WO2018041827A1 - Adenovirus armed with bispecific t cell engager (bite) - Google Patents
Adenovirus armed with bispecific t cell engager (bite) Download PDFInfo
- Publication number
- WO2018041827A1 WO2018041827A1 PCT/EP2017/071655 EP2017071655W WO2018041827A1 WO 2018041827 A1 WO2018041827 A1 WO 2018041827A1 EP 2017071655 W EP2017071655 W EP 2017071655W WO 2018041827 A1 WO2018041827 A1 WO 2018041827A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bite
- adenovirus
- cells
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/761—Adenovirus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/521—Chemokines
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/521—Chemokines
- C07K14/522—Alpha-chemokines, e.g. NAP-2, ENA-78, GRO-alpha/MGSA/NAP-3, GRO-beta/MIP-2alpha, GRO-gamma/MIP-2beta, IP-10, GCP-2, MIG, PBSF, PF-4, KC
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7156—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interferons [IFN]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2809—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/861—Adenoviral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55522—Cytokines; Lymphokines; Interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/58—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
- A61K2039/585—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation wherein the target is cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/768—Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/75—Agonist effect on antigen
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/90—Fusion polypeptide containing a motif for post-translational modification
- C07K2319/92—Fusion polypeptide containing a motif for post-translational modification containing an intein ("protein splicing")domain
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10332—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/60—Vector systems having a special element relevant for transcription from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor
Definitions
- the present disclosure relates to a modified adenovirus, in particular Enadenotucirev (EnAd), armed with a bispecific T cell engager (BiTE) comprising at least two binding domains, wherein at least one of the domains is specific for a surface antigen on a T-cell of interest.
- the disclosure further relates to a composition, such as a pharmaceutical formulation comprising the virus, use of the virus and virus formulations, particularly in treatment, especially in the treatment of cancer.
- the disclosure also extends to processes for preparing the virus and DNA encoding the same.
- Cancer is still a huge social burden to society in terms of the hardship and suffering of patients and their loved ones, and also in terms of the high financial cost of treating, caring for and supporting patients.
- Antibody- based therapy for cancer has become established over the past 15 years and is now one of the most successful and important strategies for treating patients with haematological malignancies and solid tumours.
- monoclonal antibody based anti-cancer therapies currently in clinical use include rituximab, which targets CD20, bevacizumab which targets VEGF, cetuximab which targets EGFR and labetuzumab which targets CEA.
- bispecific T-cell engagers show much promise. These are relatively simple bi-specific molecules that are specific for the CD3£ subunit of the TCR complex of a T-cell and also a target an antigen of interest, such as a cancer antigen. Since BiTEs are specific for the TCR complex, this enables BiTEs to activate resident T-cells to kill cells expressing a particular target antigen on their cell surface, for example cancer cells.
- An important property of BiTEs is their ability to make CD4 + and non-activated CD8 + T-cells target cancer cells. In other words, T-cells activated by BiTES can be made to kill cells independent of MHC expression on the cell surface. This is important because some tumour cells downregulate MHC which makes them resistant to agents such as CAR-T cells and immTACs.
- BiTEs have poor circulation kinetics relative to full length antibodies. This means that when administered to the patient, a large proportion of the BiTEs do not reach their target cells.
- the use of high affinity anti-CD3 ScFv as part of the BiTE can lead to strong binding to T-cells in the blood, which also interferes with delivery to the tumour. As a result, the BiTEs are unable to reach their full potential as an anti-cancer therapy because they cannot be effectively delivered to the tumour cells.
- tumour cells have become increasingly important since it is becoming more apparent that solid tumours protect themselves in vivo in a number of ways, for example by developing stroma around the tumour.
- Progression to a carcinoma is associated with proliferation of epithelial cells (mitotic cells) along with the development of an activated tumour stroma.
- ECM extracellular-matrix
- the number of inflammatory cells increases and fibroblasts differentiate into myofibroblasts, resulting in their expression of growth factors, matrix components and degrading proteases.
- Angiogenesis is maintained, resulting in a high number of leaky tumour vessels. Following activation of a tumour stroma with persistent angiogenesis, invasion by tumour cells begins through the degraded basement membrane, and blood vessels infiltrate the tumour tissue.
- This stroma is a physical protection in that it may have a function of trapping immune cells sent to fight the tumour.
- the stroma shields the hypoxic microenviroment of the tumour, which is permissive and optimised for the tumour's growth. There are some theories that cells in the stroma are a source of energy in the tumour.
- tumour stroma A large component of tumour stroma are fibroblasts, which have been corrupted to serve the purpose of the cancer.
- Other cells that infiltrate the stroma are tumour associated macrophages (TAMs), which are type 2 (M2) macrophages that can promote tumour growth by secreting cytokines and chemokines, such as IL-10 that suppress immune responses.
- TAMs tumour associated macrophages
- M2 type 2
- tumour stroma Because the cells that make the environment are "native" immune or connective tissue cells, which are found throughout the body. Thus targeting these cells with therapeutic agents can lead to serious off-target effects.
- the present inventors believe that one of the most effective ways to deliver the therapeutic agents directly to the tumour is with an oncolytic adenovirus engineered to express agents that, for example activate T cells and target an antigen, such as in the stroma.
- an adenovirus comprising a sequence of formula (I) :
- B ⁇ is bond or comprises: E1A, E1B or E1A-E1B;
- B A comprises-E2B-Ll-L2-L3-E2A-L4;
- B2 is a bond or comprises: E3;
- ⁇ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both;
- Bg comprises L5
- ⁇ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both;
- B3 is a bond or comprises: E4;
- the adenovirus encodes a Bispecific T cell Engager (BiTE) comprising at least two binding domains wherein at least one of the said domains is specific to a surface antigen on an immune cell of interst, such as a T cell of interest; and said adenovirus further encodes a second BiTE wherein the adenovirus is EnAd or Adll.
- BiTE Bispecific T cell Engager
- the BiTE or BiTEs of according to the present disclosure do not comprise a transmembrane domain and so are not expressed on the cancer cell surface but rather comprises a signal sequence to facilitate release of the BiTE molecule from the cancer cell.
- An adenovirus comprising a sequence of formula (I):
- B ⁇ is bond or comprises: E1A, E1B or E1A-E1B;
- B A comprises-E2B-Ll-L2-L3-E2A-L4;
- B2 is a bond or comprises: E3;
- ⁇ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both;
- Bg comprises L5
- ⁇ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both;
- B3 is a bond or comprises: E4;
- the adenovirus encodes a first Bispecific T cell Engager (BiTE) comprising at least two binding domains, Bdl and Bd2, wherein at least one of the said domains, such as Bdl, is specific to a surface antigen on an immune cell, such as a T cell and a second BiTE comprising at least two binding domains, Bd3 and Bd4, and at least one of said binding domains, such as Bd3, is specific to a surface antigen on an immune cell, such as a T cell;
- BiTE Bispecific T cell Engager
- adenovirus is EnAd or Adll.
- An adenovirus according to paragraph 1 or 2 wherein the surface antigen is a component of the T-cell receptor complex (TCR), such as CD3, TCR-a and TCR- ⁇ .
- TCR T-cell receptor complex
- adenovirus according to paragraph 3 wherein the surface antigen is CD3 such as CD3s, CD3y and CD38, in particular CD3s.
- An adenovirus according to claim 1 or 2 wherein one of the binding domains in the BiTE is specific to a non-TCR activating protein such as CD31, CD2 and CD277.
- binding domain in the first BiTE such as Bdl
- a binding domain in the second BiTE such as Bd3
- binding domain in the first BiTE such as Bdl
- binding domain in the second BiTE such as Bd2
- a tumour antigen such as CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166,
- binding domains for example Bd2 and/or Bd4 is specific to EpCAM, for example an EpCAM comprising an amino acid sequence as set forth in SEQ ID NO: 28.
- adenovirus according to any one of paragraphs 1 to 4, wherein one of the binding domains is specific to a tumour stromal antigen, for example fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-a receptor (PDGFR-a), platelet-derived growth factor- ⁇ receptor (PDGFR- ⁇ ) and vimentin.
- FAP fibroblast activation protein
- TREM1 TREM1, IGFBP7
- FSP-1 platelet-derived growth factor-a receptor
- PDGFR-a platelet-derived growth factor-a receptor
- PDGFR- ⁇ platelet-derived growth factor- ⁇ receptor
- adenovirus according to paragraph 12, wherein one of the binding domains, for example Bd2 and/or Bd4, is specific to FAP, for example a FAP comprising an amino acid sequence as set forth in SEQ ID NO: 30.
- An adenovirus according to any one of paragraphs 1 to 16 wherein the adenovirus is chimeric.
- ⁇ comprises one or more transgenes or a transgene cassette.
- ⁇ comprises one or more transgenes or a transgene cassette.
- An adenovirus according to any one of paragraphs 1 to 23, wherein the one or more transgenes or transgene cassettes is under the control of an endogenous or exogenous promoter, such as an endogenous promotor.
- transgene or transgene cassette is under the control of an endogenous promoter selected from the group consisting of E4 promoter and major late promoter, in particular the major late promoter.
- transgene or transgene cassette is under the control of an exogenous promoter, such as CMV.
- transgene cassette further comprises a regulatory element independently selected from:
- transgene cassette comprises a Kozak sequence which is at the start of the protein coding sequence.
- transgene cassette further comprises a polyadenylation sequence.
- transgene cassette further comprises a restriction site at the 'end of the DNA sequence and/or at the 'end of the DNA sequence.
- An adenovirus according to any of paragraphs 1 to 31, wherein at least one transgene cassette encodes monocistronic mRNA.
- An adenovirus according to any one of paragraphs 1 to 33, wherein the BiTE is encoded in a region selected from El, E3, ⁇ , ⁇ and combinations thereof.
- adenovirus according to any one of paragraphs 1 to 35, wherein the first BiTE molecule is specific to a tumour antigen, for example a tumor antigen (for example as listed herein) and the second BiTE molecule is specific to a tumour stromal antigen, for example a stromal antigen (for example as listed herein).
- a tumour antigen for example a tumor antigen (for example as listed herein)
- the second BiTE molecule is specific to a tumour stromal antigen, for example a stromal antigen (for example as listed herein).
- adenovirus according to any one of paragraphs 1 to 36, wherein the adenovirus further comprises a cytokine or chemokine or an immunomodulator (such as a cytokine or chemokine).
- cytokine or chemokine is selected from ⁇ , IL-la, IL- ⁇ , IL-6, IL-9, IL-12, IL-13, IL-17, IL-18, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-33, IL-35, IL-2, IL-4, IL-5, IL-7, IL-10, IL-15, IL-21, IL-25, IL-1RA, IFNa, IFNp, IFNy, TNFa, lymphotoxin a (LTA), Flt3L, GM-CSF, IL-8, CCL2, CCL3, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, (for example IL-la, IL- ⁇ , IL-6, IL-9, IL-12, IL-13, IL-17
- an adenovirus according to any one of paragraphs 1 to 38, wherein the adenovirus further comprises an immunomodulator, such as an antibody or antibody fragment, or protein or peptide ligand, specific to a checkpoint protein such as CTLA-4, PD-1, PD-L1, PD-L2, VISTA, B7- H3, B7-H4, HVEM, ILT-2, ILT-3, ILT-4, TIM-3, LAG- 3, BTLA, LIGHT or CD160, for example CTLA- 4, PD-1, PD-L1 and PD-L2, or to a co-stimulatory molecule, such as CD28, CD80, CD86, CD83, ICOS, B7H2, TL1A and 4-1BB.
- an immunomodulator such as an antibody or antibody fragment, or protein or peptide ligand, specific to a checkpoint protein such as CTLA-4, PD-1, PD-L1, PD-L2, VISTA, B7- H3, B7-H4,
- adenovirus according to any one of the paragraphs 1 to 39, wherein the BiTE comprises a VH domain comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 8, 13 or 18, or an amino acid sequence that is at least 95% identical thereto.
- adenovirus according to any one of paragraphs 1 to 40, wherein the BiTE comprises a VL domain comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 9, 12 or 17, or an amino acid sequence that is at least 95% identical thereto.
- adenovirus according to any one of paragraphs 1 to 41, wherein the BiTE comprises a scFv comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 7, 11 or 16, or an amino acid sequence that is at least 95% identical thereto.
- BiTE comprises an amino acid sequence set forth in SEQ ID NOs: 2 or 4, or an amino acid sequence that is at least 95% identical thereto, for example an amino acid sequence as set forth in SEQ ID NOs: 73 or 75.
- composition comprising an adenovirus according to any one of paragraphs 1 to 41 and a diluent or carrier.
