US20060270013A1 - Method for the production of evolved microorganisms which permit the generation or modification of metabolic pathways - Google Patents

Method for the production of evolved microorganisms which permit the generation or modification of metabolic pathways Download PDF

Info

Publication number
US20060270013A1
US20060270013A1 US10/546,139 US54613904A US2006270013A1 US 20060270013 A1 US20060270013 A1 US 20060270013A1 US 54613904 A US54613904 A US 54613904A US 2006270013 A1 US2006270013 A1 US 2006270013A1
Authority
US
United States
Prior art keywords
evolved
synthase
gene
modified
methionine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/546,139
Other languages
English (en)
Inventor
Michel Chateau
Benjamin Gonzalez
Isabelle Meynial-Salles
Philippe Soucailles
Olivier Zink
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Metabolic Explorer SA
Original Assignee
Metabolic Explorer SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=32931448&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20060270013(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from FR0301924A external-priority patent/FR2851256A1/fr
Priority claimed from FR0305769A external-priority patent/FR2854902B1/fr
Priority claimed from FR0305768A external-priority patent/FR2851255B1/fr
Priority claimed from FR0313054A external-priority patent/FR2862067A1/fr
Application filed by Metabolic Explorer SA filed Critical Metabolic Explorer SA
Assigned to METABOLIC EXPLORER reassignment METABOLIC EXPLORER ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MEYNIAL-SALLES, ISABELLE, SOUCAILLE, PHILIPPE NOEL PAUL, ZINK, OLIVIER, CHATEAU, MICHEL, GONZALEZ, BENJAMIN
Publication of US20060270013A1 publication Critical patent/US20060270013A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1058—Directional evolution of libraries, e.g. evolution of libraries is achieved by mutagenesis and screening or selection of mixed population of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/01—Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
    • C12P7/20—Glycerol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/52—Propionic acid; Butyric acids

