WO1990005783A1 - Insect signal peptide mediated secretion of recombinant proteins - Google Patents

Abstract

Novel DNA, plasmid and viral constructs are described for enhanced expression and secretion of proteins in various host cells, preferably insect cells, consisting of DNA sequences that encode insect cell signal peptide sequences associated with DNA sequences that encode heterologous proteins along with appropriate regulatory and control DNA sequences.

Description

Insect Signal Peptide Mediated Secretion

of Recombinant Proteins

The present invention relates to the field of molecular biology. In particular, it relates to novel methods and compositions for enhancing the secretion of recombinant proteins from various cell types, preferably insect cells.

A continuing goal of molecular biology is to develop prokaryotic and eukaryotic host/vector systems that efficiently produce large quantities of proteins from cloned genes. Generally, this requires that not only must a cloned gene be transcribed accurately, and the message faithfully translated, but the resulting protein product must be properly modified so as to mirror the naturally occurring molecule. This requires that the protein be modified through processes such as glycosylation, disulfide-bond formation, proper tertiary and quaternary structure, and additionally, if the protein is to be secreted from the cell, have what is known as the signal peptide removed from a nascent polypeptide chain.

In addition to biochemical modification of recombinant molecules, another key element that determines the overall efficiency of a particular expression system, is the ease with which recombinant proteins can be isolated and purified. Often it is preferred to purify recombinant proteins from cell-culture media, instead of from the host cell. This requires that the recombinant molecule be secreted from the host cell. For example, in prokaryotic cells, proteins secreted to the periplasmic space can easily be released from the cell by osmotic shock and readily purified. A key element determinative of whether recombinant proteins are secreted is the presence of a signal peptide that is transiently associated with most secretory proteins, and which initiates export across the inner membrane of prokaryotes, or the endoplasmic reticulum in eukaryotes.

Consequendy, one of the goals of biotechnology has been to enhance the secretion of recombinant heterologous proteins by fusing them to appropriate signal peptides. For example, in prokaryotics, particularly E. coli. the secretion of recombinant ricin is enhanced if the alkaline phosphatase signal peptide is fused to ricin. Alkaline phosphatase of E. coli is located in the periplasmic space and synthesized in large amounts if the cells are grown under low phosphate inducing conditions. The enzyme is synthesized as a precursor with a signal peptide at the N-terminus, and the mature monomer form, in which the signal peptide is deleted, is transported to the periplasmic space. In addition to ricin, the alkaline phosphatase single peptide has been fused to other proteins with the aim of obtaining them in secreted form.

An additional example is the expression of a α-neo-endorphin. See Ohsuye, et al., 1983,

Nucleic Acid Research.11: 1285.

Aside from alkaline phosphatase signal peptide, a variety of other signal peptides have been used to express heterologous proteins, both in bacteria and yeast. Often employed is the signal peptide of the OmpA protein, a significant outer membrane protein of E. coli. The pINIII expression vectors employ the OmpA protein. In yeast, heterologous protein secretion has been reported using signal peptides from invertase and acid phosphatase precursors, among others. See Bitter, et al., 1987, Methods in Enzvmologv, 153:516.

An example of heterologous protein secretion in eukaiyotes is the secretion of IL-2 from insect cells using a baculovirus expression system having the polyhedrin peptide sequence. See Smith, et al., 1985, Proc. Nat'l Acad. of Sci. USA.82:8404. In this system, however, the amount of IL-2 produced and secreted is similar per ml of medium to that obtained in E. coli.

Despite considerable effort, the essential features of a signal sequence, and how such signals are recognized by a host cell remain largely unsolved problems in biotechnology.

Indeed, signal sequences show little discernable primary sequence similarities, and recent work indicates that sequence variation can be considerable. The Von Heijne, G., 1986, Nucleic Acid Research, 14:4683. Consequently, it is still difficult to predict with any confidence which amino acid sequence can serve as a signal sequence that may be useful in achieving enhanced expression and secretion of recombinant proteins in either prokaiyotes or eukaryotes.

Accordingly, one aspect of the instant invention is a description of methods and compositions that enhance the secretion of recombinant proteins from eukaryotic cells.

A second aspect of the invention is the description of an insect cell recombinant protein expression system wherein enhanced levels of secreted protein are realized using insect cell signal peptides.

A third aspect of the invention is the description of specific types of insect signal peptides associated with the secretion of particular insect cell proteins which when associated with heterologous proteins, markedly enhance their secretion in an insect cell expression system. Examples of such signal peptides are those which are associated with α-amylase, chorion A, and cecropin B.

A further aspect of the invention is the description of a baculovirus expression system consisting of baculovirus expression vectors containing DNA sequences encoding recombinant heterologous proteins associated with insect cell signal peptide sequences.

A still further aspect of the invention is a description of processes for obtaining in secreted form heterologous proteins encoded by baculovirus expression vectors.

Figure 1 shows the DNA and amino acid sequence of the plasminogen activator present in the plasmid, pPD17.

Figure 2 is a schematic presentation of the plasmid pPD 17 containing a DNA sequence encoding a plasminogen activator and restriction sites associated therewith, and the

construction of the plasmid pPD10 from pPD17 and PAcC3. Figure 3 presents a schematic of the construction of the transfer vectors pPD36, pPD37, pPD38 and pPD39.

Figure 4 shows the nucleotide sequence for several insect cell signal sequences, including D. melanogaster α-amylase, A. polvhemus chorion A, H. cecropia cecropin-B, wherein alanine is at position 20, and H. cecropia cecropin-B, wherein valine is at position 20.

Figure 5 presents the results of a plasminogen activation assay from media containing Sf9 cells that were infected with recombinant baculovirus having a DNA insert which encodes a chimeric plasminogen activator.

One aspect of the invention is a description of methods and compositions for realizing enhanced secretion/expression of heterologous proteins in insect cells resulting from fusing insect cell signal peptides with heterologous protein. Because the methods and compositions used to realize the invention rely on the techniques of molecular biology, a description of generally applicable techniques, as well as those techniques specific to insect cell expression systems will now be presented.

