SI9011773B - Vaccine against lyme disease, process for obtaining it, monoclonal antibody, antigene, recombinant dna, recombinant vector and process for obtaining this antigene - Google Patents
Vaccine against lyme disease, process for obtaining it, monoclonal antibody, antigene, recombinant dna, recombinant vector and process for obtaining this antigene Download PDFInfo
- Publication number
- SI9011773B SI9011773B SI9011773A SI9011773A SI9011773B SI 9011773 B SI9011773 B SI 9011773B SI 9011773 A SI9011773 A SI 9011773A SI 9011773 A SI9011773 A SI 9011773A SI 9011773 B SI9011773 B SI 9011773B
- Authority
- SI
- Slovenia
- Prior art keywords
- antigen
- burgdorferi
- obtaining
- antigene
- lyme disease
- Prior art date
Links
- 238000000034 method Methods 0.000 title claims abstract 6
- 108020004511 Recombinant DNA Proteins 0.000 title claims 2
- 229960005486 vaccine Drugs 0.000 title abstract 4
- 208000016604 Lyme disease Diseases 0.000 title abstract 3
- 239000000427 antigen Substances 0.000 claims abstract 13
- 102000036639 antigens Human genes 0.000 claims abstract 13
- 108091007433 antigens Proteins 0.000 claims abstract 13
- 241000589969 Borreliella burgdorferi Species 0.000 claims abstract 5
- 108700006640 OspA Proteins 0.000 claims abstract 4
- 238000010171 animal model Methods 0.000 claims abstract 4
- 241000448699 Borrelia burgdorferi ZS7 Species 0.000 claims abstract 3
- 108020001507 fusion proteins Proteins 0.000 claims 2
- 102000037865 fusion proteins Human genes 0.000 claims 2
- 108020004414 DNA Proteins 0.000 claims 1
- 241000699670 Mus sp. Species 0.000 claims 1
- 108091028043 Nucleic acid sequence Proteins 0.000 claims 1
- 108091005804 Peptidases Proteins 0.000 claims 1
- 239000004365 Protease Substances 0.000 claims 1
- 102100037486 Reverse transcriptase/ribonuclease H Human genes 0.000 claims 1
- 125000003275 alpha amino acid group Chemical group 0.000 claims 1
- 102000005936 beta-Galactosidase Human genes 0.000 claims 1
- 108010005774 beta-Galactosidase Proteins 0.000 claims 1
- 230000007850 degeneration Effects 0.000 claims 1
- 230000002068 genetic effect Effects 0.000 claims 1
- 230000002163 immunogen Effects 0.000 claims 1
- 229940042470 lyme disease vaccine Drugs 0.000 claims 1
- 150000007523 nucleic acids Chemical group 0.000 claims 1
- 244000052769 pathogen Species 0.000 claims 1
- 102000004169 proteins and genes Human genes 0.000 claims 1
- 108090000623 proteins and genes Proteins 0.000 claims 1
- 230000001717 pathogenic effect Effects 0.000 abstract 3
- 206010062746 Carditis Diseases 0.000 abstract 1
- 206010003246 arthritis Diseases 0.000 abstract 1
- 208000006454 hepatitis Diseases 0.000 abstract 1
- 231100000283 hepatitis Toxicity 0.000 abstract 1
- 210000004408 hybridoma Anatomy 0.000 abstract 1
- 230000008105 immune reaction Effects 0.000 abstract 1
- 238000002955 isolation Methods 0.000 abstract 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/20—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
- C07K16/1207—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicinal Preparation (AREA)
- Saccharide Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Claims (6)
1 PATENTNI ZAHTEVKI 1. Postopek za pridobivanje cepiva proti lajmski bolezni, označen s tem, da imuniziramo poskusne živali, prednostno miši, z 31 kD antigenom (OspA) ali/in s 34 kD antigenom (OspB) B.burgdorferi ZS7 (DSM 5527) in/ali B31 (ATCC 35210) in iz imunizirane poskusne živali pridobimo na običajen način protektivna monoklonska protitelesa proti OspA ali/in OspB.
2. Patogeni B.burgdorferi soj ZS7, DSM5527.
3. Antigen, označen s tem, da imunsko reagira s protitelesom proti 31 kD antigenu (OspA) B.burgdorferi in vsebuje naslednjo aminokislinsko sekvenco ali imunogeni epitop iz te sekvence: M K K Y L L G I G L I L A L I A C K Q N V s s L D E K N s V s V D L P G E M N V L v s K E K N X D G K Y D L I A T V D K L E L K G T S D K N N G S G v L E G V K A D K S K V K L T I S D D L G Q T T L E V F K E D G K T L V S K K V T S K D K 5 S T E E K F N E K G E V S E K I I T R A D G T R L E Y T E I K S D G s G K A K ir V L K S Y V L E G T L T A E K T T L V V K E G T V T L S K s I S K S G E v S V £ L K D T D S S A A T K K T A A W H S G T S T L T I T V M S K K X K D L V F T K Ξ n T I T V Q Q Y D s N G T X L E G S A V E I T K L D E r K N A L K A , κ.νν>· 2
4. Antigen po zahtevku 3, označen s tem, da se nahaja zanj kodirajoča sekvenca DNA na vektorju, prednostno prokariontskem vektorju, kije primeren za izražanje proteina.
5. Antigen po zahtevku 3 ali 4, označen s tem, da je antigen β-galaktozidazni fuzijski protein ali nefuzijski protein.
6. Rekombinantna DNA, označena s tem, da kodira za antigen po enem od zahtevkov 3, 4 ali 5 ter vsebuje (1) v nadaljevanju prikazano sekvenco nukleinske kisline ali (2) sekvenco, ki ji ustreza v okviru degeneracije genetske kode: atgaaaaaacaLttac.tgggaataggtctaat.accagccttaat.agcatgtaagcaaaa.t ςζ tagcagccttgacgagaaaaacagcgtctcagtagatT:tgcctggc.gaaatgaacgi.:: cz. tgxaagcaaagaaaaaaacaaagacggcaagtacg«tc::aactgcaacagT.agacaag cztgagctt.aaaggaaczt.cE.gai.aAaaacaa:.ggawCt.ggagT.act'gaaggcgcaaaa gcrgacaaaagx.aaagx&aaattaacaattcctgacgat.ccaggxcaaaccacacctgaa g^ttccaaagaagatggcaaaacaccagxaccaaaaaaacx.aacccccaaagacaagwca ccaacagaagaaaaaLtcaatgaaaaaggxgaagtatctgaaaaaat.aacaacaagagca gacggaaccagacttgaatacacagaaattasaagcgatggatct.ggaaaagct.aaagag gr.tttaaaaagccatg^c.ct rgaaggaact^taactgctgaaaaaacaacattggzggtt. aaagaaggaact.gT.tacctcaagcaaaaa*attteaaaatctggggaagccccagTtgaa cctaac.gacactgacagtagtgctgccactaaaaaaactgcagcttggaactcaggcact. ccaaccccaacaaL^accg^aaacagrcaaaaaaactaaagaccccgtgcccacaaaagaa aacacaacc.acagr.acaacaaracgactcaaatggcaccaaactagaggggtcagcagct
gaaactacaaaacctgacgaaaccaaaaacgctccaaaataa
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE3931236 | 1989-09-19 | ||
DE4015911A DE4015911A1 (de) | 1989-09-19 | 1990-05-17 | Impfstoff gegen die lyme-krankheit |
YU177390A YU48250B (sh) | 1989-09-19 | 1990-09-18 | Postupak za pripremanje aktivne vakcine protiv lajmske bolesti |
Publications (2)
Publication Number | Publication Date |
---|---|
SI9011773A SI9011773A (sl) | 1998-04-30 |
SI9011773B true SI9011773B (en) | 2001-12-31 |
Family
ID=25885304
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
SI9011773A SI9011773B (en) | 1989-09-19 | 1990-09-18 | Vaccine against lyme disease, process for obtaining it, monoclonal antibody, antigene, recombinant dna, recombinant vector and process for obtaining this antigene |
Country Status (24)
Country | Link |
---|---|
US (6) | US5178859A (sl) |
EP (5) | EP0633313B1 (sl) |
JP (3) | JP3205932B2 (sl) |
KR (2) | KR100205462B1 (sl) |
AT (4) | ATE186646T1 (sl) |
AU (1) | AU651560B2 (sl) |
CA (1) | CA2025597C (sl) |
CZ (2) | CZ284538B6 (sl) |
DE (5) | DE4015911A1 (sl) |
DK (4) | DK0418827T3 (sl) |
ES (4) | ES2082812T3 (sl) |
FI (1) | FI102248B (sl) |
GR (3) | GR3018995T3 (sl) |
HK (2) | HK1002405A1 (sl) |
HR (1) | HRP940545B1 (sl) |
HU (2) | HU212716B (sl) |
IE (1) | IE903377A1 (sl) |
NO (2) | NO311767B1 (sl) |
NZ (1) | NZ235260A (sl) |
PL (2) | PL170229B1 (sl) |
PT (1) | PT95349B (sl) |
SI (1) | SI9011773B (sl) |
SK (3) | SK280285B6 (sl) |
YU (2) | YU48250B (sl) |
Families Citing this family (45)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK590288D0 (da) | 1988-10-24 | 1988-10-24 | Symbicom Ab | Kemiske forbindelser |
US5777095A (en) * | 1988-10-24 | 1998-07-07 | Symbicom Aktiebolag | Osp A and B Sequence of Borrelia burgdonferi strains ACA1 and IP90 |
US6143872A (en) * | 1988-10-24 | 2000-11-07 | Symbicom Aktiebolag | Borrelia burdorferi Osp A and B proteins and immunogenic peptides |
US7094391B1 (en) * | 1988-10-24 | 2006-08-22 | The University Of Texas System | Compositions and methods for administering Borrelia burgdorferi antigens |
DE4015911A1 (de) * | 1989-09-19 | 1991-03-28 | Max Planck Gesellschaft | Impfstoff gegen die lyme-krankheit |
US5582829A (en) * | 1990-04-05 | 1996-12-10 | Rx Technologies, Inc. | Sonicated borrelia burgdorferi vaccine |
WO1992000055A1 (en) * | 1990-06-15 | 1992-01-09 | Yale University | Compositions and methods for the prevention and diagnosis of lyme disease |
EP1016416A3 (en) * | 1990-07-06 | 2002-10-23 | Wyeth | Vaccine against lyme disease and a challenge model for evaluating vaccine efficacy |
CA2057536C (en) * | 1990-12-21 | 1999-10-26 | John J. Dunn | Cloning and expression of borrelia lipoproteins |
US6221363B1 (en) * | 1991-07-11 | 2001-04-24 | Baxter Aktiengesellschaft | Vaccine for the prevention of lyme disease |
US6872550B1 (en) | 1991-07-11 | 2005-03-29 | Baxter Vaccine Ag | Immunogenic formulation of OspC antigen vaccines for the prevention and treatment of lyme disease and recombinant methods for the preparation of such antigens |
EP0877085A1 (en) * | 1991-08-15 | 1998-11-11 | SMITHKLINE BEECHAM BIOLOGICALS s.a. | OspA protein of borrelia burgdorferi subgroups, encoding genes and vaccines |
US6676942B1 (en) | 1991-08-15 | 2004-01-13 | Smithkline Beecham Biologicals (S.A.) | Osp a proteins of Borrelia burgdorferi subgroups, encoding genes and vaccines |
PT100980B (pt) * | 1991-10-18 | 1999-07-30 | Connaught Lab | Proteinas recombinantes de borrelia, seu processo de producao, vacina contra infeccao por borrelia e agente de imunodiagnostico para a sua deteccao |
AU2903892A (en) * | 1991-10-22 | 1993-05-21 | Symbicom Aktiebolag | Improvement in (borrelia burgdorferi) diagnosis and prophylaxis |
US6303129B1 (en) * | 1992-07-28 | 2001-10-16 | Rx Technologies | Production of borrelia burgdorferi vaccine, product produced thereby and method of use |
US5656451A (en) * | 1993-07-30 | 1997-08-12 | Yale University | OspE, OspF, and S1 polypeptides in borrelia burgdorferi |
US6716591B1 (en) | 1993-07-30 | 2004-04-06 | Yale University | B. burgdorferi polypeptides |
US7008625B2 (en) | 1993-11-01 | 2006-03-07 | Research Foundation Of The State University Of New York | Recombinant constructs of Borrelia burgdorferi |
US5558993A (en) * | 1994-06-17 | 1996-09-24 | The Regents Of The University Of California | Cloned Borrelia burgdorferi virulence protein |
GB9511909D0 (en) * | 1995-06-12 | 1995-08-09 | Microbiological Res Authority | Vaccine |
DE69733944T3 (de) * | 1996-02-21 | 2012-07-26 | The Board Of Regents, The University Of Texas System | Vmp-ähnliche sequenzen von pathogener borrelia |
DE19632862B4 (de) | 1996-08-14 | 2006-08-03 | Mikrogen Molekularbiologische Entwicklungs-Gmbh | Immunologisch aktive Proteine von Borrelia burgdorferi, dafür kodierende Nukleinsäuren sowie deren Verwendung in Testkits und als Impfstoffe |
US6458555B1 (en) * | 1996-08-21 | 2002-10-01 | Gerd Bach | Cytologic method of examining mucous membranes |
US6060082A (en) * | 1997-04-18 | 2000-05-09 | Massachusetts Institute Of Technology | Polymerized liposomes targeted to M cells and useful for oral or mucosal drug delivery |
DE19740735A1 (de) * | 1997-09-16 | 1999-03-18 | Max Planck Gesellschaft | Arzneimittel zur Therapie einer manifesten Lyme-Borreliose |
US6306623B1 (en) * | 1998-02-24 | 2001-10-23 | The University Of California | Leptospiral major outer membrane protein LipL32 |
DE69938183T2 (de) | 1998-07-31 | 2009-02-19 | Gundersen Lutheran Medical Foundation, Inc., La Crosse | Verwendungen eines borreliaziden epitops des aussermembranproteins c von borrelia burgdorferi (ospc) als impstoff |
WO2000056298A2 (en) * | 1999-03-19 | 2000-09-28 | Luitpold Pharmaceuticals, Inc. | Treatment of lyme disease with polysulfated glycosaminoglycan formulations |
US6592875B1 (en) | 1999-06-21 | 2003-07-15 | Milkhaus Laboratory, Inc. | Method for treatment of lyme disease |
ES2298249T3 (es) | 2000-08-18 | 2008-05-16 | Research Foundation Of State University Of New York | Ospa modificada de borrelia burgdorferi. |
US7847084B2 (en) | 2002-12-20 | 2010-12-07 | Board Of Regents, The University Of Texas System | VMP-like sequences of pathogenic Borrelia species and strains |
MX2009004866A (es) | 2006-11-03 | 2009-05-19 | Schering Plough Ltd | Vacuna para enfermedad de lyme canina. |
WO2008116468A2 (en) | 2007-03-26 | 2008-10-02 | Dako Denmark A/S | Mhc peptide complexes and uses thereof in infectious diseases |
EP2167537A2 (en) | 2007-07-03 | 2010-03-31 | Dako Denmark A/S | Compiled methods for analysing and sorting samples |
US10611818B2 (en) | 2007-09-27 | 2020-04-07 | Agilent Technologies, Inc. | MHC multimers in tuberculosis diagnostics, vaccine and therapeutics |
DK2254592T3 (da) | 2008-02-28 | 2019-09-09 | Dako Denmark As | MHC-multimerer til Borrelia-diagnostik og sygdom |
US10722562B2 (en) | 2008-07-23 | 2020-07-28 | Immudex Aps | Combinatorial analysis and repair |
GB0817244D0 (en) | 2008-09-20 | 2008-10-29 | Univ Cardiff | Use of a protein kinase inhibitor to detect immune cells, such as T cells |
US11992518B2 (en) | 2008-10-02 | 2024-05-28 | Agilent Technologies, Inc. | Molecular vaccines for infectious disease |
WO2010037402A1 (en) | 2008-10-02 | 2010-04-08 | Dako Denmark A/S | Molecular vaccines for infectious disease |
WO2011063003A2 (en) * | 2009-11-17 | 2011-05-26 | Abaxis, Inc. | Peptides and methods for the detection of lyme disease antibodies |
US8758772B2 (en) | 2011-11-04 | 2014-06-24 | Abaxis, Inc. | Peptides and methods for the detection of lyme disease antibodies |
PL223175B1 (pl) | 2012-10-22 | 2016-10-31 | Inst Chemii Bioorganicznej Polskiej Akademii Nauk | Szczepionka przeciw boreliozie, konstrukt genetyczny, rekombinowane białko, sposób otrzymywania konstruktu genetycznego, sposób otrzymywania szczepionki, sposób otrzymywania rekombinowanych białek, zastosowanie rekombinowanych białek do wytwarzania szczepionki przeciwko boreliozie |
US9610336B1 (en) * | 2014-07-16 | 2017-04-04 | Amiram Katz | Immunotherapy for lyme disease |
Family Cites Families (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK590288D0 (da) * | 1988-10-24 | 1988-10-24 | Symbicom Ab | Kemiske forbindelser |
US4772464A (en) | 1985-08-01 | 1988-09-20 | Miles Laboratories, Inc. | Protective antibodies to serotypic determinants of flagellar antigens |
US4888276A (en) * | 1986-06-26 | 1989-12-19 | Minnesota Mining And Manufacturing Company | Method and composition for the diagnosis of Lyme disease |
US4721617A (en) | 1986-08-14 | 1988-01-26 | Regents Of The University Of Minnesota | Vaccine against lyme disease |
US5034515A (en) * | 1987-09-22 | 1991-07-23 | Wisconsin Alumni Research Foundation | Staphylococcal fibronectin receptor, monoclonal antibodies thereto and methods of use |
DE4015911A1 (de) * | 1989-09-19 | 1991-03-28 | Max Planck Gesellschaft | Impfstoff gegen die lyme-krankheit |
ATE140461T1 (de) * | 1989-12-22 | 1996-08-15 | Mikrogen Molekularbiol Entw | Immunologisch aktive proteine von borrelia burgdorferi, zusammenhängende testkits und impfstoff |
WO1992000055A1 (en) * | 1990-06-15 | 1992-01-09 | Yale University | Compositions and methods for the prevention and diagnosis of lyme disease |
EP1016416A3 (en) * | 1990-07-06 | 2002-10-23 | Wyeth | Vaccine against lyme disease and a challenge model for evaluating vaccine efficacy |
CA2057536C (en) * | 1990-12-21 | 1999-10-26 | John J. Dunn | Cloning and expression of borrelia lipoproteins |
EP0877085A1 (en) * | 1991-08-15 | 1998-11-11 | SMITHKLINE BEECHAM BIOLOGICALS s.a. | OspA protein of borrelia burgdorferi subgroups, encoding genes and vaccines |
DE69227844T2 (de) * | 1991-08-27 | 1999-08-05 | Novo Nordisk As | Waschmittelzusammensetzungen |
PT100980B (pt) * | 1991-10-18 | 1999-07-30 | Connaught Lab | Proteinas recombinantes de borrelia, seu processo de producao, vacina contra infeccao por borrelia e agente de imunodiagnostico para a sua deteccao |
AU681572B2 (en) * | 1991-10-21 | 1997-09-04 | Med Immune, Inc. | Bacterial expression vectors containing DNA encoding secretion signals of lipoproteins |
-
1990
- 1990-05-17 DE DE4015911A patent/DE4015911A1/de not_active Withdrawn
- 1990-09-07 HU HU905816A patent/HU212716B/hu not_active IP Right Cessation
- 1990-09-11 NZ NZ235260A patent/NZ235260A/xx unknown
- 1990-09-12 AU AU62444/90A patent/AU651560B2/en not_active Ceased
- 1990-09-18 AT AT94112145T patent/ATE186646T1/de not_active IP Right Cessation
- 1990-09-18 YU YU177390A patent/YU48250B/sh unknown
- 1990-09-18 ES ES90117943T patent/ES2082812T3/es not_active Expired - Lifetime
- 1990-09-18 EP EP94112144A patent/EP0633313B1/de not_active Expired - Lifetime
- 1990-09-18 ES ES94112143T patent/ES2129551T3/es not_active Expired - Lifetime
- 1990-09-18 AT AT94112144T patent/ATE191499T1/de not_active IP Right Cessation
- 1990-09-18 PL PL90307358A patent/PL170229B1/pl not_active IP Right Cessation
- 1990-09-18 DE DE59009978T patent/DE59009978D1/de not_active Expired - Fee Related
- 1990-09-18 EP EP90117943A patent/EP0418827B1/de not_active Expired - Lifetime
- 1990-09-18 DE DE59010863T patent/DE59010863D1/de not_active Expired - Fee Related
- 1990-09-18 CA CA002025597A patent/CA2025597C/en not_active Expired - Fee Related
- 1990-09-18 DK DK90117943.2T patent/DK0418827T3/da active
- 1990-09-18 DE DE59010903T patent/DE59010903D1/de not_active Expired - Fee Related
- 1990-09-18 ES ES94112144T patent/ES2145077T3/es not_active Expired - Lifetime
- 1990-09-18 DK DK94112143T patent/DK0643974T3/da active
- 1990-09-18 DK DK94112144T patent/DK0633313T3/da active
- 1990-09-18 AT AT90117943T patent/ATE131732T1/de not_active IP Right Cessation
- 1990-09-18 EP EP94112145A patent/EP0633028B1/de not_active Expired - Lifetime
- 1990-09-18 AT AT94112143T patent/ATE175576T1/de not_active IP Right Cessation
- 1990-09-18 DE DE59010888T patent/DE59010888D1/de not_active Expired - Fee Related
- 1990-09-18 ES ES94112145T patent/ES2141182T3/es not_active Expired - Lifetime
- 1990-09-18 EP EP98105444A patent/EP0861664A3/de not_active Withdrawn
- 1990-09-18 PL PL90286918A patent/PL169804B1/pl not_active IP Right Cessation
- 1990-09-18 IE IE337790A patent/IE903377A1/en not_active IP Right Cessation
- 1990-09-18 FI FI904597A patent/FI102248B/fi not_active IP Right Cessation
- 1990-09-18 EP EP94112143A patent/EP0643974B1/de not_active Expired - Lifetime
- 1990-09-18 DK DK94112145T patent/DK0633028T3/da active
- 1990-09-18 NO NO19904062A patent/NO311767B1/no unknown
- 1990-09-18 SI SI9011773A patent/SI9011773B/sl not_active IP Right Cessation
- 1990-09-19 KR KR1019900014814A patent/KR100205462B1/ko not_active IP Right Cessation
- 1990-09-19 CZ CS904560A patent/CZ284538B6/cs not_active IP Right Cessation
- 1990-09-19 JP JP24765090A patent/JP3205932B2/ja not_active Expired - Fee Related
- 1990-09-19 PT PT95349A patent/PT95349B/pt active IP Right Grant
- 1990-09-19 SK SK4560-90A patent/SK280285B6/sk unknown
- 1990-09-19 SK SK1510-98A patent/SK283088B6/sk unknown
- 1990-09-19 CZ CZ95970A patent/CZ284616B6/cs not_active IP Right Cessation
- 1990-09-19 SK SK1511-98A patent/SK283089B6/sk unknown
- 1990-09-19 US US07/585,310 patent/US5178859A/en not_active Expired - Lifetime
-
1993
- 1993-05-27 US US08/068,063 patent/US5434077A/en not_active Expired - Fee Related
-
1994
- 1994-09-15 HR HR940545A patent/HRP940545B1/xx not_active IP Right Cessation
-
1995
- 1995-03-20 US US08/407,350 patent/US5686267A/en not_active Expired - Lifetime
- 1995-03-20 US US08/406,623 patent/US5780030A/en not_active Expired - Fee Related
- 1995-04-24 HU HU95P/P00108P patent/HU211228A9/hu unknown
-
1996
- 1996-02-14 GR GR960400397T patent/GR3018995T3/el unknown
-
1997
- 1997-03-12 YU YU9097A patent/YU49370B/sh unknown
-
1998
- 1998-02-13 HK HK98101147A patent/HK1002405A1/xx not_active IP Right Cessation
- 1998-02-23 US US09/027,843 patent/US5856447A/en not_active Expired - Fee Related
- 1998-08-29 KR KR1019980035375A patent/KR100202128B1/ko not_active IP Right Cessation
- 1998-12-23 HK HK98114958A patent/HK1013620A1/xx not_active IP Right Cessation
-
1999
- 1999-10-07 US US09/413,858 patent/US6613331B1/en not_active Expired - Fee Related
- 1999-11-30 GR GR990403104T patent/GR3032010T3/el unknown
-
2000
- 2000-06-14 GR GR20000401362T patent/GR3033675T3/el not_active IP Right Cessation
- 2000-07-26 JP JP2000225341A patent/JP3328644B2/ja not_active Expired - Fee Related
- 2000-12-11 JP JP2000376159A patent/JP3418171B2/ja not_active Expired - Fee Related
-
2001
- 2001-09-24 NO NO20014624A patent/NO315905B1/no unknown
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
SI9011773B (en) | Vaccine against lyme disease, process for obtaining it, monoclonal antibody, antigene, recombinant dna, recombinant vector and process for obtaining this antigene | |
Gadde et al. | Passive immunization with hyperimmune egg-yolk IgY as prophylaxis and therapy for poultry diseases–a review | |
Theisen et al. | Antigenicity and immunogenicity of recombinant glutamate-rich protein of Plasmodium falciparum expressed in Escherichia coli | |
Simon et al. | Recombinant outer surface protein A from Borrelia burgdorferi induces antibodies protective against spirochetal infection in mice | |
Schaible et al. | Monoclonal antibodies specific for the outer surface protein A (OspA) of Borrelia burgdorferi prevent Lyme borreliosis in severe combined immunodeficiency (scid) mice. | |
Hanson et al. | Active and passive immunity against Borrelia burgdorferi decorin binding protein A (DbpA) protects against infection | |
Michael et al. | Chicken egg yolk antibodies (IgY) as an alternative to mammalian antibodies | |
Fahey et al. | Virus-neutralizing and passively protective monoclonal antibodies to infectious bursal disease virus of chickens | |
Berghman et al. | Antibodies: an alternative for antibiotics? | |
Vidotto et al. | Intermolecular relationships of major surface proteins of Anaplasma marginale | |
Van den Broeck et al. | Receptor-specific binding of purified F4 to isolated villi | |
Shivachandra et al. | Immunogenicity of highly conserved recombinant VacJ outer membrane lipoprotein of Pasteurella multocida | |
CN104168918A (zh) | 含有t-细胞表位的b细胞受体复合体结合蛋白质 | |
CN107586335A (zh) | 一种人源化单克隆抗体及应用 | |
JP2017523136A (ja) | 抗体誘導ワクチン及び迅速な成熟免疫応答の発生のための使用方法 | |
Gogolewski et al. | Protective ability of antibodies against 78-and 40-kilodalton outer membrane antigens of Haemophilus somnus | |
WO2014043215A1 (en) | Bi-specifc diabodies for masking and targeting vaccines | |
DE69737323D1 (de) | Adhesin aus heliobacter pylori, welches an blutgruppenantigene bindet | |
Woollard et al. | Synthetic peptides induce antibody against a host-protective antigen of Echinococcus granulosus | |
Nasiri et al. | Production and characterization of egg yolk antibody (IgY) against recombinant VP8-S2 antigen | |
Bagdasarian et al. | Immunogenicity of Actinobacillus ApxIA toxin epitopes fused to the E. coli heat-labile enterotoxin B subunit | |
Klemm et al. | Prediction of antigenic determinants and secondary structures of the K88 and CFA1 fimbrial proteins from enteropathogenic Escherichia coli | |
Bailey et al. | Production of murine monoclonal antibodies to the major axial filament polypeptide of Treponema pallidum | |
Koti et al. | Construction of single-chain Fv with two possible CDR3H conformations but similar inter-molecular forces that neutralize bovine herpesvirus 1 | |
Romito et al. | Eliciting antigen-specific egg-yolk IgY with naked DNA |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
IF | Valid on the event date | ||
KO00 | Lapse of patent |
Effective date: 20060515 |