WO1997014805A2 - Methods for production of recombinant plasmids - Google Patents
Methods for production of recombinant plasmids Download PDFInfo
- Publication number
- WO1997014805A2 WO1997014805A2 PCT/CA1996/000693 CA9600693W WO9714805A2 WO 1997014805 A2 WO1997014805 A2 WO 1997014805A2 CA 9600693 W CA9600693 W CA 9600693W WO 9714805 A2 WO9714805 A2 WO 9714805A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plasmid
- cells
- gene
- ofthe
- bacterial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- GDOPTJXRTPNYNR-UHFFFAOYSA-N CC1CCCC1 Chemical compound CC1CCCC1 GDOPTJXRTPNYNR-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
Definitions
- genetically engineered bacterial cells and recombinant plasmids are the foundation of industrial biotechnology. For example, they are used for production of industrially and medically important proteins such as enzymes, cytokines, growth hormones, and antigens or as live bacterial vaccines.
- the advent of DNA immunization and gene therapy technologies has added another dimension to the use of genetically engineered bacterial cells and their companion recombinant plasmids.
- expression of proteins in genetically engineered bacterial cells is no longer the principal objective, which is, instead, the replication and high-level production of structurally and genetically stable recombinant plasmids carrying foreign DNA.
- the present invention relates to the use of genetically-engineered bacterial cells and their companion recombinant plasmids for cloning of foreign DNA. More particularly, the invention provides a method whereby foreign DNA suitable for use in DNA immunization and gene therapy can be replicated and produced in large quantities in these companion recombinant plasmids.
- antibiotic resistance genes have been very useful and effective in providing a means of recombinant plasmid stability, their use has serious drawbacks. Firstly, addition of antibiotics in the culture medium during fermentation on an industrial scale is expensive. Secondly, in those cases where the mechanism of antibiotic resistance is based on secretion of an antibiotic-inactivating compound, some plasmid-free bacterial cells may survive because surrounding plasmid-harbouring bacterial cells secrete enough ofthe antibiotic-inactivating compound into the culture medium so as to permit survival of both plasmid-harbouring and plasmid-free bacterial cells.
- the known methods can be divided into three groups depending on the type of polypeptide encoded by the gene used.
- each ofthe known methods is either impractical in reducing the rate at which plasmid-free bacterial cells arise under industrial conditions and/or unsuitable for production of recombinant plasmids for use in eukaryotes, such as for DNA immunization and gene therapy.
- Each group of methods will be described in turn.
- the first group comprises methods in which a chromosomal defect results in the failure to produce an essential nutrient and the plasmid-borne gene encodes an enzyme essential for the biosynthesis of this nutrient (e.g. an amino acid) that normally exists in commonly used bacterial growth medium (Dwivedi, CP. et al.
- the second group comprises methods wherein a chromosomal defect resides in defective production of an end-product that is required, and the plasmid-borne gene encodes an enzyme that synthesizes this end-product, but where the end-product does not exist in commonly used bacterial growth medium (Diderichsen, B. Bacillus Molecular Genetics and Biotechnology Applications (1986) pp.35-46; Ferrari, E. et al. BioTechnology (1985) 3:1003-1007; Galan, J.E. et al. Gene (1990) 94:29; Nakayama, K. et al. BioTechnology (1988) 6:696; Curtiss, R. et al. Res Microbiol (1990) 141 :797).
- the enzymes that have been used in these situations to date e.g., aspartate semialdehyde dehydrogenase (asd) or alanine racemase (air)
- catalyse the formation of a small diffusible growth factor (aspartate semialdehyde and D-alanine, respectively)
- the factor may accumulate in the culture medium under industrial bioreactor conditions.
- Such accumulation contributes to plasmid loss because of a cross-feeding effect in which plasmid-harbouring bacterial cells (producing the small diffusible growth factor) support the growth of plasmid-free bacterial cells.
- this type of gene has been used with low-copy-number plasmids, i.e., of a type which occur as only 1 or 2 copies per bacterial cell.
- low-copy-number recombinant plasmids is impractical for production of industrial quantities of plasmid DNA, where plasmids of a type resulting in high copy numbers are desired.
- High-copy-number recombinant plasmids are those of a type which occur somewhere on the order of about 50 to several hundreds of plasmid copies per bacterial cell.
- the asd gene as the plasmid-borne gene has another drawback. This drawback is related to the recent findings (Park, J.T. Molecular Microbiology (1995) 17:421- 426) that bacterial cells (e.g. E. coli) actually degrade approximately 50% of their peptidoglycan layer.
- the degradation product is a tripeptide consisting of L-alanine D-glutamate/mesodiaminopimelic acid, which is reused by the bacterial cells to form peptidoglycan thus conserving energy that the bacterial cell would have expended synthesizing new tripeptide components of peptidoglycan.
- this tripeptide is released into the culture medium and is available to be taken up by neighbouring bacterial cells for incorporation into their own peptidoglycan layer.
- the asd gene encodes the first enzyme in the biosynthesis ofthe amino acid mesodiaminopimelic acid (dap) which is already included in this tripeptide.
- bacterial cells can recycle their own peptidoglycan, and can secrete the tripeptide containing the replaced amino acid dap, there is no selective pressure on the plasmid- harboring bacterial cells to maintain their plasmids.
- the third group comprises methods wherein the plasmid-borne gene encodes a protein that has functional and structural counterparts in eukaryotic cells and/or is capable of acting upon a eukaryotic cell component.
- the use of such genes represents a major safety concern because ofthe potential for the proteins encoded by these genes to function in eukaryotic cells and because ofthe potential for integration ofthe gene itself into the eukaryotic genome by homologous recombination. Examples include genes encoding proteins involved in the vital function of DNA replication (single strand DNA binding protein; Porter, R.D. et al. BioTechnology (1990) 8:47) or a tRNA-related function (valine tRNA synthetase; Nilsson, J. and Skogman, G. BioTechnology (1986) 4:901-903).
- alanine racemase catalyses the conversion of L-alanine into D-alanine. Since eukaryotic cells contain L-alanine as a natural component of their biochemical make-up, the use of alanine racemase can interfere with the biochemical reactions involved in L-alanine biosynthesis in eukaryotic cells and could lead to the formation of an amino acid (D-alanine) that does not naturally exist in eukaryotic cells.
- the invention provides recombinant systems for production of large quantities of desired DNA, and in particular DNA that can be safely introduced into eukaryotes.
- the systems ofthe present invention offer advantages of efficiency and safety over art- known methods.
- the invention is directed to culture systems and the components thereof which are designed for stable, high-level production of recombinant plasmids.
- bacterial cells are employed wherein the bacterial cell chromosome is irreversibly modified to effect production ofa substance toxic to the bacterial cells.
- the bacterial cells are modified to contain recombinant plasmids wherein the recombinant plasmids include genetic material that effects production of a second substance which neutralizes the toxicity ofthe first substance that would otherwise be toxic to the cells under the cell culture system conditions.
- the invention is directed also to the bacterial cells and plasmids useful in this cell culture system, and to methods to produce high levels of desired DNA using these materials
- the plasmids employed in this system may further include a foreign DNA operatively linked to control sequences functional only in eukaryotes, whereby the foreign DNA is expressed in eukaryotic cells, but not in prokaryotic cells.
- the invention in a second aspect, relates to cell culture systems for the stable, high-level production of recombinant plasmids wherein the bacterial cell chromosome ofthe bacteria in these cultures is irreversibly modified so as to render the cell incapable of producing an essential metabolite and also incapable ofthe uptake ofthe metabolite from the culture medium.
- the recombinant plasmid used in this system is a plasmid which includes genetic material which restores either the ability to synthesize the metabolite or the ability to take up the metabolite from the medium or both.