- composition according to claim 45 wherein the formulation comprises a second oncolytic virus, for example Adll or a derivative thereof, such as EnAd, in particular wherein the additional virus is according to the present disclosure.
- a second oncolytic virus for example Adll or a derivative thereof, such as EnAd, in particular wherein the additional virus is according to the present disclosure.
- a method of treating a patient comprising administering a therapeutically effective amount of an adenovirus of any one of paragraphs 1 to 44 or a composition of paragraph 46.
- the adenovirus according to the present disclosure encodes at least one further transgene, for example 1, 2 ,3 or 4 further transgenes.
- cleavage peptide is encoded between each of the genes.
- all the transgenes are in one location in the virus, for example the are in in position ⁇
- the present inventors have discovered that arming an adenovirus with a BiTE molecule allows the bi-specific antibody fragment molecule to 'piggyback' on the ability of the adenovirus to selectively infect cancer cells, thereby enabling the targeted delivery of the BiTE to tumour cells.
- BiTEs are small and can be made in mammalian cells.
- the BiTE molecules are synthesized by tumour cells, secreted and can act locally, spreading beyond the immediate footprint of the virus. This therefore allows the BiTE to spread beyond the immediate site of infection but at the same time limits the spread of the virus too far beyond the infected tumour cell nest. This minimises the risk of undesired off-target effects.
- the adenovirus is EnAd.
- EnAd has been shown to have an enhanced oncolytic activity compared to prior art adenoviruses.
- EnAd has also been shown to have a high selectivity for human epithelial-derived carcinoma cells, such as colon, lung, bladder and renal cancer cells. This makes it an ideal delivery vehicle for BiTE molecules because T-cells can be activated by the BiTE molecule to attack target cells whilst EnAd simultaneously infects and lyses cancer cells. This results in a two-pronged attack on the tumour which has a synergistic oncolytic effect.
- the surface antigen is a component of the T-cell receptor complex (TCR), such as CD3, TCR-a and TCR- ⁇ .
- TCR T-cell receptor complex
- the surface antigen is CD3 such as CD3s, CD3y and CO38, in particular
- one of the binding domains is specific to a tumour antigen such as CEA,
- MUC-1 EpCAM
- EpCAM EpCAM
- a HER receptor such as HER1, HER2, HER3, HER4
- PEM PEM
- A33 G250
- one of the binding domains is specific to EpCAM, for example an EpCAM comprising an amino acid sequence as set forth in SEQ ID NO: 28 or a sequence at least 95% identical thereto.
- one of the binding domains is specific to a tumour stroma antigen, for example fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factored receptor (PDGFR-a), platelet-derived growth factor- ⁇ receptor (PDGFR- ⁇ ) and vimentin.
- FAP fibroblast activation protein
- TREM1 TREM1, IGFBP7, FSP-1
- PDGFR-a platelet-derived growth factored receptor
- PDGFR- ⁇ platelet-derived growth factor- ⁇ receptor
- vimentin vimentin.
- stromal cells non-transformed cells expressing these antigens are not subjected to the same level of mutation-resistance-selection process as transformed cells. Therefore, these cells are easier to target for cancer therapy since they are not a 'moving target'.
- the types of receptors found in stromal cells are often common across different types of cancer. Hence, targeting one of the above antigens is likely to be effective for multiple cancer types
- one of the binding domains is specific to FAP, for example a FAP comprising an amino acid sequence as set forth in SEQ ID NO: 30 or a sequence at least 95% indentical thereto.
- FAP is upregulated on tumour associated fibroblasts.
- Fibroblasts are a vital component of solid carcinomas supporting growth, invasion and recovery from interventions. They typically comprise 40-60% of the cells in advanced carcinomas.
- fibroblasts are genetically stable cells that are less likely to escape therapy than cancers cells.
- Activated fibroblasts are also relatively similar across a variety of tumour types.
- the adenoviruses of the present disclosure can help to diminish a spectrum of immune suppressive pathways, such as those mediated by IL-10, TGF and IDO.
- Other stromal targets include tumor associated macrophages and myeloid derived suppressor cell antigen, for example CD163, CD206, CD68, CDllc, CDllb, CD14, CSF1 receptor, CD15, CD33, CD66b and combinations of two or more of the same.
- one of the binding domains in the BiTE is specific to a non-TCR activating protein such as CD31, CD2 and CD277.
- one of the binding domains is specific to a surface antigen on a T cell of interest, such as selected from CD3 (such as CD3 delta, CD3 epsilon or CD3 gamma), TCR-a chain and TCR- ⁇ chain, and one binding domain is specific to a tumour antigen.
- CD3 such as CD3 delta, CD3 epsilon or CD3 gamma
- TCR-a chain and TCR- ⁇ chain one binding domain is specific to a tumour antigen.
- one of the binding domains is specific to CD3 and another binding domain is specific for a tumor antigen,f or example selected from the group consisting of: CEA, MUC- 1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3.
- a tumor antigen f or example selected from the group consisting of: CEA, MUC- 1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3.
- one of the binding domains is specific to CD3 (such as CD3 delta, CD3 epsilon or CD3 gamma) and another binding domain is specific to EpCAM.
- one of the binding domains is specific to CD3s and another binding domain is specific to EpCAM.
- one of the binding domains is specific to a surface antigen on a T cell of interest, such as selected from CD3 (such as CD3 delta, CD3 epsilon or CD3 gamma), TCR-a and TCR- ⁇ , and another binding domain is specific to a tumour stromal antigen.
- CD3 such as CD3 delta, CD3 epsilon or CD3 gamma
- TCR-a and TCR- ⁇ TCR-a and TCR- ⁇
- another binding domain is specific to a tumour stromal antigen.
- one of the binding domains is specific to CD3 (such as CD3 delta, CD3 epsilon or CD3 gamma) and another binding domain is specific to a tumour stromal antigen, for example selected from the group consisting of: fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-a receptor (PDGFR-a), platelet-derived growth factor- ⁇ receptor (PDGFR- ⁇ ) and vimentin.
- FAP fibroblast activation protein
- TREM1 TREM1
- IGFBP7 fibroblast activation protein
- FSP-1 fibroblast activation protein
- PDGFR-a platelet-derived growth factor-a receptor
- PDGFR- ⁇ platelet-derived growth factor- ⁇ receptor
- one of the binding domains is specific to CD3 (such as CD3 delta, CD3 epsilon or CD3 gamma) and another binding domain is specific to FAP.
- CD3 such as CD3 delta, CD3 epsilon or CD3 gamma
- FAP FAP
- one of the binding domains is specific to CD3s and another binding domain is specific to FAP.
- one of the binding domains is specific to a surface antigen on a T cell of interest, such as CD3, TCR-a and TCR- ⁇ and another binding domain is specific to a non-TCR activating protein.
- one of the binding domains is specific to a CD3 (such as CD3 delta, CD3 epsilon or CD3 gamma) and another binding domain is specific to a non-TCR activating protein selected from the group consisting of CD31, CD2 and CD277.
- a CD3 such as CD3 delta, CD3 epsilon or CD3 gamma
- another binding domain is specific to a non-TCR activating protein selected from the group consisting of CD31, CD2 and CD277.
- one of the binding domains is specific to CD3s and another binding domain is specific to non-TCR activating protein selected from the group consisting of CD31, CD2 and CD277.
- At least one of ⁇ or ⁇ is not a bond.
- ⁇ is not a bond.
- ⁇ is not a bond.
- both ⁇ and ⁇ are not bonds.
- the adenovirus is chimeric.
- the adenovirus is oncolytic.
- the adenovirus is chimeric and oncolytic.
- the adenovirus replication capable in one embodiment the adenovirus replication capable.
- the adenovirus is chimeric, oncolytic and replication capable.
- the adenovirus is replication competent.
- the adenovirus is chimeric, oncolytic and replication competent.
- the adenovirus is replication deficient, i.e. is a vector.
- ⁇ comprises a transgene or transgene cassette, in particular a transgene cassette encoding a BiTE according to the present disclosure.
- ⁇ comprises a transgene or transgene cassette, in particular a transgene cassette encoding a BiTE according to the present disclosure.
- ⁇ comprises a transgene or transgene cassette, in particular a transgene cassette encoding a BiTE according to the the present disclosure and ⁇ represents a bond.
- both ⁇ and ⁇ comprise a transgene or transgene cassette.
- the one or more transgenes or transgene cassettes is under the control of an endogenous or exogenous promoter, such as an endogenous promotor.
- an exogenous promoter may be advantageous in some embodiments because it can strongly and constitutively express the antibody or fragment, which may be particularly useful in some situations, for example where the patient has very pervasive cancer.
- Employing an endogenous promoter may be advantageous because it reduces the size of the transgene cassette that needs to be incorporated to express the BiTE, i.e. the cassette can be smaller because no exogenous promoter needs to be included.
- the transgene or transgene cassette is under the control of an endogenous promoter selected from the group consisting of E4 and major late promoter, in particular the major late promoter.
- an endogenous promoter in the virus may also be advantageous in a therapeutic context because the transgene is only expressed when the virus is replicating in a cancer cell as opposed to a constitutive exogenous promoter which will continually transcribe the transgene and may lead to an inappropriate concentration of the antibody or fragment.
- the transgene or transgene cassette(for example encoding a BiTE) is under the control of an exogenous promoter, such as CMV.
- an exogenous promoter such as CMV.
- the use of a constitutive exogenous promoter results in continuous transcription of the transgene which may be desirable in certain instances.
- one transgene or transgene cassette (for example encoding a BiTE) is under the control of an endogenous promoter and another transgene or transgene cassette (for example encoding a BiTE) is under the control of an exogenous promoter.
- another transgene or transgene cassette (for example encoding a BiTE) is under the control of an exogenous promoter.
- all of the transgenes or transgene cassettes (for example encoding a BiTE) in the virus is/are under the control of an endogenous promoter.
- all of the transgenes or transgene cassettes (for example encoding a BiTE) in the virus is/are under the control of an exogenous promoter.
- the transgene cassette comprises i) or ii) or iii) or iv).
- the transgene cassette comprises i) and ii), or i) and iii), or i) and iv), or ii) and iii), or ii) and iv), or iii) and iv).
- the transgene cassette comprises i) and ii) and iii), or i) and ii) and iv), or i) and iii) and iv), or ii) and iii) and iv).
- the transgene cassette comprises i) and ii) and iii) and iv).
- the transgene cassette comprises a Kozak sequence at the start of the protein (for example BiTE) coding sequence, which assists in the translation of mRNA.
- the transgene cassette encodes a high self-cleavage efficiency 2A peptide.
- the transgene cassette further comprises a polyadenylation sequence.
- the transgene cassette further comprises a restriction site at the 3'end of the DNA sequence and/or at the 5'end of the DNA sequence.
- At least one transgene cassette encodes monocistronic mRNA.
- the BiTE molecule has short half-life, for example 48 hours or less.
- the BiTE molecule is encoded in a region selected from El, E3, ⁇ , ⁇ and combinations thereof.
- the present inventors have established that a variety of transgenes can be inserted into ⁇ and/or ⁇ under the control of an exogenous or endogenous promoter, without adversely affecting the life cycle of the virus or the stability of the vector.
- the BiTE molecule is encoded at least in position ⁇ , for example under the control of the major late promoter.
- the transgene or transgene cassette allows the BiTE or any additional molecule to be expressed together with the adenovirus itself.
- the present inventors successfully demonstrated that the expression of the BiTE did not significantly affect the ability of EnAd to replicate nor negatively impact its oncolytic activity.
- the BiTE molecule is encoded at least in position ⁇ , for example under the control of the major late promoter.
- the transgene or transgene cassette allows the BiTE or any additional molecule to be expressed together with the adenovirus itself.
- the present inventors successfully demonstrated that the expression of the BiTE did not significantly affect the ability of EnAd to replicate nor negatively impact its oncolytic activity.
- the adenovirus further encodes a second BiTE.
- the first BiTE molecule is specific to a tumour antigen, for example a tumor antigen as described above
- the second BiTE molecule is specific to a tumour stromal antigen, for example a stromal antigen as described above.
- the first BiTE molecule is specific to a tumour antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HERl, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3 and the second BiTE molecule is specific to a tumour stromal antigen selected from the group consisting of: fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet- derived growth factor-a receptor (PDGFR-a), platelet-derived growth factor- ⁇ receptor (PDGFR- ⁇ ) and vimentin.
- a tumour antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HERl, HER2, HER3, HER4, PEM, A33, G
- the first BiTE molecule is specific to EpCAM and the second BiTE molecule is specific to a tumour stromal antigen selected from the group consisting of: fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-a receptor (PDGFR- a), platelet-derived growth factor- ⁇ receptor (PDGFR- ⁇ ) and vimentin.
