Classifications

• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/531—Production of immunochemical test materials
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/82—Translation products from oncogenes
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
  • C07K16/2809—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
  • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
  • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
  • C07K2317/622—Single chain antibody (scFv)
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
  • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
  • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

• the present invention relates to multivalent F v antibody constructs, expression plasmids encoding them, and a method for producing the F v antibody constructs and their use.
• Natural antibodies are dimers and are therefore called bivalent. They have four variable domains, namely two V H and two V L domains. The variable domains serve as binding sites for an antigen, a binding site being formed from a V H and a V L domain. Natural antibodies recognize an antigen, which is why they are also called monospecific. They also have constant domains. These contribute to the stability of the natural antibodies. On the other hand, they are also responsible for unwanted immune reactions that arise when natural antibodies from different animal species are administered reciprocally.
• antibodies are constructed that lack the constant domains.
• these are antibodies that only have the variable domains.
• Such antibodies are referred to as F v antibody constructs. These are often in the form of single-chain, paired monomers.
• F v -antibody constructs have little stability. Their usability for therapeutic purposes is therefore very limited.
• the object of the present invention is therefore to provide an antibody with which undesired immune reactions can be avoided. Furthermore, it should have a stability that makes it suitable for therapeutic purposes makes it usable.
• the present invention thus relates to a multivalent F v antibody construct which has great stability. Such is suitable for diagnostic and therapeutic purposes.
• the present invention is based on the knowledge of the applicant that the stability of an F v -antibody construct can be increased if it is in the form of a single-chain dimer in which the four variable domains are connected to one another via three peptide linkers.
• the applicant has also recognized that the F v antibody construct folds itself when the central peptide linker is about 10-30 amino acids in length.
• the applicant has recognized that the F v antibody construct folds together with other F v antibody constructs when the middle peptide linker has a length of approximately up to 10 amino acids, whereby a multimeric, ie multivalent, F v Antibody construct is obtained.
• the applicant has also recognized that the F v antibody construct can be multispecific.
• the applicant's findings are used to provide a multivalent F v antibody construct which comprises at least four variable domains which are linked to one another via peptide linkers 1, 2 and 3.
• F v antibody construct indicates an antibody that has variable domains, but not constant domains.
• variable F v antibody construct indicates an F v antibody which has several variable domains, but at least four. This is achieved when the single-chain F v antibody construct folds with itself, resulting in four variable domains, or with other single domains. folds chain-like F v antibody constructs. In the latter case there is an F v antibody construct which has 8, 12, 16, etc. variable domains. It is favorable if the F v antibody construct has four or eight variable domains, ie it is bi- or tetravalent (cf. FIG. 1). Furthermore, the variable domains can be the same or different from one another, as a result of which the antibody construct recognizes one or more antigens.
• the antibody construct preferably recognizes one or two antigens, ie it is mono- or bispecific. Examples of such antigens are the proteins CD19 and CD3.
• peptide linker 1, 3 indicates a peptide linker which is suitable for connecting variable domains of an F v antibody construct to one another.
• the peptide linker can contain any amino acids, with the amino acids glycine (G), serine (S) and proline (P) being preferred.
• Peptide linkers 1 and 3 can be the same or different from one another.
• the peptide linker can have a length of about 0-10 amino acids. In the former case, the peptide linker is only a peptide bond from the COOH residue of one of the variable domains and the NH 2 residue of another of the variable domains.
• the peptide linker preferably has the amino acid sequence GG.
• peptide linker 2 indicates a peptide linker which is suitable for linking variable domains of an F v antibody construct to one another.
• the peptide linker can contain any amino acids, with the amino acids glycine (G), serine (S) and proline (P) being preferred. Further, the peptide linker may have a length of about 3 to 10 amino acids, preferably 5 amino acids, and especially the amino acid sequence GGPGS, have thereby achieved that the single chain F v antibody construct single chain F v with other anti-body constructs folds up.