The initial step in the construction of DNA recombinant molecules having an insect cell signal peptide sequence is the selection and identification of an appropriate protein sought to be secreted. DNA sequences encoding the desired protein can be identified by screening cDNA or genomic libraries. These techniques are generally known in the art and are described by Maniatis, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory. Cold Spring Laboratory. New York. (1982). In addition, many of the materials and methods described herein and are also exemplified in Methods & Enzymologv. 153-155. Editor Ray Wu/Lawrence Grossman, Academic Press. Inc.. Volume 153 covers methods related to new vectors for cloning DNA and for the expression of cloned genes. Particularly applicable is volume 154, which describes methods for cloning cDNA, identification of various cloned genes and mapping techniques useful to characterize the genes, chemical synthesis and analysis of oligodeoxynucleotides, mutagenesis, and protein engineering. Finally, volume 155 presents the description of restriction enzymes, particularly those discovered in recent years, as well as methods for DNA sequence analysis. These references are hereby incorporated by reference in their entirety.

The procedures for creating either cDNA or genomic libraries are known in the art and are described in the above cited references. Preferably, cDNA libraries will be employed to identify DNA sequences that encode proteins that are sought to be secreted by fusion to appropriate insect cell signal peptide sequences. cDNA libraries can be screened using either the colony or plaque hybridization procedures, depending on whether plasmids or phage are used to create the library and thus carry the cDNA inserts. Lifts of colonies or plaques are made onto nitrocellulose filter paper (S and S type BA-85). In the instance where colony hybridization is employed, the colonies are lysed and DNA fixed to the filter paper by treatment for 5 minutes with 0.5 M NaOH, 1.5 M NaCl, and washed twice for 5 minutes each wash with 1.0 M Tris pH 8, 3 M NaCl. The filters are air dried and baked at 80°C for 2 hours, or alternatively the DNA can be affixed by ultraviolet radiation, preferably onto nylon membranes. Duplicate filters are prehybridized with the appropriate probe (discussed below) at 45-50°C for 1 hour in 5 x SSC, 10 x Denhardt's solution (0.2% polyvinylpyrrolidone, 0.2% Ficoll, 0.2% BSA), 0.1% SDS, 50 mM sodium phosphate pH 7.0, and 100 μg/ml tRNA.

If a phage cDNA library is screened using the plaque hybridization procedure, many plaques are replicated onto duplicate nitrocellulose filters, and the DNA affixed to the filters by sequential treatment for 5 minutes with 0.5 N NaOH plus 1.0 M NaCl; 1.5 M NaCl plus 0.5 M Tris-HCl pH 8; and 20 mM Tris plus 2 mM EDTA pH 8, and baked at 80°C for about 2 hours. Prehybridization of the appropriate oligonucleotide probe to phage DNA can be accomplished using conditions similar to those described above for the colony hybridization procedure.

Regardless of whether colony or plaque hybridization is conducted, hybridization with the appropriate oligonucleotide probe to the filter is preferably carried out in a solution similar to that described above for prehybridization, but typically also contains 10% dextran sulfate and kinased probe between about 1-2 x 10⁶ CPM/ml under conditions which depend on the stringency of hybridization employed. Generally, moderately stringent conditions are used with temperatures of about 42-50°C for 16-36 hours with 1-5 ml/filter of DNA hybridization buffer containing the oligonucleotide probe. If higher stringencies are desired, then

correspondingly higher temperatures are often used. Following the hybridization incubation period, filters are preferably washed three times for 15 minutes each wash at the appropriate temperature using 3 x SSC, 0.1% SDS, air dried and autoradiographed at -70°C for several days.

An example of identifying a DNA sequence that encodes a protein desired to be fused to an insect cell signal peptide consist of generating a cDNA library and screening it for cDNA that encodes a plasminogen activator. This procedure is described in European Patent

Publication No.0273,774, published July 6, 1988. Briefly, phage cDNA library was constructed from a poly A+ RNA fraction isolated from a cell line which produces high levels of the plasminogen activator, urokinase. The cell line was LD-1, and is described in the aforementioned U.S. patent application, and by Lilly and Rado, in Blood, 6.4:130, (1984). A phage, lambda gt10 cDNA library was constructed using the total Poly A+ RNA fraction isolated from LD-1. The library was constructed essentially as described by Haynh, gt al., in DNA Cloning.1, IRL Press Ltd., Oxford, England, 1st Ed., 1985, D. Miglover, Ed. Single stranded cDNA was made using the poly A+ mRNA fraction by reverse transcription with avian myeloblastosis virus reverse transcriptase. The DNA-RNA hybrids were denatured by heating, and the denatured single-stranded DNA was made double stranded (ds) with DNA polymerase I using the single cDNA strands as self primers. S1 nuclease digestion was employed to remove hairpin regions, and the dsDNA was size fractionated using preparative gel electrophoresis. To prevent ECQR I endonuclease digestion of the dsDNA, it was treated with EcoR I methylase, followed by blunt ending with Klenow fragment After treatment with Klenow, the mixture was extracted with phenol/chloroform and ethanol precipitated. The blunt ended dsDNA was extracted, purified and ligated to [γ³²P]-labelled EcoR I linkers. The linkers were cleaved with EcoR I to generate cohesive EcoR l ends, and the cDNA purified on low melting point agarose. dsDNA with EcoR I cohesive ends was ligated to gtlO previously digested with EcoR I, and the cDNA library packaged in vitro and plated onto BNN102 cells.

This library was then probed using the plaque hybridization assay described above and the oligonucleotide probe having the sequence:

5' - ACTTGATGAAGTTCATTGCT - 3'

The probe was radiolabelled with 32P. Plaques which exhibited a positive signal as revealed autoradiography were expanded in BNN 102 cells, and the phage" DNA extracted and digested with HindIII and Stul.

The oligonucleotide probe shown above was constructed based on the published DNA sequence of urokinase, Ny, et al., 1984, Proc. Natl. Acad. Sci. USA.81:5355 and Verde, et al, 1984, Proc. Natl. Acad. Sci. USA. 81 :4727 and prepared.by the triester method of Matteucci, et al ., 1981, J. Am. Chem. Soc.. 103:3185. or using commercially available automated oligonucleotide synthesizers. The probe was kinased using an excess, that is, approximately 10 units of polynucleotide kinase to 10 pmole substrate in the presence of 50 mM Tris, pH 7.6, 10 mM MgCl₂, 5 mM dithiothreitol, 40 pmoles of γ³²P-ATP (3000

Ci/mmole), 0.1 mM spermidine, 0.1 mM EDTA.