- FAP fibroblast activation protein
- TREM1 fibroblast activation protein
- IGFBP7 fibroblast activation protein
- FSP-1 fibroblast activation protein
- PDGFR- a platelet-derived growth factor-a receptor
- PDGFR- ⁇ platelet-derived growth factor- ⁇ receptor
- the first BiTE molecule is specific to a tumour antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HERl, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3 and the second BiTE is specific to FAP.
- a tumour antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HERl, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3 and the second BiTE is specific to FAP.
- the first BiTE molecule s specific to EpCAM and the second BiTE molecule is specific to FAP.
- the first BiTE molecule is specific to a tumour antigen and the second BiTE molecule is specific to a non-TCR activating protein.
- the first BiTE molecule is specific to a tumor antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HERl, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3.
- a tumor antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HERl, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3.
- the first BiTE molecule is specific to EpCAM and the second BiTE molecule is specific to a non-TCR activating protein selected from the group consisting of: CD31, CD2 and CD277.
- the first BiTE molecule is specific to a tumour stromal antigen and the second BiTE molecule is specific to a non-TCR activating protein.
- the first BiTE molecule is specific to a tumour stromal antigen selected from the group consisting of: fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet- derived growth factor- ⁇ receptor (PDGFR-a), platelet-derived growth factor- ⁇ receptor (PDGFR- ⁇ ) and vimentin and the second BiTe molecule is specific to a non-TCR activating protein selected from the group consisting of: CD31, CD2 and CD277.
- FAP fibroblast activation protein
- TREM1 TREM1
- IGFBP7 interleukin-1
- FSP-1 platelet- derived growth factor- ⁇ receptor
- PDGFR-a platelet- derived growth factor- ⁇ receptor
- vimentin the second BiTe molecule is specific to a non-TCR activating protein selected from the group consisting of: CD31, CD2 and CD277.
- the first BiTE molecule is specific to FAP and the second BiTE molecule is specific to a non-TCR activating protein selected from the group consisting of: CD31, CD2 and CD277.
- the adenovirus only comprises one BiTE.
- the adenovirus comprises two BiTEs. In another embodiment the adenovirus comprises three BiTEs.
- the virus may also encode a 1, 2, 3 or 4 further transgenes.
- the adenovirus further encodes a cytokine or chemokine.
- the adenovirus further encodes a cytokine.
- the adenovirus further encodes a chemokine.
- the adenovirus further encodes a cytokine and a chemokine.
- the adenovirus comprises one BiTE and at least one cytokine or chemokine, for example 1, 2 or 3 cytokines, 1, 2 or 3 chemokines or a combination of 2 or 3 genes each gene independently encoding a cytokine of chemokine.
- the adenovirus comprises two BITEs and at least one cytokine or chemokine for example 1 or 2 cytokines, 1 or 2 chemokines or a combination of a cytokine and a chemokine.
- the adenovirus comprises three BiTEs and at least one cytokine or chemokine.
- the cytokine or chemokine is selected from IL-la, IL- ⁇ , IL-6, IL-9, IL- 12, IL-13, IL-17, IL-18, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-33, IL-35, IL-2, IL-4, IL-5, IL-7, IL- 10, IL-15, IL-21, IL-25, IL-1RA, IFNa, IFNp, IFNy, TNFa, lymphotoxin a (LTA) and GM-CSF, IL-8, CCL2, CCL3, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCLIO, CXCLll, CXCL13, CXCL12, CCL2, CCL19, CCL21, for example IL-12, IL-18, IL-22, IL-7, IL-15, IL-21, IFNy, TNFa, lympho
- the the encoded cytokine is selected from TNF alpha super family (TNFRSF includes TNF-alpha, TNF-C, OX40L, CD154, FasL, LIGHT, TL1A, CD70, Siva, CD153, 4-1BB ligand, TRAIL, RANKL, TWEAK, APRIL, BAFF, CAMLG, NGF, BDNF, NT-3, NT-4, GITR ligand, EDA-A, EDA-A2), TGF-beta superfamily, IL-1 family (i.e. IL-1 and IL-8), IL-2 family, IL-10 family, IL-17 family, interferon family.
- TNF alpha super family TNF alpha super family
- TNFRSF includes TNF-alpha, TNF-C, OX40L, CD154, FasL, LIGHT, TL1A, CD70, Siva, CD153, 4-1BB ligand, TRAIL, RANKL, TWEAK, A
- the chemokine is selected from the group comprising MIP-1 alpha, RANTES, IL-8, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCLIO, CXCLll, CXCL13, CXCL12, CCL2, CCL19 and CCL21.
- the adenovirus further comprises an immunomodulator, such as an antibody or antibody fragment, or protein or peptide ligand, specific to a checkpoint protein or co- stimulatory molecule, or specific binding ligands for such molecules.
- an immunomodulator such as an antibody or antibody fragment, or protein or peptide ligand, specific to a checkpoint protein or co- stimulatory molecule, or specific binding ligands for such molecules.
- the immunomodulator is an antibody or antibody fragment, or protein or peptide ligand, specific to a checkpoint protein such as CTLA-4, PD-1, PD-L1, PD-L2, VISTA, B7- H3, B7-H4, HVEM, ILT-2, ILT-3, ILT-4, TIM-3, LAG-3, BTLA, LIGHT or CD160, for example CTLA-4, PD-1, PD-L1 and PD-L2.
- a checkpoint protein such as CTLA-4, PD-1, PD-L1, PD-L2, VISTA, B7- H3, B7-H4, HVEM, ILT-2, ILT-3, ILT-4, TIM-3, LAG-3, BTLA, LIGHT or CD160, for example CTLA-4, PD-1, PD-L1 and PD-L2.
- the immunomodulator is an inhibitor, for example a checkpoint inhibitor.
- the immunomodulator is an agonist.
- the immunomodulator is an antibody or antibody fragment, or protein or peptide ligand, specific to a co-stimulatory molecule such as CD28, CD80, CD86, CD83, ICOS, B7H2, TL1A and 4-1BB.
- the adenovirus comprises a first antibody, antibody fragment, protein or peptide ligand specific to a checkpoint protein and a second antibody, antibody fragment, protein or peptide ligand specific to a co-stimulatory molecule.
- the BiTE comprises a VH domain comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 8, 13 or 18, or an amino acid sequence that is at least 95% identical thereto.
- the BiTE comprises a VL domain comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 9, 12 or 17, or an amino acid sequence that is at least 95% identical thereto.
- the BiTE comprises a scFv comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 7, 11 or 16, or an amino acid sequence that is at least 95% identical thereto.
- a BiTE employed in the present disclosure comprises a binding domain with a VH domain with a sequence shown in SEQ ID NO: 8 or a sequence at least 95% identical thereto, and a VL domain with a sequence shown in SEQ ID NO: 9 or a sequence at least 95% identical thereto.
- a BiTE employed in the present disclosure comprises a binding domain with a VH domain with a sequence shown in SEQ ID NO: 13 or a sequence at least 95% identical thereto, and a VL domain with a sequence shown in SEQ ID NO: 12 or a sequence at least 95% identical thereto.
- a BiTE employed in the present disclosure comprises a binding domain with a VH domain with a sequence shown in SEQ ID NO: 18 or a sequence at least 95% identical thereto, and a VL domain with a sequence shown in SEQ ID NO: 17 or a sequence at least 95% identical thereto.
- a BiTE employed in the present disclosure comprises a binding domain with a VH domain with a sequence shown in SEQ ID NO: 8 or a sequence at least 95% identical thereto, and a VL domain with a sequence shown in SEQ ID NO: 9 or a sequence at least 95% identical thereto, and a binding domain with a VH domain with a sequence shown in SEQ ID NO: 13 or a sequence at least 95% identical thereto, and a VL domain with a sequence shown in SEQ ID NO: 12 or a sequence at least 95% identical thereto.
- a BiTE employed in the present disclosure comprises a binding domain with a VH domain with a sequence shown in SEQ ID NO: 8 or a sequence at least 95% identical thereto, and a VL domain with a sequence shown in SEQ ID NO: 9 or a sequence at least 95% identical thereto, and a binding domain with a VH domain with a sequence shown in SEQ ID NO: 18 or a sequence at least 95% identical thereto, and a VL domain with a sequence shown in SEQ ID NO: 17 or a sequence at least 95% identical thereto.
- a BiTE employed in the present disclosure comprises a sequence shown in SEQ ID NO: 7, 11, 16 or a sequence at least 95% identical to any one of the same.
- a BiTE employed in the present disclosure (i.e encoded by the adenovirus) comprises a sequence shown in SEQ ID NO: 7 or a sequence at least 95% identical thereto.
- a BiTE employed in the present disclosure (i.e encoded by the adenovirus) comprises a sequence shown in SEQ ID NO: 11 or a sequence at least 95% identical thereto.
- a BiTE employed in the present disclosure (i.e encoded by the adenovirus) comprises a sequence shown in SEQ ID NO: 16 or a sequence at least 95% identical thereto.
- the BiTE comprises an amino acid sequence set forth in SEQ ID NOs: 2 or 4, or an amino acid sequence that is at least 95% identical thereto, for example an amino acid as set forth in SEQ ID NOs: 73 or 75.
- the adenovirus according to the present disclosure comprises a DNA sequence set forth in any one of SEQ ID NOs: 34 to 37, or a DNA acid sequence that that hybridises thereto under stringent conditions.
- the adenovirus according to the present disclosure comprises a DNA sequence set forth in any one of SEQ ID NOs: SEQ ID NOs: 79 to 82.
- the adenovirus according to the present disclosure comprises a DNA sequence shown in any one of SEQ ID NO: 34, 35, 36, 37, 79, 80, 82, 96, 97, 98, 99, 100, 101, 102, 103, 120, 298 or a sequence encoding the same virus, or a sequence that hybrises to the any one of the same under stringent conditions.
- the adenovirus according to the present disclosure comprises a DNA sequence shown in any one of SEQ ID NO: 34, 35, 36, 37, 79, 80, 82, 96, 97, 98, 99, 100, 101, 102, 103, 120 or 298.
- the C-terminal deca-His (HHHHHHHHHH SEQ ID NO: 24) affinity tag is useful for purification of the BiTE or adenovirus. However, it is optional and may be excluded for example in the end product. The skilled person would also be aware that other affinity tags other than deca-His can be used and likewise may be excluded without affecting the biological function of the BiTE or adenovirus. Accordingly, in one embodiment the BiTE comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 2 or 4 but excludes the deca-His affinity tag at the C-terminal end of the sequence, for example as set forth in SEQ ID NOs: 73 or 75.
- the adenovirus comprises a DNA sequence set forth in any one of SEQ ID NOs: 34 to 37 but excludes the deca-His affinity tag, for example a DNA sequence as set forth in any one of SEQ ID NOs: 79 to 82.
- deca-His affinity tag further extends to all other sequences disclosed herein comprising the deca-His affinity tag, i.e. the present disclosure includes the same amino acid or DNA sequences lacking the C-terminal deca-His tag (HHHHHHHHHH or CATCACCATCACCATCACCACCATCACCAT), for example as set forth in any one of SEQ ID NOs: 72 to 82.
- the BiTE encoded by the virus of the present disclosure is under the control of an exogenous promoter, for example the CMV promoter.
- the exogenonus may be placed between the MPL and the encoded transgene when the transgene is between L5 and E4 regions.
- the exogenonus may be placed between the encoded transgene and L5 when the transgene is between L5 and E3 regions.
- composition comprising an adenovirus as described herein and a diluent or carrier.
- a method of treating a patient comprising administering a therapeutically effective amount of an adenovirus or a composition as described herein.
- the method is for the treatment of cancer, for example an epithelial cancer, in particular a solid tumour.
- a method of treatment comprising administering a virus according to the present disclosure in combination with a checkpoint inhibitor (such as a PD-1 or PDL1 inhibitor), in particular wherein the checkpoint inhibitor is encoding in the virus.
- a checkpoint inhibitor such as a PD-1 or PDL1 inhibitor
- a method of treatment comprising administering a virus according to the present disclosure which is NOT in combination with a checkpoint inhibitor (for example as listed elsewhere herein such as a PD-1 or PDL1 inhibitor), in particular wherein the checkpoint inhibitor is not encoding in the virus.
- a checkpoint inhibitor for example as listed elsewhere herein such as a PD-1 or PDL1 inhibitor
- the BiTEs encoded by the virus as per the present disclosure have the ability to potentiate the cytotoxicity of the virus.