• the peptide linker can have a length of approximately 11-20 amino acids, in particular 15-20 amino acids, and very particularly the amino acid sequence (G 4 S) 4 , whereby the single-chain F v antibody construct is associated with it itself folds.
• An F v antibody construct according to the invention can be produced by conventional methods. A method is favorable in which DNAs coding for peptide linkers 1, 2 and 3 are ligated with DNAs coding for the four variable domains of an F v -antibody construct in such a way that the peptide linkers connect the variable domains to one another, and the resultant DNA molecule is expressed in an expression plasmid. Reference is made to Examples 1-6.
• DNAs which code for an F v antibody construct according to the invention are also the subject of the present invention.
• Expression plasmids which contain such DNAs are also the subject of the present invention.
• Preferred expression plasmids are pDISC3x19-LL, pDISC3x19-SL, pPIC-DISC-LL, pPIC-DISC-SL, pDISC5-LL and pDISC6-SL. The first four were deposited with the DSMZ (German Collection for Microorganisms and Cells) on April 30, 1998 under DSM 12150, DSM 12149, DSM 12152 and DSM 12151.
• Another object of the present invention is a kit comprising:
• One or more representatives of the individual components can be present.
• the present invention provides a multivalent F v antibody construct in which the variable domains are linked to one another via peptide linkers.
• Such an antibody construct is characterized in that it does not contain any parts that can lead to undesirable immune reactions. It also has great stability. Furthermore, it enables several antigens to be bound simultaneously.
• the F v antibody construct according to the invention is therefore ideally suited not only for diagnostic but also for therapeutic purposes. Such purposes can be seen with respect to any disease, particularly viral, bacterial or tumor disease.
• FIG. 1 shows the genetic organization of an F v antibody construct (A) according to the invention and schemes for forming a bivalent (B) or tetravalent F v antibody construct (C).
• Ag antigen
• His ⁇ six C-terminal histidine residues
• Stop Stop Codon (TAA)
• V H and V L variable region of the heavy and light chain.
• Fig. 2 shows the scheme for the construction of the plasmids pDISC3x19-LL and pDISC3x19-SL.
• c-myc sequence coding for an epitope recognized by the antibody 9E1, His ⁇ : sequence coding for six C-terminal histidine residues;
• PelB signal peptide sequence of the bacterial pectate lyase (PelB leader); rbs: ribosome binding site; Stop: Stop Codon (TAA); V H and V L : variable region of the heavy and light chain.
• FIG. 3 shows a diagram of the expression plasmid pDISC3x19-LL.
• 6xHis sequence coding for six C-terminal histidine residues; bla: gene encoding jß-lactamase responsible for ampicillin resistance; bp: base pairs; c- myc.
• 6xHis sequence coding for six C-terminal histidine residues
• bla gene that for ß- Encodes lactamase, which is responsible for ampicillin resistance
• bp base pairs
• c- myc Sequence encoding an epitope recognized by antibody 9E10
• ColE1 Origin of DNA Replication
• f1-IG intergenic region of bacteriophage f1
• Lac P / O wt / ac operon promoter / operator
• Linker 1 Sequence coding for a GlyGly dipeptide that connects the V H and V L domains; Left S.
• c- / 77 t epitope sequence coding for an epitope recognized by the antibody 9E10; CDR: complementarity determining region; Scaffold: scaffold region (framework region); His6 tail, sequence encoding six C-terminal histidine residues; PelB leader: signal peptide sequence of bacterial pectalyase; RBS: ribosome binding site; V H and V L : variable region of the heavy and light chain.
• FIG. 6 shows the nucleotide and the derived amino acid sequence of the tetravalent F v antibody construct encoded by the expression piasmid pDISC3x19-SL.
• c-myo-Ep Xop sequence coding for an epitope that is recognized by the antibody 9E10;
• CDR region determining complementarity, framework: framework region (framework region);
• His6 tail sequence encoding six C-terminal histidine residues;
• PelB leader signal peptide sequence of bacterial pectalyase;
• RBS ribosome binding site;
• V H and V L variable region of the heavy and light chain.
• Figure 7 shows the nucleotide and deduced amino acid sequence of a link between a gene coding for an ⁇ factor leader sequence and a gene coding for the tetravalent F v antibody construct in the Pichia expression plasmid pPIC- DISC-SL.
• Figure 8 shows the nucleotide and deduced amino acid sequence of a link between a gene encoding an ⁇ factor leader sequence and a gene encoding the bivalent F v antibody construct in the Pichia expression plasmid pPIC- DISC-LL.
• Alpha factor signal leader peptide sequence of the Saccharomyces ce eiz / s / äe- ⁇ factor secretion signal;
• V H variable region of the heavy chain. Rhombuses indicate the signal gap points.
• 6xHis sequence coding for six C-terminal histidine residues
• bla gene coding for ⁇ -lactamase, which is responsible for ampicillin resistance