The ligations described above, as well as those described subsequently, were performed in 15-30 μl volumes under the following standard conditions and temperatures: 20 mM Tris-Cl pH 7.5, 10 mM MgCl₂, 10 mM DTT, 33 μg/ml BSA, 10 mM-50 mM NaCl, and either 40 μM ATP, 0.01-0.02 (Weiss) units T4 DNA ligase at 0°C. This reaction is generally used to ligate "sticky ends", and was employed above. "Blunt end" ligations can be carried out using 1 mM ATP and 0.3-0.6 (Weiss) units T4 DNA ligase at 14°C. Typically "sticky end" ligations are performed at 33-100 μg/ml total DNA which generally corresponds to 5-100 mM total end concentration. "Blunt end" ligations usually employ a 10-30 fold molar excess of linkers, and are generally performed at 1 μM total end concentration.

The preferred next step in the identification and isolation of a DNA sequence that encodes a protein that is desired to be fused to an insect cell signal peptide is to subclone the DNA sequence from the initial cloning vector into appropriate amplification vectors in order to amplify the DNA sequence, as well as associate with the DNA suitable restriction sites that will facilitate combining the DNA with other DNA sequences to yield a novel plasminogen activator. Using the HindlII/StuI fragment that encodes the partial urokinase cDNA sequence, a plasmid ρJV104 was constructed in combination with pUC18 and the phage M13 origin of replication. The M13 origin of replication is present as a RsaI fragment from M13, and this fragment was amplified by first blunt end ligating it to HindlH linkers and cloning it into the Hind site of a pBR322 derivative that contains a suitable polylinker sequence. Following application of the origin of replication, the HindIII fragment containing the origin of replication was isolated, repaired with Klenow, and blunt end ligated to Ndel linkers. After digestion with Ndel, the resulting Ndel fragment containing the M13 origin of replication was ligated into Ndel-digested pUC18 under the sticky end conditions described above to form pJV104. The resulting ligation mixture was used to transform competent E. coli strain MM294. Using the colony hybridization technique described above, and the labelled probe also described above, a plasmid termed JV104-17 was identified. Presence of the proper DNA fragment was confirmed by restriction fragment analysis and the sequencing of selected fragments.

hi vector construction employing "vector fragments", the vector fragment is commonly treated with bacterial alkaline phosphatase (BAP) in order to remove the 5' phosphate and prevent religation of the vector. BAP digestions are conducted at pH 8 in approximately 150 mM Tris, in the presence of Na+ and Mg+2 using about 1 unit of BAP per μg of vector at 60°C for about one hour. Vector fragments subjected to this treatment are referred to herein as "BAPped". If unkinased oligodeoxyribonucleotides are used however, the vector fragments are not "BAPped". In order to recover the nucleic acid fragments, the preparation is extracted with phenol/chloroform and ethanol precipitated and desalted by application to a Sephadex G- 50 spin column. Alternatively, religation can be prevented in vectors that have been double digested by additional restriction enzyme digestion of the unwanted fragments.

Several points are worth noting at this juncture. First, probes other than the one shown above can be used to identify urokinase DNA sequences, as is well known to those skilled in the art. The information needed to construct such probes is ascertainable from the work of Ny, et al., and Verde, et al., above. Second, it will be appreciated that transformation of particular host cells is a procedure well known in the art, and is done using standard techniques appropriate to the host cell sought to be transformed. Host cells that exhibit substantial cell wall barriers, such as prokaryotes are generally transformed using calcium chloride as described by Cohen, S.N., 1972, Proc. Natl. Acad. Sci. USA, 69 :2110, or the RbCl method described by Maniatis, et al., above. In contrast, mammalian cells, which lack cell walls, may be transformed using the calcium phosphate precipitation method of Graham and Vander Eb, 1978, Virology, 52:546, or Wang, et al., 1985, Science. 228:149. Further, the DEAE dextran method of Manos and Gluzman, 1984, Mol. Cell. Bio., 4:1125, is also useful for mammalian cell transformations. Moreover, yeast can be transformed typically using the method of Van Solingen, E., et al., 1977, J. Bact., 130:946 and Hsiao, C.L., et al., 1979, Prog, Natl, Acad. Sci, USA, 76:3829.

It is apparent from the description of the generation of pJV104, that a variety of host cells are used in establishing a cDNA library as well as for sequencing and expression of DNA constructs. Host strains used in cloning and expression herein are as follows. For cloning and sequencing, and for the expression of constructions under the control of most bacterial promoters, E. coli strain MM294 Talmadge, K., et al., 1980, Gene.12:235; Messelson, M., et al., 1968, Nature.217:1110. was used as the host. For expression under the control of the P_L N-RBS promoter, E. coli strain K12 MC1000 lambda lysogen, N₇N₅₃cI857SusP_8o, ATCC 39531 (hereinafter sometimes referred to as MC1000-39513 λgDG95 or DG95) may be used, as well as E. coli strain DG116 also an MM294 strain λ CI857, bio T76, del HI; the bio T76 substitution deletes early λ function (N att) and the del HI deletion removes λDNA from cro through att (del cro- Bio+ n-). This strain is deposited in the assignees culture collection under accession number CMCC 2298.

For M13 phage recombinants, E. coli strains susceptible to phage infection, such as E. coli K12 strain DG98 are employed. The DG98 strain has been deposited with ATCC July 13,

1984 and has accession number 1965.

Mammalian expression may be earned out in a number of Cell types. Preferably COS cell lines will be employed, and derivatives thereof. Expression may also be carried out with appropriate vectors in insect cell lines, in culture and using Spodoptera frugiperda cells.

Appropriate cell lines include Sf9 and IPLB-SF21. It will be appreciated by those skilled in the art that these are exemplary of cell lines that may be used, and the invention is not limited to these. See generally Summers, M.D. and Smith, G.E., 1987, "A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures", Texas Agricultural Experiment Station Bulletin. No. 1555, and European Patent Publication No. 127,839 published December 12, 1984.