- This aspect ofthe invention also includes the bacterial cells and plasmids which are components ofthe cell culture system and methods to produce large quantities of DNA using the system.
- the plasmids may also be modified to contain a foreign DNA operably linked to control sequences functional only in eukaryotes, so that the foreign DNA is expressed in eukaryotic cells, but not in prokaryotic cells.
- the invention provides a culture system for stable and high-level production of recombinant plasmids for DNA immunization and gene therapy, comprising genetically engineered bacterial cells and recombinant plasmids.
- the bacterial cell chromosome is irreversibly altered and the bacterial cells are propagated under conditions such that the viability ofthe bacterial cells is dependant on the recombinant plasmid.
- the recombinant plasmid includes genetic material which functionally complements the chromosomal alteration, but the genetic material has no functional or structural equivalent in eukaryotic cells and does not produce any protein capable of acting upon any eukaryotic cell component.
- the protein encoded by the compensating genetic material, or any product thereof, is also incapable of being secreted by, or produced at levels toxic for, the bacterial cells.
- the recombinant plasmid is also adapted to include foreign DNA operatively linked to control sequences functional only in eukaryotes so as to effect expression ofthe foreign DNA only in eukaryotic cells, but not in prokaryotes.
- the invention is also directed to the bacterial cells and high-copy-number plasmids used in this cell culture system, as well as to methods to stably prepare foreign DNA for administration to eukaryotes using this system.
- the invention is directed to methods to provide a desired foreign DNA to eukaryotic cells or a eukaryotic subject which method comprises contacting said cells or administering to said subject DNA prepared by the methods of the invention, or administering to the subject the bacterial cells containing the desired DNA.
- Figure 1 shows the construction of recombinant plasmid pCB237.
- Figure 2 shows the construction of a genetically engineered bacterial strain (CB 101 E. coli) having a deletion in the chromosomal galE and galT genes.
- Figure 3 is a schematic showing the cloning ofthe murF gene.
- Figure 4 shows the construction ofthe recombinant plasmid pCB243.
- Figure 5 shows the construction of a genetically engineered bacterial strain (CB1031 E. coli) having a deletion in the chromosomal murF gene.
- Figure 6 is a diagrammatic representation ofthe construction of plasmids containing the murF gene.
- Figure 7 shows plasmid yields for pMO106 produced in a /wi/rE-deficient strain at 42°C.
- Figure 8 shows the stability of pMO106 in TKL-50 cells.
- Figure 9 shows the in vitro transfection efficiency ofa vector containing murF.
- Figure 10 is a graphic representation of ELISA titers obtained from vectors containing antigens with and without the murF gene.
- Figure 11 shows the nucleotide sequence ofthe temperature-sensitive murF gene derived from TKL-46.
- the present invention provides culture systems which permit the stable production of a desired DNA
- the desired DNA will be a foreign DNA whose expression in a eukaryotic cell is desired either for immunization or genetic therapy
- This "expression" includes simple transcription as well as production of polypeptides
- the foreign DNA for use in eukaryotes may be employed in antisense therapy, as well as in genetic therapy involving production of therapeutic proteins or markers
- the amplified replicated DNA may be recovered and administered in the form of a pharmaceutical composition using standard formulation techniques Suitable formulations for administering DNA include various excipients, for example, liposomes, dendrimers, aquasomes, cochleates, isotonic saline or PBS
- Suitable formulations for administering DNA include various excipients, for example, liposomes, dendrimers, aquasomes, cochleates, isotonic saline or PBS
- the DNA can also be recovered and ligated into a retroviral vector
- the bacterial cells themselves containing the replicated DNA can be administered to a eukaryotic subject.
- the cells are chosen or manipulated so as to have the appropriate features which will permit the included DNA to locate in the nucleus of, for example, macrophage, so that expression ofthe foreign DNA may be effected
- the prokaryotes administered must be able to exit the lysosome, disintegrate, and permit the DNA to enter the nucleus
- Some bacterial hosts, such as Shigella and Listeria strains are innately capable of effecting these results.
- vaccines which involve simply "naked DNA" have also been used successfully.
- administration ofthe DNA is by injection; typically, intravenous, intramuscular, intradermal or subcutaneous Administration may also be intranasal or oral, or by a particle bombardment technique
- any effective systemic means of administration may be employed
- All ofthe culture systems ofthe invention rely on complementation of a destructive feature found in the bacterial chromosome by the effect of genetic material contained on a plasmid which is itself to be stably replicated in the bacterial culture
- the bacterial chromosome produces a substance toxic to the bacterial cells and this substance is counteracted by a substance produced by genetic material on the plasmid.
- the bacterial chromosome is modified so as to render the cell incapable of producing an essential metabolite and also incapable ofthe uptake of this metabolite from the culture medium, and the recombinant plasmid restores one or both of these abilities.
- an additional desired DNA sequence to be amplified may be included in the plasmid; in addition, this desired DNA may be operably linked to control sequences for expression exclusively in eukaryotic cells.
- the invention employs genetically engineered bacterial cells, the native chromosomal genome of which has been irreversibly altered. The alteration may consist of a modification of one or more chromosomal genes which alone or in combination are essential for cell viability in the conditions under which the bacterial cells are propagated or may consist ofthe insertion of one or more foreign genes that are detrimental to bacterial cell viability under such conditions.
- the bacterial cells are then further modified by inclusion of a recombinant plasmid, preferably a high-copy-number recombinant plasmid (a type which occurs in a relatively high number of copies, from 50 to several hundred, per plasmid-harbouring bacterial cell).
- the recombinant plasmid is constructed to include genetic material which complements the above-mentioned chromosomal alteration. The introduction of the recombinant plasmid into the bacterial cells restores viability ofthe bacterial cells and ensures that only bacterial cells harbouring the recombinant plasmid can survive.
- the complementary genetic material must relate to one or more genes that have no functional or structural equivalent in the eukaryotic cells which are to be treated with the plasmid DNA.
- the complementary genetic material must not encode a polypeptide (or produce an mRNA) capable of acting upon any cell component ofthe eukaryotic cells which are to be treated with the plasmid DNA.
- any factors or materials produced as a result ofthe presence ofthe complementary genetic material must be incapable of being secreted by, or of being produced at levels which are toxic for, the genetically engineered bacterial cells.
- the complementary genetic material serves to ensure structural and genetic stability ofthe genetically engineered bacterial cells, by exerting selective pressure for survival only of plasmid-harbouring bacterial cells.
- the plasmid is preferably, but not necessarily, a high-copy number plasmid.
- the genetically engineered bacterial cells can be used to produce large quantities ofthe plasmid DNA containing the foreign gene(s) for use in DNA immunization and gene therapy, including antisense therapy.
- the foreign genes preferably are incapable of being expressed in the genetically engineered bacterial cells, so as to avoid unnecessary metabolic burden or cell toxicity. This can be accomplished by operatively linking each foreign gene to a promoter functional only in eukaryotes.
- the plasmid DNA can be used in DNA immunization and/or gene therapy.
- the plasmid DNA can be used for in vivo treatment, to convey one or more desired foreign genes to a eukaryotic host
- the foreign gene may be a mammalian gene encoding a polypeptide required for the health or survival ofa treated mammal.
- the foreign gene may be a viral gene encoding a polypeptide against which it is desired to induce immunity in a treated animal.
- the expression system contained in the recombinant plasmid may produce an antisense mRNA for therapeutic treatment.
- Other examples will be apparent to those skilled in the art.
- the invention will now be further described with reference to various preferred embodiments. However, the invention is not restricted to these embodiments, and one skilled in the art will readily appreciate alternative embodiments within the scope ofthe description ofthe features ofthe invention.