• bp base pairs
• c-myc gene coding for ⁇ -lactamase, which is responsible for ampicillin resistance
• lacZ bacteriophage T7 gene 10 (T7g10) or from the E. coli skp gene (skp); skp: gene coding for the bacterial periplasmic factor Skp / OmpH; tHP: strong transcription terminator; TIP: transcription terminator; V H and V L : variable region of the heavy and light chain.
• 10 shows a diagram of the expression plasmid pDISC6-SL.
• 6xHis sequence coding for six C-terminal histidine residues
• bla gene coding for ⁇ -lactamase, which is responsible for ampicillin resistance
• bp base pairs
• c-myc a diagram of the expression plasmid pDISC6-SL.
• lacZ bacteriophage T7 gene 10 (T7g10) or from the E. coli skp gene (skp); skp: gene coding for the bacterial periplasmic factor Skp / OmpH; tHP: strong transcription terminator; TIP: transcription terminator; V H and V L : variable region of the heavy and light chain.
• Example 1 Construction of the piasmids pDISC3x19-LL and pDISC3x19-SL for the expression of bivalent, bispecific or tetravalent, bispecific F v antibody constructs in bacteria
• a PCR fragment 1 of the V H domain of anti-CD19 followed by a segment coding for a GlyGly linker was generated using the primers DP1, 5'-TCA-CACAOA ⁇ TICTTAGATCTATTAAAGAGGAGAAATTAACC, and DP2, 5'- AGCACACGATATCACCGCCAAGCTTGGGTGTTGTTTTGGC. generated (see Fig. 2).
• the PCR fragment 1 was digested with Eco ⁇ and EcorN and ligated with the plasmid pHOG-dmOKT3 linearized with EcoRI / EcoRV, whereby the vector ⁇ HOG19-3 was generated.
• PCR fragment 2 of the V L domain of anti-CD19, followed by a segment encoding a c-myc-Ep ' ftop and a hexahistidinyl tail was generated using primers DP3, 5'-AGCACA-CAAGC IGGCGGTGATATCTTGCTCACCCAAACTCCA, and DP4, 5'-AGCA-CACTCTAGAGACACACAGATCTTGTTGGGGAGTGTGTGGG.
• the PCR fragment 2 was digested with H / ndll and Xba and ligated with the plasmid pHOG-dmOKT3 linearized by HindWjXba, whereby the vector pHOG3-19 was obtained (cf. FIG. 2).
• Encoding the hybrid scFv-encoding gene in the plasmid 3-19 pHOG3-19 was amplified by PCR with primers Bi3sk, 5'CAGCCGGCCATGGCGCAGGTGCAACTGCAGCAG and either Li-1, 5'-TATA TACTGCAGCTGCACCTGGCTA CCACCAC - CACCGGAGCCGCCACCACCGCTACCACCGCCGCCAGAACCACCACCACC- AGCGGCCGCAGCATCAGCCCG, for generating a long flexible (Gly 4 Ser) 4 - inter-scFv linker (PCR fragment 3, see FIG.
• Example 2 Construction of the plasmids pPIC-DISC-LL and pPIC-DISC-SL for the expression of bivalent, bispecific or tetravalent, bispecific F v antibody constructs in yeast
• the vector pPICZ ⁇ A (Invitrogen BV, Leek, Netherlands) for the expression and secretion of recombinant proteins in the yeast Pichia pastoris was used as the starting material. It contains a gene that is responsible for the Saccharomyces cerevi s / äe ⁇ factor secretion signal encoded, followed by a polylinker. The secretion of this vector is based on the dominant selectable marker, Zeocin TM, which is bifunctional in both Pichia and E coli.
• the gene coding for the tetravalent F v antibody construct was PCR-isolated from the template pDISC3x19-SL using the primers 5-PIC, 5'-CCGTGAAT-ICCAGGTGCAACTGCAGCAGTCTGGGGCTGAACTGGTC 'and pSEXGn 5' - GACGTTAACCGACAAACAACAGATAAAACG amplified.
• the PCR product thus obtained was cleaved with EcoR ⁇ and Xba and ligated into pPICZ ⁇ A linearized with EcoRI / Xba.
• the expression piasmid pPIC-DISC-SL was obtained.
• the nucleotide and protein sequences of the tetravalent F v antibody construct are shown in FIG. 7.
• pPIC-DISC-LL The construction of pPIC-DISC-LL was carried out on the basis of pPICZ ⁇ A (Invitrogen BV, Leek, Netherlands) and pDISC3x19-LL (see Fig. 3).
• the plasmid DNA pPICZ ⁇ A was digested with EcoRI.
• the protruding 5 'ends were filled in using a Klenow fragment of the E c ⁇ / ⁇ DNA polymerase I.
• the DNA thus obtained was digested with Xba and the large fragment comprising the pPIC vector was isolated.
• the DNA from pDISC3x19-LL was cleaved with Nc ⁇ and treated with a Klenow fragment.
• Example 3 Expression of the tetravalent or bivalent F v -antibody construct in bacteria
• the spheroplasts were centrifuged at 30,000 g for 30 min at 4 ° C., whereby the soluble periplasmic extract as a supernatant and the spheroplasts with the insoluble periplasmic material as a pellet were obtained.
• the culture supernatant and the soluble periplasmic extract were combined and clarified by further centrifugation (30,000 g, 4 ° C., 40 min).
• the recombinant product was concentrated by ammonium sulfate precipitation (final concentration 70% saturation).
• the protein precipitate was collected by centrifugation (10,000 g, 4 ° C, 40 min) and dissolved in 10% of the initial volume of 50 mM Tris-HCl, 1 M NaCl, pH 7.0.
• Immobilized metal affinity chromatography (IMAC) was performed at 4 ° C using a 5 ml column of chelating Sepharose (Pharmacia) loaded with Cu 2+ and with 50 mM Tris-HCl, 1 M NaCI, pH 7.0 (start buffer) had been equilibrated. The sample was charged by passing it over the column.
• Protein concentrations were determined using the Bradford dye binding test (1976, Anal. Biochem., 72, 248-254) using the Bio-Rad (Munich, Germany) protein assay kit.