In addition to bacteria, eukaryotic microbes, such as yeast, may also be used as hosts. Laboratory strains of Saccharomvces cerevisiae. Baker's yeast, are most used although a number of other strains are commonly available. Vectors employing the 2 micron origin of replication are available (Broach, J.R., 1983, Meth. Enz.. 101:307). and other plasmid vectors suitable for yeast expression are known (see, for example, Stinochcomb, et al., 1979, Nature, 282:39, Tschempe, et al., 1980, Gene.10:157 and Clarke, L., et al., 1983, Meth. Enz..

101:300). Control sequences for yeast vectors include promoters for the synthesis of glycolytic enzymes (see, Hess, et al., 1968, J. Adv. Enzyme Req., 7:149; Holland, et al., 1978, Biochemistry, 17:4900). Additional promoters known in the art include the promoter for 3-phosphoglycerate kinase (Hitzman, et al., 1980, J. Biol. Chem..255:2073), and those for other glycolytic enzymes, such as glyceraldehyde-3-phosphate dehydrogenase, hexose kinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3- phosphoglycerate mutase, pyruvate kinase, triosphosphate isomerase, phosphoglucose isomerase, and glucokinase. Other promoters, which have the additional advantage of transcription controlled by growth conditions are the promoter regions for alcohol

dehydrogenase 2, isocytochrome c, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and enzymes responsible for maltose and galactose utilization (Holland, ibid).

Terminator sequences may also be desirable at the 3' end of the coding sequences sought to be fused to an appropriate insect cell signal peptide sequence. Such terminators are found in the 3" untranslated region following the coding sequences. Platt, 1986, Annual Review of Biochemistry.5.5:339. In yeast-derived genes, many of the vectors illustrated contain control sequences derived from the enolase gene containing plasmid peno46 (Holland, M.J., et al., 1981, J. Biol. Chem., 256:1385) or the LEU2 gene obtained from YEp13 (Broach, J. et al., 1978, Gene, 8: 121), however any vector containing a yeast compatible promoter, origin of replication and other control sequences is suitable.

As alluded to above, it is also, of course, possible to express genes encoding polypeptides in eukaryotic host cell cultures derived from multicellular organisms as described further hereinbelow. See, generally, for example, Tissue Culture, Academic Press, Cruz and Patterson, editors (1973). Useful host cell lines include murine myelomas NS1, VERO and HeLa cells, COS cells, and Chinese hamster ovary (CHO) cells. Expression vectors for such cells ordinarily include promoters and control sequences compatible with mammalian cells such as, for example, the commonly used early and late promoters from Simian Virus 40 (S V40) (Fiers, et al., 1978, Nature.273: 113), or other viral promoters such as those derived from polyoma, Adenovirus 2, bovine papilloma virus, or avian sarcoma viruses, or immunoglobin promoters and heat shock promoters. General aspects of mammalian cell host system transformations have been described by Axel, U.S. Patent No.4,399,216 issued April 16, 1983. It now appears, also that "enhancer" regions are important in optimizing expression. These are, generally, sequences found upstream of the promoter region. Origins of replication may be obtained, if needed, from viral sources. However, integration into the chromosome is a common mechanism for DNA replication in eukaryotes. Plant cells are also available as hosts, and control sequences compatible with plant cells such as the nopaline synthase promoter and polyandenylation signal sequences (Depicker, A., et al, 1982, J. Mol, Appl. Gen., 1:561 are available.

Once having cloned a particular cDNA sequence, such as the pro-urokinase present in pJV104-17, it may be desired to have associated with it various regulatory sequences to effect the expression of the cDNA sequence in various host cells. Additionally, the cDNA sequence may be subject to mutagenesis, either site specific mutagenesis or alternatively, by

incorporating synthetic oligodeoxyribonucleotides. For portions of vectors derived from cDNA or genomic DNA which require sequence modifications, site specific primer directed mutagenesis is used. This may be conducted using a synthetic oligonucleotide primer complementary to a single stranded phage DNA to be mutagenized except for limited

mismatching, representing the desired mutation. Briefly, the synthetic oligonucleotide is used as a primer to direct synthesis of a strand complementary to the phage, and the resulting double- stranded DNA is transformed into a phage-supporting host bacterium. Cultures of the transformed bacteria are plated in top agar, permitting plaque formation from single cells which harbor the phage.

As applied to the instant invention, the cDNA sequence encoding for pro-urokinase was modified substantially as described in U.S. patent application serial number 132,206, referred to above. The cDNA sequence was engineered to encode a protein having the amino acid sequence shown in Figure 1; also shown in the figure is the corresponding DNA sequence. The plasmid containing this sequence is diagrammatically shown in Figure 2, and is designated pPD17. The pro-urokinase sequence present in pPD17 encodes a molecule having properties unique from naturally occurring urokinase. For example, it is not susceptible to cleavage by plasminogen, and exist as a single chain.

After the cDNA sequence has been modified or altered as desired, the preferred next step in the construction of a DNA sequence encoding a particular protein fused to an insect cell signal peptide is to insert the sequence into an appropriate insect cell transfer vector. An example of a suitable vector is baculovirus transfer vector pAcC3. As applied to baculovirus, transfer vectors are employed to facilitate obtaining recombinant virus through homologous recombination because the genome of baculovirus (AcNPV) is large and exhibits numerous restrictions sites which renders difficult readily cloning a particular heterologous gene into the virus. Therefore, recombinant virus, containing the gene to be expressed, are derived through recombination between viral DNA and genetically engineered chimeric plasmids called transfer vectors.