Definitions

  • This invention concerns a new method for the preparation of evolved microorganisms permitting the creation or modification of metabolic pathways, the strains of evolved microorganisms thereby obtained, the evolved genes coding for the evolved proteins that may be obtained by the method according to the invention, and the use of said evolved microorganisms, genes or proteins in a biotransformation process.
  • the preparation of microorganisms with modified properties is a widely used process.
  • the aim is either to cause the microorganisms to evolve by letting them grow on a growth medium with a factor that exerts a selection pressure, so as to select those microorganisms able to resist that pressure, or to introduce one or more heterologous genes by means of widely used genetic engineering methods, in order to lend the microorganisms new phenotypic features associated with the expression of said heterologous gene or genes.
  • This evolution can be favored by the use of mutagenic agents well known to those skilled in the art.
  • This invention concerns a new method for the preparation of evolved microorganisms permitting the creation or modification of metabolic pathways, characterized in that it comprises the following steps:
  • the evolved microorganism preferentially contains at least one evolved gene coding for an evolved protein, the evolution of which makes it possible to replace the inhibited metabolic pathway by a new metabolic pathway.
  • This invention also concerns a method comprising an additional step a1) in which at least one heterologous gene coding for a heterologous protein is introduced, which heterologous gene is intended to cause the evolution of a new metabolic pathway, prior to step b) in which a modified microorganism is grown.
  • This invention also concerns a method comprising a step d) in which an evolved gene coding for said evolved protein is isolated.
  • This invention also concerns a method according to the invention whereby the evolved gene obtained previously is introduced, in an appropriate form, into a production microorganism intended for the production of the evolved protein.
  • This invention also concerns an evolved microorganism that may be obtained by a method according to the invention as defined above and below.
  • the invention also concerns a method for the preparation of an evolved protein characterized in that an evolved microorganism according to the invention is grown in an appropriate culture medium for the production of the evolved protein, which protein is purified when appropriate.
  • This invention also concerns an evolved gene coding for an evolved protein that may be obtained by a method according to the invention as defined above and below.
  • This invention also concerns an evolved protein that may be obtained by a method according to the invention as defined above and below.
  • This invention also concerns the use of an evolved microorganism or an evolved protein as defined above and below in a biotransformation process.
  • an ‘evolved microorganism’ is defined as a microorganism obtained by selection of a modified microorganism.
  • the evolved microorganism displays at least one difference from the modified microorganism. This difference may, for example, be the improvement of an enzymatic characteristic, or the creation of a new metabolic pathway.
  • a ‘metabolic pathway’ is one or more enzymatic reactions the succession of which forms a molecule (product) that is different from the starting molecule (substrate).
  • a ‘modification’ is a change, in particular a deletion, of at least one gene and/or its promoter sequence, which gene codes for an enzyme.
  • a ‘metabolite’ is a molecule synthesized and/or transformed by the microorganism.
  • a ‘defined medium’ is a medium of known molecular composition suitable for the growth of the microorganism.
  • the defined medium is substantially free of the metabolite or metabolites, the production of which is inhibited by performing the modification.
  • a ‘co-substrate’ is an organic or inorganic molecule, different from the substrate, which is involved in a reaction and gives one or more of its atoms to the substrate to form a product.
  • the co-substrate has no recognized mutagenic properties.
  • selection is a culture method used to select microorganisms that have evolved in such a way that a modification does not affect growth anymore.
  • a preferred application is a continuous culture method, carried out by applying increasing rates of dilution so as to conserve in the culture medium only those microorganisms with a growth rate equal to or greater than the imposed rate of dilution.
  • an ‘evolved gene’ is a sequence of nucleic acids (comprising A, T, G or C) bounded by a stop codon (TAA, TAG, TGA) in phase and possessing, after selection, at least one nucleic acid that is different from the initial sequence, so that the protein coded by that evolved gene differs in at least one amino acid from the protein coded by the initial gene.
  • a ‘heterologous gene’ is a sequence of nucleic acids bounded by a start codon (ATG or GTG) and a stop codon (TAA, TAG, TGA) in phase, called a coding sequence, derived from an organism different from that used to carry out the evolution and/or the production.
  • an ‘evolved protein’ is a sequence of amino acids (protein sequence) that differs in at least one amino acid from the initial protein sequence after selection.
  • heterologous protein is a protein resulting from the translation of a heterologous gene.
  • genes and proteins can be identified by their primary sequences, but also by sequence or alignment homology defining groups of proteins.
  • PFAM protein families database of alignments and hidden Markov models; http://www.sanger.ac.uk/Software/Pfam/) represents a large collection of protein sequence alignments. Each PFAM makes it possible to visualize multiple alignments, see protein domains, evaluate distribution among organisms, gain access to other databases, and visualize known protein structures.
  • COGs clusters of orthologous groups of proteins; http://www.ncbi.nlm.nih.gov/COG/) are obtained by comparing protein sequences from 43 fully sequenced genomes representing 30 major phylogenic lines. Each COG is defined from at least three lines, which permits the identification of former conserved domains.
  • the means of identifying homologous sequences and their percentage homologies are well known to those skilled in the art, and include in particular the BLAST programs, which can be used from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that website.
  • the sequences obtained can then be exploited (e.g., aligned) using, for example, the programs CLUSTALW (http://www.ebi.ac.uk/clustalw/) or MULTALIN (http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl), with the default parameters indicated on those websites.
  • genes that may be deleted or overexpressed for the evolved, strains according to the invention are principally defined using the denomination of the gene of E. coli . However, this usage has a more general meaning according to the invention and covers the corresponding genes of other microorganisms. Using the GenBank references for the genes of E. coli those skilled in the art can determine the equivalent genes in bacterial strains other than E. coli.
  • a ‘new metabolic pathway’ is a set of one or more enzyme reactions, the succession of which produces a chemical entity that, after the step to select the evolved microorganism, differs in its enzymatic activities from the corresponding pathway in the corresponding non-evolved microorganism. This difference can reside in the type of reaction catalyzed, or in kinetic characteristics (K m , V max , K i , etc.).
  • a new enzymatic pathway makes it possible to produce a chemical entity different from or the same as the initial product, from a substrate different from or the same as the initial substrate.
  • an ‘appropriate form’ is a sequence of nucleic acids, bounded by a start codon (ATG or GTG) and a stop codon (TAA, TAG, TGA) in phase, called a coding sequence, or a part of that coding sequence, under the control of regulators necessary for its expression in the microorganism in which the heterologous gene is to be expressed.
  • regulators are well known to those skilled in the art, and include promoting regulators, or promoters, in particular promoters called strong constitutive promoters in microorganisms.
  • the constitutive promoter is preferably chosen from among pTAC-O, pLAC-O, pTRC-O, strong promoters for which the lac operator has been deleted to make them constitutive, pTHLA.
  • an ‘initial microorganism’ is a microorganism that has not yet undergone any modification, mutation or evolution.
  • a ‘production microorganism’ is an evolved microorganism or optimized microorganism into which a new metabolic pathway from an evolved microorganism has been introduced.
  • a ‘modified microorganism’ is a microorganism obtained by performing controlled modifications, i.e., that are not the result of a process of evolution.
  • controlled modifications i.e., that are not the result of a process of evolution.
  • examples of such a modification are the directed mutation or deletion of a gene, or the directed modification of a promoter.
  • a ‘culture medium suitable for the production of the evolved protein’ is a medium of defined composition, or a complex medium, or a partially defined medium.
  • the complex medium is obtained from a plant, microorganism or animal hydrolysate; its composition may be determined by analysis, although an exhaustive analysis of this type of medium is seldom possible.
  • a partially defined medium is a defined medium to which a complex medium has been added.
  • a ‘biotransformation process’ is a process whereby a molecule A is transformed into a molecule B by means of one or more enzymes, which may or may not be contained in one or more microorganisms.
  • biotransformation There are three types of biotransformation: bioconversion, fermentation and biocatalysis.
  • bioconversion the enzyme or enzymes are produced in one or more microorganisms grown on a suitable medium, and substance A and if necessary one or more co-substrates are supplied for conversion into substance B.
  • the enzyme or enzymes are produced in one or more microorganisms grown on a suitable medium to enable the microorganism or microorganisms to synthesize substance A; the suitable medium can contain co-substrates.
  • biocatalysis the enzyme or enzymes are not in cells but in a suitable medium supplying substance A and any co-substrates necessary for the biotransformation.
  • a ‘deletion’ is the suppression of the activity of the ‘deleted’ gene.
  • This suppression can result from an inactivation, by suitable means, of the product of the expression of the gene concerned, or the inhibition of the expression of the gene concerned, or the deletion of at least part of the gene concerned so that its expression is impaired (for example deletion of part or all of promoter region necessary for its expression), or the loss of function of the product of the expression (for example deletion in the coding part of the gene concerned).
  • the deletion of a gene preferably consists of the removal of most of that gene, and if appropriate its replacement by a selection marker gene to facilitate identification, isolation and purification of the evolved strains according to the invention.
  • a ‘substrate’ is a metabolite that can be transformed by the action of an enzyme, if necessary in the presence of a co-substrate.
  • strains of modified microorganisms according to the invention can be prokaryotic or eukaryotic.
  • a strain of a microorganism is a set of microorganisms belonging to the same species, that comprises at least one microorganism of that species.
  • the characteristics described for the strain apply to each of the microorganisms of that strain.
  • the characteristics described for one of the microorganisms of the strain apply to all the microorganisms of which that strain is composed.
  • the optimized bacteria according to the invention are selected from among bacteria, yeasts and fungi, in particular among the following species: Aspergillus sp., Bacillus sp., Brevibacterium sp., Clostridium sp., Corynebacterium sp., Escherichia sp., Gluconobacter sp., Pseudomonas sp., Rhodococcus sp., Saccharomyces sp., Streptomyces sp., Xanthomonas sp., Candida sp.
  • Aspergillus sp. Bacillus sp., Brevibacterium sp., Clostridium sp., Corynebacterium sp., Escherichia sp., Gluconobacter sp., Pseudomonas sp., Rhodococcus sp., Saccharomyces sp.
  • the bacterial strain is a strain of Escherichia , in particular E. coli .
  • the bacterial strain is a strain of Corynebacterium , in particular C. glutamicum.
  • yeast strain is a strain of Saccharomyces , in particular S. cerevisiae
  • the overexpression of a gene can be achieved by replacing the promoter of that gene in situ by a strong or inducible promoter.
  • a single-copy or multicopy replicative plasmid in which the gene that is to be overexpressed is controlled by the appropriate promoter is introduced into the cell.
  • the inactivation of a gene is carried out preferably by homologous recombination.
  • the principal of a protocol is briefly as follows: a linear fragment obtained in vitro is introduced into the cell; this fragment comprises the two regions flanking the gene and at least one gene of selection between these two regions (generally a gene of resistance to an antibiotic); the fragment therefore presents an inactivated gene.
  • the cells that have undergone a recombination event and have integrated the fragment are then selected by spreading them on a selective medium.
  • the cells that have undergone a double recombination event in which the native gene has been replaced by the inactivated gene are then selected.
  • This protocol can be improved by using positive or negative selection systems to increase the rate of detection of double recombination events.
  • the inactivation of a gene in S. cerevisiae is achieved preferably by homologous recombination (Baudin et al., Nucl. Acids Res. 21, 3329-3330, 1993; Wach et al., Yeast 10, 1793-1808, 1994; Brachmann et al., Yeast. 14:115-32, 1998).
  • the production microorganisms are also selected from among the bacteria, yeasts and fungi listed above. They can be evolved microorganisms obtained by the evolution procedure according to the invention, or microorganisms optimized for the production of a desired metabolite, in which at least one evolved gene according to the invention has been introduced.
  • the terms ‘culture’ and ‘fermentation’ are used indifferently to denote the growth of a microorganism on an appropriate culture medium containing a simple carbon source.
  • a simple carbon source is a source of carbon that can be used by those skilled in the art to obtain normal growth of a microorganism, in particular of a bacterium.
  • it can be an assimilatable sugar such as glucose, galactose, sucrose, lactose or molasses, or by-products of these sugars.
  • An especially preferred simple carbon source is glucose.
  • Another preferred simple carbon source is sucrose.
  • the bacteria are fermented at a temperature between 20° C. and 55° C., preferably between 25° C. and 40° C., and more specifically about 30° C. for C. glutamicum and about 37° C. for E. coli.
  • the fermentation is generally conducted in fermenters with an inorganic culture medium of known defined composition adapted to the bacteria used, containing at least one simple carbon source, and if necessary a co-substrate necessary for the production of the metabolite.
  • the inorganic culture medium for E. coli can thus be of identical or similar composition to an M9 medium (Anderson, 1946, Proc. Natl. Acad. Sci. USA 32:120-128), an M63 medium (Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) or a medium such as that defined by Schaefer et al. (1999 , Anal. Biochem. 270: 88-96).
  • the inorganic culture medium for C. glutamicum can thus be of identical or similar composition to BMCG medium (Liebl et al., 1989 , Appl. Microbiol. Biotechnol. 32: 205-210) or to a medium such as that described by Riedel et al. (2001 , J. Mol. Microbiol. Biotechnol. 3: 573-583).
  • the metabolic pathways to be evolved are generally selected from among the synthetic pathways of amino acids, the synthetic pathways of nucleic acids, the synthetic pathways of lipids or the metabolic pathways of sugars.
  • the evolved metabolic pathway is a biosynthesis pathway of amino acids, in particular a biosynthesis pathway of an amino acid selected from among methionine, cysteine, threonine, lysine, or isoleucine.
  • the modified metabolic pathway is a pathway by which NADP is regenerated from NADPH.
  • the biosynthesis pathway of cysteine, of hydroxypropionate and of xylitol will be cited.
  • the invention can be applied, for example, to the methionine biosynthesis pathway ( FIG. 1 ) and yields strains of microorganisms, in particular bacteria, e.g., E. coli and corynebacteria , that produce 2-amino-4-(alkylmercapto)butyrc acid, in particular L-methionine 2-amino-4-(methylmercapto)butyrc acid) by metabolism of a simple carbon source and a sulfur source, in particular methylmercaptan (CH 3 SH), hydrogen sulfide (H 2 S) or physiologically acceptable salts of these.
  • the sulfur source H 2 S can also be introduced into the culture medium as sulfate.
  • the invention also concerns the strain of a microorganism, the improved enzymes and their coding sequences.
  • the invention concerns finally a process for the preparation of methionine by culturing the said strain of a microorganism.
  • DL-methionine is produced industrially by chelical synthesis.
  • Methylmercaptan reacts with acroleine to produce ⁇ -thiopropionaldehyde that reacts with hydrogen cyanide producing ⁇ -hydorxy- ⁇ -thiobutyronitrile. After treatment with ammonia and hydrolysis methionine is obtained.
  • One industrial process includes biocatalysis in the chemical synthesis, using amino acylase, an enzyme produced by Aspergillus oryzas , to obtain pure L-methionine from DL-methionine
  • Patents U.S. Pat. No. 6,379,934 and EP 1 055 730 describe the production of amino acids using a strain of coryneform bacteria in which the accBC gene is amplified. Methionine is mentioned, but only the preparation of L-lysine is exemplified.
  • Patent application WO 93/17112 describes the different enzymes involved in the biosynthesis of methionine from L-aspartic acid in various organisms. This patent application also describes the introduction into a micro-organism of several exogenous genes acting in sequence for the synthesis of methionine, using methyl mercaptan or hydrogen sulfide as a sulfur source.
  • This invention concerns strains of micro-organisms, in particular of bacteria, in particular of E. coli and corynebacteria , producing 2-amino-4-(alkylmercapto)butyric acids of general formula (I) R—S—(CH 2 ) 2 —CHNH 2 —COOH (I)
  • R is a straight-chain or branched-chain alkyl group containing 1 to 18 carbon atoms, which may bear one or more hydroxy substituents, or an aryl group or a heteroaryl group containing one or more atoms of nitrogen or sulfur in its heteroaromatic ring, and which can be a phenyl, pyridyl, pyrolyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, or thienyl group,
  • R′ is a hydrogen atom or a group R as defined above, and its physiologically acceptable salts
  • strains present at least one gene coding for an enzyme with a modified ‘methionine synthase’ activity.
  • An enzyme with a modified ‘methionine synthase’ activity is any enzyme involved in the biosynthesis of 2-amino-4-(alkylmercapto)butyric acids of general formula (I) by bioconversion of a substrate of general formula (III) R′′—O—(CH 2 ) 2 —CHNH 2 —COOH (III)
  • R′′ is an acyl group, preferably either a succinyl group or an acetyl group,
  • the enzymes with modified ‘methionine synthase’ activity are enzymes that are modified compared with the wild type enzymes, so that they will preferentially perform the direct bioconversion of the substrate of general formula (III) into the acid of general formula (I) or homocysteine, of formula (IV), in place of the reaction catalysed by the wild type enzyme.
  • This modification also termed mutation, results essentially in a greater affinity of the modified enzyme for the sulfur-containing compound of general formula (II) than for its natural co-substrate.
  • a simple carbon source according to the present invention is any carbon source that can be used by those skilled in the art to obtain the normal growth of a micro-organism, in particular a bacterium.
  • This definition includes in particular any assimilable sugar, such as glucose, galactose, sucrose, or molasses, or by-products of these sugars.
  • One especially preferred simple carbon source is glucose.
  • Another preferred simple carbon source is sucrose.
