WO1990012882A1 - Herpes virus recombinant poxvirus vaccine - Google Patents

Herpes virus recombinant poxvirus vaccine Download PDF

Info

Publication number
WO1990012882A1
WO1990012882A1 PCT/US1990/002094 US9002094W WO9012882A1 WO 1990012882 A1 WO1990012882 A1 WO 1990012882A1 US 9002094 W US9002094 W US 9002094W WO 9012882 A1 WO9012882 A1 WO 9012882A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
dna
herpesvirus
poxvirus
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1990/002094
Other languages
English (en)
French (fr)
Inventor
Enzo Paoletti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Health Research Inc
Original Assignee
Health Research Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Health Research Inc filed Critical Health Research Inc
Priority to KR1019900702630A priority Critical patent/KR920700289A/ko
Priority to NL9020677A priority patent/NL195016C/nl
Priority to DE4090565A priority patent/DE4090565C2/de
Publication of WO1990012882A1 publication Critical patent/WO1990012882A1/en
Priority to DK199101743A priority patent/DK176464B1/da
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P1/00Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes
    • C12P1/02Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes by using fungi
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16211Lymphocryptovirus, e.g. human herpesvirus 4, Epstein-Barr Virus
    • C12N2710/16222New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16622New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16711Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16722New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24041Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00Reverse transcribing DNA viruses
    • C12N2730/00011Details
    • C12N2730/10011Hepadnaviridae
    • C12N2730/10111Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/16011Orthomyxoviridae
    • C12N2760/16111Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/20011Rhabdoviridae
    • C12N2760/20111Lyssavirus, e.g. rabies virus
    • C12N2760/20122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to a modified poxvirus and to methods of making and using the same. More in particular, the invention relates to recombinant
  • poxvirus which virus expresses gene products of a
  • herpesvirus gene and to vaccines which provide protective immunity against herpesvirus infections.
  • Vaccinia virus and more recently other poxviruses have been used for the insertion and expression of foreign genes.
  • the basic technique of inserting foreign genes into live infectious poxvirus involves recombination between pox DNA sequences flanking a foreign genetic element in a donor plasmid and homologous sequences present in the rescuing poxvirus (28).
  • the recombinant poxviruses are constructed in two steps known in the art and analogous to the methods for creating synthetic recombinants of the vaccinia virus described in U.S. Patent No. 4,603,112, the disclosure of which patent is incorporated herein by
  • the DNA gene sequence to be inserted into the virus is placed into an E. coli plasmid construct into which DNA homologous to a section of DNA of the poxvirus has been inserted.
  • the DNA gene sequence to be inserted is ligated to a promoter.
  • the promoter-gene linkage is positioned in the plasmid construct so that the promoter-gene linkage is flanked on both ends by DNA
  • the resulting plasmid construct is then amplified by growth within E. coli
  • the isolated plasmid containing the DNA gene sequence to be inserted is transfected into a cell culture, e.g. chick embryo fibroblasts, along with the poxvirus.
  • a cell culture e.g. chick embryo fibroblasts
  • Recombination between homologous pox DNA in the plasmid and the viral genome respectively gives a poxvirus modified by the presence, in a nonessential region of its genome, of foreign DNA sequences.
  • the term "foreign" DNA designates exogenous DNA, particularly DNA from a non-pox source, that codes for gene products not ordinarily produced by the genome into which the exogenous DNA is placed.
  • RNA may replace DNA.
  • homologous sections of nucleic acid are sections of nucleic acid (DNA or RNA) which have the same sequence of nucleotide bases.
  • Genetic recombination may take place naturally during the replication or manufacture of new viral genomes within the infected host cell. Thus, genetic recombination between viral genes may occur during the viral replication cycle that takes place in a host cell which is co-infected with two or more different viruses or other genetic
  • a section of DNA from a first genome is used interchangeably in constructing the section of the genome of a second co-infecting virus in which the DNA is homologous with that of the first viral genome.
  • recombination can also take place between sections of DNA in different genomes that are not perfectly homologous. If one such section is from a first genome homologous with a section of another genome except for the presence within the first section of, for example, a genetic marker or a gene coding for an antigenic determinant
  • recombination can still take place and the products of that recombination are then detectable by the presence of that genetic marker or gene in the recombinant viral genome.
  • the second condition for expression of inserted DNA is the presence of a promoter in the proper relationship to the inserted DNA.
  • the promoter must be placed so that it is located upstream from the DNA sequence to be expressed.
  • Equine herpesvirus 1 EHV-1
  • EHV-4 equine herpesvirus 4
  • Equine herpesviruses are members of the alphaherpesvirus subfamily and display many of the typical biological and biochemical characteristics of human
  • herpesviruses such as genomic isomerization, regulation of gene expression, establishment of latent infections, generation of defective interfering virus particles, induction of neurological disorders, and in vitro oncogenic transformation (1,4,23).
  • EHV advantageously can be used for studying the varied biological consequences of herpesvirus infections.
  • Herpesvirus glycoproteins mediate essential viral functions such as cellular attachment and penetration, cell to cell spread of the virus and, importantly, determine the pathogenicity profile of infection.
  • Herpesvirus glycoproteins mediate essential viral functions such as cellular attachment and penetration, cell to cell spread of the virus and, importantly, determine the pathogenicity profile of infection.
  • glycoproteins are critical components in the interaction with the host immune system (36,37).
  • glycoproteins of herpes simplex virus include gB, gC, gD, gE, gG, gH and gl
  • gC can stimulate class I restricted cytotoxic lymphocytes (15,32) whereas gD can stimulate class II cytotoxic T cell responses
  • EHV-1 appears unique among the alphaherpesviruses whose
  • glycoprotein genes have been mapped in that five of its six major glycoproteins are encoded from sequences within the genome L component while only one (gp17/18) is mapped to the U s region. Analyzing these data, it has been predicted that some of the low-abundance glycoproteins identified in EHV-1 virions as well as EHV-1 glycoproteins not yet identified map to the S component of the genome (3).
  • the envelope glycoproteins are the principal immunogens of herpesviruses involved in eliciting both humoral and cellular host immune responses (5,8,73-75) and so are of the highest interest for those attempting to design vaccines.
  • the protein has the characteristic features of a membrane- spanning protein with nine potential N-linked glycosylation sites (Asn-X-Ser/Thr) present in the surface domain between the putative signal and transmembrane anchor portions of the protein (2).
  • the glycoprotein was shown to be homologous to the herpes simplex virus (HSV) gC-1 and gC-2, to the
  • EHV-1 gp13 is thus the structural homolog of the herpesvirus gC-like glycoproteins.
  • the nucleotide sequence of EHV-1 gp14 (71,72) has recently been reported. Analysis of the predicted amino acid sequence of gp14 glycoprotein revealed significant homology to the corresponding glycoprotein of HSV, gB.
  • Pseudorabies virus an alphaherpesvirus
  • PRV Pseudorabies virus
  • encephalitis is a frequent consequence of infection.
  • Latent viral infections a characteristic of herpes viruses, can be established thus allowing recovered adult swine to serve as chronic carriers of the virus.
  • Wittmann and Rziha (81).
  • the PRV genome consists of a 90 x 10 6 dalton double stranded DNA (82) separated by inverted repeat sequences into unique long (U L ) or unique short (U s )
  • the PRV genome encodes approximately 100 polypeptides whose expression is regulated in a cascade-like fashion similar to other herpesviruses (85, 86). To date, five glycoproteins gpl, gpli, gpIII, gp63 and gp50 have been shown to be associated with the viral envelope and
  • PRV infected cells 80,86-91).
  • a sixth PRV encoded glycoprotein (gX) is released into the culture medium (92).
  • the physical location of these glycoproteins on the PRV genome and their DNA sequence are currently known (62,80,91-98).
  • the PRV glycoproteins mediate essential viral functions such as cellular
  • the PRV glycoproteins are critical in the pathogenicity profile of PRV infection and are critical components in the
  • PRV gpl is non-essential for virus replication in vitro and in vivo and is absent from most attenuated PRV strains (99). The attenuated nature of these gl-deleted strains also indicates a possible role for gl in virulence (99,100). Other PRV proteins, however, appear to be
  • vaccinia virus expressing PRV gl-encoded polypeptides does not protect mice against a lethal PRV challenge
  • PRV glycoprotein gp63 is located adjacent to gp50 in the U s region of the PRV genome (80).
  • PRV gp63 starts with three consecutive ATG codons approximately 20 nucleotides downstream from the stop codon of gp50. There is no recognizable transcriptional signal motif and translation probably occurs from the same transcript as gp50. PRV gp63 is non-essential in vitro
  • PRV gp63 as a continuous DNA sequence with PRV gp50 has been expressed in vaccinia virus as reported by Kost et al. (98). The contribution of PRV gp63 to protection in mice against PRV challenge is difficult to assess since those studies did not dissect the contributions of PRV gp50 and gp63.
  • PRV glycoprotein gX is a non-structural glycoprotein whose end product is secreted into the
  • PRV glycoprotein gp50 is the Herpes simplex virus type 1 (HSV-1) gD analog (97).
  • the DNA open reading frame encodes 402 amino acids (95).
  • the mature glycosylated form (50-60 kDa) contains O-linked carbohydrate without N-linked glycosylation (95).
  • Swine serum is highly reactive with PRV gp50, suggesting its importance as an immunogen.
  • Monoclonal antibodies to gp50 neutralize PRV in vitro with or without complement (97,105,106) and passively protect mice
  • the PRV gpIII gene is located in the U L region of the genome.
  • the 1437 bp open reading frame encodes a protein of 479 amino acids.
  • the 50.9 kDa deduced primary translation product has eight potential N-linked
  • PRV gill is the HSV-1 gC analog (96). Functional replacement of PRV gill by HSVgC was not observed (109). Although PRV gill is nonessential for replication in vitro (110 , 111) , the mature glycosylated form (98 kDa) is an abundant constituent of the PRV envelope.
  • Anti-gpIII monoclonal antibodies neutralize the virus in vitro with or without complement (86 , 106 , 110) and can passively protect mice and swine (102).
  • glycoprotein gill can protect mice and swine from lethal PRV challenge after immunization with a Cro/glll fusion protein expressed in E. coli (Robbins, A., R. Watson, L. Enquist, European Patent application 0162738A1) or when expressed in a vaccinia recombinant (Panicali, D., L. Gritz, G. Mazzara, European Patent application 0261940A2).
  • PRV gpll a disulfide linked complex of three glycoproteins (120 kDa, 67 kDa and 58 kDa) designated as PRV gpll according to the nomenclature of Hampl (86).
  • the DNA sequence encoding PRV gpll is located in the left end of U L .
  • the open reading frame of 2976 nucleotides encodes a primary translation product of 913 amino acids or 110 kDa.
  • PRV gpll is the HSV- 1 gB homolog (62).
  • Monoclonal antibodies directed against PRV gpll have been shown to neutralize the virus in vitro (5) with or without complement (81). Moreover, passive immunization studies demonstrated that neutralizing
  • glycoprotein has not been reported.
  • HSV2 herpes simplex virus type 2
  • the herpes simplex virus type 1 (HSV1) genome encodes at least eight antigenically distinct glycoproteins: gB, gC, gD, gE, gG, gH, gl and gJ (115). Homologues for these genes appear to be present in HSV2 (116-119). Since these glycoproteins are present in both the virion envelope and the infected cell plasma membrane, they can induce humoral and cell-mediated protective immune responses (37).
  • HSV1 gB, gC or gD are protected against lethal HSV1 challenge (120).
  • Mice have also been protected against lethal HSV1 or HSV2 challenge by passive immunization with antibodies to total HSV1 (121) or HSV2 (122) virus and with antibodies to the individual HSV2 gB, gC, gD or gE glycoproteins (123).
  • This protection appears to be dependent upon a competent T-cell response since animals immunosuppressed by irradiation,
  • glycoproteins The contribution of the individual glycoproteins in eliciting a protective immune response is not completely understood. Expression of these glycoproteins in a
  • heterologous system such as vaccinia
  • vaccinia virus vectors expressing HSV1 gB (125) and HSV1 gC (32) have been shown to induce cytotoxic T-cell responses.
  • HSV1 gB HSV1 gC (126) or HSV1 gD (26) are protected against a lethal challenge of HSV1.
  • a recombinant vaccinia virus expressing HSV1 gD has also been shown to be protective against HSV2 in a guinea pig model system (44). It is not known, however, whether expression of multiple HSV antigens will result in a potentiation of this protective response.
  • Bovine herpesvirus 1 (BHV1) is responsible for a variety of diseases in cattle, including conjunctivitis, vulvovaginitis and abortion (127). It is also one of the most important agents of bovine respiratory disease, acting either directly or as a predisposing factor for bacterial infection (128).
  • BHV1 specifies more than 30 structural polypeptides, 11 of which are glycosylated (129).
  • 129 glycosylated glycoproteins
  • gl, gll, gill and gIV have been characterized and found to be homologous to the herpes simplex virus (HSV) glycoproteins gB, gC, gD, and gE
  • Subunit vaccines consisting of gl, gIll and/or gIV have been shown to protect cattle from disease (using a BHVl/Pasteurella haemolytica aerosol challenge model) but not from infection (132). These results indicate the importance of these glycoproteins in eliciting a successful immune response against BHV1.
  • gl and gIll have also been cloned into vaccinia virus and cattle immunized with these recombinants are shown to produce neutralizing antibodies to BHV1 (56,133).
  • Feline rhinotracheitis is a common and worldwide disease of cats which is caused by an alphaherpesvirus designated feline herpesvirus type 1 (FHV-1). Like other herpesviruses, FHV-1 establishes a latent infection which results in periodic reactivation (134). FHV-1 infections in breeding colonies are characterized by a high rate of mortality in kittens. Secondary infections of the upper respiratory tract are quite debilitating in adults. The control of this disease is currently attempted by using modified live or inactivated vaccines which can suppress the development of clinical signs but do not prevent infection that results in shedding of virus. Thus, asymptomatic vaccinated cats can spread virulent virus and latent
  • Herpesvirus glycoproteins mediate attachment of the virion to the host cell and are extremely important in viral infectivity (138,139). They also determine the subtype specificity of the virus (140). Herpesvirus
  • glycoproteins antigens are recognized by both the humoral and cellular immune systems and have been shown to evoke protective immune responses in vaccinated hosts
  • FHV-1 has been shown to contain at least 23 different proteins (143,144). Of these, at least five are glycosylated (144,145) with reported molecular masses ranging from 120 kDa to 60 kDa. The FHV-1 glycoproteins have been shown to be immunogenic (143,145).
  • FHV-1 appears to have a homolog of glycoprotein B (gB) of HSV-1, and partial sequence of the FHV-1 gB gene has recently been reported (146).
  • the HSV-1 gB is required for virus entry and for cell fusion (147-149).
  • the HSV-1 gB and the gB analogs of other herpesviruses have been shown to elicit important circulating antibody as well as cell-mediated immune
  • the FHV-1 gB glycoprotein is a 134 kDa complex which is dissociated with B- mercaptoethanol into two glycoproteins of 66 kDa and 60 kDa.
  • the FHV-1 DNA genome is approximately 134 Kb in size (153).
  • Epstein Barr Virus a human B lymphotropic herpesvirus
  • EBV Epstein Barr Virus
  • 115 the subfamily gammaherpesvirus
  • 156 the causative agent of infectious mononucleosis (154) and of B-cell lymphomas (156).
  • EBV is associated with two human malignancies: the endemic Burkitt's lymphoma and the
  • EBV genome was completely sequenced (207) as the genomes of VZV (66) and HSV1 (158) numerous homologies between these different herpesviruses have been described (159). In some cases these homologies have been used to predict the potential functions of some open reading frame (ORFs) of EBV.
  • the EBV genes homologous to the HSV1 genes involved in immunity are of particular interest. So the EBV BALF4 gene has homologies with HSV1 gB (68) and the EBV BXLF2 gene with HSV1 gH (161). Finally, the EBV BBRF3 gene contains homologies with a CMV membrane protein (162).
  • the two major envelope glycoproteins gp340 and gp220 are the best characterized potential vaccinating antigens. They are derived from the same gene by splicing without a change in the reading frame (163,164). Monoclonal antibodies and polyclonal sera directed against gp340 neutralize EBV in vitro (165). The cottontop tamarinds, the only susceptible animal, can be protected by an immunization with purified gp340 (166) and with a recombinant EBV gp340 vaccinia virus (167).
  • the protection was achieved with a recombinant derived from the WR vaccinia strain but not with a recombinant derived from the Wyeth vaccinia strain.
  • the Wyeth strain has been widely used as a vaccine strain.
  • HCMV Human cytomegalovirus
  • betaherpesvirinae subfamily family Herpesviridae
  • HCMV can produce a persistent productive infection in the face of substantial specific immunity. Even if HCMV possesses a low pathogenicity in general, intrauterine infection causes brain damages or deafness in about 0.15% of all newborns and it is the most common infectious complication of organ transplantation (170).