The transfer vector pAcC3 was indirectly derived from the transfer vector pAc436 reported by Luckow and Summers, in Bio/Technology Trends in the Development of

Baculovirus Expression Vectors, Vol. 6, pg. 47, (1988). This publication is hereby

incorporated by reference in its entirety. First, a transfer vector, pAcCl lacking the EcoRI site present in pAc436 was generated. This was done by digesting pAc436 to completion with

EcoRI and blunt ending with Klenow fragment The fragments were ligated and transformed into a suitable host cell, and colonies screened for the absence of an EcoRI site. The resulting plasmid was termed pAcC2. Next, pAcC3 was generated from pAcC2 by introducing a Ncol restriction site at the ATG translational start site of the polyhedrin gene. This was carried out by digesting pAcC2 to completion with Smal endonuclease. The restriction digest was extracted with phenol and precipitated with ethanol and dissolved in TE buffer consisting of 10 mM Tris-HCl pH 7.4; 1 mM EDTA. 10 μg of Sm al-digested pAcC2 in 50 μl of ExoIII buffer (50 mM Tris-HCl pH 8.0; 5 mMMgCl₂; 10 mM -mercaptoethanol) was treated with 50 units of E. Eoli Exonuclease III (ExoIII) at 30°C for 5 minutes. The sample was phenol extracted and ethanol precipitated twice. Then 50 pmoles of a primer EK85, AACCTATAAACCATGGCGGCCCGG, was kinased with cold ATP in a 20 μl reaction volume (50 mM Tris-HCl pH 7.8; 10 mM MgCl₂; 10 μM -mercaptoethanol). To 5 μg ofExolll-treated pAcC2 was added 10 pmoles of kinased EK85 in a final volume of 20 μl NET (100 mM NaCl; 10 mM Tris-HCl pH 7.5; 1 mM EDTA) buffer. To anneal the plasmid and primer, the reaction was heated to 65°C for 10 minutes, incubated at 37°C for 10 minutes and placed on ice. The extension reaction was performed by adding 20 μl 2x Klenow buffer (40 mM Tris-HCl pH 7.5; 20 mM MgCl₂; 2 mM β- mercaptoethanol) containing 1 μl 10 mM dNTPs, 1 μl 10 mM ATP, 1 μl (about 2 units) Klenow fragment and 1 μl (about 1-2 units) T4 DNA ligase. The reaction was incubated at 16°C for about 4 hours and then used to transform MM294. Miniprep DNA was screened by analyzing for the presence of a Ncol site. Miniprep DNA was then used to retransform and obtain the desired clone, ρAcC3.

Once a suitable transfer vector is constructed, such as pAcC3, a DNA sequence sought to be fused to an insect cell signal peptide can be inserted into the transfer vector, after which the necessary engineering can be performed to associate the insect cell signal peptide sequences with the DNA insert. Exemplary of this approach is to remove the DNA fragment present in pPD17 by NcoI/EcoRV-digestion, and insert it into pAcC3, after subjecting the transfer vector to NcoI/Smal-digestion and subsequently ligating the insert with T4 ligase. The desired transformant, pPD10, consists of a transfer vector with the PA-A gene inserted at the regenerated translational start codon in pAcC3. The construction of pPD10 is shown in figure 2.

After a suitable transfer vector, such as pPD10 is identified and isolated which contains a DNA fragment that encodes a protein sought to be associated with an insect cell signal peptide, the preferred next step is to produce a secreted form of the protein by placing the signal peptide sequence 5 ' of the coding region. This approach can be implemented whereby oligonucleotides that encode the insect cell signal sequence are chemically synthesized

Preferably, the oligonucleotides are synthesized to be compatible for ligation into the appropriate transfer vector. After ligation, the transfer vector along with baculovirus DNA, preferably wild-type virus DNA, is corransfected into a suitable insect cell line, such as for example, Sf9. Those constructs which express the DNA fragment, and more importantly express it in secreted form, can be identified by analysis of culture supernatants using among other techniques, Western blotting. If an insect cell signal peptide effects expression and secretion of the protein, it will be detected both in the supernatants, as well as in cell sonicates. On the other hand, little or no protein will be detected in the supernatant if it is not secreted In addition to Western blotting, biological assays may be conducted if the protein exhibits such activity.

As applied to the expression of the pro-urokinase sequence in pPD10, shown above, oligonucleotides that encode a particular insect signal sequence can be inserted into the Ncol site of the plasmid. The resulting transfer vectors can be cotransfected with baculovirus DNA into Sf9 cells, and expression/secretion of the molecule measured using either Western blot techniques, or by determining urokinase activity. In both instances, those insect cell signal peptide sequences which effect secretion should result in considerable urokinase being detectable in the culture supernatant If a particular insect cell peptide sequence results in secretion, then a molecule having a molecular weight of about 39,000, which is encoded by pPD10, should be detected in the culture supernatant.

A biological assay can also be used to detect urokinase. Because urokinase is a plasminogen activator, it converts the protein plasminogen to the active form plasmin. Plasmin in turn degrades fibrin. Plasminogen activation is shown by a number of assays. The fibrin plate assay is one such assay. See J. Plbug, et al-. Urokinase: an activator of plasminogen from human urine isolation and properties, 1952, Biochem. Biophys. Acta.. 24:278-282. The plasma clot lysis assay described in Zamarron, et al., 1984, Throm Hemostasis. 52:19-23. may also be used In this assay, plasma clots are prepared by mixing 1 ml pooled normal plasma, 25,000 cpm ¹²⁵I-labeled human fibrinogen, 50 μl 0.5 M CaCl and 100 μl of 80 NIH U/ml thrombin. The mixture is immediately drawn into a 4 mm internal diameter plastic tube and incubated at 37°C for one hour to allow clotting and cross-linking. The clot is removed from the tube, washed in 0.15 M NaCl, pH 7.4, and cut into approximately 1.0 mm pieces. Each piece is counted in a gamma counter, and incubated in a 5 ml tube containing 2.45 ml pooled citrated normal plasma. Varying amounts (50-200 U/ml) of the plasminogen activator to be tested are suspended in 0.15 M NaCl, pH 7.4. Plasma samples are taken at intervals and released 1251 fibrin degradation products are counted.

Extracts from recombinant cells may be assayed for plasminogen activation according to the method of Pennica, et al., 1983, Nature. 3.01:214. Briefly, an aliquot of cell extract containing plasminogen activator is incubated at 37°C for 10 minutes in 0.15 ml of 50 mM Tris- HCl pH 7.4, 12 mM NaCl containing 0.37 mg/ml plasminogen and 2.6 mg/ml fibrinogen. 0.35 ml of a 1 mM solution of the chromogenic substrate S-2251 (Kabivitrum Molndal, Sweden) in the above buffer is added and the reaction is continued for 5-30 minutes at 37°C. Acetic acid is added to a final concentration of 0.18 M to stop the reaction. Samples are centrifuged and absorbance at 405 nM is measured. Units are determined by comparison to a urokinase standard.

Plasminogen activation activity may also be determined on casein/agarose plates containing plasminogen, as described in Saksela, O., 1981, Analytical Biochem., 111:276- 282. Briefly, petri dishes are prepared with an agarose medium containing 100 ml of medium, which contains 37.5 ml dH₂O, 10 ml 10x phosphate buffered saline, 40 ml 2.5% agarose, 12.5 ml of 8% boiled powdered milk and 1000 μg of plasminogen (Calbiochem #528175) in 20 mM Tris-HCl, pH 8. The boiled powdered milk is prepared by boiling an 8 g/100 ml dH₂O solution of milk for 20 minutes; centrifuging 20 minutes at 10,000xg and retaining the supernatant. The liquid agarose solution is added at 65°C; plasminogen is added when the mixture has cooled, but not hardened. 20 ml is added to a 100 mm Petri dish. To assay plasminogen activation, 20 μl of solution containing a plasminogen activator is placed in 4 mm holes punched in the casein/agarose, and incubated at 37°C for 2-4 hours. The radius of the lysis halo that forms as the casein is degraded by plasmin is in proportion to the log of the amount of plasminogen activator that was placed in the well. A standard plasminogen activator, such as naturally occurring urokinase, is used to calibrate the assay.

Methods for growing insect cells, such as Sf9 cells, are known in the art and detailed procedures for their cultivation can be found in Summers, et al., (1987 supra) or in EPO 127,839 to Smith, G.E., et al.. The preferred insect expression host of the current invention, Spodoptera frugiperda (Sf9), is well suited to the production of heterologous proteins because of its ability to grow in either monolayer or suspension culture.

As monolayer cultures, Spodoptera frugiperda cells divide every 18-24 hours depending on the type of culture media used The cells do not require carbon dioxide to maintain the pH of the medium and they will grow well at temperatures between 25-30°C. Subculturing is done 2 or 3 times a week when the cells are confluent Because insect cells are loosely adherent, they are easily resuspended without the need of proteases.

Suspension culture conditions will vary depending on the medium and culture volume, and should be determined empirically. Subculturing is required when the cell density reaches about 2 x 10⁶ cells/ml by replacing 80% or more of the culture with an equal volume of fresh medium. With suspension cultures larger than 500 ml, it may become necessary to aerate by either bubbling or diffusion.

Preferred media and culture conditions can be found in PCT/US88/02170, filed July 20, 1988 and PCT/US88/0244A, filed July 20, 1988, respectively.

It will be appreciated that transfection with a transfer vector and wild type virus DNA yields, via genetic recombination, recombinant virus containing the DNA sequence present in the transfer vector. Detailed methods for the generation of recombinant virus can be found in European Patent Application No.0 127 839 to G.E. Smith and M.D. Summers of the Texas A & M University System, or U.S. Patent No. 4,745,051. In general, 2 μg of genetically engineered transfer vector DNA and 1 μg of AcNPV viral DNA are cotransfected onto monolayer culture cells of Spodoptera frugiperda. The infected cells usually show viral occlusions by day 3 or 4, with 10-90% of the cells being infected The virus titre of the medium is expected to be about 10⁷ pfu/ml and 0.1 %-0.5% are expected to be recombinant virus.

Several methods for the detection of recombinant virus are known in the art. Visual detection of the plaques is best achieved using a low power dissecting microscope and observing the plaques on inverted plates with a black background and illumination from the side. More unequivocal methods for detecting recombinants are plaque hybridization using

DNA probes to the cloned gene, or antibody probe that recognize the product of the cloned gene.

Isolation of the recombinant virus is achieved through plaque purification of serially infected monolayer cells overlayed with soft agar. After two or three cycles the recombinant virus is seen as separate plaques showing the characteristic occlusion-negative morphology.

The plaques, containing about 10,000 pfu of virus, are picked using a sterile Pasture pipet and transferred to 2 ml of medium.

Having generally described their invention, Applicants will exemplify it by presenting the following examples. However, it will be understood by those skilled in the art that the examples are intended to be illustrative of the invention, and should not be interpreted as limiting the invention.

Example I

Secretion of a Plasminogen Activator Consisting of Plasminogen Kringle-1. a Proline Rich Linker.and the Pro-Urokinase Protease Domain Insect cell signal peptide sequences were fused to a plasminogen activator, thereby realizing the secretion of the plasminogen activator from Sf9 cells in significant amounts. The pro-urokinase sequence was obtained from the plasmid pPD18, which is on deposit with the American Type Culture Collection, Accession Number 67431 (deposit date June 12, 1987). pPD18 contains the plasminogen activator sequence carried by pPD10, discussed above, and additionally has a eukaryotic signal peptide sequence in front of the encoding region. The plasminogen activator sequence was engineered to consist of plasminogen Kringle-1, a proline rich linker, and the pro-urokinase protease domain. The plasmid containing this sequence was designated pLP19. The eukaroytic signal peptide sequences were removed from pLP19, and the insect signal peptide sequences added

pLP19 was prepared as described in co-pending, commonly assigned U.S. patent application serial number 132,206.

Briefly, the plasmid pPD18 was digested with Ncol and Notl and the resulting fragments separated by electrophoresis through low melting point agarose, and the large fragment encoding most of a urokinase-like protease domain isolated. This fragment was ligated to the oligonucleotides JD90, JD91, JD92, and JD93 described in Table I, below.

These four oligonucleotides anneal together to form a double-stranded segment of DNA with a single-strand extension at both ends; one of these ends is compatible with the single strand created by the enzyme Ncol and the other end is compatible with the single strand generated by the enzyme Notl. After ligation, the mixture was heated to 65°C for five minutes, diluted from 20 μl to 200 μl with 10 mM Tris pH 7.5 EDTA 1 mM, cooled to room temperature and used to transform competent E. coli (strain MM294) cells. A colony containing pPD20 was identified by restriction mapping.

pPD20 was digested with Xmal and Notl. The large fragment was isolated from low melting point agarose after electrophoresis. This segment was ligated to oligonucleotides JD94, JD95, JD96, and JD97, also described in Table I, below. These four oligonucleotides anneal to form a double-stranded segment of DNA with single-stranded Xmal and Notl extensions. After ligation, E. coli strain MM294 were transformed and a colony containing pPD21 was isolated by hybridization with JD96. The oligonucleotide-derived DNA in pPD21 was sequeπced and found to contain two incorrect bases. The errors were in the region encoding the signal sequence (corrected with oligonucleotide JD123) and in kringle-1 of plasminogen (corrected with oligonucleotide JD 124). Table I shows the oligonucleotides JD90, JD91, JD92, JD93, JD123 and JD124.

These errors were corrected by in vitro mutagenesis. This was done by placing the small Eco RV-EcoRI fragment of pPD21 in the vector M13mp19 that had been digested with HincII and EcoRI, thereby creating mpJD18. Single-stranded mpJD 18 was prepared and used a template for the mutagenic oligonucleotide JD123. A phage with the correct sequence was isolated by hybridization with JD123 and termed mpJD18-123; single-stranded DNA was prepared from this phage and used as a template for the mutagenic oligonucleotide JD124. A phage containing the corrections made by both JD123 and JD 124 was then identified by hybridization with JD 124 and designated mpJD 18-123/124. The Notl-Ncol fragment of mpJD18-123/124 that encodes the plasminogen kringle-1 was isolated from low melting point agarose after electrophoresis. This fragment was ligated to the large Ncol -NotI fragment of pPD 18 that had been isolated from low melting point agarose after electrophoresis. Competent E. coli (strain MM294) cells were transformed with this ligation mixture and pJD22 was identified by restriction mapping.

Similarly, plasmid pLP19 was constructed which encodes cPA-P2, a gene identical to that encoding cPA-P except that the codon corresponding to Lys₁₅₈ in urokinase encodes a Lys in cPA-P2 and a Gly in cPA-P. To construct pLP19, the oligonucleotide JD89B, illustrated in Table I, was used for site-specific mutagenesis to change Gly Lys at trie position

corresponding to Lysiss urokinase of the gene encoding cPA-P in plasmid pJD22.

Example II

Construction of a Transfer Vector Encoding for and -expression of a

Plasminogen Activator Comprising Plasminogen Kringle-L a Proline

Rich Linker, a Pro-ϋrokinase Protease Domain, and An Insect

Cell Signal Peptide From Drosophila- α-Amylase

Th. plasmid pLP 19, described above, was treated with Ncoi and Nhel, as shown in Figure 3, and the resulting fragments separated by electrophoresis. The large fragment was recovered wϊύch contains the plasrainogen activator sequence less trie mammalian cell signal peptide sequences. Next, an insect cell signal pepide sequence having Ncol and Nhel sticky ends was inserted into the plasmid The oligonucleotides that encode the signal peptide sequence are shown in Figure 4. The oligonucleotides were ligated into pLP19 and the resulting plasmid designated pPD36.

pPD36 can be transfected into Sf9 cells using the calcium phosphate precipitation technique described by Graham, F.L., et al., 1973, Virology, 52:456 as adapted for insect cells as described by J.P. Burand, et al., 1980. Virology, 101:58, andE.B. Casstens, et al., 1980, Virology. 101:311. Additionally, Sf9 cells can be transfected as described by Summers and Smith in "A Manual of Methods for Baculovirus Vectors and Insect Cell Procedures", Texas A & M Press: 1986. In tne latter reference, two methods are described, Method I and Method II. Transfection of pPD36 was performed using Method II,, except the amount of transfer vector, and baculovirus DNA was doubled The transfected cells were allowed to grow for three days in media, after which the media containing both recombinant and non- recombinant virus was harvested Recombinant virus was distinguished from non- recombinant virus using the polyhedrin plaque assay described by L.E. Volkman, M.D.

Summers and CH. Hsieh, 19 Journal Virology. 820: 1976. This assay distinguishes plaques harboring non-recombinant from recombinant virus by the appearance of the plaques under a low power binocular microscope. Non-recombinant virus produces viral occlusions, while plaques containing recombinant virus do not produce viral occlusions. Virus present in occlusion minus plaques was plaque purified, and tested for plasminogen activator activity. Subsequently, large stocks of the recombinant virus, PD36 were then obtained by infecting Sf9 cells using standard procedures.

Twice plaque purified PD36 virus was used to directly infect 4 x 10⁶ SF9 cells with 0.5 ml of culture media containing about 2 x 10⁶ PFU/ml, and four days later 10 μl of the supernatant assayed on casein/agarose plates to detect plasminogen activator activity. The assay was conducted generally as described by Saksela, O., 1981. Anal. Bio. Chem..

ϋi:276. Petri dishes were prepared with an agarose medium containing 100 ml of medium which contains 37.5 ml dH₂O, 10 ml 10x phosphate buffered saline, 40 ml 2.5% agarose, 12.5 ml of 8% boiled powdered milk, and 1,000 μg of plasminogen (Calbiochem No. 528175) in 20 mM Tris-HCl, pH 8. The powdered milk was prepared by boiling an 8 g/per 100 ml dH₂O solution of milk for 20 minutes, followed by centrifuging the solution for 20 minutes at 10,000xg, and recovering the supernatant. The liquid agarose solution is added at 65°C to the supernatant, and plasminogen is added when the mixture has cooled, but not hardened 20 ml of this mixture is then pipetted into a 100 mm Petri dish. The plasminogen activation assay then consisted of adding 10 μl of the viral cell culture supernatant sought to be assayed in 4 mm holes punched in the casein/agarose. The plates were incubated at 37°C for 24 hours, and a lysis halo formed as the casein was degraded by plasmin activated by the plasminogen activator. The lysis halo is in proportion to the log of the amount of plasminogen activator present in the cell culture media.

The results of the plasminogen activator assay are shown in Figure 5. Also shown are the results of a similar assay done on LP19 recombinant virus for comparative purposes. LP19 contains the same plasminogen activator present in PD36, but without the insect cell signal peptide and instead has a consensus signal peptide. Figure 5 also presents a standard curve relating mm of clearance to units of urokinase activity. After 1/25 dilution, the size of the zones observed for LP19 and PD36 were 6.0 x 6.5 mm, and 11.0 x 11.0 mm, respectively. Based on the standard curve, and as shown in Figure 5, it is apparent that media from PD36- infected Sf9 cells has at least five times more activity than media from LP19-infected Sf9 cells. Thus, it will be appreciated that this activity is the result of the insect cell signal peptide associated with the urokinase present in PD36.