  • a physiologically acceptable salt according to the invention is any salt of the compound of general formula (I) that does not affect the metabolism or the growth capacity of the micro-organism according to the invention, being in particular an alkali metal salt, such as a sodium salt.
  • R is a straight-chain or branched-chain alkyl group containing 1 to 4 atoms of carbon, in particular a methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl or t-butyl group, and is preferably a methyl group.
  • the 2-amino-4-(alkylmercapto)butyric acid of general formula (I) obtained is preferably L-methionine.
  • the use of a simple carbon source and a sulfur compound of formula (II) to produce an acid of formula (I) by bioconversion offers several advantages a priori, in particular:
  • the invention is based on the directed modification of the ‘methionine-synthase’ activity of cystationine- ⁇ -synthase (EC 4.2.99.9; GenBank AAN83320, or AAA24167) in the presence of methyl-mercaptan.
  • This enzyme of the methionine biosynthesis pathway coded for by the gene metB in E. coli ( FIG. 2 ) and C. glutamicum , presents an activity for a wide spectrum of substrates (Flavin, M.; Slaughter, C. (1967) Enzymatic synthesis of homoserine or methionine directly from O-succinyl-homoserine. Biochim. Biophys. Acta 132: 400-405).
  • the invention is also based on the directed modification of the ‘methionine-synthase’ activity of O-acetyl-L-homoserine sulfhydrylase (or O-acetyl-L-homoserine sulfhydrylase, C 4.2.99.10) in the presence of methyl mercaptan.
  • This enzyme of the methionine biosynthesis pathway coded for by the gene metY in C. glutamicum (Genbank AF220150), presents an activity for a wide spectrum of substrates (Smith I K, Thompson J F. (1969) Utilization of S-methylcysteine and methyl mercaptan by methionineless mutants of Neurospora and the pathway of their conversion to methionine. II. Enzyme studies. Biochim Biophys Acta 184(1):130-8).
  • the invention therefore also concerns a method for the preparation of the strains according to the invention and their use in a method for the preparation of a 2-amino-4-(alkylmercapto)butyric acid of general formula (I), preferably L-methionine.
  • the method for the preparation of strains according to the invention consists of obtaining, from an initial bacterial strain, a genetically modified bacterial strain that presents at least one modification to a gene coding for an enzyme with ‘methionine synthase’ activity, by a process that comprises a step in which that initial bacterial strain is subjected to a selection pressure in the presence of a compound of formula (II) defined above, in order to direct the evolution of the gene coding for the enzyme with ‘methionine synthase’ activity in that bacterial strain towards a gene coding for an enzyme with a ‘methionine synthase’ activity that is modified relative to that of the initial bacterial strain.
  • a ‘methionine synthase’ activity is improved in strain (A) of the micro-organism relative to the initial strain (I) when the production of methionine in the same culture conditions (in a medium containing an appropriate quantity of the sulfur-containing compound of formula (II)) is greater in strain (A) than in strain (I).
  • This improvement is preferably observed by measuring the quantity of methionine produced. In some cases this improvement can be observed by the increase in the growth rate of bacteria (A) relative to the growth rate of bacteria (I), in a minimum medium containing no methionine.
  • This invention also concerns those strains with improved ‘methionine synthase’ activity that can be obtained by the selection process according to the invention, and comprising at least one gene coding for an enzyme with a modified ‘methionine synthase’ activity as defined above and below.
  • the enzyme with modified ‘methionine synthase’ activity allows the direct conversion of the substrate of general formula (III) into the acid of general formula (I).
  • the sulfur source is a compound of general formula (II) where R′ is a group R as defined above.
  • the enzyme with modified methionine synthase activity is chosen from among the cystathionine- ⁇ -synthases and the acylhomoserine sulfhydrylases.
  • the enzyme with modified ‘methionine synthase’ activity allows the conversion of the substrate of general formula (III) into homocysteine, of general formula (IV) HS—(CH 2 ) 2 —CHNH 2 —COOH (IV)
  • the sulfur-containing source is a compound of general formula (II) in which R′ is an atom of hydrogen, preferably, hydrogen sulfide.
  • the sulfur source H 2 S can be introduced into the culture medium or be produced by the bacteria from a simple sulfur source, for example a sulfate.
  • the enzyme with modified methionine synthase activity is advantageously chosen from among the cystathionine- ⁇ -synthases and the acylhomoserine sulfhydrylases.
  • the substrate is advantageously O-acetyl-L-homoserine or O-succinyl-L-homoserine, preferably O-succinyl-L-homoserine.
  • the substrate is advantageously O-succinyl-L-homoserine or O-acetyl-L-homoserine, preferably O-acetyl-L-homoserine.
  • the modification consists essentially of a mutation such that the conversion of the substrate of general formula (III) takes place preferentially with the compound of general formula (II) rather than with L-cysteine.
  • the mutation of the enzymes can be obtained by implementing the method for the preparation of strains with improved ‘methionine synthase’ activity according to the invention by culture under selection pressure in the presence of the compound of general formula (II).
  • the gene with the sequence coding for cystathionine-Y-synthase or acylhomoserine sulfhydrylase can be
  • Such regulatory elements are well known to those skilled in the art, and contain promoter regulation sequences, or promoters, in particular strong constitutive promoters in micro-organisms.
  • the strong constitutive promoter is preferably pTAC-O (SEQ ID No. 1), or pLAC-O (SEQ ID No. 2), or pTRC-O (SEQ ID No. 3), or pTHLA (SEQ ID No. 4), all of which are strong promoters in which the lac operator has been deleted to make them constitutive.
  • cystathionine- ⁇ -synthases are advantageously selected among the cystathionine- ⁇ -synthases corresponding to PFAM reference PF01053 and to COG reference CPG0626.
  • the cystathionine- ⁇ -synthase is preferably the cystathionine- ⁇ -synthase from E. coli K12, represented by SEQ ID No. 6.
  • Homologous sequences of this sequence have cystathionine- ⁇ -synthase activity and at least 80% homology, preferably 90% homology, and more preferably 95% homology with the amino acid sequence of SEQ ID No. 6.
  • the means of identifying homologous sequences and their percentage of homology are well-known to those skilled in the art, and include in particular the BLAST program, and in particular the BLASTP program, which can be used from the web site http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that site.
  • the initial cystathionine- ⁇ -synthase, before modification contains the following sequence of amino acids in its C-terminal part. (conserved zone 1)
  • X1 represents A,G,S, preferably A
  • X2 represents E,V,P,T, preferably E
  • X3 represents S,T,N, preferably S
  • X4 represents G,D,A,H,T, preferably G
  • X5 represents V,A,T,H,N, preferably V
  • X6 represents E,R,K,F, preferably E
  • X7 represents S,T, preferably S
  • X8 represents L,I,V,A, preferably L and
  • X9 represents I,V,A,T, preferably I.
  • cystathionine- ⁇ -synthase with modified ‘methionine synthase’ activity preferably contains the following amino acid sequence in its C-terminal part:
  • the initial cystathionine ⁇ -synthase, before modification, also advantageously contains at least one of the following amino acid sequences in its N-terminal part (conserved zone 2):
  • X10 represents H,Y,F,L,K, preferably A
  • X11 represents E,D,K,R V,I, preferably Y
  • X12 represents S,A,T,P,G, preferably S
  • X13 represents I,S,T,R,E,F,W,D, preferably S
  • X14 represents S,G,A,I,E,N,K,P, preferably G
  • X15 represents N,H,Q,S, preferably N
  • X16 represents P,D,L, preferably P
  • X17 represents T,M,N,G,S, preferably T and
  • X18 represents R,L,V,S,W,E, preferably R.
  • Amino acids X1 to X9 correspond to residues 324 to 334 of the cystathionine ⁇ -synthase sequence of E. coli K12, represented on SEQ ID No. 6.
  • amino acids X10 to X18 correspond to residues 44 to 54 of the sequence of cystathionine ⁇ -synthase of E. coli K12, represented on SEQ ID No. 6.
  • the positions of the amino acids used above and below are relative positions set with reference to the sequence of the cystathionine- ⁇ -synthase of E. coli K12.
  • sequence alignment tools include in particular the BLAST program, which can be used from the web site http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that site.
  • the sequence alignment can be carried out at the level of both the protein (SEQ ID No. 6) and its coding sequence, such as for example the coding sequence represented on SEQ ID No. 5.
  • the advanced search function of BlastP can also be advantageously used by refining the search with a (PHI-BLAST) motif.
  • the motif [AGS]-[EVPT]-[STN]-L-G-[GDAHT]-[VATHN]-[ERKF]-[ST]-[LIVA]-[IVAT] can be taken for a first conserved zone, and the motif x(2)-Y-[SATPG]-R-x(2)-[NHQS]-[PDL]-[TMNGS]-[RLVSWE] for a second conserved zone, where the letters in bold type represent the amino acids found most often at that position in the sequence, and where x stands for any amino acid.
  • the number 2 in brackets signifies that there are two undetermined amino acids.
  • the CLUSTALW program http://www.ebi.ac.uk/clustalw/
  • MULTALIN program http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl
  • CCS cystathionine- ⁇ -synthases
  • the modified cystathionine- ⁇ -synthase as defined above preferably presents at least one mutation in its C-terminal part, and (or) at least one mutation in its N-terminal part.
  • a mutation according to the invention is the substitution of an amino acid in the wild type sequence by a different amino acid.
  • the mutation preferably consists of the replacement of an acidic amino acid, which interacts with the cysteine co-substrate for the unmodified enzyme, by an apolar amino acid.
  • This apolar amino acid is a glycine, alanine, leucine, isoleucine, valine, phenylalanine or methionine residue.
  • amino acids can be identified by reference to the crystal structure of the cystathionine- ⁇ -synthases of E. coli , described by Clausen et al. (EMBOJ, Vol. 17, No. 23, pp 6827-6838, 1998).
  • the mutation in the C-terminal part is advantageously introduced among the acidic amino acids of the ‘conserved zone 1’ as defined above, in particular at the level of residue X2.
  • cystathionine- ⁇ -synthase with modified ‘methionine synthase’ advantageously contains the following amino acid sequence in its C-terminal part:
  • X1, X3, X4, X5, X6, X7, X8 and X9 are defined above, and
  • X2 stands for G,A,L,I,V,F, or M, and preferably A.
  • the mutation in the N-terminal part is advantageously introduced among the amino acids of the ‘conserved zone 2’ as defined above, in particular at the level of residue X11 and (or) R and (or) X13.
  • cystathionine- ⁇ -synthase with modified ‘methionine synthase’ activity contains the following amino acid sequence in its C-terminal part.
  • the cystathionine- ⁇ -synthase with modified ‘methionine synthase’ activity according to the invention can advantageously contain the following amino acid sequence in its N-terminal part:
  • X7; X9,X12, X14, X15, X16, X17 and X18 are defined above,
  • X11 is defined above or is an apolar amino acid
  • X19 is defined above or is an apolar amino acid
  • At least one of the amino acids X11, X13 and X19 is an apolar amino acid as described above.
  • cystathionine- ⁇ -synthase with modified ‘methionine synthase’ activity is a cystathionine- ⁇ -synthase as defined above, modified to allow the direct conversion of O-succinyl-L-homoserine into L-methionine with methyl mercaptan as a sulfur source (compound of general formula (II) where R is a methyl group).
  • cystathionine- ⁇ -synthase with modified ‘methionine synthase’ activity contains the sequence of amino acids represented on SEQ ID No. 8.
  • a DNA sequence coding for this modified enzyme is represented on SEQ ID No. 7.
  • This invention also concerns the modified cystathionine- ⁇ -synthases as defined above, and the nucleic acid sequences coding for these modified cystathionine- ⁇ -synthases, in particular the isolated sequences, in particular the DNA sequences, and in particular the sequence represented on SEQ ID No. 7, the cloning and (or) expression vectors containing those nucleic acid sequences under the control of the regulatory elements necessary for the expression and transcription of the modified cystathionine- ⁇ -synthase in a host organism, and the host organisms transformed with those vectors.
  • acylhomoserine sulihydrylases are advantageously chosen among the acylhomoserine sulfhydrylases corresponding to the PFAM reference PF01053 and the COG reference COG2873.
  • acylhomoserine sulhydrylases are preferably chosen among the following acylhomoserine sulhydrylases:
  • the modification of the methionine biosynthetic pathway requires initially a genetically modified bacterium.
  • the modification involves necessarily the attenuation of at least one gene and possibly the cloning of at least one heterologous gene.
  • the attenuation of the gene makes the bacterium dependent on the restoration of an equivalent metabolic pathway allowing its growth.
  • the genetically modified bacterium is cultivated and the strain or the bacterial strains are selected whose growth rate improves in the presence or absence of an exogenous co-substrate.
  • the process for the construction of strains according to the invention consists of obtaining, starting with an initial strain, a genetically modified bacterial strain that comprises at least one modification in a gene coding for an enzyme with “methionine synthase” activity (e.g. E. coli MetE) or “homocysteine synthase” activity (e.g. E. coli MetC).
  • This process comprises a step that consists of subjecting the said initial bacterial strain to a selection pressure in the presence of the sulfur source defined above in order to direct the evolution of at least one gene (e.g. metB in E. coli ) in the said bacterial strain, in order to restore a methionine synthase activity or homocysteine synthase activity in the evolved strain; this restoration of activity is not linked to a reversion of the effected modification.
  • a genetically modified bacterial strain that comprises at least one modification in a gene coding for an enzyme with “methionine synthase” activity (e.
  • the invention also concerns a strain with improved “methionine synthase” activity that comprises an inactivation of at least one endogenous gene involved in the conventional methionine biosynthesis pathway.
  • the bacterial strain comprises an inactivation of at least one endogenous gene.
  • This endogenous gene is chosen among metB, metJ, metC, metE, or metH.
  • the said modification of the initial strain that is found in the strain with improved “methionine synthase” activity notably E. coli consists of inactivating the wild-type methionine synthase activity (encoded by the gene metE in E.
  • the medium used for the selection of the evolved microorganism is identical to the medium on which the initial microorganism (the one that is not modified) grows; only one co-substrate (e.g. alkylmercaptan) is added.
  • the bacterial strain selected comprising the evolved microorganism according to the invention is an E. coli strain, more particularly the strain E. coli K183, that has been registered under the number 1-3005, on Apr. 2 nd 2003 at the Collection Nationale de Culture et Microorganismes (CNCM), 25 rue du Do Budapest Roux, 75724 Paris Cedex 15, France according to the treaty of Budapest.
  • This strain comprises a gene expressing modified cystathionine- ⁇ -synthase, the enzyme harboring the mutation E325A, and the inactivation of metE.
  • the said modification of the initial strain notably E. coli
  • the said modification of the initial strain consists of inactivating the cystathionine- ⁇ -lyase activity (encoded by the gene MetC in E. coli ), then of cultivating the said modified microorganism that is obtained on a defined medium lacking methionine, S-adenosylmethionine, homocysteine and cystathionine, then selecting an evolved microorganism in which the homocysteine synthase activity of the cystathionine- ⁇ -synthase is strongly improved in the presence of endogenous H2S, to the point of replacing the initial inactivated activity.
  • the medium used for the selection of the evolved microorganism is identical to the medium on which grows the initial microorganism (the non-modified).
  • the said modification of the initial strain notably E. coli
  • the said modification of the initial strain consists of inactivating the wild type succinyl-homoserine sulfhydrylase (encoded by the metB gene) and methionine synthase (encoded by the metE gene in E. coli ). Then the acetyl-homoserine sulfhydrylase (encoded by the metY gene in C.
  • glutamicum is introduced and the said modified obtained microorganism is cultured on a defined medium lacking methionine, S-adenosylmethionine, homocysteine and cystathionine, but supplemented with sodium methylmercaptide with the goal to select an evolved microorganism in which the methionine synthase activity carried by the acetyl-homoserine sulfhydrylase (MetY) is strongly improved, in the presence of sodium methylmercaptide, to the point of replacing the methionine synthase activity that was initially inactivated.
  • MethodY acetyl-homoserine sulfhydrylase
  • the medium used for the selection of the evolved microorganism is identical to the medium on which the initial microorganism (the one that is not modified) grows; only a co-substrate (e.g. methylmercaptan) is added.
  • a co-substrate e.g. methylmercaptan
  • JP 2000157267-A/3 A mutation of the gene metJ is proposed in JP 2000157267-A/3, to produce a greater quantity of methionine (see also GenBank E35587).
  • This gene codes for a protein that represses the genes metB, E, L, J and R (in Salmonella typhimurium ). Its inactivation or its modification reduces the negative feedback control exerted by methionine.
  • the gene metC (GenBank M12858), codes for the cystathionine- ⁇ -lyase (EC 4.4.1.8), and the genes metE (GenBank AE000458) and metH (GenBank J04975) code for the methionine synthase (EC 2.1.1.13).
  • Methionine is an amino acid that is essential for cell life. The inactivation of one or more of these genes has the effect of suppressing the usual methionine biosynthesis pathway.
  • the strain with modified ‘methionine synthase’ activity according to the invention that possesses an enzyme with modified ‘methionine synthase’ activity defined above preferably presents at least one inactivation of the gene metE and (or) metH, and (or) of the gene metC, and (or) of the gene metB.
  • the strain according to the invention advantageously presents at least one inactivation of the gene metE and (or) metH and (or) metB, preferably at least one inactivation of the gene metE.
  • the strain according to the invention presents at least one inactivation of the gene MetC and (or) metB. It can also present an inactivation of the gene metE and (or) endogenous metH. In this case, the methylase activity associated with the genes metE and (or) metH is restored by the introduction of a gene coding for an enzyme with the same activity.
  • This enzyme can be one that has been selected and (or) modified to improve the yields of the synthesis of the amino acids of general formula (I).
  • the bacterial strain can also present a modification of the homoserine O-acyltransferase activity controlled by the gene metA such as to lend it either a homoserine O-succinyltransferase activity (EC 2.3.1.46) or a homoserine O-acetyltransferase activity (EC 2.3.1.11).
  • the over-expression of a gene can be achieved by changing a promoter of this gene in situ for a strong or inducible promoter.
  • a replicative plasmid single-copy or multicopy
  • the gene to be over-expressed is under the control of an appropriate promoter.
  • the inactivation of a gene is preferably carried out by homologous recombination.
  • the protocol principle is briefly as follows: a linear fragment is introduced into the cell. This fragment is obtained in vitro, and it comprises the two regions flanking the gene, and at least one selected gene between these two regions (generally a gene for antibiotic resistance). This linear fragment thus presents an inactivated gene.
  • the cells that have undergone a recombination event and have integrated the fragment introduced are selected by plating on a selective medium.