  • glycoproteins associated with the HCMV envelope have been described (172): gCI (gp55 and gp93-130); gCII (gp47-52); and gCIII (gp85-p145).
  • the gene coding for gCI is homologous to HSVl gB.
  • the gCII glycoproteins are coded by a family of five genes (HXLF) arranged in tandem and sharing one or two regions of homology. More probably gCII is coded by only two of these genes (172,173).
  • the gene coding for gCIII is homologous to HSVl gH (174).
  • Suitably modified poxvirus mutants carrying exogenous equine herpesvirus genes which are expressed in a host as an antigenic determinant eliciting the production by the host of antibodies to herpesvirus antigens represent novel vaccines which avoid the drawbacks of conventional vaccines employing killed or attenuated live organisms.
  • vaccines containing attenuated live organisms always present the possibility of a reversion of the attenuated organism to a pathogenic state.
  • a recombinant poxvirus suitably modified with an equine herpesvirus gene coding for an antigenic determinant of a disease-producing herpesvirus is used as a vaccine, the possibility of reversion to a
  • the poxvirus contains only the gene coding for the antigenic determinant of the disease-producing organism and not those genetic portions of the organism responsible for the replication of the
  • Inactivated vaccines are less efficient, require several immunizations and usually contain potent adjuvants. These latter formulations can induce post-vaccinal allergic reactions such as lack of appetite, hyperthermia or abortion in pregnant sows.
  • These vaccine types also suffer from certain drawbacks with respect to prevention of latent infections, overcoming the effects of maternal antibodies on vaccination efficacy, and eliminating the potential use of a serological diagnostic assay to distinguish vaccinated animals from those
  • avipoxviruses which replicate in avian species, have been engineered to express immunologically pertinent gene products. Inoculation of avian (42,177) and non-avian species (41) with avipoxvirus recombinants
  • Attenuated live vaccines and inactivated vaccines to BHV1 have been available for over 30 years and have successfully reduced the incidence of BHVl related diseases. These vaccines, however, do not prevent latent infection or reinfection with wildtype virus. They also complicate the differentiation between infected and vaccinated animals.
  • Vaccination of pregnant cows with attenuated live vaccines can cause fetal death and subsequent abortion (127).
  • vaccinated animals have been shown to shed virus (178). Therefore, vaccinated animals kept with pregnant cows can spread infectious virus to the pregnant animal and cause abortion of the fetus.
  • Inactivated vaccines do not induce abortions or provoke viral excretion. However, they necessitate the use of adjuvants and can cause fatal hypersensitivity reactions (anaphylaxis) and nonfatal inflammation and fever (179).
  • the present invention relates to a recombinant poxvirus containing therein a DNA sequence from herpesvirus in a nonessential region of the poxvirus genome.
  • the herpesvirus is a member of the
  • the DNA sequence from herpesvirus codes for a herpesvirus glycoprotein.
  • the herpesvirus glycoprotein is selected from the group consisting of equine herpesvirus gp13, equine herpesvirus gp14, equine herpesvirus gD, equine herpesvirus gp63, equine herpesvirus gE, pseudorabies virus gp 50, pseudorabies virus gpll, pseudorabies virus gpIII, pseudorabies virus gpl, herpes simplex virus gB, herpes simplex virus gC, herpes simplex virus gD, bovine herpes virus gl, feline herpes virus gB, Epstein-Barr virus gp220, Epstein-Barr virus gp340, Epstein-Barr virus gB, Epstein-Barr virus gB, Epstein-Barr virus g
  • the recombinant poxvirus expresses gene products of the foreign herpesvirus gene.
  • the foreign DNA sequence codes for a herpesvirus glycoprotein and the foreign DNA is expressed in a host by the production of the herpesvirus glycoprotein.
  • a plurality of herpesvirus glycoproteins are coexpressed in the host by the recombinant poxvirus.
  • the poxvirus is advantageously a vaccinia virus or an avipox virus, such as fowlpox virus or canarypox virus.
  • the present invention relates to a vaccine for inducing an immunological response in a host animal inoculated with the vaccine, said vaccine including a carrier and a recombinant poxvirus containing, in a nonessential region thereof, DNA from herpesvirus.
  • the DNA codes for and expresses a herpesvirus glycoprotein.
  • a plurality of herpesvirus glycoproteins are coexpressed in the host by the poxvirus.
  • the poxvirus used in the vaccine according to the present invention is advantageously a vaccinia virus or an avipox virus, such as fowlpox virus or canarypox virus.
  • the present invention relates to mechanisms to bypass the issue of maternal immunity. If the barrier is due to the presence of antibodies to a given antigen(s) then the barrier of maternal immunity may be overcome or avoided by using, selectively, vectors
  • the pregnant animal can be vaccinated with a recombinant
  • vaccinia virus expressing pseudorabies virus glycoprotein gp50 and the offspring can be vaccinated at birth or shortly thereafter with vaccinia recombinants expressing other pseudorabies virus glycoproteins gpll or gpIII or
  • the present invention relates to a method for overcoming or avoiding maternal immunity which would otherwise prevent successful immunization in a newborn offspring.
  • the newborn offspring is inoculated with a recombinant poxvirus containing therein DNA from a non-pox source in a nonessential region of the poxvirus genome, said DNA coding for a first antigen of a pathogen of the newborn offspring, and said antigen being different from a second antigen of the same pathogen used to induce an immunological response to the same pathogen in the mother of the newborn offspring.
  • the newborn offspring is inoculated with a recombinant first poxvirus containing therein DNA from a non-pox source in a nonessential region of the first
  • poxvirus genome said DNA coding for an antigen of a
  • FIG. 1 schematically shows a method for the construction of the recombinant vaccinia virus vP425
  • FIG. 2 shows the DNA sequence of an EHV-1 1.88 Kb fragment containing the gp13 coding sequences
  • FIG. 3 schematically shows a method for the construction of the recombinant vaccinia virus vP483
  • FIG. 4 schematically shows a method for the construction of the recombinant vaccinia virus vP458
  • FIG. 5 schematically shows a method for the construction of the recombinant vaccinia virus vP577
  • FIG. 6 shows the DNA sequence of an EHV-1 3.35 Kb fragment containing the gp14 coding sequence
  • FIG. 7 is a plot of relative hydrophilicity for the EHV-1 gp14 coding sequences
  • FIG. 8 schematically shows a method for the construction of the recombinant fowlpox virus vFP44
  • FIG. 9 schematically shows a method for the construction of the recombinant canarypox virus vCP48 containing the EHV-1 gp13 gene
  • FIG. 10 schematically shows a method for the construction of donor plasmids pHES-MP63, pHES-MPl and pHES- MP34 containing modified versions of the EHV-1 gp14 gene;
  • FIG. 11 is a map of the BamHI cleavage sites of the EHV-1 Kentucky D strain indicating the inverted repeats of the genome by boxes, showing the location of the six major EHV-1 glycoprotein genes and showing an expansion of the region of the genome which includes the gD, gp63 and gE genes;
  • FIG. 12 shows the nucleotide sequence of an EHV-1 6402 base-pair fragment containing the gD, gp63 and gE coding sequences
  • FIG. 13 is a hydropathy plot of the sequence of 402 amino acids composing EHV-1 gD;
  • FIG. 14 is a hydropathy plot of the sequence of 413 amino acids composing EHV-1 gp63;
  • FIG. 15 is a hydropathy plot of the sequence of
  • FIG. 16 schematically shows a method for the construction of donor plasmids pJCA006, pJCA007 and pJCA008 containing the EHV-1 gD gene, the EHV-1 gE gene and the EHV- 1 gp63 gene, respectively, and generation of recombinant vaccinia virus containing these genes;
  • FIG. 17 schematically shows a method for the construction of donor plasmids pJCA009 (containing the EHV-1 gD and gp63 genes) and pJCA010 (containing the EHV-1 gD, gp63 and gE genes), and generation of recombinant vaccinia virus containing these genes;
  • FIG. 18 schematically shows a method for the construction of donor plasmid PR18 containing the PRV gpll gene, and generation of recombinant vaccinia virus
  • FIG. 19 shows the DNA sequence of the PRV gpll open reading frame
  • FIG. 20 schematically shows a method for the construction of donor plasmid pPR24 containing the PRV gpIII gene, and generation of recombinant vaccinia virus
  • FIG. 21 shows the DNA sequence of the PRV gpIII open reading frame
  • FIG. 22 schematically shows a method for the construction of donor plasmid pPR26 containing the PRV gp50 gene, and generation of recombinant vaccinia virus
  • FIG. 23 shows the DNA sequence of the PRV gp50 open reading frame
  • FIG. 24 schematically shows a method for the construction of plasmid pSD478VC, and pSD479VCBG and insertion of Beta-galactoside into vaccinia virus;
  • FIG. 25 schematically shows a method for the construction of plasmid pMP13PP
  • FIG. 26 schematically shows a method for the construction of plasmid pFPPRVII containing the PRV gpll gene
  • FIG. 27 schematically shows a method for the construction of the recombinant canarypox virus vCP55 expressing the PRV gpll gene
  • FIG. 28 schematically shows a method for the construction of the recombinant vaccinia virus vP717
  • FIG. 29 schematically shows a method for the construction of recombinant vaccinia viruses vP569 and vP734 expressing the HSV-2 gB gene;
  • FIG. 30 schematically shows a method for the construction of recombinant vaccinia viruses vP579, vP748 and vP776 expressing the HSV-2 gC gene;
  • FIG. 31 schematically shows a method for the construction of recombinant vaccinia viruses vP570, vP761, vP775 and vP777 expressing the HSV-2 gD gene;
  • FIG. 32 schematically shows a method for the construction of recombinant vaccinia viruses vP637 and vP724 expressing the BHV-1 gl gene;
  • FIG. 33 schematically shows a method for the construction of donor plasmid pJCA001 containing the FHV-1 gB gene and for the construction of the recombinant vaccinia virus VP713 expressing the FHV-1 gB gene;
  • FIG. 34 shows the nucleotide sequence of the 3400 bp segment of FHV-1 DNA encoding glycoprotein gB;
  • FIG. 35 is a hydropathy plot of the sequence of 947 amino acids composing FHV-1 gB;
  • FIG. 36 schematically shows a method for the construction of donor plasmids 409gp220 containing the EBV gp220 gene and 409gp340 containing the EBV gp340 gene;
  • FIG. 37 schematically shows a method for the construction of vaccinia donor plasmid 409gB containing the EBV gB gene
  • FIG. 38 schematically shows a method for the construction vaccinia donor plasmid 486gH containing the EBV gH gene
  • FIG. 39 schematically shows the structure of the vaccinia donor plasmid 513gHgBgp340 containing the EBV genes gp340, gB and gH;
  • FIG. 40 schematically shows a method for the construction of vaccinia donor plasmid 409CMVgB containing the CMV gB gene
  • FIG. 41 shows the nucleotide and amino acid sequences of HCMV (Towne strain) HXLF1 gene.
  • FIG. 42 shows the nucleotide and amino acid sequences of HCMV (Towne strain) HXLF2 gene.
  • the Copenhagen strain of vaccinia virus obtained from Rhone Merieux, Inc. (Athens, Georgia) was utilized in this example.
  • the virus was propagated from a purified plaque isolate on either VERO (ATCC# CCL81) or MRC-5 (ATCC# CCL171) cells in Eagle's minimal essential medium (MEM) plus 10% fetal bovine serum (FBS).
  • VERO ATCC# CCL81
  • MRC-5 ATCC# CCL171
  • MEM Eagle's minimal essential medium
  • FBS fetal bovine serum
  • vP410 This thymidine kinase deletion mutant was used for further manipulations. Plasmids were constructed, screened, and grown by standard procedures (20,27,28).
  • pSD456VC thus contains the right end of the Hindlll A fragment within which is the complete coding region for the hemagglutinin (HA) gene (35) flanked by approximately 0.4 Kb additional vaccinia sequences on each side.
  • pSD456VC was cut (partial digest) at the Rsal site upstream of the HA gene and at the Eagl site 80 bp from the 3' end of the HA gene.
  • the approximate 3.5 Kb Rsal/Eagl fragment was isolated from an agarose gel.
  • restriction sites as indicated, is as follows:
  • the annealed MPSYN59-62 mixture was ligated into the 3.5 Kb Rsal/Eagl fragment from pSD456VC, generating pSD466VC.
  • a plasmid containing the 11 kDa promoter/Beta- galactosidase gene cassette in a left to right orientation relative to flanking vaccinia arms was designated
  • pSD466VCBGA and recombined into a thymidine kinase deletion mutant, vP410, of the Copenhagen strain of vaccinia virus generating the vaccinia recombinant vP425 expressing Beta- galactosidase. Eighty base pairs at the carboxy terminus of the HA gene were retained so not to disrupt a short
  • the recombinant vaccinia virus, vP425 (184) was identified on the basis of blue plaque formation in the presence of the chromogenic substrate, X-gal, as described by others (9,24). Substitution of the Beta-galactosidase gene by yet another foreign gene in subsequent vaccinia recombinants could be readily scored by isolating colorless plaques instead of blue plaques.
  • the Smal site derived from the pUC8 multicloning region was eliminated by digestion of pSD466VC with BamHI/EcoRI, blunt ending with the Klenow fragment of E. coli polymerase, and religation.
  • the single Smal site remaining in the resulting plasmid, pSD467VC is in the polylinker region of the HA deletion.
  • DNA sequence analysis revealed an open reading frame of 1,404 bp encoding 468 amino acids with a predicted primary translation product of 50.9 kDa. Significant amino acid homology in the carboxy half of the putative gp13 open reading frame was observed to gC of herpes simplex viruses type l and type 2, gill of pseudorabies virus, and gpV of varicella-zoster virus suggesting that gp13 was a member of the gC like glycoproteins of herpesviruses. Further detailed analysis of the EHV-1 gp13 open reading frame was presented in a previous publication (2).
  • FIG. 2 To facilitate the description of the cloning and expression of the EHV-1 gp13 in vaccinia virus vectors, the gp13 open reading frame plus additional 5' and 3' sequences are shown in FIG. 2.
  • FIG. 2 a presumptive TATA box and amino acids comprising
  • H6 promoter into pSD467VC oligonucleotides H6SYN oligos A-D were synthesized.
  • the underlined bases denote modification from the native H6 promoter sequence.
  • the 130 bp full length, double stranded DNA formed by the annealing of H6SYN oligos A-D was purified by
  • pTP15 Smal/Hindlll and 3.1 Kb Bglll/Hindlll fragments derived from pSD467VC.
  • the resulting plasmid, pTP15 (184) has the ATG initiation codon modified to CCC as part of the Smal site which is immediately followed by a PstI site.
  • the termination codon (TAG) is immediately followed by a vaccinia early transcription terminator (ATTTTTAT).
  • ATTTTTAT vaccinia early transcription terminator
  • the double stranded DNA fragment obtained by annealing the pair of 42-mers contains an Narl sticky end, followed by the 3' end of the coding sequence for the EHV-1 gp13 gene, as well as a vaccinia early transcription termination signal (45), a PstI site, and an Ndel sticky end. This fragment was inserted between the Narl/Ndel sites of pNSIEN generating pNSIENPN (FIG. 3).
  • the Nsil/PstI fragment from pNSIENPN was isolated and cloned into the Nsil/PstI sites of plasmid pNSI, generating plasmid pVHA6g13Nsil (FIG. 3).
  • pVHA6gl3NsiI was cut at the EcoRV site in the H6 promoter and the Nsil site which had been introduced near the beginning of the EHV-1 gp13 gene. This vector fragment was blunt ended with Mung Bean nuclease.
  • Two complementary 32-mer oligonucleotides were synthesized having the sequence, with restriction site as indicated, as follows: ECORV
  • oligonucleotides were annealed and ligated into the pVHA6g13NsiI vector fragment, producing plasmid pVHA6g13, which contains a precise junction at the ATG initiation codon (underlined in the 32-mer sequence) of the H6 promoter and EHV-1 gp13 gene (FIG. 3).
  • pVHA6g13 was transfected into vP425 infected cells to generate the vaccinia recombinant vP483 containing the EHV-1 gp13 gene (FIG. 3).
  • Beta-galactosidase gene replaces the vaccinia HA coding sequences
  • plasmid DNA 25ug of pSD466VCBGA in HeBS (16)
  • BioRad Gene Pulser capacitance 960, 200 volts
  • Sub ⁇ onfluent monolayers of cells were infected at 10 pfu/cell with vP410 one hour prior to use. The infected cells were harvested with trypsin and washed with HeBS before electroporation. Cells were
  • Recombinant virus expressing Beta-galactosidase was detected as blue plaques in the presence of X-gal substrate (9,24).
  • X-gal substrate 9,24.
  • vaccinia virus where the EHV-1 gp13 gene replaced the Beta-galactosidase gene in vP425
  • the vaccinia recombinant vP483, containing EHV-1 gp13 was detected as a colorless plaque in the presence of X-gal and confirmed as a true recombinant by DNA hybridization after 3 cycles of plaque purification.
  • the protein predicted from the DNA sequence has the typical features characteristic of a membrane spanning glycoprotein (14).
  • gp13 glycoprotein is incorporated into the various membrane systems of the cell and is transported into the cytoplasmic membrane and detectable on the external surface of the infected cell.
  • EHV-1 gp13 is additionally a component of the EHV-1 virion. Therefore, immunofluorescence studies were performed to determine whether EHV-1 gp13 expressed by the vaccinia virus recombinant, vP483, was similarly
  • the infection was allowed to proceed for 24 hours when cells were lysed by the addition of 1ml of 3x Buffer A containing 3% NP-40, 30 mM Tris pH 7.4, 450 mM NaCl, 3 mM EDTA, 0.03% sodium azide, and 0.6mg/ml PMSF.
  • the lysed cells and supernatant were harvested, vortexed, and clarified by centrifugation at 10,000g for 15 minutes.
  • Protein A-Sepharose CL-4B (Pharmacia, Cat. No.
  • an open reading frame reading right to left relative to the vaccinia genome and encoding a putative protein of 220 amino acids is located entirely within the Hindlll M fragment from the Copenhagen strain of vaccinia virus to the left of the unique Bglll site.
  • this gene which is located immediately to the right of MIL (58), was designated M2L.
  • Deletion studies directed to the vaccinia (WR) genome extending leftward from the unique Bglll site in Hindlll fragment M (57) indicate that vaccinia coding sequences contained in Hindlll M to the left of the Bglll site are not essential for replication of the virus in tissue culture.
  • a plasmid vector To facilitate use of the M2L region as an insertion locus for foreign genes, a plasmid vector,
  • pMP409DVC was created in which the entire M2L coding sequence was replaced by a Bglll site as follows.
  • pSD409VC which consists of the Copenhagen vaccinia Hindlll M fragment cloned into the Hindlll site of pUC8, was digested with