- the BiTes encoded by a virus as per the present disclosure can activate CD4+ cells and/or CD8+ cells, for example even cells in the suppressive environment of the tumor, including T cells in the fluid environment, such as ascites, of the tumor.
- the BiTes encoded by a virus as per the present disclosure can activate cytotoxic T cells, for example even T cells in the suppressive environment of the tumor, including T cells in the fluid environment, such as ascites, of the tumor.
- BiTEs encoded by a virus as per the present disclosure are capable of stimulating (activating) T cell proliferation.
- viruses encoding BiTEs according to the present disclosure seem to be able to by-pass, overcome or reverse the immune suppressive microenvironment of the tumor.
- the activation of T cells results in upregulation of a T cell marker, for example CD25.
- a binding of a BiTE in a virus according to the present disclosure is specific to a neoantigen.
- First BiTE as employed herein is a label given to one of the two BiTEs encoded by the adenovirus according to the present disclosure. It is not a reference or limitation on the location of the BiTE or the relative position of the BiTE vis-a-vis the second BiTE.
- Second BiTE as employed herein is a label given to one of the two BiTEs encoded by the adenovirus according to the present disclosure. It is not a reference or limitation on the location of the BiTE or the relative position of the BiTE vis-a-vis the first BiTE.
- Bdl and Bd2 as employed herein are nominal labels for the binding domains in the first BiTE. It is not a reference or limitation in respect of the location of orientation of the binding domains within said first BiTE.
- Bd3 and Bd4 as employed herein are nominal labels for the binding domains in the second
- antibody refers to an immunoglobulin molecule capable of specific binding to a target antigen, such as a carbohydrate, polynucleotide, lipid, polypeptide, peptide etc., via at least one antigen recognition site (also referred to as a binding site herein), located in the variable region of the immunoglobulin molecule. Unless the context indicates otherwise the term extends to full length antibodies and multi-specific antibody molecules comprising full length antibodies.
- antibody molecule includes antibodies and binding fragments thereof and multi-specific formats of any one of the same.
- Antigen binding site refers to a portion of the molecule, which comprises a pair of variable regions, in particular a cognate pair that interact specifically with the target antigen.
- binding site that only recognises the antigen to which it is specific or a binding site that has significantly higher binding affinity to the antigen to which is specific compared to affinity to antigens to which it is non-specific, for example 5, 6, 7, 8, 9, 10 times higher binding affinity.
- Binding fragments or antibody binding fragments as employed herein refer to antibody binding fragments and multi-specific antibody molecules comprising antibody binding fragments including but not limited to Fab, modified Fab, Fab', modified Fab', F(ab') 2, Fv, single domain antibodies, scFv, bi, tri or tetra-valent antibodies, Bis-scFv, diabodies, triabodies, tetrabodies and epitope-binding fragments of any of the above (see for example Holliger and Hudson, 2005, Nature Biotech. 23(9):1126-1136; Adair and Lawson, 2005, Drug Design Reviews - Online 2(3), 209-217).
- antibody fragments for use in the present disclosure include the Fab and Fab' fragments described in International patent applications WO05/003169, WO05/003170 and WO05/003171.
- Multivalent antibodies may comprise multiple specificities e.g. bispecific or may be monospecific (see for example W092/22853 and WO05/113605).
- the adenovirus comprises a multi-specific antibody molecule.
- Multi-specific antibody molecule refers to an antibody molecule which has two or more antigen binding domains, for example two (bispecific) or three (tri-specific) or four (tetra-specific) binding domains.
- Multi-specific antibody molecules of the present disclosure may be constructed from various antibody fragments such as those described above.
- a diabody is a bispecific antibody molecule composed of a non-covalent dimer of ScFv fragments
- a F(ab') 2 is a bispecific antibody molecule composed of 2 Fab fragments linked by a hinge region.
- the skilled person will therefore be aware that different antibody fragments can be arranged in various combinations in order to produce a bi- or multi-specific antibody molecule.
- tri-specific or tetra-specific antibody formats include but are not limited to Fab 3 , triabody, tetrabody, tribody, DVD-Ig, IgG-scFv, ScFv 2 -Fc, tandAbs and DNL-Fab3.
- Bi-specific antibody molecule as employed herein refers to a molecule with two antigen binding domains, which may bind the same or different antigens.
- a BiTE is a subclass of bispecific antibody molecules.
- the domains may bind different antigens.
- the domains may all bind the same antigen, including binding the same epitope on the antigen or binding different epitopes on the same antigen.
- bispecific antibody formats include but are not limited to Bispecific T cell engager (BiTE), F(ab')2, F(ab')-ScFv2, di-scFv, diabody, minibody, scFv-Fc, DART, TandAb, ScDiabody, ScDiabody-CH3, Diabody-CH3, triple body, miniantibody, minibody, TriBi minibody, ScFv-CH3 KIH (knobs in holes), Fab-ScFv, SCFv-CH-CL-scFv, scFv-KIH, Fab-scFv-Fc, Tetravalent HCAb, scDiabody-Fc, Diabody-Fc, intrabody, dock and lock antibodies, ImmTAC, HSAbody, ScDiabody-HAS, humabody and Tandem ScFv-toxic (see for example Christoph Spiess et al, Molecular Immunology 67 (2015) page 95-106).
- the adenovirus of the present disclosure comprises a BiTE which is specific for at least a surface antigen on a T cell of interest.
- T cell surface antigens include but are not limited to: CD3, CD2, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277 and CXCR3, particularly CD2, CD3, CD31 and CD277.
- Bispecific T cell Engager refers to a class of artificial bispecific monoclonal antibodies comprising 2 scFvs of different antibodies or amino acid sequences from 4 different genes on a single peptide chain of about 55 KDa.
- One of the scFvs is specific for an immune cell, such as a T cell antigen, such as the CD3 receptor, expressed on the surface of T cells.
- the other scFv typically binds to a tumour cell via a tumour-specific molecule. Accordingly, BiTEs are able to form a link between T cells and tumour cells by virtue of their specificities for an antigen on the T cell and an antigen on the tumour cell.
- BITE based therapies currently approved or undergoing clinical trials include for example Blinatumomab (Blyncyto®) which targets CD19 and is for the treatment of non-Hodkin's lymphoma and acute lymphoblastic leukemia and Solitomab which targets EpCAM and is for treating gastrointestinal and lung cancers.
- the immune cell engager (such as T cell engager) is arranged is the format VLl-linkerl-VHl-linker2-VH2-linker3-VL2, for example employing linkers independently selected from linker sequences disclosed herein, for example.
- linkers in a BiTE according to the present disclosure are independently selected from SEQ ID NO: 10, 14, 23, 124 to 162 and 166 to 297.
- linkerl and linker3 have the same sequence, for example a sequence shown in any one of SEQ ID NOs: 10, 14, 23, 124 to 162 and 166 to 296, in particular 10, 14 and 23.
- linkerl and linker3 have different amino acid sequence, for example independently selected from SEQ ID NOs: 10, 14, 23, 124 to 162 and 166 to 296, in particular 10, 14 and 23.
- Linkerl is SEQ ID NO: 10.
- Linkerl is SEQ ID NO: 14.
- Linker3 is SEQ ID NO: 10.
- Linker3 is SEQ ID NO: 14.
- Linkerl and Linker3 are SEQ ID NO: 10.
- Linkerl and Linker3 are SEQ ID NO: 14.
- Linkerl is SEQ ID NO: 10 and Linker 3 is SEQ ID NO: 14.
- Linkerl is SEQ ID NO: 14 and Linker3 is SEQ ID NO: 10.
- Linker2 is different to both Linker 1 and Linker3.
- Linker 2 is selected from any one of SEQ ID NOs: 10, 14, 23, 124 to 162 and 166 to 297, such as SEQ ID NO: 297.
- Linkerl is in the range 10 to 30 amino acids in length, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.
- Linker3 is in the range 10 and 30 amino acids in length, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.
- Linker 2 is in the range 2 to 10 amino acids in length, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10.
- VH1 & VL1 are specific to a T cell antigen according to the present disclosure, such as CD3.
- VH2 & VL2 are specific to an immune cell antigen, such as a T cell antigen, according to the present disclosure, such as CD3.
- VH1 & VL1 are specific to an antigen or interest, such as a cancer antigen or stromal antigen, etc.
- VH2 & VL2 are specific to an antigen or interest, such as a cancer antigen or stromal antigen, etc.
- Stroma or stromal antigen as employed herein refers to an antigen therapeutic target in the stroma, including expressed in the molecular structure of the stroma matrix, such as connective tissue molecules or molecules associated with this matrix or antigens associated with the cellular components of the stroma, for example expressed on fibroblasts, tumour-associated macrophages, dendritic cells, NK cells and/or T-cells which have infiltrated the stroma.
- stroma antigens include but are not limited to FAP, TGFp, TREM1, IGFBP7, FSP-1, fibroblast associated antigen, NG2, endosialin (CD248), platelet-derived growth factor-a receptor (PDGFR-a), platelet- derived growth factor- ⁇ receptor (PDGFR- ⁇ ) and vimentin.
- Fibroblasts may be targeted by employing the antigen fibroblast activation protein (FAP), in particular an antibody specific to FAP which does not bind CD26, (see US2012/0258119 incorporated herein by reference).
- FAP antigen fibroblast activation protein
- FAP was originally identified as a serine protease on reactive stromal fibroblasts. Subsequent molecular cloning revealed that FAP is identical to seprase, a 170 kDa membrane associated gelatinase that is expressed by melanoma cell lines.
- DPPIV dipeptidyl peptidase IV
- FAP and DPPIV have similar gene sizes and are chromosomally adjacent to each other at 2q24, suggesting a gene duplication event (Genebank accession number U09278). Both proteins are members of the prolyl peptidase family. This class of enzymes is inducible, active on the cell surface or in extracellular fluids, and uniquely capable of cleaving N-terminal dipeptides from polypeptides with proline or alanine in the penultimate position. DPPIV, also termed CD26, is constitutively expressed by several cell types including fibroblasts, endothelial and epithelial cells, leukocyte subsets like NK-cells, T-lymphocytes and macrophages.
- DPPIV DPPIV
- FAP is typically not expressed in normal adult tissue and its proteolytically active soluble form is termed a2-Antiplasmin Cleaving Enzyme (APCE). Marked FAP expression occurs in conditions associated with activated stroma, including wound healing, epithelial cancers, osteoarthritis, rheumatoid arthritis, cirrhosis and pulmonary fibrosis.
- the FAP structure has been solved (PDB ID 1Z68) and is very similar to that of DPPIV.
- FAP is anchored in the plasma membrane by an uncleaved signal sequence of approximately 20 amino acids and has a short, amino terminal, cytoplasmic domain of six amino acids.
- the major part of the protein, including the catalytic domain, is exposed to the extracellular environment.
- the FAP glycoprotein is a homodimer consisting of two identical 97-kDa subunits. Each FAP-monomer subunit consists of two domains, an ⁇ hydrolase domain (aa 27-53 and 493-760) and an eight-blade ⁇ propeller domain (aa 54-492) that enclose a large cavity.
- a small pocket within this cavity at the interface of both domains contains the catalytic triad (Ser624, Asp702 and His734).
- FAP gains its enzymatic activity upon homodimerization of the subunits and beside its dipeptidyl peptidase activity, FAP also has collagen type I specific gelatinase and endopeptidase activity.
- the ⁇ propeller acts as scaffolding for protein-protein interactions and determines substrate and extracellular matrix (ECM) binding. Furthermore, the ⁇ propeller is involved in forming supra-molecular complexes of FAP with other prolyl peptidases or with other membrane-bound molecules.
- heteromeric or tetrameric complexes of FAP and DPPIV were found to be associated with invadopodia of migrating cells on a collagen substrate.
- Type I collagen induces a close association of FAP with ⁇ integrins, thereby playing major organizational roles in the formation and adhesion of invadopodia.
- the involved mechanisms are not understood in detail, the formation of such proteinase-rich membrane domains at the cellular invasion front contributes to directed pericellular ECM degradation. This indicates that FAP and ECM interactions may be closely related to invasive cell behaviour by influencing cell adhesion, migration, proliferation and apoptosis through integrin pathways and supports o role of FAP in disease pathogenesis and progression.
- FAP is recognized as a multifunctional protein that executes its biological functions in a cell dependent manner through a combination of its protease activity and its ability to form complexes with other cell-surface molecules.
- Over-expression of FAP in epithelial and fibroblastic cell lines promotes malignant behaviour, pointing to the clinical situation, where cellular expression levels of FAP are correlated with worse clinical outcome.