• Example 4 Expression of the tetravalent or bivalent antibody construct in the yeast Pichia pasto s
• Competent P. y ⁇ ⁇ 3s ⁇ ? / 7i? GS155 cells were electroporated in the presence of 10 ⁇ g plasmid DNA from pPIC-DISC-LL or pPIC-DISC-SL, which had been linearized with Sa ⁇ .
• the transformants were selected for 3 days at 30 ° C. on YPD plates containing 100 ⁇ g / ml Zeocin TM.
• the clones that secreted bivalent or tetravalent F v antibody constructs were selected by plate screening using an anti-c / 77 c mAb 9E10 (IC Chemicals, Ismaning, Germany).
• the clones were grown in YPD medium in shake flasks for 2 days at 30 ° C. with stirring.
• the cells were centrifuged, resuspended in the same volume of the medium containing methanol and incubated for a further 3 days at 30 ° C. with stirring.
• the supernatants were collected after centrifugation.
• the recombinant product was isolated by ammonium sulfate precipitation followed by IMAC as described above.
• Analytical gel filtration of the F v antibody constructs was performed in PBS using a Superdex 200 HR10 / 30 column (Pharmacia).
• the Sample volume and flow rate were 200 ⁇ l / min and 0.5 ml / min, respectively.
• the column was calibrated with high and low molecular weight gel filtration calibration kits (Pharmacia).
• the human CD3 + / CD19 " acute T cell leukemia line Jurkat and the CD19 + / - CD3 " B cell line JOK-1 were used for flow cytometry. 5 ⁇ 10 5 cells in 50 ⁇ l RPMI 1640 medium (GIBCO BRL, Eggestein, Germany), which was supplemented with 10% FCS and 0.1% sodium azide (referred to as complete medium), were treated with 100 ⁇ l of the F v antibodies - Incubated preparations for 45 min on ice. After washing with the complete medium, the cells were incubated with 100 ⁇ l 10 ⁇ g / ml anti-c- / 77j c-Mak 9E10 (IC chemicals) in the same buffer for 45 min on ice.
• the cells were incubated with 100 ul of the FITC-labeled goat anti-mouse IgG (GIBCO BRL) under the same conditions as before. The cells were then washed again and resuspended in 100 ⁇ l of 1 ⁇ g / ml propidium iodide solution (Sigma, Deisenhofen, Germany) in complete medium with the exclusion of dead cells. The relative fluorescence of the stained cells was measured using a FACScan flow cytometer (Becton Dickinson, Mountain View, CA).
• the CD19-expressing Burkitt lymphoma cell line Raji and Namalwa were used as target cells.
• the cells were incubated in RPMI 1640 (GIBCO BRL) supplemented with 10% heat inactivated FCS (GIBCO BRL), 2 mM glutamine and 1 mM pyruvate at 37 ° C in a humidified atmosphere with 7.5% CO 2 .
• the cytotoxic T cell tests were performed in RPMI-1640 medium supplemented with 10% FCS, 10 mM HEPES, 2 mM glutamine, 1 mM pyruvate and 0.05 mM 2-ME.
• Cytotoxic activity was assessed using a standard [ 51 Cr] release assay; 2 x 10 ⁇ target cells were with 200 ⁇ Ci Na [ 51 Cr] O 4 (Amersham-Buchler, Braunschweig, Germany) marked and washed 4 times and then resuspended in medium in a concentration of 2 ⁇ 10 5 / ml. The effector cells were adjusted to a concentration of 5 x 10 6 / ml. Increasing amounts of CTLs in 100 ⁇ l were titrated to 10 4 target cells / well in 50 ⁇ l. 50 ul antibody was added to each well. The entire test was run in triplicate and incubated for 4 h at 37 ° C.
• Example 6 Construction of the plasmids pDISC5-LL and pDISC6-SL for the expression of bivalent, bispecific or tetravalent, bispecific F v -antibody constructs in bacteria by high cell density fermentation
• Expression vectors containing the hok / sok plasmid-free cell "suicide" system and a gene encoding the Skp / OmpH periplasmic factor for greater production of recombinant antibodies were prepared.
• the skp gene was PCR by means of the primers skp-1, 5'-CGA ATT CTT AAG ATA AGA AGG AGT TTA TTG TGA AAA AGT GGT TAT TAG CTG CAG G and skp-2, 5'-CGA ATT AAG CTT CAT TAT TTA ACC TGT TTC AGT ACG TCG G amplified using the plasmid pGAH317 (Holck and Kleppe, 1988, Gene 67, 117-124).
• the resulting PCR fragment was digested with AflII and HindIII and inserted into the plasmid pHKK (Hörn et al., 1996, Appl. Microbiol. Biotechnol. 46, 524-532) linearized with AflII / HindIII, whereby the vector pSKK was obtained.
• the genes contained in the plasmids pDISC3x19-LL and ⁇ DISC3x19-SL and coding for the scFv antibody constructs were determined by PCR using the primers. 1, 5'-CGA ATT TCT AGA TAA GAA GGA GAA ATT AAC CAT GAA ATA CC and
• Multivalent F v antibody construct with at least four variable domains, which are connected to one another via peptide linkers 1, 2 and 3.
• F v antibody construct according to claim 1 wherein the peptide linkers 1 and 3 have 0-10 amino acids.
• F v antibody construct according to claim 4 wherein the peptide linker has 2 11-20 amino acids.
• F v antibody construct according to claim 7 or 8 wherein the peptide linker 2 has the amino acid sequence GGPGS. 10. F v antibody construct according to any one of claims 1-9, wherein the F v antibody construct is multispecific.
• F v -antibody construct according to claim 10 wherein the F v -antibody construct is bispecific.
• F v antibody construct according to any one of claims 1-9, wherein the F v antibody construct is monospecific.