  • the resulting plasmid, pMP409BVC was linearized with SphI, which cuts within the M2L open reading frame, and was subjected to Bal- 31 exonuclease digestion for two minutes. Mutagenesis was performed on the resulting DNA (19) using a synthetic 49 mer (5'-TTTCTGTATATTTGCAACAATTTAGATCTTACTCAAAATATGTAACAAT-3'; Bglll site underlined). In the mutagenized plasmid,
  • the M2L coding sequences have been deleted from position +3 through the end of the open reading frame.
  • the G of the initiation codon ATG was changed to a C to create a unique Bglll site (AGATCT) at the deletion junction.
  • pMP409DVCBG 11 kDa promoter/Beta- galactosidase gene cassette in a right to left orientation relative to flanking vaccinia arms and genome was designated pMP409DVCBG.
  • pMP409DVCBG was used as donor plasmid for recombination with rescuing vaccinia virus, vP410, described in Example 1.
  • the novel vaccinia recombinant, designated vP458, expressing the Beta-galactosidase gene inserted into the M2L deletion locus was detected using the chromogenic X- gal substrate (9,24) and purified by repeated plaque
  • FIG. 5 the EHV-1 gp14 coding sequence spans the junction between the BamHI restriction fragments a and i (3).
  • the EHV-1 DNA fragments BamHI-a (21.3 Kb) and i (7.1 Kb) (59) were isolated from agarose gels. Plasmid pUC (BamHI-i) was constructed by inserting the EHV-1 BamHI-i fragment into plasmid pUC8 at the BamHI site. The EHV-1 BamHI-a fragment was digested with EcoRI and ligated into EcoRI/BamHI
  • Plasmid pUC (BamHI-a/EcoRI) contains a 10 Kb EHV-1 BamHI/EcoRI insert. Based on the fragment size determinations reported (59), DNA sequences in this insert are contiguous with those of the BamHI-i fragment in the EHV-1 genome.
  • Nucleotide sequence analysis was obtained utilizing different subclones from the pUC (BamHI-a/EcoRI) and pUC (BamHI-i) plasmids. Sequencing of the plasmid pUC (BamHI-a/EcoRI) was started at the BamHI site because the EHV-1 gp14 gene spans the BamHI-a/i
  • DNA sequence analysis revealed an open reading frame extending from nucleotide positions 300 to 3239 reading from left to right relative to the EHV-1 genome, i.e. the ATG start codon was contained in the BamHI-a/EcoRI fragment and the stop codon TAA was contained in the BamHI-i fragment (3,59).
  • nucleotides 148 to 155 was located 70 nucleotides
  • a polyadenylation signal AATAAA (nucleotides 3251 to 3256) was located 8 nucleotides downstream from the TAA termination codon (nucleotides 3240 to 3242).
  • a polyadenylation signal AATAAA (nucleotides 3251 to 3256) was located 8 nucleotides downstream from the TAA termination codon (nucleotides 3240 to 3242).
  • a polyadenylation signal AATAAA was located 8 nucleotides downstream from the TAA termination codon (nucleotides 3240 to 3242).
  • Nine out of eleven nucleotides in the sequence 5'-TCCTGCGCGCA-3' (nucleotides 218 to 228) are complementary to the 18S ribosomal RNA sequence 3'-AGGAAGGCGT-5' (61) and may serve as the ribosome binding site.
  • the EHV-1 gp14 open reading frame encodes 980 amino acids with a calculated molecular weight of 109.8 kDa. Analysis of the amino acid sequence revealed a number of features common to membrane-associated glycoproteins. A region extending from amino acids 58 to 99 had a characteristic hydrophobicity profile and is proposed to be the signal sequence (FIG. 6). An unusual feature of the EHV-1 gp14 gene product is that the long hydrophobic signal sequence is preceded by a long hydrophilic sequence.
  • the hydrophilic cytoplasmic domain contains 110 amino acids.
  • FIG. 7 A hydrophilicity plot of the EHV-1 gp14 coding sequence is shown in FIG. 7.
  • the hydropathic index of EHV-1 gp14 is computed by the method of Kyte and Doolittle (65) with a window of seven amino acids and no smoothing. Points below the horizontal line represent areas of higher
  • Lambda gt11 expression vectors and monoclonal antibodies have been useful in identifying the EHV-1 DNA sequences encoding the major EHV-1 glycoproteins (3).
  • a lambda gt11 recombinant, 4a1 was shown to express an EHV-1 gp14 epitope recognized by the specific monoclonal antibody 3F6 (3).
  • the EHV-1 DNA contained within 4al was sequenced and compared with the DNA sequence of the EHV-1 gp14 coding sequence (FIG. 6).
  • EHV-1 gp14 amino acid sequence to other herpesvirus glycoproteins. Comparison of the amino acid composition of the EHV-1 gp14 gene revealed extensive homology with glycoproteins of other herpesviruses.
  • the EHV-1 gp14 is homologous to gll of PRV (62), gl of BHV-1 (63), gll of varicella-zoster virus (VZV) (66), gB of herpes simplex virus (HSV) (67,71,72) as well as to glycoproteins in Epstein-Barr virus (EBV) (68) and human cytomegalovirus (HCMV) (10).
  • plasmid Blue (Kpnl/BamHI) was generated by inserting a Kpnl/BamHI fragment from pUC (BamHI-a/EcoRI) into plasmid Bluescript SK+ digested with Kpnl/BamHI.
  • Oligonucleotide directed mutagenesis was performed by a modification of the procedure of Kunkel (17) using uracil- containing DNA templates from plasmid Blue (Kpnl/BamHI) produced in the dut- ung- host E. coli strain CJ236.
  • plasmid Blue Kpnl/BamHI
  • an Nsil site was created at codons 1 and 2 of the EHV-1 gp14 gene, changing the sequence ATG/TCC (Met/Ser) to ATG/CAT (Met/His).
  • the mutated sequence was verified by DNA sequence analysis.
  • the Kpnl/BamHI fragment from the mutant was transferred to Kpnl/BamHI digested pUC18 generating the plasmid pUC (Kpnl/BamHI).
  • a plasmid, pUCg14, containing the complete EHV-1 gp14 gene with the Nsil site mutation was constructed by inserting theEcoRI /BamHI fragment from pUC (Kpnl/BamHI) into EcoRI/BamHI digested pUC (BamHI/PstI), a 3.9 Kb
  • pMP409DVC was cut with Bglll and ligated with synthetic double-stranded DNA containing the modified vaccinia H6 (early/late) promoter, described in Example 1, flanked by restriction sites. Restriction sites for Nsil, SacI, PstI and EcoRI were created immediately downstream from the endogenous initiation codon in the H6 promoter.
  • the polylinker sequence downstream from the H6 promoter is ATG CAT GAG CTC TGC AGA ATT CGG ATC T.
  • the unique Nsil site, containing the H6 initiation codon is immediately followed by unique SacI, PstI and EcoRI sites.
  • the EcoRI/Nsil DNA fragment from pUCg14 containing the EHV-1 DNA region upstream from the EHV-1 gp14 initiation codon was replaced by the EcoRI/Nsil fragment from plasmid pMGll, thus generating plasmid pMRHg14 which contains the right arm of vaccinia Hindlll M, the H6 promoter, and the entire length of the EHV-1 gp14 gene.
  • the Hpal/PstI EHV-1 gp14 containing fragment from plasmid pMRHg14 was
  • pVM2LH6g14 contains the entire EHV-1 gp14 coding sequence (with codon 2 changed from TCC (Ser) to CAT (His) as indicated, and approximately 1.2 Kb of EHV-1 DNA downstream from the EHV-1 gp14 gene) under the control of the H6 promoter, inserted in a right to left orientation with respect to flanking vaccinia sequences relative to the vaccinia genome targeting the insertion of the EHV-1 gp14 gene to the M2L locus.
  • vaccinia recombinant was designated vP577.
  • Truncation of the EHV-1 gp14 hydrophilic leader sequences Using variations of the mutagenesis and cloning manipulations described above, chimeric donor plasmid pVM2LH6g14-1 was constructed. To create pVM2LH6g14-1, which contains a deletion of codons 2 through 34 of EHV-1 gp14 with the substitution of 4 codons, in vitro mutagenesis (17) was performed on plasmid Blue (Kpnl/BamHI), creating an Nsil site in codons 32 through 34 rather than codons 1 and 2.
  • the Nsil/BamHI fragment from the newly mutagenized Blue (Kpnl/BamHI) plasmid was substituted for the Nsil/BamHI fragment in pVM2LH6gl4.
  • Multiple Nsil linkers (New England BioLabs, Beverly, MA) were ligated into the Nsil site to bring the initial ATG in frame with the remainder of the EHV-1 gp14 coding sequence.
  • the final plasmid, pVM2LH6g14- 1 contains the sequence ATG/CAT/GCA/TGC/ATT/GCT....
  • the vaccinia recombinant vP613 was obtained by recombination with rescuing virus vP458 and donor plasmid pVM2LH6g14-1.
  • recombination was performed with either vP577 or vP613 as rescuing virus and the donor plasmid pVHA6gl3 (described in Example 1) which contains the EHV-1 gp13 gene under the control of the vaccinia H6 promoter inserted at the HA deletion locus of vaccinia. Insertion of the EHV-1 gp13 sequences into recombinant viruses was identified by in situ DNA hybridization (25,28).
  • vaccinia virus double recombinants vP633 and vP634 were plaque cloned and the presence of both EHV-1 gp13 and gp14 coding sequences confirmed by DNA hybridization analysis and by expression assays (see below).
  • glycoproteins expressed in vaccinia virus recombinants were assessed for the EHV-1 gp13 and gp14 glycoproteins expressed by vaccinia virus recombinants.
  • VERO cells were infected with the recombinants and proteins were
  • Example 1 The specific monoclonal antibody to EHV-1 gp13 (14H7) or to EHV-1 gp14 (3F6) (3) were bound at a 1:1000 dilution for 4 hours at room temperature. Samples were analyzed by SDS
  • EHV-1 gp13 radiolabeled products were precipitated by monoclonal 14H7 from VERO cells infected with vP483, a vaccinia recombinant expressing only the EHV-1 gp13, or the vaccinia virus double recombinants expressing both EHV-1 gp13 with either intact gp14, vP633, or truncated gp14, vP634.
  • There are two products of approximately 44 and 47 kDa detectable which are somewhat smaller than the predicted primary translation product (51 kDa) and a larger product of approximately 90 kDa which is consistent with a fully glycosylated form of the EHV-1 gp13 gene product.
  • EHV-1 gp13 is unaffected by coexpression of either form of EHV-1 gp14 in the vaccinia double recombinants, vP633 and vP634.
  • VERO cells were infected with vP633, vP634, vP613, and vP577, respectively, and immunoprecipitated with the specific anti-EHV-1 gp14 monoclonal 3F6 (3).
  • Immunofluorescence of recombinant vaccinia virus infected VERO cells was performed as described in Example 1 using either EHV-1 gp13 or gp14 specific monoclonal antibody.
  • EHV-1 gp13 was readily detectable on the surface of VERO cells infected with vaccinia recombinants vP483, vP633 and vP634 as well as internally after acetone
  • guinea pigs were inoculated with the virus and the presence of serum neutralizing antibodies against both vaccinia virus and equine herpes virus was assayed.
  • guinea pigs weighing approximately 450 grams were divided into groups of five.
  • One group received 1ml of the vaccinia recombinant (10 8 TCID 50 /ml) on day 0 followed by a 1ml booster on day 21 by subcutaneous
  • Guinea pigs were immunized to evaluate their response against EHV-1 gp14 expressed by vaccinia
  • EHV-1 serum neutralizing antibodies are detectable at three weeks after the primary vaccination, a more
  • hamsters were given either a primary or primary plus booster vaccination and they, along with an uninoculated control group or a group inoculated twice with a control vaccinia virus, vP452, were challenged intraperitoneally with a hamster adapted Kentucky strain of
  • Group A received a single subcutaneous (1ml) inoculation of either 10 8 , 10 6 , or 10 4 TCID 50 of the vaccinia recombinant vP483, five animals per dose.
  • Group B was vaccinated with vP483 on day 0 followed by a booster on day 14.
  • the (1ml) primary and booster doses were administered subcutaneously to groups of 5 animals using 10 8 , 10 6 , or 10 4 TCID 50 .
  • Group C consisted of 5 hamsters and received 2 subcutaneous injections (10 8 TCID 50 per injection) on days 0 and 14 of vaccinia vP452.
  • vaccinated hamsters Twenty one-day-old syrian hamsters weighing approximately 60 g each were inoculated subcutaneously with 1 ml of control vaccinia virus or with recombinant vaccinia viruses vP483, vP577, vP613, vP633 and vP634 expressing EHV-1 gp13 and/or gp14.
  • Primary vaccinated hamsters Twenty one-day-old syrian hamsters weighing approximately 60 g each were inoculated subcutaneously with 1 ml of control vaccinia virus or with recombinant vaccinia viruses vP483, vP577, vP613, vP633 and vP634 expressing EHV-1 gp13 and/or gp14.
  • the vaccinia virus recombinant, vP577, expressing the full length EHV-1 gp14 gene failed to protect hamsters against challenge with a PD 50 calculated > 9.0 log 10 .
  • the vaccinia virus recombinant, vP577, expressing the full length EHV-1 gp14 gene failed to protect hamsters against challenge with a PD 50 calculated > 9.0 log 10 .
  • pVHA6g13 was utilized as the source of the EHV-1 gp13 gene.
  • pVHA6g13 was digested with Nrul and Hindlll.
  • a fragment of approximately 1.8 Kb containing 28 bp of the 3' end of the vaccinia virus H6 promoter, the entire EHV-1 gp13 gene, and approximately 410 bp of vaccinia virus sequences was generated by this digestion.
  • the 1.8 Kb Nrul/Hindlll fragment was isolated for insertion into the avipoxvirus insertion vectors pFPCV2 and pCPCVl.
  • the fowlpox virus (FP) insertion vector pFPCV2 provides a vehicle for generating recombinants which harbor foreign genes in a non-essential region of the FP genome designated the f7 locus.
  • pFPCV2 was derived from pRW731.13.
  • the plasmid pRW731.13 contains an FP genomic PvuII fragment of approximately 5.5 Kb inserted between the two PvuII sites of pUC9.
  • MCS multiple cloning sequence
  • the MCS was derived by annealing oligonucleotides CE4 (5'-TCGC
  • the plasmid containing the MCS was designated as pCEll.
  • pFeLVIA is a derivative of vaccinia insertion vector pTP15 (184) (FIG.3) in which the feline leukemia virus (FeLV) env gene (192), is inserted into the PstI site downstream from the H6 promoter.
  • FeLV feline leukemia virus
  • FIG.8 To transfer the 2.4 kb expression cassette to a FP vector, (FIG.8) the H6/FeLV env sequences were excised from pFeLVIA by digestion with Bglll and partial digestion with PstI.
  • the Bglll site is at the 5' border of the H6 promoter sequence.
  • the PstI site is located 420 bp downstream from the translation termination signal for the FeLV envelope glycoprotein open reading
  • the 2.4 Kb H6/FeLV env sequence was inserted into pCEll digested with BamHI and PstI. This plasmid was designated as pFeLVFl.
  • the pFeLVFl plasmid was then
  • the resultant plasmid containing the vaccinia virus H6 promoter within pCEll was designated pFPCVl.
  • the sequences 5' to the promoter were mutagenized (19) to remove extraneous
  • oligonucleotide FPCV1 (5'- CAGTAATACACGTTATTGCAGAGAGGACCATTCTTTATTCTATACTTAAAAAGT-3') to produce pFPCVl.
  • the region 3' to the promoter (multiple cloning site) was mutagenized with oligonucleotide FPCV3 (5'-TAGAGT CGACCTGCAGGCATCCAAGCTTGTTAACGAC-3' ) to remove the SphI site, which contains an ATG.
  • the resultant plasmid was designated pFPCV2.
  • Nrul/Hindlll fragment contained the 5' portion of the vaccinia virus H6 promoter (100 bp), the FP flanking
  • the plasmid pFPEHV13A was then digested with Kpnl and Hindlll to remove an approximately 600 bp fragment.
  • This fragment contained the 3' most region of the EHV-1 gp13 gene (200 bp) and the 410 bp vaccinia virus DNA segment.
  • the 600 bp Kpnl/Hindlll fragment was replaced by a 200 bp fragment derived from pNSIENPN (FIG.3) as follows.
  • a PstI digestion of pNSIENPN linearized the plasmid.
  • the PstI termini were blunt-ended by the T4 DNA polymerase (New
  • TAG termination codon
  • TTTTTNT sequence motif known to be a vaccinia virus early transcription termination signal
  • pFPEHV13B was also utilized to generate a 1.4 Kb Nrul/Hindlll fragment for insertion into pCPCVl.
  • the pCPCVl plasmid contains the vaccinia virus H6 promoter in the unique EcoRI site within the 3.3 Kb PvuII canarypox virus (CP) genomic fragment.
  • pCPCVl was derived from pRW764.2, which contains a 3.3 Kb PvuII CP genomic fragment inserted into a pUC vector.
  • pRW764.2 was linearized by digestion withEcoRI. This fragment was blunt-ended using the Klenow fragment of the E. coli DNA polymerase (Boehringer Mannheim Biochemicals, Indianapolis, IN) in the presence of dNTPs (0.5 mM each).
  • Vaccinia virus H6 promoter sequences and a multiple cloning region situated 3' to the promoter were excised from pFPCVl by digestion with KpnI/Hpal.
  • This 200 bp fragment was blunt-ended with T4 DNA polymerase in the presence of dNTPs (0.5 mM each) and inserted into the linearized blunt-ended plasmid pRW764.2.
  • the resultant plasmid was designated pCPCVl.
  • the plasmid pCPCVl was digested with Nrul and Hindlll and the 5.8 Kb fragment was isolated for ligation to the 1.4 Kb EHV gp13 containing fragment described above.
  • the resultant plasmid was designated pCPEHV13A. This plasmid was used in in vitro recombination experiments for insertion of the H6 promoted EHV gp13 gene into the C3 locus of the CP genome.
  • the recombinant canarypox virus was designated VCP48.
  • recombinant avipoxvirus containing the EHV-1 gp13 gene were identified by a standard plaque hybridization assay. Positive plaques were purified by 3 cycles of plaque isolation followed by hybridization analyses. Recombinants were designated as vFP44 and vCP48 for FP and CP recombinants, respectively. Both recombinants were analyzed using a Protein A-B- galactosidase immunoscreen assay with a monoclonal antiserum to EHV-1 gp13. The results demonstrated that CEF and VERO cell monolayers infected with either vFP44 or vCP48 express the EHV-1 gp13 on the surface of virus infected cells.
  • EHV-1 gp14 containing constructs (Example 2) were modified in three ways: (a) varying the length of the EHV-1 gp14 leader sequence; (b) removing excess EHV-1 DNA 3' from the gene; and (c) inserting the modified versions of the EHV-1 gp14 gene into a vaccinia virus vP293 host range selection system (69) for evaluation.
  • the EHV-1 gp14 gene product contains an unusually long leader sequence.
  • a long hydrophobic sequence extending from amino acids 58 through 99 is proposed to be the signal sequence. This region is preceded by a long hydrophilic sequence.
  • a similar long leader sequence has also been noted for two other gB homologs, pseudorabies virus gll (62) and bovine herpesvirus 1 gl (63).
  • EHV-1 gp14 Modification of the 5' end of EHV-1 gp14.
  • plasmids containing the EHV-1 gp14 gene with three different lengths of leader sequence were constructed by modifying the previous EHV-1 gp14 containing constructs in the following ways.
  • Example 2 contains the entire EHV-1 gp14 coding sequence under the control of the H6 promoter inserted into the
  • pVM2LH6g14 amino acid number 2 of the EHV-1 gp14 gene is present as His rather than the native Ser.
  • Nsil recognition sequence ATGCAT
  • Mutagenesis was performed (19) using synthetic oligonucleotide MPSYN240 (5' ATCCGTTAAGTTTGTATCGTAATGTCCTCTGGTTGCCGTTCTGTC 3').
  • the resulting plasmid, pMP14M contains the entire EHV-1 gp14 gene with the native codon (Ser) at position 2.
  • Plasmid pVM2LH6g14-1 (Example 2) is identical to pVM2LH6g14 except for a truncation of the leader sequence and introduction of four codons derived from synthetic Nsil linkers.