  • the cells that have undergone a double recombination event are then selected, in which the native gene has been replaced by the inactivated gene.
  • This protocol can be improved by using systems of positive and negative selection to speed up the detection of double recombination events.
  • the bacterial strain is a strain of E. coli.
  • the bacterial strain is a strain of Corynebacterium , in particular C. glutamicum.
  • the bacterial strain is the strain E. coli K183 registered at the CNCM (French IDA) on 2 Apr. 2003 under the number I-3005.
  • This strain possesses a gene expressing a modified cystathionine- ⁇ -synthase that presents the mutation E325A described previously, and an inactivation of the gene metE.
  • the strains of micro-organisms according to the invention possess a cystathionine- ⁇ -synthase enzyme and (or) an acylhomoserine sulfhydrylase enzyme. They are preferably selected and improved by a method of screening and evolution, which is also an object of the invention.
  • the strains according to the invention can also be genetically modified (that is, they can present an inactivation, a mutation and (or) an over-activation of at least one endogenous gene). This modification can be made before or after the implementation of the screening process.
  • One option is to disrupt the metE gene coding for methionine-synthase, which produces methionine from homocysteine. The strain then becomes auxotrophic for methionine.
  • Methionine Methionine Biomass yields yields a yields b Y x/s (g/g) Y p/s (g/g) Y p/s (g/g) 0 0.36 0.74 0.11 0.30 0.62 0.28 0.21 0.42 0.44 0.12 0.24 0.61 0 0
  • the medium has to be supplemented with methionine to enable the micro-organism to grow.
  • the gene metJ which codes for a repressor gene, can thus be suppressed.
  • homoserine transsuccinylase coded for by the gene metA, is down-regulated by methionine and S-adenosylmethionine (Taylor et al., 1966, J. Biol. Chem., 241: 3641-3642). It is therefore desirable to replace this enzyme by one that is insensitive to this negative feedback (Chater et al, 1970, J. Gen. Microbiol. 63: 121-131).
  • a further object of the invention is a screening and identification test by which it is possible to obtain a micro-organism producing a 2-amino-4-(alkylmercapto)butyric acid, in particular L-methionine, by metabolising an alkyl mercaptan or H 2 S, in particular methyl mercaptan.
  • the present invention makes it possible to identify the strains that possess mutations in their genome such that the strain is able to assimilate a compound of formula (II), and produce the amino acid of formula (I). These modifications thus induce an increase in the ‘methionine synthase’ activity of that strain. It is thus possible to accelerate the production of the strain producing methionine autonomously from a simple carbon source and a compound of formula (II).
  • a further object of the invention is thus a method of screening of an initial bacterial strain, which can be a genetically modified bacterial strain, that possesses a gene coding for a cystathionine- ⁇ -synthase enzyme or acylhomoserine sulfhydrylase enzyme, in order to obtain a genetically modified bacterial strain producing an amino acid of formula (I), in particular L-methionine, and presenting a modification to the gene of that enzyme that induces a modification to the ‘methionine synthase’ activity in the presence of a sulfur-containing compound of formula (II), whereby the bacterial strain is subjected to a selection pressure in the presence of a compound of formula (II), so as to direct an evolution of the gene coding for the cystathionine- ⁇ -synthase enzyme or for the acylhomoserine sulfhydrylase enzyme in that bacterial strain, which evolution consists of a mutation that enables it to carry out a prefer
  • the initial bacterial strain can present an inactivation and (or) an over-activation, in particular by the insertion of a strong constitutive promoter, of at least one endogenous gene.
  • the invention also concerns a bacterial strain presenting a modification to the gene of the cystathionine- ⁇ -synthase enzyme and (or) to the gene of the acylhomoserine sulfhydrylase enzyme, inducing an increased ‘methionine synthase’ activity of that enzyme in the presence of a compound of formula (II), in particular methyl mercaptan.
  • a strain can also present at least one other genetic modification (inactivation, mutation or over-expression of an endogenous gene), as described above.
  • the strain according to the invention can preferably be obtained by a method according to the invention, and in particular is obtained by the method according to the invention.
  • the invention also concerns a method for the preparation of a 2-amino-4(alkylmercapto)butyric acid of formula (I) defined above, whereby a micro-organism with a modified ‘methionine synthase’ activity as defined above is grown in the presence of a sulfur-containing compound of general formula (II) in an appropriate medium containing a simple carbon source as defined above.
  • the amino acid of formula (I) is preferably methionine, more preferably L-methionine, and the sulfur-containing compound of general formula (II) is methyl mercaptan or H 2 S.
  • culture and ‘fermentation’ are used interchangeably to designate the growth of bacteria in an appropriate culture medium containing a simple carbon source.
  • the culture conditions for micro-organisms according to the invention can be set by those skilled in the art.
  • bacteria are grown at a temperature between 20° C. and 55° C., preferably between 25° C. and 40° C., and in particular at about 30° C. for C. glutamicum and about 37° C. for E. coli.
  • the fermentation is carried out in fermenters with a mineral culture medium of known set composition adapted to the bacteria used, containing at least one simple carbon source together with the sulfur-containing compound of formula (II).
  • the mineral medium for E. coli can be identical or similar in composition to an M9 medium (Anderson, 1946 , Proc. Natl. Acad. Sci. USA 32:120-128), or to an M63 medium (Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), or to a medium such as defined by Schaefer et al. (1999 , Anal. Biochem. 270: 88-96).
  • the mineral culture medium for C. glutamicum can be identical or similar in composition to BMCG medium (Liebl et al., 1989 , Appl. Microbiol Biotechnol. 32: 205-210), or to a medium such as defined Riedel et al. (2001 , J. Mol. Microbiol. Biotechnol. 3: 573-583).
  • the media can be supplemented to compensate for any auxotrophy. They contain a concentration of simple carbon that is adapted to the culture and production mode, and a sulfur-containing compound of formula (II) at a concentration adapted to the evolution of the strain and the mode of production selected.
  • amino acid of formula (I) is recovered by the usual methods and if necessary purified.
  • the present invention also concerns a method for the preparation of a 2-amino-4(alkylmercapto)butyric acid of formula (I) defined above, whereby a substrate of general formula (III) R′′—O—(CH 2 ) 2 —CHNH 2 —COOH (III)
  • R′′ represents an acyl group, preferably either a succinyl or an acetyl group
  • the appropriate reaction medium is a usual enzyme reaction medium well known to those skilled in the art, in particular an aqueous medium in which the substrates and the enzyme are dissolved or suspended.
  • the conditions of implementation of the reaction are well known to those skilled in the art, in particular those required to prevent any substantial denaturing of the enzyme.
  • the enzyme with modified ‘methionine synthase’ activity is present in an inactivated bacterium or in a cell extract.
  • the enzyme with modified ‘methionine synthase’ activity is a purified enzyme.
  • the present invention also relates to the field of bioconversion and the production of amino acids by fermentation of microorganisms. It relates also to a screening and directed evolution method allowing the identification of strain of microorganisms, possibly genetically modified, possessing an enzyme with “modified cysteine synthase” activity, in particular a modified O-acyl-L-homoserine sulfhydrylase.
  • the corresponding strain produces L-cysteine or an amino acid derivative by metabolism of a simple carbon source.
  • the invention also concerns the strain of a microorganism and the process for the preparation of L-cysteine, or an amino acid derivative, by culturing the said strain of a microorganism.
  • Cysteine can be produced using various means and different sources.
  • Sun-Orient Chemical Co., Ltd extracts L-cystine from hydrolyzed hair in the presence of HCl. L-cystine is then converted into cysteine monohydrochloride using an electrolytic process.
  • DL-cysteine monohydrochloride can be produced by the Strecker process (synthesis of L-cystine in the presence of ammonium, HCN and mercaptaldehyde).
  • the Bucherer-Berg reaction in which chloracetaldehyde, HCN, ammoniumbicarbonate and sodiumsulfide are mixed, allows also the production of L-cysteine.
  • La L-cysteine is crystallized as monohydrochloride in a solution of hydrochloric acid.
  • the invention can also be applied, for example, to the cysteine biosynthesis pathway ( FIG. 4 ) providing strains of evolved microorganisms, in particular bacteria, e.g., E. Coli and Corynebacteria , that produce 2-amino-4-(alkylmercapto) propionic acids with the general formula (V) R—S—CH 2 —CHNH 2 —COOH (V)
  • strains present at least one gene coding for a mutated enzyme with an ‘evolved cysteine synthase’ activity.
  • a ‘physiologically acceptable salt’ of the compound of general formula (I) is one that does not effect the metabolism or ability to grow of the microorganism strain according to the invention, in particular the salts of alkali metals such as sodium.
  • R is a straight-chain or branched-chain alkyl radical containing 1 to 4 atoms of carbon, selected in particular from among the methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl and t-butyl groups.
  • R is preferentially a methyl radical.
  • the 2-amino-4-(alkylmercapto)propionic acid of general formula (V) obtained is preferably L-cysteine.
  • an enzyme with evolved ‘cysteine synthase’ activity is any mutated enzyme involved in the biosynthesis of the amino acid of general formula (V), in particular L-cysteine, the essential activity of which is to carry out the direct conversion of an acetylserine, preferably O-acetyl-L-serine, into an amino acid of general formula (V) in the presence of a sulfur compound of general formula (II), whereas the essential activity of the initial non-mutated enzyme was not a ‘cysteine synthase’ activity.
  • cysteine synthases A and B coded for by genes cysK or cysM, respectively, are therefore excluded from this definition.
  • the ‘initial’ non-mutated enzyme is preferentially an enzyme that catalyzes a sulfhydrylation reaction in the presence of H 2 S, preferably an enzyme with O-acyl-L-homoserine sulfhydrylase activity.
  • the ‘initial’ enzymes with O-acyl-L-homoserine sulfhydrylase activity are advantageously selected form among the O-acyl-L-homoserine sulfhydrylases corresponding to PFAM reference PF01053 and COG reference COG2873.
  • acylhomoserine NP_785969 O-acetylhomoserine (thiol)-lyase, Lactobacillus plantarum WCFS1 AAN68137 O-acetylhomoserine sulfhydrylase, Pseudomonas putida KT2440 NP_599886 O-acetylhomoserine sulfhydrylase, Corynebacterium glutamicum ATCC 13032 NP_712243 acetylhomoserine sulfhydrylase, Leptospira interrogans serovar lai str.
  • the O-acyl-L-homoserine sulfhydrylase is selected from among the O-acyl-L-homoserine sulfhydrylases coded for by the gene metY of Corynebacterium , in particular the gene metY of C. glutamicum (Genbank AF220150), and the homologous enzymes presenting the same O-acyl-L-homoserine sulfhydrylase activity, and at least 80% sequence homology with O-acyl-L-homoserine sulfhydrylase coded for by the gene metY of C. glutamicum (Genbank AF220150), preferably at least 85% homology, and more preferably at least 90% homology.
  • the invention is in particular based on the fact that it is possible to obtain, in a controlled manner, a modification of the substrate specificity of the enzyme acyl-homoserine sulfhydrylase so that it uses acetylserine preferentially. Consequently the invention is based on the fact that it is possible to modify, in a controlled manner, the substrate specificity of the unmodified enzyme in order to evolve from an acylhomoserine sulfhydrylase activity to a cysteine synthase activity.
  • the strains of unmodified microorganisms do not naturally possess O-acyl-L-homoserine sulfhydrylase activity or do not possess a gene homologous to the gene metY that codes for that enzyme.
  • the strains modified according to the invention are genetically modified by the inactivation, mutation and/or overactivation of at least one endogenous gene in order to permit the evolution of a new metabolic pathway.
  • the strains of microorganisms according to the invention are genetically modified to suppress the genes cysK and/or cysM coding for the proteins respectively bearing the cysteine synthase A, and cysteine synthase B enzyme activities.
  • the genes cysK and cysM are preferentially suppressed.
  • the gene cysK ( FIG. 4 ) codes for cysteine synthase A (GenBank NP — 416909) and the gene cysM codes for cystene synthase B (GenBank NP — 416916). The effect of inactivating these genes closes the cysteine biosynthesis pathways and so makes the strain auxotrophic for cysteine.
  • a gene is then introduced into the modified bacteria that codes for an enzyme catalyzing a sulfhydrylation reaction in the presence of H 2 S, as defined previously, other than those enzymes the main activity of which is a cysteine synthase activity (also called O-acetylserine sulfhydrylase), in particular a gene coding for an O-acyl-L-homoserine sulfhydrylase, such as the gene metY of Corynebacterium , and in particular the gene metY of C. glutamicum (Genbank AF220150).
  • the gene coding for an enzyme catalyzing a sulfhydrylation reaction in the presence of H 2 S can be introduced into the bacterium to be modified by the usual methods available to those skilled in the art, either by direct integration or carried by a replicative plasmid.
  • the strain modified in this way is preferably selected and improved by a method of screening and evolution, which is also an object of this invention, and which makes it possible to cause the acyl-homoserine sulfhydrylase activity to evolve into a cysteine synthase activity to restore the production of cysteine.
  • the transformation of the acyl-homoserine sulfhydrylase activity into an ‘evolved cysteine synthase’ activity is deemed to be achieved when the genetically modified and evolved bacterial strain (E) has a growth rate at least similar to that of the initial modified strain (M) when grown in a minimal medium in the presence of glucose as a single carbon source.
  • the transformation of the acyl-homoserine sulfhydrylase activity into the ‘evolved cysteine synthase’ activity is deemed to be achieved when the cysteine synthase activity carried by the modified O-acyl-L-homoserine sulfhydrylase protein has been improved by 10% relative to its initial activity.
  • the strains according to the invention can also be genetically modified by inactivation, mutation and/or overactivation of at least one endogenous gene, such modification being made before or after the evolution step of the modified strain.
  • the strains of microorganisms are genetically modified in order to suppress the enzymatic activities cysteine synthase A, cysteine synthase B and cystathionine- ⁇ -synthase.
  • the genes cysK and cysM are suppressed.
  • the gene cysK encodes the cysteine synthase A (GenBank NP — 416909)
  • the gene cysM encodes cysteine synthase B (Genbank NP — 416916).
  • the gene coding for cystathionine gamma-lyase activity can be deleted, if required.
  • the bacterial strain can also undergo modification of the serine O-acyltransferase activity carried by the gene cysE ( FIG. 4 ) to make it insensitive to feedback inhibition by cysteine.
  • the bacterial strain can also be made to overexpress the gene cysB in order to deregulate the H 2 S sulfur assimilation pathway.
  • amino acids of formula (V), preferably L-cysteine can also be advantageous for the production of amino acids of formula (V), preferably L-cysteine, to overexpress the gene coding for acetyl-CoA synthetase, such as the gene acs (EC 6.2.1.1), accession number AE000480, at the same time as the gene coding for an enzyme with an ‘improved cysteine synthase activity’ defined previously ( FIG. 4 ).
  • genes coding for an acetate kinase and/or for a phosphotransacetylase in particular the genes ack and pta accession numbers AE000318 and AE000319 respectively, and coding respectively for an acetate kinase (EC 2.7.2.1) and a phosphotransacetylase (EC 2.3.1.8).
  • This attenuation/deletion is preferably combined with an overexprssion of the gene coding for acetyl-CoA synthetase.
  • the invention thus further concerns a method for the preparation of a bacterial strain with an ‘evolved cysteine synthase activity’ as defined previously, which method comprises a step consisting in growing, in an appropriate culture medium containing a simple carbon source, a bacterial strain possessing an enzyme catalyzing a sulfhydrylation reaction in the presence of H 2 S of which the essential activity is not a ‘cysteine synthase’ activity as defined previously, in order to cause an evolution of the gene coding for that enzyme in that bacterial strain into a gene coding for an ‘evolved cysteine synthase’ activity.
  • genes cysK, cysM and possibly metB and possibly the gene coding for a cystathionine gamma lyase may be deleted, in order to suppress all natural cysteine synthesis pathways. In this way the strain becomes auxotroph for cysteine.
  • the microorganism In order to live in minimal medium containing a simple carbon source, the microorganism has to optimize the cysteine synthase activity of the O-acyl-homoserine sulfhydrylase, so that it can reestablish the synthetic pathway of cysteine starting with acetylserine and H2S. When metB is deleted, it can be necessary to supplement the medium with methionine.
  • the cysB gene encoding the activator protein of the assimilatory sulfur pathway can be overexpressed (WO01/27307) allowing the optimization of H2S production. Furthermore it has been shown that serine acetyltransferase encoded by the cysE gene, is feed-back inhibited by cysteine. Therefore it is desirable to replace this enzyme by an enzyme that is not sensitive to feed-back inhibition (WO97/15673; WO 02/061106) or alternatively overexpressing the enzyme (WO 02/29029).
  • the invention further concerns a method for the preparation of cysteine, in which a microorganism with an ‘evolved cysteine synthase’ activity as defined previously is grown in an appropriate culture medium containing a simple carbon source as defined previously.
  • the definition of the fermentation conditions belongs to those skilled in the art.
  • the fermentation is conducted in fermenters with an inorganic growth medium of known set composition adapted according to the bacteria used, containing at least one simple carbon source.
  • the media can be supplemented to compensate for the auxotrophies other than that caused by the deletion of the genes cysK and/or cysM; they contain a simple source of carbon at a concentration adapted according to the mode of growth and production, and a sulfur compound of formula (II) at a concentration adapted according to the evolution of the strain and to the desired mode of production.
  • cysteine is recovered by the usual methods and purified if necessary.
  • This invention further concerns a method for the preparation of an amino acid of general formula (V) as defined previously, characterized in that acetylserine is made to react with an enzyme with an ‘evolved cysteine synthase’ activity as defined previously, in an appropriate reaction medium containing a sulfur compound of general formula (II) defined previously.
  • the appropriate reaction medium is a usual enzyme reaction medium, well known to those skilled in the art, in particular an aqueous medium in which the substrates and the enzyme are dissolved or suspended.
  • the operating conditions for the reaction are well known to those skilled in the art, in particular those required to prevent substantial denaturing of the enzyme.
  • the enzyme with an ‘evolved cysteine synthase’ activity is present in an inactivated bacterium or in a cell extract.
  • a NADPH-dependent pathway can be caused to evolve.
  • the initial bacterial strain must be modified in such a way that the rate of production of NADPH is greater than its rate of oxidation to NADP+ (also designated NADP), which will prevent growth of the bacteria on the defined medium selected to implement the method.
  • NADP+ also designated NADP