- Peptidoglycans are cell wall structures unique to bacterial cells. Accordingly, some ofthe genes encoding enzymes responsible for the biosynthesis or assembly of the peptidoglycan layer are excellent candidates for use as marker genes in recombinant plasmids intended for use in DNA immunization and gene therapy.
- the peptidoglycan layer consists of several adjacent chains. Each chain consists of alternating units of N-acetylmuramic acid (NAM) and N-acetylglucosamine (NAG) residues. Certain NAM residues on each chain are attached to a tetrapeptide whose composition varies slightly depending on whether the bacteria is Gram positive or Gram negative.
- the adjacent peptidoglycan chains are linked together by a peptide bond that links the third amino acid, diaminopimelic (dap), of one tetrapeptide to the fourth amino acid, D-alanine, ofthe tetrapeptide attached to the NAM residue on the adjacent chain.
- the amino acid D-alanine is a unique component ofthe peptidoglycan of all bacteria. This amino acid is synthesized from L-alanine by the action ofthe enzyme designated alanine racemase (air). The formation of this latter peptide linkage is crucial to bacterial cell viability since in its absence the bacterial cells lyse in commonly used bacterial growth media.
- Tetrapeptide formation requires the action of two different sets of genes, namely those that encode enzymes required for the biosynthesis ofthe individual amino acids ofthe tetrapeptides (e.g. enzymes required for biosynthesis of L-alanine, D-glutamic acid, dap and D-alanine) and those that are required for the sequential addition and ligation of these amino acids to one another to form the tetrapeptide.
- the latter enzymes are called amino acid-adding enzymes.
- the tetrapeptide sequence in the N- C direction is L-alanine D-glutamic acid/diaminopomelic acid (dap)/D-alanine.
- the series of amino acid-adding enzymes comprises the L-Ala adding enzyme that adds the amino acid L-alanine to the polysaccharide chain; the enzyme that adds the amino acid D-glutamic acid to the polysaccharide-linked L-alanine (murD) the enzyme that adds the amino acid dap to the L-alanine/D-glutamic acid dipeptide (murE), and the enzyme that adds D-alanine to the L-alanine/D-glutamic acid/dap tripeptide (murF).
- a system for production of plasmid DNA suitable for use in DNA immunization and gene therapy can be constructed by genetically engineering bacterial cells so as to render nonfunctional a chromosomal gene encoding one ofthe amino acid-adding enzymes (e.g. the murF gene).
- the viability ofthe genetically engineered bacterial cells is ensured by inclusion of a recombinant plasmid on which is cloned a functional murF gene.
- Temperature-sensitive bacterial cells are known that contain a mutation in the gene encoding one ofthe amino acid-adding enzymes (e.g. murF). These cells cannot grow at nonpermissive temperatures, although they can synthesize the individual amino acid components ofthe tetrapeptide. The inability of these mutants to grow at nonpermissive temperatures is due to the fact that they cannot assemble a complete and functional tetrapeptide at this temperature. Thus, additional suitable bacterial host cells for use in the cell cultures ofthe present invention would include such existing strains cultured at nonpermissive temperatures.
- the murF gene in the resulting system comprising genetically engineered bacterial cells including complementary recombinant plasmids.
- the murF enzyme is an intracellular and nondifrusible protein, and does not generate a product that is either toxic or secreted. Thus reduction in the number of plasmid-harbouring bacterial cells because ofthe cross- feeding effect described previously is avoided.
- the murF gene is unique to bacterial cells and has no functional or structural counterpart in eukaryotic cells, as demonstrated specifically for human cells below.
- the murF gene has no substrate in eukaryotic cells.
- the murF-based system is safe for use in DNA immunization and gene therapy.
- any ofthe four amino acid-adding enzymes discussed above can be used as the basis for the complementation system useful in the present invention.
- any one of these amino acid-adding enzymes can be chosen, there is a hierarchy which leads to a preferential selection of murF > murE > murD > L- Ala- adding enzyme. This is an efficiency-based consideration grounded in the manner in which cell wall degradation occurs when bacteria divide.
- a second embodiment depends on rendering nonfunctional a chromosomal gene encoding an enzyme responsible for the synthesis of an amino acid that is present naturally in commonly used bacterial media used in an industrial setting.
- a chromosomal gene alteration is not a practical method for enhancing recombinant plasmid stability nor for high-level production of plasmid DNA.
- this approach can be used for stable plasmid DNA production on an industrial scale.
- a chromosomal gene (designated lysA) which encodes an enzyme essential for the synthesis ofthe amino acid lysine is rendered nonfunctional.
- a second chromosomal gene (designated lysP) encoding a permease protein that is responsible for uptake of that amino acid from the environment or growth medium is also rendered nonfunctional.
- lysP a permease protein that is responsible for uptake of that amino acid from the environment or growth medium.
- a genetically engineered bacterial cell that is defective in lysine uptake (due to a nonfunctional chromosomal lysP gene) and lysine biosynthesis (due to a nonfunctional chromosomal lysA gene) transformed with a recombinant plasmid carrying a functional or equivalent of lysA gene provides an efficient system for stable and high level production of plasmid DNA for DNA immunization and gene therapy.
- the plasmid-borne complementation gene in this example is the lysA gene since it is known that lysA gene has no structural or functional counte ⁇ art in eukaryotic cells Furthermore, the lysA enzyme encoded by the lysA gene has no substrate in eukaryotic cells and as such this enzyme cannot function in eukaryotic cells even if it is expressed therein. Since lysine is an essential amino acid for all living microorganisms, including both Gram positive and Gram negative bacteria, this system provides a practical and versatile system for stable and high level production of plasmid DNA in any bacterial cell.
- selective pressure is maintained by using a postsegregational killing mechanism.
- the naturally occurring E. coli plasmids Rl and F contain genetic loci appropriate for this approach
- this locus is parB (Gerdes, K. et al. PNAS (1986) 83:3116-3120; Rasmussen, P.B. et al. Mol Gen Genetics (1987) 209: 122-128).
- the F plasmid this locus is Flm (Loh, S.M. et al., Gene (1988) 66:259-268).
- Both X eparB and Flm loci consist of two small genes referred to as the hok (host killing) and sok (suppressor of host killing) genes in the case o ⁇ parB, and flmA (host killing) and flmB (suppressor of host killing) in the case ofthe F plasmid.
- the hok and flmA genes are analogous in structure and function
- this hok and flmB genes are analogous in structure and function.
- the hok and flmA gene products are small hydrophilic proteins (52 amino acids) that are potent host killing factors.
- the expression of hok gene is regulated by a small (about 100 base pairs) RNA molecule transcribed from the sok gene and which acts as an antisense RNA complementary to the mRNA ofthe hok gene
- the expression of the flmA gene is regulated by an approximately 100-base pair RNA molecule transcribed from the flmB gene which acts as an antisense RNA complementary to the mRNA of t e flmA gene
- the hok and flmA mRNAs are highly stable, whereas the sok and flmB RNAs are rapidly degraded It is the differential stability ofthe two RNA species in each case which results in the mechanism of bacterial cell killing.
- hok and sok genes or of the flmA and flmB genes can be used to advantage in constructing a system for use in plasmid DNA production for use in DNA immunization and gene therapy.
- the utility of these systems could be hampered by the potential for killing eukaryotic cells such as those of mammalian hosts injected with plasmid DNA containing the hok/sok o ⁇ flmAlflmB combination during DNA immunization or gene therapy.
- sok gene (100 bp) or flmB gene (100 bp) is included in the recombinant plasmid, whereas the hok gene o ⁇ flmA gene is integrated in the bacterial cell chromosome.
- a bacterial strain is genetically engineered in which the gene encoding the hok o ⁇ flmA protein is inserted in a non-essential region ofthe bacterial chromosome (e.g. in the lacZ gene). Genetically engineered bacterial cells are then transformed with a recombinant plasmid in which the only marker is the corresponding sok o ⁇ fl B gene.