- cancer cells activate stromal fibroblasts and induce the expression of FAP, which in turn, affects the proliferation, invasion and migration of the cancer cells.
- TGF- ⁇ is the dominant factor in promoting FAP protein expression (Chen, H et al (2009) Exp and Molec Pathology, doi: 10.1016/j.yexmp. 2009.09.001).
- FAP is heavily expressed on reactive stromal fibroblasts in 90% of human epithelial carcinomas, including those of the breast, lung, colorectum and ovary (Garin-Chesa, P et al (1990) PNAS USA 87: 7236-7239).
- FAP may be targeted by binding said antigen and sterically blocking its interaction with biologically relevant molecules.
- cross-linking the FAP molecule with another FAP molecule or a different molecule, for example an antigen on the surface of a cancer cell may be achieved employing a multispecific, such as a bispecific antibody molecule. This cross linking raised the visibility of the cells bearing the antigens to the immune systems, which then may be activated to neutral or destroy the same.
- Tumour associated macrophages are thought to express TREM1, CD204, CD68 (alone or in combination with CD163 or CD206). These markers can be used to target the TAMs.
- the adenovirus of the present disclosure has the ability to infect tumour cells, and in particular is chosen to preferentially infect tumour, cells.
- the oncolytic virus infection causes death and lysis of the cancer cell with release of newly generated virus particles.
- Incorporated transgenes encoding antibodies, BiTEs and other "payloads" are newly synthesized and actively secreted by the tumor cells prior to their death, and some molecules will also be released upon cell lysis.
- Antibody molecules with a short half-life may be particularly suitable for use in the present disclosure because this minimises off-target effects because the body rapidly clears the molecules if they become systemically available.
- NKT cells have the ability to target and destroy tumour associated macrophages. However, their activity seems to be inhibited by the hypoxic environment of the tumour. This activity can be restored by providing the NKT cells with IL-2 and/or IL-15, for example encoded in the virus of the present disclosure.
- the virus according to the present disclosure further encodes a cytokine to activate and NKT cells, for example selected from IL-2, IL-15 and combinations thereof.
- the gene encoding the cytokine may be in the same location or a different location to the gene encoding the antibody molecule, for example independently selected from El, E3, E4, ⁇ and ⁇ .
- the adenovirus according to the present disclosure has at least two or three mechanisms for attacking the tumour, including indirect mechanisms which undermine the tumour stroma.
- Transgene as employed herein refers to a gene that has been inserted into the genome sequence, which is a gene that is unnatural to the virus (exogenous) or not normally found in that particular location in the virus. Examples of transgenes are given below. Transgene as employed herein also includes a functional fragment of the gene that is a portion of the gene which when inserted is suitable to perform the function or most of the function of the full-length gene.
- Transgene and coding sequence are used interchangeably herein in the context of inserts into the viral genome, unless the context indicates otherwise.
- Coding sequence as employed herein means, for example a DNA sequence encoding a functional RNA, peptide, polypeptide or protein.
- the coding sequence is cDNA for the transgene that encodes the functional RNA, peptide, polypeptide or protein of interest.
- Functional RNA, peptides, polypeptide and proteins of interest are described below.
- virus genome contains coding sequences of DNA. Endogenous (naturally occurring genes) in the genomic sequence of the virus are not considered a transgene, within the context of the present specification unless then have been modified by recombinant techniques such as that they are in a non-natural location or in a non-natural environment.
- transgene refers to a segment of DNA containing a gene or cDNA sequence that has been isolated from one organism and is introduced into a different organism i.e. the virus of the present disclosure.
- this non-native segment of DNA may retain the ability to produce functional RNA, peptide, polypeptide or protein.
- the transgene inserted encodes a human or humanised protein, polypeptide or peptide.
- the transgene inserted encodes a non-human protein, polypeptide or peptide (such as a non-human mammalian protein, polypeptide or peptide) or RNA molecule, for example from a mouse, rat, rabbit, camel, llama or similar.
- the viruses of the present disclosure allow the transgenes to be transported inside the cancerous cell.
- responses generated by the human patient to a non-human sequence can be minimised by this intra-cellular delivery.
- a DNA sequence may comprise more than one transgene, for example, 1, 2, 3 or 4 transgenes, such as 1 or 2.
- a transgene cassette may comprise more than one transgene, for example, 1, 2, 3 or 4 transgenes, such as 1 or 2.
- the cassette is arranged as shown in the one or more of the
- Transgene cassette as employed herein refers to a DNA sequence encoding one or more transgenes in the form of one or more coding sequences and one or more regulatory elements.
- a transgene cassette may encode one or more monocistronic and/or polycistronic mRNA sequences.
- the transgene or transgene cassette encodes a monocistronic or polycistronic mRNA, and for example the cassette is suitable for insertion into the adenovirus genome at a location under the control of an endogenous promoter or exogenous promoter or a combination thereof.
- Monocistronic mRNA as employed herein refers to an mRNA molecule encoding a single functional RNA, peptide, polypeptide or protein.
- the transgene cassette encodes monocistronic mRNA.
- the transgene cassette in the context of a cassette encoding monocistronic mRNA means a segment of DNA optionally containing an exogenous promoter (which is a regulatory sequence that will determine where and when the transgene is active) or a splice site (which is a regulatory sequence determining when a mRNA molecule will be cleaved by the spliceosome) a coding sequence (i.e. the transgene), usually derived from the cDNA for the protein of interest, optionally containing a polyA signal sequence and a terminator sequence.
- an exogenous promoter which is a regulatory sequence that will determine where and when the transgene is active
- a splice site which is a regulatory sequence determining when a mRNA molecule will be cleaved by the spliceosome
- a coding sequence i.e. the transgene
- the transgene cassette may encode one or more polycistronic mRNA sequences.
- Polycistronic mRNA as employed herein refers to an mRNA molecule encoding two or more functional RNA, peptides or proteins or a combination thereof.
- the transgene cassette encodes a polycistronic mRNA.
- transgene cassette in the context of a cassette encoding polycistronic mRNA includes a segment of DNA optionally containing an exogenous promoter (which is a regulatory sequence that will determine where and when the transgene is active) or a splice site (which is a regulatory sequence determining when a mRNA molecule will be cleaved by the spliceosome) two or more coding sequences (i.e. the transgenes), usually derived from the cDNA for the protein or peptide of interest, for example wherein each coding sequence is separated by either an IRES or a 2A peptide.
- the cassette may optionally contain a polyA sequence and a terminator sequence.
- the transgene cassette encodes a monocistronic mRNA followed by a polycistronic mRNA. In another embodiment the transgene cassette a polycistronic mRNA followed by a monocistronic mRNA.
- the adenovirus is a human adenovirus.
- “Adenovirus”, “serotype” or adenoviral serotype” as employed herein refers to any adenovirus that can be assigned to any of the over 50 currently known adenoviral serotypes, which are classified into subgroups A-F, and further extends to any, as yet, unidentified or unclassified adenoviral serotypes. See, for example, Strauss, "Adenovirus infections in humans," in The Adenoviruses, Ginsberg, ea., Plenum Press, New York, NY, pp.
- the adenoviruses of the present disclosure are subgroup B virues, namely, Adll, in particular Adllp (the Slobitski strain) and derivatives thereof, such as EnAd.
- Adenoviruses are designated to their groups/serotypes based on the capsid, such as the hexon and/or fibre
- the adenovirus of the present disclosure is not a group A, C, D, E or F virus.
- the viruses of the present disclosure do not comprise an adenovirus death protein.
- the adenovirus of the present disclosure is chimeric.
- an adenovirus is chimeric then the characteristics of the outer capsid will be employed to determine the serotype.
- Chimeric as employed herein refers to a virus that comprises DNA from at least two different virus serotypes, including different serotypes within the same group.
- the oncolytic virus has a fibre, hexon and penton proteins from the same serotype, for example Adll, in particular Adllp, for example found at positions 30812-31789, 18254-21100 and 13682-15367 of the genomic sequence of the latter wherein the nucleotide positions are relative to genbank ID 217307399 (accession number: GC689208).
- Adll hexon and penton proteins from the same serotype
- Adllp for example found at positions 30812-31789, 18254-21100 and 13682-15367 of the genomic sequence of the latter wherein the nucleotide positions are relative to genbank ID 217307399 (accession number: GC689208).
- the adenovirus is enadenotucirev (also known as EnAd and formerly as
- Enadenotucirev refers the chimeric adenovirus of SEQ ID NO: 38. It is a replication competent oncolytic chimeric adenovirus which has enhanced therapeutic properties compared to wild type adenoviruses (see WO2005/118825).
- EnAd has a chimeric E2B region, which features DNA from Adllp and Ad3, and deletions in E3/E4. The structural changes in enadenotucirev result in a genome that is approximately 3.5kb smaller than Adllp thereby providing additional "space" for the insertion of transgenes.
- Enadenotucirev is a chimeric oncolytic adenovirus, formerly known as EnAd (WO2005/118825), with fibre, penton and hexon from Adllp, hence it is a subgroup B virus. It has a chimeric E2B region, which comprises DNA from Adllp and Ad3. Almost all of the E3 region and part of the E4 region is deleted in EnAd. Therefore, it has significant space in the genome to accommodate additional genetic material whilst remaining viable. Furthermore, because EnAd is a subgroup B adenovirus, pre-existing immunity in humans is less common than, for example, Ad5. Other examples of chimeric oncolytic viruses with Adll fibre, penton and hexon include OvAdl and OvAd2 (see WO2006/060314).
- EnAd seems to preferentially infect tumour cells, replicates rapidly in these cells and causes cell lysis. This, in turn, can generate inflammatory immune responses thereby stimulating the body to also fight the cancer. Part of the success of EnAd is hypothesised to be related to the fast replication of the virus in vivo.
- EnAd selectively lyses tumour cells
- transgenes such as a transgene which encodes a cell signalling protein or an antibody, or a transgene which encodes an entity which stimulates a cell signalling protein(s).
- Advantageously arming a virus, with DNA encoding certain proteins, such as a BiTE, that can be expressed inside the cancer cell may enable the body's own defences to be employed to combat tumour cells more effectively, for example by making the cells more visible to the immune system or by delivering a therapeutic gene/protein preferentially to target tumour cells.
- transgenes that are reporters into the genome can aid clinical or pre-clinical studies.
- transgenes It is important that expression of the transgenes does not adversely affect the replication or other advantageous properties of the virus. Thus, the gene or genes must be inserted in a location that does not compromise the replication competence and other advantageous properties of the virus.
- the genome of adenoviruses is tightly packed and therefore it can be difficult to find a suitable location to insert transgenes. This also limits the size of transgenes that can be accommodated.
- OvAdl and OvAd2 are also chimeric adenoviruses similar to enadenotucirev, which also have additional "space” in the genome (see WO2008/080003).
- the adenovirus is OvAdl or OvAd2.
- the adenovirus is oncolytic.
- Oncolytic adenovirus as employed herein means an adenovirus that preferentially kills cancer cells as compared with non-cancer cells.
- the oncolytic virus is apoptotic. That is, it hastens programmed cell death.
- the oncolytic virus is cytolytic.
- the cytolytic activity of oncolytic adenoviruses of the disclosure can be determined in representative tumour cell lines and the data converted to a measurement of potency, for example with an adenovirus belonging to subgroup C, such as Ad5, being used as a standard (i.e. given a potency of 1).
- a suitable method for determining cytolytic activity is an MTS assay (see Example 4, Figure 2 of WO2005/118825 incorporated herein by reference).
- the oncolytic virus is necrolytic. That is, it causes or hastens cell necrosis or immunogenic cell death. In one embodiment necrolytic cell death is advantageous because it triggers, induces the patients (host) immune responses.
- adenovirus refers to a replication capable virus (such as a replication competent virus) and also replication deficient viral vectors.
- Replication capable as employed herein refers to a replication competent virus or a virus whose replication is dependent on a factor in the cancer cells, for example an upregulated factor, such as p53 or similar.
- the virus is replication competent.
- Replication competent in the context of the present specification refers to a virus that possesses all the necessary machinery to replicate in cells in vitro and in vivo, i.e. without the assistance of a packaging cell line.
- a viral vector for example deleted in the El region, capable of replicating in a complementary packaging cell line is not a replication competent virus in the present context.
- Viral vectors are replication deficient and require a packaging cell to provide a complementary gene to allow replication.
- Adenovirus genome as employed herein means the DNA sequence encoding the structural proteins and elements relevant to the function/life cycle of an adenovirus.
- the viral genome contains five early transcription units (E1A, E1B, E2, E3, and E4), three delayed early units (IX, IVa2 and E2 late) and one late unit (major late) that is processed to generate five families of late mRNAs (L1-L5).