  • This invention concerns strains of microorganisms modified to permit the evolution of metabolic pathways that consume NADPH.
  • the strains according to the invention can be used in biotransformation processes that consume NADPH.
  • This invention further concerns a method for the preparation of chemical entities by biotransformation involving the growth in an appropriate medium of a strain according to the invention, which strain also possesses the genetic features necessary for the preparation of such chemical entities.
  • Biotransformation processes have been developed to permit the production of large quantities of chemical entities at low cost, while at the same time putting to good use various industrial or agricultural by-products.
  • the improvement of a biotransformation process can involve various factors such as temperature, oxygenation, the composition of the medium, the recovery process, etc. It is also possible to modify the microorganism in such a way that the production and/or excretion of the chemical entity of interest is increased.
  • efforts may be directed, for example, to optimizing the biosynthesis pathway by, for example, modifying the regulation of genes or by modifying genes to modify enzyme characteristics or by optimizing the regeneration of co-substrates.
  • NADPH is important, in particular for the production of amino acids (e.g., arginine, proline, isoleucine, methionine or lysine), vitamins (e.g., pantothenate, phylloquinone or tocopherol), aromatic compounds (e.g., WO9401564), or other chemicals with high added value.
  • amino acids e.g., arginine, proline, isoleucine, methionine or lysine
  • vitamins e.g., pantothenate, phylloquinone or tocopherol
  • aromatic compounds e.g., WO9401564
  • This invention concerns strains of microorganisms modified to cause the evolution of enzymes or metabolic pathways that consume NADPH.
  • microorganisms For the creation of such microorganisms, the inventors chose modifications that increase the rate of production of NADPH and reduce its rate of oxidation to NADP+, which modified microorganisms are then used to cause the evolution of enzymes or metabolic pathways that consume NADPH. These bacteria can also be used judiciously in biotransformation processes for the production of chemical entities derived from NADPH-dependent synthesis pathways.
  • NADPH NADPH
  • strains modified according to the invention have undergone the deletion of the gene udhA and/or the gene qor.
  • the genes udhA and qor are both deleted.
  • the strain modified according to the invention has also undergone the deletion of a gene selected from among pgi or pfkA and or pfkB.
  • udhA X66026 soluble pyridine transhydrogenase
  • pfkA X02519 phosphofructokinase-1
  • pfkB K02500 phosphofructokinase-2.
  • a further object of this invention is an evolved microorganism modified for the production of NADPH as described above and below, which also possesses one or more genes coding for NADPH-dependent enzymes involved in the biotransformation of a chemical entity of interest, which enzymes it is intended to cause to evolve, together with one or more selection marker genes.
  • genes can be native to the modified strain according to the invention or be introduced into the optimized strain according to the invention by transformation with an appropriate vector, either by integration in the genome of the microorganism, or by a replicative vector, which vector possesses one or more genes coding for the enzymes involved in the bioconversion of the said chemical entity of interest or the said selection markers.
  • genes contain a nucleic acid sequence coding for an enzyme involved in the biotransformation of the chemical entity of interest and/or for a selection marker, the coding sequence being attached to efficient promoter sequences in the prokaryotic and/or eukaryotic cell selected for the biotransformation.
  • the vector (or plasmid) can be a shuttle vector between E. coli and another microorganism.
  • This invention further concerns a method for the preparation of modified strains according to the invention as defined above and below, in which the genes udhA and/or qor, and if necessary the genes pgi or pfkA and/or pfkB are deleted.
  • the method of preparation of the strains also includes the transformation of the modified strains with at least one appropriate vector with one or more genes coding for one or more NADPH-consuming enzymes involved in the biotransformation of a chemical entity of interest, and one or more selection marker genes.
  • the vector allows either the replication of the genes or their integration in the chromosome of the modified bacterium.
  • the transformation of the strain by the vector defined above can be carried out on the modified strain or before the modification of the strain according to the invention.
  • the strain modified for the production of NADPH is obtained by molecular biology methods.
  • a further aspect of the invention concerns the use of these modified strains according to the invention to cause the evolution of NADPH-dependent enzymes to improve their kinetic characteristics, to broaden or to narrow their substrate specificity, and ultimately to create a new metabolic pathway and/or to improve biotransformation yields.
  • a further aspect of the invention concerns the use of the modified strain or the evolved strain to carry out biotransformation reactions that consume NADPH with biotransformation yields greater than those obtained with an unmodified and/or non-evolved strain.
  • the invention further concerns a method for the production of a chemical entity of interest synthesized by a NADPH-consuming process, characterized in that it comprises the following steps:
  • the chemical entity of interest is preferably selected from among cysteine, methionine, 3-hydroxypropionate, hydrocortisone, xylitol and glycerol.
  • the method also includes the addition to the appropriate culture medium of the substrate to be converted.
  • the culture medium of step b) of the method according to the invention defined above contains at least one assimilatable carbohydrate chosen from among the different assimilatable sugars such as glucose, galactose, sucrose, lactose, or molasses, or by-products of these sugars.
  • An especially preferred simple carbon source is glucose.
  • Another preferred simple carbon source is sucrose.
  • the culture medium can also contain one or more substances (e.g., amino acids, vitamins, mineral salts, etc.) that favor the production of the chemical entity of interest.
  • FIG. 1 Synthesis of methionine from homoserine in bacteria.
  • FIG. 2 Scheme for the synthesis of methionine according to the invention applied in E. coli ; an equivalent strategy is transposable to many microorganisms including C. glutamicum .
  • the metB* or metY** strategies require the use of a strain that is initially at least ⁇ (metE), while the metB** or metY* strategies require the use of a strain that is initially at least ⁇ (metC).
  • MetA homoserine succinyltransferase; can be replaced by an isoform that is insensitive to feedback inhibition by methionine, or possibly by a homoserine acetyltransferase isoform that is insensitive to feedback inhibition by methionine.
  • MetB cystathionine ⁇ -synthase
  • MetB* cystathionine ⁇ -synthase evolved into ‘methionine synthase’
  • MetB** cystathionine ⁇ -synthase evolved into homocysteine synthase
  • the central pathway represents the natural synthetic pathway of methionine in E. coli .
  • the other pathways indicated correspond to the methods according to the invention.
  • FIG. 3 representation of a continuous fermentation mechanism for the directed selection of strains according to the invention.
  • a modular system is controlled by a computer allowing the parallel fermentation of microorganisms with a control of feeding of medium, pH and pO2.
  • FIG. 4 Synthesis of cysteine from serine in bacteria.
  • FIG. 5 Strategy to achieve the synthesis of cysteine from O-acetyl-L-serine.
  • the red arrow corresponds to the cysteine synthase activity of the enzyme coded for by the evolved gene metY according to the invention (metY*).
  • FIG. 6 Comparison of 13 C-NMR spectra, corresponding to the 5-carbon of methionine, obtained by HSQC on a hydrolysate of the wild strain (top) or the optimized K1 a-F strain (bottom). It can be observed that the 5-carbon of the strain K1 a-F is not labeled by carbon 13, confirming that it originates from sodium methylmercaptide.
  • FIG. 7 Alignment of non-modified sequences of cystathionine- ⁇ -synthases obtained with the algorithm MULTIALIN (http://prodes.toulouse.inra.fr/multalin/multalin.html).
  • FIG. 8 Alignment of non-modified sequences of acylhomoserine sulfhydrylases obtained with the algorithm MULTIALIN.
  • FIG. 9 Growth rate evolution of the initial E. coli strain ⁇ (metE) during the process of directed selection in batch culture. Abscissa: number of subcultures; arrow: population K144; deduced ⁇ : values obtained starting at OD values of 2-3; calculated ⁇ : values obtained with more than 4 values of DO.
  • FIG. 10 Growth kinetics of the population of E. coli ⁇ (metC) after initial seeding (Culture 1) and after tenth reseeding (Reseeding 10).
  • FIG. 11 Execution of PCR on the modified strain of E. Coli ⁇ metJ::Cm using starters DmetJBF and MetJR.
  • the 5′ end of the starter DmetJBF is also able to hybridise a sequence located in the 3′ part of the gene metL.
  • FIG. 12 Strains obtained after homologous recombination with the PCR-amplified fragment (see FIG. 11 ); it is possible to have two different homologous recombination events, each occurring with the same probability. In the first case, a strain E. coli ⁇ metJ::Cm is recreated, while in the second case the strain E. Coli [ ⁇ metJ, ⁇ metJ::Cm] is created by replacement of the promoter of the operon metBLF before metL.
  • FIG. 13 Time course of the growth rate evolution of the strain E. coli [ ⁇ (metBJ, metC) pTrc-metY] on a defined medium (MML8) containing glucose as sole carbon source.
  • a first application (Example F.I.1.) of the invention to the metabolic engineering of the biosynthesis pathway of methionine comprises the following steps:
  • a second application (Example F.I.2.) of the invention to the metabolic engineering of the biosynthesis pathway of methionine comprises the following steps:
  • a third application (Example F.I.3.) of the invention to the evolution of the biosynthesis pathway of methionine comprises the following steps:
  • the inactivation of the gene metE is achieved by inserting a chloramphenicol resistance gene cassette and at the same time deleting most of the gene concerned.
  • the method used is described by Datsenko, K. A., Wanner, B. L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
  • DmetER with 100 bases (SEQ ID NO 1): tacccccgacgcaagttctgcgccgcctgcaccatgttcgccagtgccgc gcgggtttctggccagccgcgcgttttcagCATATGAATATCCTCCTTAG
  • DmetEF de 100 bases (SEQ ID NO 2): tgacaatattgaatcacaccctcggtttccctcgcgttggcctgcgtcgc gagctgaaaaagcgcaagaaagttattggTGTAGGCTGGAGCTGCTTCG
  • the oligonucleotides DmetER and DmetEF are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3.
  • the PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46) in which the enzyme Red recombinase expressed permits the homologous recombination.
  • the chloramphenicol-resistant transformants are then selected and the insertion of the resistance cassette is verified by PCR analysis with the oligonucleotides metER and metEF.
  • MetER SEQ ID NO 3: ggtttaagcagtatggtgggaagaagtcgc (homologous to the sequence from 4012978 to 4012949).
  • MetEF SEQ ID NO 4: cccggggatgaataaacttgccgccttccc (homologous to the sequence from 4010567 to 4010596).
  • the chloramphenicol resistance cassette can then be eliminated.
  • the plasmid pCP20 carrying the FLP recombinase acting at the FRT sites of the chloramphenicol resistance cassette is then introduced into the recombinant strains by electroporation. After a series of cultures at 42° C., the loss of the chloramphenicol resistance cassette is verified by a PCR analysis with the same oligonucleotides as used previously.
  • the E. coli strain made auxotrophic for methionine by inactivating the metE gene cannot grow unless it can make its own methionine from methylmercaptan.
  • the implementation of this method permits the selection of a strain of Escherichia coli of which the cystathionine- ⁇ -synthase (EC 4.2.99.9) has acquired a modified ‘methionine-synthase’ activity in the presence of methylmercaptan.
  • the controlled selection is conducted in a hermetically sealed glass flask containing 50 ml of inorganic medium (Schaefer et al., 1999 , Anal. Biochem. 270: 88-96) in the presence of 33 mM glucose and chloramphenicol at a final concentration of 25 mg/l.
  • the culture media are seeded with the strain E. coli K12 ⁇ metE at a defined value of OD 600nm . Seeding is carried out with a sufficiently large population of bacteria so that some bacteria potentially possess relevant spontaneous mutations in the gene metB enabling assimilation of methylmercaptan. This population is obtained by culture of the strain auxotrophic for methionine on a minimal medium supplemented with methionine.
  • the bacterial population of flask 2 can then be used to improve even more the “methionine synthase” activity in the presence of methylmercaptan, using a screening process and improvement by multi-stage fermentation or by starting over the process in flasks as described above.
  • the directed selection is carried out in a continuous multi-stage system ( FIG. 3 ).
  • the first fermenter produces bacteria with a speed close to maximal growth rate.
  • the bacteria are transferred continually from this fermenter to a second fermenter characterized by a lower dilution rate with a selective screen (here methylmercaptan).
  • the selection pressure imposed on the bacteria in the second fermenter, depends on the methylmercaptan concentration. Successive cycles of selection allow applying stronger and stronger screening conditions to the bacteria by increasing methylmercaptan concentrations.
  • the selected strain in the second fermenter has evolved so that it metabolizes the total amount of methylmercaptan (no residual methylmercaptan in the fermenter).
  • K1 a-F The new population obtained K1 a-F is cultured in a minimal medium (Schaefer et al., 1999, Anal. Biochem. 270: 88-96) containing 2.5 g ⁇ ⁇ 1 of uniformly carbon 13-labeled glucose, and sodium methylmercaptide (200 ppm) with no carbon 13 enrichment.
  • This population is auxotrophic for methionine in the absence of sodium methylmercaptide.
  • the experiment is conducted in a similar manner with the wild strain E. coli K12 (producing methionine from glucose), in the absence of sodium methylmercaptide.
  • FIG. 6 shows two 1D spectra, derived from two separate acquisitions, superimposed for greater clarity. These 1D spectra were extracted from 2D NMR spectra of the HSQC type (correlation between protons and carbon 13). The 2D NMR spectra are obtained on an acid hydrolysate of the bacteria.
  • the sample analyzed is a total hydrolysate. However, given the sensitivity of the NMR and the acquisition times used, essentially amino acids, sugars, bases and glycerol are detected, each carbon atom (coupled to a proton) of each acid giving an NMR signal.
  • the 5-carbon of methionine (i.e., the terminal methyl group) presents a chemical shift of about 14.7 ppm.
  • FIG. 6 shows the area of the chemical shift centered at 14.7 ppm for the two strains.
  • strain K1a-F produces methionine from succinyl-L-homoserine and sodium methylmercaptide.
  • the population K1a-F undergoes 14 further successive reseeding cycles in flasks. In this way the population K144 is obtained ( FIG. 9 ), which is then spread on minimal medium plates containing glucose as sole carbon source.
  • the inoculated dishes are placed in aerobic conditions in an aerobic jar into which is inserted a tube containing sodium methylmercaptide dissolved in water. The jar is then placed in an incubator at 37° C. As the boiling point of methylmercaptan is 5° C., the atmosphere in the jar becomes enriched in methylmercaptan. After 4 days, clones appear in the dishes; these are bacteria able to produce methionine in the presence of methylmercaptan. Ten clones are isolated, including the clone K176. The clone K176 is grown in liquid culture and glycerol stocks are prepared, numbered K183.
  • metJ For the clone K183 and the initial strain E. coli K12 ⁇ (metE), the sequence of the genes metJ and metB (SEQ ID No.5) is determined.
  • metB* The sequence obtained for evolved metB, designated metB* (SEQ ID No.7) reveals the presence of an alanine unit at position 325 (SEQ ID No.8) in place of a glutamate (SEQ ID No.6).
  • the gene metJ shows no mutation. This strain is registered at the CNCM on Apr. 2, 2003, under the number I-3005.
  • the clone K183 is grown in flasks in a minimal medium with glucose and sodium methylmercaptide as sole carbon source. In parallel, a culture is carried out under identical conditions with wild strain E. coli K12. The consumption of glucose per unit of biomass is found to be twice that of a wild strain of E. coli (MBM01). This over-consumption is probably partly due to acetate production.
  • MBM01 0.45 ⁇ 0.002 K183 0.24 0.36
  • enzyme reactions are carried out using cell-free extracts prepared from cultures of the strains K183 and MBM01 carried out on rich medium (BH1, marketed by DIFCO, with 2.5 g/L of glucose) in the absence of methylmercaptan.
  • BH1 rich medium marketed by DIFCO, with 2.5 g/L of glucose
  • the protein extracts are desalted on PD 10 and stored on ice.
  • the analysis is carried out by GC-MS, which requires the silylation of samples before injection.
  • each sample receives an internal standard (serine 13C) to allow the quality of the silylation to be validated.
  • the samples are then lyophilized overnight.
  • the derivatization is carried out using the following protocol:
  • the samples are filtered on a disposable filter with a 0.22 ⁇ m PTFE membrane or centrifuged at 5000 g for 5 minutes. They are transferred to 1.5 ml flasks, sealed and injected into the GC.
  • the analyses are carried out with an Agilent Technologies GC6890/MSD5973 apparatus fitted with a non-polar column (HP-5MS, Bios Analytique).
  • the carrier gas is helium with a constant flow rate of 1 ml ⁇ min ⁇ 1 .
  • the injection of 1 ⁇ l of sample is in splitless mode with a purge flow rate of 50 ml ⁇ min ⁇ 1 for 0.85 min.
  • the temperature profile is: initial temperature 90° C. maintained for 2 minutes and then increased to 320° C. with a gradient of 10° C.min ⁇ 1 . This temperature is maintained for 6 minutes.
  • the solvent passage time is set at 3.10 minutes.
  • a ‘methionine synthase’ activity can be assayed in the samples incubated with methanethiol, by the quantification first of succinate by ion chromatography and second of methionine by GC-MS.
  • the genes metB and metB* are cloned in an overexpression vector pTopo (Invitrogene) using the following strategy:
  • the effect of the mutation A325E reduces the cystathionine- ⁇ -synthase activity 13-fold and the K m of the enzyme for cysteine.
  • DmetCR with 100 bases (SEQ ID NO 13): ccggcgtccagatcggcaatcagatcgtcgacatcttccagaccaatatg caggcgaatcaaggtcccgctaaatcgatCATATGAATATCCTCCTTAG
  • DmetCF with 100 bases (SEQ ID NO 14): cggacaaaaagcttgatactcaactggtgaatgcaggacgcagcaaaaa tacactctcggcgcggtaaatagcgtgattTGTAGGCTGGAGCTGCTTCG
  • the oligonucleotides DmetCR and DmetCF are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3.
  • the PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46) in which the Red recombinase enzyme expressed permits the homologous recombination.
  • the chloramphenicol resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides metCR and metCF defined previously.
  • the strain retained is designated MG1655 ( ⁇ metC::Cm).
  • MetCR SEQ ID NO 11: cgtccgggacgccttgatcccggacgcaac (homologous to the sequence from 3151522 to 3151493).
  • MetCF SEQ ID NO 12: gcgtttacgcagtaaaaaagtcaccagcacgc (homologous to the sequence from 3150118 to 3150149).
  • the chloramphenicol resistance cassette can then be eliminated.
  • the plasmid pCP20 carrying recombinase FLP acting at the FRT sites of the chloramphenicol resistance cassette is then introduced into the recombinant strains by electroporation. After a series of cultures at 42° C., the loss of the chloramphenicol resistance cassette is verified by a PCR analysis with the same oligonucleotides as those used previously. The strain retained is designated MG1655 ( ⁇ metC).
  • Example F.I.2 The construction of the strain ⁇ (metC) is described in Example F.I.2.
  • the strain E. coli ⁇ (metC) is cultured in flasks (see Example F.I.1) containing a minimal medium with glucose as sole carbon source.
  • the medium contained neither methylmercaptan nor H 2 S.
  • Reseeding is carried out and growth rates are determined for each reseeding.