Example III

Secretion Of Novel Urokinase With Polyphemus Chorion

A Associated Insect Cell Signal Peptide

The materials and methods presented in this example are similar to those described in the two preceding examples with the exception that the insect cell signal peptide sequence used was from polyphemus Chorion A. Oligonucleotides corresponding to this sequence .are shown in Figure 4. These oligonucleotides were ligated into pLP19 as described for the drosophila α- amylase signal peptide sequences shown in Example II. The resulting transfer vector was termed pPD37.

pPD37 was transfected into Sf9 insect cells, along with wild-type baculovirus DNA, using the techniques shown in the preceding examples. Recombinant PD37 virus was isolated from the cell culture supernatant, plaque purified and used to infect Sf9 cells. Four days after infection, the media was assayed for plasminogen activator activity using the casein/agarose assay. The results are shown hi Figure 5. It is apparent that the level of plasminogen activator activity is similar to that observed for recombinant baculovirus PD36, which, in turn, is considerably greater than that observed for the recombinant baculovirus, LP19, which has the mammalian signal peptide sequence and was used for comparison. At a 1/25 dilution of culture supernatant obtained from LP19 and PD37, the size of the zone observed in the casein/agarose plates was 6.0 x 6.5 mm, and 11.5 x 11.5 mm for LP19 and PD37, respectively. This result was all the more impressive when it is realized that the PFU/ml for PD37 was 3 x 10⁶ compared to LP19, which was 11 x 10⁶. Thus, PD37 was used at a lower PFU/ml than LP19.

Example IV

Secretion Of Novel Urokinase With Insect Cell

Signal Peptide Cecropia Cecropin B

In addition to the insect cell signal peptides, α-amylase, and chorion A, from

drosophila. and polyphemus. respectively, other insect cell signal peptide sequences can be used successfully to express the instant plasminogen activator. For example, Figure 4 shows the oligonucleotide sequences that encode insect cell signal peptides associated with cecropin B, wherein valine or glycine is at position 20. These oligonucleotides were synthesized to have Ncol and Nhel "sticky" ends that are compatible for insertion into pLP19. Thus, using the material and methods shown in the preceding examples, these signal peptide sequences may be inserted into pLP19 and assayed for enhance secretion of plasminogen activator activity. The plasminogen activator activity exhibited by the recombinant virus is expected to be similar to that observed for PD36 and PD37.

It will be understood by those skilled in the art that the scope of the invention should no be viewed as being confined to what is shown in the examples, but rather only by the appended claims.

Claims

WE CLAIM:

1. A DNA sequence comprising a first and second DNA sequence, said first sequence encoding an insect cell signal peptide, and said second sequence encoding a heterologous protein, said first and second sequences exhibiting a tandem relationship with said second sequence being downstream of said first sequence, and being transcribable therewith.

2. The DNA sequence of claim 1 further comprising control sequences for the expression of said DNA sequence in a host cell.

3. A DNA sequence as described in claim 2, wherein said host cell is selected from the group consisting of insect cells, mammalian cells, and prokaryotic cells.

4. A DNA sequence as described in claim 3, wherein said host cell is an insect cell.

5. A DNA sequence as described in claim 2, wherein said control sequences are derived from the genome of Autographa Califomica multiple nuclear polyhedrosis virus.

6. A DNA sequence as described in claim 5, wherein said control sequences are selected from the group consisting of those derived from an Autographa Califomica multiple nuclear polyhedrosis virus polyhedrin protein promoter.

7. A recombinant baculovirus transfer vector comprising a first and second DNA sequence, said first sequence encoding an insect cell signal peptide, and said second sequence encoding a heterologous protein, said first and second sequences exhibiting a tandem relationship with said second sequence being downstream of said first sequence, and being transcribable therewith.

8. A recombinant baculovirus transfer vector as described in claim 7, wherein said DNA sequence is under the transcriptional control of a baculovirus promoter.

9. A recombinant baculovirus transfer vector as described in claim 8, wherein said baculovirus promoter comprises the polyhedrin promoter.

10. A recombinant baculovirus transfer vector as described in claim 9, wherein said insect cell signal peptide sequence is selected from the group consisting of drosophila α- amylase, polyphemus chorion A, and cecropia cecropin, wherein position 20 comprises either alanine or valine.

11. A recombinant baculovirus transfer vector selected from the group consisting of pPD36, pPD37, pPD38 and pPD39.

12. A method for producing polypeptides, comprising the steps of:

a) Co-transfecting a susceptible host insect cell with a recombinant

baculovirus transfer vector comprising a first DNA sequence that encodes a heterologous protein and a second DNA sequence that encodes an insect cell signal peptide sequence expressible with said heterologous protein;

b) Growing said co-transfected insect cells in suitable culture media;

c) Isolating recombinant baculoviruses from said culture media;

d) Infecting insect cells growing in a suitable culture media with said

recombinant baculoviruses; and

e) Isolating said polypeptides from said recombinant baculovirus infected insect cell culture medium.

13. A method as described in claim 12, wherein said baculovirus transfer vectors are selected from the group consisting of pPD36, pPD37, pPD38, and pPD39.

14. Baculovirus expression vectors wherein said vectors comprise two DNA sequences, a first sequence encoding an insect cell signal peptide, and a second sequence encoding a heterologous protein downstream of said insect cell signal peptide sequence and transcribable therewith.

15. Baculovirus transfer vectors as described in claim 14, wherein expression of said insect cell signal peptide and heterologous sequences are under the control of the baculovirus polyhedrin gene promoter.

16. Baculovirus expression vectors selected from the group consisting of PD36, PD37, PD38, and PD39.

17. Recombinant baculovirus expression vector PD36.

18. Recombinant baculovirus expression vector PD37.

19. Recombinant baculovims expression vector PD38.

20. Recombinant baculovirus expression vector PD39.