Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/745—Blood coagulation or fibrinolysis factors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
  • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
  • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P11/00—Drugs for disorders of the respiratory system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
  • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
  • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
  • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
  • C12N9/6424—Serine endopeptidases (3.4.21)
  • C12N9/6437—Coagulation factor VIIa (3.4.21.21)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
  • C12Y304/21—Serine endopeptidases (3.4.21)
  • C12Y304/21021—Coagulation factor VIIa (3.4.21.21)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• the present invention relates to novel Factor Nil (FNH) or Factor Vila (FVIIa) polypeptide conjugates, to their preparation and use in therapy, in particular for the treatment of a variety of coagulation -related disorders.
• FNH Factor Nil
• FVIIa Factor Vila
• Blood coagulation is a process consisting of a complex interaction of various blood components (or factors) that eventually gives rise to a fibrin clot.
• the blood components participating in what has been referred to as the coagulation "cascade” are proenzymes or zymogens, i.e. enzy atically inactive proteins that are converted into an active form by the action of an activator.
• proenzymes or zymogens i.e. enzy atically inactive proteins that are converted into an active form by the action of an activator.
• FVII a coagulation factor
• FVII is a vitamin K-dependent plasma protein synthesized in the liver and secreted into the blood as a single-chain glycoprotein with a molecular weight of 53 kDa (Broze & Majerus, J. Biol. Chem 1980; 255:1242-1247).
• the FVII zymogen is converted into an activated form (FVIIa) by proteolytic cleavage at a single site, R152-I153, resulting in two chains linked by a single disulfide bridge.
• FVIIa in complex with tissue factor is able to convert both factor IX and factor X into their activated forms, followed by reactions leading to rapid thrombin production and fibrin formation ( ⁇ sterud & Rapaport, Proc Natl Acad Sci USA 1977; 74:5260-5264).
• FVII undergoes post-translational modifications, including vitamin K-dependent carboxylation resulting in ten ⁇ -carboxyglutamic acid residues in the N-terminal region of the molecule.
• residue number 6, 7, 14, 16, 19, 20, 25, 26, 29 and 35 shown in SEQ ID NO:l are ⁇ -carboxyglutamic acids residues in the Gla domain important for FVII activity.
• Other post- translational modifications include sugar moiety attachment at two naturally occurring N- glycosylation sites at position 145 and 322, respectively, and at two naturally occurring O- glycosylation sites at position 52 and 60, respectively.
• hFVTJ human FVTJ
• FVII The gene organisation and protein structure of FVII are similar to those of other vitamin K-dependent procoagulant proteins, with exons la and lb encoding for signal sequence; ex on 2 the propeptide and Gla domain; exon 3 a short hydrophobic region; exons 4 and 5 the epidermal growth factor-like domains; and exon 6 through 8 the serine protease catalytic domain (Yoshitake et al.,
• NovoSeven® Commercial preparations of human recombinant FVIIa are sold as NovoSeven®. NovoSeven® is indicated for the treatment of bleeding episodes in hemophilia A or B patients. NovoSeven® is the only rFVIIa for effective and reliable treatment of bleeding episodes available on the market.
• FVII in which arginine 152 and/or isoleucine 153 is/are modified has been reported in WO91/1154. These amino acids are located at the activation site.
• WO 96/12800 describes inactivation of FVIIa by a serine proteinase inhibitor; inactivation by carbamylation of FVIIa at the ⁇ -amino acid group 1153 has been described by Petersen et al., Eur J Biochem, 1999;261 : 124-129.
• the inactivated form is capable of competing with wild- type FVII or FVIIa for binding to tissue factor and inhibiting clotting activity.
• the inactivated form of FVIIa is suggested to be used for treatment of patients being in hypercoagulable states, such as patients with sepsis, in risk of myocardial infarction or of thrombotic stroke.
• One way to increase the circulation half -life of a protein is to ensure that renal clearance of the protein is reduced. This may be achieved by conjugating the protein to a chemical moiety, which is capable of conferring reduced renal clearance to the protein. Furthermore, attachment of a chemical moiety to the protein or substitution of amino acids exposed to proteolysis may effectively block a proteolytic enzyme from contact leading to proteolytic degradation of the protein.
• Polyethylene glycol (PEG) is one such chemical moiety that has been used in the preparation of therapeutic protein products.
• WO98/32466 suggests that FVII, among many other proteins, may be PEGylated but does not contain any further information in this respect.
• the conjugate of the present invention has one or more improved properties as compared to commercially available rFVIIa, including increased functional in vivo half-life and/or increased plasma half-life, and/or increased bioavailability and/or reduced sensitivity to proteolytic degradation. Consequently, medical treatment with a conjugate of the invention offers a number of advantages over the currently available rFVIIa compound, such as longer duration between injections.
• the invention relates to a conjugate comprising at least one non-polypeptide moiety covalently attached to a polypeptide, wherein the amino acid sequence of the polypeptide differs from that of wild-type FVII or FVIIa shown in SEQ ID NO: 1 in that at least one amino acid residue comprising an attachment group for said non- polypeptide moiety has been introduced or removed.
• the invention in another aspect relates to a polypeptide, wherein the amino acid sequence of the polypeptide differs from that of wild-type FVTJ or hFVIIa shown in SEQ ID NO: 1 in that at least one amino acid residue comprising an attachment group for a non- polypeptide moiety has been introduced or removed.
• novel FVII polypeptides are contemplated to be useful as such for therapeutic, diagnostic or other purposes, but find particular interest as intermediate products for the preparation of a conjugate of the invention.
• the invention relates to: a nucleotide sequence encoding the polypeptide of the invention or the polypeptide part of the conjugate of the invention; an expression vector harbouring the nucleotide sequence of the invention; a host cell comprising the nucleotide sequence of the invention or the expression vector of the invention.
• the invention relates to pharmaceutical compositions comprising the conjugate of the invention as well as to methods for preparing and using such conjugates.
• conjugate is intended to indicate a heterogeneous (in the sense of composite or chimeric) molecule formed by the covalent attachment of one or more polypeptide(s) to one or more non-polypeptide moieties such as polymer molecules, lipophilic compounds, sugar moieties or organic derivatizing agents.
• the conjugate is soluble at relevant concentrations and conditions, i.e. soluble in physiological fluids such as blood.
• conjugated polypeptides of the invention include glycosylated and/or PEGylated polypeptides.
• covalent attachment means that the polypeptide and the non-polypeptide moiety are either directly covalently joined to one another, or else are indirectly covalently joined to one another through an intervening moiety or moieties, such as a bridge, spacer, or linkage moiety or moieties.
• non -conjugated polypeptide may be used about the polypeptide part of the conjugate.
• non-polypeptide moiety means a molecule that is capable of conjugating to an attachment group of the polypeptide of the invention.
• Preferred examples of such molecules include polymer molecules, sugar moieties, lipophilic compounds, or organic derivatizing agents.
• the non-polypeptide moiety is linked to the polypeptide part of the conjugate through an attachment group of the polypeptide.
• the non-polypeptide moiety may be directly covalently joined to the attachment group or it may be indirectly covalently joined to the attachment group through an intervening moiety or moieties, such as a bridge, spacer, or linkage moiety or moieties.
• polymer molecule is a molecule formed by covalent linkage of two or more monomers, wherein none of the monomers is an amino acid residue, except where the polymer is human albumin or another abundant plasma protein.
• polymer may be used interchangeably with the term “polymer molecule”.
• the term is intended to cover carbohydrate molecules attached by in vitro glycosylation, i.e. a synthetic glycosylation performed in vitro normally involving covalently linking a carbohydrate molecule to an attachment group of the polypeptide, optionally using a cross-linking agent.
• Carbohydrate molecules attached by in vivo glycosylation are referred to herein as a "sugar moiety".
• sugar moieties such as polymer molecule(s) or sugar moieties in the conjugate
• every reference to "a non-polypeptide moiety" contained in a conjugate or otherwise used in the present invention shall be a reference to one or more non-polypeptide moieties, such as polymer molecule(s) or sugar moieties.
• attachment group is intended to indicate a functional group of the polypeptide, in particular of an amino acid residue thereof or a carbohydrate moiety, capable of attaching a non-polypeptide moiety such as a polymer molecule, a lipophilic molecule, a sugar moiety or an organic derivatizing agent.
• a non-polypeptide moiety such as a polymer molecule, a lipophilic molecule, a sugar moiety or an organic derivatizing agent.
• attachment group is used in an unconventional way to indicate the amino acid residues constituting a N-glycosylation site (with the sequence N-X-S/T/C, wherein X is any amino acid residue except proline, N is asparagine and S/T/C is either serine, threonine or cysteine, preferably serine or threonine, and most preferably threonine).
• N is asparagine
• S/T/C is either serine, threonine or cysteine, preferably serine or threonine, and most preferably threonine.
• amino acid residue comprising an attachment group for the non-polypeptide moiety as used in connection with alterations of the amino acid sequence of the polypeptide of interest is to be understood as meaning that one or more amino acid residues constituting an N-glycosylation site are to be altered in such a manner that either a functional N-glycosylation site is introduced into the amino acid sequence or removed from said sequence.
• amino acid names and atom names are used as defined by the Protein DataBank (PDB) (www.pdb.org) based on the IUPAC nomenclature (IUPAC Nomenclature and Symbolism for Amino Acids and Peptides (residue names, atom names, etc.), Eur. J. Biochem., 138, 9-37 (1984) together with their corrections in Eur. J. Biochem., 152, 1 (1985)).
• PDB Protein DataBank
• amino acid residue is intended to indicate an amino acid residue contained in the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (lie or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine
• G124 indicates that position 124 is occupied by a glycine residue in the amino acid sequence shown in SEQ ID NO: 1.
• G124R indicates that the glycine residue of position 124 has been substituted with an arginine residue.
• Alternative substitutions are indicated with a "/”, e.g. K32D/E means an amino acid sequence in which lysine in position 32 is substituted with either aspartic acid or glutamic acid. Multiple substitutions are indicated with a "+”, e.g.
• K143N+N145S/T means an amino acid sequence which comprises a substitution of the lysine residue in position 143 with an asparagine residue and a substitution of the asparagine residue in position 145 with a serine or a threonine residue.
• the insertion of an additional amino acid residue, such as insertion of an alanine residue after G124 is indicated by G124GA.
• a deletion of an amino acid residue is indicated by an asterix. For example, deletion of a glycine in position 124 is indicated by G124*. Unless otherwise indicated, the numbering of amino acid residues made herein is made relative to the amino acid sequence of wild-type FV ⁇ /FVIIa shown in SEQ ID NO: 1.
• the term "differs from” as used in connection with specific mutations is intended to allow for additional differences being present apart from the specified amino acid difference.
• the FVJJ or FVIIa polypeptide may comprise other substitutions that are not related to introduction and/or removal of such amino acid residues.
• the amino acid sequence of the polypeptide of the invention may, if desired, contain other alterations that need not be related to introduction or removal of attachment sites, i.e. other substitutions, insertions or deletions.
• These may, for example, include truncation of the N- and/or C-terminus by one or more amino acid residues, or addition of one or more extra residues at the N- and/or C-terminus, e.g. addition of a methionine residue at the N-terminus as well as "conservative amino acid substitutions", i.e. substitutions performed within groups of amino acids with similar characteristics, e.g. small amino acids, acidic amino acids, polar amino acids, basic amino acids, hydrophobic amino acids and aromatic amino acids.
• Preferred substitutions in the present invention may in particular be selected from the conservative substitution groups listed in the table below.
• nucleotide sequence is intended to indicate a consecutive stretch of two or more nucleotide molecules.
• the nucleotide sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
• PCR polymerase chain reaction
• the PCR method involves repeated cycles of primer extension synthesis, using oligonucleotide primers capable of hybridising preferentially to a template nucleic acid.
• Cell "host cell”, “cell line” and “cell culture” are used interchangeably herein and all such terms should be understood to include progeny resulting from growth or culturing of a cell.
• Transformation and “transfection” are used interchangeably to refer to the process of introducing DNA into a cell.
• operably linked refers to the covalent joining of two or more nucleotide sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed.
• the nucleotide sequence encoding a presequence or secretory leader is operably linked to a nucleotide sequence coding for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
• operably linked means that the nucleotide sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used, in conjunction with standard recombinant DNA methods.
• introduce refers to introduction of an amino acid residue comprising an attachment group for a non-polypeptide moiety, in particular by substitution of an existing amino acid residue, or alternatively by insertion of an additional amino acid residue.
• remove refers to removal of an amino acid residue comprising an attachment group for a non-polypeptide moiety, in particular by substitution of the amino acid residue to be removed by another amino acid residue, or alternatively by deletion (without substitution) of the amino acid residue to be removed
• FVII or “FVII polypeptide” refers to a FVII molecule provided in single chain form.
• FVIIa or “FVIIa polypeptide” refers to a FVIIa molecule provided in its activated two-chain form, wherein the peptide bond between R152 and 1153 of the single-chain form has been cleaved.
• amino acid sequence of SEQ ID NO;l is used herein to describe the amino acid sequence of FVIIa it will be understood to that one of the chains comprises amino acid residues 1-152, the other chain amino acid residues 153-406.
• rFVTI and “rFVIIa” refer to FVII and FVIIa molecules produced by recombinant techniques, respectively.
• hFVH and hFVIIa refer to wild-type human FVH and FVIIa, respectively.
• catalytic site is used to mean the catalytic triad consisting of S344, D242 and H193 of the FVII polypeptide.
• active FVIIa active FVIIa polypeptide
• active FVIIa conjugate active conjugate
• active conjugate is used to mean a FVIIa polypeptide or conjugate that possesses at least 10% of the catalytic activity of wild-type hFVIIa.
• Catalytic acitivity as used herein, may suitably be determined in the assay described in the section entitled Method of measuring the catalytic activity or in the assay entitled Method of measuring low levels of catalytic activity (see the Materials and Methods section herein).
• an active conjugate has at least 15%, such as at least 20%, e.g. at least 25%, more preferably at least 30%, such as at least 40%, most preferably at least 50%, e.g.
• an active conjugate is able to bind to tissue factor and further activate plasma factor X and/or LX.
• the active FVUa polypeptide or a conjugate thereof has a clotting activity of at least 25% as compared to wild type FVUa, such as a clotting activity of at least 50% as compared to wild type FVUa, e.g. a clotting activity of at least 75% as compared to wild type FVII.
• the clotting activity of the active FVUa polypeptide or conjugate thereof is preferably in the range of 25-200% as compared to the wild type FVUa.
• the FVUa polypeptide or conjugate has a clotting activity in the range of 30-150% as compared to wild type FVUa, such as a clotting activity in the range of 30-100% as compared to wild type FVUa.
• the clotting activity may be determined by any method known in the art as further discussed in the Materials and Methods section hereinafter. It is particularly preferred, however, that the clotting activity is determined in accordance with the method described in the section entitled "Method of measuring the clotting activity" (see the Materials and Method section).
• immunogenicity as used in connection with a given substance is intended to indicate the ability of the substance to induce a response from the immune system.
• the immune response may be a cell or antibody mediated response (see, e.g., Roitt: Essential Immunology (8 th Edition, Blackwell) for further definition of immunogenicity).
• Roitt Essential Immunology (8 th Edition, Blackwell) for further definition of immunogenicity.