  • a very marked improvement in the growth rate of the strain ⁇ (metC) is observed on the minimal medium, suggesting that the homocysteine synthase activity of the cystathionine ⁇ -synthase is strongly improved in the presence of endogenous H 2 S (see FIG. 10 ).
  • Reseeding cycle number measured ⁇ (h ⁇ 1 ) 1 0.05 3 0.37 5 0.39 10 0.44 12 0.44
  • a chloramphenicol resistance cassette is inserted, while at the same time deleting most of the genes concerned and maintaining the promoter of metBL.
  • DmetJBF with 100 bases (SEQ ID NO 10): tatgcagctgacgacctttcgcccctgcctgcgcaatcacactcattttt accccttgtttgcagcccggaagccattttcaggcaccagagtaaacatt
  • the PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46) in which the Red recombinase enzyme expressed permits the homologous recombination.
  • the chloramphenicol resistant transformants are then selected and the deletion of the gene metB by homologous recombination is verified by PCR analysis with the oligonucleotides MetJR and MetLR, defined previously.
  • the desired strain is strain MG1655 ( ⁇ metB- ⁇ metJ::Cm) in which the genes metJ and metB are eliminated and the promoter of the operon metBLF repositioned before metL (see FIG. 12 ).
  • the chloramphenicol resistance cassette can then be eliminated.
  • the plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the chloramphenicol resistance cassette is then introduced into the recombinant strains by electroporation. After a series of cultures at 42° C., the loss of the chloramphenicol resistance cassette is verified by PCR analysis with the same oligonucleotides as used previously (MetLR and MetJR).
  • the cloramphenicol transformants are then selected and the insertion of the region containing (metC::Cm) is verified by a PCR analysis with the oligonucleotides MetCR and MetCF, and MetJR and MetLR to verify also the strain with genes metB and metJ.
  • the strain retained is designated MG1655 ⁇ (metC::Cm, metJB).
  • MetCR SEQ ID NO 11: cgtccgggacgccttgatcccggacgcaac (homologous to sequence 3151522 à 3151493)
  • MetCF SEQ ID NO 12: gcgtttacgcagtaaaaaagtcaccagcacgc (homologous to the sequence from 3150118 to 3150149).
  • the chloramphenicol resistance cassette can then be eliminated.
  • the plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the chloramphenicol resistance cassette is then introduced into the recombinant sites by electroporation.
  • the loss of the chloramphenicol resistance cassette is verified by a PCR analysis with the same oligonucleotides as used previously (MetCR and MetCF, and MetJR and Met LR). The strain retained is designated MG1655 ⁇ (metC, metJB).
  • a plasmid is constructed that permits the expression of the gene metY of C. glutamicum .
  • This gene is amplified by PCR from chromosomal ADN of C. glutamicum and introduced into a plasmid pTrc99A. It is possible to amplify by PCR the gene metY and if necessary its natural promoter.
  • the gene metY is cloned under the control of a promoter that permits an expression in E. coli .
  • the vector used is a pTrC99A (Pharmacia), but a vector selected from among pUC, pBluescript, pCR-Script, pTopo, etc. could also be used.
  • the strain Escherichia coli ⁇ (metC, metJB) obtained previously is transformed with the plasmid pTrc-metY of C. glutamicum .
  • the transformation of the strain is carried out by electroporation.
  • the strain obtained is then inoculated in a conical flask (OD 600nm ⁇ 0.4-0.5) containing 10% of its volume in a minimal medium with glucose for sole carbon source.
  • the low succinylhomoserine sulfhydrylase activity initially carried by the enzyme MetY limits the growth ( ⁇ ⁇ 0.06 h ⁇ 1 ) of the bacterial population on the minimal medium (MML8) owing to limitation of synthesized methionine.
  • Reseeding is carried out when the OD 600nm in the flask reached about 2. The selection is thus conducted for 22 culture cycles. A marked improvement in the growth rate is observed during this phase of evolution-selection ( FIG. 13 ).
  • the improvement in growth observed corresponds to an evolution of the gene metY such that the O-acetyl-homoserine sulfhydrylase activity is changed into an O-succinyl-homoserine sulfhydrylase activity allowing the production of homocysteine from O-succinylhomoserine and H 2 S; these two substrates being produced by the bacterium.
  • the pre-culture is carried out overnight in a 500 ml flask containing 50 ml of minimal medium, type M9 modified, supplemented with 2.5 g/l of glucose.
  • the cells are recovered by centrifuging and taken up in 5 ml of minimal medium, type M9 modified.
  • the culture is carried out in a fermenter with a useable volume of 300 ml of the Fedbatch-pro DASGIP type.
  • the fermenter is filled with 145 ml of minimal medium, type M9 modified, and inoculated with 5 ml of pre-culture, i.e., an inoculation OD 600nm between 0.5 and 1.2.
  • the temperature of the culture is maintained between 30 and 37° C. and the pH is continuously adjusted to a value between 6.5 and 8. It is partially regulated by adding a solution of CH 3 SNa. A solution of 2N sodium hydroxide can if necessary be used to complete the regulation. Shaking is maintained at between 200 and 400 rpm during the batch phase and is increased to 1000 rpm at the end of the fed-batch process. The dissolved O 2 content is maintained between 30% and 40% saturation using a gas controller. As soon as the OD 600nm attains a value between 2.5 and 3 the fed-batch process is started by adding the fed medium at an initial flow rate of between 0.3 and 0.5 ml/h with a gradual increase to flow rates between 2.5 and 3.5 ml/h.
  • the fed medium is made up on the basis of a modified M9 medium complemented by a glucose concentration between 300 and 500 g/l of glucose.
  • the medium is supplemented with a solution of CH 3 SNa (solution between 1 and 5 M) to allow bacterial growth while at the same time regulating the pH.
  • CH 3 SNa solution between 1 and 5 M
  • the fed medium is replaced by a minimal medium of type M9 with limited phosphorus.
  • the solution of methylmercaptan is replaced by a direct injection of CH 3 SH in gaseous form into the fermenter.
  • the gas flow rate is adapted to the flow rate of the fed solution in molar ratios to the carbon substrate ranging from 1 to 3.
  • the pH of the fermentation must liquor is adjusted to between 7.5 and 9 with a solution of NaOH, and it is heated to between 60 and 80° C.
  • the liquor is then filtered on UF modules.
  • the temperature of the liquor is maintained at between 60 and 80° C., and the liquor is then concentrated before running it through charcoal to de-color it (in a column or batchwise).
  • the de-colored liquor is filtered again to remove last particles before acidification with concentrated HCl to a pH below 2.28 (pK 1 of methionine).
  • the crystals of methionine hydrochloride thus formed are recovered by filtration and the HCl eliminated by evaporation, yielding purified L-methionine.
  • the strain K183 was registered on Apr. 2, 2003 at the Collection Nationale de Cultures de Microorganismes (CNCM), 25 rue du Dondel-Roux, 75724 Paris Cedex 15, France, in compliance with the provisions of the Treaty of Budapest, under the serial number I-3005.
  • the inactivation of the genes cysK and cysM is carried out by inserting an antibiotic resistance cassette (chloramphenicol and kanamycin respectively) while at the same time deleting most of the genes concerned.
  • the method used is described by Datsenko, K. A.; Wanner, B. L. (2000), One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
  • a pair of oligonucleotides is synthesized:
  • DcysKR with 100 bases (SEQ ID NO 15): Tgttgcaattctftctcagtgaagagatcggcaaacaatgcggtgcttaa ataacgctcacccgatgatggtagaataacCATATGAATATCCTCCTTAG
  • DcysKF de 100 bases (SEQ ID NO 16): agtaagatttttgaagataactcgctgactatcggtcacacgccgctggt tcgcctgaatcgcatcggtaacggacgcatTGTAGGCTGGAGCTGCTTCG
  • DcysMR with 100 bases (SEQ ID NO 17): cccgccccctggctaaaatgctcttccccaaacaccccggtagaaaggta gcgatcgccacgatcgcagatgatcgccacCATATGAATATCCTCCTTAG
  • DcysMF with 100 bases Agtacattagaacaaacaataggcaatacgcctctggtgaagttgcagcg aatggggccggataacggcagtgaagtgtgTGTAGGCTGGAGCTGCTTCG
  • the oligonucleotides DcysKR and DcysKF, and DcysMR and DcysMF are used respectively to amplify the chloramphenicol and kanamycin resistance cassettes from plasmids pKD3 and pKD4.
  • the PCR product obtained is then introduced by electroporation in the strain MG1655 (pKD46) in which the enzyme Red recombinase expressed permits the homologous recombination.
  • the transformants resistant to each of the antibiotics are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides cysKR and cysKF, and cysMR and cysMF.
  • cyKR (SEQ ID NO 19): tttttaacagacgcgacgcacgaagagcgc (homologous to the sequence from 2531698 to 2531669)
  • cysKF (SEQ ID NO 20): ggcgcgacggcgatgtgggtcgattgctat (homologous to the sequence from 2530188 to 2530217)
  • cysMR SEQ ID NO 21: ggggtgacggtcaggactcaccaatacttc (homologous to the sequence from 2536430 to 2536459)
  • cysMF SEQ ID NO 22: gcgcgcatcgctggccgctgggctacacac (homologous to the sequence from 2538071 to 2538042).
  • the chloramphenicol and kanamycin resistance cassettes can then be eliminated.
  • the plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the chloramphenicol or kanamycin resistance cassettes, is introduced into the recombinant strains by electroporation. After a series of cultures at 42° C., the loss of the antibiotic resistance cassette is verified by a PCR analysis with the same oligonucleotides as used previously.
  • the plasmid pTopometY is constructed by insertion of the gene metY in the vector Zero Blunt TOPO PCR cloning kit (PCR4 TOPO vector, Invitrogen).
  • PCR4 TOPO vector PCR4 TOPO vector, Invitrogen
  • the gene metY is amplified by PCR with the polymerase Pwo from the chromosomal DNA of the strain Corynebacterium glutamicum ATCC13032 using the following oligonucleotides:
  • Promoter of type TRC in bold roman, RBS of the gene metY in bold roman underlined, initiation codon of the gene metY in bold italics.
  • the PCR product obtained is then directly cloned in the vector Topo to give the plasmid pTopometY.
  • the vector Topo carries a replication origin for E. coli , an ampicillin resistance gene and a kanamycin resistance gene.
  • the plasmid pTopometY is then introduced into the strain E. coli DH5 ⁇ for verification of the construction.
  • the sequencing of the gene metY of the plasmid pTopometY with the universal oligonucleotides M13 reverse and M13 forward is then carried out to confirm the construction.
  • the plasmid is introduced into the strain E. coli ⁇ (cysK, cysM) by electroporation.
  • the controlled selection of the preceding strain containing the gene metY can be carried out in bottles or conical flasks.
  • the implementation of this method permits the selection of a strain of Escherichia coli in which the enzyme acetyl-homoserine sulfhydrylase has evolved into a ‘cysteine synthase’ activity.
  • the controlled selection is performed in conical flasks containing 50 ml of inorganic medium (Schaefer et al., 1999 , Anal. Biochem. 270: 88-96) in the presence of 33 mM glucose, chloramphenicol at a final concentration of 25 mg/l and kanamycin at a concentration of 25 mg/l.
  • the culture media are seeded with the strain E. coli K12 [ ⁇ ((cysK, cysM) pTopometY] at a defined OD 600nm value. Seeding is carried out with a population of bacteria sufficiently large for some bacteria potentially to possess relevant mutations in the gene metY enabling them to assimilate O-acetyl serine. This population is obtained by growing the strain auxotrophic for cysteine on a cysteine-supplemented minimal medium. A control culture is seeded with the strain E. coli K12 ( ⁇ cysK, cysM).
  • the cultures are carried out with shaking at 37° C., for 6 days, after which time the OD 600nm is measured.
  • the control culture displays practically no change in OD, while some other cultures exhibit significant evolution of their OD. It is therefore probable that the ‘evolved cysteine synthase activity’ has appeared in the populations contained in those conical flasks. The mutation or mutations probably occurr in the gene metY because this gene was the only difference between these strains and the control strain.
  • the bacterial population of these positive cultures can then be used to further improve the cysteine synthase activity by repeating the flask culture procedure as described.
  • the evolved population is then spread on a gelosed minimal medium containing glucose as sole carbon source.
  • the inoculated dishes are placed in aerobic conditions in an incubator at 37° C. After 36 hours, the clones appear on the dishes; they correspond to bacteria able to produce cysteine from glucose as sole carbon source. Three clones are isolated
  • E. coli K12 [ ⁇ (cysK, cysM) pTopometY] is cultured in a minimal medium (Schaefer et al., 1999 , Anal. Biochem. 270: 88-96) containing 2,5 g ⁇ l ⁇ 1 of glucose uniformly labeled with carbon 13. After culture, the cells were recovered, washed and hydrolysed with 6N HCl for 24 hours at 107° C. A 2D NMR analysis was then performed (HSQC).
  • the inactivation of the gene udhA is carried out by inserting an antibiotic resistance cassette conferring resistance to kanamycin while at the same time deleting most of the gene concerned.
  • the method used is described by Datsenko, K. A.; Wanner, B. L. (2000), One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
  • DudhAR with 100 bases (SEQ ID NO 25): cccagaatctcttttgtttcccgatggaacaaaattttcagcgtgcccac gttcatgccgacgatttgtgcgtgccagTGTAGGCTGGAGCTGCTTCG
  • DudhAF with 100 bases (SEQ ID NO 26): ggtgcgcgcgtcgcagttatcgagcgttatcaaaatgttggcggcggttg cacccactggggcaccatcccgtcgaaagcCATATGAATATCCTCCTTAG
  • the oligonucleotides DudhAR and DudhAF are used to amplify the kanamycin resistance cassette from the plasmid pKD4.
  • the PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46) in which the Red recombinase enzyme expressed permits the homologous recombination.
  • the kanamycin resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides UdhAR and UdhAF
  • UdhAR (SEQ ID NO 27): gcgggatcactttactgccagcgctggctg (homologous to the sequence 4156772 to 4156801)
  • UdhAF (SEQ ID NO 28): ggccgctcaggatatagccagataaatgac (homologous to the sequence 4158475 to 4158446)
  • the inactivation of the gene pgi is carried out by inserting an antibiotic resistance cassette conferring resistance to chloramphenicol while at the same time deleting most of the gene concerned.
  • the method used is described by Datsenko, K. A.; Wanner, B. L. (2000), One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
  • DpgiR with 100 bases (SEQ ID NO 29): gcgccacgctttatagcggttaatcagaccattggtcgagctatcgtggc tgctgatttctttatcatctttcagctctgCATATGAATATCCTCCTTAG
  • DpgiF with 100 bases (SEQ ID NO 30): ccaacgcagaccgctgcctggcaggcactacagaaacacttcgatgaaat gaaagacgttacgatcgccgatctttttgcTGTAGGCTGGAGCTGCTTCG
  • the oligonucleotides DpgiR and DpgiF are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3.
  • the PCR product obtained is then introduced by electroporation into the strain MG1655 ⁇ udhA (pKD46) in which the Red recombinase enzyme expressed permits the homologous recombination.
  • the chloramphenicol resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides PgiR and PgiF
  • PgiR (SEQ ID NO 31): cggtatgatttccgttaaattacagacaag (homologous to the sequence 4233220 to 4233191)
  • PgiF (SEQ ID NO 32): gcggggcggttgtcaacgatggggtcatgc (homologous to the sequence 4231138 to 4231167)
  • the two antibiotic resistance cassettes can then be eliminated.
  • the plasmid pCP20 carrying recombinase FLP acting at the FRT sites of both the kanamycin and chloramphenicol resistance cassette is then introduced into the recombinant strains by electroporation. After a series of cultures at 42° C., the loss of the two resistance cassettes is verified by a PCR analysis with the same oligonucleotides as those used previously.
  • the inactivation of the gene pfkA is carried out by inserting an antibiotic resistance cassette conferring resistance to chloramphenicol while at the same time deleting most of the gene concerned.
  • the method used is described by Datsenko; K. A.; Wanner, B. L. (2000), One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
  • DpfkAR with 100 bases (SEQ ID NO 33): ttcgcgcagtccagccagtcacctttgaacggacgcttcatgttttcgat agcgtcgatgatgtcgtggtgaaccagctgCATATGAATATCCTCCTTAG
  • DpfkAF de 100 bases (SEQ ID NO 34): ggtgtgttgacaagcggcggtgatgcgccaggcatgaacgccgcaattcg cggggttgttcgttctgcgctgacagaaggTGTAGGCTGGAGCTGCTTCG
  • the oligonucleotides DpfkAR and DpfkAF are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3.
  • the PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46) in which the Red recombinase enzyme expressed permits the homologous recombination.
  • the chloramphenicol resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides PfkAR and PfkAF PfkAR (SEQ ID NO 35): ccctacgccccacttgttcatcgcccg (homologous to the
  • PfkAF SEQ ID NO 36: cgcacgcggcagtcagggccgacccgc (homologous to the sequence 4104751 to 4104777)
  • the two antibiotic resistance cassette can then be eliminated.
  • the plasmid pCP20 carrying recombinase FLP acting at the FRT sites of both the kanamycin and chloramphenicol resistance cassette is then introduced into the recombinant strains by electroporation. After a series of cultures at 42° C., the loss of the two resistance cassettes is verified by a PCR analysis with the same oligonucleotides as those used previously.
  • the inactivation of the gene pfkB is carried out by inserting an antibiotic resistance cassette conferring resistance to chloramphenicol while at the same time deleting most of the gene concerned.
  • the method used is described by Datsenko, K. A.; Wanner, B. L. (2000), One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
  • DpfkBR with 100 bases (SEQ ID NO 37): gcgggaaaggtaagcgtaaattttttgcgtatcgtcatgggagcacagac gtgttccctgattgagtgtggctgcactccCATATGAATATCCTCCTTAG
  • DpfkBF with 100 bases (SEQ ID NO 38): gcgccctctctcgatagcgcaacaattaccccgcaaatttatcccgaagg aaaactgcgctgtaccgcaccggtgttcgTGTAGGCTGGAGCTGCTTCG
  • the oligonucleotides DpfkBR and DpfkBF are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3.
  • the PCR product obtained is then introduced by electroporation into the strain MG1655 ⁇ (pfkA, udhA) (pKD46) in which the Red recombinase enzyme expressed permits the homologous recombination.
  • the chloramphenicol resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides PfkBR and PfkBF
  • PfkBR (SEQ ID NO 39): gccggttgcactttgggtaagccccg (homologous to the sequence 1805657 to 1805632)
  • PfkBF (SEQ ID NO 40): tggcaggatcatccatgacagtaaaacgg (homologous to the sequence 1803996 to 1804025)
  • the chloramphenicol resistance cassette can then be eliminated.
  • the plasmid pCP20 carrying recombinase FLP acting at the FRT sites of the chloramphenicol resistance cassette is then introduced into the recombinant strains by electroporation. After a series of cultures at 42° C., the loss of the chloramphenicol resistance cassette is verified by a PCR analysis with the same oligonucleotides as those used previously. The strain retained is designated MG1655 ⁇ (pfkA, pfkB, udhA).
  • the gene yueD is cloned into the vector pTrc99A (Amersham-Pharmacia).
  • the oligos YueDR and YueDF are used for the amplification of the gene from chromosomal DNA of Bacillus cereus . YueDR (SEQ ID NO 41): CGTGAATTCttattcatcaattctaataa
  • YueDF (SEQ ID NO 42): ACGTTCatgAgAtacgttatcataacaggaac
  • the PCR product obtained is digested with the restriction enzymes BspHI and EcoRI and cloned into the vector pTrc99A that has been digested with NcoI and EcoRI.
  • the resulting plasmid pYU1 is then introduced into the strain MG1655 ⁇ (pgi, udhA).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Ecology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
US10/546,139 2003-02-18 2004-02-17 Method for the production of evolved microorganisms which permit the generation or modification of metabolic pathways Abandoned US20060270013A1 (en)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
FR03/01924 2003-02-18
FR0301924A FR2851256A1 (fr) 2003-02-18 2003-02-18 Procede de criblage et d'evolution dirigee de souches produisant de la methionine par nouvelle voie metabolique
FR0305769A FR2854902B1 (fr) 2003-05-14 2003-05-14 Microorganisme a activite cysteine synthase modifiee et procede de preparation de la cysteine
FR03/05769 2003-05-14
FR03/05768 2003-05-14
FR0305768A FR2851255B1 (fr) 2003-02-18 2003-05-14 Microorganisme a activite methionine synthase modifiee et procede de preparation de la methionine
FR0313054A FR2862067A1 (fr) 2003-11-06 2003-11-06 Procede de preparation de microorganismes evolues permettant la creation ou la modification de voies metaboliques
FR03/13054 2003-11-06
PCT/FR2004/000354 WO2004076659A2 (fr) 2003-02-18 2004-02-17 Procede de preparation de microorganismes evolues permettant la creation ou la modification de voies metaboliques