- the sok or flmB gene on the recombinant plasmid serves to regulate the expression ofthe hok or flmA gene and the bacterial cell thrives.
- the recombinant plasmid carrying the sok o ⁇ flmB gene is lost, the bacterial cell dies because ofthe killing factor produced by the chromosomal hok o ⁇ flmA gene.
- This system offers the following specific advantages for production of plasmid DNA.
- First, the system is not limited in its use to a particular bacterial strain.
- recombinant plasmids which can serve as a vector for foreign DNA
- the recombinant plasmid includes DNA complementary to the altered (i.e. added or rendered nonfunctional by modification, deletion, or inactivation) chromosomal DNA and which accordingly serves as a marker for presence or absence ofthe recombinant plasmid, as well as selective pressure to maintain the recombinant plasmid in the genetically engineered bacterial cell.
- the peptidoglycan layer is absolutely required for bacterial cell viability under ordinary circumstances, as it protects the fragile cytoplasmic membrane from osmotic shock.
- bacterial cells that have a defect in peptidoglycan synthesis can still survive in certain types of media such as those supplemented with sodium chloride or sucrose.
- the reason for the ability of these bacterial cells to survive in these types of media is attributed to the action of these supplementary compounds as osmotic stabilizers or due to their ability to induce colanic acid production which acts as an osmotic stabilizer.
- bacterial cells are genetically engineered so as to be absolutely dependent on the presence of an intact peptidoglycan layer regardless ofthe type of media in which the bacterial cells are grown.
- the ability of these bacterial cells to synthesize colanic acid is, in this embodiment, abolished in addition to introducing a mutation or a deletion that results in a defective peptidoglycan assembly.
- Colanic acid is a polymer composed of glucose, galactose, fucose, and glucuronic acid. Since galactose is one ofthe colanic acid components, one way to abolish the ability of bacterial cells to produce colanic acid is to inhibit the ability of bacterial cells to synthesize and utilize galactose.
- this is achieved by introducing irreversible deletions in the galE and galT chromosomal genes involved in galactose utilization.
- the resulting bacterial strain is then subjected to a deletion in the murF chromosomal gene to produce a strain whose viability is dependent on complementation with a recombinant plasmid carrying a functional murF gene, as follows:
- the JM105 E. coli strain containing a deletion in the galE and galT genes was constructed.
- two oligonucleotide primers upstream and downstream
- the upstream primer (designated gal- 3) corresponded to the 5' end ofthe galE gene and had the following nucleotide sequence:
- the downstream primer corresponded to the 3' end ofthe galT gene and had the following nucleotide sequence: 5 'gctctagatctgccagcatttcataaccaa3 ' .
- pTZ18 plasmid containing the galE and galT genes was designated pCB233.
- FIG. 1 An internal deletion within galE and galT genes was constructed as further illustrated in Figure 1.
- a pTZ18 plasmid was cut with Hindlll enzyme, treated with Klenow enzyme, and self-ligated to produce plasmid pCB234 in which the Hindlll site no longer existed.
- Plasmid pCB233 was cut with EcoRI and PstI enzymes to retrieve a DNA fragment encompassing the entire galE and galT genes. This latter fragment was ligated into pCB234 that was also cut with EcoRI and PstI enzymes. The ligation event led to the isolation ofa plasmid designated pCB235.
- Plasmid pCB235 was cut with Hindlll and Ncol enzymes to delete an internal portion ofthe nucleotide sequence within the galE and galT sequences, treated with Klenow enzyme, and then self-ligated to produce plasmid pCB236.
- Plasmid pCB236 was cut with EcoRI and PstI enzymes to retrieve the shortened galE and galT genes. The DNA fragment encompassing the shortened galE and galT genes was treated with T4 DNA polymerase enzyme.
- the suicide vector plasmid designated pCVD442 was cut with Xbal enzyme and then treated with Klenow enzyme.
- Plasmid pCB237 was then transformed into E. coli SM10 and the latter bacterial cells containing pCB237 were selected for further use as described below.
- the galE and galT deletions were introduced into JM105 E. coli as illustrated in Figure 2.
- SM10 bacterial cells carrying plasmid pCB237 were used to transfer the irreversibly nonfunctional (i.e. with internal deletion) galE and galT genes into E. coli strain JM105 by the conjugation protocol described by Donnenberg, M. and Kaper, J Infection and Immunity (1990) 59:4310-4317.
- the inco ⁇ oration ofthe irreversibly nonfunctional galE and galT genes into the chromosome of JM105 bacterial cells and the replacement of full-length wild type galE and galT genes ofthe latter bacterial cells with the irreversibly nonfunctional galE and galT genes was verified by PCR analysis of JM105 chromosomal DNA.
- the JM105 E. coli bacterial strain containing an internal deletion in galE and galT genes was designated CB101.
- the murF gene appears to be transcribed under the control ofthe murE promoter, consequently the above PCR primers were designed so as to allow inframe fusion ofthe murF coding sequence to the murE promoter.
- the murE gene including its promoter element was isolated from JM105 E. coli using PCR primers designated murEl and murE2.
- the nucleotide sequences of these primers were as follows:
- the murE gene was cloned into plasmid pBR322 to produce a plasmid designated pCB238.
- the murF gene was amplified from JM105 bacterial cells using primers murFl and murFl. Plasmid pCB238 was digested with Nrul enzyme to remove the murE gene coding sequence, leaving behind the murE promoter sequences.
- the amplified murF gene was then ligated to the plasmid pCB238 that had been digested with Nrul enzyme and the resulting plasmid was designated pCB239 Plasmid pCB239 is digested with appropriate enzymes to excise a DNA fragment encompassing the murE promoter fused to the murF gene, and the fragment is then cloned into plasmid pACYC184 to produce plasmid pCB240.
- an E. coli strain with an irreversible alteration (i.e. deletion) in its murF gene a plasmid in which a deleted murF gene is cloned along with DNA sequences derived from upstream and downstream flanking sequences is constructed.
- an oligonucleotide primer is designed based on the known sequences ofthe murE gene (upstream of murF gene) and a second oligonucleotide primer is designed on the basis ofthe known sequence ofthe OrjY gene (downstream ofthe murF gene).
- the upstream primer is designated murEl and had the following nucleotide sequence.
- the downstream primer is designated OrjY-1 and has the following nucleotide sequence: 5'taacgccagcgaacctacatc3'.
- Primers murEl and Orf ⁇ -1 axe used in the PCR reaction to amplify the murF gene with flanking sequences derived from the murE and the Orfy gene.
- the amplified DNA fragment is cloned in plasmid pBR322 to produce plasmid pCB241.
- Plasmid pCB241 is digested with appropriate enzymes to remove most of the murF gene leaving only a small portion of the murF gene sequence flanked by a sequence derived from the murE gene on one side and a sequence derived from the Orf ⁇ gene on the other side. Following digestion, the plasmid is self-ligated to produce plasmid pCB242.
- the DNA fragment encompassing the sequences derived from the murE part of murF and OrjY genes is retrieved from plasmid pCB242 by digestion ofthe latter with appropriate enzymes.
- the DNA fragment carrying the latter sequences is then ligated into the suicide vector pCVD442 and transformed into SY327 E. coli cells.
- the latter bacterial cells are used to prepare plasmid pCVD442 containing the flanking sequences and this latter plasmid is designated pCB243
- Plasmid pCB243 is then transformed into E. coli SM10 cells to produce a population of bacterial cells suitable for use in transfer ofthe murF deletion into the E. coli strain CBlOl.
- SM10 bacterial cells carrying plasmid pCB243 are used to transfer the irreversibly nonfunctional (i.e. with intemal deletion) murF gene into E. coli strain CBlOl transformed with plasmid pCB240 by the conjugation protocol described above (Donnenberg and Kaper 1990).
- the inco ⁇ oration ofthe i ⁇ eversibly altered murF gene into the chromosome of CBlOl bacterial cells and the replacement of full-length wild type murF gene ofthe latter bacterial cells with the irreversibly altered murF gene is verified by PCR analysis of CBlOl chromosomal DNA.
- the CBlOl bacterial strain containing an intemal deletion in the murF gene is designated CB 102.
- Bacterial strain CB102 can then be transformed with plasmid pCB239 to displace plasmid pCB240.
- Bacterial strain CB102 carrying plasmid pCB239 is designated CB 103.
- Certain temperature-sensitive bacterial cell mutants containing a mutation in the murF gene can grow at 30°C, but cannot grow at the nonpermissive temperature of 42°C.
- the inability of these mutants to grow at nonpermissive temperatures is due to the fact that they cannot assemble a complete and functional cell wall tetrapeptide due to the mutation in the murF gene.
- These mutants can be used as bacterial hosts in the cell culture systems ofthe invention.
- a system for production of recombinant plasmids suitable for use in DNA immunization and gene therapy can thus be constructed by inclusion, in these temperature-sensitive bacterial cells (e.g. E. coli strain TKL-46 or its derivatives), of a recombinant plasmid containing a murF gene functional at 42°C. By growing the bacterial cells at 42°C, only cells carrying the recombinant plasmid can survive.
- a more preferred derivative of TKL-46, useful as a host was prepared.
- E. coli strain TKL-46 (Lugtenberg et al, J Bacteriology (1972) 110:35-40) was obtained from Coli Genetic Stock Center (CGSC).
- TKL-46 bacterial cells were first grown at 30°C in LB broth containing the antibiotic nalidixic acid to select for a nalidixic acid-resistant strain, designated TKL-47.
- TKL-47 cells were rendered recA- negative by conjugation with the (nalidixic acid-sensitive, recA -negative) bacterial strain JC 10240 in order to abolish the ability ofthe cells to perform homologous recombination. Thus their chromosomes will not acquire any genetic material from introduced plasmid DNA.
- RecA -negative cells derived from TKL-47 cells were designated TKL-48.
- TKL-48 bacterial cells were grown at 30°C and then used for preparation of competent bacterial cells. Competent TKL-48 bacterial cells are transformed with plasmid pCB239 carrying a functional murF gene to produce a bacterial strain designated TKL-49. TKL-49 bacterial cells are then grown at 42°C as a method for recombinant plasmid maintenance and plasmid DNA production.
- additional improved forms are constructed by modifying the murF gene in the chromosomes of cells that have native qualities that are desirable. For example, some E. coli strains are deficient in enzymes, such as endonucleases which degrade plasmid DNA. If the chromosomes of these hosts can be altered to provide, for example, the temperature- sensitive form of murF, these hosts provide advantageous alternatives to TKL-48.
- the temperature-sensitive murF gene from TKL-46 was obtained by amplifying the appropriate sequence using PCR with murF3 and murFA as primers:
- CB102 or TKL-48 or other desired bacteria modified to contain the temperature-sensitive murF gene which have irreversible chromosomal mutations in the murF gene, rendering the gene or the encoded murF protein nonfunctional under the culture conditions employed, can be used as suitable hosts where the introduced plasmid has a murF gene functional under the culture conditions employed.
- the production levels can be compared to production of foreign DNA contained on plasmid pBR322 in which a marker gene encodes ampicillin.
- the chromosomal murE gene was PCR amplified from E. coli JM105 genomic DNA and cloned into the BamHl site of pUC 18
- the resulting plasmid, pMO 101 was cut with Nrul which removes most ofthe murE gene, except for the murE promoter and approximately 330 bp of the murE 3' end.
- the murF gene, amplified as described in Example 1, was ligated into the Nrul site of pMOlOl, and the ligation mixture transformed into E.
- coli JM109 Two plasmids, designated pMO102 and pMO106 were identified, which contain the murF coding sequence in opposite orientations pMO106 contains the murF gene in the correct orientation operably linked to the murE promoter and expresses the murF protein, pMO 102 contains the wrong orientation for murF, and thus does not express the gene.
- pMO102 and pMO106 A summary ofthe construction of pMO102 and pMO106 is shown in Figure 6
- pHW203 was constructed as a system for testing in vitro transfection efficiency into eukaryotic cells.
- pCMVB available from Clonetech, which contains the ⁇ -galactocidase gene under control of a promoter operable in mammalian cells was cut with EcoRI, treated with Klenow, and ligated with the BamHl, Klenow-filled fragment from pMOl 06 that contained the murF gene.
- the resulting plasmid was cut with BstHI to remove the ampicillin-resistance gene and religated.
- the religated product was transformed into TKL-48 and an isolated colony, containing the plasmid pHW203, the colony designated TKL-52, was used for large-scale production ofthe plasmid.
- the plasmid pCB253 was constructed in order to evaluate whether the murF gene had any effect on DNA immunization in eukaryotic hosts.
- the host plasmid, pSLRSVGIV.mdl, obtained from R. Braun contains the gene encoding glycoprotein IV (GIV) from bovine he ⁇ es virus under control ofthe Rous Sarcoma Virus promoter; therefore, this plasmid contains an expression system for production of an immunogen in vertebrates.
- the BamHl DNA fragment from pMO106 containing the murF gene under control ofthe murE promoter was ligated into the Msc site of pSLRSVGIV.mdl and the ligation mixture transformed into JM109 cells (obtained from New England Biolabs).
- the plasmid isolated from successful transformants was digested with BstHI to remove the ampicilllin resistance gene, religated and then transformed into TKL-48 to obtain the product plasmid pCB253.
- the pCB253 colony, designated TKL-51, was used for large-scale preparation of this plasmid.
- TKL-48 was transformed with pMO102, pMO 106, pCB253 or pHW203 by mixing competent cells with plasmid DNA and incubating on ice for 30 min. The cells were then heat-shocked at 42°C for 90 sec and then incubated in 1 ml of LB broth at 30°C for 2 hrs. The cells were then plated on LB/0.1% thymine plates and incubated at 42°C overnight. The transformed cell lines obtained were designated as follows: pMO102 - TKL-49A; pMO106 - TKL-50; pCB253 - TKL-51; pHW203 - TKL-52.
- TKL-49A cells produce the murF gene product only 30°C, and they are used as a control to assess plasmid yield in the presence of ampicillin as the selectable marker at 30°C. Plasmid yield could be assessed at 42°C without addition of ampicillin for the remaining cell lines.
- TKL-50, -51, and -52 cells were used to assess plasmid yield when cells are grown at 42°C without addition of ampicillin, TKL-49A cells were used as controls.
- Single colonies from LB/thymine plates were picked and inoculated into 2 ml of TB/thymine broth and incubated for 6 hr at 42° (30°C in presence of ampicillin for TKL-49A). Cells were then inoculated into 10 ml TB/thymine broth, grown for four more hours, then inoculated into 250 ml of TB/thymine broth and grown for an additional 12 hr.
- Plasmids were extracted from cells using Quiagen columns as recommended by the manufacturer, and plasmid yield determined by calculating O.D. 260 and 280. Purity of plasmids was determined by analysis of plasmid aliquote on agarose gels.
- Plasmid yield was also determined in a 10-liter fed-batch oxygen enriched fermentation in a 14-liter NBS Microferm apparatus, in TB broth supplemented with 0.01% thymine at agitation speed of 200 ⁇ m, aeration flow of 0.6WM (6 l/min, 5 psig) and pH maintained at 7.2. Plasmid yield was determined following extraction of plasmid DNA from aliquots of culture medium using the Quiagen column method.
- Yield of pCB253 is the average of two fermentations for p 0102 and pMO106. Yield of pCB253 is derived from one fermentation run.
- Figure 7 shows the absolute and specific plasmid yield determined for plasmid pMO106 produced in TKL-50 strain.
- Stability of plasmid pMO106 in TKL-50 strain was assessed over 170 generations of growth under different selection pressures for plasmid maintenance as follows. Cells were grown in TB/0.1% thymine broth at either 30°C or 42°C. Samples were taken after different numbers of generations at the relevant temperature, diluted and plated on TB/thymine plates and incubated at 30°C. Colonies were then replicated onto TB/thymine/ampicillin plates and incubated at 30°C or 42°C. The percent of plasmid-containing cells was determined by comparing the number of colonies growing in the presence and absence of ampicillin at 30°C or 42°C. Presence of plasmids was further verified by the small scale alkaline lysis method for plasmid preparation.
- Plasmid pMO106 was gradually lost from cells grown at 30°C, but was retained in 100% ofthe cells grown at 42°C for 170 generations of growth as shown in Figure 8. The integrity of plasmid pMO106 was confirmed by restriction analysis.
- TKL-49A cells were also tested by growing in the presence of ampicillin at 30°C; plasmid pMO102 was retained in 100% ofthe cells for 120 generations.
- Plasmid pCMVB and pHW203, described above were used in this assay. 2 ⁇ g of each plasmid were mixed separately with varying amounts of lipofectamine (Gibco/BRL) and transfected into the mouse fibroblast L-929 cells according to the manufacturer's recommendation. The efficiency of transfection was determined in an X-gal colorometric assay by counting the number of cells expressing ⁇ -galactosidase relative to the total number of cells per well.
- mice were immunized twice (two weeks apart) intramuscularly with 100 ⁇ g each of either plasmid pCB253, pSLRSVGIV.mdl (described above) or with a null vector. At one and three weeks following the second injection, the mice were bled and their sera analyzed for the presence of antibodies specifically immunoreactive for the GIV glycoprotein using an ELISA assay. Similar antibody titers were found in both cases, as shown in Figure 10.
- human genomic DNA purchased from Promega Co ⁇ oration was digested with EcoRI and BamHl and spiked with pMO 106 cut with BamHl. The genomic DNA was electrophoresed in 0.7% agarose gels along with the BamHl fragment containing the murF gene from pMO106, the murF gene coding sequence per se, and an EcoRI linearized plasmid pMO106. After transfer to nylon membranes using capillary transfer, the DNAs were fixed by ultraviolet light cross-linking according to the manufacturer's instructions.
- the membranes were prehybridized for 8 hours in 6xSSC, 0.5% sodium dodecosulfate at 50°C and then hybridized for 12 hours with 32 PdCTP labeled full-length murF UN A probe.
- the blots were washed twice in 2xSSC, 0.5% SDS for 30 minutes at 22°C, followed by two washings for 30 minutes in lxSSC, 0.5% SDS at 50°C. After drying and exposure to X-ray films for 16 hours-2 weeks, no hybridization signal with human genomic DNA was detected.
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP9515377A JPH11513562A (ja) | 1995-10-17 | 1996-10-17 | 組換えプラスミドの生産方法 |
| AT96933294T ATE247713T1 (de) | 1995-10-17 | 1996-10-17 | Verfahren zur herstellung von rekombinanten plasmiden |
| EP96933294A EP0856059B1 (en) | 1995-10-17 | 1996-10-17 | Methods for production of recombinant plasmids |
| AU72088/96A AU7208896A (en) | 1995-10-17 | 1996-10-17 | Methods for production of recombinant plasmids |
| DE69629576T DE69629576T2 (de) | 1995-10-17 | 1996-10-17 | Verfahren zur herstellung von rekombinanten plasmiden |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US54805995A | 1995-10-17 | 1995-10-17 | |
| US56497395A | 1995-11-30 | 1995-11-30 | |
| US08/564,973 | 1995-11-30 | ||
| US08/548,059 | 1995-11-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO1997014805A2 true WO1997014805A2 (en) | 1997-04-24 |
| WO1997014805A3 WO1997014805A3 (en) | 1997-06-12 |
Family
ID=27068752
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA1996/000693 Ceased WO1997014805A2 (en) | 1995-10-17 | 1996-10-17 | Methods for production of recombinant plasmids |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US5922583A (enExample) |
| EP (1) | EP0856059B1 (enExample) |
| JP (1) | JPH11513562A (enExample) |
| AT (1) | ATE247713T1 (enExample) |
| AU (1) | AU7208896A (enExample) |
| CA (1) | CA2232234A1 (enExample) |
| DE (1) | DE69629576T2 (enExample) |
| TW (1) | TW514667B (enExample) |
| WO (1) | WO1997014805A2 (enExample) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000028048A1 (en) * | 1998-11-09 | 2000-05-18 | Genecare Development Aps | Novel plasmids for use in medicine and method of producing same |
| US6423545B1 (en) * | 1999-07-08 | 2002-07-23 | Albert Einstein College Of Medicine Of Yeshiva University | Unmarked deletion mutants of mycobacteria and methods of using same |
| WO2005052167A3 (en) * | 2003-11-20 | 2005-07-28 | Cobra Biolog Ltd | Plasmid maintenance |
| EP1362110B1 (en) * | 2001-02-23 | 2012-09-12 | Université Libre de Bruxelles | Method for the selection of recombinant clones comprising a sequence encoding an antidote protein to a toxic molecule |
| US8318497B2 (en) | 2002-09-03 | 2012-11-27 | Universite Libre De Bruxelles | Reversible, parallel and multitask cloning method and kit |
| US9309518B2 (en) | 2002-09-03 | 2016-04-12 | Universite Libre De Bruxelles | Reversible, parallel and multitask cloning method and kit |
| US9333227B2 (en) | 2013-08-19 | 2016-05-10 | Syngulon Sa. | Controlled growth of microorganisms |
| US11932672B2 (en) | 2017-12-19 | 2024-03-19 | Syngulon S.A. | Fermentation process |
Families Citing this family (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BE1006085A3 (fr) * | 1992-07-31 | 1994-05-10 | Univ Bruxelles | Vecteur de clonage. |
| CA2327387C (en) * | 1998-05-07 | 2012-07-03 | Gx Biosystems A/S | Cytotoxin-based biological containment |
| DE69935927T2 (de) * | 1998-12-02 | 2008-01-10 | University Of Maryland, Baltimore | Plasmidstabilisierungssystem für die verabreichung von antigenen |
| US8076130B2 (en) * | 1998-12-02 | 2011-12-13 | University Of Maryland, Baltimore | Plasmid maintenance system for antigen delivery |
| US6413768B1 (en) | 1998-12-02 | 2002-07-02 | University Of Maryland | Expression plasmids |
| EP1111061A1 (en) * | 1999-12-20 | 2001-06-27 | Universite Libre De Bruxelles | Double selection vector |
| US9012141B2 (en) * | 2000-03-27 | 2015-04-21 | Advaxis, Inc. | Compositions and methods comprising KLK3 of FOLH1 antigen |
| US20030194798A1 (en) * | 2001-05-24 | 2003-10-16 | Surber Mark W. | Minicell compositions and methods |