- E1A, E1B, E2, E3, and E4 the early transcription units
- IX, IVa2 and E2 late the delayed early units
- L1-L5 late unit
- Proteins encoded by the early genes are primarily involved in replication and modulation of the host cell response to infection, whereas the late genes encode viral structural proteins.
- Early genes are prefixed by the letter E and the late genes are prefixed by the letter L.
- the genome of adenoviruses is tightly packed, that is, there is little non-coding sequence, and therefore it can be difficult to find a suitable location to insert transgenes.
- the present inventors have identified two DNA regions where transgenes are tolerated, in particular the sites identified are suitable for accommodating complicated transgenes, such as those encoding antibodies. That is, the transgene is expressed without adversely affecting the virus' viability, native properties such as oncolytic properties or replication.
- the oncolytic or partial oncolytic virus according to the disclosure may be as a result of deletion in the E4 and/or E3 region, for example deleted in part of the E4 region or fully deleted in the E3 region, or alternatively deleted in part of the E4 region (such as E4orf4) and fully deleted in the E3 region, for example as exemplified in the sequences disclosed herein.
- the oncolytic virus of the disclosure is chimeric.
- Chimeric as employed herein refers to virus that comprises DNA from two or more different serotypes and has oncolytic virus properties.
- the oncolytic virus is EnAd or an active derivate thereof which retains the essential beneficial properties of the virus.
- EnAd is disclosed in WO2005/118825 (incorporated herein by reference) and the full sequence for the virus is provided herein SEQ ID NO: 38.
- the chimeric E2B region is disclosed herein as SEQ ID NO: 71.
- OvAdl and OvAd2 are respectively disclosed as SEQ ID NO: 2 and 3 in WO2008/080003 and incorporated herein by reference.
- the adenoviruses of the present disclosure exhibit similar virus activity, for example replication and/or infectivity, profiles to EnAd following infection of a variety of different colon cancer cell lines in vitro.
- the present disclosure also relates to the novel sequences of viruses or viral components/constructs, such as plasmids, disclosed herein.
- the adenovirus comprises a genome comprising the sequence of formula
- B ⁇ comprises EIA, EIB or E1A-E1B;
- B A comprises E2B-L1-L2-L3-E2A-L4;
- B2 is a bond or comprises E3;
- ⁇ is a bond or a DNA sequence comprising a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an exogenous promoter) or both;
- Bg comprises L5;
- ⁇ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an endogenous promoter, such as the MPL or under the control of an exogenous promoter, such as the CMV promoter) or both;
- B3 is a bond or comprises E4; wherein at least one of ⁇ and ⁇ is not a bond and comprises a trans
- the adenovirus comprises a genome comprising the sequence of formula
- the adenovirus comprises a genome comprising the sequence of formula
- B A comprises E2B-L1-L2-L3-E2A-L4;
- B2 is a bond or comprises E3;
- ⁇ is a bond or a DNA sequence comprising a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an exogenous promoter) or both;
- Bg comprises L5;
- ⁇ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an endogenous promoter, such as the MPL or under the control of an exogenous promoter, such as the CMV promoter) or both;
- B3 is a bond or comprises E4; wherein at least one of ⁇ and ⁇ is not a bond and at least one comprises a transgene or a restriction site, such as a transgene.
- the adenovirus comprises a genome comprising the sequence of formula (la) whereinBx is a bond.
- the adenovirus comprises a genome comprising the sequence of formula (la) wherein ⁇ is a bond.
- the adenovirus comprises a genome comprising the sequence of formula
- B A comprises E2B-L1-L2-L3-E2A-L4;
- ⁇ is a bond or a DNA sequence comprising a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an exogenous promoter) or both;
- Bg comprises L5;
- ⁇ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an endogenous promoter, such as the MPL or under the control of an exogenous promoter, such as the CMV promoter) or both;
- B3 is a bond or comprises E4; wherein at least one of ⁇ and By is not a bond and comprises a transgene or a restriction site or both, such as a transgene.
- the adenovirus comprises a genome comprising the sequence of formula (lb) whereinBx is a bond.
- the adenovirus comprises a genome comprising the sequence of formula (lb) wherein By is a bond.
- the adenovirus comprises a genome comprising the sequence of formula
- B ⁇ comprises E2B-L1-L2-L3-E2A-L4;
- B 2 is E3;
- ⁇ is a bond or a DNA sequence comprising a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an exogenous promoter) or both;
- Bg comprises L5;
- By is a bond or a DNA sequence comprising: a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an endogenous promoter, such as the MPL or under the control of an exogenous promoter, such as the CMV promoter) or both; wherein at least one of ⁇ and By is not a bond and comprises a transgene or a restriction site or both, such as a transgene.
- the adenovirus comprises a genome comprising the sequence of formula (Ic) wherein ⁇ is a bond.
- the adenovirus comprises a genome comprising the sequence of formula (Ic) whereinBy is a bond.
- B ⁇ comprises E1A, E1B or E1A-E1B;
- B ⁇ comprises E2B-L1-L2-L3-E2A-L4;
- ⁇ is a bond or a DNA sequence comprising a restriction site, one or more transgenes (in particular a transgene encoding at least one BiTE according to the present disclosure, for example under the control of an exogenous promoter) or both;
- Bg comprises L5;
- B3 is a bond or comprises E4; wherein at least one of ⁇ and By is not a bond and comprises a transgene a restriction site or both.
- the adenovirus comprises a genome comprising the sequence of formula (Id) whereinBy is a bond.
- the adenovirus comprises a genome comprising the sequence of formula (Ie):
- ⁇ is a bond or a DNA sequence comprising: one or more transgenesencoding at least one BiTE according to the present disclosure (for example under the control of an endogenous promoter, such as the MPL or under the control of an exogenous promoter, such as the CMV promoter); wherein at least one of ⁇ and ⁇ is not a bond and comprises a transgene a restriction site or both.
- ⁇ and ⁇ is not a bond and comprises a transgene a restriction site or both, such as ⁇ and
- ⁇ are both a transgene.
- formula (I), (la), (lb), (Ic) or (Id) only ⁇ encodes one or two BiTEs, for example one BiTE (and ⁇ does not encode a BiTE), in particular said BiTE or BiTEs are under the control of an exogenous promoter, such as the CMV promoter.
- said BiTE or BiTEs are under the control of an endogenous promoter, such as the MPL or under the control of an exogenous promoter, such as a CMV promoter.
- ⁇ encodes a BiTE (for example under the control of an exogenous promoter such as a CMV promoter) and ⁇ encodes a BiTE (for example under the control of an endogenous promoter, such as the MPL or under the control of an exogenous promoter such as a CMV promoter).
- a bond refers to a covalent bond connecting one DNA sequence to another DNA sequence, for example connecting one section of the virus genome to another.
- a variable in formula (I) (la), (lb), (Ic), (Id) or (Ie) herein represents a bond the feature or element represented by the bond is absent i.e. deleted.
- adenoviruses As the structure of adenoviruses is, in general, similar the elements below are discussed in terms of the structural elements and the commonly used nomenclature referring thereto, which are known to the skilled person.
- an element When an element is referred to herein then we refer to the DNA sequence encoding the element or a DNA sequence encoding the same structural protein of the element in an adenovirus. The latter is relevant because of the redundancy of the DNA code. The viruses' preference for codon usage may need to be considered for optimised results.
- Any structural element from an adenovirus employed in the viruses of the present disclosure may comprise or consist of the natural sequence or may have similarity over the given length of at least 95%, such as 96%, 97%, 98%, 99% or 100%.
- the original sequence may be modified to omit 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the genetic material.
- the skilled person is aware that when making changes the reading frames of the virus must be not disrupted such that the expression of structural proteins is disrupted.
- the given element is a full-length sequence i.e. the full-length gene. In one embodiment the given element is less than a full-length and retains the same or corresponding function as the full-length sequence.
- the DNA sequence may be less than a full-length and have no functionality.
- the structural genes encoding structural or functional proteins of the adenovirus are generally linked by non-coding regions of DNA.
- the genomic sequence of the structural element of interest especially non-coding regions thereof
- the element will be considered a structural element of reference to the extent that it is fit for purpose and does not encode extraneous material.
- the gene will be associated with suitable non-coding regions, for example as found in the natural structure of the virus.
- an insert such as DNA encoding a restriction site and/or transgene, is inserted into a non-coding region of genomic virus DNA, such as an intron or intergenic sequence.
- genomic virus DNA such as an intron or intergenic sequence.
- Having said this some non-coding regions of adenovirus may have a function, for example in alternative splicing, transcription regulation or translation regulation, and this may need to be taken into consideration.
- the sites identified herein, that are associated with the L5 region are suitable for accommodating a variety of DNA sequences encoding complex entities such as RNAi, cytokines, single chain or multimeric proteins, such as antibodies, such as a ⁇ .
- Gene as employed herein refers to coding and any non-coding sequences associated therewith, for example introns and associated exons.
- a gene comprises or consists of only essential structural components, for example coding region.
- ITR Inverted Terminal Repeat
- the 5'ITR as employed herein refers to part or all of an ITR from the 5' end of an adenovirus, which retains the function of the ITR when incorporated into an adenovirus in an appropriate location.
- the 5'ITR comprises or consists of the sequence from about lbp to 138bp of SEQ ID NO: 38 or a sequence 90, 95, 96, 97, 98 or 99% identical thereto along the whole length, in particular the sequence consisting of from about lbp to 138bp of SEQ ID NO: 38.
- the 3'ITR as employed herein refers to part or all of an ITR from 3' end of an adenovirus which retains the function of the ITR when incorporated into an adenovirus in an appropriate location.
- the 3'ITR comprises or consists of the sequence from about 32189bp to 32326bp of SEQ ID NO: 38 or a sequence 90, 95, 96, 97, 98 or 99% identical thereto along the whole length, in particular the sequence consisting of from about 32189bp to 32326bp of SEQ ID NO: 38.
- E1A refers to the DNA sequence encoding: part or all of an E1A from an adenovirus, part or all of the E1B region of an adenovirus, and independently part or all of E1A and
- E1B region of an adenovirus E1B region of an adenovirus.
- B ⁇ is a bond then E1A and E1B sequences will be omitted from the virus.
- B ⁇ is a bond and thus the virus is a vector.
- EIA as employed herein refers to the DNA sequence encoding part or all of an adenovirus
- EIA region The latter here is referring to the polypeptide/protein EIA. It may be mutated such that the protein encoded by the EIA gene has conservative or non-conservative amino acid changes, such that it has: the same function as wild-type (i.e. the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein; or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
- E1B refers to the DNA sequence encoding part or all of an adenovirus E1B region (i.e. polypeptide or protein), it maybe mutated such that the protein encoded by the E1B gene/region has conservative or non-conservative amino acid changes, such that it has: the same function as wild-type (i.e. the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein; or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
- B ⁇ can be modified or unmodified relative to a wild-type El region, such as a wild-type EIA and/or E1B.
- a wild-type EIA and/or E1B can easily identify whether EIA and/or E1B are present or
- Wild-type as employed herein refers to a known adenovirus.
- a known adenovirus is one that has been identified and named, regardless of whether the sequence is available.
- B ⁇ has the sequence from 139bp to 3932bp of SEQ ID NO: 38.
- B ⁇ refers to the DNA sequence encoding the E2B-L1-L2-L3-E2A-L4 regions including any non-coding sequences, as appropriate. Generally this sequence will not comprise a transgene. In one embodiment the sequence is substantially similar or identical to a contiguous sequence from a known adenovirus, for example a serotype shown in Table 1, in particular a group B virus, for example Ad3, Ad7, Adll, Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll or a combination thereof. In one embodiment is E2B-L1-
- L2-L3-E2A-L4 refers to comprising these elements and other structural elements associated with the region, for example B ⁇ will generally include the sequence encoding the protein IV2a, for example as follows: IV2A IV2a-E2B-Ll-L2-L3-E2A-L4
- the E2B region is chimeric. That is, comprises DNA sequences from two or more different adenoviral serotypes, for example from Ad3 and Adll, such as Adllp.
- Ad3 adenoviral serotypes
- Adllp Adllp
- the E2B region has the sequence from 5068bp to 10355bp of SEQ ID NO: 38 or a sequence 95%, 96%, 97%, 98% or 99% identical thereto over the whole length.
- E2B in component B ⁇ comprises the sequences shown in SEQ ID NO:
- B ⁇ has the sequence from 3933bp to 27184bp of SEQ ID NO: 38.