• reduced antibody reactivity will be an indication of reduced immunogenicity.
• the reduced immunogenicity may be determined by use of any suitable method known in the art, e.g. in vivo or in vitro.
• inactive FVUa is used to mean a FVUa polypeptide or conjugate that possesses less than 10% of the catalytic activity of wild-type hFVIIa.
• Catalytic acitivity may suitably be determined in the assay described in the section entitled Method of measuring the catalytic activity or in the assay entitled Method of measuring low levels of catalytic activity (see the Materials and Methods section herein).
• an inactive conjugate has less than 8%, such as less than 6%, e.g.
• an inactive conjugate has significantly reduced in vitro or in vivo clotting activity as compared to wild-type hFVIIa.
• the inactive FVU or FVUa polypeptide or conjugate may be capable of competing with wild-type FVU or FVUa for binding tissue factor, thereby inhibiting clotting activity.
• the inactive FVU or FVUa polypeptide or conjugate has less than 1% clotting activity compared to wild-type hFVJJ or hFVIIa. More preferably the inactive FVJJ or FVUa polypeptide or conjugate has less than 0.05% clotting activity compared to wild type hFVJJ or hFVIIa. Most preferably the inactive FVU or FVUa polypeptide or conjugate has less than 0.01% clotting activity as compared to wild type hFVJJ or hFVIIa.
• the clotting activity may be determined by any method known in the art as further discussed in the Materials and Method section hereinafter, but is preferably determined in accordance with the method described in the section entitled "Method of measuring the clotting activity".
• the term "functional in vivo half-life” is used in its normal meaning, i.e. the time at which 50% of the biological activity of the polypeptide or conjugate is still present in the body/target organ, or the time at which the activity of the polypeptide or conjugate is 50% of the initial value.
• "serum half -life” may be determined, i.e. the time at which 50% of the polypeptide or conjugate molecules circulate in the plasma or bloodstream prior to being cleared. Determination of serum half-life is often more simple than determining the functional in vivo half -life and the magnitude of serum half-life is usually a good indication of the magnitude of functional in vivo half-life.
• serum half-life examples include “plasma half-life”, “circulating half-life”, “serum clearance”, “plasma clearance” and “clearance half-life”.
• the polypeptide or conjugate is cleared by the action of one or more of the reticuloendothelial systems (RES), kidney, spleen or liver, by tissue factor, SEC receptor or other receptor mediated elimination, or by specific or unspecific proteolysis.
• clearance depends on size (relative to the cutoff for glomerular filtration), charge, attached carbohydrate chains, and the presence of cellular receptors for the protein.
• the functionality to be retained is normally selected from procoagulant, proteolytic or receptor binding activity.
• the functional in vivo half-life and the serum half-life may be determined by any suitable method known in the art as further discussed in the Materials Methods section below.
• the term "increased" as used about the functional in vivo half -life or plasma half-life is used to indicate that the relevant half-life of the conjugate or polypeptide is statistically significantly increased relative to that of a reference molecule, such as a non-conjugated rFVIIa (e.g. NovoSeven®) as determined under comparable conditions.
• a reference molecule such as a non-conjugated rFVIIa (e.g. NovoSeven®) as determined under comparable conditions.
• the relevant half- life may increased by at least about 25%, such as by at least about 50%, e.g. by at least about 100%, 150%, 200%, 250%, 300%, 500% or 1000%.
• Renal clearance is used in its normal meaning to indicate any clearance taking place by the kidneys, e.g. by glomerular filtration, tubular excretion or degradation in the tubular cells. Renal clearance depends on physical characteristics of the conjugate, including size (diameter), hydrodynamic volume, symmetry, shape/rigidity, and charge. Normally, a molecular weight of about 67 kDa is considered to be a cut-off-value for renal clearance. Renal clearance may be established by any suitable assay, e.g. an established in vivo assay. Typically, renal clearance is determined by administering a labelled (e.g.
• Radiolabelled or fluorescence labelled) polypeptide conjugate to a patient and measuring the label activity in urine collected from the patient.
• Reduced renal clearance is determined relative to a corresponding reference polypeptide, e.g. the corresponding non-conjugated polypeptide, a non-conjugated corresponding wild-type polypeptide or another conjugated polypeptide (such as a conjugated polypeptide not according to the invention), under comparable conditions.
• the renal clearance rate of the conjugate is reduced by at least 50%, preferably by at least 75%, and most preferably by at least 90% compared to a relevant reference polypeptide.
• compositions comprising degradation products will typically have less specific activity as compared to compositions in which none or only a minor part of the conjugate has been degraded.
• a content of non- physiological degradation products in the composition to be administered may trigger the immune system of the patient.
• the term "reduced sensitivity to proteolytic degradation” is primarily intended to mean that the conjugate has reduced sensitivity to proteolytic degradation in comparison to non- conjugated wild type FVUa as determined under comparable conditions.
• the proteolytic degradation is reduced by at least 10%, such as at least 25% (e.g. by 10-25%), more preferably by at least 35%, such as at least 50%, (e.g. by 10-50%, such as 25-50%) even more preferably by at least 60%, such as by at least 75% or even at least 90%.
• the proteolytic degradation is reduced by 100%.
• the conjugate of the invention is subjected to proteolytic degradation to a lesser extent than wild-type FVUa, i.e.
• the proteolytic degradation of the conjugate of the invention is preferably reduced by 10-100%, such as by 25-100%, more preferably by 50-100%, and most preferably by 75-100%.
• the present inventors have developed a suitable preliminary in vitro test, which may be employed in the assessment of whether such conjugates possess reduced sensitivity to proteolytic cleavage (reduced autoproteolysis).
• the conjugate of the invention has a reduced sensitivity to proteolytic degradation (as defined above) as compared to wild type FVIIa when determined by the method described in the section entitled “Measurement of reduced sensitivity to proteolytic degradation", when determined by the method described in the section entitled Method of measuring the catalytic activity or when determined by the method described in the section entitled Method of measuring low levels of catalytic activity (see the Materials and Methods section herein).
• the term "parent FVJJ " or "parent polypeptide” is intended to indicate the molecule to be modified in accordance with the present invention.
• a typical parent FVU is the hFVJJ or hFVIIa (including rFVIIa (NovoSeven®)) with the amino acid sequence shown in SEQ ID NO:l.
• a “variant” is a polypeptide, which differs in one or more amino acid residues from a parent polypeptide, normally in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid residues.
• the conjugates of the invention are the result of a generally new strategy for developing improved FVU or FVUa molecules. More specifically, by removing and/or introducing an amino acid residue comprising an attachment group for the non-polypeptide moiety it is possible to specifically adapt the polypeptide so as to make the molecule more susceptible to conjugation to the non-polypeptide moiety of choice, to optimize the conjugation pattern (e.g.
• the renal clearance of the conjugate is typically significantly reduced due to the altered shape, size and/or charge of the molecule achieved by the conjugation.
• more than one amino acid residue of the FVU or FVUa polypeptide is altered, e.g. the alteration embraces removal as well as introduction of amino acid residues comprising an attachment group for the non-polypeptide moiety of choice.
• the polypeptide may comprise other substitutions or glycosylations that are not related to introduction and/or removal of amino acid residues comprising an attachment group for the non-polypeptide moiety.
• the polypeptide may be attached, e.g., to a serine proteinase inhibitor to inhibit the catalytic site of the polypeptide.
• amino acid residue comprising an attachment group for a non-polypeptide moiety is selected on the basis of the nature of the non-polypeptide moiety of choice and, in most instances, on the basis of the method in which conjugation between the polypeptide and the non-polypeptide moiety is to be achieved.
• the non-polypeptide moiety is a polymer molecule such as a polyethylene glycol or polyalkylene oxide derived molecule
• amino acid residues comprising an attachment group may be selected from the group consisting of lysine, cysteine, aspartic acid, glutamic acid, histidine, and tyrosine, preferably cysteine and lysine, in particular lysine.
• the position of the polypeptide to be modified is preferably located at the surface of the polypeptide, and more preferably occupied by an amino acid residue which has more than 25% of its side chain exposed to the solvent, preferably more than 50% of its side chain exposed to the solvent.
• positions have been identified on the basis of an analysis of a 3D structure of the human FVU or FVUa molecule as described in the Materials and Methods section herein.
• the position is preferably selected from a part of the FVU molecule that is located outside a tissue factor binding site region and/or an active site region.
• attachment groups for the non-polypeptide moieties such as attachment groups for in vivo N-glycosylation sites, may advantageously be inserted in the active site region or at the ridge of the active site binding cleft of the FVU molecule.
• the active site region and the ridge of the active site binding cleft are defined in the Materials and Methods section herein and is constituted by the following residues:
• the distance between amino acid residues located at the surface of the FVJJ or FVIIa molecule is calculated on the basis of a 3D structure of the polypeptide. More specifically, the distance between the CB's of the amino acid residues comprising such attachment groups, or the distance between the functional group (NZ for lysine, CG for aspartic acid, CD for glutamic acid, SG for cysteine) of one and the CB of another amino acid residue comprising an attachment group are determined. In case of glycine, CA is used instead of CB. In the FVU or FVIIa polypeptide part of a conjugate of the invention, any of said distances is preferably more than 8 A, in particular more than IOA in order to avoid or reduce heterogeneous conjugation.
• the relevant amino acid residue comprising such group and occupying a position as defined above is preferably substituted with a different amino acid residue that does not comprise an attachment group for the non-polypeptide moiety in question.
• the amino acid residue to be removed is one to which conjugation is disadvantageous, e.g. an amino acid residue located at or near a functional site of the polypeptide (since conjugation at such a site may result in inactivation or reduced FVU or FVUa activity of the resulting conjugate due to impaired receptor recognition).
• the term "functional site" is intended to indicate one or more amino acid residues which is/are essential for or otherwise involved in the function or performance of FVU or FVUa.
• Such amino acid residues are a part of the functional site.
• the functional site may be determined by methods known in the art and is preferably identified by analysis of a structure of the FVTIa- tissue factor complex (See Banner et al., Nature 1996; 380:41-46).
• an amino acid residue comprising such group is introduced into the position, preferably by substitution of the amino acid residue occupying such position.
• the exact number of attachment groups present and available for conjugation in the FVU or FVUa polypeptide is dependent on the effect desired to be achieved by the conjugation.
• the effect to be obtained is, e.g., dependent on the nature and degree of conjugation (e.g. the identity of the non-polypeptide moiety, the number of non-polypeptide moieties desirable or possible to conjugate to the polypeptide, where they should be conjugated or where conjugation should be avoided, etc.).
• Functional in vivo half -life is i.a. dependent on the molecular weight of the conjugate, and the number of attachment groups needed for providing increased half -life thus depends on the molecular weight of the non-polypeptide moiety in question.
• the conjugate of the invention has a molecular weight of at least 67 kDa, in particular at least 70 kDa, e.g., as measured by SDS-PAGE according to Laemmli, U.K., Nature Vol 227 (1970), p680-85.
• FVJJ has a molecular weight of about 53 kDa, and therefore additional 10-20kDa is required to obtain the desired effect. This may, e.g., be provided by conjugating 2-4 lOkDa
• polypeptide part of the conjugate will typically have an amino acid sequence having more than 90% identity with SEQ ID NO:l, preferably more than 95%, such as more than 96%.
• polypeptide part of the conjugate will typically have an amino acid sequence having more than 97% identity with SEQ ID NO:l, such as more than 98%, more than 99%, more than 99.25%, more than 99.25% or more than 99.5%.
• Amino acid sequence homology/identity is conveniently determined from aligned sequences, using e.g.
• the total number of amino acid residues to be altered in accordance with the present invention (as compared to the amino acid sequence shown in SEQ ID NO: 1) will typically not exceed 15.
• the FVJJ or FVUa polypeptide part of the conjugate of the invention or the polypeptide of the invention comprises an amino acid sequence differing in 1-15 amino acid residues from the amino acid sequence shown in SEQ ID NO:l, typically in 1- 10 or in 2-10 amino acid residues, e.g. in 1-8 or in 2-8 amino acid residues, such as in 3-7 or in 4-6 amino acid residues from the amino acid sequence shown in SEQ ID NO:l.
• the polypeptide part of the conjugate or the polypeptide of the invention comprises an amino acid sequence which differs from the amino acid sequence shown in SEQ ID NO:l in at the most 15 amino acid residues (such as 15 amino acid residues), in at the most 14 amino acid residues (such as 14 amino acid residues), in at the most 13 amino acid residues (e.g. 13 amino acid residues), in at the most 12 amino acid residues (such as 12 amino acid residues), in at the most 11 amino acid residues (such as 11 amino acid residues), in at the most 10 amino acid residues (e.g.
• amino acid residues in at the most 9 amino acid residues (such as 9 amino acid residues), in at the most 8 amino acid residues (such as 8 amino acid residues), in at the most 7 amino acid residues (such as 7 amino acid residues), in at the most 6 amino acid residues (such as 6 amino acid residues), in at the most 5 amino acid residues (such as 5 amino acid residues), in at the most 4 amino acid residues (such as 4 amino acid residues), in at the most 3 amino acid residues (such as 3 amino acid residues) or in at the most 2 amino acid residues (such as 2 amino acid residues).
• the conjugate of the invention typically contains, e.g., 1-15 non- polypeptide moieties, typically 1-10 non-polypeptide moieties or 2-10 non-polypeptide moieties, such as 1-8 or 2-8 non-polypeptide moieties, e.g. 1-6, 1-4, 3-7 or 4-6 non-polypeptide moieties.
• the conjugate of the invention has one or more of the following improved properties: Increased functional in vivo half-life, increased plasma half-life, reduced renal clearance and reduced sensitivity to proteolytic degradation as compared to rFVJJa (e.g.NovoSeven®).
• proteolytic degradation of FVTJ/FVJJa primarily takes place at various proteolytic sites in the molecule, namely at the positions K32, K38, 142, Y44, K143, R290, R315, K341, R392, R396 and R402 (or rather between the positions K32-D33, K38-L39, 142-S43, Y44-S45, K143-R144, R290-G291, R315-K316, K341- G342, R392-S393, R396-P397 and R402-A403).
• one preferred strategy for increasing e.g.
• an attachment group has been introduced in one or more of the above-mentioned identified positions or at position -4, -3, -2, -1, 1, 2, 3, 4, preferably position -2, -1, 1, 2, such as position -1, 1, relative to the position directly involved in proteolytic degradation.
• a non-naturally occurring in vivo glycosylation site in particular a non-naturally occurring in vivo N-glycosylation site (see further below) has been introduced in positions selected from the group consisitng of 28-48, 139-147, 286-294, 311-319, 338-345, and 388-406.
• the in vivo glycosylation site such as an in vivo N-glycosylation site (see further below) has been introduced in positions selected from the group consisiting of 30-34, 36-46, 141-144, 288-292, 313-317, 341-343, 390-
• the in vivo glycosylation site such as an in vivo N- glycosylation site (see further below) has been introduced in positions selected from the group consisiting of 31-33 (e.g. positions 31, 32 or 33), 37-39 (e.g. positions 37, 38 or 39), 41-46 (e.g. positions 41, 42, 43, 44, 45 or 46), 142-144 (e.g. positions 142, 143 or 144), 289-291 (e.g. positions 289, 290 or 291), 314-316, (e.g. positions 314, 315 or 316), 341-342 (e.g. positions 341, 342 or 343), 391-393 (e.g. positions 391, 392 or 393), 395-397 (e.g. positions 395, 396 or 397) and 401-403 (e.g. positions 401, 402 or 403).