Publications (1)

Publication Number Publication Date
US20060270013A1 true US20060270013A1 (en) 2006-11-30

Family

ID=32931448

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/546,139 Abandoned US20060270013A1 (en) 2003-02-18 2004-02-17 Method for the production of evolved microorganisms which permit the generation or modification of metabolic pathways
US10/781,499 Expired - Fee Related US7745195B2 (en) 2003-02-18 2004-02-18 Method for the preparation of an evolved microorganism for the creation or the modification of metabolic pathways

Family Applications After (1)

Application Number Title Priority Date Filing Date
US10/781,499 Expired - Fee Related US7745195B2 (en) 2003-02-18 2004-02-18 Method for the preparation of an evolved microorganism for the creation or the modification of metabolic pathways

Country Status (6)

Country Link
US (2) US20060270013A1 (fr)
EP (2) EP1597364B1 (fr)
JP (1) JP2006517796A (fr)
BR (1) BRPI0407600A (fr)
MX (1) MXPA05008857A (fr)
WO (1) WO2004076659A2 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080286840A1 (en) * 2005-02-07 2008-11-20 Rainer Figge Microorganisms Comprising Enzymes Express with Low Gamma-Elimination Activity
US20100184164A1 (en) * 2006-07-28 2010-07-22 Cj Cheiljedang Corporation Microorganism Producing L-Methionine Precursor And Method Of Producing L-Methionine And Organic Acid From The L-Methionine Precursor
US20100248311A1 (en) * 2007-10-02 2010-09-30 Metabolic Explorer Increasing methionine yield
US20110011798A1 (en) * 2007-12-17 2011-01-20 Charles Borg Removal of selenium in contaminated wastewater streams
US8900838B2 (en) 2010-07-05 2014-12-02 Metabolic Exployer Method for the preparation of 1,3-propanediol from sucrose
US8911978B2 (en) 2010-07-02 2014-12-16 Metabolic Explorer Method for the preparation of hydroxy acids
US9506092B2 (en) 2011-06-29 2016-11-29 Metabolic Explorer Microorganism for methionine production with enhanced glucose import