- E3 refers to the DNA sequence encoding part or all of an adenovirus E3 region (i.e. protein/polypeptide), it may be mutated such that the protein encoded by the E3 gene has conservative or non-conservative amino acid changes, such that it has the same function as wild- type (the corresponding unmutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein or has a new function in comparison to wild-type protein or a combination of the same, as appropriate.
- the E3 region is form an adenovirus serotype given in Table 1 or a combination thereof, in particular a group B serotype, for example Ad3, Ad7, Adl l (in particular Adl lp), Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll (in particular Adllp) or a combination thereof.
- Ad3, Ad7, Adl l in particular Adl lp
- Adl4 Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll (in particular Adllp) or a combination thereof.
- the E3 region is partially deleted, for example is 95%, 90%, 85%, 80%,
- B2 is a bond, wherein the DNA encoding the E3 region is absent.
- the DNA encoding the E3 region can be replaced or interrupted by a transgene.
- E3 region replaced by a transgene as employed herein includes part or all of the E3 region is replaced with a transgene.
- the B2 region comprises the sequence from 27185bp to 28165bp of SEQ
- B2 consists of the sequence from 27185bp to 28165bp of SEQ ID NO: 38.
- ⁇ refers to the DNA sequence in the vicinity of the 5' end of the L5 gene in Bg. In the vicinity of or proximal to the 5' end of the L5 gene as employed herein refers to: adjacent
- ⁇ is joined directly to a base of L5 which represents, for example the start of a coding sequence of the L5 gene.
- ⁇ is joined directly to a base of L5 which represents, for example the start of a non-coding sequence, or joined directly to a non-coding region naturally associated with L5.
- a non-coding region naturally associated L5 as employed herein refers to part of all of a non-coding regions which is part of the L5 gene or contiguous therewith but not part of another gene.
- ⁇ comprises the sequence of SEQ ID NO: 39.
- This sequence is an artificial non-coding sequence wherein a DNA sequence, for example comprising a transgene (or transgene cassette), a restriction site or a combination thereof may be inserted therein.
- This sequence is advantageous because it acts as a buffer in that allows some flexibility on the exact location of the transgene whilst minimising the disruptive effects on virus stability and viability.
- the insert(s) can occur anywhere within SEQ ID NO: 39 from the 5' end, the 3' end or at any point between bp 1 to 201, for example between base pairs 1/2, 2/3, 3/4, 4/5, 5/6, 6/7, 7/8, 8/9, 9/10, 10/11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19, 19/20, 20/21, 21/22,
- ⁇ comprises SEQ ID NO: 39 with a DNA sequence inserted between bp
- the insert is a restriction site insert. In one embodiment the restriction site insert comprises one or two restriction sites. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site. In one embodiment the restriction site insert comprises one or two restriction sites and at least one transgene, for example one or two transgenes. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites and at least one transgene, for example one or two transgenes. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site and at least one transgene, for example one, two or three transgenes, such as one or two.
- two restriction sites sandwich one or more, such as two transgenes (for example in a transgene cassette).
- ⁇ comprises two restrictions sites the said restriction sites are different from each other.
- said one or more restrictions sites in ⁇ are non-naturally occurring in the particular adenovirus genome into which they have been inserted.
- said one or more restrictions sites in ⁇ are different to other restrictions sites located elsewhere in the adenovirus genome, for example different to naturally occurring restrictions sites and/or restriction sites introduced into other parts of the genome, such as a restriction site introduced into ⁇ .
- the restriction site or sites allow the DNA in the section to be cut specifically.
- Cut specifically as employed herein refers to where use of an enzyme specific to the restriction sites cuts the virus only in the desired location, usually one location, although occasionally it may be a pair of locations.
- a pair of locations as employed herein refers to two restrictions sites in proximity of each other that are designed to be cut by the same enzyme (i.e. cannot be differentiated from each other).
- restriction site insert is SEQ ID NO: 50.
- ⁇ has the sequence from 28166bp to 28366bp of SEQ ID NO: 38. In one embodiment ⁇ is a bond.
- ⁇ comprises a restriction site, for example 1, 2, 3 or 4 restriction sites, such as 1 or 2.
- ⁇ comprises at least one transgene, for example 1 or 2 transgenes.
- ⁇ comprises at least one transgene, for example 1 or 2 transgenes and one or more restriction sites, for example 2 or 3 restriction sites, in particular where the restrict sites sandwich a gene or the DNA sequence comprising the genes to allow it/them to be specifically excised from the genome and/or replaced.
- the restriction sites may sandwich each gene, for example when there are two transgenes three different restriction sites are required to ensure that the genes can be selectively excised and/or replaced.
- one or more, for example all the transgenes are in the form a transgene cassette.
- ⁇ comprises SEQ ID NO: 39.
- SEQ ID NO: 39 is interrupted, for example by a transgene.
- SEQ ID NO: 39 is uninterrupted.
- ⁇ does not comprise a restriction site.
- ⁇ is a bond.
- Bx comprises or consists of one or more transgenes.
- ⁇ comprises a restriction site, for example 1, 2, 3 or 4 restriction sites, such as 1 or 2.
- ⁇ comprises at least one transgene, for example 1 or 2 transgenes.
- ⁇ comprises at least one transgene, for example 1 or 2 transgenes and one or more restriction sites, for example 2 or 3 restriction sites, in particular where the restrict sites sandwich a gene or the DNA sequence comprising the genes to allow it/them to be specifically excised from the genome and/or replaced.
- the restriction sites may sandwich each gene, for example when there are two transgenes three different restriction sites are required to ensure that the genes can be selectively excised and/or replaced.
- one or more, for example all the transgenes are in the form a transgene cassette.
- ⁇ comprises SEQ ID NO: 40.
- SEQ ID NO: 40 is interrupted, for example by a transgene.
- SEQ ID NO: 40 is uninterrupted.
- ⁇ does not comprise a restriction site.
- ⁇ is a bond.
- ⁇ comprises or consists of one or more transgenes.
- ⁇ and ⁇ each comprises a restriction site, for example 1, 2, 3 or 4 restriction sites, such as 1 or 2.
- ⁇ and ⁇ each comprises at least one transgene, for example 1 or 2 transgenes.
- ⁇ and ⁇ each comprises at least one transgene, for example 1 or 2 transgenes and one or more restriction sites, for example 2 or 3 restriction sites, in particular where the restriction sites sandwich a gene or the DNA sequence comprising the genes to allow it to be specifically excised from the genome and/or replaced.
- the restriction sites may sandwich each gene, for example when there are two transgenes three different restriction sites are required to ensure that the genes can be selectively excised and/or replaced.
- one or more, for example all the transgenes are in the form a transgene cassette.
- ⁇ and ⁇ comprises SEQ ID NO: 39 and SEQ ID NO: 40 respectively.
- ⁇ and ⁇ do not comprise a restriction site.
- ⁇ is a bond and ⁇ is not a bond.
- ⁇ is a bond and ⁇ is not a bond.
- Bg refers to the DNA sequence encoding the L5 region.
- the L5 region refers to the DNA sequence containing the gene encoding the fibre polypeptide/protein, as appropriate in the context.
- the fibre gene/region encodes the fibre protein which is a major capsid component of adenoviruses. The fibre functions in receptor recognition and contributes to the adenovirus' ability to selectively bind and infect cells.
- the fibre can be from any adenovirus strain of serotype 11, such as Adllp.
- Bg has the sequence from 28367bp to 29344bp of SEQ ID NO: 38.
- DNA sequence in relation to ⁇ refers to the DNA sequence in the vicinity of the 3' end of the L5 gene of Bg. In the vicinity of or proximal to the 3' end of the L5 gene as employed herein refers to: adjacent (contiguous) to the 3' end of the L5 gene or a non-coding region inherently associated therewith i.e. abutting or contiguous to the 3' prime end of the L5 gene or a non-coding region inherently associated therewith (i.e. all or part of an non-coding sequence endogenous to L5). Alternatively, in the vicinity of or proximal to may refer to being close the L5 gene, such that there are no coding sequences between the ⁇ region and the 3' end of the L5 gene.
- ⁇ is joined directly to a base of L5 which represents the "end" of a coding sequence.
- ⁇ is joined directly to a base of L5 which represents the "end" of a non-coding sequence, or joined directly to a non-coding region naturally associated with L5.
- ⁇ comprises the sequence of SEQ ID NO: 40.
- This sequence is a non-coding sequence wherein a DNA sequence, for example comprising a transgene (or transgene cassette), a restriction site or a combination thereof may be inserted.
- This sequence is advantageous because it acts a buffer in that allows some flexibility on the exact location of the transgene whilst minimising the disruptive effects on virus stability and viability.
- the insert(s) can occur anywhere within SEQ ID NO: 40 from the 5' end, the 3' end or at any point between bp 1 to 35, for example between base pairs 1/2, 2/3, 3/4, 4/5, 5/6, 6/7, 7/8, 8/9, 9/10, 10/11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19, 19/20, 20/21, 21/22,
- ⁇ comprises SEQ ID NO: 40 with a DNA sequence inserted between positions bp 12 and 13 or a place corresponding to 29356bp and 29357bp in SEQ ID NO: 38.
- the insert is a restriction site insert.
- the restriction site insert comprises one or two restriction sites.
- the restriction site is a 19bp restriction site insert comprising 2 restriction sites.
- the restriction site insert is a 9bp restriction site insert comprising 1 restriction site.
- the restriction site insert comprises one or two restriction sites and at least one transgene, for example one or two or three transgenes, such as one or two transgenes.
- the restriction site is a 19bp restriction site insert comprising 2 restriction sites and at least one transgene, for example one or two transgenes.
- the restriction site insert is a 9bp restriction site insert comprising 1 restriction site and at least one transgene, for example one or two transgenes.
- two restriction sites sandwich one or more, such as two transgenes (for example in a transgene cassette).
- ⁇ comprises two restrictions sites the said restriction sites are different from each other.
- said one or more restrictions sites in ⁇ are non-naturally occurring (such as unique) in the particular adenovirus genome into which they have been inserted.
- said one or more restrictions sites in ⁇ are different to other restrictions sites located elsewhere in the adenovirus genome, for example different to naturally occurring restrictions sites or restriction sites introduced into other parts of the genome, such as ⁇ .
- the restriction site or sites allow the DNA in the section to be cut specifically.
- the restriction site insert is SEQ ID NO: 51.
- ⁇ has the sequence from 29345bp to 29379bp of SEQ ID NO: 38.
- ⁇ is a bond
- the insert is after bp 12 in SEQ ID NO: 40.
- the insert is at about position 29356bp of SEQ ID NO: 38.
- the insert is a transgene cassette comprising one or more transgenes, for example 1, 2 or 3, such as 1 or 2.
- E4 refers to the DNA sequence encoding part or all of an adenovirus E4 region (i.e. polypeptide/protein region), which may be mutated such that the protein encoded by the E4 gene has conservative or non-conservative amino acid changes, and has the same function as wild-type (the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
- the E4 region has E4orf4 deleted.
- the E4 region is partially deleted, for example is 95%, 90%, 85%, 80%,
- the E4 region has the sequence from 32188bp to 29380bp of SEQ ID NO: 38.
- B3 is a bond, i.e. wherein E4 is absent.
- B3 has the sequence consisting of from 32188bp to 29380bp of SEQ ID NO: 38.
- formulas herein such as formula (I), (la), (lb), (Ic), (Id) and (Ie) are contiguous and may embody non-coding DNA sequences as well as the genes and coding DNA sequences (structural features) mentioned herein.
- the formulas of the present disclosure are attempting to describe a naturally occurring sequence in the adenovirus genome.
- the formula is referring to the major elements characterising the relevant section of genome and is not intended to be an exhaustive description of the genomic stretch of DNA.
- E1A, E1B, E3 and E4 as employed herein each independently refer to the wild-type and equivalents thereof, mutated or partially deleted forms of each region as described herein, in particular a wild-type sequence from a known adenovirus.
- "Insert” as employed herein refers to a DNA sequence that is incorporated either at the 5' end, the 3' end or within a given DNA sequence reference segment such that it interrupts the reference sequence. The latter is a reference sequence employed as a reference point relative to which the insert is located. In the context of the present disclosure inserts generally occur within either SEQ ID NO: 10 or SEQ ID NO: 11.
- An insert can be either a restriction site insert, a transgene cassette or both. When the sequence is interrupted the virus will still comprise the original sequence, but generally it will be as two fragments sandwiching the insert.
- the transgene or transgene cassette does not comprise a non-biased inserting transposon, such as a TN7 transposon or part thereof.
- Tn7 transposon as employed herein refers to a non-biased insertion transposon as described in WO2008/080003.