• the introduction is preferably performed by susbstitution.
• the non-polypeptide moiety has lysine as an attachment group, i.e., the conjugate of the invention is one which comprises at least one non-polypeptide moiety covalently attached to a polypeptide, wherein the amino acid sequence of the polypeptide differs from that of wild-type FVJJ or FVUa shown in SEQ ID NO: 1 in that at least one lysine residue has been introduced or removed.
• FV ⁇ /FVUa contains 17 lysine residues. Three lysine residues (K18, K62 and K85) are located in the tissue factor binding domain and two lysine residues (K197 and K341) are located in the active site region.
• lysine residues in the parent polypeptide Due to the relative high amount of lysine residues in the parent polypeptide it is envisaged that at least one lysine residue should preferably be removed, in particular by substitution of a lysine residue with a non-lysine residue, in order to avoid excessive conjugation to non-polypeptide moieties.
• the amino acid sequence of the FVJJ or FVUa polypeptide part of the conjugate differs from that shown in SEQ JD NO:l in that at least one lysine residue, such as 1-15 lysine residues, in particular 1-10, 1-6 or 2-4 lysine residues, has been removed, preferably by substitution.
• the lysine residue(s) to be removed, preferably by substitution is selected from the group consisting of K18, K32, K38, K62, K85, K109, K137, K143, K148, K157, K161, K197, K199, K316, K337, K341, K389 and combinations thereof.
• lysine residues which constitute part of tissue factor binding site and/or the active site region, i.e. the residues K18, K62, K85, K197, K341 or combinations thereof.
• the lysine residue may be substituted with any other amino acid residue, but is preferably substituted with R, Q, N or H, more preferably R
• the amino acid sequence of the FVTJ or FVUa polypeptide part of the conjugate differs from that shown in SEQ ID NO:l in that at least one lysine residue, such as 1-15 lysine residues, in particular 1-10, 1-6 or 2-4 lysine residues, has been introduced, preferably by substitution. It will be understood that it is particularly preferred that at least one of the lysines residues, which are introduced at a predetermined site in the parent molecule, is combined with at least one of the above-mentioned removals of lysine residues.
• the amino acid sequence of the FVU or FVTIa polypeptide part of the conjugate differs from that shown in SEQ ID NO: 1 in that at least one lysine residue has been removed and at least one lysine residue has been introduced.
• positions, wherein lysine residues may be introduced include, but is not limited to, positions at or in the vicinity of the proteolytic degradation sites described above.
• the substitution of a non-lysine residue with a lysine residue is selected from the group consisting of of I42K, Y44K, L288K, D289K, R290K, G291K, A292K, T293K, Q313K, S314K, R315K, V317K, L390K, M391K, R392K, S393K, E394K, P395K, R396K, P397K, G398K, V399K, L400K, L401K, R402K, A403K, P404K, F405K and combinations thereof, in particular selected from the group consisting of R290K, R315K, R392K, R396K, R402K and combinations thereof.
• non-polypeptide moiety of the conjugate according to this aspect of the invention may be any molecule which, when using the given conjugation method has lysine as an attachment group it is preferred that the non-polypeptide moiety is a polymer molecule.
• the polymer molecule may be any of the molecules mentioned in the section entitled "Conjugation to a polymer molecule", but is preferably selected from the group consisting of linear or branched polyethylene glycol or another polyalkylene oxide.
• polymer molecules examples include, e.g., SS-PEG, NPC-PEG, aldehyde-PEG, mPEG-SPA, mPEG-SCM, PEG- BTC from Shearwater Polymers, Inc, SC-PEG from Enzon, Inc., tresylated mPEG as described in US 5,880,255, or oxycarbonyl-oxy-N-dicarboxyimide-PEG (US 5,122,614).
• the non-polypeptide moiety has a molecular weight of from about 5 to about 20 kDa, such as from about 5 to about 10 kDa, e.g. about 5 kDa or about 10 kDa
• Conjugate of the invention wherein the non-polypeptide moiety is a molecule that has cysteine as an attachment group
• the non-polypeptide moiety has cysteine as an attachment group
• the conjugate of the invention is one which comprises at least one non-polypeptide moiety covalently attached to a polypeptide, wherein the amino acid sequence of the polypeptide differs from that of wild-type FVJJ or FVJJa shown in SEQ ID NO: 1 in that at least one cysteine residue has been introduced or removed.
• FVU/FVIJa contains 24 cysteine residues and disulfide bridges are established between the following cysteine residues: C17 and C22, C50 and C61, C55 and C70, C72 and C81, C91 and C102, C98 and C112, C114 and C127, C135 and C262, C159 and C164, C178 and C194, C310 and C329, and between C340 and C368.
• the amino acid sequence of the FVJJ or FVUa polypeptide differs from that shown in SEQ TD NO: 1 in that at least one cysteine residue, such as 1-15 cysteine residues, in particular 1-10, 1-6 or 2-4 cysteine residues, has been introduced, preferably by substitution.
• positions, wherein cysteine residues may be introduced include, but is not limited to, positions at or in the vicinity of the proteolytic degradation sites described above.
• the lysine residue(s) to be introduced preferably by substitution, is selected from the group consisting of I30C, K32C, D33C, A34C, T37C, K38C, W41C, Y44C, S45C, D46C, L141C, E142C, K143C, R144C, L288C, D289C, R290C, G291C, A292C, S314C, R315C, K316C, V317C, L390C, M391C, R392C, S393C, E394C, P395C, R396C, P397C, G398C, V399C, L401C, R402C, A403C, P404C and combinations thereof, in particular selected from the group consisting of K32
• cysteine residue(s) is/are introduced into a position that in wildtype hFVJJ is occupied by a threonine or serine residue having at least 25% of its side chain exposed to the surface.
• a cysteine residue is introduced, preferably by substitution, into at least one position selected from the group consisting of S12, S23, S43, S45, S52, S53, S60, S67, T83, S103, T106, T108, Sill, S119, S126, T128, T130, S147, T185, S214, S222, S232, T233, T238, T239, T255, T267, T293, T307, S320, T324, S333, S336, T370 and S393.
• the cysteine residue is introduced into at least one position of hFVII containing an S residue, the position being selected from the group consisting of S12,
• cysteine residue(s) is/are introduced into a position that in wildtype hFVJJ is occupied by a threonine or serine residue having at least 50% of its side chain exposed to the surface.
• a cysteine residue is introduced, preferably by substitution, into at least one position selected from the group consisting of S23, S43, S52, S53, S60, S67, T106, T108, Sill, SI 19, S147, S214, T238, T267 and T293, even more preferably a position selected from the group consisting of S23, S43, S52, S53, S60, S67, Sill, S119, S147 and S214.
• a cysteine residue is introduced into at least one position selected from any of the above-mentioned positions, which is not located in an active site region.
• the position is one occupied by a T or an S residue.
• the FVJJ polypeptide comprises a cysteine residue introduced into at least one position selected from the group consisting of S12, S23, S43, S45, S52, S53, S60, S67, T83, S103, T106, T108, Sill, S119, S126, T128, T130, S147, T185, S214, S222, T255, T267, T307, S320, S333, S336, T370 and S393 (having more than 25% of its side chain exposed to the surface), in particular selected from the group consisting of SI 2, S23, S43, S45, S52, S53, S60, S67, S103, Sill, S119, S126, S147, S214, S222, S320, S333
• a cysteine residue is introduced into at least one position selected from any of the above lists, which is not located in a tissue factor binding site region.
• the position is one occupied by a T or an S residue.
• the FVU polypeptide comprises a cysteine residue introduced into at least one position selected from the group consisting of S12, S23, S45, S52, S53, S67, T83, S103, T106, T108, Sill, S119, S126, T128, T130, S147, T185, S214, S222, S232, T233, T238, T239, T255, T267, T293, S320, T324, S333, S336, T370 and S393 (having more than 25% of its side chain exposed to the surface), in particular selected from the group consisting of S12, S23, S45, S52, S53, S67, S103, Sill, S119, S126, S147, S214, S222, S232, S320
• a cysteine residue is introduced into at least one position selected from any of the above lists, which is neither located in a tissue factor binding site region nor in an active site region.
• the position is one occupied by a T or an S residue.
• the FVU polypeptide comprises a cysteine residue introduced into at least one position selected from the group consisting of S12, S23, S45, S52, S53, S67, T83,
• S333, S336, T370 and S393 (having more than 25% of its side chain exposed to the surface), in particular selected from the group consisting of S12, S23, S45, S52, S53, S67, S103, Sill, SI 19, S126, S147, S214, S222, S320, S333, S336 and S393 (occupied by S residue), and more preferably from the group consisting of S23, S52, S53, S67, T106, T108, Sill, SI 19, S147, S214 and T267 (having more than 50% of its side chain exposed to the surface), in particular from the group consisting of S23, S52, S53, S67, Sill, S119, S147 and S214 (occupied by an S residue).
• non-polypeptide moiety of the conjugate according to this aspect of the invention may be any molecule which, when using the given conjugation method has cysteine as an attachment group it is preferred that the non-polypeptide moiety is a polymer molecule.
• the polymer molecule may be any of the molecules mentioned in the section entitled "Conjugation to a polymer molecule", but is preferably selected from the group consisting of linear or branched polyethylene glycol or another polyalkylene oxide.
• the polymer molecule is PEG, such as VS-PEG.
• the conjugation between the polypeptide and the polymer may be achieved in any suitable manner, e.g.
• the FVU or FVUa polypeptide comprises only one conjugatable cysteine residue, this is preferably conjugated to a non-polypeptide moiety with a molecular weight of from about 5 kDa to about 20 kDa, e.g.
• each of the non-polypeptide moieties has a molecular weight of from about 5 to about 10 kDa, such as about 5 kDa or about 10 kDa.
• Conjugate of the invention wherein the non-polypeptide moiety is a molecule that has aspartic acid or glutamic acid as an attachment group.
• the non-polypeptide moiety has aspartic acid or glutamic acid as an attachment group
• the conjugate of the invention is one which comprises at least one non-polypeptide moiety covalently attached to a polypeptide, wherein the amino acid sequence of the polypeptide differs from that of wild-type FVJJ or FVUa shown in SEQ ID NO: 1 in that at least one aspartic acid residue and/or at least one glutamic acid residue has been introduced or removed.
• the amino acid sequence of the FVJJ or FVUa polypeptide differs from that shown in SEQ ID NO: 1 in that at least one aspartic acid residue and/or glutamic acid residue, such as 1-15 aspartic acid residues and/or glutamic acid residues, in particular 1-10, 1-6 or 2-4 aspartic acid residues and/or glutamic acid residues, has been introduced, preferably by substitution.
• positions, wherein aspartic acid residues or glutamic acid residues may be introduced include, but is not limited to, positions at or in the vicinity of the proteolytic degradation sites described above.
• the aspartic acid residue and/or the glutamic acid residue to be introduced preferably by substitution, is selected from the group consisting of I30D/E, K32D/E, A34D/E, T37D/E, K38D/E, W41D/E, Y44D/E, S45D/E, D46C, L141D/E, E142D E, K143D/E, R144D/E, L288D/E, R290D/E, G291D/E, A292D/E, Q313D/E, S314D/E, R315D/E, K316D/E, V317D/E, L390D/E, M391D/E, R392D/E, S393D/E, P395
• polypeptide of the conjugate according to the above embodiment may comprise removal, preferably by substitution, of at least one of the aspartic acid residue and/or at least one glutamic acid residue.
• amino acid sequence of the FVU or FVUa polypeptide part of the conjugate differs from that shown in SEQ ID NO:l in that at least one aspartic acid or glutamic acid residue, such as 1-15 aspartic acid or glutamic acid residues, in particular 1-10,
• the aspartic acid and glutamic acid residue(s) to be removed is selected from the group consisting of D33, D46, D48, E77, E82, D86, D87, E94,
• the amino acid sequence of the FVU or FVUa polypeptide part of the conjugate differs from that shown in SEQ ID NO:l in that at least one aspartic acid or glutamic acid residue has been removed, preferably by substitution, and at least one aspartic acid or glutamic acid residue has been introduced, preferably by substitution.
• non-polypeptide moiety of the conjugate according to this aspect of the invention which has an aspartic acid group or a glutamic acid group as an attachment group
• the non- polypeptide moiety is a polymer molecule or an organic derivatizing agent, in particular a polymer molecule, and the conjugate is prepared, e.g., as described by Sakane and Pardridge, Pharmaceutical Research, Vol. 14, No. 8, 1997, pp 1085-1091.
• an attachment group for a sugar moiety such as a glycosylation site, in particular an in vivo glycosylation site
• the conjugate of the invention is one which comprises at least one sugar moiety covalently attached to a polypeptide, wherein the amino acid sequence of the polypeptide differs from that of wild-type FVU or FVUa shown in SEQ ID NO:l in that at least one non-naturally occurring glycosylation site has been introduced and/or at least one naturally occurring glycosylation site has been removed.
• a non-naturally occurring glycosylation site has been introduced, or a non-naturally occurring glycosylation site has been introduced in combination with the removal of a natural occurring glycosylation site.
• the introduced glycosylation site may be an O-glycosylation site or an N-glycosylation site.
• the glycosylation site is an in vivo O-glycosylation site or an in vivo N-glycosylation site, in particular an in vivo N-glycosylation site.
• the term “naturally occurring glycosylation site” covers the glycosylation sites at postions N145, N322, S52 and S60.
• the term “naturally occurring in vivo O-glycosylation site” includes the positions S52 and S60
• the term “naturally occurring in vivo N-glycosylation site” includes positions N145 and N322.
• the amino acid sequence of the FVJJ or FVUa polypeptide differs from that shown in SEQ ID NO:l in that at least one non-naturally occurring glycosylation site (e.g.
• At least one non-naturally occurring in vivo N-glycosylation site such as 1-15 non-naturally occurring glycosylation sites (e.g. 1-15 non-naturally occurring in vivo N-glycosylation sites), in particular 1-10, 1-6 or 2-4 non-naturally occurring glycosylation sites (e.g. 1-10, 1-6 or 2-4 non-naturally occurring in vivo N-glycosylation sites), has been introduced, preferably by substitution.
• the polypeptide of the conjugate comprises one or more glycosylation sites
• the polypeptide in order to prepare a conjugate, wherein the polypeptide of the conjugate comprises one or more glycosylation sites, the polypeptide must be expressed in a host cell capable of attaching sugar (oligosaccharide) moieties at the glycosylation site(s) or alternatively subjected to in vitro glycosylation.
• sugar oligosaccharide
• an in vivo glycosylation site is introduced into a position of the parent FVU or FVUa molecule occupied by an amino acid residue exposed to the surface of the molecule, preferably with more than 25% of the side chain exposed to the solvent, in particular more than 50% exposed to the solvent (these positions are identified in the Methods section herein).
• the N-glycosylation site is then introduced in such a way that the N- residue of said site is located in said position.