Families Citing this family (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006517796A (ja) * 2003-02-18 2006-08-03 メタボリック エクスプローラー 代謝経路の生成または改変を可能とする進化した微生物の生産方法
JP4479283B2 (ja) * 2004-03-04 2010-06-09 味の素株式会社 Ｌ−システイン生産菌及びｌ−システインの製造法
US8399214B2 (en) * 2005-07-18 2013-03-19 Evonik Degussa Gmbh Use of dimethyl disulfide for methionine production in microoraganisms
PL1969130T3 (pl) 2006-01-04 2014-08-29 Evonik Degussa Gmbh Sposób wytwarzania metioniny i jej prekursorów lub sukcynylo homoseryny przy zastosowaniu mikroorganizmów
US20100092954A1 (en) * 2006-08-02 2010-04-15 Bernhard Palsson Method for Determining the Genetic Basis for Physiological Changes in Organisms
US20100210017A1 (en) * 2007-01-12 2010-08-19 Gill Ryan T Compositions and methods for enhancing tolerance for the production of organic chemicals produced by microorganisms
JP5546870B2 (ja) * 2007-03-23 2014-07-09 メタボリック エクスプローラー １，２−プロパンジオールおよびアセトールの製造のための微生物および方法
DK2109681T3 (en) * 2007-03-23 2014-12-08 Metabolic Explorer Sa NEW MICROORGANISMS FOR THE PREPARATION OF 1,2-PROPANDIOL OBTAINED BY A COMBINATION OF EVOLUTION AND RATIONAL DESIGN
ES2575906T3 (es) * 2007-04-11 2016-07-04 Cj Cheiljedang Corporation Composiciones y métodos de producir metionina
US20090181901A1 (en) * 2007-11-14 2009-07-16 Thomas Eidenberger Compositions and methods to increase bioavailability of carotenoids
US8048624B1 (en) 2007-12-04 2011-11-01 Opx Biotechnologies, Inc. Compositions and methods for 3-hydroxypropionate bio-production from biomass
US7851180B2 (en) * 2008-04-04 2010-12-14 Cj Cheiljedang Corporation Microorganism producing L-methionine precursor and the method of producing L-methionine precursor using the microorganism
US9005952B2 (en) * 2008-04-04 2015-04-14 Cj Cheiljedang Corporation Microorganism producing L-methionine precursor and the method of producing L-methionine precursor using the microorganism
US20110244575A1 (en) * 2008-07-23 2011-10-06 Lipscomb Tanya E W Methods, systems and compositions for increased microorganism tolerance to and production of 3-hydroxypropionic acid (3-hp)
WO2010022763A1 (fr) * 2008-08-25 2010-03-04 Metabolic Explorer Procédé de préparation de 2-hydroxy-isobutyrate
BRPI0923748B1 (pt) 2008-12-31 2019-04-09 Metabolic Explorer Método para a preparação de dióis
EP2267126A1 (fr) 2009-06-26 2010-12-29 Metabolic Explorer Processus d'interruption de gène stable chez clostridia
US8809027B1 (en) 2009-09-27 2014-08-19 Opx Biotechnologies, Inc. Genetically modified organisms for increased microbial production of 3-hydroxypropionic acid involving an oxaloacetate alpha-decarboxylase
KR20140015136A (ko) 2009-09-27 2014-02-06 더 리젠츠 오브 더 유니버시티 오브 콜로라도, 어 바디 코포레이트 3-히드록시프로피온산 및 다른 생성물의 제조 방법
CA2781400A1 (fr) * 2009-11-20 2011-05-26 Opx Biotechnologies, Inc. Production d'un acide organique, et/ou produits chimiques connexes
WO2011073738A1 (fr) 2009-12-14 2011-06-23 Metabolic Explorer Utilisation de promoteurs inductibles dans la production de méthionine
BR112012016908B1 (pt) 2009-12-30 2020-03-31 Evonik Degussa Gmbh Linhagens e métodos para a produção de metionina
CN102712941A (zh) 2009-12-30 2012-10-03 代谢探索者公司 通过过表达琥珀酸脱氢酶增加甲硫氨酸生产
KR101335841B1 (ko) 2010-12-21 2013-12-02 씨제이제일제당 (주) 호모세린 아세틸 트랜스퍼라제 활성을 가지는 변이형 폴리펩티드 및 이를 발현하는 미생물
EP2658986B1 (fr) * 2010-12-29 2020-10-28 CJ CheilJedang Corporation Procédés de production de l-méthionine
EP2540834A1 (fr) 2011-06-29 2013-01-02 Metabolic Explorer Procédé de préparation de 1,3-propanediol
EP2578559A1 (fr) 2011-10-07 2013-04-10 Metabolic Explorer Procédé de production d'isobutène à partir d'isobutylamine
EP2766492B1 (fr) 2011-10-11 2018-06-06 Metabolic Explorer Production de prénol par fermentation
WO2013076144A2 (fr) 2011-11-21 2013-05-30 Metabolic Explorer Souches de micro-organismes pour la production de 2,3-butanediol
CN104204206B (zh) 2012-03-02 2017-10-10 代谢探索者公司 一种用于生产丁醇的方法
EP2647718A3 (fr) 2012-04-06 2014-12-24 Metabolic Explorer Procédé de production de 5-aminopentanoate en utilisant un micro-organisme recombinant
KR101944150B1 (ko) 2012-06-18 2019-01-30 에보니크 데구사 게엠베하 메티오닌의 발효적 생산을 위한 재조합 미생물
AU2013299414A1 (en) 2012-08-10 2015-03-26 Opx Biotechnologies, Inc. Microorganisms and methods for the production of fatty acids and fatty acid derived products
WO2014049382A2 (fr) 2012-09-26 2014-04-03 Metabolic Explorer Production de fermentation d'éthylènediamine par un micro-organisme recombinant
US20150119601A1 (en) 2013-03-15 2015-04-30 Opx Biotechnologies, Inc. Monofunctional mcr + 3-hp dehydrogenase
CA2905602A1 (fr) 2013-03-15 2014-09-18 Sarah M. Hoyt Evaporation eclair pour la purification de production et la recuperation
US11408013B2 (en) 2013-07-19 2022-08-09 Cargill, Incorporated Microorganisms and methods for the production of fatty acids and fatty acid derived products
JP6603658B2 (ja) 2013-07-19 2019-11-06 カーギル インコーポレイテッド 脂肪酸及び脂肪酸誘導体の製造のための微生物及び方法
CN105658803B (zh) 2013-08-30 2020-06-23 赢创运营有限公司 具有改善的甲硫氨酸合酶活性和甲硫氨酸流出的用于甲硫氨酸生产的微生物
KR20170044740A (ko) 2014-09-01 2017-04-25 메타볼릭 익스플로러 메티오닌 유출이 개선된 발효에 의한 메티오닌 생산을 위한 방법 및 미생물
EP2993228B1 (fr) 2014-09-02 2019-10-09 Cargill, Incorporated Production d'esters d'acides gras
KR20160111285A (ko) 2015-03-16 2016-09-26 씨제이제일제당 (주) 사료 첨가제용 조성물 및 이를 포함하는 동물 사료 조성물
WO2016193161A1 (fr) 2015-05-29 2016-12-08 Institut National De La Sante Et De La Recherche Medicale (Inserm) Composition immunogène polyvalente pour induire une réponse immunitaire contre des espèces de yersinia
WO2017211883A1 (fr) * 2016-06-07 2017-12-14 Danmarks Tekniske Universitet Cellules bactériennes à tolérance améliorée aux polyols
EP3267345A1 (fr) * 2016-07-06 2018-01-10 European Molecular Biology Laboratory Procédés d'évolution de laboratoire adaptatif
JP7321089B2 (ja) 2016-07-08 2023-08-04 メタボリック エクスプローラー 糖ホスホトランスフェラーゼ系（ｐｔｓ）をコードする遺伝子を含んでなる微生物による目的分子の発酵生産法
US11479758B2 (en) 2016-08-24 2022-10-25 Danmarks Tekniske Universitet Method of improving methyltransferase activity
EP3296404A1 (fr) 2016-09-15 2018-03-21 Evonik Degussa GmbH Micro-organisme modifie pour production de methionine
EP3354742A1 (fr) 2017-01-26 2018-08-01 Metabolic Explorer Procédés et micro-organismes destinés à la production d'acide glycolique et/ou d'acide glyoxylique
US11345938B2 (en) 2017-02-02 2022-05-31 Cargill, Incorporated Genetically modified cells that produce C6-C10 fatty acid derivatives
EP3652321B9 (fr) 2017-07-11 2023-10-04 Adisseo France S.A.S. Saccharomyces cerevisiae améliorée productrice de métabolite
RU2020105358A (ru) 2017-07-11 2021-08-11 Адиссео Франс С.А.С. Дрожжи, продуцирующие метионин
US11319564B2 (en) 2017-07-11 2022-05-03 Adisseo France S.A.S. Enhanced metabolite-producing yeast
EP3428282A1 (fr) 2017-07-11 2019-01-16 Alderys Une levure produisant de l'ectoine
CN110914434A (zh) 2017-07-11 2020-03-24 安迪苏法国联合股份有限公司 苏氨酸生产酵母
KR101866884B1 (ko) 2018-01-29 2018-06-14 씨제이제일제당(주) 사료 첨가제용 조성물 및 이를 포함하는 동물 사료 조성물
CN110684811B (zh) * 2019-11-13 2021-06-29 浙江工业大学 一种提高甲硫氨酸产量的方法
CN113388630B (zh) * 2020-03-11 2022-07-26 华东理工大学 合成l-半胱氨酸的重组大肠杆菌的构建方法及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050054060A1 (en) * 2003-02-18 2005-03-10 Michel Chateau Method for the preparation of an evolved microorganism for the creation or the modification of metabolic pathways
US20050124010A1 (en) * 2000-09-30 2005-06-09 Short Jay M. Whole cell engineering by mutagenizing a substantial portion of a starting genome combining mutations and optionally repeating
US20080118959A1 (en) * 2002-05-23 2008-05-22 Hartwig Schroder Method for the Production of Sulpher-Containing Fine Chemicals by Fermentation

Family Cites Families (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3071518A (en) * 1960-02-09 1963-01-01 Cons Lab Inc Method of increasing metabolic product yield of organisms
JPS51151391A (en) * 1975-06-19 1976-12-25 Ajinomoto Co Inc Process for preparing l-sulfur- containing amino acids
JPS56144092A (en) * 1980-04-14 1981-11-10 Ajinomoto Co Inc Preparation of l-methionine by fermentation
JPS61242589A (ja) 1985-04-22 1986-10-28 Mitsui Toatsu Chem Inc Ｌ−含硫アミノ酸の製造方法
CA1299128C (fr) 1986-11-19 1992-04-21 Tooru Miyahara Methode pour la production de la l-cystine
JPH02222692A (ja) 1989-02-23 1990-09-05 Kyowa Hakko Kogyo Co Ltd Ｌ―含硫アミノ酸の製造法
EP0519113A1 (fr) * 1991-06-21 1992-12-23 Ajinomoto Co., Inc. Souches de bactérie avec une production élévée en acide aminé et procédé de preparation de ces souches
FR2678601B1 (fr) * 1991-07-01 1993-10-22 Commissariat Energie Atomique Procede de preparation de sulfures et d'acides amines marques au soufre 35.
WO1993017112A1 (fr) * 1992-02-20 1993-09-02 Genencor International, Inc. Biosynthese de methionine au moyen d'une source reduite de soufre
FR2693207B1 (fr) 1992-07-03 1994-09-30 Orsan Souche de levure permettant la co-expression d'une activité mono-oxygénase de cytochrome P450 hétérologue et d'une NADPH-cytochrome P450-réductase endogène ou hétérologue et son utilisation à des fins de bioconversion.
JP3514507B2 (ja) 1994-05-13 2004-03-31 サントリー株式会社 硫化水素生成が低減された酵母とこの酵母を用いたビール製造法
DE19539952A1 (de) 1995-10-26 1997-04-30 Consortium Elektrochem Ind Verfahren zur Herstellung von O-Acetylserin, L-Cystein und L-Cystein-verwandten Produkten
DE19726083A1 (de) 1997-06-19 1998-12-24 Consortium Elektrochem Ind Mikroorganismen und Verfahren zur fermentativen Herstellung von L-Cystein, L-Cystin, N-Acetyl-Serin oder Thiazolidinderivaten
CA2341554A1 (fr) 1998-08-26 2000-03-09 Klaus Heinzmann Procede de preparation de derives de (2r)-piperidine
US6368793B1 (en) * 1998-10-14 2002-04-09 Microgenomics, Inc. Metabolic selection methods
JP2000157267A (ja) 1998-11-24 2000-06-13 Ajinomoto Co Inc 変異型ｍｅｔＪ遺伝子及びＬ−メチオニンの製造法
DE19856136C2 (de) 1998-12-04 2002-10-24 Pasteur Institut Verfahren und Vorrichtung zur Selektion beschleunigter Proliferation lebender Zellen in Suspension
KR100309327B1 (ko) 1999-05-06 2001-09-29 담철근 아라비노스 이성화효소를 포함한 재조합 대장균주와 이를 이용한타가토스의 생산방법
DE19924364A1 (de) 1999-05-27 2000-11-30 Degussa Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
JP2003169674A (ja) 1999-07-02 2003-06-17 Ajinomoto Co Inc Ｌ−リジンの製造法
DE19949579C1 (de) 1999-10-14 2000-11-16 Consortium Elektrochem Ind Verfahren zur fermentativen Herstellung von L-Cystein oder L-Cystein-Derivaten
JP4380029B2 (ja) * 2000-07-05 2009-12-09 味の素株式会社 微生物を利用した物質の製造法
DE10109690A1 (de) * 2000-09-02 2002-03-14 Degussa Neue für das metY-Gen kodierende Nukleotidsequenzen
DE10136986A1 (de) 2000-09-03 2002-03-21 Degussa Für Gene cysD, cysN, cysK, cysE und cysH kodierende Nukleotidsequenzen
AU2002239733A1 (en) 2000-10-26 2002-06-18 Paradigm Genetics, Inc. Methods for the identification of inhibitors of cysteine syhthase in plants
WO2002051231A1 (fr) * 2000-12-22 2002-07-04 Basf Aktiengesellschaft Genes de corynebacterie
DE10104722A1 (de) 2001-02-02 2002-08-14 Ipk Inst Fuer Pflanzengenetik Verfahren zur fermentativen Herstellung von Cystein, Cystin und Glutathion
US6579705B2 (en) * 2001-04-04 2003-06-17 Consortium Fur Elektrochemische Industrie Gmbh Process for preparing non-proteinogenic L-amino acids
FR2823219B1 (fr) * 2001-04-10 2003-07-04 Pasteur Institut Mutants de la desoxycytidine kinase possedant une activite enzymatique elargie
AU2002330671B2 (en) 2001-07-06 2008-04-03 Centre National De La Recherche Scientifique (Cnrs) Method for obtaining cells with new properties

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050124010A1 (en) * 2000-09-30 2005-06-09 Short Jay M. Whole cell engineering by mutagenizing a substantial portion of a starting genome combining mutations and optionally repeating
US20080118959A1 (en) * 2002-05-23 2008-05-22 Hartwig Schroder Method for the Production of Sulpher-Containing Fine Chemicals by Fermentation
US20050054060A1 (en) * 2003-02-18 2005-03-10 Michel Chateau Method for the preparation of an evolved microorganism for the creation or the modification of metabolic pathways

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080286840A1 (en) * 2005-02-07 2008-11-20 Rainer Figge Microorganisms Comprising Enzymes Express with Low Gamma-Elimination Activity
US20100184164A1 (en) * 2006-07-28 2010-07-22 Cj Cheiljedang Corporation Microorganism Producing L-Methionine Precursor And Method Of Producing L-Methionine And Organic Acid From The L-Methionine Precursor
US8426171B2 (en) * 2006-07-28 2013-04-23 Cj Cheiljedang Corporation Microorganism producing L-methionine precursor and method of producing L-methionine and organic acid from the L-methionine precursor
US9029105B2 (en) 2006-07-28 2015-05-12 Cj Cheiljedang Corporation Microorganism producing L-methionine precursor and method of producing L-methionine and organic acid from the L-methionine precursor
US20100248311A1 (en) * 2007-10-02 2010-09-30 Metabolic Explorer Increasing methionine yield
US10858679B2 (en) * 2007-10-02 2020-12-08 Evonik Degussa Gmbh Increasing methionine yield
US20110011798A1 (en) * 2007-12-17 2011-01-20 Charles Borg Removal of selenium in contaminated wastewater streams
US8323497B2 (en) * 2007-12-17 2012-12-04 Aptwater Inc. Removal of selenium in contaminated wastewater streams
US8911978B2 (en) 2010-07-02 2014-12-16 Metabolic Explorer Method for the preparation of hydroxy acids
US8900838B2 (en) 2010-07-05 2014-12-02 Metabolic Exployer Method for the preparation of 1,3-propanediol from sucrose
US9506092B2 (en) 2011-06-29 2016-11-29 Metabolic Explorer Microorganism for methionine production with enhanced glucose import

Also Published As

Publication number Publication date
US7745195B2 (en) 2010-06-29
WO2004076659A2 (fr) 2004-09-10
EP1597364A2 (fr) 2005-11-23
JP2006517796A (ja) 2006-08-03
WO2004076659A3 (fr) 2004-12-16
EP2348107A2 (fr) 2011-07-27
EP2348107A3 (fr) 2012-07-11
BRPI0407600A (pt) 2006-02-14
EP1597364B1 (fr) 2013-07-24
MXPA05008857A (es) 2006-03-09
US20050054060A1 (en) 2005-03-10

Similar Documents

Publication Publication Date Title
US20060270013A1 (en) Method for the production of evolved microorganisms which permit the generation or modification of metabolic pathways
CN104862352B (zh) 生产o-磷酸丝氨酸的微生物和使用该微生物由o-磷酸丝氨酸生产l-半胱氨酸或其衍生物的方法
US9493801B2 (en) Compositions and methods of producing methionine
JP5701604B2 (ja) メチオニン収量の増加
EP3090070B1 (fr) Compositions et procédés pour la production biologique d'acide aminés chez des micro-organismes hydrogénotrophes
JP6100370B2 (ja) メチオニンの発酵生産のための組換え微生物
JP2017169576A (ja) メチオニン生産のためのｎａｄｐｈの供給増加
JP2008529485A (ja) 低いγ脱離活性を有する発現酵素を含む微生物
US9115362B2 (en) Mutant microorganism having high production of cadaverine, and preparation method of cadaverine using same
JP2007536921A (ja) フィードバック感受性が変化した組み換え酵素
CN109055289B (zh) 一种高产l-甲硫氨酸的重组大肠杆菌及其应用
US10196658B2 (en) Microorganism for methionine production with improved methionine synthase activity and methionine efflux
WO2017005910A1 (fr) Voies de la méthionine hydroxy analogue (mha) pour la production par fermentation
JP2023071865A (ja) メチオニン生産酵母
JP5847840B2 (ja) メチオニンヒドロキシ類似体（ｍｈａ）の発酵生産
FR2862067A1 (fr) Procede de preparation de microorganismes evolues permettant la creation ou la modification de voies metaboliques
FR2851255A1 (fr) Microorganisme a activite methionine synthase modifiee et procede de preparation de la methionine

Legal Events

Date Code Title Description
AS Assignment

Owner name: METABOLIC EXPLORER, FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHATEAU, MICHEL;GONZALEZ, BENJAMIN;MEYNIAL-SALLES, ISABELLE;AND OTHERS;REEL/FRAME:017018/0674;SIGNING DATES FROM 20050921 TO 20050926

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION