ig.
- the specific binding and dissociation of mutant proteins was measured by surface plasmon resonance (O'Shannessy, D. J., et al, (1993) Anal. Biochem. 212:457-468). All experiments were run on BIAcoreTM or BIAcoreTM 2000 biosensors at 25°C.
- Ligands were immobilized on research grade NCM5 sensor chips (Pharmacia) using standard N-ethyl-N'-(dimethylaminopropyl) carbodiimidN- hydroxysuccinimide coupling (Johnsson, B., et al. (1991) Anal. Biochem. 198: 268-277; Khilko, S.N., et al.(1993) J. Biol. Chem 268:5425-15434).
- COS cells grown in 24 well tissue culture plates were transiently transfected with DNA encoding mutant CTLA4Ig.
- Culture media containing secreted soluble mutant CTLA4Ig was collected 3 days later.
- Conditioned COS cell culture media was allowed to flow over BIAcore biosensor chips derivatized with CD86Ig or CD80Ig (as described in Greene et al., 1996 J. Biol. Chem. 271:26762-26771), and mutant molecules were identified with "off rates slower than that observed for wild type CTLA4Ig.
- the cDNAs corresponding to selected media samples were sequenced and DNA was prepared to perform larger scale COS cell transient transfection,- fronTwhich mutant CTLA4Ig protein was prepared following protein A purification of culture media.
- BIAcore analysis conditions and equilibrium binding data analysis were performed as described in J. Greene et al. 1996 J. Biol. Chem. 271:26762-26771, and as described herein.
- Senosorgram baselines were normalized to zero response units (RU) prior to analysis. Samples were run over mock-derivatized flow cells to determine background response unit (RU) values due to bulk refractive index differences between solutions. Equilibrium dissociation constants (K d ) were calculated from plots of eq versus C, where R eq is the steady-state response minus the response on a mock-derivatized chip, and C is the molar concentration of analyte. Binding curves were analyzed using commercial nonlinear curve-fitting software (Prism, GraphPAD Software).
- the binding site model was used except when the residuals were greater than machine background (2-10 RU, according to machine), in which case the two-binding site model was employed.
- Murine mAb L307.4 (anti-CD80) was purchased from Becton Dickinson (San Jose, California) and IT2.2 (anti-B7-0 [also known as CD86]), from Pharmingen (San Diego, California).
- CD80-positive and/or CD86-positive CHO cells were removed from their culture vessels by incubation in phosphate-buffered saline (PBS) containing lOmM EDTA.
- PBS phosphate-buffered saline
- CHO cells (1-10 x 10 5 ) were first incubated with mAbs or immunoglobulin fusion proteins in DMEM containing 10% fetal bovine serum (FBS), then washed and incubated with fluorescein isothiocyanate-conjugated goat anti-mouse or anti-human immunoglobulin second step reagents (Tago, Burlingame,- California). Cells were given a final wash and analyzed on a FACScan (Becton Dickinson).
- FBS fetal bovine serum
- CTLA4Ig 25 ⁇ g
- L104EA29YIg 25 ⁇ g
- CTLA4Ig 25 ⁇ g
- L104EA29YIg 25 ⁇ g
- TSK-GEL G300 SWX column 7.8 x 300mm, Tosohaas, Montgomeryville, PA
- CTLA4Xri2ng and L104EA29YXr 1 n CTLA4Xri2ng and L104EA29YXr 1 n .
- Single chain CTLA4X ⁇ 2 os was prepared as previously described (Linsley et al., (1995) Biol. Chem., 270:15417-15424). Briefly, an oncostatin M CTLA4 (OMCTLA4) expression plasmid was used as a template, the forward primer, GAGGTGATAAAGCTTCACCAATGGGTGTACTGCTCACACAG (SEQ ID NO.: 17) was chosen to match sequences in the vector; and the reverse primer,
- GTGGTGTATTGGTCTAGATCAATCAGAATCTGGGCACGGTTC corresponded to the last seven amino acids (i.e. amino acids 118-124) in the extracellular domain of CTLA4, and contained a restriction enzyme site, and a stop codon (TGA).
- the reverse primer specified a C120S (cysteine to serine at position 120) mutation.
- the nucleotide sequence GCA (nucleotides 34-36) of the reverse primer shown above is replaced with one of the following nucleotide sequences: AGA, GGA, TGA, CGA, ACT, or GCT.
- nucleotide sequence GCA is a reversed complementary sequence of the codon TGC for cysteine.
- nucleotide sequences AGA, GGA, TGA, CGA, ACT, or GCT are the reversed complementary sequences of the codons for serine.
- Polymerase chain reaction products were digested with HindHVXbal and directionally subcloned into the expression vector ⁇ LN (Bristol-Myers Squibb Company, Princeton, NJ). L104EA29YXc ⁇ 2 os was prepared in an identical manner. Each construct was verified by DNA sequencing.
- Mutagenesis of sites S25, T30, K93, L96, Y103, and G105 resulted in the identification of some mutant proteins that had slower "off rates from CD86Ig. However, in these instances, the slow "off rate was compromised by a slow "on” rate which resulted in mutant proteins with an overall avidity for CD86Ig that was apparently similar to that seen with wild type CTLA4Ig. In addition, mutagenesis of K93 resulted in significant aggregation which may have been responsible for the kinetic changes observed.
- L104EA29YIg ( ⁇ 1 ⁇ g; lane 3) and L104EIg ( ⁇ 1 ⁇ g; lane 2) apparently had the same electrophoretic mobility as CTLA4Ig ( ⁇ 1 ⁇ g; lane 1) under reducing ( ⁇ 50kDa; +BME; plus 2-mercaptoethanol) and non-reducing (-lOOkDa; -BME) conditions (FIG. 14A).
- Size exclusion chromatography demonstrated that L104EA29YIg (FIG. 14C) apparently had the same mobility as dimeric CTLA4Ig (FIG. 14B).
- the major peaks represent protein dimer while the faster eluting minor peak in FIG. 14B represents higher molecular weight aggregates.
- Approximately 5.0% of CTLA4Ig was present as higher molecular weight aggregates but there was no evidence of aggregation of L104EA29YIg or L104EIg. Therefore, the stronger binding to CD86Ig seen with L104EIg and L104EA29YIg could not be attributed to aggregation induced by mutagenesis.
- L104EA29YIg 3.66 nM
- L104EIg 4.47 nM
- CTLA4Ig 6.51 nM
- L104EA29YXc ⁇ os bound with approximately 2-fold higher affinity than CTLA4Xc ⁇ os to both CD80Ig and CD86Ig.
- the increased affinity was due to approximately 3-fold slower rate of dissociation from both ligands. Therefore, stronger ligand binding by L104EA29Y was most likely due to avidity enhancing structural changes that had been introduced into each monomeric chain rather than alterations in which the molecule dimerized.
- the structural consequences of the two avidity enhancing mutants were assessed by modeling.
- the A29Y mutation can be easily accommodated in the cleft between the S25-R33 region and the MYPPPY region, and may serve to stabilize the conformation of the MYPPPY region.
- LI 04 forms extensive hydrophobic interactions with L96 and V94 near the MYPPPY region.
- the glutamic acid mutation adopts a conformation similar to that of LI 04 for two reasons.
- Second, the energetic costs of burying the negative charge of the glutamic acid side chain in the hydrophobic region would be large. Instead, modeling studies predict that the glutamic acid side chain flips out on to the surface where its charge can be stabilized by solvation.
- Such a conformational change can easily be accommodated by G105, with minimal distortion to other residues in the regions.
- FIG. 9 FACS analysis (Fig. 9) of CTLA4Ig and mutant molecules binding to stably transfected CD ⁇ 0+ and CD86+CHO cells was performed as described herein.
- CD ⁇ O-positive and CD ⁇ 6-positive CHO cells were incubated with increasing concentrations of CTLA4Ig, L104EA29YIg, or L104EIg, and then washed.
- Bound immunoglobulin fusion protein was detected using fluorescein isothiocyanate-conjugated goat anti-human immunoglobulin.
- L104EA29YIg, L104EIg, and CTLA4Ig Binding of L104EA29YIg, L104EIg, and CTLA4Ig to human CD80-transfected CHO cells is approximately equivalent (FIG. 9A).
- L104EA29YIg and L104E ⁇ g bind more strongly to CHO cells stably transfected with human CD86 than does CTLA4Ig (FIG. 9B).
- CD4-positive T cells Human CD4-positive T cells were isolated by immunomagnetic negative selection (Linsley et al., (1992) J. Exp. Med. 176:1595-1604). Isolated CD4-positive T cells were stimulated with phorbal myristate acetate (PMA) plus CD80-positive or CD ⁇ 6-positive CHO cells in the presence of titrating concentrations of inhibitor. CD4-positive T cells ( ⁇ -10 x 10 4 /well) were cultured in the presence of 1 nM PMA with or without irradiated CHO cell stimulators. Proliferative responses were measured by the addition of 1 ⁇ Ci/well of [3H]thymidine during the final 7 hours of a 72 hour culture.
- PMA phorbal myristate acetate
- CD80-positive or CD ⁇ 6-positive CHO cells in the presence of titrating concentrations of inhibitor.
- CD4-positive T cells ⁇ -10 x 10 4 /well were cultured in the
- L104EA29YIg inhibits proliferation of CD ⁇ O-positive PMA treated CHO cells more than CTLA4Ig (FIG. 10A).
- L104EA29YIg is also more effective than CTLA4Ig at inhibiting proliferation of CD86-positive PMA treated CHO cells (FIG. 10B). Therefore, L104EA29YIg is a more potent inhibitor of both CD80- and CD ⁇ 6-mediated costimulation of T cells.
- Figure 11 shows inhibition by L104EA29YIg and CTLA4Ig of allostimulated human T cells prepared above, and further allostimulated with a human B lymphoblastoid cell line (LCL) called PM that expressed CD ⁇ O and CD ⁇ 6 (T cells at 3.0xl0 4 /well and PM at ⁇ .0xl0 3 /well).
- LCL human B lymphoblastoid cell line
- L104EA29YIg and CTLA4Ig are shown in Figure 13.
- Peripheral blood mononuclear cells (PBMC'S; 3.5xl0 4 cells/well from each monkey) from 2 monkeys were purified over lymphocyte separation medium (LSM) and mixed with 2 ⁇ g/ml phytohemaglutmin (PHA). The cells were stimulated 3 days then pulsed with radiolabel 16 hours before harvesting.
- L104EA29YIg inhibited monkey T cell proliferation better than CTLA4Ig. Table I
- This example provides a description of donor pancreatectomy and islet isolation, and islet transplant procedures in an animal model.
- Donor Pancreatectomy and Islet Isolation The donor pancreatectomy was performed one day prior to transplantation. The procedure was performed under general anesthesia (a combination of parenteral ketamine and Isolflurane by inhalation) through a midline abdominal incision. The splenorenal and splenocolic ligaments were divided so that the spleen, together with the tail of the pancreas was mobilized. The head of the pancreas and second portion of the duodenum were mobilized following Kocher maneuver. After administration of heparin (200U/kg), the aorta was cannulated just above its bifurcation and the animal was exsanguinated.
- heparin 200U/kg
- Rhesus monkey islet isolation was completed via minor modifications of the automated method for human islet isolation (Ricordi, (1988) Diabetes, 37: 413; Ranuncoli, (2000) Cell Transplant 9: 409) by using Liberase (Roche/Boehringer Mannheim, Indpls, IN) at a concentration of 0.47-0.71 mg/ml.
- Liberase Roche/Boehringer Mannheim, Indpls, IN
- a three layer, discontinuous Euroficoll gradient densities 1.108, 1.097, 1.037; Meditech, Herndon, VA) and a Cobe 2991 blood cell processor (Gambro, Lakewood, CO) were used for purification of islets from the pancreatic digest. Samples of the final islet preparation were stained with dithizone (Sigma, St.
- pancreatectomy and Intrahepatic Islet Cell Transplantation were performed at least one week prior to transplant.
- the tail and body of the pancreas were dissected along the splenic artery and vein, which were carefully preserved by ligating and dividing only pancreatic branches.
- the inferior mesenteric and middle colic veins were identified and preserved during dissection of the body of the pancreas.
- the portal and superior mesenteric veins were recognized and pancreatic veins were ligated and divided.
- the duodenum was mobilized and branches of the pancreaticoduodenal vessels that entered the pancreas were ligated and divided, leaving the duodenal branches intact.
- the common bile duct was identified and preserved during blunt dissection between the head of the pancreas and the c-loop of the duodenum.
- the main and accessory pancreatic ducts were hgated, divided, and the pancreas was removed from the abdominal cavity. All animals underwent intravenous glucose tolerance test to evaluate the efficacy of the pancreatectomy procedure. All were documented to be c-peptide negative prior to islet transplantation.
- L104EA29YIg was administered intravenously intra-operatively (10 mg/kg) and on post-operative days 4 (15mg/kg), 14, 28, 42, 56, 70, 84, 98, 112, 126 (20mg/kg) to maintain serum trough levels greater than 30 ⁇ g/ml.
- the chimeric anti-human IL-2R mAb (0.3mg/kg iv), was administered intra-operatively and on POD 4.
- Sirolimus Rosolimus (Rapamune®) was administered orally 1.25mg/kg bid (target levels 10-15) POD 0-50, Img/kg bid (target levels 7-10) POD 50-100, and then tapered to terminate dosing by POD130.
- Sirolimus Rosolimus
- Tacrolimus Prograf®
- the chimeric anti-human JL-2R mAb was provided by Novartis Pharma AG (Basel, Switzerland).
- Detection of Anti-donor antibodies The presence of detectable donor specific alloantibody was determined using flow cytometry. Peripheral blood leukocytes served as the target cells for the pre-transplant analysis. Leukocytes isolated from mesenteric lymph nodes obtained at the time of transplant were the target cells for the post-transplant assays.
- Anti-donor enzyme-linked immunospot assay Responses were measured by interferon- ⁇ (IFN- ⁇ ) enzyme-linked immunospot (ELISpot) assay using peripheral blood leukocytes obtained from the recipient and donor animals.
- IFN- ⁇ interferon- ⁇
- ELISpot enzyme-linked immunospot
- CD28 pathway blockade-based therapy prolongs the survival of the islet allografts in Rhesus macaques. Diabetes was induced by surgical pancreatectomy of recipient animals and confirmed by pretransplant intravenous glucose tolerance test. Donor- recipient pairings were defined based on molecular typing using a panel of previously defined major histocompatibilty alleles (8 class I and 12 class H) (Lobashevsky A, et al., Tissue Antigens 54:254 -263, (1999); Knapp LA, et al., Tissue Antigens 50:657-661, (1997); Watkins D.I., Crit Rev Immunol 15:1-29, (1995)).
- major histocompatibilty alleles 8 class I and 12 class H
- control animals required insulin replacement therapy within one week of islet transplant (Figure 6).
- Four of five animals receiving the L104EA29YIg regimen enjoyed rejection-free survival for the duration of the treatment period (Table III).
- Intravenous glucose tolerance test with measurement of insulin and glucose levels confirmed islet function posttransplant (representative animal, Figures 7 and 16D). Table III
- L104EA29YIg therapy inhibits priming of anti-donor T- and B-cell responses.
- the frequency of primed alloreactive T-cells can effectively be detected by using the ELISpot assay, which can discriminate production of IFN- ⁇ at the single-cell level.
- Peripheral blood samples from islet recipients were analyzed at various time points both pre- and posttransplant for their ability to generate IFN- ⁇ in response to donor antigen. Animals treated with the base regimen alone quickly developed a measurable anti-donor response that coincided with rejection 1 week after transplant.
- the frequency of anti- donor IFN- ⁇ producing cells in animals receiving the L104EA29YIg-containing regimen was undetectable until therapy was withdrawn (representative animals, Figure l A and B).
- the L104EA29YIg regimen effectively blocked the generation of anti-donor T- cell responses as measured by the ability to produce JFN- ⁇ .
- Islet transplantation is quickly becoming a viable treatment option for patients with brittle type 1 diabetes.
- the elimination of glucocorticoids from immunosuppressive regimens represents a major step forward in the effort to treat type 1 diabetes, the reliance on calcineurin inhibitor therapy for primary immunosuppression may limit the application of this approach.
- Calcineurin inhibitors have numerous unwanted side effects, including nephrotoxicity, diabetes, hypertension, impaired lipid metabolism, and hirasitism (Kahan B.D.
- Blockade of T-cell costimulatory pathways is a promising strategy for the development of nontoxic immunosuppressive and potentially tolerogenic regimens.
- This approach targets those T-cells that receive "signal 1" during the period of drug admimsfration. For example, treatment during the peritransplant period is thought to render allo-specific T- cells impotent upon encounter with the new organ or tissue, whereas other T-cells are left unimpaired (Li Y, et al, Nat Med 5:1298-1302, 1999).
- Blockade of the CD28/B7 pathway has demonstrated remarkable promise in experimental models of autoimmumty and transplantation, making it a particularly appealing immunosuppressive target in islet transplantation, where presumably both auto- and allo-immune obstacles exist.
- CTLA4-Ig The potential of CD2 ⁇ blockade in a large animal transplant model was described by Levisetti MG, et al, (J Immunol 159:5187-5191, 1997).
- Treatment with CTLA4-Ig was found to significantly, although modestly, prolong islet allograft survival in nonhuman primates (Levisetti MG, et al, J Immunol 159:5187-5191, 1997).
- CTLA4-Ig monotherapy does little to prolong renal allograft survival (Pearson T. et al., (Abstract). In Programs and Abstracts of the 17th American Society of Transplant Physicians Annual Meeting, Chicago, 10-14 May 1997. Chicago, American Society of Transplant Physicians).
- the biologic agent L104EA29YIg is a potent immunosuppressant.
- L104EA29YIg may replace Tacrolimus in the Edmonton protocol, thereby eliminating the unwanted side effects of the calcineurin inhibitor.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Diabetes (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Physical Education & Sports Medicine (AREA)
- Dermatology (AREA)
- Cell Biology (AREA)
- Rheumatology (AREA)
- Neurology (AREA)
- Mycology (AREA)
- Pain & Pain Management (AREA)
- Endocrinology (AREA)
- Emergency Medicine (AREA)
- Transplantation (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE60225914T DE60225914T2 (de) | 2001-05-23 | 2002-05-23 | Verfahren zum schützen eines allogenen inseltransplantats mit löslichen ctla4-mutationsmolekülen |
| CA2447921A CA2447921C (en) | 2001-05-23 | 2002-05-23 | Methods for protecting allogeneic islet transplant using soluble ctla4 mutant molecules |
| JP2002590923A JP4837880B2 (ja) | 2001-05-23 | 2002-05-23 | 可溶性ctla4突然変異体分子を使って同種異系島移植片を保護する方法 |
| MXPA03010568A MXPA03010568A (es) | 2001-05-23 | 2002-05-23 | Metodos para proteger trasplantes alogenicos de celulas de isletas usando moleculas mutantes ctla4 solubles. |
| PL364578A PL204899B1 (pl) | 2001-05-23 | 2002-05-23 | Zastosowanie rozpuszczalnej zmutowanej cząsteczki CTLA4 |
| AU2002305716A AU2002305716B2 (en) | 2001-05-23 | 2002-05-23 | Methods for protecting allogeneic islet transplant using soluble CTLA4 mutant molecules |
| DK02734556T DK1397153T3 (da) | 2001-05-23 | 2002-05-23 | Fremgangsmåde til beskyttelse af allogent ö-celle-transplantat ved anvendelse af oplöselige CTLA4-mutantmolekyler |
| SI200230684T SI1397153T1 (sl) | 2001-05-23 | 2002-05-23 | Postopek za zaĺ äśito alogenega presadka celic pankreatiäśnih otoäśkov, s topnimi ctla4 mutantnimi molekulami |
| HU0401590A HU229680B1 (hu) | 2001-05-23 | 2002-05-23 | Eljárások allogén sziget átültetés védelmére oldható CTLA4 mutáns molekulák alkalmazásával |
| EP02734556A EP1397153B1 (en) | 2001-05-23 | 2002-05-23 | Methods for protecting allogeneic islet transplant using soluble ctla4 mutant molecules |
| NO20035176A NO332465B1 (no) | 2001-05-23 | 2003-11-21 | Anvendelse av loselige, muterte CTLA4-molekyler for fremstilling av et medikament for a inhibere avstotning av oycelletransplantat. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US29340201P | 2001-05-23 | 2001-05-23 | |
| US60/293,402 | 2001-05-23 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2002094202A2 true WO2002094202A2 (en) | 2002-11-28 |
| WO2002094202A3 WO2002094202A3 (en) | 2003-06-26 |
| WO2002094202B1 WO2002094202B1 (en) | 2003-07-31 |
Family
ID=23128937
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2002/016708 Ceased WO2002094202A2 (en) | 2001-05-23 | 2002-05-23 | Methods for protecting allogeneic islet transplant using soluble ctla4 mutant molecules |
Country Status (17)
| Country | Link |
|---|---|
| US (2) | US7304033B2 (https=) |
| EP (1) | EP1397153B1 (https=) |
| JP (1) | JP4837880B2 (https=) |
| AT (1) | ATE390931T1 (https=) |
| AU (1) | AU2002305716B2 (https=) |
| CA (1) | CA2447921C (https=) |
| CY (1) | CY1108127T1 (https=) |
| CZ (1) | CZ305380B6 (https=) |
| DE (1) | DE60225914T2 (https=) |
| DK (1) | DK1397153T3 (https=) |
| ES (1) | ES2302811T3 (https=) |
| HU (1) | HU229680B1 (https=) |
| MX (1) | MXPA03010568A (https=) |
| NO (1) | NO332465B1 (https=) |
| PL (1) | PL204899B1 (https=) |
| PT (1) | PT1397153E (https=) |
| WO (1) | WO2002094202A2 (https=) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006108035A1 (en) * | 2005-04-06 | 2006-10-12 | Bristol-Myers Squibb Company | Methods for treating immune disorders associated with graft transplantation with soluble ctla4 mutant molecules |
| WO2007087521A3 (en) * | 2006-01-24 | 2007-11-01 | Bristol Myers Squibb Co | Cd86 and cd80 receptor competition assays |
| WO2008014035A3 (en) * | 2006-07-25 | 2008-04-03 | Univ California | Modulation of nkg2d and method for treating or preventing solid organ allograft rejection |
| US20090191608A1 (en) * | 2008-01-22 | 2009-07-30 | Baylor Research Institute | Pancreatic Islet Cell Preparation and Transplantation |
| EP1935427A3 (en) * | 2000-07-03 | 2011-05-25 | Bristol-Myers Squibb Company | Uses of soluble CTLA4 mutant molecules |
| US8148332B2 (en) | 2000-07-03 | 2012-04-03 | Bristol-Myers Squibb Company | Method for treating a rheumatic disease using a soluble TLA4 molecule |
| US10508144B2 (en) | 2005-12-20 | 2019-12-17 | Bristol-Myers Squibb Company | Carbohydrate content of CTLA4 molecules |
| US10851150B2 (en) | 2005-12-20 | 2020-12-01 | Bristol-Myers Squibb Company | Carbohydrate content of CTLA4 molecules |
Families Citing this family (73)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6887471B1 (en) * | 1991-06-27 | 2005-05-03 | Bristol-Myers Squibb Company | Method to inhibit T cell interactions with soluble B7 |
| US5637481A (en) | 1993-02-01 | 1997-06-10 | Bristol-Myers Squibb Company | Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell |
| EP0892643B2 (en) * | 1996-03-20 | 2009-09-02 | Bristol-Myers Squibb Company | Methods for inhibiting an immune response by blocking the gp39/cd40 and ctla4/cd28/b7 pathways and compositions for use therewith |
| US20030219863A1 (en) * | 1997-01-31 | 2003-11-27 | Bristol-Myers Squibb Company | Soluble CTLA4 mutant molecules and uses thereof |
| ZA98533B (en) * | 1997-01-31 | 1999-07-22 | Bristol Myers Squibb Co | Soluble CTLA4 mutant molecules and uses thereof. |
| US7094874B2 (en) * | 2000-05-26 | 2006-08-22 | Bristol-Myers Squibb Co. | Soluble CTLA4 mutant molecules |
| MXPA02012157A (es) * | 2000-06-09 | 2003-06-06 | Bristol Myers Squibb Co | Metodos para regular una respuesta inmune mediada por celulas al bloquear se°ales linfociticas y al bloquear la adhesion mediada por el antigeno 1 asociado con la funcion de linfocitos. |
| CA2436139A1 (en) * | 2001-01-26 | 2002-08-01 | Emory University | Methods of inducing organ transplant tolerance and correcting hemoglobinopathies |
| US7304033B2 (en) * | 2001-05-23 | 2007-12-04 | Bristol-Myers Squibb Company | Methods for protecting allogeneic islet transplant using soluble CTLA4 mutant molecules |
| MXPA05006522A (es) * | 2002-12-23 | 2006-02-17 | Bristol Myers Squibb Co | Mejora en la calidad de producto en procesos de cultivo en celulas de mamiferos para la produccion de proteina. |
| MXPA05006523A (es) * | 2002-12-23 | 2005-08-26 | Squibb Bristol Myers Co | Procesos de cultivo de celulas de mamiferos para la produccion de proteinas. |
| SG144925A1 (en) * | 2003-08-04 | 2008-08-28 | Bristol Myers Squibb Co | Methods for treating cardiovascular disease using a soluble ctla4 molecule |
| EP1658096A1 (en) * | 2003-08-25 | 2006-05-24 | PanGenetics B.V. | Method of inducing immune tolerance |
| CA2654446C (en) * | 2005-06-07 | 2014-02-25 | The Regents Of The University Of Colorado | Inhibitors of serine protease activity and their use in methods and compositions for treatment of graft rejection and promotion of graft survival |
| US8715649B2 (en) * | 2005-06-07 | 2014-05-06 | The Regents Of The University Of Colorado, A Body Corporate | Compositions and methods of use for alpha-1 antitrypsin having no significant serine protease inhibitor activity |
| US9457070B2 (en) | 2005-06-07 | 2016-10-04 | The Regents Of The University Of Colorado, A Body Corporate | Compositions, methods and uses of alpha 1-antitrypsin for early intervention in bone marrow transplantation and treatment of graft versus host disease |
| EP3138403A1 (en) * | 2005-08-09 | 2017-03-08 | Revivicor, Inc. | Transgenic ungulates expressing ctla4-ig and uses thereof |
| US20070087029A1 (en) * | 2005-10-14 | 2007-04-19 | Pakala Syamasundar V | Localized delivery to the lymphatic system |
| US20090029904A1 (en) * | 2006-07-21 | 2009-01-29 | Sean Oldham | Compositions and methods for treatment of insulin-resistance diseases |
| JP5570808B2 (ja) * | 2006-08-18 | 2014-08-13 | アルゴス・セラピューティクス・インコーポレーテッド | 併用療法におけるcd83の使用 |
| GB0620934D0 (en) * | 2006-10-20 | 2006-11-29 | Cambridge Antibody Tech | Protein variants |
| EP2612867A1 (en) * | 2007-11-01 | 2013-07-10 | Perseid Therapeutics LLC | Immunosuppressive polypeptides and nucleic acids |
| US8986253B2 (en) | 2008-01-25 | 2015-03-24 | Tandem Diabetes Care, Inc. | Two chamber pumps and related methods |
| US7915222B2 (en) * | 2008-05-05 | 2011-03-29 | Bristol-Myers Squibb Company | Method of preventing the development of rheumatoid arthritis in subjects with undifferentiated arthritis |
| US8408421B2 (en) | 2008-09-16 | 2013-04-02 | Tandem Diabetes Care, Inc. | Flow regulating stopcocks and related methods |
| CA2737461A1 (en) | 2008-09-19 | 2010-03-25 | Tandem Diabetes Care, Inc. | Solute concentration measurement device and related methods |
| NO2344540T3 (https=) | 2008-10-02 | 2018-04-28 | ||
| US9738872B2 (en) * | 2008-10-30 | 2017-08-22 | Yeda Research And Development Co. Ltd. | Anti third party central memory T cells, methods of producing same and use of same in transplantation and disease treatment |
| ES2645692T3 (es) | 2008-11-11 | 2017-12-07 | The Board Of Regents,The University Of Texas System | Microcápsulas de rapamicina y su uso para el tratamiento del cáncer |
| US8926561B2 (en) | 2009-07-30 | 2015-01-06 | Tandem Diabetes Care, Inc. | Infusion pump system with disposable cartridge having pressure venting and pressure feedback |
| ES2767881T3 (es) * | 2009-08-14 | 2020-06-18 | Revivicor Inc | Cerdos multi-transgénicos para el tratamiento de diabetes |
| US9283211B1 (en) | 2009-11-11 | 2016-03-15 | Rapamycin Holdings, Llc | Oral rapamycin preparation and use for stomatitis |
| CN106432474A (zh) | 2010-03-12 | 2017-02-22 | 艾伯维生物医疗股份有限公司 | Ctla4蛋白和其用途 |
| US9527912B2 (en) | 2010-05-17 | 2016-12-27 | The Board Of Trustees Of The Leland Stanford Junior University | Prevention of immunological rejection of transplanted stem cells by leukocyte costimulatory molecule blockade |
| JP2013540731A (ja) | 2010-09-08 | 2013-11-07 | イェダ リサーチ アンド デベロップメント カンパニー リミテッド | 安定かつ長期間の生着のための免疫抑制薬物組合せ |
| CN103282047B (zh) | 2010-09-08 | 2016-08-24 | 耶达研究及发展有限公司 | 抗第三方中枢记忆性t细胞在抗白血病/淋巴瘤治疗中的用途 |
| ES2680636T3 (es) | 2011-02-14 | 2018-09-10 | Revivicor Inc. | Cerdos genéticamente modificados para xenotrasplante de xenoinjertos vascularizados y derivados de los mismos |
| WO2012178102A2 (en) | 2011-06-24 | 2012-12-27 | The Regents Of The Unversity Of Colorado, A Body Corporate | Compositions, methods and uses for alpha-1 antitrypsin fusion molecules |
| WO2013035099A1 (en) | 2011-09-08 | 2013-03-14 | Yeda Research And Development Co. Ltd. | Anti third party central memory t cells, methods of producing same and use of same in transplantation and disease treatment |
| US9180242B2 (en) | 2012-05-17 | 2015-11-10 | Tandem Diabetes Care, Inc. | Methods and devices for multiple fluid transfer |
| US8735359B2 (en) | 2012-05-24 | 2014-05-27 | Orban Biotech Llc | Combinations of modalities for the treatment of diabetes |
| US9555186B2 (en) | 2012-06-05 | 2017-01-31 | Tandem Diabetes Care, Inc. | Infusion pump system with disposable cartridge having pressure venting and pressure feedback |
| KR20150033703A (ko) * | 2012-06-27 | 2015-04-01 | 오르반 바이오테크 엘엘씨 | 당뇨병 치료를 위한 ctla4 융합 단백질 |
| US20140112958A1 (en) | 2012-10-24 | 2014-04-24 | Mwm Biomodels Gmbh | Pancreatic islets of transgenic LEA29Y animals for treating diabetes |
| WO2014160328A1 (en) | 2013-03-13 | 2014-10-02 | The Board Of Regents Of The University Of Texas System | Mtor inhibitors for prevention of intestinal polyp growth |
| US9173998B2 (en) | 2013-03-14 | 2015-11-03 | Tandem Diabetes Care, Inc. | System and method for detecting occlusions in an infusion pump |
| SG11201506919XA (en) * | 2013-03-28 | 2015-10-29 | Bristol Myers Squibb Co | Methods for identifying patients at risk for costimulation blockade resistant rejection |
| WO2014182601A1 (en) * | 2013-05-08 | 2014-11-13 | Children's Medical Center Corporation | A method of preventing and treating type 1 diabetes, allograft rejection and lung fibrosis (by targeting the atp/p2x7r axis) |
| ES2769778T3 (es) * | 2013-12-13 | 2020-06-29 | Swedish Stromabio Ab | Composiciones inmunomoduladoras |
| US9700544B2 (en) | 2013-12-31 | 2017-07-11 | Neal K Vail | Oral rapamycin nanoparticle preparations |
| EP3089737B1 (en) | 2013-12-31 | 2021-11-03 | Rapamycin Holdings, LLC | Oral rapamycin nanoparticle preparations and use |
| GB2523399B (en) | 2014-02-25 | 2019-03-13 | Orban Tihamer | A composition comprising ten overlapping peptide fragments of the entire preproinsulin sequence |
| GB201403775D0 (en) | 2014-03-04 | 2014-04-16 | Kymab Ltd | Antibodies, uses & methods |
| US9512229B2 (en) | 2015-03-03 | 2016-12-06 | Kymab Limited | Synergistic combinations of OX40L antibodies for the treatment of GVHD |
| CN121159719A (zh) | 2015-04-17 | 2025-12-19 | 高山免疫科学股份有限公司 | 具有可调的亲和力的免疫调节蛋白 |
| EP3322424B1 (en) | 2015-07-16 | 2023-10-11 | Yeda Research and Development Co., Ltd. | Use of anti third party central memory t cells |
| US11260027B2 (en) | 2015-07-29 | 2022-03-01 | Musc Foundation For Research Development | Donor organ pre-treatment formulation |
| RU2769282C2 (ru) | 2016-06-20 | 2022-03-30 | Кимаб Лимитед | Анти-PD-L1 и IL-2 цитокины |
| GB201611123D0 (en) | 2016-06-27 | 2016-08-10 | Euremab Srl | Anti met antibodiesand uses thereof |
| IT201800000534A1 (it) * | 2018-01-03 | 2019-07-03 | Procedimenti per la promozione della crescita cellulare degli isolotti pancreatici. | |
| EP3534947A1 (en) | 2016-11-03 | 2019-09-11 | Kymab Limited | Antibodies, combinations comprising antibodies, biomarkers, uses & methods |
| US10751368B2 (en) | 2017-01-18 | 2020-08-25 | Yeda Research And Development Co. Ltd. | Methods of transplantation and disease treatment |
| ES3064681T3 (en) | 2017-01-18 | 2026-04-28 | Yeda Res And Development Co Ltd | Genetically modified veto cells and use of same in immunotherapy |
| JP7749319B2 (ja) | 2017-10-10 | 2025-10-06 | アルパイン イミューン サイエンシズ インコーポレイテッド | Ctla-4変異型免疫調節タンパク質およびそれらの使用 |
| AU2019205273B2 (en) | 2018-01-03 | 2024-04-04 | Alpine Immune Sciences, Inc. | Multi-domain immunomodulatory proteins and methods of use thereof |
| FR3090320B1 (fr) * | 2018-12-19 | 2023-03-03 | Karim Bouzakri | Utilisation de la decorine dans le traitement du diabete |
| EP3934677A4 (en) | 2019-03-13 | 2022-11-16 | University of Virginia Patent Foundation | COMPOSITIONS AND METHODS TO PROMOTE ISLAND VIABILITY AND INCREASE INSULINE SECRETION |
| WO2020232247A1 (en) | 2019-05-14 | 2020-11-19 | Provention Bio, Inc. | Methods and compositions for preventing type 1 diabetes |
| EP4146684A2 (en) | 2020-05-08 | 2023-03-15 | Alpine Immune Sciences, Inc. | April and baff inhibitory immunomodulatory proteins with and without a t cell inhibitory protein and methods of use thereof |
| IL298999A (en) | 2020-06-11 | 2023-02-01 | Provention Bio Inc | Methods and compositions for the prevention of type 1 diabetes |
| JP2024520444A (ja) | 2021-05-24 | 2024-05-24 | プロヴェンション・バイオ・インコーポレイテッド | 1型糖尿病を治療するための方法 |
| CN115089718B (zh) * | 2021-11-30 | 2024-05-28 | 杭州瑞普晨创科技有限公司 | 用于异种移植的免疫抑制剂组合和免疫抑制方法 |
| WO2025235670A1 (en) * | 2024-05-07 | 2025-11-13 | Eledon Pharmaceuticals, Inc. | Use of anti-cd40 ligand antibodies for immunosuppression in islet cell transplantation |
Family Cites Families (54)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4399216A (en) | 1980-02-25 | 1983-08-16 | The Trustees Of Columbia University | Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials |
| US5858358A (en) | 1992-04-07 | 1999-01-12 | The United States Of America As Represented By The Secretary Of The Navy | Methods for selectively stimulating proliferation of T cells |
| US6905680B2 (en) | 1988-11-23 | 2005-06-14 | Genetics Institute, Inc. | Methods of treating HIV infected subjects |
| CA2003455C (en) | 1988-11-23 | 2000-02-22 | Craig B. Thompson | Immunotherapy involving cd28 stimulation |
| US6685941B1 (en) | 1988-11-23 | 2004-02-03 | The Regents Of The University Of Michigan | Methods of treating autoimmune disease via CTLA-4Ig |
| US6534055B1 (en) | 1988-11-23 | 2003-03-18 | Genetics Institute, Inc. | Methods for selectively stimulating proliferation of T cells |
| US6352694B1 (en) | 1994-06-03 | 2002-03-05 | Genetics Institute, Inc. | Methods for inducing a population of T cells to proliferate using agents which recognize TCR/CD3 and ligands which stimulate an accessory molecule on the surface of the T cells |
| US6641809B1 (en) | 1990-03-26 | 2003-11-04 | Bristol-Myers Squibb Company | Method of regulating cellular processes mediated by B7 and CD28 |
| US7070776B1 (en) | 1990-03-26 | 2006-07-04 | Bristol-Myers Squibb Company | Methods for blocking binding of CD28 receptor to B7 |
| CA2580812A1 (en) | 1991-06-27 | 1993-01-07 | Bristol-Myers Squibb Company | Ctla4 receptor, fusion proteins containing it and uses thereof |
| US5844095A (en) | 1991-06-27 | 1998-12-01 | Bristol-Myers Squibb Company | CTLA4 Ig fusion proteins |
| US5851795A (en) | 1991-06-27 | 1998-12-22 | Bristol-Myers Squibb Company | Soluble CTLA4 molecules and uses thereof |
| US5637481A (en) | 1993-02-01 | 1997-06-10 | Bristol-Myers Squibb Company | Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell |
| US5770197A (en) | 1991-06-27 | 1998-06-23 | Bristol-Myers Squibb Company | Methods for regulating the immune response using B7 binding molecules and IL4-binding molecules |
| US6090914A (en) | 1991-06-27 | 2000-07-18 | Bristol-Myers Squibb Company | CTLA4/CD28Ig hybrid fusion proteins and uses thereof |
| US5958403A (en) * | 1992-02-28 | 1999-09-28 | Beth Israel Hospital Association | Methods and compounds for prevention of graft rejection |
| EP1488805A2 (en) | 1992-04-07 | 2004-12-22 | The Regents of the University of Michigan | CD28 pathway immunoregulation |
| US5397703A (en) | 1992-07-09 | 1995-03-14 | Cetus Oncology Corporation | Method for generation of antibodies to cell surface molecules |
| US5773253A (en) | 1993-01-22 | 1998-06-30 | Bristol-Myers Squibb Company | MYPPPY variants of CTL A4 and uses thereof |
| ATE293686T1 (de) | 1993-06-04 | 2005-05-15 | Us Navy | Verfahren zur selektiven stimulierung der t- zellproliferation. |
| AU7107794A (en) | 1993-06-10 | 1995-01-03 | Regents Of The University Of Michigan, The | Cd28 pathway immunosuppression |
| ES2143553T3 (es) | 1993-09-02 | 2000-05-16 | Dartmouth College | Anticuerpos anti-gp39 y sus utilizaciones. |
| US5683693A (en) | 1994-04-25 | 1997-11-04 | Trustees Of Dartmouth College | Method for inducing T cell unresponsiveness to a tissue or organ graft with anti-CD40 ligand antibody or soluble CD40 |
| EP0764203A1 (en) | 1994-06-03 | 1997-03-26 | THE UNITED STATES OF AMERICA as represented by THE SECRETARY OF THE NAVY | Methods for selectively stimulating proliferation of t cells |
| US6719972B1 (en) | 1994-06-03 | 2004-04-13 | Repligen Corporation | Methods of inhibiting T cell proliferation or IL-2 accumulation with CTLA4- specific antibodies |
| JPH10501815A (ja) | 1994-06-07 | 1998-02-17 | リージェンツ・オブ・ザ・ユニバーシティ・オブ・ミネソタ | 抗原特異的t細胞応答の阻害方法 |
| AU4158396A (en) | 1994-11-10 | 1996-06-06 | Dana-Farber Cancer Institute | Methods for inhibiting graft versus host disease in bone marrow transplantation |
| US5876950A (en) | 1995-01-26 | 1999-03-02 | Bristol-Myers Squibb Company | Monoclonal antibodies specific for different epitopes of human GP39 and methods for their use in diagnosis and therapy |
| GB9506844D0 (en) | 1995-04-03 | 1995-05-24 | Armitage Ian M | Pharmaceutical microencapsulation |
| US5993800A (en) | 1995-06-05 | 1999-11-30 | Bristol-Myers Squibb Company | Methods for prolonging the expression of a heterologous gene of interest using soluble CTLA4 molecules and an antiCD40 ligand |
| US6113898A (en) | 1995-06-07 | 2000-09-05 | Idec Pharmaceuticals Corporation | Human B7.1-specific primatized antibodies and transfectomas expressing said antibodies |
| US7041634B2 (en) * | 1995-09-27 | 2006-05-09 | Emory University | Method of inhibiting immune system destruction of transplanted viable cells |
| US6750334B1 (en) | 1996-02-02 | 2004-06-15 | Repligen Corporation | CTLA4-immunoglobulin fusion proteins having modified effector functions and uses therefor |
| EP0892643B2 (en) | 1996-03-20 | 2009-09-02 | Bristol-Myers Squibb Company | Methods for inhibiting an immune response by blocking the gp39/cd40 and ctla4/cd28/b7 pathways and compositions for use therewith |
| KR19980066046A (ko) | 1997-01-18 | 1998-10-15 | 정용훈 | 고역가의 CTLA4-Ig 융합단백질 |
| ZA98533B (en) * | 1997-01-31 | 1999-07-22 | Bristol Myers Squibb Co | Soluble CTLA4 mutant molecules and uses thereof. |
| US20030219863A1 (en) | 1997-01-31 | 2003-11-27 | Bristol-Myers Squibb Company | Soluble CTLA4 mutant molecules and uses thereof |
| AU748533B2 (en) | 1997-06-11 | 2002-06-06 | United States Of America As Represented By The Secretary Of The Navy, The | Composition and method to prevent graft rejection and other counter-adaptive T lymphocyte mediated immune responses |
| AU748443B2 (en) | 1998-02-04 | 2002-06-06 | General Hospital Corporation, The | Costimulatory blockade and mixed chimerism in transplantation |
| IL126681A0 (en) | 1998-10-21 | 1999-08-17 | Opperbas Holding Bv | Treatment of trauma-related conditions |
| JP2003520828A (ja) | 2000-01-27 | 2003-07-08 | ジェネティクス インスティテュート,エルエルシー | Ctla4(cd152)に対する抗体、これを含む結合体、およびその使用 |
| AU2001264936A1 (en) | 2000-05-23 | 2001-12-03 | Genaissance Pharmaceuticals, Inc. | Haplotypes of the ctla4 gene |
| US7094874B2 (en) * | 2000-05-26 | 2006-08-22 | Bristol-Myers Squibb Co. | Soluble CTLA4 mutant molecules |
| CN101255192A (zh) | 2000-05-26 | 2008-09-03 | 布里斯托尔-迈尔斯斯奎布公司 | 可溶性ctla4突变体分子及其应用 |
| AU2006203199B2 (en) * | 2000-05-26 | 2009-02-12 | Bristol-Myers Squibb Company | Soluble CTLA4 mutant molecules and uses thereof |
| MXPA02012157A (es) | 2000-06-09 | 2003-06-06 | Bristol Myers Squibb Co | Metodos para regular una respuesta inmune mediada por celulas al bloquear se°ales linfociticas y al bloquear la adhesion mediada por el antigeno 1 asociado con la funcion de linfocitos. |
| US20040022787A1 (en) | 2000-07-03 | 2004-02-05 | Robert Cohen | Methods for treating an autoimmune disease using a soluble CTLA4 molecule and a DMARD or NSAID |
| EP1935427B1 (en) | 2000-07-03 | 2018-03-07 | Bristol-Myers Squibb Company | Uses of soluble CTLA4 mutant molecules |
| CA2436139A1 (en) | 2001-01-26 | 2002-08-01 | Emory University | Methods of inducing organ transplant tolerance and correcting hemoglobinopathies |
| US20030031652A1 (en) | 2001-04-16 | 2003-02-13 | Bernhard Hering | Systems and methods for inducing mixed chimerism |
| US7304033B2 (en) * | 2001-05-23 | 2007-12-04 | Bristol-Myers Squibb Company | Methods for protecting allogeneic islet transplant using soluble CTLA4 mutant molecules |
| MXPA05006523A (es) | 2002-12-23 | 2005-08-26 | Squibb Bristol Myers Co | Procesos de cultivo de celulas de mamiferos para la produccion de proteinas. |
| MXPA05006522A (es) | 2002-12-23 | 2006-02-17 | Bristol Myers Squibb Co | Mejora en la calidad de producto en procesos de cultivo en celulas de mamiferos para la produccion de proteina. |
| SG144925A1 (en) | 2003-08-04 | 2008-08-28 | Bristol Myers Squibb Co | Methods for treating cardiovascular disease using a soluble ctla4 molecule |
-
2002
- 2002-05-23 US US10/155,514 patent/US7304033B2/en not_active Expired - Lifetime
- 2002-05-23 HU HU0401590A patent/HU229680B1/hu not_active IP Right Cessation
- 2002-05-23 WO PCT/US2002/016708 patent/WO2002094202A2/en not_active Ceased
- 2002-05-23 AU AU2002305716A patent/AU2002305716B2/en not_active Ceased
- 2002-05-23 PL PL364578A patent/PL204899B1/pl unknown
- 2002-05-23 CA CA2447921A patent/CA2447921C/en not_active Expired - Fee Related
- 2002-05-23 MX MXPA03010568A patent/MXPA03010568A/es active IP Right Grant
- 2002-05-23 AT AT02734556T patent/ATE390931T1/de active
- 2002-05-23 PT PT02734556T patent/PT1397153E/pt unknown
- 2002-05-23 DK DK02734556T patent/DK1397153T3/da active
- 2002-05-23 JP JP2002590923A patent/JP4837880B2/ja not_active Expired - Fee Related
- 2002-05-23 EP EP02734556A patent/EP1397153B1/en not_active Expired - Lifetime
- 2002-05-23 DE DE60225914T patent/DE60225914T2/de not_active Expired - Lifetime
- 2002-05-23 ES ES02734556T patent/ES2302811T3/es not_active Expired - Lifetime
- 2002-05-23 CZ CZ2003-3188A patent/CZ305380B6/cs not_active IP Right Cessation
-
2003
- 2003-11-21 NO NO20035176A patent/NO332465B1/no not_active IP Right Cessation
-
2007
- 2007-10-29 US US11/978,701 patent/US7829534B2/en not_active Expired - Lifetime
-
2008
- 2008-06-09 CY CY20081100608T patent/CY1108127T1/el unknown
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10052360B2 (en) | 2000-07-03 | 2018-08-21 | Bristol-Myers Squibb Company | Methods for treating dermatomyositis or polymyositis by administering a soluble CTLA4 molecule |
| US8227420B2 (en) | 2000-07-03 | 2012-07-24 | Bristol-Myers Squibb Company | Method for treating an autoimmune disease using a soluble CTLA4 molecule and a DMARD or NSAID |
| US8497247B2 (en) | 2000-07-03 | 2013-07-30 | Bristol-Myers Squibb Company | Methods for treating type I diabetes mellitus by administering a soluble CTLA4 molecule |
| US8703718B2 (en) | 2000-07-03 | 2014-04-22 | Bristol-Myers Squibb Company | Methods for treating juvenile rheumatoid arthritis by administering a soluble CTLA4 molecule |
| US9296808B2 (en) | 2000-07-03 | 2016-03-29 | Bristol-Myers Squibb Company | Methods for treating scleroderma by administering a soluble CTLA4 molecule |
| US8722632B2 (en) | 2000-07-03 | 2014-05-13 | Bristol-Myers Squibb Company | Methods for treating Sjogrens syndrome by administering a soluble CTLA4 molecule |
| EP2281568A3 (en) * | 2000-07-03 | 2013-04-24 | Bristol-Myers Squibb Company | Uses of soluble CTLA4 mutant molecules |
| EP1935427A3 (en) * | 2000-07-03 | 2011-05-25 | Bristol-Myers Squibb Company | Uses of soluble CTLA4 mutant molecules |
| US8148332B2 (en) | 2000-07-03 | 2012-04-03 | Bristol-Myers Squibb Company | Method for treating a rheumatic disease using a soluble TLA4 molecule |
| NO342966B1 (no) * | 2005-04-06 | 2018-09-10 | Bristol Myers Squibb Co | Fremgangsmåter for behandling av immunforstyrrelser assosiert med organtransplantasjon med løselige CTLA4-mutantmolekyler |
| EA013122B1 (ru) * | 2005-04-06 | 2010-02-26 | Бристол-Маерс Сквибб Компани | Способы лечения иммунных нарушений, связанных с пересадкой трансплантата, растворимым мутантным ctla4 |
| US7482327B2 (en) | 2005-04-06 | 2009-01-27 | Bristol-Myers Squibb Company | Methods for treating immune disorders associated with graft transplantation with soluble CTLA4 mutant molecules |
| WO2006108035A1 (en) * | 2005-04-06 | 2006-10-12 | Bristol-Myers Squibb Company | Methods for treating immune disorders associated with graft transplantation with soluble ctla4 mutant molecules |
| AU2006231622B2 (en) * | 2005-04-06 | 2012-07-05 | Bristol-Myers Squibb Company | Methods for treating immune disorders associated with graft transplantation with soluble CTLA4 mutant molecules |
| US10808021B2 (en) | 2005-12-20 | 2020-10-20 | Bristol-Myers Squibb Company | Compositions and methods for producing a composition |
| US10508144B2 (en) | 2005-12-20 | 2019-12-17 | Bristol-Myers Squibb Company | Carbohydrate content of CTLA4 molecules |
| US10851150B2 (en) | 2005-12-20 | 2020-12-01 | Bristol-Myers Squibb Company | Carbohydrate content of CTLA4 molecules |
| US10941189B2 (en) | 2005-12-20 | 2021-03-09 | Bristol-Myers Squibb Company | Carbohydrate content of CTLA4 molecules |
| US12030923B2 (en) | 2005-12-20 | 2024-07-09 | Bristol-Myers Squibb Company | Compositions and methods for producing a composition |
| US8969531B2 (en) | 2006-01-24 | 2015-03-03 | Bristol-Myers Squibb Company | Anti-CD80 antibody |
| US7510844B2 (en) | 2006-01-24 | 2009-03-31 | Bristol-Myers Squibb Company | CD86 and CD80 receptor competition assays |
| WO2007087521A3 (en) * | 2006-01-24 | 2007-11-01 | Bristol Myers Squibb Co | Cd86 and cd80 receptor competition assays |
| US8378082B2 (en) | 2006-01-24 | 2013-02-19 | Catherine Aversa Fleener | Anti-CD86 antibody |
| WO2008014035A3 (en) * | 2006-07-25 | 2008-04-03 | Univ California | Modulation of nkg2d and method for treating or preventing solid organ allograft rejection |
| US20090191608A1 (en) * | 2008-01-22 | 2009-07-30 | Baylor Research Institute | Pancreatic Islet Cell Preparation and Transplantation |
Also Published As
| Publication number | Publication date |
|---|---|
| DE60225914T2 (de) | 2009-07-23 |
| ES2302811T3 (es) | 2008-08-01 |
| NO20035176L (no) | 2004-01-05 |
| CA2447921C (en) | 2011-08-09 |
| MXPA03010568A (es) | 2005-03-07 |
| CY1108127T1 (el) | 2014-02-12 |
| EP1397153A4 (en) | 2006-01-04 |
| AU2002305716B2 (en) | 2007-10-25 |
| WO2002094202B1 (en) | 2003-07-31 |
| US20080160022A1 (en) | 2008-07-03 |
| DE60225914D1 (de) | 2008-05-15 |
| HUP0401590A2 (hu) | 2004-11-29 |
| HUP0401590A3 (en) | 2012-09-28 |
| NO332465B1 (no) | 2012-09-24 |
| ATE390931T1 (de) | 2008-04-15 |
| CA2447921A1 (en) | 2002-11-28 |
| PL364578A1 (en) | 2004-12-13 |
| US7829534B2 (en) | 2010-11-09 |
| NO20035176D0 (no) | 2003-11-21 |
| CZ20033188A3 (cs) | 2005-04-13 |
| HU229680B1 (hu) | 2014-04-28 |
| JP2004535402A (ja) | 2004-11-25 |
| US7304033B2 (en) | 2007-12-04 |
| CZ305380B6 (cs) | 2015-08-26 |
| PL204899B1 (pl) | 2010-02-26 |
| WO2002094202A3 (en) | 2003-06-26 |
| AU2002305716B8 (en) | 2002-12-03 |
| EP1397153B1 (en) | 2008-04-02 |
| JP4837880B2 (ja) | 2011-12-14 |
| EP1397153A2 (en) | 2004-03-17 |
| US20030022836A1 (en) | 2003-01-30 |
| PT1397153E (pt) | 2008-06-12 |
| DK1397153T3 (da) | 2008-05-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7304033B2 (en) | Methods for protecting allogeneic islet transplant using soluble CTLA4 mutant molecules | |
| AU2002305716A1 (en) | Methods for protecting allogeneic islet transplant using soluble CTLA4 mutant molecules | |
| CA2630062C (en) | Methods for treating graft versus host disease and immune disorders associated with rejection using a soluble ctla4 molecule | |
| US8722632B2 (en) | Methods for treating Sjogrens syndrome by administering a soluble CTLA4 molecule | |
| US7439230B2 (en) | Methods of treatment using CTLA4 mutant molecules | |
| AU2001273174A1 (en) | Methods for treating rheumatic diseases using a soluble CTLA4 molecule | |
| HK1048126B (en) | Soluble ctla4 mutant molecules and uses thereof | |
| WO2003088991A1 (en) | Methods for treating an autoimmune disease using a soluble ctla4 molecule and a dmard or nsaid | |
| HK1262138A1 (en) | Uses of soluble ctla4 mutant molecules | |
| HK1120221B (en) | Uses of soluble ctla4 mutant molecules | |
| HK1120221A (en) | Uses of soluble ctla4 mutant molecules | |
| HK1153945A (en) | Uses of soluble ctla4 mutant molecules | |
| WO2006107298A1 (en) | Methods for treating immune disorders associated with graft transplantation with soluble ctla4 mutant molecules | |
| HK1071931B (en) | Soluble ctla4 mutant molecules and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| B | Later publication of amended claims |
Free format text: 20030527 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002734556 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2003/010568 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2447921 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV2003-3188 Country of ref document: CZ Ref document number: 2002305716 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002590923 Country of ref document: JP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002734556 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: PV2003-3188 Country of ref document: CZ |