• an O-glycosylation site is introduced so that the S or T residue making up such site is located in said position. Examples of such positions include K32S/T, I42S/T, Y44S/T, K143S/T, R290S/T, R315S/T, K341S/T,
• the in vivo glycosylation site is introduced into a position wherein only one mutation is required to create the site (i.e. where any other amino acid residues required for creating a functional glycosylation site is already present in the molecule).
• the conjugate according to the invention is preferably a conjugate, wherein the amino acid sequence of the polypeptide differs from SEQ ID NO:l in that at least one naturally occurring N-X'-X sequence is substituted with a N-X'-S or N-X'-T sequence, wherein X' is any amino acid except P, and X is any amino acid except for S and T.
• the conjugate according to the invention is preferably a conjugate, wherein the amino acid sequence of the polypeptide differs from SEQ ID NO:l in that at least one naturally occurring X-X'-S or X-X'-T sequence naturally present in SEQ ID NO:l is substituted with a N-X'-S or a N-X'-T sequence, wherein X' is any amino acid except P, and X is any amino acid except for N.
• substitutions creating an in vivo N-glycosylation site include a substitution selected from the group consisting of F4S/T, P10N, Q21N, W41N, S43N, A51N,
• the substitution is selected from the group consisting of F4S/T, P10N, Q21N, W41N, A51N, G58N, G59S/T,
• the in vivo glycosylation site is introduced in a position occupied by a lysine residue or an arginine residue, preferably occupied by an lysine residue, in particular so that the N-residue of the N-glycosylation site or the S or T residue of an O-glycosylation site substitutes the lysine residue.
• the conjugate according to the invention is preferably a conjugate, wherein the amino acid sequence of the polypeptide differs from SEQ ID NO:l in that at least one K-X'-X sequence or R-X'-X sequence, preferably a K-X'-X sequence, naturally present in SEQ ID NO:l is substituted with a N-X'-S or a N-X'-T sequence, wherein X' is any amino acid except P, and X is any amino acid except for S and T.
• substitutions creating an in vivo N-glycosylation site include a substitution selected from the group consisting of K32N+A34S/T, K38N+F40S/T, K62N+Q64S/T, K85N+D87S/T, K137N+P139S/T, K143N+N145S/T, K148N+Q149S/T, K161N+E163S/T, K197N+K199S/T, K199N+W201S/T, K316N+G318S/T, K337N, K341N+D343S/T, K389N+M391S/T and combinations thereof.
• a glycosylation site in particular an N-glycosylation site, may be introduced in positions at or in the vicinity of the proteolytic degradation sites described above (see the section entitled "Conjugate of the invention").
• substitutions creating an in vivo N-glycosylation site include a substitution selected from the group consisting of K32N+A34S/T, F31N+D33S/T, I30N+K32S/T, A34N+R36S/T, K38N+F40S/T, T37N+L39S/T, R36N+K38S/T, L39N+W41S/T, F40N+I42S/T, W41N, I42N+Y44S/T, S43N, Y44N+D46S/T, S45N+G47S/T, D46N+D48S/T, G47N+Q49S/T, K143N+N145S/T, E142N+R144S/T, L141N+K143S/T, I140N+E142S/T, R144N+A146S/T, A146N+K148S/T, S147N+P149S/T, R290N+
• the substitution is selected from the group consisting of K32N+A34S/T, K38N+F40S/T, Y44N+D46S/T, K143N+N145S/T, R290N+A292S/T, R315N+V317S/T, K341N+D343S/T, R392N+E394S/T, R396N+G398S/T, R402N+P404S/T and combinations thereof, such as K143N+N145S/T+ R315N+V317S/T.
• the substitution is selected from the group consisting of K32N+A34T, K38N+F40T, Y44N+D46T, K143N+N145T, R290N+A292T, R315N+V317T, 341N+D343T, R392N+E394T,
• the in vivo glycosylation site is introduced in a position which does neither form part of the tissue factor binding nor form part of the active site region and the ridge of the active site binding cleft as defined herein. It is envisaged that such glycosylation variants will primarily belong to the class of active conjugates as defined hereinbefore.
• substitutions creating such an in vivo N-glycosylation site include substitutions selcted from the group consisting of K32N+A34S/T, I30N+K32S/T,
• the substitution is selcted from the group consisting of K32N+A34S/T, K38N+F40S/T, Y44N+D46S/T, K143N+N145S/T, R315N+V317S/T, R392N+E394S/T, R396N+G398S/T, R402N+P404S/T and combinations thereof, such as K143N+N145S/T+ R315N+V317S/T.
• the substitution is selected from the group consisting of K32N+A34T, K38N+F40T, Y44N+D46T, K143N+N145T, R315N+V317T, R392N+E394T, R396N+G398T, R402N+P404T and combinations thereof, in particular K143N+N145T+ R315N+V317T.
• the in vivo glycosylation site is introduced in a position which does not form part of the tissue factor but which forms part of the active site region and the ridge of the active site binding cleft as defined herein.
• substitutions creating such an in vivo N-glycosylation site include substitutions selcted from the group consisting of I153N+G155S/T, Q167N+L169S/T, V168N+L170S/T, L169N+L171S/T, L170N+V172S/T, L171N+N173S/T, A175S/T, A175N+L177S/T, L177N+G179S/T, G179N, G180N+L182S/T, T181N+I183S/T, V188N, V189N+A191S/T, S190N+A192S/T, A191N+H193S/T, H193N+F195S/T, F195N+K197S/T, D196N+I198S/T, K197N+
• G342N+S344S/T D343N+G345S/T, S344N+G346S/T, G345N+P347S/T, P347N+A349S/T, H348N, L358N+G360S/T, T359N+I361S/T, G360N+V362S/T, I361N, V362N+W364S/T,
• the substitution is selected from the group consisting of D289N+G291S/T, R290N+A292S/T, G291N, A292N+A294S/T, T293N+L295S/T, S339N+K341S/T,
• substitution is selcted from the group consisting of D289N+G291T, R290N+A292T, G291N, A292N+A294T, T293N+L295T, S339N+K341T, K341N+D343T, G342N+S344T, D343N+G345T, and combinations thereof.
• the conjugate according to the aspect of the invention described in the present section may contain additional non-polypeptide moieties, in particular a polymer molecule, as described in the present application, conjugated to one or more attachment groups present in the polypeptide part of the conjugate.
• any of the glycosylated variants disclosed in the present section having introduced and/or removed at least one glycosylation site may further be conjugated to a polymer molecule, such as PEG, or any other non-polypeptide moiety.
• a polymer molecule such as PEG
• the conjugation may be achieved by use of attachment groups already present in the FVJJ or FVUa polypeptide or attachment groups may have been introduced and/or removed, in particular such that a total of 1-6, in particular 3-4 or 1, 2, 3, 4, 5, or 6 attachment groups are available for conjugation.
• the number and molecular weight of the non-polypeptide moiety is chosen so as that the total molecular weight added by the non-polypeptide moiety is in the range of 5-25 kDa, such as in the range of 10-25 kDa, in particular about 5 kDa, about 12 kDa, about 15 kDa or about 20kDa.
• An inactive conjugate is chosen so as that the total molecular weight added by the non-polypeptide moiety is in the range of 5-25 kDa, such as in the range of 10-25 kDa, in particular about 5 kDa, about 12 kDa, about 15 kDa or about 20kDa.
• the conjugates of the invention may be rendered inactive by removing at least one amino acid residue occupying a position selected from the group consisting of R152, 1153,
• the removal may be effected by substitution or deletion of one or more of the above-identified amino acid residues.
• the removal is effected by substitution, in particular by conservative substitution. Accordingly, the inactive
• FVJJ or FVUa polypeptide used herein may comprise one or more of the following substitutions: R152X, I153X, S344X, D242X or H193X, wherein X is any amino acid residue, preferably one leading to a conservative substitution.
• the inactive FVU or FVUa polypeptide comprises the mutations R152X, wherein X is any amino acid residue other than lysine (since lysine forms part of a protease cleavage site).
• Other examples of specific substitutions include I153A/V/L; S344T/A/G/Y; D242E/A and/or H193R/A.
• an active FVJJ or FVUa polypeptide may be rendered inactive by carbamylating the ⁇ -amino acid group 1153 or by complexing the polypeptide to a serine proteinase inhibitor.
• a suitable serine inhibitor protein is, e.g., selected from the group consisting of an organophosphor coumpound, a sulfanylfluoride, a peptide halomethylketone, preferably a dansyl-Phe-Pro-Arg chloromethylketone, dansyl-Glu-Glu-Arg chlormethylketone, Dansyl-Phe-Phe-Arg chlormethylketone or a Phe-Phe-Arg chlormethylketone, or an azapeptide.
• a conjugate may also be rendered inactive by introducing at least one glycosylation site in a position selected so that the subsequent glycosylation inactivates the conjugate.
• non-polypeptide moiety of the conjugate of the invention is preferably selected from the group consisting of a polymer molecule, a lipophilic compound, a sugar moiety (by way of in vivo glycosylation) and an organic derivatizing agent. All of these agents may confer desirable properties to the polypeptide part of the conjugate, in particular increased functional in vivo half-life and/or increased plasma half -life.
• the polypeptide part of the conjugate is normally conjugated to only one type of non-polypeptide moiety, but may also be conjugated to two or more different types of non-polypeptide moieties, e.g.
• conjugation to two or more different non-polypeptide moieties may be done simultaneous or sequentially.
• a polypeptide conjugate according to the invention may be produced by culturing an appropriate host cell under conditions conducive for the expression of the polypeptide, and recovering the polypeptide, wherein a) the polypeptide comprises at least one N- or O- glycosylation site and the host cell is a eukaryotic host cell capable of in vivo glycosylation, and/or b) the polypeptide is subjected to conjugation to a non-polypeptide moiety in vitro.
• the conjugation should be designed so as to produce the optimal molecule with respect to the number of non-polypeptide moieties attached, the size and form of such molecules (e.g.
• the molecular weight of the non-polypeptide moiety to be used may e.g. be chosen on the basis of the desired effect to be achieved. For instance, if the primary purpose of the conjugation is to achieve a conjugate having a high molecular weight (e.g. to reduce renal clearance) it is usually desirable to conjugate as few high molecular weight non-polypeptide moieties as possible to obtain the desired molecular weight. When a high degree of shielding is desirable this may be obtained by use of a sufficiently high number of low molecular weight non-polypeptide moieties (e.g.
• the polypeptide and the lipophilic compound may be conjugated to each other, either directly or by use of a linker.
• the lipophilic compound may be a natural compound such as a saturated or unsaturated fatty acid, a fatty acid diketone, a terpene, a prostaglandin, a vitamine, a carotenoide or steroide, or a synthetic compound such as a carbon acid, an alcohol, an amine and sulphonic acid with one or more alkyl-, aryl-, alkenyl- or other multiple unsaturated compounds.
• the conjugation between the polypeptide and the lipophilic compound, optionally through a linker may be done according to methods known in the art, e.g. as described by
• the polymer molecule to be coupled to the polypeptide may be any suitable polymer molecule, such as a natural or synthetic homo-polymer or hetero-polymer, typically with a moleculai- weight in the range of about 300-100,000 Da, such as about 500-20,000 Da, more preferably in the range of about 500-15,000 Da, even more preferably in the range of about 2- 12 kDa, such as in the range of about 3-10 kDa.
• a moleculai- weight in the range of about 300-100,000 Da, such as about 500-20,000 Da, more preferably in the range of about 500-15,000 Da, even more preferably in the range of about 2- 12 kDa, such as in the range of about 3-10 kDa.
• homo-polymers examples include a polyol (i.e. poly-OH), a polyamine (i.e. poly- NH 2 ) and a polycarboxylic acid (i.e. poly-COOH).
• a hetero-polymer is a polymer comprising different coupling groups, such as a hydroxyl group and an amine group.
• suitable polymer molecules include polymer molecules selected from the group consisting of polyalkylene oxide (PAO), including polyalkylene glycol (PAG), such as polyethylene glycol (PEG) and polypropylene glycol (PPG), branched PEGs, poly- vinyl alcohol (PVA), poly-carboxylate, poly-(vinylpyrolidone), polyethylene-co-maleic acid anhydride, polystyrene-co-maleic acid anhydride, dextran, including carboxymethyl-dextran, or any other biopolymer suitable for reducing immunogenicity and/or increasing functional in vivo half-life and/or serum half-life.
• PEO polyalkylene oxide
• PAG polyalkylene glycol
• PEG polyethylene glycol
• PPG polypropylene glycol
• PVA poly- vinyl alcohol
• PVA poly-carboxylate
• poly-(vinylpyrolidone) polyethylene-co-maleic acid anhydride
• PEG is the preferred polymer molecule, since it has only few reactive groups capable of cross-linking compared to, e.g., polysaccharides such as dextran.
• mono- functional PEG e.g. methoxypolyethylene glycol (mPEG)
• mPEG methoxypolyethylene glycol
• the hydroxyl end groups of the polymer molecule must be provided in activated form, i.e. with reactive functional groups (examples of which include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidyl proprionate (SPA), succinimidy carboxymethylate (SCM), benzotriazole carbonate (BTC), N-hydroxysuccinimide (NHS), aldehyde, nitrophenylcarbonate (NPC), and tresylate (TRES)).
• reactive functional groups include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidyl proprionate (SPA), succinimidy carboxymethylate (SCM), benzotriazole carbonate (BTC), N-hydroxysuccinimide (NHS), al
• Suitable activated polymer molecules are commercially available, e.g. from Shearwater Polymers, Inc., Huntsville, AL, USA, or from PolyMASC Pharmaceuticals pic, UK.
• the polymer molecules can be activated by conventional methods known in the art, e.g. as disclosed in WO 90/13540.
• Specific examples of activated linear or branched polymer molecules for use in the present invention are described in the Shearwater Polymers, Inc. 1997 and 2000 Catalogs (Functionalized Biocompatible Polymers for Research and pharmaceuticals, Polyethylene Glycol and Derivatives, incorporated herein by reference).
• Specific examples of activated PEG polymers include the following linear PEGs: NHS-PEG (e.g.
• SPA-PEG SSPA-PEG, SBA-PEG, SS-PEG, SSA-PEG, SC-PEG, SG-PEG, and SCM-PEG
• NOR-PEG BTC-PEG, EPOX-PEG, NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG, TRES-PEG, VS-PEG, IODO-PEG, and MAL-PEG
• branched PEGs such as PEG2-NHS and those disclosed in US 5,932,462 and US 5,643,575, both of which are incorporated herein by reference.
• the conjugation of the polypeptide and the activated polymer molecules is conducted by use of any conventional method, e.g. as described in the following references (which also describe suitable methods for activation of polymer molecules): R.F. Taylor, (1991), “Protein immobilisation. Fundamental and applications", Marcel Dekker, N.Y.; S.S. Wong, (1992), “Chemistry of Protein Conjugation and Crosslinking", CRC Press, Florida, USA; G.T.
• the activation method and/or conjugation chemistry to be used depends on the attachment group(s) of the polypeptide (examples of which are given further above), as well as the functional groups of the polymer (e.g. being amine, hydroxyl, carboxyl, aldehyde, sulfydryl, succinimidyl, maleimide, vinysulfone or haloacetate).
• the PEGylation may be directed towards conjugation to all available attachment groups on the polypeptide (i.e. such attachment groups that are exposed at the surface of the polypeptide) or may be directed towards one or more specific attachment groups, e.g. the N-terminal amino group as described in US 5,985,265.