Landscapes

• Health & Medical Sciences (AREA)
• Immunology (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Molecular Biology (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Genetics & Genomics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biophysics (AREA)
• Engineering & Computer Science (AREA)
• Hematology (AREA)
• Biomedical Technology (AREA)
• Urology & Nephrology (AREA)
• Biotechnology (AREA)
• Pathology (AREA)
• Cell Biology (AREA)
• Food Science & Technology (AREA)
• Physics & Mathematics (AREA)
• Analytical Chemistry (AREA)
• General Physics & Mathematics (AREA)
• Microbiology (AREA)
• Oncology (AREA)
• Gastroenterology & Hepatology (AREA)
• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (9)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (2)

Family

ID=7866613

Family Applications (1)

Country Status (10)

Cited By (72)

Families Citing this family (176)

Family Cites Families (11)

• 1998
  • 1998-05-05 DE DE19819846.9A patent/DE19819846B4/de not_active Expired - Lifetime
• 1999
  • 1999-05-05 DK DK99932626T patent/DK1078004T3/da active
  • 1999-05-05 CA CA2331641A patent/CA2331641C/en not_active Expired - Lifetime
  • 1999-05-05 DE DE59914538T patent/DE59914538D1/de not_active Expired - Lifetime
  • 1999-05-05 US US09/674,794 patent/US7129330B1/en not_active Expired - Lifetime
  • 1999-05-05 AU AU48960/99A patent/AU4896099A/en not_active Abandoned
  • 1999-05-05 JP JP2000547118A patent/JP4431277B2/ja not_active Expired - Lifetime
  • 1999-05-05 EP EP99932626A patent/EP1078004B1/de not_active Expired - Lifetime
  • 1999-05-05 WO PCT/DE1999/001350 patent/WO1999057150A2/de not_active Ceased
  • 1999-05-05 ES ES99932626T patent/ES2296395T3/es not_active Expired - Lifetime
  • 1999-05-05 AT AT99932626T patent/ATE377027T1/de active
• 2006
  • 2006-10-10 US US11/546,262 patent/US7507796B2/en not_active Expired - Lifetime
• 2009
  • 2009-02-06 US US12/367,219 patent/US8148496B2/en not_active Expired - Fee Related

Non-Patent Citations (7)

Also Published As

Similar Documents

Legal Events