  • the sequence of the 5' truncated end of the EHV-1 gp14 gene is ATG/CAT/GCA/TGC/ATT/GCT. . . encoding Met/His/Ala/Cys/Ile/Ala. . .where GCT (Ala) is codon 35 of EHV-1 gp14.
  • pVM2LH6g14-1 was modified by mutagenesis (19) in two ways.
  • pVM2LH6g14-1 was cut with Nsil at codons 1 - 2. Mutagenesis was performed using synthetic oligonucleotide MPSYN241
  • the EHV-1 gp14 coding sequence begins with ATG/AGT/GTC/CCA. . .Met/Ser/Val/Pro. . .where CCA (Pro) is amino acid 36 of EHV-1 gp14.
  • the EHV-1 gp14 gene contains an Nael site (GCCGGC) at codons 61 - 63 (Lys/Pro/Ala).
  • pVM2LH6g14-1 was linearized with Nael, followed by digestion with Nsil and isolation of vector fragment from an agarose gel. Mutagenesis was performed using synthetic oligonucleotide MPSYN243
  • the EHV-1 gp14 coding sequence begins with ATG/GCA. . .Met/Ala. . .where GCA (Ala) is amino acid 63 of the native EHV-1 gp14.
  • EHV-1 gp14 containing plasmids discussed above, the EHV-gp14 coding sequences are followed by approximately 1200 bp of EHV-1 DNA.
  • the termination codon (TAA) for the gp14 gene occurs within a Dral site (TTTAAA) .
  • TTTAAA Dral site
  • pMP14M-63 was subjected to partial Dral digestion followed by isolation of linear DNA from an agarose gel, and digestion with PstI which cuts at the junction of EHV-1 DNA and the downstream vaccinia flanking arm. A 6.5 Kb Dral/Pstl DNA band was isolated from an agarose gel.
  • H6 promoter/EHV-1 gp41 gene Insertion of the H6 promoter/EHV-1 gp41 gene into a pHES/vP293 selection system.
  • EHV-1 gp14 containing plasmids discussed above the EHV-1 gp14 gene is under the control of the vaccinia H6 promoter inserted into the M2L deletion locus of Copenhagen strain vaccinia virus. Since the M2L insertion locus is located within a larger region of the genome that can be deleted (69), the relocation of the H6 promoter/EHV-1 gp14 expression cassette to a potentially more stable insertion site was investigated. As a,
  • EHV-1 gp14 gene constructs containing different lengths of the leader sequence were moved to the WR pHES/vP293-based host range selection system (69) to allow rapid generation of vaccinia recombinants for
  • Plasmid pHES-4 contains the vaccinia H6 promoter, followed by a polylinker region and the KIL human host range gene (70), all inserted between WR vaccinia arms flanking a 21.7 Kb deletion (69).
  • pHES-4 contains two Nrul sites, one within the H6 promoter and one within flanking vaccinia sequences. pHES-4 was linearized by partial digestion with Nrul and the band containing full length linear DNA was isolated from an agarose gel. This linear DNA was cut at the Xhol site in the polylinker region.
  • pMP14M-63P contains two Nrul sites, one within the H6 promoter and the other within EHV-1 gp14 coding sequences, 0.2 Kb from the 3' end of the gene.
  • pMP14M-63P was linearized with Nrul, followed by digestion with Xhol.
  • a 2.8 Kb Nrul (partial)/Xhol fragment was isolated from an agarose gel. This fragment contains part of the H6 promoter, followed by the form of the modified EHV-1 gp14 gene containing the shortest version of the leader sequence.
  • the 2.8 Kb H6 promoter/EHV-1 gp14- containing fragment derived from pMP14-63P was ligated with the Nrul(partial)/Xhol vector fragment derived from pHES-4.
  • the resulting plasmid, pHES-MP63 contains the H6
  • plasmids pMP14M and pMP14M-34 were cut with Nrul and the 2.8 Kb and 2.7 Kb bands, respectively, isolated from agarose gels.
  • pHES-MP63 was subjected to partial Nrul digestion and a 7.2 Kb fragment isolated from an agarose gel.
  • the 7.2 Kb vector fragment corresponds to pHES-MP63 from which the 2.6 Kb Nrul fragment containing the H6 promoter/EHV-1 gp14 5' end has been removed.
  • Nrul (partial) vector fragment derived from pHES-MP63 was ligated with the 2.8 Kb Nrul fragment from pMP14M,
  • pHES-MPl The 7.2 Kb Nrul (partial) vector fragment derived from pHES-MP63 was also ligated with the 2.7 Kb Nrul fragment from pMP14M-34, generating pHES-MP34.
  • the cloning steps leading to the generation of plasmids PHES-MP63, pHES-MP1 and pHES-MP34 are presented
  • Plasmids pHES-MP1, pHES-MP34 and pHES-MP63 were used as donor plasmids for recombination with vP293 (69), generating recombinant vaccinia viruses vP753, vP765 and vP721, respectively. Recombinant progeny were selected on human MRC-5 cells.
  • VERO cell monolayers were infected with the three EHV-1 gp14- containing recombinant vaccinia viruses. Infected cell monolayers were analyzed for surface immunofluorescence using the EHV-1 gp14-specific monoclonal antibody 3F6.
  • MRC-5 cells were infected by vP753, vP765 and vP721 and proteins were metabolically labeled with 35 S- methionine. Immunoprecipitations were performed with the radiolabeled cell lysates using EHV-1 gp14-specific
  • Immunoprecipitated proteins from cells infected with vP753, vP765 and vP721 are indistinguishable from each other, and are equivalent to the proteins immunoprecipitated from vP613, the EHV-1 gp14-containing vaccinia recombinant produced from plasmid pVM2LH6g14-1. These results indicate that the variations in length of the EHV-1 gp14 leader sequence tested in these recombinants neither enhance nor interfere with proper processing of the gene product.
  • recombinants are protective, with a log 10 PD 50 of 6.2 or better. Differences in protection among the three vaccinia virus recombinants are not statistically significant.
  • a subsequent vaccinia virus recombinant which was also generated by recombination between pVM2LH6g14 and vP458 shows an identical EHV-1 gp14 immunoprecipitation pattern to the one seen with vP613, vP753, vP765 and vP721 and, like these EHV-1 gp14 expressing recombinant vaccinia virus, expressed the EHV-1 gp14 protein on the surface of infected cells.
  • EHV-1 gD which on sequencing showed homology with the products of the HSV gD and PRV gp50 genes
  • EHV-1 gp63 which showed homology with the products of the HSV US7 and PRV gp63 genes
  • EHV-1 gE which showed homology with the products of the HSV gE and PRV gl genes. All three genes, either individually or in association, were cloned in a host range selection system of the Copenhagen vaccinia strain for rapid expression studies. Immunofluorescence obtained with an anti-EHV-1 rabbit serum revealed the expression of EHV-1 specific products.
  • EHV-1 gp17/18 gene was located on the S component of the EHV-1 genome (3), the BamHI D fragment which represents most of the U s region (59) was isolated and cloned.
  • EHV-1 genomic DNA of Kentucky D strain was digested with BamHI.
  • the 11.0 Kb BamHI D fragment was isolated from agarose gel (Geneclean, Bio101, Inc., La Jolla, CA) and cloned in plasmid pIBI24 as plasmid pEHVBamHID. A restriction map of this fragment was derived (FIG.11).
  • DNA sequence analysis of the EHV-1 gD, gp63 and gE genes The DNA sequence analysis of the 6402 bp region sequenced from the BamHI D fragment (representing most of the unique short region) revealed the existence of at least three complete open reading frames reading all from the same strand. This sequence is presented in FIG. 12 as the rightward 5' to 3' strand.
  • the base composition is 50.44% G + C.
  • the first open reading frame extended from nucleotide positions 971 to 2176. Putative transcriptional regulatory signals were found in the region 5' to the most probable ATG initiation codon at position 971.
  • a TATA box having the sequence TATATTAA (nucleotides 871 to 878) was located 60 nucleotides downstream from a putative CAT box at positions 811 to 817 having the sequence TGACAAT.
  • No polyadenylation signal (AATAAA) was found downstream of the TAA termination codon (nucleotides 2177 to 2179). Seven out of ten nucleotides in the sequence 5' TCCCTTCGCC 3'
  • nucleotides 890 to 899 are complementary to the 18S ribosomal RNA sequence 3' AGGAAGGCGT 5' (61) and may serve as the ribosome binding site.
  • a scanning model has been proposed by which eukaryotic mRNAs initiate translation (151). The cardinal rule of this model is that ribosomes bind to the 5' end of the mRNA and linearly scan the mRNA molecule. Commitment to the translation initiation is usually at the first 5' proximal ATG codon although
  • the EHV-1 ORF1 encodes 402 amino acids with a calculated molecular mass of 45239 daltons.
  • amino acids 351 to 374 Analysis of the amino acid sequence revealed a number of features common to membrane-associated glycoproteins. A region extending from amino acids 1 to 26 had a characteristic hydrophobicity profile and is proposed to be the signal sequence. A hydrophobic region consisting of 24 amino acids (amino acids 351 to 374) is predicted to
  • glycoprotein molecule respectively, of the glycoprotein molecule.
  • EHV-1 ORF1 protein is similar to PRV gp50 (95) and HSV-1 gD (79,160).
  • the second open reading frame (ORF2) extended from nucleotide positions 2287 to 3525. No putative
  • transcriptional regulatory signals were found in the region 5' to the ATG initiation codon at position 2287. No AATAAA polyadenylation signal was found downstream of the TGA termination codon (nucleotides 3526 to 3528) but two
  • YGTGTTYY polyadenylation signals 180 are located downstream of this termination codon at approximately 40 and 70 bp.
  • the sequence context around the proposed initiation codon GCTATGG is consistent with Kozak's rules (151,155). There are at least two other possible ATG initiation codons at positions 2305 to 2307 and 2332 to 2334 but the sequence context of these two codons (GGGATGT and TCTATGG) does not qualify as functional for translation initiation.
  • the EHV-1 ORF2 encodes a 413 amino acid polypeptide with a calculated molecular mass of 45431 daltons.
  • a region extending from amino acids 1 to 22 had a characteristic hydrophobicity profile and is proposed to be the signal sequence (although the computer score for the putative cleavage site was low).
  • a hydrophobic region consisting of 32 amino acids is predicted to function as a transmembrane anchor domain.
  • glycoprotein molecule glycoprotein molecule
  • EHV-1 ORF2 amino acid sequence Comparison of the EHV-1 ORF2 amino acid sequence to other herpesvirus glycoproteins. Comparison of the amino acid composition of the EHV-1 ORF2 revealed significant homology with glycoproteins of other herpesviruses. Thus, the EHV-1 ORF2 protein is homologous to PRV gp63 (80), VZV gpIV (181) and HSV-1 US7 (79).
  • the third open reading frame extended from nucleotide positions 3796 to 5451. Putative transcriptional regulatory signals were found in the region 5' to the ATG initiation codon at position 3796.
  • a TATA box having the sequence GTTTAAA was located 50 nucleotides downstream of a putative CAT box at positions 3649 to 3654 having the sequence GCAATG.
  • the EHV-1 ORF3 encodes a 552 amino acid polypeptide with a calculated molecular mass of 61493 daltons.
  • a hydrophobic region consisting of 38 amino acids (positions 404 to 437) is predicted to function as a transmembrane anchor domain. There are five Asn-X- Thr/Ser sites for potential N-linked glycosylation.
  • a hydrophobicity plot of the EHV-1 ORF3 amino acid sequence is shown in FIG. 15. The characteristics of a membrane
  • glycoprotein molecule respectively, of the glycoprotein molecule.
  • EHV-1 ORF3 protein is homologous to PRV gl (80), VZV gE (181) and HSV-1 gE (79).
  • a Copenhagen vaccinia virus based host range selection system similar to the WR
  • pHES/vP293 host range selection system (69) was constructed.
  • Copenhagen vaccinia virus deletion mutant vP668 is deleted for 12 genes from the Hindlll C through Hindlll K region, including both human host range genes KIL (70) and C7L, a gene which maps to Hindlll C. vP668 is unable to grow on human MRC-5 cells.
  • Members of the COPCS plasmid series contain the C7L gene within flanking vaccinia arms, allowing recombination with vP668 and restoration of the ability of the virus to grow on MRC-5 cells.
  • the ability of recombinant vaccinia progeny generated by recombination using the vP668/COPCS host range selection system to plaque on human MRC-5 cells provides a means of rapid
  • Plasmid pCOPCS657 contains the synthetic H6 vaccinia promoter followed by a polylinker cloning region for the insertion of foreign genes. The polylinker region is followed by stop codons and a vaccinia transcriptional termination signal (45).
  • plasmid pEHVBamHID was digested with Hindlll and a 1240 bp Hindlll DNA fragment containing EHV-1 gD was isolated from an agarose gel (Geneclean, Bio10, Inc., La Jolla, CA) and repaired using the Klenow fragment of DNA polymerase. The repaired fragment was then ligated into plasmid pCOPCS657 digested with Smal. The resulting plasmid, pJCA006, has the ATG initiation codon approximately 10 bp from the H6 promoter (FIG. 16).
  • Plasmid pEHVBamHID was digested with Hindlll. EcoRI and
  • PvuII and the 1300 bp Hindlll-PvuII DNA fragment containing EHV-1 gp63 was isolated from an agarose gel and repaired with Klenow. The repaired fragment was then ligated into plasmid pC0PCS657 digested with Smal. The resulting plasmid with EHV-1 gp63 in the proper orientation relative to the H6 promoter was designated pJCA008 (FIG. 16).
  • Plasmid pEHVBamHID was digested with Aatll and Apal and a 2630 bp Aatll-Apal DNA fragment containing EHV-1 gE was isolated from an agarose gel and repaired with Klenow. The repaired fragment was then inserted into plasmid pC0PCS657 digested with Smal . The resulting plasmid with the EHV-1 gE gene in the right orientation relative to the H6 promoter was designated pJCA007 (FIG. 16).
  • Plasmid PJCA006 was digested with Clal and EcoRI and the 1450 bp
  • Clal-EcoRI DNA fragment (B) was isolated from an agarose gel. Plasmid pCOPCS657 was digested with Clal and Smal and the 3700 bp Clal-Smal DNA fragment (C) was isolated from an agarose gel. Fragments A, B and C were then ligated
  • Plasmid pEHVBamHID was digested with EcoRI and SacII and the 4240 bp EcoRI-SacII DNA fragment (D) was isolated from an agarose gel. Fragment D was then ligated with fragments B and C (see above) with addition of dNTPs to ensure the repair of the junction SacII-Smal. The resulting plasmid was designated pJCA010 (FIG. 17).
  • Vaccinia recombinant vP773 was obtained from recombination performed with donor plasmid pJCA006
  • Vaccinia recombinant vP822 was obtained from recombination performed with donor plasmid pJCA008 containing the EHV-1 gp63 gene. Vaccinia
  • recombinant vP803 was obtained from recombination performed with donor plasmid pJCA007 containing the EHV-1 gE gene.
  • Vaccinia recombinant vP809 was obtained from recombination performed with donor plasmid pJCA009 containing the EHV-1 gD-gp63 fragment and vaccinia recombinant vP810 was obtained from recombination performed with donor plasmid pJCA010 containing the EHV-1 gD-gp63-gE fragment (Table 5).
  • the Copenhagen strain of vaccinia virus and its derivatives vP410, vP425 and vP458 (184) were utilized in this example.
  • PRV NIA 3 virus (182) was propagated on NIL 2 cell culture (183). Cellular debris was removed from the
  • the virions were purified by centrifugation through a 40% (wt/vol) sucrose cushion at 40,000 rpm for 60 minutes in a 45 Ti Beckman rotor followed by a discontinuous 30-50%
  • the viral pellet was resuspended in TE buffer (50 mM Tris-HCl pH7.8, 10 mM EDTA) and lysed by addition of sodium dodecyl sulfate to a final concentration of 0.5% (wt/vol) and proteinase K to 100 mg/ml. After incubation at 37°C for 2 hours the lysate was extracted once with phenol:chloroform (1:1) and once with
  • the DNA sequence encoding the gpll gene resides in the BamHI fragment 1 and Sall subfragments 1A and 1B of the PRV genome (62, 94).
  • the plasmid designated pPR9.25 containing the PRV BamHI fragment 1 inserted into the BamHI site of pBR322 was digested with Ncol.
  • the resulting DNA digest was fractionated on a 0.8% agarose gel and a 6.2 Kb Ncol DNA fragment was purified using Gene CleanTM procedure (Bio101, Inc. La Jolla, CA) and subsequently inserted into the Ncol site of pBR328 (Boehringer Mannheim Biochemicals, Indianapolis, IN) treated with CIAP.
  • the resulting plasmid pPR2.15 was digested with SphI and fractionated on an agarose gel. The 2.7 and 1.8 Kb fragments were purified and inserted into the SphI site of phosphatased pUC18 to create plasmids pPRl and pPR2 (FIG. 18) and into M13 phage. Nucleotide sequence was determined as described above. The DNA sequence analysis revealed an open reading frame of 2742 bp encoding 913 amino acids.
  • the DNA sequence encoding the PRV glycoprotein gpIII resides in the BamHI fragments 2 and 9 of the PRV genome (96).
  • the plasmid pPR9.9 containing the BamHI fragment 2 inserted into the
  • BamHI site of pBR322 (FIG. 20) was digested with BamHI and SphI.
  • the plasmid pPR7.5 containing the BamHI fragment 9 inserted into the BamHI site of pBR322 was digested with
  • the DNA resulting from both digestions was fractionated on an agarose gel.
  • the 2.35 Kb SphI-BamHI fragment and the 1.1 Kb Ncol-BamHI fragment were purified and ligated into the EcoRI-SphI sites of phosphatased IBI25 (FIG. 20) using an Ncol-EcoRI phosphorylated linker
  • a plasmid designated pPR17 was isolated which contained a 3450 bp SphI-Ncol fragment including the complete PRV gpIII gene (FIG. 20).
  • the nucleotide sequence was obtained from double stranded plasmid templates denatured with alkali and from single stranded templates after cloning into M13 phage.
  • the DNA sequence analysis revealed an open reading frame of 1440 bp encoding 479 amino acids (FIG. 21). Significant homology to HSV gC was observed as previously reported (96). Referring now to FIGS. 22 and 23, the DNA sequence encoding the PRV glycoprotein gp50 resides in the BamHI
  • Plasmid pPR7.1 (FIG. 22) containing the PRV BamHI fragment 7 inserted into the BamHI site of pBR322 was digested with StuI and Ndel and treated with Mung bean nuclease. The 1.7 Kb fragment was purified from an agarose gel, inserted into the HincII site of
  • This plasmid, pPR22, (FIG. 22) contains the entire PRV gp50 gene. Determination of the nucleotide sequence revealed a 1215 bp open reading frame encoding 404 amino acids (FIG. 23). Significant homology to the HSV-1 gD was observed as previously reported (95).
  • pPR6 was digested with Hindlll and Apal and treated with CIAP.
  • the Apal site is located 32 bp
  • the synthetic DNA was ligated to the 3920 bp Hindlll-Apal fragment derived from pPR6 to generate plasmid pPR9 (FIG.
  • Plasmid pPR9 was digested with BamHI and Nhel,
  • plasmid pPR10 was digested with Hindlll and Nael and treated with CIAP.
  • the Nael site is located 44 bp upstream of the
  • the underlined sequences correspond to the PRV gpll termination codon and to a vaccinia early transcription termination signal (45).
  • Hindlll-EcoRV digested 2780 bp fragment from pPR15 was treated with Mung bean nuclease, purified from an agarose gel and inserted into plasmid pTP15 (184) (FIG.3)
  • PRV gpll is linked with the synthetic vaccinia H6 promoter in the vaccinia hemagglutinin deletion locus.
  • This plasmid was transfected into vaccinia virus infected cells to generate vaccinia recombinants vP534, vP644, v621 and vP692 containing the PRV gpll gene (see below).