• the conjugation may be achieved in one step or in a stepwise manner (e.g. as described in WO 99/55377).
• the PEGylation is designed so as to produce the optimal molecule with respect to the number of PEG molecules attached, the size and form of such molecules (e.g. whether they are linear or branched), and the attachment site(s) in the polypeptide.
• the molecular weight of the polymer to be used may e.g. be chosen on the basis of the desired effect to be achieved. For instance, if the primary purpose of the conjugation is to achieve a conjugate having a high molecular weight (e.g. to reduce renal clearance) it is usually desirable to conjugate as few high molecular weight polymer molecules as possible to obtain the desired molecular weight.
• a high degree of shielding when a high degree of shielding is desirable this may be obtained by use of a sufficiently high number of low molecular weight polymer molecules (e.g. with a molecular weight of from about 300 Da to about 5 kDa) to effectively shield all or most protease cleavage sites or other vulnerable sites of the polypeptide.
• a sufficiently high number of low molecular weight polymer molecules e.g. with a molecular weight of from about 300 Da to about 5 kDa
• 2-8, such as 3- 6 such polymers may be used.
• the polymer molecule which may be linear or branched, has a high molecular weight, preferably about 10-25 kDa, such as about 15- 25 kDa, e.g. about 20 kDa.
• the polymer conjugation is performed under conditions aimed at reacting as many of the available polymer attachment groups with polymer molecules. This is achieved by means of a suitable molar excess of the polymer relative to the polypeptide.
• the molar ratios of activated polymer molecules to polypeptide are up to about 1000-1, such as up to about 200-1, or up to about 100-1. In some cases the ration may be somewhat lower, however, such as up to about 50-1, 10-1 or 5-1 in order to obtain optimal reaction.
• the polypeptide conjugate of the invention comprises a polymer molecule covalently attached to the Al N-terminal of the wild type FVU or FVUa polypeptide shown in SEQ ID NO:l, where said polymer molecule is the only polymer molecule attached to the polypeptide.
• such polypeptide conjugates are ones, which comprise a single PEG molecule attached to the N-terminal of the polypeptide and no other PEG molecules.
• a linear or branched PEG molecule with a molecular weight of at least about 5 kDa, in particular about 10-25 kDa, such as about 15-25 kDa, e.g. about 20 kDa is preferred.
• polypeptide conjugate may further comprise one or more sugar moieties attached to an N-linked or O-linked glycosylation site of the polypeptide or sugar moieties attached by in vitro glycosylation.
• the polypeptide conjugate of the invention comprises polymer molecules covalently attached to the Al N-terminal and to the 1153 N-terminal of the wild type FVUa polypeptide shown in SEQ ID NO:l, where said polymer molecules are the only polymer molecules attached to the polypeptide.
• polypeptide conjugates are ones, which comprise a PEG molecule attached to both of the N-terminals of FVUa and no other PEG molecules.
• linear or branched PEG molecules with a molecular weight of at least about 5 kDa, in particular about 10-25 kDa, such as about 15-25 kDa, e.g. about 20 kDa are preferred.
• the polypeptide conjugate according to this embodiment may further comprise one or more sugar moieties attached to an N-linked or O-linked glycosylation site of the polypeptide or sugar moieties attached by in vitro glycosylation.
• One preferred method for selectively coupling polymer molecules, such as PEG molecules, to the N-terminal of the polypeptide is the method disclosed in US 5,985,265.
• This method involves reductive alkylation (reaction of the N-terminal amino group of the polypeptide with an aldehyde-containing polypeptide, such as aldehylde-PEG, in the presence of a reducing agent, such as NaCNBH 3 ).
• This method exploits differential reactivity of different types of primary amino groups (lysine versus N-terminal) available for derivatization in the polypeptide, thereby achieving substantially selective derivatization of the polypeptide at the N- terminus with a carbonyl group-containing polymer molecule, such as aldehyde-PEG.
• the reaction is performed at a pH which allows one to take advantage of the pK a differences between the ⁇ -amino groups of the lysine residues and that of the -amino group of the N- terminal residue of the polypeptide.
• the reaction is typically carried at slightly acidic conditions.
• suitable pH ranges include pH 4.5-7, such as pH 4.5-6, e.g. pH 5-6, in particular about pH 5,
• the polypeptide conjugate of the invention comprises a PEG molecule attached to each of the lysine residues in the polypeptide available for PEGylation, in particular a linear or branched PEG molecule, e.g. with a molecular weight of about 1-15 kDa, typically about 2-12 kDa, such as about 3-10 kDa, e.g. about 5 or 6 kDa.
• the polypeptide conjugate of the invention comprises a PEG molecule attached to each of the lysine residues in the polypeptide available for PEGylation, in particular a linear or branched PEG molecule, e.g. with a molecular weight of about 1-15 kDa, typically about 2-12 kDa, such as about 3-10 kDa, e.g. about 5 or 6 kDa.
• the polypeptide conjugate of the invention comprises a
• PEG molecule attached to each of the lysine residues in the polypeptide available for PEGylation, and in addition to the N-terminal amino acid residue of the polypeptide.
• Covalent in vitro coupling of carbohydrate moieties (such as dextran) to amino acid residues of the polypeptide may also be used, e.g. as described, for example in WO 87/05330 and in Aplin etl al., CRC Crit Rev. Biochem, pp. 259-306, 1981.
• the in vitro coupling of carbohydrate moieties or PEG to protein- and peptide-bound Gin-residues can be carried out by transglutaminases (TGases).
• Transglutaminases catalyse the transfer of donor amine-groups to protein- and peptide-bound Gin-residues in a so-called cross-linking reaction.
• the donor-amine groups can be protein- or peptide-bound , such as the ⁇ -amino-group in Lys-residues or it can be part of a small or large organic molecule.
• An example of a small organic molecule functioning as amino-donor in TGase-catalysed cross-linking is putrescine (1,4-diaminobutane).
• An example of a larger organic molecule functioning as amino-donor in TGase-catalysed cross- linking is an amine-containing PEG (Sato et al., 1996, Biochemistry 35, 13072-13080).
• TGases in general, are highly specific enzymes, and not every Gin-residues exposed on the surface of a protein is accessible to TGase-catalysed cross-linking to amino-containing substances. On the contrary, only few Gin-residues are naturally functioning as TGase substrates but the exact parameters governing which Gin-residues are good TGase substrates remain unknown. Thus, in order to render a protein susceptible to TGase-catalysed cross- linking reactions it is often a prerequisite at convenient positions to add stretches of amino acid sequence known to function very well as TGase substrates. Several amino acid sequences are known to be or to contain excellent natural TGase substrates e.g. substance P, elafin, fibrinogen, fibronectin, ⁇ 2 -plasmin inhibitor, ⁇ -caseins, and ⁇ -caseins.
• substance P elafin, fibrinogen, fibronectin, ⁇ 2
• the expression host cell may be selected from fungal (filamentous fungal or yeast), insect or animal cells or from transgenic plant cells.
• the host cell is a mammalian cell, such as a CHO cell, BHK or HEK, e.g. HEK 293, cell, or an insect cell, such as an SF9 cell, or a yeast cell, e.g. S. cerevisiae or Pichia pastoris, or any of the host cells mentioned hereinafter.
• Covalent modification of the polypeptide may be performed by reacting one or more attachment groups of the polypeptide with an organic derivatizing agent.
• organic derivatizing agent Suitable derivatizing agents and methods are well known in the art. For example, cysteinyl residues most commonly are reacted with ⁇ -haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxyamidomethyl derivatives.
• Cysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, -bromo- ⁇ -(4-imidozoyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2- oxa-l,3-diazole.
• Histidyl residues are derivatized by reaction with diethylpyrocarbonateat pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain.
• Para-bromophenacyl bromide also is useful.
• the reaction is preferably performed in 0.1 M sodium cacodylate at pH 6.0. Lysinyl and amino terminal residues are reacted with succinic or other carboxylic acid anhydrides. Derivatization with these agents has the effect of reversing the charge of the lysinyl residues.
• Suitable reagents for derivatizing -amino-containing residues include imidoesters such as methyl picolinimidate, pyridoxal phosphate, pyridoxal, chloroborohydride, trinitrobenzenesulfonic acid, O-methylisourea, 2,4-pentanedione and transaminase-catalyzed reaction with glyoxylate.
• Arginyl residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin. Derivatization of arginine residues requires that the reaction be performed in alkaline conditions because of the high pKa of the guanidine functional group.
• these reagents may react with the groups of lysine as well as the arginine guanidino group.
• aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
• the helper molecule is one, which specifically recognizes a functional site of the polypeptide, such as a receptor, in particular tissue factor, either full length or a suitably truncated form of tissue factor or two molecules, one being tissue factor the other one being a peptide or peptide inhibitor binding to and thus protecting the area around the catalytic triad (preferably defined as amino acid residues within 10 A of any atom in the catalytic triad).
• the helper molecule may be an antibody, in particular a monoclonal antibody recognizing the FVJJ polypeptide.
• the helper molecule may be a neutralizing monoclonal antibody.
• the polypeptide is allowed to interact with the helper molecule before effecting conjugation. This ensures that the functional site of the polypeptide is shielded or protected and consequently unavailable for derivatization by the non-polypeptide moiety such, as a polymer. Following its elution from the helper molecule, the conjugate between the non-polypeptide moiety and the polypeptide can be recovered with at least a partially preserved functional site.
• the subsequent conjugation of the polypeptide having a blocked functional site to a polymer, a lipophilic compound, a sugar moiety, an organic derivatizing agent or any other compound is conducted in the normal way, e.g. as described in the sections above entitled "Conjugation to .".
• helper molecule is free from or comprises only few attachment groups for the non-polypeptide moiety of choice in part(s) of the molecule, where the conjugation to such groups will hamper the desorption of the conjugated polypeptide from the helper molecule.
• selective conjugation to attachment groups present in non-shielded parts of the polypeptide can be obtained and it is possible to reuse the helper molecule for repeated cycles of conjugation.
• the non- polypeptide moiety is a polymer molecule such as PEG, which has the epsilon amino group of a lysine or N-terminal amino acid residue as an attachment group
• the helper molecule is substantially free from conjugatable epsilon amino groups, preferably free from any epsilon amino groups.
• the helper molecule is a protein or peptide capable of binding to the functional site of the polypeptide, which protein or peptide is free from any conjugatable attachment groups for the non-polypeptide moiety of choice.
• helper molecule is first covalently linked to a solid phase such as column packing materials, for instance Sephadex or agarose beads, or a surface, e.g. reaction vessel. Subsequently, the polypeptide is loaded onto the column material carrying the helper molecule and conjugation carried out according to methods known in the art, e.g. as described in the sections above entitled "Conjugation to .". This procedure allows the polypeptide conjugate to be separated from the helper molecule by elution. The polypeptide conjugate is eluted by conventional techniques under physico-chemical conditions that do not lead to a substantive degradation of the polypeptide conjugate.
• a solid phase such as column packing materials, for instance Sephadex or agarose beads, or a surface, e.g. reaction vessel.
• the fluid phase containing the polypeptide conjugate is separated from the solid phase to which the helper molecule remains covalently linked.
• the separation can be achieved in other ways:
• the helper molecule may be derivatised with a second molecule (e.g. biotin) that can be recognized by a specific binder (e.g. streptavidin).
• the specific binder may be linked to a solid phase thereby allowing the separation of the polypeptide conjugate from the helper molecule-second molecule complex through passage over a second helper-solid phase column which will retain, upon subsequent elution, the helper molecule-second molecule complex, but not the polypeptide conjugate.
• the polypeptide conjugate may be released from the helper molecule in any appropriate fashion.
• Deprotection may be achieved by providing conditions in which the helper molecule dissociates from the functional site of the FVJJ to which it is bound.
• a complex between an antibody to which a polymer is conjugated and an anti-idiotypic antibody can be dissociated by adjusting the pH to an acid or alkaline pH.
• a conformation specific antibody that recognizes a Ca specific conformation of FVJJ and consequently can be eluted with EDTA under mild conditions.
• Attachment of a serine protease inhibitor can be performed in accordance with the method described in WO 96/12800.
• the polypeptide is expressed as a fusion protein with a tag, i.e. an amino acid sequence or peptide stretch made up of typically 1-30, such as 1-20 amino acid residues.
• a tag i.e. an amino acid sequence or peptide stretch made up of typically 1-30, such as 1-20 amino acid residues.
• the tag is a convenient tool for achieving conjugation between the tagged polypeptide and the non-polypeptide moiety.
• the tag may be used for achieving conjugation in microtiter plates or other carriers, such as paramagnetic beads, to which the tagged polypeptide can be immobilised via the tag.
• the conjugation to the tagged polypeptide in, e.g., microtiter plates has the advantage that the tagged polypeptide can be immobilised in the microtiter plates directly from the culture broth (in principle without any purification) and subjected to conjugation. Thereby, the total number of process steps (from expression to conjugation) can be reduced.
• the tag may function as a spacer molecule, ensuring an improved accessibility to the immobilised polypeptide to be conjugated.
• the conjugation using a tagged polypeptide may be to any of the non-polypeptide moieties disclosed herein, e.g. to a polymer molecule such as PEG.
• the identity of the specific tag to be used is not critical as long as the tag is capable of being expressed with the polypeptide and is capable of being immobilised on a suitable surface or carrier material.
• suitable tags are commercially available, e.g. from Unizyme
• the tag may consist of any of the following sequences:
• EQKLI SEEDL (a C-terminal tag described in Mol. Cell. Biol. 5:3610-16, 1985)
• DYKDDDDK (a C- or N-terminal tag)
• Antibodies against the above tags are commercially available, e.g. from ADI, Aves
• the subsequent cleavage of the tag from the polypeptide may be achieved by use of commercially available enzymes.
• polypeptide of the present invention or the polypeptide part of a conjugate of the invention, optionally in glycosylated form may be produced by any suitable method known in the art. Such methods include constructing a nucleotide sequence encoding the polypeptide and expressing the sequence in a suitable transformed or transfected host.
• the host cell is a gammacarboxylating host cell such as a mammalian cell.
• polypeptides of the invention may be produced, albeit less efficiently, by chemical synthesis or a combination of chemical synthesis or a combination of chemical synthesis and recombinant DNA technology.
• a nucleotide sequence encoding a polypeptide or the polypeptide part of a conjugate of the invention may be constructed by isolating or synthesizing a nucleotide sequence encoding the parent FVJJ, such as hFVJJ with the amino acid sequence shown in SEQ ID NO:l and then changing the nucleotide sequence so as to effect introduction (i.e. insertion or substitution) or removal (i.e. deletion or substitution) of the relevant amino acid residue(s).
• the nucleotide sequence is conveniently modified by site-directed mutagenesis in accordance with conventional methods.
• the nucleotide sequence is prepared by chemical synthesis, e.g.
• oligonucleotide synthesizer by using an oligonucleotide synthesizer, wherein oligonucleotides are designed based on the amino acid sequence of the desired polypeptide, and preferably selecting those codons that are favored in the host cell in which the recombinant polypeptide will be produced.
• oligonucleotides are designed based on the amino acid sequence of the desired polypeptide, and preferably selecting those codons that are favored in the host cell in which the recombinant polypeptide will be produced.
• several small oligonucleotides coding for portions of the desired polypeptide may be synthesized and assembled by PCR, ligation or ligation chain reaction
• nucleotide sequence modification methods are available for producing polypeptide variants for high throughput screening, for instance methods which involve homologous cross-over such as disclosed in US 5,093,257, and methods which involve gene shuffling, i.e. recombination between two or more homologous nucleotide sequences resulting ⁇ o in new nucleotide sequences having a number of nucleotide alterations when compared to the starting nucleotide sequences.
• Gene shuffling also known as DNA shuffling
• homology-based nucleic acid shuffling the relevant parts of the nucleotide
• 15 sequences are preferably at least 50% identical, such as at least 60% identical, more preferably at least 70% identical, such as at least 80% identical.
• the recombination can be performed in vitro or in vivo.
• Family shuffling involves subjecting a family of homologous genes from different species to one or more cycles of shuffling and subsequent screening or selection.
• the synthetically generated oligonucleotides are recombined, and the resulting recombinant nucleic acid sequences are screened and if desired used for further shuffling cycles. Synthetic shuffling techniques are disclosed in WO 00/42561.
• In silico shuffling refers to a DNA shuffling procedure, which is performed or modelled using a computer system, thereby partly or entirely avoiding the need for physically manipulating nucleic acids. Techniques for in silico shuffling are disclosed in WO 00/42560.
• the nucleotide sequence encoding the polypeptide is inserted into a recombinant vector and operably linked to control sequences necessary for expression of the FVU in the desired transformed host cell.
• vectors and expression control sequences function equally well to express the nucleotide sequence encoding a polypeptide described herein. Neither will all hosts function equally well with the same expression system. However, one of skill in the art may make a selection among these vectors, expression control sequences and hosts without undue experimentation. For example, in selecting a vector, the host must be considered because the vector must replicate in it or be able to integrate into the chromosome. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. In selecting an expression control sequence, a variety of factors should also be considered.
• Hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the nucleotide sequence, their secretion characteristics, their ability to fold the polypeptide correctly, their fermentation or culture requirements, and the ease of purification of the products coded for by the nucleotide sequence.
• the recombinant vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid.
• the vector is one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
• the vector is preferably an expression vector, in which the nucleotide sequence encoding the polypeptide of the invention is operably linked to additional segments required for transcription of the nucleotide sequence.
• the vector is typically derived from plasmid or viral
• Suitable expression vectors for expression in the host cells mentioned herein are commercially available or described in the literature.
• Useful expression vectors for eukaryotic hosts include, for example, vectors comprising expression control sequences from
• SV40 bovine papilloma virus
• adenovirus adenovirus
• cytomegalovirus adenovirus
• Specific vectors are, e.g., pCDNA3.1(+) ⁇ Hyg (Invitrogen, Carlsbad, CA, USA) and pCI-neo (Stratagene, La Jola, CA,
• Useful expression vectors for yeast cells include the 2 ⁇ plasmid and derivatives thereof, the POT1 vector (US 4,931 ,373), the pJSO37 vector described in Okkels, Ann. New York Acad. Sci. 782, 202-207, 1996, and pPICZ A, B or C (Invitrogen).
• Useful vectors for insect cells include pVL941, pBG311 (Cate et al., "Isolation of the Bovine and Human Genes for Mullerian Inhibiting Substance And Expression of the Human Gene In Animal Cells", Cell, 45, pp. 685-98 (1986), pBluebac 4.5 and pMelbac (both available from Invitrogen).
• Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E. coli, including pBR322, ⁇ ET3a and pET12a (both from Novagen Inc., WI, USA), wider host range plasmids, such as RP4, phage DNAs, e.g., the numerous derivatives of phage lambda, e.g., NM989, and other DNA phages, such as M13 and filamentous single stranded DNA phages.
• Other vectors for use in this invention include those that allow the nucleotide sequence encoding the polypeptide to be amplified in copy number. Such amplifiable vectors are well known in the art.
• DHFR vectors able to be amplified by DHFR amplification
• vectors able to be amplified by DHFR amplification see, e.g., Kaufman, U.S. Pat. No. 4,470,461, Kaufman and Sharp, "Construction Of A Modular Dihydrafolate Reductase cDNA Gene: Analysis Of Signals Utilized For Efficient Expression", Mol. Cell. Biol., 2, pp. 1304-19 (1982)
• GS glutamine synthetase
• the recombinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
• a DNA sequence enabling the vector to replicate in the host cell in question.
• An example of such a sequence is the SV40 origin of replication.
• suitable sequences enabling the vector to replicate are the yeast plasmid 2 ⁇ replication genes REP 1-3 and origin of replication.
• the vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40,
• a selectable marker e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40,
• selectable markers include ura3 and leu2.
• selectable markers include amdS, pyrG, arcB, niaD and sC.
• control sequences is defined herein to include all components, which are necessary or advantageous for the expression of the polypeptide of the invention.
• Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide.
• control sequences include, but are not limited to, a leader sequence, polyadenylation sequence, propeptide sequence, promoter, enhancer or upstream activating sequence, signal peptide sequence, and transcription terminator.
• the control sequences include a promoter.
• expression control sequences may be used in the present invention.
• useful expression control sequences include the expression control sequences associated with structural genes of the foregoing expression vectors as well as any sequence known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
• control sequences for directing transcription in mammalian cells include the early and late promoters of SV40 and adenovirus, e.g. the adenovirus 2 major late promoter, the MT-1 (metallothionein gene) promoter, the human cytomegalovirus immediate- early gene promoter (CMV), the human elongation factor l ⁇ (EF-l ⁇ ) promoter, the Drosophila minimal heat shock protein 70 promoter, the Rous Sarcoma Virus (RSV) promoter, the human ubiquitin C (UbC) promoter, the human growth hormone terminator, SV40 or adenovirus Elb region polyadenylation signals and the Kozak consensus sequence (Kozak, M. J Mol Biol 1987 Aug 20;196(4):947-50).
• adenovirus 2 major late promoter e.g. the adenovirus 2 major late promoter, the MT-1 (metallothionein gene) promoter, the human cytomegalovirus immediate- early gene
• a synthetic intron may be inserted in the 5' untranslated region of the nucleotide sequence encoding the polypeptide.
• An example of a synthetic intron is the synthetic intron from the plasmid pCI-Neo (available from Promega Corporation, WI, USA).
• suitable control sequences for directing transcription in insect cells include the polyhedrin promoter, the P10 promoter, the Autographa californica polyhedrosis virus basic protein promoter, the baculovirus immediate early gene 1 promoter and the baculovirus 39K delayed-early gene promoter, and the SV40 polyadenylation sequence.
• suitable control sequences for use in yeast host cells include the promoters of the yeast ⁇ -mating system, the yeast triose phosphate isomerase (TPI) promoter, promoters from yeast glycolytic genes or alcohol dehydrogenase genes, the ADH2-4c promoter, and the inducible GAL promoter.
• suitable control sequences for use in filamentous fungal host cells include the ADH3 promoter and terminator, a promoter derived from the genes encoding Aspergillus oryzae TAKA amylase triose phosphate isomerase or alkaline protease, an
• A. niger ⁇ -amylase A. niger or A. nidulans glucoamylase, A. nidulans acetamidase,
• Rhizomucor miehei aspartic proteinase or lipase the TPI1 terminator and the ADH3 terminator.
• control sequences for use in bacterial host cells include promoters of the lac system, the trp system, the TAC or TRC system, and the major promoter regions of phage lambda.
• the presence or absence of a signal peptide will, e.g., depend on the expression host cell used for the production of the polypeptide to be expressed (whether it is an intracellular or extracellular polypeptide) and whether it is desirable to obtain secretion.
• the signal peptide may conveniently be derived from a gene encoding an Aspergillus sp. amylase or glucoamylase, a gene encoding a Rhizomucor miehei lipase or protease or a Humicola lanuginosa lipase.
• the signal peptide is preferably derived from a gene encoding A. oryzae TAKA amylase, A.
• the signal peptide may conveniently be derived from an insect gene (cf. WO 90/05783), such as the Lepidopteran manduca sexta adipokinetic hormone precursor, (cf. US 5,023,328), the honeybee melittin (Invitrogen), ecdysteroid UDPglucosyltransferase (egt) (Murphy et al., Protein Expression and Purification 4, 349-357 (1993) or human pancreatic lipase (hpl) (Methods in Enzymology 284, pp.
• insect gene cf. WO 90/05783
• the Lepidopteran manduca sexta adipokinetic hormone precursor cf. US 5,023,328
• the honeybee melittin Invitrogen
• ecdysteroid UDPglucosyltransferase egt
• hpl human pancreatic lipase
• a preferred signal peptide for use in mammalian cells is that of hFVJJ or the murine lg kappa light chain signal peptide (Coloma, M (1992) J. Imm. Methods 152:89-104).
• suitable signal peptides have been found to be the ⁇ -factor signal peptide from S. cereviciae (cf. US 4,870,008), a modified carboxypeptidase signal peptide (cf. L.A. Vails et al, Cell 48, 1987, pp. 887-897), the yeast BAR1 signal peptide (cf.
• WO 87/02670 the yeast aspartic protease 3 (YAP3) signal peptide (cf. M. Egel-Mitani et al, Yeast 6, 1990, pp. 127-137), and the synthetic leader sequence TA57 (WO98/32867).
• YAP3 yeast aspartic protease 3
• TA57 the synthetic leader sequence TA57
• the nucleotide sequence of the invention encoding a FVU polypeptide may optionally include a nucleotide sequence that encode a signal peptide.
• the signal peptide is present when the polypeptide is to be secreted from the cells in which it is expressed. Such signal peptide, if present, should be one recognized by the cell chosen for expression of the polypeptide.
• the signal peptide may be homologous (e.g. be that normally associated with hFVJJ) or heterologous (i.e. originating from another source than hFVII) to the polypeptide or may be homologous or heterologous to the host cell, i.e.
• the signal peptide may be prokaryotic, e.g. derived from a bacterium such as E. coli, or eukaryotic, e.g. derived from a mammalian, or insect or yeast cell.
• Any suitable host may be used to produce the polypeptide or polypeptide part of the conjugate of the invention, including bacteria, fungi (including yeasts), plant, insect, mammal, or other appropriate animal cells or cell lines, as well as transgenic animals or plants.
• bacterial host cells include grampositive bacteria such as strains of Bacillus, e.g. B. brevis or B.
• subtilis subtilis, Pseudomonas or Streptomyces, or gramnegative bacteria, such as strains of E. coli.
• the introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209- 221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).
• suitable filamentous fungal host cells include strains of Aspergillus, e.g. A. oryzae, A. niger, or A. nidulans, Fusarium or Trichoderma. Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and US 5,679,543. Suitable methods for transforming Fusarium species are described by Malardier et al, 1989, Gene 78: 147-156 and WO 96/00787. Examples of suitable yeast host cells include strains of Saccharomyces, e.g. S.
• Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N.
• suitable insect host cells include a Lepidoptora cell line, such as Spodoptera frugiperda (Sf9 or Sf21) or Trichoplusioa ni cells (High Five) (US
• Transformation of insect cells and production of heterologous polypeptides therein may be performed as described by Invitrogen.
• suitable mammalian host cells include Chinese hamster ovary (CHO) cell lines, (e.g. CHO-K1 ; ATCC CCL-61), Green
• COS Monkey cell lines
• COS 7 e.g. COS 7
• mouse cells e.g. NS/O
• Baby Hamster Kidney (BHK) cell lines e.g. ATCC CRL-1632 or ATCC
• HEK 293 ATCC CRL-1573
• plant cells in tissue culture Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland.
• the mammalian cell such as a CHO cell, may be modified to express sialyltransferase, e.g. 1,6- sialyltransferase, e.g. as described in US 5,047,335, in order to provide improved glycosylation of the FVU or FVUa polypeptide.
• polypeptide of the invention in order to increase secretion it may be of particular interest to produce the polypeptide of the invention together with an endoprotease, in particular a PACE (Paired basic amino acid converting enzyme) (e.g. as described in US 5,986,079), such as a Kex2 endoprotease (e.g. as described in WO 00/28065).
• PACE Paned basic amino acid converting enzyme
• Kex2 endoprotease e.g. as described in WO 00/28065.
• Methods for introducing exogeneous DNA into mammalian host cells include calcium phosphate-mediated transfection, electroporation, DEAE-dextran mediated transfection, liposome-mediated transfection, viral vectors and the transfection method described by Life Technologies Ltd, Paisley, UK using Lipofectamin 2000. These methods are well known in the art and e.g. described by Ausbel et al (eds.), 1996, Current Protocols in Molecular Biology, John Wiley & Sons, New York, USA. The cultivation of mammalian cells are conducted according to established methods, e.g. as disclosed in (Animal Cell Biotechnology, Methods and Protocols, Edited by Nigel Jenkins, 1999, Human Press Inc, Totowa, New Jersey, USA and Harrison MA and Rae IF, General Techniques of Cell Culture, Cambridge University Press 1997).
• the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art.
• the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermenters performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
• the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art.
• suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture
• polypeptide If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
• the resulting polypeptide may be recovered by methods known in the art.
• the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.
• the polypeptides may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
• Single chain FVU can be purified and activated to two-chain FVUa by a number of methods as described in the literature (Broze and Majerus, 1980, J. Biol. Chem. 255:1242-47 and Hedner and Kisiel, 1983, J.Clin.Invest. 71:1836-41). Another method whereby single chain FVU can be purified is by incorporation of Zn ions during purification as described in US 5,700,914.
• the polypeptide is purified as a single chain FVJJ, which further is PEGylated.
• the PEGylated FVU single chain polypeptide is activated by either use of an immobilized enzyme (e.g. factors JJa, JXa, Xa and XUa) or by autoactivation using a positively charged ion exchange matrix or the like. It is advantageous to first purify FVJJ in its single chain form, then PEGylate (if desired) and last activate by one of the methods described above or by autoactivation as described by Pedersen et al, 1989, Biochemistry 28: 9331-36.
• composition of the invention and its use in a further aspect, relates to a composition, in particular to a pharmaceutical composition, comprising a polypeptide or conjugate (including an inactive conjugate as described further above) of the invention and a pharmaceutically acceptable carrier or excipient.
• a pharmaceutical composition comprising a polypeptide or conjugate (including an inactive conjugate as described further above) of the invention and a pharmaceutically acceptable carrier or excipient.
• the conjugate, the polypeptide or the pharmaceutical composition according to the invention may be used as a medicament.
• the polypeptide or the (active) conjugate may be used for the manufacture of a medicament for the treatment or prophylaxis of a FVJJa/TF-related disease or disorder in a mammal.
• the polypeptide or the (active) conjugate may be used for the manufacture of a medicament for the treatment or prophylaxis of diseases wherein increased clot formation is desirable, such as treatment of patients having diseases resulting in inadequate blood coagulation in response to damage to blood vessels.
• the polypeptide or the (active) conjugate may be used for the manufacture of a medicament for the treatment of hemophiliacs, hemophiliacs with inhibitors to FVTJJ and FIX, patients with thrombocytopenia, patients with thrombocytopathies, such as Glanzmann's thrombastenia platelet release defects and storage pool defects, patients with von Willebrand's disease, patients with liver diseases, or otherwise healthy people with severe bleeding problems, e.g. due to trauma or major surgery, who have developed inhibitors to FVUa, bleeding disorders such as hemophiliacs and other typically associated with severe tissue damages.
• the inactive conjugate of the invention may be used for the manufacture of a medicament for the treatment or prophylaxis of a FVIJa/TF-related disease or disorder in a mammal.
• the inactive conjugate of the invention may be used for the manufacture of a medicament for the treatment or prophylaxis of diseases where decreased clot formation is desirable, such as prophylaxis or treatment of patients being in hypercoagulable states, such as patients with sepsis, deep-vein thrombosis, patients in risk of myocardial infections or thrombotic stroke, pulmonary embolism, patients with acute coronary syndromes (myocardial infarction and unstable angina pectoris), patients undergoing coronary cardiac, prevention of cardiac events and restonosis for patients receiving angioplasty, patients with peripheral vascular diseases.
• diseases where decreased clot formation is desirable such as prophylaxis or treatment of patients being in hypercoagulable states, such as patients with sepsis, deep-vein thrombosis, patients in risk of my
• the inactive conjugate of the invention may also be used for the manufacture of a medicament for the treatment of respiratory diseases, tumor growth and metastasis.
• the polypeptide, the (active) conjugate or the pharmaceutical composition comprising the (active) conjugate of the invention may be used in a method for treating a mammal having a FVJJa/TF-related disease or disorder (such as one or more of the diseases or disorders mentioned above), comprising administering to a mammal in need thereof an effective amount of such a polypeptide, conjugate or composition.
• the inactive conjugate or the pharmaceutical composition comprising the inactive conjugate of the invention may be used in a method for treating a mammal having a FVJJa/TF-related disease or disorder (such as one or more of the diseases or disorders mentioned above), comprising administering to a mammal in need thereof an effective amount of such an inactivated conjugate or composition.
• the polypeptides or conjugates of the invention is administered to patients in a therapeutically effective dose, normally one approximately paralleling that employed in therapy with rFVII such as NovoSeven®, or at higher dosage.
• a therapeutically effective dose herein is meant a dose that is sufficient to produce the desired effects in relation to the condition for which it is administered. The exact dose will depend on the circumstances, and will be ascertainable by one skilled in the art using known techniques. Normally, the dose should be capable of preventing or lessening the severity or spread of the condition or indication being treated.
• an effective amount of a polypeptide, conjugate or composition of the invention depends, inter alia, upon the disease, the dose, the administration schedule, whether the polypeptide or conjugate or composition is administered alone or in conjunction with other therapeutic agents, the plasma half -life of the compositions, and the general health of the patient.
• the polypeptide, conjugate, or composition of the invention is administered in an effective dose, in particular a dose which is sufficient to normalize the coagulation disorder.
• the polypeptide or conjugate of the invention is preferably administered in a composition including a pharmaceutically acceptable carrier or excipient.
• a pharmaceutically acceptable carrier or excipient means a carrier or excipient that does not cause any untoward effects in patients to whom it is administered.
• Such pharmaceutically acceptable carriers and excipients are well known in the art (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. R. Gennaro, Ed., Mack Publishing Company [1990]; Pharmaceutical Formulation Development of Peptides and Proteins, S. Frokjaer and L. Hovgaard, Eds., Taylor & Francis [2000] ; and Handbook of Pharmaceutical Excipients, 3rd edition, A. Kibbe, Ed., Pharmaceutical Press [2000]).
• the polypeptide or conjugate of the invention can be formulated into pharmaceutical compositions by well-known methods. Suitable formulations are described by Remington's Pharmaceutical Sciences by E.W. Martin (Mark Publ. Co., 16th Ed., 1980).
• the polypeptide or conjugate of the invention can be used "as is" and or in a salt form thereof. Suitable salts include, but are not limited to, salts with alkali metals or alkaline earth metals, such as sodium, potassium, calcium and magnesium, as well as e.g. zinc salts. These salts or complexes may by present as a crystalline and/or amorphous structure.
• the pharmaceutical composition of the invention may be administered alone or in conjunction with other therapeutic agents.
• agents may be incorporated as part of the same pharmaceutical composition or may be administered separately from the polypeptide or conjugate of the invention, either concurrently or in accordance with another treatment schedule.
• the polypeptide, conjugate or pharmaceutical composition of the invention may be used as an adjuvant to other therapies.
• a "patient” for the purposes of the present invention includes both humans and other mammals. Thus the methods are applicable to both human therapy and veterinary applications.
• the pharmaceutical composition of the polypeptide or conjugate of the invention may be formulated in a variety of forms, e.g. as a liquid, gel, lyophilized, or as a compressed solid. The preferred form will depend upon the particular indication being treated and will be apparent to one skilled in the art.
• the pharmaceutical composition of the polypeptide or conjugate of the invention may be formulated in lyophilised or stable soluble form.
• the polypeptide or the conjugate may be lyophilised by a variety of procedures known in the art.
• a polypeptide or the conjugate may be a stable soluble form by the removal or shielding of proteolytic degradation sites.
• the advantage of obtaining a stable soluble preparation lies in easier handling for the patient and, in the case of emergencies, quicker action, which potentially can become life saving.
• the preferred form will depend upon the particular indication being treated and will be apparent to one of skill in the art.
• the administration of the formulations of the present invention can be performed in a variety of ways, including, but not limited to, orally, subcutaneously, intravenously, intracerebrally, intranasally, transdermally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, intraocularly, or in any other acceptable manner.
• the formulations can be administered continuously by infusion, although bolus injection is acceptable, using techniques well known in the art, such as pumps or implantation. In some instances the formulations may be directly applied as a solution or spray.
• a preferred example of a pharmaceutical composition is a solution designed for parenteral administration.
• pharmaceutical solution formulations are provided in liquid form, appropriate for immediate use, such parenteral formulations may also be provided in frozen or in lyophilized form.
• the composition must be thawed prior to use.
• the latter form is often used to enhance the stability of the active compound contained in the composition under a wider variety of storage conditions, as it is recognized by those skilled in the art that lyophilized preparations are generally more stable than their liquid counterparts.
• Such lyophilized preparations are reconstituted prior to use by the addition of one or more suitable pharmaceutically acceptable diluents such as sterile water for injection or sterile physiological saline solution.
• parenterals In case of parenterals, they are prepared for storage as lyophilized formulations or aqueous solutions by mixing, as appropriate, the polypeptide having the desired degree of purity with one or more pharmaceutically acceptable carriers, excipients or stabilizers typically employed in the art (all of which are termed "excipients"), for example buffering agents, stabilizing agents, preservatives, isotonifiers, non-ionic surfactants or detergents, antioxidants and/or other miscellaneous additives.
• excipients typically employed in the art
• Buffering agents help to maintain the pH in the range which approximates physiological conditions. They are typically present at a concentration ranging from about 2 mM to about 50 mM Suitable buffering agents for use with the present invention include both organic and inorganic acids and salts thereof such as citrate buffers (e.g., monosodium citrate- disodium citrate mixture, citric acid-trisodium citrate mixture, citric acid-monosodium citrate mixture, etc.), succinate buffers (e.g., succinic acid-monosodium succinate mixture, succinic acid-sodium hydroxide mixture, succinic acid-disodium succinate mixture, etc.), tartrate buffers (e.g., tartaric acid-sodium tartrate mixture, tartaric acid-potassium tartrate mixture, tartaric acid- sodium hydroxide mixture, etc.), fumarate buffers (e.g., fumaric acid-monosodium fumarate mixture, fumaric acid-disodium fum
• Stabilizers refer to a broad category of excipients which can range in function from a bulking agent to an additive which solubilizes the therapeutic agent or helps to prevent denaturation or adherence to the container wall.
• Typical stabilizers can be polyhydric sugar alcohols (enumerated above); amino acids such as arginine, lysine, glycine, glutamine, asparagine, histidine, alanine, omithine, L-leucine, 2-phenylalanine, glutamic acid, threonine, etc., organic sugars or sugar alcohols, such as lactose, trehalose, stachyose, mannitol, sorbitol, xylitol, ribitol, myoinisitol, galactitol, glycerol and the like, including cyclitols such as inositol; polyethylene glycol; amino acid polymers; sulfur-containing reducing agents, such as urea, glutathione, thioctic acid, sodium thioglycolate, thioglycerol, ⁇ -monothioglycerol and sodium thiosulfate; low mo
• proteins such as human serum albumin, bovine serum albumin, gelatin or immunoglobulins
• hydrophilic polymers such as polyvinylpyrrolidone
• monosaccharides such as xylose, mannose, fructose and glucose
• disaccharides such as lactose, maltose and sucrose
• trisaccharides such as raffinose, and polysaccharides such as dextran.
• Stabilizers are typically present in the range of from 0.1 to 10,000 parts by weight based on the active protein weight.
• Preservatives are added to retard microbial growth, and are typically added in amounts of about 0.2%- 1% (w/v).
• Suitable preservatives for use with the present invention include phenol, benzyl alcohol, meta-cresol, methyl paraben, propyl paraben, octadecyldimethylbenzyl ammonium chloride, benzalkonium halides (e.g. benzalkonium chloride, bromide or iodide), hexamethonium chloride, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol and 3-pentanol.
• Isotonicifiers are added to ensure isotonicity of liquid compositions and include polyhydric sugar alcohols, preferably trihydric or higher sugar alcohols, such as glycerin, erythritol, arabitol, xylitol, sorbitol and mannitol.
• Polyhydric alcohols can be present in an amount between 0.1% and 25% by weight, typically 1% to 5%, taking into account the relative amounts of the other ingredients.
• Non-ionic surfactants or detergents may be present to help solubilizing the therapeutic agent as well as to protect the therapeutic polypeptide against agitation-induced aggregation, which also permits the formulation to be exposed to shear surface stress without causing denaturation of the polypeptide.
• Suitable non-ionic surfactants include polysorbates (20, 80, etc.), polyoxamers (184, 188 etc.), Pluronic® polyols, polyoxyethylene sorbitan monoethers (Tween®-20, Tween®-80, etc.). Additional miscellaneous excipients include bulking agents or fillers (e.g. starch), chelating agents (e.g. EDTA), antioxidants (e.g., ascorbic acid, methionine, vitamin E) and cosolvents.
• bulking agents or fillers e.g. starch
• chelating agents e.g. EDTA
• antioxidants e.g., ascorbic acid, methionine, vitamin E
• the active ingredient may also be entrapped in microcapsules prepared, for example, by coascervation techniques or by interfacial polymerization, for example hydroxymethylcellulose, gelatin or poly-(methylmethacylate) microcapsules, in colloidal drug delivery systems (for example liposomes, albumin microspheres, microemulsions, nano- particles and nanocapsules) or in macroemulsions.
• colloidal drug delivery systems for example liposomes, albumin microspheres, microemulsions, nano- particles and nanocapsules
• macroemulsions for example liposomes, albumin microspheres, microemulsions, nano- particles and nanocapsules
• Parenteral formulations to be used for in vivo administration must be sterile. This is readily accomplished, for example, by filtration through sterile filtration membranes.
• sustained-release preparations include semi-permeable matrices of solid hydrophobic polymers containing the polypeptide or conjugate, the matrices having a suitable form such as a film or microcapsules.
• sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate) or poly( vinylalcohol)), polylactides, copolymers of L-glutamic acid and ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the ProLease® technology or Lupron Depot® (injectabie microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid.
• polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for long periods such as up to or over 100 days
• certain hydrogels release proteins for shorter time periods.
• encapsulated polypeptides remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved.
• stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
• SEQ ID NO: l shows the hFVII protein (including ⁇ -carboxylated residues)
• SEQ ID NO:2 shows the cDNA sequence encoding the hFVJJ protein.
• SEQ ID NO: 3 shows the hFVJJ protein (without ⁇ -carboxylated residues)
• SEQ ID NO:4 shows an expression cassette for expression of FVU in mammalian cells.
• SEQ ID NO:5 shows the CBProFprl74 primer.
• SEQ ID NO:6 shows the CBProFprl75 primer.
• SEQ ID NO:7 shows the CBProFpr216 primer.
• SEQ ID NO: 8 shows the CBProFpr229 primer.
• SEQ ID NO:9 shows the CBProFpr221 primer.
• SEQ ID NO: 10 shows the CBProFpr228 primer.
• SEQ ID NO: 11 shows the CBProFpr226 primer.
• ASA Accessible Surface Area
• ASA accessible surface area
• the fractional ASA of the side chain atoms is computed by division of the sum of the ASA of the atoms in the side chain with a value representing the ASA of the side chain atoms of that residue type in an extended Ala-x-Ala tripeptide (See Hubbard, Campbell & Thornton (1991) J.Mol.Biol.220,507-530).
• the CA atom is regarded as a part of the side chain of Glycine residues but not for the remaining residues.
• the following table is used as standard 100% ASA for the side chain:
• Residues not detected in the structure are defined as having 100% exposure as they are thought to reside in flexible regions.
• the gamma-carboxy glutamic acids at positions 6, 7, 14, 16, 19, 20, 25, 26, 29 and 35 are all defined as being 100% exposed.
• the distance between atoms is most easily determined using molecular graphics software e.g. InsightE® v. 98.0, MSI INC.
• the catalytic site region is defined as any residues having at least one atom within 10 A of any atom in the catalytic triad (residues H193, D242, S344).
• the receptor-binding site is defined as comprising of all residues having their accessible surface area changed upon receptor binding. This is determined by at least two ASA calculations; one on the isolated ligand(s) in the ligand(s)/receptor(s) complex and one on the complete ligand(s)/receptor(s) complex.
• Measurement of functional in vivo half-life can be carried out in a number of ways as described in the literature.
• An example of an assay for the measurement of in vivo half-life of rFVIIa or variants thereof is described in FDA reference number 96-0597. Briefly, FVJJ clotting activities are measured in plasma drawn prior to and during a 24-hour period after administration of the conjugate, polypeptide or composition. The median apparent volume of distribution at steady state is measured and the median clearance determined.
• a composition containing the conjugate (100-750 ⁇ g/ml, preferably 600 ⁇ g/ml), 1.5 mg Ca 2+ /ml (as calcium chloride), mannitol (30 mg/ml), polysorbate 80 (0.1 mg/ml), sodium chloride (3 mg/ml) and glycyl-glycine buffer (1.3 mg/ml, pH 5.5) is prepared.
• a similar composition containing wild-type rFVIIa is prepared.
• the initial clotting activity or, alternatively, the initial amidolytic activity is then determined as described in the section entitled “Method for measuring the clotting activity” or as described in the section entitled “Method of measuring low levels of catalytic activity” or “Method of measuring the catalytic activity”.
• compositions are then incubated at 37°C until the composition containing the wild- type rFVJJ has lost at least 25%, preferably at least 50%, of its initial clotting or amidolytic acitivity.
• the clotting or amidolytic activity of the composition containing the conjugate of the invention is then measured.
• the reduced sensitivity to proteolytic degradation of the conjugate of the invention as compared to wild-type rFVIIa is then expressed in percentage.
• Proteolytic degradation can be measured using the assay described in US 5,580,560, Example 5, where proteolysis is autoproteolysis.