| US7396822B2 (en) | 2001-05-24 | 2008-07-08 | Vaxiion Therapeutics, Inc. | Immunogenic minicells and methods of use |
| US20030207833A1 (en) * | 2002-02-25 | 2003-11-06 | Neil Berkley | Pharmaceutical compositions with minicells |
| US20030224369A1 (en) * | 2002-02-25 | 2003-12-04 | Surber Mark W. | Reverse screening and target identification with minicells |
| US20030224444A1 (en) * | 2002-02-25 | 2003-12-04 | Sabbadini Roger A. | Antibodies to native conformations of membrane proteins |
| CA2477194A1 (en) * | 2002-03-19 | 2003-09-25 | Universite Libre De Bruxelles | Poison/antidote genetic systems for the selection of genetically modified eucaryote cells or organisms |
| US20040005700A1 (en) * | 2002-05-28 | 2004-01-08 | Surber Mark W. | Poroplasts |
| WO2006055024A2 (en) * | 2004-04-05 | 2006-05-26 | Vaxiion Therapeutics, Inc. | Minicells as vaccines |
| PT2942391T (pt) | 2004-08-13 | 2018-10-09 | Univ Pennsylvania | Métodos de produção de vacinas não resistentes aos antibióticos |
| TWI311152B (en) * | 2004-09-17 | 2009-06-21 | Boehringer Ingelheim Rcv Gmbh & Co K | Host-vector system for antibiotic-free cole1 plasmid propagation |
| CN1912127B (zh) * | 2005-08-08 | 2011-05-25 | 百瑞全球有限公司 | 一种大肠杆菌表达载体及其应用 |
| EP2333091B1 (en) | 2007-05-29 | 2017-06-21 | Nature Technology Corporation | Vectors and methods for genetic immunization |
| US9017660B2 (en) | 2009-11-11 | 2015-04-28 | Advaxis, Inc. | Compositions and methods for prevention of escape mutation in the treatment of Her2/neu over-expressing tumors |
| US9650639B2 (en) | 2008-05-19 | 2017-05-16 | Advaxis, Inc. | Dual delivery system for heterologous antigens |
| US20120135033A1 (en) * | 2008-05-19 | 2012-05-31 | Anu Wallecha | Multiple delivery system for heterologous antigens |
| US20110129499A1 (en) * | 2008-05-19 | 2011-06-02 | Paulo Maciag | Dual delivery system for heterologous antigens |
| JP5985397B2 (ja) * | 2009-11-11 | 2016-09-06 | アドバクシス インコーポレイテッド | 組換えリステリア株およびそれを含む免疫原性組成物 |
| US10016617B2 (en) | 2009-11-11 | 2018-07-10 | The Trustees Of The University Of Pennsylvania | Combination immuno therapy and radiotherapy for the treatment of Her-2-positive cancers |
| WO2012138377A2 (en) | 2010-10-01 | 2012-10-11 | Trustees Of The University Of Pennsylvania | The use of listeria vaccine vectors to reverse vaccine unresponsiveness in parasitically infected individuals |
| CA2827443C (en) | 2011-02-15 | 2021-07-06 | Vaxiion Therapeutics, Inc. | Therapeutic compositions and methods for antibody and fc-containing targeting molecule-based targeted delivery of bioactive molecules by bacterial minicells |
| CA2829960A1 (en) | 2011-03-11 | 2012-09-20 | John Rothman | Listeria-based adjuvants |
| WO2013138337A1 (en) | 2012-03-12 | 2013-09-19 | Advaxis | Suppressor cell function inhibition following listeria vaccine treatment |
| AU2013309488A1 (en) | 2012-08-29 | 2015-03-05 | Nature Technology Corporation | DNA plasmids with improved expression |
| WO2014077863A1 (en) | 2012-11-19 | 2014-05-22 | Nature Technology Corporation | Replicative minicircle vectors with improved expression |
| DK3456821T4 (da) | 2017-09-19 | 2024-04-15 | Deutsches Krebsforsch | Ikke-integrerende dna-vektorer til genetisk modifikation af celler |
| WO2019057774A1 (en) | 2017-09-19 | 2019-03-28 | Deutsches Krebsforschungszentrum | NON-INTEGRATING DNA VECTORS FOR THE GENETIC MODIFICATION OF CELLS |
| DK3768846T5 (da) | 2018-03-21 | 2024-08-19 | Aldevron L L C | Virale og ikke-virale nanoplasmidvektorer med forbedret produktion |
| WO2025160245A1 (en) | 2024-01-25 | 2025-07-31 | Aldevron, L.L.C. | Viral and non-viral nanoplasmid vectors with improved production |
| WO2025231315A2 (en) | 2024-05-03 | 2025-11-06 | Aldevron, L.L.C. | Bacterial host strains |
| WO2026076187A1 (en) | 2024-10-03 | 2026-04-09 | Aldevron, L.L.C. | Compositions and methods for microbial production of antibiotic-free closed-ended linear dna |
Family Cites Families (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4190495A (en) * | 1976-09-27 | 1980-02-26 | Research Corporation | Modified microorganisms and method of preparing and using same |
| US4968619A (en) * | 1976-09-27 | 1990-11-06 | Research Corporation | Modified microorganisms and method of preparing and using same |
| US5077044A (en) * | 1980-05-19 | 1991-12-31 | The Board Of Trustees Of The Leland Stanford Jr. University | Novel non-reverting shigella live vaccines |
| US4735801A (en) * | 1982-09-07 | 1988-04-05 | Board Of Trustees Of Leland Stanford Jr. University | Novel non-reverting salmonella live vaccines |
| US4550081A (en) * | 1980-05-19 | 1985-10-29 | The Board Of Trustees Of The Leland Stanford Jr. University | Non-reverting salmonella |
| US4837151A (en) * | 1980-05-19 | 1989-06-06 | The Board Of Trustees Of The Leland Stanford Junior University, Stanford University | Live vaccines comprising two mutations and foreign antigen |
| US5210035A (en) * | 1980-05-19 | 1993-05-11 | Board Of Trustees Of Leland Stanford Jr. University | Non-reventing live vaccines |
| US4888170A (en) * | 1981-10-22 | 1989-12-19 | Research Corporation | Vaccines obtained from antigenic gene products of recombinant genes |
| DK410783D0 (da) * | 1982-09-16 | 1983-09-09 | Benzon A Salfred | Fremgangsmade til stabilisering af plasmider |
| US5702916A (en) * | 1982-09-16 | 1997-12-30 | Gx Biosystems A/S | Biological Containment |
| FR2568891B1 (fr) * | 1984-08-09 | 1988-05-27 | Transgene Sa | Procede de preparation d'une souche, notamment de levure, transformee par un vecteur d'expression, qui peut etre cultivee sur un milieu complet sans pression de selection et souche ainsi obtenue |
| DK594084A (da) * | 1984-12-12 | 1986-06-13 | Novo Industri As | Fremgangsmaade til stabilisering af extra-chromosomale elementer i bakterier under dyrkning |
| GB2177097A (en) * | 1985-06-18 | 1987-01-14 | Genencor Inc | Stable maintenance of nucleic acid in recombinant cells |
| DK275685D0 (da) * | 1985-06-18 | 1985-06-18 | Benzon As Alfred | Stabilisering af biologiske systemer |
| US5294441A (en) * | 1987-06-04 | 1994-03-15 | Washington University | Avirulent microbes and uses therefor: salmonella typhi |
| US5387744A (en) * | 1987-06-04 | 1995-02-07 | Washington University | Avirulent microbes and uses therefor: Salmonella typhi |
| IL86583A0 (en) * | 1987-06-04 | 1988-11-15 | Molecular Eng Ass | Vaccine containing a derivative of a microbe and method for the production thereof |
| DE3853683T2 (de) * | 1987-10-07 | 1995-08-31 | Univ Washington | Verfahren zur erhaltung eines erwünschten rekombinanten gens in einer genetischen zellpopulation. |
| CA1339307C (en) * | 1988-09-06 | 1997-08-19 | Roy Curtiss, Iii | Oral immunization by transgenic plants |
| EP0465561A4 (en) * | 1989-03-31 | 1992-04-08 | Washington University | Avirulent microbes and uses therefor |
| ES2090129T3 (es) * | 1989-03-31 | 1996-10-16 | Univ Washington | Vacunas que contienen microorganismos tipo phop avirulentos. |
| JPH04504656A (ja) * | 1989-03-31 | 1992-08-20 | ワシントン ユニバーシティー | ボルデテラワクチン |
| US5399346A (en) * | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
| DE69032408T2 (de) * | 1989-11-03 | 1998-10-08 | Univ Washington | Kreuzschützende salmonella impfstoffe |
| ATE177787T1 (de) * | 1990-11-21 | 1999-04-15 | Univ Washington | Rekombinante avirulente salmonella antifruchtbarkeitsimpfstoffe |
| AU6705594A (en) * | 1993-04-15 | 1994-11-08 | Washington University | Compositions of antigen containing recombinant salmonella, their use in anti-malarial vaccines and method for their preparation |
-
1996
- 1996-10-16 US US08/732,612 patent/US5922583A/en not_active Expired - Fee Related
- 1996-10-17 AT AT96933294T patent/ATE247713T1/de not_active IP Right Cessation
- 1996-10-17 EP EP96933294A patent/EP0856059B1/en not_active Expired - Lifetime
- 1996-10-17 WO PCT/CA1996/000693 patent/WO1997014805A2/en not_active Ceased
- 1996-10-17 JP JP9515377A patent/JPH11513562A/ja not_active Ceased
- 1996-10-17 CA CA002232234A patent/CA2232234A1/en not_active Abandoned
- 1996-10-17 DE DE69629576T patent/DE69629576T2/de not_active Expired - Fee Related
- 1996-10-17 AU AU72088/96A patent/AU7208896A/en not_active Abandoned
- 1996-12-24 TW TW085115998A patent/TW514667B/zh not_active IP Right Cessation
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000028048A1 (en) * | 1998-11-09 | 2000-05-18 | Genecare Development Aps | Novel plasmids for use in medicine and method of producing same |
| US6423545B1 (en) * | 1999-07-08 | 2002-07-23 | Albert Einstein College Of Medicine Of Yeshiva University | Unmarked deletion mutants of mycobacteria and methods of using same |
| US20130280810A1 (en) * | 2001-02-23 | 2013-10-24 | Universite Libre De Bruxelles | Method for the selection of recombinant clones comprising a sequence encoding an antidote protein to toxic molecule |
| US8877504B2 (en) * | 2001-02-23 | 2014-11-04 | Universite Libre De Bruxelles | Method for the selection of recombinant clones comprising a sequence encoding an antidote protein to toxic molecule |
| EP1362110B1 (en) * | 2001-02-23 | 2012-09-12 | Université Libre de Bruxelles | Method for the selection of recombinant clones comprising a sequence encoding an antidote protein to a toxic molecule |
| US8470580B2 (en) | 2001-02-23 | 2013-06-25 | Universite Libre De Bruxelles | Method for the selection of recombination clones comprising a sequence encoding an antidote protein to a toxic molecule |
| US9309518B2 (en) | 2002-09-03 | 2016-04-12 | Universite Libre De Bruxelles | Reversible, parallel and multitask cloning method and kit |
| US8318497B2 (en) | 2002-09-03 | 2012-11-27 | Universite Libre De Bruxelles | Reversible, parallel and multitask cloning method and kit |
| AU2004293658B2 (en) * | 2003-11-20 | 2010-09-16 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Plasmid maintenance |
| US7611883B2 (en) | 2003-11-20 | 2009-11-03 | Cobra Biologics Limited | Plasmid maintenance |
| WO2005052167A3 (en) * | 2003-11-20 | 2005-07-28 | Cobra Biolog Ltd | Plasmid maintenance |
| US9333227B2 (en) | 2013-08-19 | 2016-05-10 | Syngulon Sa. | Controlled growth of microorganisms |
| US10188114B2 (en) | 2013-08-19 | 2019-01-29 | Syngulon Sa | Controlled growth of microorganisms |
| US11427800B2 (en) | 2013-08-19 | 2022-08-30 | Syngulon Sa | Controlled growth of microorganisms |
| US12297422B2 (en) | 2013-08-19 | 2025-05-13 | Syngulon Sa | Controlled growth of microorganisms |
| US11932672B2 (en) | 2017-12-19 | 2024-03-19 | Syngulon S.A. | Fermentation process |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2232234A1 (en) | 1997-04-24 |
| JPH11513562A (ja) | 1999-11-24 |
| WO1997014805A3 (en) | 1997-06-12 |
| EP0856059A1 (en) | 1998-08-05 |
| AU7208896A (en) | 1997-05-07 |
| US5922583A (en) | 1999-07-13 |
| EP0856059B1 (en) | 2003-08-20 |
| TW514667B (en) | 2002-12-21 |
| DE69629576D1 (de) | 2003-09-25 |
| ATE247713T1 (de) | 2003-09-15 |
| DE69629576T2 (de) | 2004-06-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0856059B1 (en) | Methods for production of recombinant plasmids | |
| Zinoni et al. | Cotranslational insertion of selenocysteine into formate dehydrogenase from Escherichia coli directed by a UGA codon. | |
| Hansen et al. | The effect of the lacY gene on the induction of IPTG inducible promoters, studied in Escherichia coli and Pseudomonas fluorescens | |
| Park et al. | MppA, a Periplasmic Binding Protein Essential for Import of the Bacterial Cell Wall Peptidel-Alanyl-γ-d-Glutamyl-meso-Diaminopimelate | |
| US6808896B2 (en) | Method for stable chromosomal multi-copy integration of genes | |
| US4666848A (en) | Polypeptide expression using a portable temperature sensitive control cassette with a positive retroregulatory element | |
| EP0946711B1 (en) | Improved expression vectors | |
| US4436815A (en) | Method for stabilizing and selecting recombinant DNA containing host cells | |
| Inada et al. | Conditionally lethal amber mutations in the leader peptidase gene of Escherichia coli | |
| CN101495625B (zh) | 地衣芽孢杆菌中的氯霉素抗性选择 | |
| JPH06261746A (ja) | 高収量の組換え産物の産生宿主体 | |
| US5958728A (en) | Methods for producing polypeptides in mutants of bacillus cells | |
| JPH0691827B2 (ja) | 新規ベクタ−プラスミド | |
| KR100356581B1 (ko) | 플라스미드의안정화 | |
| PT97081B (pt) | Processo para a preparacao de vectores bacterianos | |
| WO1991018101A1 (en) | Process for producing protein | |
| EP1268823B1 (en) | Methods and cells for expression of recombinant protein products | |
| US4725535A (en) | Promoter probe vectors | |
| Botterman et al. | Characterization of phosphinothricin acetyltransferase and C-terminal enzymatically active fusion proteins | |
| US5212083A (en) | Sequence for stabilizing proteins in bacteria | |
| EP0048497A2 (en) | DNA transducing vector and microorganism containing it | |
| Hoshino et al. | Genetic analysis of the Pseudomonas aeruginosa PAO high-affinity branched-chain amino acid transport system by use of plasmids carrying the bra genes | |
| CA1275954C (en) | 3'-expression enhancing fragments and method | |
| US20040175705A1 (en) | Systems for expression of heterologous proteins in m capsulatus | |
| KR102933941B1 (ko) | 세포외막 지질단백질 PrsA 발현계를 이용한 세포표면 대량발현 기술 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI |
|
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2232234 Country of ref document: CA Kind code of ref document: A Ref document number: 2232234 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 1997 515377 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1996933294 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1996933294 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1996933294 Country of ref document: EP |