  • the PRV gpIII gene was manipulated to be expressed under the control of the early vaccinia virus promoter, ⁇ , (see below) located in the vaccinia Hindlll B fragment.
  • an Nsil site was introduced by changing the sequence CGC (bases 192-194) (FIG. 21) in
  • PRV gpIII to ATG and an Xbal site was introduced by changing the sequence GTGACGT to TTCTAGA (bases 1632-1638) (FIG. 21).
  • To do this single stranded DNA was generated from plasmid pPR17 using a helper phage R408 (Stratagene, La Jolla, CA) (185).
  • the site directed mutagenesis was performed using two purified phosphorylated synthetic oligonucleotides
  • Plasmid pPR28 was digested with Nsil and Xbal and treated with Mung bean nuclease. A 1440 bp fragment was purified from an agarose gel and inserted into the Bglll-Hpal sites of pSD478VC (FIGS. 20,24) after treatment with Mung bean nuclease and CIAP. Plasmid pPR24 was transfected into vaccinia virus infected cells to generate vaccinia virus recombinants vP604, vP644, vP691 and vP692 containing the PRV gpIII gene (see below).
  • PRV gp50 was manipulated to be expressed under the control of an early/intermediate vaccinia virus promoter, I3L (167).
  • I3L an early/intermediate vaccinia virus promoter
  • an Nsil site was introduced by changing the sequence, CCTGCCAGCGC (bases 177-167) (FIG. 23) in gp50 to ATGCATTTAAT and a Bglll site was introduced by changing the sequence CCTCCGCAGTACCGG at bases 1404-1418 (FIG. 23) to AATTTTTATAGATCT.
  • Previously described procedures (17,185,186) of mutagenesis were employed to generate plasmid pPR29 from pPR22 using
  • MRSYN13 5'GCAGCCCGGTCCGTAGAATTTTTATAGATCTCGTCGATGATGATGGT 3' pPR29 was digested with Nsil, treated with Mung bean nuclease and partially digested with Bglll to generate a 1290 bp fragment.
  • Plasmid pMP13PP (FIGS. 22,25) was digested with EcoRI, treated with Mung bean nuclease and then with BamHI to generate a 140 bp fragment containing the vaccinia I3L promoter.
  • the 1290 and 140 bp fragments were purified from agarose gels and ligated into the phosphatased Bglll site of pMP409DVC (FIGS.4,22).
  • the resulting plasmid, pPR26 was used in recombination to produce vaccinia virus recombinants vP591, vP621, vP691 and vP692 containing the gp50 gene (see below).
  • vaccinia recombinants expressing PRV glycoproteins gpll. gpIII and gp50 individually or in combinations.
  • PRV glycoproteins gpll, gpIII and gp50
  • a series of vaccinia recombinants were constructed expressing the three PRV glycoproteins alone or in combination.
  • vaccinia virus vP533, expressing the Beta-galactosidase gene was constructed as follows: A 1 Kb region within vaccinia
  • Hindlll fragment B spanning the Sall F/I junction of the Copenhagen genome contains DNA homology with the hemorrhagic ( ⁇ ) gene of cowpox virus (188) as determined by Southern blot analysis (189).
  • the ⁇ gene encodes a polypeptide with similarity to serine protease inhibitors and biologically is responsible for hemorrhagic pock formation by virus on the chorioallantoic membrane.
  • Plasmid pSD419VC (184) (FIG. 24) contains the left portion of the ⁇ region. Plasmid pSD422VC, which contains the Copenhagen Sall fragment I cloned into pUC8, contains the remainder of the ⁇ region. To remove unwanted vaccinia sequences to the left, pSD419VC was digested with Ncol and Smal, blunt-ended with the Klenow fragment of E. coli polymerase and religated resulting in plasmid pSD476VC (FIG. 24).
  • Plasmid pSD422VC was digested with Hpal and Nrul and an approximately 0.3 Kb fragment located immediately to the right of the ⁇ region was isolated from an agarose gel. This fragment was ligated into pSD476VC cut with HincII (which recognizes Sall sites) resulting in plasmid pSD477VC. To express Beta-galactosidase under the control of the
  • oligonucleotides 22mer/20mer were prepared. The sequence of 22mer/20mer with restriction sites indicated and ATG
  • the annealed 22mer/20mer mixture was ligated into pSD477VC digested with Clal and HincII resulting in the novel plasmid pSD479VC (FIG. 24).
  • a 3.1 Kb BamHI fragment containing the E. coli Beta-galactosidase coding sequences from pMC1871 (34) devoid of initiation codon and promoter was ligated into pSD479VC cut with BamHI.
  • pSD479VCBG This insertion donor plasmid was recombined into vaccinia virus vP410 (184).
  • a recombinant vaccinia virus was identified on the basis of blue plaque formation in the presence of the chromogenic substrate, X-gal (9,24), plaque cloned and designated vP533 (FIG. 24).
  • plasmid pMP419 contains an 850 bp BamHI fragment from vaccinia Hindlll fragment I containing the I3L promoter inserted into the BamHI site of pUC8 (FIG. 25).
  • the I3L promoter element corresponds to DNA sequences upstream of the I3L open reading frame in the vaccinia Hindlll fragment I (187) and has been used
  • pMP419 was linearlized at the unique Clal site within I3L coding sequences and subjected to Bal 31 digestion followed by digestion with EcoRI and blunt- ending by treatment with the Klenow fragment of E. coli polymerase.
  • the resulting plasmid, pMP419-5, (FIG. 25) contains the I3L promoter sequences upstream of nucleotide - 8 linked to an EcoRI site.
  • the promoter element was
  • pMP13PP (FIGS. 22,25) contains the I3L promoter sequences from position -126 through position -8 followed by an EcoRI site at position -8.
  • PRV gp50 driven by the vaccinia I3L promoter was inserted into the M2L deletion plasmid vector pMP409DVC (FIG.4) resulting in pPR26 (FIG. 22).
  • pPR26 was used to generate vaccinia recombinants vP591, vP621 and vP691 and vP692.
  • Recombinant vaccinia viruses containing the PRV genes were identified and purified as described above.
  • Recombinant vaccinia viruses expressing the three PRV glycoproteins gpll, gpIII, and gp50 alone or in combination are listed in Table 7.
  • glycoproteins gpll, gpIII and gp50 are typical glycoproteins associated with the membranous structure of PRV infected cells and are additionally components of the virus. Anti- gpll, anti-gpIII and anti-gp50 specific monoclonal
  • mice inoculated in the footpad with 50 to 100 ul of different doses of the recombinant viruses.
  • Fourteen days after the immunization the mice were challenged with 10 LD 50 of the virulent Kojnock strain of PRV by the intraperitoneal route.
  • each of the PRV glycoproteins were shown to be efficacious in protecting inoculated mice against a virulent PRV challenge.
  • the efficacy of vaccinia recombinants expressing PRV glycoproteins was assessed.
  • the vaccination dose able to protect 50% of the challenged mice (PD 50 ) was calculated and the results of these studies are shown in Table 8.
  • Recombinant vaccinia virus expressing individually PRV glycoproteins gpll, gp50 and gpIII generate calculated PD 50 values of 6.4, 5.4 and 5.8 (log 10 ), respectively. When the glycoproteins are expressed in combination significantly better PD 50 values are calculated.
  • the vaccinia recombinant expressing PRV gpll plus gp50 generated a PD 50 value of 3.3, whereas the vaccinia recombinant expressing PRV gp50 plus gpIII results in an essentially similar PD 50 value (3.6). Apparently more efficacious is the recombinant expressing PRV glycoproteins gpll plus gpIII where a PD 50 of 1.5 is obtained.
  • Coexpression of all three PRV glycoproteins gpll, gpIII and gp50 in a recombinant vaccinia virus does not provide a PD 50 value significantly lower than those obtained with the recombinant viruses expressing the three PRV glycoproteins individually.
  • the potentiated efficacy obtained with the vaccinia recombinant expressing gpll and gpIII compared to vaccinia recombinant virus expressing the genes individually is similar to the results reported in Example 6 for the coexpression of equine herpesvirus glycoproteins gp13 and gp14.
  • Virus inoculum was diluted in PBS. Thirty five days after this inoculation, the piglets were challenged by an intranasal injection (1 ml into each nostril) of a virulent PRV isolate NIA3
  • the effectiveness of vaccination was evaluated by measuring comparative weight gain of vaccinated and control piglets for seven days after challenge. Relative weight gain is calculated as the daily mean percentage weight gain observed in vaccinated pigs minus the daily mean percentage weight gain of unvaccinated control pigs. Normal weight gain of pigs in unperturbed conditions is greater than 1.1 kg. As demonstrated by the data in Table 9, weight evolution during the seven day period after PRV challenge is greatly enhanced in the vaccinated piglets over the wildtype virus inoculated control set. A single inoculation with the vaccinia virus recombinants gives significant protection against weight loss after virulent PRV challenge.
  • vaccinia virus recombinants expressing the three dominant PRV glycoproteins individually or in combination offer a number of advantages to the control of PRV infections in the field: (a) one significant advantage is that the recombinant vaccinia viruses as vaccinating agents express only a limited number of PRV genes and, therefore, there is no attendant risk of
  • Maternal immunity should protect the offspring from PRV infection.
  • the offspring then could be vaccinated with a vaccinia virus recombinant expressing yet a different configuration of PRV antigens distinct from those used to vaccinate the sow.
  • Canarypoxvirus was propagated on primary chick embryo fibroblasts (CEF) derived from 10 to 11 day old embryonated eggs obtained from SPAFAS, Inc. (Norwich, CT) using conditions described previously (41,42). Virus was purified from host cell contaminants by sucrose gradient centrifugation using the method described by Joklik (191). Pig kidney (PK-1) cells were obtained from American Type Culture Collection, Rockville, MD (ATCC #CL101).
  • CEF chick embryo fibroblasts
  • the plasmid pPR15 (FIG.18) was utilized as the source of the PRVgpII gene. To isolate the DNA segment containing the entire PRVgpII gene, pPR15 was digested with EcoRV and Hindlll. A fragment of
  • the 2.8 Kb EcoRV/Hindlll fragment (defined above) was inserted into the 8.0 Kb pFPCV2 fragment derived by complete digest with Hindlll and partial digestion with
  • plasmid pFPPRVII was utilized to generate a 2.8 Kb Nrul/Hindlll fragment for insertion into pCPCVl (FIG.9).
  • the pCPCVl plasmid contains the W H6 promoter in the unique EcoRI site within the 3.3 Kb PvuII CP genomic fragment. This insertion plasmid enables the insertion of foreign genes into the C3 locus of the CP genome.
  • the plasmid pCPCVl was digested with Nrul and Hindlll and the 5.8 Kb fragment was isolated for ligation to the 2.8 Kb fragment defined above. The
  • E. coli xanthineguanine phosphoribosyl transferase (Eco gpt) was inserted into pCPPRVII as a means of growth selection for CP/PRVgpII recombinants.
  • Eco gpt The dominant selectable marker E. coli xanthineguanine phosphoribosyl transferase was inserted into pCPPRVII as a means of growth selection for CP/PRVgpII recombinants.
  • Eco gpt The Eco gpt gene was obtained from the plasmid pSV2gpt (ATCC #37145).
  • PSD486VC The resulting plasmid, pGPT-1, contains the Eco gpt gene between the W ⁇ gene flanking arms and under the transcriptional regulation of the ⁇ promoter.
  • the plasmid PSD486VC was derived from pSD478VC (FIG.24) in the following manner. pSD478VC was digested with EcoRI in the MCR, filled in by Klenow standard reaction in the presence of dNTP (0.5 mM each) and religated to produce pSD478E VC. This plasmid was digested with Hpal and BamHI and annealed
  • oligonucleotide HEM 5 (5'-GATCCGATTCTAGCT-3') and HEM 6 (5'- AGCTAGAATCG-3') were inserted to produce pSD486VC.
  • the resultant plasmid containing the Eco gpt and PRVgpII genes linked in a tail to tail configuration was designated as pCPPRVII gpt. This plasmid was used in in vitro recombination experiments for insertion into the C3 locus of the CP genome. Selection of recombinants
  • CEF or PK-1 cells were seeded on 22 mm glass coverslips in 35 mm dishes at 5 x 10 5 cells/dish. CEF and PK-1 cells were infected with either VCP55 or the CP parental virus. Infections and incubations for the
  • the infected cells were analyzed for both internal and surface expression. No significant surface expression of gpll was observed in either cell system infected with vCP55. Internal expression of the gpll gene product was, however, demonstrated in both VCP55 infected CEF cells and PK-1 cells. The internal fluorescence signals in both cell types were localized to granules in the perinuclear region of the infected cells.
  • PRVgpII expressed by CP is trafficked to the golgi complex but not to the plasma membrane. This result differs from the results with vaccinia virus expressed gpll which was detected on the surface of infected cells.
  • polypeptides represent the precursor and proteolytically processed forms
  • polypeptides were precipitated from control CP virus
  • mice were inoculated in the footpad with 50 ul to 100 ul samples containing various doses of vCP55 shown in Table 10.
  • mice Fourteen days following immunization the mice received 16 LD 50 of the Kojnock strain of PRV by the intraperitoneal route. Survivors were counted 14 days after challenge at which point the experiment was concluded. As demonstrated in Table 10, inoculation of mice with a single dose of 10 6.85 TCID 50 protected eight out of ten mice from a lethal
  • VCP55 as an immunizing agent against live PRV challenge was also evaluated in the target species, the piglet. Fifteen piglets weighing nearly 25 kg were separated into three groups. The vCP55 group and the CP parental virus group each received two inoculations (2 ml equaling 2x10 8 TCID 50 ) on days 0 and 28 by the intramuscular route. Five piglets were left as unvaccinated controls.
  • inoculated groups four of the five piglets succumbed to challenge (three on day six, one on day seven). All the piglets in the vCP55 vaccinated group survived PRV challenge and thrived.
  • plasmid pGPI containing the PRVgl gene (NIA3 strain) was obtained from Rhone Merieux, Lyon, France.
  • the gl gene (sequence reference (80)) was isolated from this plasmid and cloned downstream of the vaccinia synthetic H6 promoter (69). This was accomplished by cloning the 2,330 bp Xhol- Ncol (partial) fragment of pGPI into the 6,400 bp Xhol-Ncol fragment of pGBC2.
  • pGBC2 was generated by cloning the HSV2 gB gene into the 3,200 bp Bglll fragment of pRW764.5.
  • pRW764.5 was constructed by cloning a 0.8 Kb PvuII fragment from canarypox DNA into the 2,360 bp PvuII fragment of pUC18.) The plasmid generated by this manipulation is designated pPGI2.
  • the initiation codon of the H6 promoter was then aligned with the initiation codon of the gl gene. This was accomplished by cloning the oligonucleotides, PRVL5 5'- ATCCGTTAAGTTTGTATCGTAATGCGGCCCTTTCTGCTGCGCGCCGCGCAGCTC-3 ' and PRVL6 5'- CTGCGCGGCGCGCAGCAGAAAGGGCCGCATTACGATACAAACTTAACGGAT-3 ', into the 5,900 bp EcoRV-AlwNI (partial) fragment of pPGI2. The plasmid generated by this manipulation is designated pPG13.
  • pBP14 contains the Bovine leukemia virus gag gene under the control of the synthetic vaccinia H6 promoter in vaccinia vector plasmid pSD494VC.
  • pSD494VC is a subclone of the Copenhagen vaccinia virus Hindlll A fragment in which the coding sequence of the vaccinia gene containing homology to the cowpox ATI gene (210) is replaced by a polylinker region.
  • the plasmid generated by this manipulation is designated pPGI7.
  • the recombinant vaccinia virus vP717 was generated by transfecting pPGI7 into vP410 infected cells.
  • vP717 Construction of vP717.
  • the gl gene of PRV was cloned into a vaccinia virus vector.
  • the strategy used to construct this vaccinia virus recombinant, vP717, is
  • the PRVgl gene contained in vP717 is cloned between the vaccinia virus sequences flanking the ATI gene and utilizes the vaccinia virus early-late promoter, H6 (41,42,69).
  • HSV2 gB gene Cloning of the HSV2 gB gene into vaccinia virus donor plasmids.
  • the nucleotide sequence of the HSV2 gB gene has been previously published (116). Referring now to FIG. 29, a 12 Kb Bglll fragment containing the HSV2 gB gene was isolated from HSV2 (strain G) genomic DNA and inserted into the BamHI site of pUC19 generating the plasmid pJ4.
  • the gB gene was then cloned between vaccinia virus
  • pMP409DVC3 is a derivative of pMP409DVC (184) (FIG.4) in which the Belli site is replaced by a polylinker region). This places the gB gene between the vaccinia sequences flanking the M2L gene.
  • the plasmid generated by this manipulation is
  • the H6 promoter was then cloned upstream of the gB gene. This was accomplished by cloning the 370 bp Bglll fragment of pBLVH14 containing the H6 promoter into the Bglll site of pGB2 (pBLVH14 contains the H6 promoted bovine leukemia virus envelope gene in the vaccinia HA deletion locus).
  • the plasmid generated by this manipulation is designated pGB3.
  • the initiation codon of the H6 promoter was then aligned with the initiation codon of the gB gene. This was accomplished by cloning the oligonucleotides, GBL1 5'- ATCCGTTAAGTTTGTATCGTAATGCGCGGGGGGGGCTTGATTTGCGCGCTGGTCGTGGGG GCGCTGGTGGCCGC-3' and GBL2 5'- GGCCACCAGCGCCCCCACGACCAGCGCGCAAATCA
  • the HSV gB gene is under the control of the vaccinia H6 promoter inserted into the M2L deletion locus of vaccinia. Since the M2L insertion locus is located within a larger region of the genome which can be deleted, the H6- promoted gB gene was cloned into a different insertion site in a different vaccinia virus donor plasmid. This was accomplished by cloning the 2,800 bp Bglll-BamHI fragment of pGB5 into the Bglll site of pSD513VCVQ.
  • pSD513VCVQ is a subclone of the Copenhagen vaccinia virus Hindlll J fragment in which the coding sequence for the thymidine kinase (TK) gene is replaced by a polylinker region). This places the H6-promoted gB gene between the vaccinia virus sequences flanking the TK gene.
  • HSV2 gC gene Cloning of the HSV2 gC gene into vaccinia virus donor plasmids.
  • the nucleotide sequence of the HSV2 gC gene has been previously determined (117).
  • a 2,900 bp Sall fragment containing the HSV2 gC gene was isolated from HSV2 (strain G) genomic DNA and inserted into the Sall site of pIBI25 generating the plasmid pGC3.
  • the gC gene was then cloned between vaccinia virus (Copenhagen) flanking arms. This was accomplished by cloning the 2,900 bp XhoI-BamHI fragment of pGC3 into the XhoI-BamHI site of pGC2.
  • pGC2 was generated by cloning the 370 bp Bglll fragment of pBLVH14, containing the vaccinia virus H6 promoter into the Bglll site of pSD486VC.
  • pSD486VC is a subclone of the Copenhagen vaccinia virus Hindlll B fragment in which the coding sequence of the ⁇ gene is replaced by a polylinker region.
  • the plasmid generated by this manipulation is designated pGC5.
  • the initiation codon of the H6 promoter was then aligned with the initiation codon of the gC gene. This was accomplished by cloning the oligonucleotides,
  • GCL1 5'- ATCCGTTAAGTTTGTATCGTAATGGCCCTTGGACGGGTGGGCCTAGCCGTGGGCCTGTG- 3' and GCL2 5'-
  • plasmid pGC12 the HSV gC gene is under the control of the H6 promoter inserted into the ⁇ deletion locus of vaccinia. Since the ⁇ insertion locus is located within a larger region of the genome which can be deleted, the H6-promoted gC gene was then cloned into the ATI insertion site in a vaccinia virus donor plasmid. This was accomplished by cloning the 1,550 bp NruI-BamHI fragment of pGC12 into the 5,000 bp NruI-BamHI fragment of pBP14. This places the H6- promoted gC gene between the vaccinia virus (Copenhagen) sequences flanking the ATI gene.
  • the plasmid generated by this manipulation is designated pGC13.
  • HSV2 gD gene Cloning of the HSV2 gD gene into vaccinia virus donor plasmids.
  • the nucleotide sequence for the HSV2 gD gene has been previously determined (118).
  • a 7.5 Kb Xbal fragment containing the HSV2 gD gene was isolated from HSV2 (strain G) genomic PNA and inserted into the Xbal site of pIBI25 generating the plasmid pGPI.
  • the gD gene was then cloned downstream of the H6 promoter and between vaccinia virus (Copenhagen) flanking arms. This was accomplished by cloning the 1,500 bp Dral- Pstl fragment of pGP1 into the Smal-PstI site of pTP15 (184) (FIG.3). This places the gD gene downstream of the H6 promoter and between the vaccinia virus sequences flanking the HA gene. The plasmid generated by this manipulation is designated pGP2.
  • the initiation codon of the H6 promoter was then aligned with the initiation codon of the gD gene. This was accomplished by cloning the oligonucleotides, GPL1 5'- ATCCGTTAAGTTTGTATCGTAATGGGGCGTTTGACCTCCGG-3' and GPL2 5'- CGCCGGAGGTCAAACGCCCCATTACGATACAAACTTAACGGAT-3', into the 5,100 bp EcoRV-Ahall (partial) fragment of pGP2.
  • the plasmid generated by this manipulation is designated pGP5.
  • All constructs utilize the vaccinia virus early-late promoter, H6 (41,42,184). Each HSV2 gene, however, is cloned into a different site in the vaccinia virus genome.
  • the H6-promoted gB gene is cloned between the sequence flanking the M2L gene (vP569) or the sequence flanking the TK gene (vP734, vP775 and vP776).
  • the H6- promoted gC gene is cloned between the sequence flanking the ⁇ gene (vP579) or the sequence flanking the ATI gene (vP748, vP776 and vP777).
  • the H6-promoted gD gene is cloned between the sequence flanking the HA gene (vP570, vP761, vP775, and vP777).
  • the recombinant vaccinia virus vP569 was generated by transfecting pGB5 into vP458 infected cells.
  • vP734 was generated by transfecting pGB6 into vP618 infected cells.
  • vP579 was generated by transfecting pGC11 into vP533
  • vP748 was generated by transfecting pGC13 into vP618 infected cells.
  • vP570 was generated by
  • vP761 was generated by transfecting pGP8 into vP618 infected cells.
  • vP425 is a variant of wildtype vaccinia virus (Copenhagen) from which the TK gene has been deleted and the HA gene has been replaced by Beta-galactosidase (Example 1) (184).
  • vP458 is a variant of wildtype vaccinia virus from which the TK gene has been deleted and the M2L gene has been replaced by Beta-galactosidase (Example 2).
  • vP533 is a variant of wildtype vaccinia virus from which the TK gene has been deleted and the ⁇ gene has been replaced by Beta- galactosidase.
  • vP618 is a variant of wildtype vaccinia virus from which the TK, ⁇ and ATI genes have been deleted.
  • vP775 contains the gB and gD genes
  • vP776 contains the gB and gC genes
  • vP777 contains the gC and gD genes.
  • vP775 was generated by transfecting pGP8 into vP734 infected cells.
  • vP776 was generated by transfecting pGC13 into vP734 infected cells.
  • vP777 was generated by transfecting pGP8 into vP748 infected cells.
  • vP812 contains the gB, gC and gD genes of HSV-2. vP812 was generated by transfecting pGP8 into vP776 infected cells.
  • HSV2 glycoproteins infected cells, gB, gC and gD (as well as other HSV2 encoded
  • glycoproteins are expressed on the plasma membrane.
  • HSV2 glycoproteins in recombinant vaccinia virus infected cells.
  • the HSV2 gB glycoprotein produced in HSV2 infected cells has a molecular weight of approximately 117 kPa (198,199).
  • Cells infected with recombinant vaccinia viruses containing the HSV2 gB gene (vP569, vP734, vP775 and vP776) also produce a HSV2 encoded polypeptide with a molecular weight of approximately 117 kPa.
  • Immunoprecipitation of vP569 infected cells with antisera to whole HSV2 virus precipitates two major proteins with molecular weights of approximately 117 kPa and 110 kPa and three minor proteins with molecular weights of 50 kPa, 45 kPa and 30 kPa.
  • Immunoprecipitation of vP734, vP775 and vP776 infected cells precipitates two major proteins with molecular weights of approximately 110 kPa and 90 kPa and five minor proteins with molecular weights of approximately 117 kPa, 100 kPa, 50 kPa, 45 kPa and 30 kPa.
  • the HSV2 gC glycoprotein produced in HSV2 infected cells has a molecular weight of approximately 63 kPa
  • the HSV2 gD glycoprotein produced in HSV2 infected cells has a molecular weight of approximately 51 kPa
  • vP570, vP761, vP775 and Will also produce a HSV2 encoded polypeptide with a molecular weight of approximately 51 kPa.
  • Immunoprecipitation of vP570, vP761, vP775 and vP777 infected cells with antisera to whole HSV2 virus precipitates a major protein with a molecular weight of approximately 48 kPa and two minor proteins with molecular weights of approximately 40 kPa and 31 kPa.
  • glycoproteins protected immunized mice from subsequent lethal HSV challenge in experiments similar to those
  • pIBR2 This was accomplished by cloning the 540 bp Sall-PstI fragment of pIBRS6 into the 4,400 bp Sall-PstI fragment of pGP5 (pGP5 was generated by cloning the HSV2 gD gene into pTP15 (184) (FIG.3). This places the gl gene downstream of the H6 promoter and between vaccinia virus HA flanking arms. The plasmid generated by this manipulation is designated pIBR2.
  • the initiation codon of the H6 promoter was then aligned with the initiation codon of the gl gene. This was accomplished by cloning the oligonucleotides,
  • pIBR4 The plasmid generated by this manipulation is designated pIBR4.
  • Ncol site necessary for future manipulations, was then generated. This was accomplished by cloning the oligonucleotides IBRL3 5'-CCATGGTTTAATGCA-3' and IBRL4 5'- TTAAACCATGGTGCA-3' into the PstI site of pIBR4.
  • the plasmid generated by this manipulation is designated pIBR5.
  • the 3' end of the gl gene was then cloned into pIBR5. This was accomplished by cloning the 1,740 bp
  • the plasmid generated by this manipulation is designated pIBR7.
  • a Bglll site necessary for future manipulations was then generated. This was accomplished by cloning the oligonucleotides IBRL5 5'-CATGGTTTAAGATCTC-3' and IBRL6 5'- CATGGAGATCTTAAAC-3', into the Ncol site of pIBR7.
  • the plasmid generated by this manipulation is designated pIBR8.
  • the H6 promoted truncated gl gene was then cloned into a different vaccinia virus donor plasmid. This was accomplished by cloning the 1,700 bp Nrul-Bglll fragment of pIBR9 into the 4,900 bp NruI-BamHI fragment of pBP14 (211). The plasmid generated by this manipulation is designated PIBR10.
  • vP637 was generated by transfecting pIBR7 into vP410 infectded cells.
  • vP724 was generated by transfecting pIBR10 into vP410 infected cells.
  • vP637 contains the entire BHVl gl gene.
  • vP724 contains a gl gene deleted of 132 bp of 5' signal sequence (63). Both constructs utilize the vaccinia virus early-late promoter, H6 (41,42,184).
  • the gl gene in vP637 is cloned between the sequences flanking the HA gene.
  • the gl gene in vP724 is cloned between the sequences flanking the ATI gene. Immunofluorescence and detection of a BHVl-encoded polypeptide in recombinant vaccinia virus infected cells. In BHV1 infected cells gl is expressed on the plasma
  • the WR strain of vaccinia virus (202) was utilized in this example.
  • the WR strain derived recombinant vaccinia virus vP293 was used as a rescuing virus (69).
  • FHV-1 DNA was extracted and purified from the C O strain.
  • the FHV-1 DNA genome was digested with EcoRI and ligated in plasmid pBR322 using standard procedures (20).
  • This FHV-1 bank was screened with DNA probes derived from the PRVgll (62) and BHV-1 gB (203) genes. Subsequent hybridizations with subclones derived from the two EcoRI clones found positive by hybridization allowed more accurate mapping of the FHV-1 gB gene.
  • a 3.2 Kb SacI-SacI fragment containing the FHV-1 gB gene was cloned into pUC18, thus generating plasmid pFHVgBC.
  • the FHV-1 gB gene was cloned in pHES4, one of the plasmids designed for the host range selection system in WR vaccinia virus strain (69) (FIG.10). This plasmid bears the host range gene KIL which allows the deletion mutant vP293 to replicate on human cells.
  • the FHV-1 gB gene was inserted immediately
  • Plasmid pFHVgBC was digested with Kpnl and SacI and the 3150 bp restriction fragment containing FHV-1 gB was isolated from an agarose gel and then ligated into plasmid pHES4 previously digested with Kpnl and SacI. The resulting plasmid was designated pJCA001 (FIG. 33).
  • DNA sequence analysis revealed an open reading frame extending from nucleotide positions 337 to 3177. Putative transcriptional regulatory signals were found in the region 5' to the ATG initiation codon at position 337.
  • a TATA box having the sequence AAATATAT having the sequence AAATATAT
  • nucleotides 184 to 191 was located 80 nucleotides
  • a polyadenylation signal AATAAA (nucleotides 3251 to 3256) was located 50 nucleotides downstream from the TAA termination codon (nucleotides 3178 to 3180). Eight out of 11 nucleotides in the sequence 5' TCATTCTAGCA 3'
  • nucleotides 200 to 210) are complementary to the 18S ribosomal RNA sequence 3' AGGAAGGCGT 5' (61) and may serve as the ribosome binding site.
  • a scanning model has been proposed by which eukaryotic mRNAs initiate translation (151,155). The sequence context around the proposed
  • initiation codon ATCATGT (nucleotides 334 to 340) qualifies as a functional sequence context for translation initiation of eukaryotic mRNA.
  • the FHV-1 gB open reading frame encodes 947 amino acids with a calculated molecular mass of 106.2 kDa.
  • the G + C content is 45.8%.
  • FHV-1 gB amino acid sequence to other herpesvirus glycoproteins. Comparison of the amino acid composition of the FHV-1 gB gene revealed extensive homology with glycoproteins of other herpesviruses.
  • the FHV-1 gB is homologous to PRVgll (62), BHV-1 gl (63), varicella zoster virus (VZV) gll (66,204), HSV-1 gB (67), HSV-2 gB (205), EHV-1 gp14 (71), as well as to glycoproteins in Epstein-Barr virus (EBV) (68,206) and human
  • HCMV cytomegalovirus
  • the FHV-1 gB coding sequences were inserted into a vaccinia virus vector using the WR vaccinia virus host range selection system
  • pHES4/vP293 (69).
  • Vaccinia virus recombinant vP713 was obtained by recombination performed with plasmid pJCA001 as donor plasmid and vP293 as rescuing virus (FIG. 33).
  • FHV-1 gB was detectable on the surface of VERO cells infected with vaccinia recombinant vP713 as well as internally after acetone fixation. No significant internal or surface immunoreactivity toward FHV-1 gB was seen in vP410 infected control cells.
  • EBV genes were isolated from the B95-8 EBV strain (207), the gp340 and gp220 genes were cDNA clones (plasmids pMLPgp340 and pMLPgp220, respectively), and the gB, gH and BBRF3 genes were isolated from a BamHI genebank.
  • FIG. 36 a 2100 bp Xmal-Clal fragment of pMLPgp220 plasmid was cloned into M13mp18 digested with Xmal-AccI. The phage obtained by this manipulation was designated mp18gp220 (FIG. 36).
  • the gp220 gene was modified to be expressed under the control of the vaccinia H6 promoter.
  • the plasmid containing the modified gp220 gene was designated mpl ⁇ gp220(5+4) (FIG. 36).
  • the modified gp220 gene was cloned into the plasmid SP131NotI which contains the complete H6 synthetic promoter (69). This was accomplished by cloning the 2300 bp Narl-EcoRV fragment of mp18gp220(5+4) into the 2940 bp
  • SP131gp220 EcoRV-NarI fragment of SP131NotI plasmid.
  • the resulting plasmid was designated SP131gp220 (FIG. 36).
  • the H6 promoted gp340 and gp220 genes were cloned into the vaccinia virus M2L insertion locus plasmid
  • pMP409DVC (FIG.4; in FIG. 36, 40 this plasmid is designated MP409). This was accomplished by cloning the 2S00 bp Mung- Bean nuclease treated NotI fragment of the plasmid
  • the gB gene was adapted to be expressed under the control of the vaccinia H6 promoter.
  • the resulting plasmid was designated p25gB(5+3).
  • the 2600 bp EcoRV-EcoRI fragment of p25gB(5+3) was cloned into the 3300 bp EcoRV-EcoRI fragment of SP131.
  • the resulting plasmid was designated SP131gB (FIG. 37).
  • the H6 promoter gB gene was then cloned into the vaccinia virus donor plasmid pMP409DVC. This was
  • the open reading frame BXLF2 is contained in the BamHI X and BamHI T fragments (207). As shown in FIG. 38, the complete BXLF2 open reading frame was
  • oligonucleotides HM5 (ACACAGAGCAACTGCAGATCTCCCGATTTCCCCTCT), HM4 (GGGCAAAGCCACAAAATATGCAGGATTTCTGCG) and HM3 (GCCAGGGTTTTCCCAGAGATCTGATAAAAACGACGGCCAGTG)
  • HM5 ACACAGAGCAACTGCAGATCTCCCGATTTCCCCTCT
  • HM4 GGGCAAAGCCACAAAATATGCAGGATTTCTGCG
  • HM3 GCCAGGGTTTTCCCAGAGATCTGATAAAAACGACGGCCAGTG
  • the plasmid containing the modified gH gene was designated 24gH(5+4+3).
  • the vaccinia ⁇ promoter is contained into the plasmid, pSD486 VC (FIG.30). (In FIG.38, this plasmid is designated SD486).
  • pSD486 VC FIG.30
  • SD486 the plasmid
  • Bglll Mung Bean nuclease treated fragment of 24gH(5+4+3) was cloned into the Bglll Mung-Bean nuclease treated pSD486VC. This last cloning step put the gH gene under the control of the vaccinia ⁇ promoter. The plasmid generated by this manipulation was designated 486gH (FIG. 38).
  • BBRF3 Cloning of the open reading frame BBRF3 into the vaccinia virus donor plasmid pCOPSC-5H.
  • the complete BBRF3 open reading frame is contained in the BamHI B fragment of the EBV DNA. This fragment was digested by BspHI, treated by the E. coli DNA polymerase I (Klenow fragment) and digested by Bglll.
  • the Bglll site within the BamHI A fragment is located 10 bases before the stop codon of BBRF3.
  • the 1230 bp BspHI-Bglll fragment was isolated and cloned into the 4200 bp Smal-Bglll fragment of the plasmid pCOPSC- 5H.
  • Lasmid pCOPCS-5H is identical to plasmid pCOPCS657
  • the plasmid generated by this manipulation was designated COPSCEBVX.
  • vaccinia virus donor plasmid pSD513VCVO The vaccinia virus donor plasmid used to generate the triple EBV recombinant was the plasmid, pSD513VCVQ (FIG.29).
  • This plasmid contains a subclone of the Copenhagen vaccinia virus Hindlll J fragment in which the coding sequence for the thymidine kinase gene is replaced by a polylinker region.
  • the ⁇ promoted EBV gH gene was cloned into pSD513VCVQ.
  • the 2300 bp SnaBI- BglII fragment of 486gH was cloned into the 4000 bp Smal- Bglll fragment of pSD513VCVQ.
  • the plasmid generated by this manipulation was designated 513UgH.
  • the H6 promoted EBV gp340 gene was cloned into 513gH.
  • the 2800 bp NotI Mung-Bean treated fragment of SP131gp340 was cloned into the 6300 bp XhoI-PstI Mung-Bean nuclease treated fragment of 513UgH.
  • the plasmid generated by this manipulation was designated 513UgH340H6.
  • the H6 promoted EBV gB gene was cloned into 513UgH340H6.
  • the 2700 bp Hindlll Mung-Bean nuclease treated fragment of SP131gp340 was cloned into the 9100 bp Bglll Mung-bean nuclease treated fragment of
  • EBV gp340 donor plasmid 409H6340
  • EBV gp220 donor plasmid 409H6220
  • EBV gB donor plasmid 409H6gB
  • vaccinia virus vP458 M2L site
  • vP480 vaccinia virus recombinants
  • vP561 EBV gH (donor plasmid 486gH) was recombined into the vaccinia virus vP533 ( ⁇ insertion site): this single vaccinia virus recombinant is designated vP611.
  • vP712 is a Copenhagen vaccinia virus deleted for TK, HA and ATI genes.
  • EBV gp340 glycoprotein produced in EBV infected cells has a molecular weight of approximately 340 kDa (165).
  • Cells infected with the recombinant vaccinia viruses vP474 or vP712 also produce an EBV encoded protein of approximately 340 kDa
  • the EBV gp220 glycoprotein has a molecular weight of 220 kDa (165). Cells infected with the vaccinia
  • recombinant virus vP480 produce an EBV encoded protein of approximately 220 kDa.
  • the EBV gB glycoprotein produced in EBV infected cells has a molecular weight of 110 kDa to 125 kDa with a precursor form of 93 kDa (206,208).
  • Cells infected with the recombinant vaccinia viruses vP561 or vP712 produce an EBV major protein with a molecular weight of approximately 125 kDa and four minor proteins with molecular weights of approximately 80 kDa, 60 kDa, 50 kDa and 45 kDa.
  • the EBV gH glycoprotein produced in EBV infected cells has a molecular weight of 85 kDa with a precursor form of 70 kDa (209).
  • Cells infected with the recombinant virus vP611 produce an EBV encoded protein of approximately 85 kDa.
  • HCMV gB gene was modified to be expressed under the control of the vaccinia H6 promoter.
  • the plasmid containing the modified HCMV gB gene was designated 24CMVgB(5+3) (FIG. 40).
  • Hindlll Mung Bean nuclease treated fragment of SP131gB was cloned into the Bglll Mung Bean nuclease treated site of pMP409DVC.
  • the resulting plasmid was designated 409CMVgB (FIG. 40).
  • H6 promoted CMV gB gene in plasmid 409CMVgB was inserted into the M2L site of the rescue virus vP458.
  • CMV gB Immunoprecipitation of CMV gB in recombinant vaccinia infected cells.
  • the CMV gB glycoprotein produced in CMV infected cells has a molecular weight of 55 kDa with a precursor form of 130 kDa (172).
  • Cells infected with vP525 produce two CMV gB encoded proteins of approximately 130 kDa and 55 kDa.
  • HXLF1 and HXLF2 Nucleotide sequences of HXLF1 and HXLF2.
  • the HXLF gene family is localized in the Hindlll X fragment of the HCMV genomic DNA (172). Using specific oligonucleotide primers the nucleotide sequence of HXLF1 and HXLF2 have been determined (FIGS. 41, 42).
  • HXLF1 is 648 nucleotides long and codes for a 215 amino acid protein.
  • HXLF2 is 558 nucleotides long and codes for a 185 amino acid protein.
  • the nucleotide seguences of the same genes have been published (173) and comparison studies show a 99% homology for HXLF1 and a 96% homology for HXLF2.
  • Herpesviruses Vol. 2, ed. B. Roizman (New York), pp. 215-318 (1983).
  • Pellett P.E., M.D. Biggin, B.L. Barrell, and B.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US1990/002094 1989-04-17 1990-04-16 Herpes virus recombinant poxvirus vaccine Ceased WO1990012882A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
KR1019900702630A KR920700289A (ko) 1989-04-17 1990-04-16 허피스바이러스 재조합 천연두바이러스 백신
NL9020677A NL195016C (nl) 1989-04-17 1990-04-16 Recombinant pokkenvirus, vaccin dat dit virus bevat, geïsoleerd nucleïnezuurmolecuul, geïsoleerd polypeptide, nucleïnezuurvector die dit nucleïnezuurmolecuul bevat en vaccin die deze vector bevat.
DE4090565A DE4090565C2 (de) 1989-04-17 1990-04-16 Rekombinantes Herpesvirus-Pockenvirus-Vakzin
DK199101743A DK176464B1 (da) 1989-04-17 1991-10-15 Rekombinant poxvirus og vaccine mod herpesvirus indeholdende dette

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US33900489A 1989-04-17 1989-04-17
US339,004 1989-04-17
US39448889A 1989-08-16 1989-08-16
US394,488 1989-08-16
US502,834 1990-04-04
US07/502,834 US5338683A (en) 1981-12-24 1990-04-04 Vaccinia virus containing DNA sequences encoding herpesvirus glycoproteins

Publications (1)

Publication Number Publication Date
WO1990012882A1 true WO1990012882A1 (en) 1990-11-01

Family

ID=27407304

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1990/002094 Ceased WO1990012882A1 (en) 1989-04-17 1990-04-16 Herpes virus recombinant poxvirus vaccine

Country Status (17)

Country Link
US (3) US5338683A (https=)
JP (2) JP3083839B2 (https=)
KR (1) KR920700289A (https=)
AT (1) AT405184B (https=)
AU (1) AU625623B2 (https=)
BE (1) BE1004369A5 (https=)
CA (1) CA2014465C (https=)
CH (1) CH682671A5 (https=)
DE (2) DE4090565T (https=)
DK (1) DK176464B1 (https=)
FR (1) FR2647808B1 (https=)
GB (1) GB2246784B (https=)
IE (1) IE61098B1 (https=)
IT (1) IT1241119B (https=)
LU (1) LU88018A1 (https=)
NL (1) NL195016C (https=)
WO (1) WO1990012882A1 (https=)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992016636A1 (en) * 1991-03-14 1992-10-01 Cantab Pharmaceuticals Research Limited Recombinant virus vectors encoding human papillomavirus proteins
EP0538496A1 (en) * 1991-08-26 1993-04-28 IMMUNO Aktiengesellschaft Recombinant fowlpox virus with intact FPV-tk-gene
EP0752888A4 (en) * 1994-03-30 1997-05-21 Virogenetics Corp NUCLEOTID AMINO ACID SEQUENCES OF THE HERPEVIRUS gB, gC AND gD FROM DOG AND THEIR USE
US5925358A (en) * 1993-02-26 1999-07-20 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US6001369A (en) * 1993-02-26 1999-12-14 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US6136318A (en) * 1993-02-26 2000-10-24 Cochran; Mark D. Recombinant fowlpox viruses and uses thereof
US7097842B2 (en) 2000-11-23 2006-08-29 Bavarian Nordic A/S Modified vaccinia virus ankara for the vaccination of neonates
US7189536B2 (en) 2000-11-23 2007-03-13 Bavarian Nordic A/S Modified vaccinia ankara virus variant
WO2006056487A3 (en) * 2004-11-24 2008-05-08 Theraptosis S A Peptides useful as dual caspase-2/-6 inhibitors and their biological applications
US7628980B2 (en) 2000-11-23 2009-12-08 Bavarian Nordic A/S Modified vaccinia virus ankara for the vaccination of neonates
US7695939B2 (en) 2002-09-05 2010-04-13 Bavarian Nordic A/S Method for the cultivation of primary cells and for the amplification of viruses under serum free conditions
EP2186823A1 (en) 2005-11-14 2010-05-19 Merial Limited Gene therapy for renal failure
EP2198881A1 (en) 2005-04-25 2010-06-23 Merial Limited Nipah virus vaccines
EP2228071A1 (en) 2006-11-14 2010-09-15 Merial Limited Intra-vascular kidney gene therapy with plasmid encoding BMP-7
US7897156B2 (en) 2001-11-22 2011-03-01 Bavarian Nordic A/S Modified vaccinia virus ankara for the vaccination of neonates
WO2012145577A1 (en) 2011-04-20 2012-10-26 Merial Limited Adjuvanted rabies vaccine with improved viscosity profile
WO2012166493A1 (en) 2011-06-01 2012-12-06 Merial Limited Needle-free administration of prrsv vaccines
WO2013012446A1 (en) 2011-07-20 2013-01-24 Merial Limited Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
WO2013025274A1 (en) 2011-08-12 2013-02-21 Merial Limited Vacuum -assisted preservation of biological products, in particular of vaccines
WO2013142371A1 (en) 2012-03-20 2013-09-26 Merial Limited Recombinant equine herpesvirus-1 vaccine containing mutated glycoprotein c and uses thereof
EP2759307A2 (en) 2006-03-29 2014-07-30 Merial Limited Vaccine against Streptococci
EP2816057A1 (en) 2006-06-01 2014-12-24 Merial Limited Recombinant vaccine against bluetongue virus
EP2899203A2 (en) 2008-05-08 2015-07-29 Merial Limited Leishmania vaccine using sand fly salivary immunogen
EP2979705A1 (fr) 2001-04-06 2016-02-03 Merial Vaccin contre le virus de la fièvre du nil
WO2016073410A1 (en) 2014-11-03 2016-05-12 Merial, Inc. Methods of using microneedle vaccine formulations to elicit in animals protective immunity against rabies virus
EP3260137A1 (en) 2008-01-28 2017-12-27 Merial, Inc. Canine influenza vaccines
RU2711907C2 (ru) * 2017-12-22 2020-01-23 Федеральное государственное бюджетное научное учреждение "Научно-исследовательский институт вакцин и сывороток им. И.И. Мечникова" (ФГБНУ НИИВС им. И.И. Мечникова) Рекомбинантный белок, содержащий антигенно-значимые фрагменты белков вируса гепатита Е, используемый в тест-системах для серодиагностики гепатита Е (варианты)

Families Citing this family (136)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5505941A (en) * 1981-12-24 1996-04-09 Health Research, Inc. Recombinant avipox virus and method to induce an immune response
US4603112A (en) * 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
US7767449B1 (en) 1981-12-24 2010-08-03 Health Research Incorporated Methods using modified vaccinia virus
US7045313B1 (en) 1982-11-30 2006-05-16 The United States Of America As Represented By The Department Of Health And Human Services Recombinant vaccinia virus containing a chimeric gene having foreign DNA flanked by vaccinia regulatory DNA
US5674735A (en) * 1990-07-06 1997-10-07 University Court Of The University Of Glasgow DNA encoding the EHV-4 gH or gC glycoprotein
GB9014950D0 (en) * 1990-07-06 1990-08-29 Univ Glasgow Ehv-4 glycoprotein vaccine
US7374768B1 (en) * 1990-09-25 2008-05-20 Xenova Research Limited Viral vaccines
DE69132311T2 (de) * 1990-09-25 2000-12-14 Cantab Pharmaceuticals Research Ltd., Cambridge Bei einer transkomplementenden zellinie erzeugter defektiver virenimpfstoff
US5997878A (en) 1991-03-07 1999-12-07 Connaught Laboratories Recombinant poxvirus-cytomegalovirus, compositions and uses
US5759552A (en) * 1991-03-07 1998-06-02 Virogenetics Corporation Marek's disease virus recombinant poxvirus vaccine
DE69229390T2 (de) * 1991-08-26 1999-11-11 Immuno Ag, Wien Direkt molekuläre Klonierung eines modifizierten Genoms eines Chordopocken-Virus
US5869312A (en) * 1992-01-13 1999-02-09 Syntro Corporation Recombinant swinepox virus
US6010703A (en) * 1993-07-26 2000-01-04 Board Of Trustees Operating Michigan State University Recombinant poxvirus vaccine against feline rhinotracheitis
ATE298370T1 (de) * 1994-04-29 2005-07-15 Baxter Healthcare Sa Rekombinante poxviren mit fremdenpolynukleotiden in wichtigen regionen
EP0979101B1 (en) 1996-07-03 2010-10-27 Merial, Inc. Recombinant canine adenovirus 2 (cav2) containing exogenous dna
US6183752B1 (en) * 1997-02-05 2001-02-06 Pasteur Merieux Serums Et Vaccins Restenosis/atherosclerosis diagnosis, prophylaxis and therapy
US6517843B1 (en) 1999-08-31 2003-02-11 Merial Reduction of porcine circovirus-2 viral load with inactivated PCV-2
US6224882B1 (en) 1997-11-07 2001-05-01 Protein Science Corp. Insect cells or fractions as adjuvant for antigens
AP1261A (en) 1998-02-24 2004-03-19 Sisters Of Providence In Oregon Composition containing an OX-40 receptor binding agent or a nucleic acid encoding the same and methods for enhancing antigen-specific immune response.
ATE512231T1 (de) 1998-02-27 2011-06-15 Univ Pennsylvania Impfstoffe, immuntherapeutika und verfahren zur anwendung derselben
AU3498200A (en) 1999-02-19 2000-09-04 Michigan State University An antigen test to detect equine protozoal myeloencephalitis in horse serum and cerebrospinal fluid
EP1168918A4 (en) 1999-03-03 2002-08-21 Univ Pennsylvania VACCINE AND GENE THERAPY COMPOSITIONS AND METHOD FOR THEIR PRODUCTION AND USE
US7446189B1 (en) 1999-04-30 2008-11-04 Institut De Recherches Cliniques De Montreal Nucleic acids encoding mutant human CD80 and compositions comprising the same
US6355246B1 (en) 1999-06-10 2002-03-12 Board Of Trustees Of Michigan State University Feline calicivirus isolated from cat urine and vaccines thereof
CA2375320C (en) * 1999-06-10 2013-02-19 Merial Dna vaccines for pets or for animals used in sports
US7419668B1 (en) 1999-09-02 2008-09-02 Board Of Trustees Of Michigan State University Vaccine to control equine protozoal myeloencephalitis in horses
AU7108700A (en) 1999-09-02 2001-03-26 Michigan State University Vaccine to control equine protozoal myeloencephalitis in horses
ATE385808T1 (de) * 1999-12-21 2008-03-15 Merial Sas Mindestens ein cryptosporidium parvum-antigen und mindestens ein antigen eines anderen darmkrankheitserregers enthaltende zusammensetzungen und impfstoffe
KR100815888B1 (ko) * 2000-07-14 2008-03-21 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 Hiv 보조 단백질을 암호화하는 dna 백신
AU2002211490A1 (en) * 2000-10-04 2002-04-15 The Trustees Of The University Of Pennsylvania Compositions and methods of using capsid protein from flaviviruses and pestiviruses
US20020108132A1 (en) * 2001-02-02 2002-08-08 Avigenics Inc. Production of a monoclonal antibody by a transgenic chicken
US7541512B2 (en) * 2001-03-30 2009-06-02 Synageva Biopharma Corp. Avians containing a lysozyme promoter transgene
US7176300B2 (en) * 2001-03-30 2007-02-13 Avigenics, Inc. Avian lysozyme promoter
WO2002079447A2 (en) 2001-03-30 2002-10-10 Avigenics, Inc. Avian lysozyme promoter
US20040037848A1 (en) * 2001-04-06 2004-02-26 Audonnet Jean-Christophe Francis Recombinant vaccine against West Nile Virus
US7740863B2 (en) * 2001-04-06 2010-06-22 Merial Recombinant vaccine against West Nile Virus
WO2002100317A2 (en) 2001-05-25 2002-12-19 The Trustees Of The University Of Pennsylvania Targeted particles and methods of using the same
US7550650B2 (en) * 2001-09-18 2009-06-23 Synageva Biopharma Corp. Production of a transgenic avian by cytoplasmic injection
US20100333219A1 (en) * 2001-11-30 2010-12-30 Synageva Biopharma Corp. Methods of protein production using ovomucoid regulatory regions
US7294507B2 (en) * 2001-11-30 2007-11-13 Avigenics, Inc. Ovomucoid promoters and methods of use
US7335761B2 (en) * 2001-11-30 2008-02-26 Avigenics, Inc. Avian gene expression controlling regions
US6875588B2 (en) 2001-11-30 2005-04-05 Avigenics, Inc. Ovomucoid promoter and methods of use
US7135562B2 (en) 2002-03-14 2006-11-14 University Of Cincinnati Avian iFABP gene expression controlling region
US20040241723A1 (en) * 2002-03-18 2004-12-02 Marquess Foley Leigh Shaw Systems and methods for improving protein and milk production of dairy herds
ATE315660T1 (de) 2002-05-16 2006-02-15 Bavarian Nordic As Intergene regionen als insertionsstellen im genom von modifiziertem vaccinia virus ankara (mva)
WO2004056977A1 (en) * 2002-12-13 2004-07-08 Aventis Pasteur, Inc. Production of alvac on avian embryonic stem cells
CN1980571A (zh) * 2003-01-24 2007-06-13 阿维季尼克斯股份有限公司 禽类及禽蛋中表达的外源蛋白质
US7262027B2 (en) * 2003-03-14 2007-08-28 Medical College Of Ohio Polypeptide and DNA immunization against Coccidioides spp. infections
EP1606419A1 (en) 2003-03-18 2005-12-21 Quantum Genetics Ireland Limited Systems and methods for improving protein and milk production of dairy herds
US7468273B2 (en) 2003-05-01 2008-12-23 Meial Limited Canine GHRH gene, polypeptides and methods of use
NZ570709A (en) 2003-06-13 2010-04-30 Univ Pennsylvania Nucleic acid sequences encoding and compositions comprising IgE signal peptide and/or IL-15 and methods for using the same
EP1633372B1 (en) 2003-06-13 2011-11-30 The Trustees of The University of Pennsylvania Vaccines, immunotherapeutics and methods for using the same
WO2005049794A2 (en) 2003-11-13 2005-06-02 University Of Georgia Research Foundation, Inc. Methods of characterizing infectious bursal disease virus
WO2005112544A2 (en) 2004-02-19 2005-12-01 The Governors Of The University Of Alberta Leptin promoter polymorphisms and uses thereof
WO2007050095A2 (en) 2004-11-19 2007-05-03 The Trustees Of The University Of Pennsylvania Improved vaccines and methods for using the same
ES2357679T3 (es) * 2005-07-28 2011-04-28 Pfizer Products Inc. VACUNA CONTRA CALICIVIRUS FELINO (FCV) QUE COMPRENDE UNA PROTEINA DE CAPSIDA DE UN FCV O UNA PROTEINA DE LA CAPSIDA DE UN FCV AISLADA QUE COMPRENDE UNA SECUENCIA PROTEICA SEC ID Nº: 13 O SECUENCIAS PROTEICAS CON, AL MENOS, 95% DE IDENTIDAD CON ELLA.
US7745158B2 (en) * 2005-12-14 2010-06-29 Kimberly-Clark Worldwide, Inc. Detection of secreted aspartyl proteases from Candida species
ES2374458T3 (es) 2006-01-13 2012-02-16 The Trustees Of The University Of Pennsylvania Vacunas y agentes inmunoterapéuticos que utilizan il-15 optimizada en codones, y métodos para utilización de los mismos.
US9259463B2 (en) 2006-01-16 2016-02-16 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Chlamydia vaccine
CA2670804A1 (en) * 2006-05-19 2007-11-29 Sanofi Pasteur Inc. Immunological composition
CA3057039C (en) 2006-07-28 2023-02-28 The Trustees Of The University Of Pennsylvania Hiv consensus envelope sequences and methods for using same
US8202967B2 (en) 2006-10-27 2012-06-19 Boehringer Ingelheim Vetmedica, Inc. H5 proteins, nucleic acid molecules and vectors encoding for those, and their medicinal use
WO2008091311A1 (en) 2007-01-26 2008-07-31 Synageva Biopharma Corp Transgene expression in avians
UA100692C2 (ru) 2007-05-02 2013-01-25 Мериал Лимитед Днк-плазмиды, имеющие повышенную экспрессию и стабильность
TW200907058A (en) 2007-05-30 2009-02-16 Wyeth Corp Raccoon poxvirus expressing rabies glycoproteins
US20090246226A1 (en) * 2008-03-28 2009-10-01 Zeon Corporation Avian vaccines possessing a positive marker gene
CA2720166A1 (en) * 2008-04-04 2009-10-08 David B. Weiner Consensus sequences of chikungunya viral proteins, nucleic acid molecules encoding the same, and compositions and methods for using the same
KR101652767B1 (ko) * 2008-04-04 2016-08-31 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 Il-28을 이용한 백신 및 면역치료제, 및 그를 사용하는 방법 및 조성물
US8921536B2 (en) 2008-10-29 2014-12-30 The Trustees Of The University Of Pennsylvania HCV vaccines and methods for using the same
WO2010050939A1 (en) 2008-10-29 2010-05-06 The Trustees Of The University Of Pennsylvania Improved hcv vaccines and methods for using the same
CA2653478A1 (en) * 2009-01-23 2010-07-23 Gregg Martin Automated wash system for industrial vehicles
US9050287B2 (en) 2009-01-23 2015-06-09 The Trustees Of The University Of Pennsylvania Vaccines for human papilloma virus and methods for using the same
US20100192236A1 (en) * 2009-01-28 2010-07-29 University Of South Carolina Modulation of Delta Opioid Receptor Expression
EP2414386B1 (en) 2009-04-03 2016-01-27 Merial Limited Newcastle disease virus vectored avian vaccines
US20100284977A1 (en) * 2009-04-28 2010-11-11 University Of South Carolina Expression of Anti-Nociceptive Compounds from Endogenously Regulated Promoters
EP2424999A1 (en) 2009-04-30 2012-03-07 Centre Hospitalier Universitaire Vaudois Lausanne (CHUV) Modified immunization vectors
AR078253A1 (es) 2009-09-02 2011-10-26 Boehringer Ingelheim Vetmed Metodos para reducir la actividad antivirica en composiciones pcv-2 y composiciones pcv-2 con mejor inmunogenicidad
WO2011032179A1 (en) 2009-09-14 2011-03-17 The Trustees Of The University Of Pennsylvania Vaccines and immunotherapeutics comprising il-15 receptor alpha and/or nucleic acid molecules encoding the same, and methods for using the same
KR102138780B1 (ko) 2009-11-02 2020-07-29 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 구제역 바이러스(fmdv) 공통 단백질, 이를 위한 코딩 서열 및 이로부터 만들어진 백신
US8298820B2 (en) 2010-01-26 2012-10-30 The Trustees Of The University Of Pennsylvania Influenza nucleic acid molecules and vaccines made therefrom
EP2539354B1 (en) 2010-02-08 2017-04-05 The Trustees Of The University Of Pennsylvania Nucleic acid molecules encoding rantes, and compositions comprising and methods of using the same
US9109007B2 (en) 2010-08-18 2015-08-18 Purdue Pharma L.P. MHC-I restricted epitopes containing non-natural amino acid residues
EP2611460B1 (en) 2010-08-31 2016-10-05 Merial, Inc. Newcastle disease virus vectored herpesvirus vaccines
AR083533A1 (es) 2010-10-22 2013-03-06 Boehringer Ingelheim Vetmed Proteinas de hemaglutinina 5 (h5) para el tratamiento y prevencion de las infecciones de gripe
JP6077450B2 (ja) 2010-11-12 2017-02-08 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア コンセンサス前立腺抗原、それをコードする核酸分子、ならびにそれを含むワクチンおよび用途
WO2012090073A2 (en) 2010-12-30 2012-07-05 The Netherlands Cancer Institute Methods and compositions for predicting chemotherapy sensitivity
EA033467B1 (ru) 2011-01-31 2019-10-31 Univ Pennsylvania Молекула нуклеиновой кислоты для индукции иммунного ответа против герпесвируса и ее применение
US9238679B2 (en) 2011-02-11 2016-01-19 The Trustees Of The University Of Pennslyvania Nucleic acid molecule encoding hepatitis B virus core protein and surface antigen protein and vaccine comprising the same
EA032364B1 (ru) 2011-02-11 2019-05-31 Дзе Трастиз Оф Дзе Юниверсити Оф Пенсильвания Молекула нуклеиновой кислоты, кодирующая коровый белок вируса гепатита в, и вакцина, содержащая указанную молекулу
US20140296248A1 (en) 2011-04-04 2014-10-02 Stichting het Nederlands Kanker Instiuut-Antoni van Leeuwenhoek ziekenhuis Methods and compositions for predicting resistance to anticancer treatment
EP2694678A2 (en) 2011-04-04 2014-02-12 Netherland Cancer Institute Methods and compositions for predicting resistance to anticancer treatment
WO2012149038A1 (en) 2011-04-25 2012-11-01 Advanced Bioscience Laboratories, Inc. Truncated hiv envelope proteins (env), methods and compositions related thereto
KR102314421B1 (ko) 2011-07-11 2021-10-19 이노비오 파마수티컬즈, 인크. 교차-보호성 아레나바이러스 백신 및 이의 사용 방법
AR088028A1 (es) 2011-08-15 2014-05-07 Boehringer Ingelheim Vetmed Proteinas h5, de h5n1 para un uso medicinal
WO2013033092A2 (en) 2011-09-03 2013-03-07 Boehringer Ingelheim Vetmedica Gmbh Streptococcus suis pilus antigens
MX360449B (es) 2011-10-12 2018-11-01 Univ Pennsylvania Vacunas para el virus del papiloma humano y metodos para su uso.
EP2771035B1 (en) 2011-10-24 2018-04-11 The Trustees Of The University Of Pennsylvania Improved hcv vaccines and methods for using the same
JP6407028B2 (ja) 2011-12-12 2018-10-17 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア MRSAのPBP2a及びその断片を含むタンパク質、それをコードする核酸、並びにMRSA感染を予防する及び治療するための組成物及びそれらの使用
JP6333730B2 (ja) 2011-12-12 2018-05-30 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア 改善されたil−12遺伝子構築物を含む組成物、及びそれを用いたワクチン、免疫治療剤及び方法
WO2013093629A2 (en) 2011-12-20 2013-06-27 Netherlands Cancer Institute Modular vaccines, methods and compositions related thereto
WO2013138776A1 (en) 2012-03-16 2013-09-19 Merial Limited Novel methods for providing long-term protective immunity against rabies in animals, based upon administration of replication-deficient flavivirus expressing rabies g
HK1210479A1 (en) 2012-04-10 2016-04-22 The Trustees Of The University Of Pennsylvania Human respiratory syncytial virus consensus antigens, nucleic acid constructs and vaccines made therefrom, and methods of using same
EP2958586B1 (en) 2013-02-21 2018-09-05 Boehringer Ingelheim Vetmedica GmbH H5 proteins of h5n1 influenza virus for use as a medicament
HK1216006A1 (zh) 2013-03-12 2016-10-07 Boehringer Ingelheim Animal Health USA Inc. 反向遺傳學施馬倫貝格病毒疫苗組合物,和其使用方法
AU2014248535B2 (en) 2013-03-12 2017-03-30 Inovio Pharmaceuticals, Inc. Improved vaccines for human papilloma virus and methods for using the same
KR20150130284A (ko) 2013-03-15 2015-11-23 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 암 백신 및 이를 이용한 치료 방법
CN105338998B (zh) 2013-03-15 2021-12-14 宾夕法尼亚大学理事会 口蹄疫病毒(fmdv)共有蛋白、其编码序列以及由其制造的疫苗
JP6395855B2 (ja) 2014-04-03 2018-09-26 ベーリンガー インゲルハイム フェトメディカ インコーポレイテッド ブタ流行性下痢ウイルスワクチン
ES3050936T3 (en) 2015-06-23 2025-12-23 Boehringer Ingelheim Vetmedica Gmbh Prrsv minor protein-containing recombinant viral vectors and methods of making and use thereof
TWI799365B (zh) 2015-08-31 2023-04-21 德商百靈佳殷格翰維美迪加股份有限公司 用於先天性痙攣症之瘟疫病毒疫苗
US20170072042A1 (en) 2015-09-16 2017-03-16 Boehringer Ingelheim Vetmedica, Inc. Salmonella choleraesuis-salmonella typhimurium vaccines
CA3036310A1 (en) 2016-09-20 2018-03-29 Boehringer Ingelheim Vetmedica Gmbh New swine influenza vaccine
NZ751966A (en) 2016-09-20 2023-03-31 Boehringer Ingelheim Vetmedica Gmbh New promoters
MX2019003161A (es) 2016-09-20 2019-05-27 Boehringer Ingelheim Vetmedica Gmbh Nuevo sitio de insercion orf70 de ehv.
WO2018057441A1 (en) 2016-09-20 2018-03-29 Boehringer Ingelheim Vetmedica Gmbh Canine adenovirus vectors
US10485866B2 (en) 2016-11-03 2019-11-26 Boehringer Ingelheim Vetmedica Gmbh Vaccine against porcine parvovirus
PT3534939T (pt) 2016-11-03 2023-04-20 Boehringer Ingelheim Vetmedica Gmbh Vacina contra parvovírus porcino e vírus da síndrome reprodutiva e respiratória porcina e métodos da sua produção
EA201991762A1 (ru) 2017-01-30 2020-01-23 Бёрингер Ингельхайм Энимал Хелс Ю-Эс-Эй Инк. Вакцины против коронавируса свиней
US11179457B2 (en) 2017-07-12 2021-11-23 Boehringer Ingelheim Animal Health USA Inc. Senecavirus a immunogenic compositions and methods thereof
MX2020003071A (es) 2017-09-23 2020-07-28 Boehringer Ingelheim Vetmedica Gmbh Sistema de expresion de paramyxoviridae.
WO2019092027A1 (en) 2017-11-09 2019-05-16 Boehringer Ingelheim Vetmedica Gmbh Sapelovirus immunogenic compositions and uses thereof
WO2019118760A1 (en) 2017-12-13 2019-06-20 Inovio Pharmaceuticals, Inc. Cancer vaccines targeting mesothelin and uses thereof
WO2019118764A1 (en) 2017-12-13 2019-06-20 Inovio Pharmaceuticals, Inc. Cancer vaccines targeting muc16 and uses thereof
CA3083532C (en) 2017-12-13 2023-09-05 Inovio Pharmaceuticals, Inc. Cancer vaccines targeting prame and uses thereof
KR102668476B1 (ko) 2017-12-13 2024-05-23 이노비오 파마수티컬즈, 인크. Boris를 표적으로 하는 암 백신 및 이의 용도
WO2019162294A1 (en) 2018-02-23 2019-08-29 Boehringer Ingelheim Vetmedica Gmbh Recombinant viral vector systems expressing exogenous feline paramyxovirus genes and vaccines made therefrom
US11384365B2 (en) 2018-03-19 2022-07-12 Boehringer Ingelheim Vetmedica Gmbh EHV with inactivated UL18 and/or UL8
EA202092165A1 (ru) 2018-03-19 2021-02-25 Бёрингер Ингельхайм Ветмедика Гмбх Новый ehv сайт инсерции ul43
CN119488586A (zh) 2018-03-26 2025-02-21 勃林格殷格翰动物保健美国有限公司 制备免疫原性组合物的方法
KR102879825B1 (ko) 2018-09-20 2025-11-03 베링거잉겔하임베트메디카게엠베하 변형된 pedv 스파이크 단백질
US10905758B2 (en) 2018-09-20 2021-02-02 Boehringer Ingelheim Vetmedica Gmbh Intranasal vector vaccine against porcine epidemic diarrhea
CN115768784A (zh) 2020-02-06 2023-03-07 勃林格殷格翰动物保健有限公司 用于检测抗弹状病毒抗体的多肽
US20220160864A1 (en) 2020-10-05 2022-05-26 Boehringer Ingelheim Animal Health USA Inc. Fusion protein comprising circoviridae capsid protein, and chimeric virus-like particles composed thereof
CA3195910A1 (en) 2020-10-05 2022-04-14 Boehringer Ingelheim Vetmedica Gmbh Fusion protein useful for vaccination against rotavirus
WO2023194913A1 (en) 2022-04-05 2023-10-12 Boehringer Ingelheim Vetmedica Gmbh Immunogenic composition useful for vaccination against rotavirus
WO2025184411A1 (en) 2024-02-27 2025-09-04 Calidi Biotherapeutics (Nevada), Inc. Serum-resistant eev viruses and uses thereof

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1061898A (en) 1963-03-07 1967-03-15 Philips Electronic Pharma Method for protecting dogs against canine distemper
US4769330A (en) * 1981-12-24 1988-09-06 Health Research, Incorporated Modified vaccinia virus and methods for making and using the same
US4603112A (en) * 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
US4722848A (en) * 1982-12-08 1988-02-02 Health Research, Incorporated Method for immunizing animals with synthetically modified vaccinia virus
AU570940B2 (en) * 1982-11-30 1988-03-31 United States of America, as represented by the Secretary, U.S. Department of Commerce, The Process for producing poxvirus recombinants for expression offoreign genes
EP0162738A1 (en) 1984-04-09 1985-11-27 MOLECULAR GENETICS RESEARCH & DEVELOPMENT LIMITED PARTNERSHIP Production of pseudorabies virus subunit vaccines
EP0261940A3 (en) * 1986-09-23 1989-07-05 Applied Biotechnology, Inc. Pseudorabies vaccines and dna vectors for recombination with pox viruses
US5242829A (en) * 1986-09-23 1993-09-07 Therion Biologics Corporation Recombinant pseudorabies virus
AU605567B2 (en) * 1987-03-11 1991-01-17 Nippon Zeon Co., Ltd. Recombinant avipoxvirus
EP0297924A3 (en) * 1987-07-01 1990-07-11 City Of Hope Recombinant vaccinia virus expressing hsv 1 gb
DE10399032I1 (de) * 1987-08-28 2004-01-29 Health Research Inc Rekombinante Viren.
WO1990001546A1 (en) * 1988-08-05 1990-02-22 Applied Biotechnology, Inc. Equine herpesvirus-1 vaccine
IE68404B1 (en) 1990-11-20 1996-06-12 Virogenetics Corp Measles virus recombinant poxvirus vaccine

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF IMMUNOLOGY, Volume 138, issued 15 May 1987, MARTIN et al., "The Mechanisms of Antiviral Immunity Induced by a Vaccinia Virus Recombinant Expressing Herpes Simplex Virus Type I Glycoprotein D: Clearance of Local Infection", pages 3431-3437. *
JOURNAL OF VIROLOGY, Volume 61, Number 8, issued August 1987, ALLEN et al., "Use of GT11 and Monoclonal Antibodies to Map the Genes for the Six Major Glycoproteins of Equine Herpes Virus 1", pages 2454-2461. *
JOURNAL OF VIROLOGY, Volume 62, issued May 1988, ROONEY et al., "Immunization with a Vaccinia Virus Recombinant Expressing Herpes Simplex Virus Type 1 Glycoprotein D: Long-term Protection and Effect of Revaccination", pages 1530-1534. *
JOURNAL OF VIROLOGY, Volume 62, Number 8, issued August 1988, ALLEN et al., "Characterization of an Equine Herpes Virus Type I Gene Encoding a Glycoprotein (gp13) With Homology to Herpes Simplex Virus Glycoprotein C", pages 2850-2858. *
O'CALLAHAN D.J. et al., "Equine Herpes Viruses: Biochemical Studies or Genomic Structure, DI Particles, Oncogenic Transformation and Persistent Infection", In: Developments in Molecular Virology, Volume 1, ed. Y. DECKES, pages 387-418 (1981), pages 396-397. *
PROC. NATL. ACAD. SCI. U.S.A., Volume 81, issued January 1984, PAOLETTI et al., "Construction of Live Vaccines Using Genetically Engineered Pox Viruses: Biological Activity of Vaccinia Virus Recombinant Expressing the Hepatitis B Virus Surface Antigen and the Herpes Simplex Virus Glycoprotein D", pages 193-197. *
SCIENCE, Volume 229, issued September 1985, PERKUS et al., "Recombinant Vaccinia Virus: Immunization Against Multiple Pathogens", pages 981-984. *
SPEAR P.G., "Antigenic Structure of Herpes Simplex Viruses", In: Immunochemistry of Viruses. The Basis for Serodiagnosis and Vaccines., Volume 1, Eds. M.H.V. VAN REGENMORTEL and A.R. NEURATH (NEW YORK), pages 425-443, (1983). *
VACCINE, Volume 6, issued December 1988, TAYLOR et al., "Protective Immunity Against an Avian Influenta Induced by a Fowl Pox Virus Recombinant", pages 504-508. *
VACCINE, Volume 6, issued December 1988, TAYLOR, et al., "Recombinant Fowl Pox Virus Inducing Protective Immunity in Noravian Species", pages 497-503. *
VIROLOGY, Volume 54, issued September 1986, BEN-PORAT et al., "Role of Glycoproteins of Pseudo Robies Virus In Elicity Neutraliting Antibodies", pages 325-334. *

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992016636A1 (en) * 1991-03-14 1992-10-01 Cantab Pharmaceuticals Research Limited Recombinant virus vectors encoding human papillomavirus proteins
US5719054A (en) * 1991-03-14 1998-02-17 Cantab Pharmaceuticals Research Limited Recombinant virus vectors encoding human papillomavirus proteins
EP0538496A1 (en) * 1991-08-26 1993-04-28 IMMUNO Aktiengesellschaft Recombinant fowlpox virus with intact FPV-tk-gene
US5670367A (en) * 1991-08-26 1997-09-23 Immuno Aktiengesellschaft Recombinant fowlpox virus
US5925358A (en) * 1993-02-26 1999-07-20 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US6001369A (en) * 1993-02-26 1999-12-14 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US6123949A (en) * 1993-02-26 2000-09-26 Cochran; Mark D. Recombinant fowlpox virus S-FPV-043 and uses thereof
US6136318A (en) * 1993-02-26 2000-10-24 Cochran; Mark D. Recombinant fowlpox viruses and uses thereof
EP0752888A4 (en) * 1994-03-30 1997-05-21 Virogenetics Corp NUCLEOTID AMINO ACID SEQUENCES OF THE HERPEVIRUS gB, gC AND gD FROM DOG AND THEIR USE
US7628980B2 (en) 2000-11-23 2009-12-08 Bavarian Nordic A/S Modified vaccinia virus ankara for the vaccination of neonates
US8372622B2 (en) 2000-11-23 2013-02-12 Bavarian Nordic A/S Modified vaccinia virus ankara for the vaccination of neonates
US7335364B2 (en) 2000-11-23 2008-02-26 Bavarian Nordic A/S Modified Vaccinia Ankara virus variant
US7189536B2 (en) 2000-11-23 2007-03-13 Bavarian Nordic A/S Modified vaccinia ankara virus variant
US7459270B2 (en) 2000-11-23 2008-12-02 Bavarian Nordic A/S Modified Vaccinia Ankara virus variant
US8163293B2 (en) 2000-11-23 2012-04-24 Bavarian Nordic A/S Modified Vaccinia Virus Ankara for the vaccination of neonates
US7892533B2 (en) 2000-11-23 2011-02-22 Bavarian Nordic A/S Modified vaccinia virus ankara for the vaccination of neonates
US7097842B2 (en) 2000-11-23 2006-08-29 Bavarian Nordic A/S Modified vaccinia virus ankara for the vaccination of neonates
EP2979705A1 (fr) 2001-04-06 2016-02-03 Merial Vaccin contre le virus de la fièvre du nil
US7897156B2 (en) 2001-11-22 2011-03-01 Bavarian Nordic A/S Modified vaccinia virus ankara for the vaccination of neonates
US7695939B2 (en) 2002-09-05 2010-04-13 Bavarian Nordic A/S Method for the cultivation of primary cells and for the amplification of viruses under serum free conditions
US8324173B2 (en) 2004-11-24 2012-12-04 Chiesi Farmaceutici S.P.A. Peptides useful as dual caspase-2/-6 inhibitors and their biological applications
WO2006056487A3 (en) * 2004-11-24 2008-05-08 Theraptosis S A Peptides useful as dual caspase-2/-6 inhibitors and their biological applications
EP2198881A1 (en) 2005-04-25 2010-06-23 Merial Limited Nipah virus vaccines
EP3536704A1 (en) 2005-11-14 2019-09-11 Boehringer Ingelheim Animal Health USA Inc. Gene therapy for renal failure
EP3147296A1 (en) 2005-11-14 2017-03-29 Merial, Inc. Gene therapy for renal failure
EP2186823A1 (en) 2005-11-14 2010-05-19 Merial Limited Gene therapy for renal failure
EP3167900A1 (en) 2006-03-29 2017-05-17 Merial Limited Vaccine against streptococci
EP2759307A2 (en) 2006-03-29 2014-07-30 Merial Limited Vaccine against Streptococci
EP2816057A1 (en) 2006-06-01 2014-12-24 Merial Limited Recombinant vaccine against bluetongue virus
EP2228071A1 (en) 2006-11-14 2010-09-15 Merial Limited Intra-vascular kidney gene therapy with plasmid encoding BMP-7
EP3260137A1 (en) 2008-01-28 2017-12-27 Merial, Inc. Canine influenza vaccines
EP2899203A2 (en) 2008-05-08 2015-07-29 Merial Limited Leishmania vaccine using sand fly salivary immunogen
WO2012145577A1 (en) 2011-04-20 2012-10-26 Merial Limited Adjuvanted rabies vaccine with improved viscosity profile
WO2012166493A1 (en) 2011-06-01 2012-12-06 Merial Limited Needle-free administration of prrsv vaccines
WO2013012446A1 (en) 2011-07-20 2013-01-24 Merial Limited Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
WO2013025274A1 (en) 2011-08-12 2013-02-21 Merial Limited Vacuum -assisted preservation of biological products, in particular of vaccines
WO2013142371A1 (en) 2012-03-20 2013-09-26 Merial Limited Recombinant equine herpesvirus-1 vaccine containing mutated glycoprotein c and uses thereof
WO2016073410A1 (en) 2014-11-03 2016-05-12 Merial, Inc. Methods of using microneedle vaccine formulations to elicit in animals protective immunity against rabies virus
RU2711907C2 (ru) * 2017-12-22 2020-01-23 Федеральное государственное бюджетное научное учреждение "Научно-исследовательский институт вакцин и сывороток им. И.И. Мечникова" (ФГБНУ НИИВС им. И.И. Мечникова) Рекомбинантный белок, содержащий антигенно-значимые фрагменты белков вируса гепатита Е, используемый в тест-системах для серодиагностики гепатита Е (варианты)

Also Published As

Publication number Publication date
IE61098B1 (en) 1994-09-21
US5338683A (en) 1994-08-16
JP3083839B2 (ja) 2000-09-04
GB2246784B (en) 1993-04-28
CA2014465A1 (en) 1990-10-17
KR920700289A (ko) 1992-02-19
IT9020063A0 (it) 1990-04-17
AU5552090A (en) 1990-11-16
AT405184B (de) 1999-06-25
IT1241119B (it) 1993-12-29
NL195016C (nl) 2003-06-10
DE4090565T (https=) 1992-05-14
CH682671A5 (fr) 1993-10-29
JP2000157292A (ja) 2000-06-13
US5482713A (en) 1996-01-09
GB2246784A (en) 1992-02-12
CA2014465C (en) 1999-06-15
NL9020677A (nl) 1992-02-03
AU625623B2 (en) 1992-07-16
JPH04505248A (ja) 1992-09-17
US6183750B1 (en) 2001-02-06
ATA902590A (de) 1998-10-15
IE901380L (en) 1990-10-17
GB9120655D0 (en) 1991-11-27
DK174391A (da) 1991-12-12
FR2647808A1 (fr) 1990-12-07
FR2647808B1 (fr) 1995-03-03
DK176464B1 (da) 2008-03-31
DE4090565C2 (de) 2000-03-09
DK174391D0 (da) 1991-10-15
BE1004369A5 (fr) 1992-11-10
IT9020063A1 (it) 1991-10-17
LU88018A1 (fr) 1992-03-11
JP3246735B2 (ja) 2002-01-15

Similar Documents

Publication Publication Date Title
US5482713A (en) Equine herpesvirus recombinant poxvirus vaccine
US5494807A (en) NYVAC vaccinia virus recombinants comprising heterologous inserts
LU88000A1 (fr) Systeme de selection d'hotes de poxvirus du recombinaision
US5688920A (en) Nucleotide and amino acid sequences for canine herpesvirus GB, GC and GD and uses therefor
Guo et al. Coexpression by vaccinia virus recombinants of equine herpesvirus 1 glycoproteins gp13 and gp14 results in potentiated immunity
US6248333B1 (en) Isolated nucleic acid sequence of equine herpesvirus type 1 glycoprotein D (EHV-1 gD)
CA2182888C (en) Nucleotide and amino acid sequences of canine herpesvirus gb, gc and gd and uses therefor
CA2105277C (en) Genetically engineered vaccine strain
CA2259047C (en) Innoculation kits for avoiding maternal immunity
NL195086C (nl) Herpesvirus recombinant pokkenvirus.
AU701599B2 (en) TROVAC fowlpox virus recombinants comprising heterologous inserts

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU CH DE DK GB JP KR LU NL

ENP Entry into the national phase

Ref document number: 1990 9025

Country of ref document: AT

Date of ref document: 19901101

Kind code of ref document: A

RET De translation (de og part 6b)

Ref document number: 4090565

Country of ref document: DE

Date of ref document: 19920514

WWE Wipo information: entry into national phase

Ref document number: 4090565

Country of ref document: DE