• reduced proteolysis can be tested in an in vivo model using radiolabelled samples and comparing proteolysis of wild type and conjugates by withdrawing blood samples and subjecting these to SDS-PAGE and autoradiography.
• reduced proteolytic degradation is intended to mean a measurable reduction in cleavage compared to that obtained by non-conjugated wild type FVUa as measured by gel scanning of Coomassie stained SDS-PAGE gels, HPLC or as measured by conserved catalytic activity in comparison to wild type using the chromogenic assay described below.
• the molecular weight of conjugated or unconjugated rFVJJ or conjugates thereof is determined by either SDS-PAGE, gel filtration, Western Blots, matrix assisted laser desorption mass spectrometry or equilibrium centrifugation, e.g. SDS-PAGE according to Laemmli, U.K., Nature Vol 227 (1970), pp. 680-85.
• the amidolytic activity in dilute samples of FVTJ/FVTJa and fermentation liquid/conditioned medium can be determined using COASET® FVJJ (Chromogenix, Art. No 82 19 00). The amidolytic activity is determined in accordance with the manufacturer's instructions. Briefly, FX is present in surplus and converted to FXa by FVUa at 37°C. The generated FXa then hydrolyses the chromogenic substrate S2765 (N- ⁇ -Cbo-D-Arg-Gly-Arg-pNA) resulting in liberation of the chromophoric molecule, para-nitro-anillin (pNA) absorbing light at wavelength 405 nm. The reaction is stopped by addition of acetic acid. The amount of FVU FVJJa in the sample is determined by comparison to a standard curve prepared from FVTfa (ranging from 125 pg/ml to 1 ng/ml in assay buffer).
• the ability of the conjugates to cleave small peptide substrates can be measured using the chromogenic substrate S-2288 (D-He-Pro-Arg-p-nitroanilide).
• Recombinant FVJJa is diluted in 0.1 M Tris, 0.1 M NaCl, 5 mM CaCl 2 , pH 8.3 containing 0.1%) BSA.
• the reaction is started by addition of the S-2288 substrate to 1 mM and the absorption at 405 nm is measured after incubation for 30 min. at 37°C.
• FVUa activity is measured using a standard one-stage clotting assay essentially as described in WO92/15686. Briefly, the sample to be tested is diluted in 50 mM Tris (pH 7.5), 0.1% BSA and 100 ⁇ l is incubated with 100 ⁇ l of FVII deficient plasma and 200 ⁇ l of thromboplastin C containing 10 mM Ca ++ . Clotting times are measured and compared to a standard curve using a pool of citrated normal human plasma in serial dilution. Method of measuring the anticoagulant activity
• the anticoagulant activity of an inactive FVU or FNHa conjugate can be measured using the one-stage clotting assay described above (Method of measuring the clotting activity) where the inactive conjugate competes with wild-type FVU for a limited amount of relipidated tissue factor.
• the assay is performed essentially as described in WO 92/15686, example HI, which is hereby incorporated as reference.
• the ability of the inactive conjugate to prolong the clotting time of wild-type FVU is recorded and taken as a measure of anticoagulant activity.
• the active site region is defined as any residue having at least one atom within a distance of 10 A from any atom in the catalytic triad (residues H193, D242, S344): 1153, Q167, V168, L169, L170, L171, Q176, L177, C178, G179, G180, T181, V188, V189, S190, A191, A192, H193, C194, F195, D196, K197, 1198, W201, V228, 1229, 1230, P231, S232, T233, Y234, V235, P236, G237, T238, T239, N240, H241, D242, 1243, A244, L245, L246, V281, S282, G283, W284, G285, Q286, T293, T324, E325, Y326, M327, F328, D338, S339, C340, K341, G342, D343, S344, G345, G346, P3
• the ridge of the active site binding cleft region was defined by visual inspection of the
• FVEa structure lFAK.pdb as: N173, A175, K199, N200, N203, D289, R290, G291, A292,
• the open reading frame of the native human blood coagulation factor cD ⁇ A was modified by making a bias in the codon usage towards the codons frequently used in highly expressed human genes. Further, two translational stop codons was inserted at the end of the open reading frame in order to facilitate efficient translational stop.
• the fully synthetic and expression optimized human FVJJ gene was assembled from 70-mer D ⁇ A oligonucleotides and finally amplified using end primers inserting Bam l and Hz ' rcdlJI sites at the 5' and 3' ends respectively using standard PCR techniques, which resulted in the following sequence (SEQ JD ⁇ O:4):
• a vector for the cloning of the generated PCR product encompassing the expression cassette for native human blood coagulation factor VJJ was prepared by cloning the intron from pCTNeo (Promega).
• the synthetic intron from pCI-Neo was amplified using standard PCR conditions as described above and the primers:
• CBProFprl74 5'- AGCTGGCTAGCCACTGGGCAGGTAAGTATCA -3' and CBProFprl75: 5'- TGGCGGGATCCTTAAGAGCTGTAATTGAACT -3'
• the expression cassette for native human blood coagulation factor VJJ was cloned between the Bam L and HindJH sites of PF#34, resulting in plasmid PF#226.
• Sequence overhang extension (SOE) PCR was used for generating constructs having variant human blood coagulation factor open reading frames with substituted codons.
• SOE-PCR both the N-terminal part and the C-terminal part of the FVU open reading frame was first amplified in individual primary PCRs.
• CBProFpr2l6 5'-CTTAAGGATCCCGCCACCATGGTCAGCCAG-3' and
• CBProFpr221 5'-ACTTAAGCTTTTATCAAGGGA-3'
• CBProFpr228 5'-GCAGCAGTCCAACAAAACCGGGGACTCC-3' .
• the primary PCR products were then combined and the terminal primers (CBProFpr216 and CBProFpr221) added resulting in the secondary full-length product encoding the desired R315N + V317T FVU variant.
• the secondary PCR product was trimmed with BamHI and JXindJJI before cloning into the vector PF#34 between the BamHl and H dJH sites resulting in PF#249.
• the introduced mutation(s) were sufficiently close to a unique restriction endo-nuclease site in the expression plasmid variant genes were constructed using construction procedure encompassing a single PCR step and a subsequent cloning.
• the substitution K143N+N145T was introduced by use of the PCR primers:
• CBProFpr226 5'-CATTCTAGAAAACCGGACCGCTAGCAAACC-3' and CBProFpr221: 5'- ACTTAAGCTTTTATCAAGGGA-3'
• the PCR product was subsequently cloned using the restriction endo-nuclease sites Xbal and H dJJI.
• glycosylation conjugates were prepared and their amidolytic activities were tested as described in the section entitled Method of measuring low levels of catalytic activity. Furthermore, some of the conjugates were subjected to the one- stage clotting assay described in the section entitled Method of measuring the clotting activity. The obtained results are compiled in the below table.
• Example 4 Improvement of glycosylation site utility by introduction of another proximal (N-terminally located) glycosylation site.
• R315N+V317T variant at approximately 0.2 ⁇ g/ml allowing for Western blotting analysis for determination of the degree of usage of the introduced glycosylation site.
• a twenty-four hour supernatant from the stable pool was assayed by Western blotting and revealed partial usage of the introduced glycosylation site at position 315, approximately one-half of the fully processed
• the cell line HEK 293 (ATCC # CRL-1573) was seeded at 20% confluence in T-25 flasks using DMEM, high glucose 10% heat inactivated FCS (Gibco BRL Cat # 10091), 5 ⁇ glm ⁇ phylloquinone and allowed to grow until confluent.
• the confluent mono cell layer was
• HEK293 cells stably expressing FVII. 5 A vial of HEK293 PF#226 transfectant pool was thawed and the cells seeded in a 75 cm 2 tissue flask containing 15 ml of DMEM high glucose, 10% FCS, phylloquinone (5 ⁇ g/ml), 100 U/l penicillin, 100 ⁇ g/l streptomycin, which was used for all subsequent experiments, and grown for 24 hours. The cells were harvested, diluted and plated in 96 well micro titer plates at a cell density of h cell/well. After 12 days colonies of about 20-100 cells were present in the
• transfected cells were incubated at 37°C with 5% CO 2 for three hours post transfection before the medium was changed to serum free medium (DMEM, ITS-A, ExCyte, Phylloquinone, P/S). Forty hours post transfection the conditioned medium was harvested and cleared by centrifugation for analysis. A standard curve was made from rFVJJa: 0.0125 ng, 0.025 ng, 0.05 ng, 0.075 ng and
• Bound conjugate (or wild-type FVJJ) was eluted with 10 mM Tris (pH 8.6), 100 mM
• the conjugate (or wild-type FVU) was activated at 37°C by Factor Xa coupled to CNBr-activated sepharose in 10 mM Tris (pH 7.4-8.0) 100 mM NaCl, 5 mM CaCl 2 .
• the conjugate (or wild-type FVIIa) was buffer-exchanged into a solution containing 10 mM CaCl , 50 mM NaCl, 3% mannitol, 0.05% Tween80, buffered at pH 5.6 and sterilfiltered before storage at -80°C.
• M-PEG-CHO methoxy polyethylene glycol
• reaction was carried out in 300-1500 ⁇ l batches at room temperature for 1 hour with agitation, and NaBH 3 CN was added to 500-1000 fold excess and incubation continued over night with agitation at room temperature.
• PEGylated FVJJ was buffer exchanged to buffer A (10 mM Tris pH 7.6) and applied at 4 °C on a mono Q column (Pharmacia) equilibrated in buffer A. Bound protein was eluted in a gradient from 0-100% B (10 mM Tris (pH 7.6), 500 mM NaCl) over 40 column volumes.
• Both wild-type FVU and the conjugates of the invention are formulated in 1.3 mg/ml glycyl-glycin buffer pH 5.5 containing 1.5 mg/ml CaCl 2 , 30 mg/ml mannitol, 0.1 mg/ml polysorbat 80 and 3 mg/ml NaCl.
• each of the preparations are administered to Sprague-Dawley rats as one intra venous bolus injection. The injections are given slowly over about 10 seconds to reduce potential risk of heart failure due to high Ca 2+ concentration. Blood samples are drawn from each of the nine anaesthetized rats at suitable intervals, e.g. 1 minute, 15 minutes, 30 minutes, 45 minutes and 1 hour after injection.
• the blood samples are collected in 1 ml tubes containing 50 ⁇ l Citrate-phosphate-dextrose solution with adenine (Sigma #C4431) in order to prevent coagulation. Immediately after collection the samples are stored at about 0°C until centrifugation and subsequent collection of the citrate plasma supematants for assay. Samples are assayed by the one-stage clotting assay as described in the section Method of measuring the clotting activity and the half -lives are then calculated.

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Medicinal Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Genetics & Genomics (AREA)
• Zoology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Biochemistry (AREA)
• Wood Science & Technology (AREA)
• Hematology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• General Engineering & Computer Science (AREA)
• Epidemiology (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Diabetes (AREA)
• Biophysics (AREA)
• Gastroenterology & Hepatology (AREA)
• Biotechnology (AREA)
• Toxicology (AREA)
• Microbiology (AREA)
• Oncology (AREA)
• Cardiology (AREA)
• Vascular Medicine (AREA)
• Communicable Diseases (AREA)
• Urology & Nephrology (AREA)
• Pulmonology (AREA)
• Heart & Thoracic Surgery (AREA)
• Peptides Or Proteins (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (14)

Applications Claiming Priority (4)

Publications (2)

Family

ID=26068765

Family Applications (1)

Country Status (18)

Cited By (113)

Families Citing this family (55)

Family Cites Families (140)

• 2001
  • 2001-02-12 PL PL386364A patent/PL206148B1/pl unknown
  • 2001-02-12 EP EP10180652A patent/EP2319541A1/en not_active Withdrawn
  • 2001-02-12 AU AU31535/01A patent/AU783512B2/en not_active Ceased
  • 2001-02-12 US US09/782,587 patent/US6806063B2/en not_active Expired - Lifetime
  • 2001-02-12 ES ES01903611T patent/ES2325877T3/es not_active Expired - Lifetime
  • 2001-02-12 DE DE60138364T patent/DE60138364D1/de not_active Expired - Lifetime
  • 2001-02-12 PT PT01903611T patent/PT1257295E/pt unknown
  • 2001-02-12 EP EP08010798A patent/EP1982732A3/en not_active Withdrawn
  • 2001-02-12 EP EP01903611A patent/EP1257295B1/en not_active Expired - Lifetime
  • 2001-02-12 PL PL362856A patent/PL204285B1/pl unknown
  • 2001-02-12 RU RU2002124129/04A patent/RU2278123C2/ru not_active IP Right Cessation
  • 2001-02-12 WO PCT/DK2001/000094 patent/WO2001058935A2/en not_active Ceased
  • 2001-02-12 JP JP2001558082A patent/JP2003521930A/ja active Pending
  • 2001-02-12 IL IL15069201A patent/IL150692A0/xx not_active IP Right Cessation
  • 2001-02-12 CA CA2739933A patent/CA2739933A1/en not_active Abandoned
  • 2001-02-12 AT AT01903611T patent/ATE428445T1/de active
  • 2001-02-12 NZ NZ521257A patent/NZ521257A/en not_active IP Right Cessation
  • 2001-02-12 CA CA2397347A patent/CA2397347C/en not_active Expired - Fee Related
  • 2001-02-12 CN CNB018048641A patent/CN100488562C/zh not_active Expired - Fee Related
  • 2001-02-12 DK DK01903611T patent/DK1257295T3/da active
• 2002
  • 2002-08-09 NO NO20023804A patent/NO20023804L/no not_active Application Discontinuation
• 2004
  • 2004-09-27 US US10/950,747 patent/US7371543B2/en not_active Expired - Fee Related
• 2005
  • 2005-04-20 JP JP2005122294A patent/JP4509846B2/ja not_active Expired - Fee Related
• 2006
  • 2006-02-02 AU AU2006200448A patent/AU2006200448B2/en not_active Ceased
  • 2006-03-30 US US11/396,314 patent/US7517974B2/en not_active Expired - Fee Related
  • 2006-04-12 US US11/279,541 patent/US7511024B2/en not_active Expired - Fee Related
  • 2006-04-18 US US11/379,189 patent/US7598056B2/en not_active Expired - Fee Related
  • 2006-06-07 US US11/448,143 patent/US20070142280A1/en not_active Abandoned
  • 2006-06-12 US US11/423,662 patent/US7442524B2/en not_active Expired - Fee Related
  • 2006-06-12 US US11/423,665 patent/US7427592B2/en not_active Expired - Fee Related
  • 2006-06-12 US US11/423,622 patent/US8084591B2/en not_active Expired - Fee Related
  • 2006-06-26 US US11/426,394 patent/US20060252689A1/en not_active Abandoned
  • 2006-06-26 US US11/426,401 patent/US7414022B2/en not_active Expired - Fee Related
• 2007
  • 2007-10-30 US US11/928,108 patent/US7754682B2/en not_active Expired - Fee Related
• 2009
  • 2009-06-23 IL IL199497A patent/IL199497A/en not_active IP Right Cessation
  • 2009-07-14 CY CY20091100736T patent/CY1109614T1/el unknown
• 2010
  • 2010-01-27 AU AU2010200296A patent/AU2010200296A1/en not_active Abandoned
• 2011
  • 2011-11-18 US US13/299,736 patent/US20120171765A1/en not_active Abandoned