- one or more restrictions sites in ⁇ and ⁇ are independently selected from a restriction site specific to an enzyme described herein, for example Notl, Fsel, AsiSl, Sgfi and
- Sbfi in particular the restriction sites inserted are all different, such as sites specific for Notl and sites specific for Fsel located in ⁇ and Sgfi and Sbfi located in ⁇ .
- the region ⁇ and/or ⁇ do not comprise a restriction site.
- the viruses and constructs of the present disclosure can be prepared without restriction sites, for example using synthetic techniques. These techniques allow a great flexibility in the creation of the viruses and constructs. Furthermore, the present inventors have established that the properties of the viruses and constructs are not diminished when they are prepared by synthetic techniques.
- Promoter as employed herein means a region of DNA that initiates transcription of a particular gene or genes. Promoters are generally located proximal to the genes they transcribe, on the same strand and upstream (i.e. 5') on the DNA. Proximal as employed in this context means sufficiently close to function as a promoter. In one embodiment, the promoter is within 100 bp of the transcription start site. Thus, endogenous promoter as employed herein refers to a promoter that naturally occurs in (i.e. is native to) the adenovirus (or construct) into which the transgene, is being inserted.
- the endogenous promoter employed is the naturally occurring promoter in the virus in its original location in the virus genome, in particular this is the primary or only promoter employed in the expression of the transgene or transgenes.
- the endogenous promoter used to promote the translation and optionally the transcription of the transgene is one resident, i.e. is one integrated in the genome of the adenovirus and not previously introduced by recombinant techniques.
- transgene/transgene cassette is inserted in the appropriate orientation to be under the control of said endogenous promoter. That is, where the promoter is generally on the antisense strand, the cassette is inserted, for example in the antisense orientation.
- genes can be expressed in one of two orientations. However, generally one orientation provides increased levels of expression over the other orientation, for a given (particular) transgene.
- the cassette is in the sense orientation. That is, is transcribed in a 5' to 3' direction.
- the cassette is in the antisense orientation. That is, transcribed in the 3' to 5' orientation.
- the endogenous promoters in the virus can, for example, be utilised by employing a gene encoding a transgene and a splice acceptor sequence.
- the cassette will comprise a splice acceptor sequence when under the control of an endogenous promoter.
- the coding sequence for example the sequence encoding the antibody or antibody binding fragment further comprises a splice acceptor sequence.
- transgene, transgenes, or transgene cassette are under the control of an E4 promoter or a major late promoter, such as the major late promoter (ML promoter).
- E4 promoter or a major late promoter, such as the major late promoter (ML promoter).
- ML promoter major late promoter
- transgene is activated, i.e. transcribed, when a particular promoter dictates.
- the Major Late Promoter refers to the adenovirus promoter that controls expression of the "late expressed" genes, such as the L5 gene.
- the MLP is a "sense strand" promoter. That is, the promoter influences genes that are downstream of the promoter in the 5'-3' direction.
- the major late promoter refers the original major late promoter located in the virus genome.
- E4 promoter refers to the adenovirus promoter of the E4 region.
- the E4 region is an antisense region; therefore the promoter is an antisense promoter. That is, the promoter is upstream of the E4 region in the 3'-5' direction. Therefore any transgene cassette under control of the E4 promoter may need to be oriented appropriately.
- the cassette under the control of the E4 promoter is in the antisense orientation.
- the cassette is under the control of the E4 promoter in the sense orientation.
- the E4 promoter as employed herein refers to the original E4 promoter located in the virus genome.
- a replication competent oncolytic adenovirus serotype 11 (such as Adllp) or virus-derivative thereof wherein the fibre, hexon and capsid are serotype 11 (such as Adllp), wherein the virus genome comprises a DNA sequence encoding a therapeutic antibody or antibody-binding fragment (such as a BiTE), wherein said DNA sequence under the control of a promoter endogenous to the adenovirus selected from consisting of E4 and the major late promoter (i.e. the E4 promoter or the major late promoter), such that the transgene does not interfere with virus replication, for example is associated with the L5 region (i.e. before or after said region), such as located after L5 in the virus genome, in particular located between L5 and the E4 region.
- an endogenous promoter is introduced into the viral genome at a desired location by recombinant techniques, for example is introduced in the transgene cassette.
- this arrangement will generally be referred to as an exogenous promoter.
- the transgene cassette comprises an exogenous promoter.
- Exogenous promoter refers to a promoter that is not naturally occurring in the adenovirus into which the transgene is being inserted. Typically, exogenous promoters are from other viruses or are mammalian promoters. Exogenous promoter as employed herein means a DNA element, usually located upstream of the gene of interest, that regulates the transcription of the gene.
- the regulator of gene expression is an exogenous promoter, for example CMV (cytomegalovirus promoter), CBA (chicken beta actin promoter) or PGK (phosphoglycerate kinase 1 promoter), such as CMV promoter.
- CMV cytomegalovirus promoter
- CBA chicken beta actin promoter
- PGK phosphoglycerate kinase 1 promoter
- the CMV exogenous promoter employed has the nucleotide sequence of SEQ ID NO: 52.
- the PGK exogenous promoter employed has the nucleotide sequence of SEQ ID NO: 53.
- the CBA exogenous promoter employed has the nucleotide sequence of SEQ ID NO: 54.
- virus genome comprises a DNA sequence encoding a therapeutic antibody or antibody-binding fragment (such as a BiTE according to the present disclosure) located in a part of the virus genome which is expressed late in the virus replication cycle and such that the transgene does not interfere with virus replication, wherein said DNA sequence under the control of a promoter exogenous to the adenovirus (for example the CMV promoter).
- a therapeutic antibody or antibody-binding fragment such as a BiTE according to the present disclosure located in a part of the virus genome which is expressed late in the virus replication cycle and such that the transgene does not interfere with virus replication, wherein said DNA sequence under the control of a promoter exogenous to the adenovirus (for example the CMV promoter).
- the DNA sequence encoding an antibody or fragment is associated with the L5 region as described elsewhere herein, in particular located between L5 and E4 region.
- the exogenous promoter is an antigen-presenting cell promoter.
- Antigen-presenting cell promoter refers to a promoter for a gene that is selectively expressed by antigen-presenting cells, such as dendritic cells or macrophages.
- genes include but are not limited to: FLT-3, FLT-3 ligand, TLRs, CD la, CDlc, CDllb, CD 11c, CD80, CD83, CD86, CD123, CD172a, CD205, CD207, CD209, CD273, CD281, CD283, CD286, CD289, CD287, CXCR4, GITR Ligand, IFN-a2, IL-12, IL-23, ILT1, ILT2, ILT3, ILT4, ILT5, ILT7, TSLP Receptor, CD141, CD303, CADM1, CLEC9a, XCR1 or CD304; antigen processing and presentation mediators such as CTIIA or GILT.
- the exogenous promoter is suitable for selective expression of transgenes in said antigen-presenting cells.
- Other Regulatory Sequence such as
- Regulator of gene expression refers to a genetic feature, such as a promoter, enhancer or a splice acceptor sequence that plays a role in gene expression, typically by initiating or enhancing transcription or translation.
- Splice acceptor sequence refers to a regulatory sequence determining when an mRNA molecule will be recognised by small nuclear ribonucleoproteins of the spliceosome complex. Once assembled the spliceosome catalyses splicing between the splice acceptor site of the mRNA molecule to an upstream splice donor site producing a mature mRNA molecule that can be translated to produce a single polypeptide or protein.
- splice acceptor sequences may be employed in the present invention and these can be described as short splice acceptor (small), splice acceptor (medium) and branched splice acceptor (large).
- SSA as employed herein means a short splice acceptor, typically comprising just the splice site, for example 4 base pairs.
- SA as employed herein means a splice acceptor, typically comprising the short splice acceptor and the polypyrimidine tract, for example 16 bp.
- bSA as employed herein means a branched splice acceptor, typically comprising the short splice acceptor, polypyrimidine tract and the branch point, for example 26 base pairs.
- the splice acceptor employed in the constructs of the disclosure are shown in SEQ ID NO: 55 to 57.
- the SSA has the nucleotide sequence of SEQ ID NO: 55.
- the SA has the nucleotide sequence of SEQ ID NO: 56.
- the bSA has the nucleotide sequence of SEQ ID NO: 57.
- the splice acceptor sequence is independently selected from the group comprising: TGCTAATCTT CCTTTCTCTC TTCAGG (SEQ ID NO: 57), CCTTTCTCTCTT CAGG (SEQ ID NO: 56), and CAGG (SEQ ID NO: 55).
- the splice site is immediately proceeded (i.e. followed in a 5' to 3' direction) by a consensus Kozak sequence comprising CCACC.
- the splice site and the Kozak sequence are interspersed by up to 100 or less base pairs.
- the Kozak sequence has the nucleotide sequence of SEQ ID NO: 58.
- the coding sequence when under the control of an endogenous or exogenous promoter (such as an endogenous promoter), the coding sequence will be immediately preceded by a Kozak sequence.
- the start of the coding region is indicated by the initiation codon (AUG), for example is in the context of the sequence (gcc)gccRccAUGg [SEQ ID NO: 59] the start of the "start" of the coding sequences is indicated by the bases in bold.
- a lower case letter denotes common bases at this position (which can nevertheless vary) and upper case letters indicate highly-conserved bases, i.e.
- the 'AUGG' sequence is constant or rarely, if ever, changes; 'R' indicates that a purine (adenine or guanine) is usually observed at this position and the sequence in brackets (gcc) is of uncertain significance.
- the initiation codon AUG is incorporated into a Kozak sequence.
- Internal Ribosome Entry DNA Sequence refers to a DNA sequence encoding an Internal Ribosome Entry Sequence (IRES).
- IRES as employed herein means a nucleotide sequence that allows for initiation of translation a messenger RNA (mRNA) sequence, including initiation starting within an mRNA sequence. This is particularly useful when the cassette encodes polycistronic mRNA. Using an IRES results in a polycistronic mRNA that is translated into multiple individual proteins or peptides.
- the Internal Ribosome Entry DNA sequence has the nucleotide sequence of SEQ ID NO: 60.
- a particular IRES is only used once in the genome. This may have benefits with respect to stability of the genome.
- “High self-cleavage efficiency 2A peptide” or “2A peptide” as employed herein refers to a peptide which is efficiently cleaved following translation. Suitable 2A peptides include P2A, F2A, E2A and T2A. The present inventors have noted that once a specific DNA sequence encoding a given 2A peptide is used once, the same specific DNA sequence may not be used a second time. However, redundancy in the DNA code may be utilised to generate a DNA sequence that is translated into the same 2A peptide. Using 2A peptides is particularly useful when the cassette encodes polycistronic mRNA.
- the encoded P2A peptide employed has the amino acid sequence of SEQ ID NO: 61.
- the encoded F2A peptide employed has the amino acid sequence of SEQ ID NO: 62.
- the encoded E2A peptide employed has the amino acid sequence of SEQ ID NO: 63.
- the encoded T2A peptide employed has the amino acid sequence of SEQ ID NO: 64.
- an mRNA or each mRNA encoded by a transgene(s) comprise a polyadenylation signal sequence, such as typically at the end of an mRNA sequence, for example as shown in SEQ ID NO: 65.
- the transgene or the transgene cassette comprises at least one sequence encoding a polyadenylation signal sequence.
- PolyA Polyadenylation signal
- polyadenylation sequence means a DNA sequence, usually containing an AATAAA site, that once transcribed can be recognised by a multiprotein complex that cleaves and polyadenylates the nascent mRNA molecule.
- the construct does not include a polyadenylation sequence.
- the regulator of gene expression is a splice acceptor sequence.
- sequence encoding a protein/polypeptide/peptide such as an antibody or antibody fragment (such as a BiTE according to the present disclosure) further comprises a polyadenylation signal.
- the at least one transgene in the virus encodes a BiTE, wherein one binding domain is specific for T cell surface antigen.
- the second binding domain may target and suitable antigen, for example a pathogen antigen, a cancer antigen, a stromal antigen.
- Cancer antigens are one category of particular interest and include for example selected from CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2, ErbB3, WT1, MUC1, LMP2, idiotype, HPV E6&E7, EGFRvIII, HER- 2/neu, MAGE A3, p53 nonmutant, p53 mutant, NY-ESO-1, GD2, PSMA, PCSA, PSA, MelanA/MARTl, Ras mutant, proteinase3 (PR1), bcr-abl, tyrosinase, survivin, PSA, hTERT, particularly WT1, MUC1, HER-2/neu, NY-ESO
- Stromal antigens include fibroblast antigens for example those described herein such as FAP, tumor associated macrophage antigens, and myeloid derived suppressor cell antigens, for example include CD163, CD206, CD68, CDllc, CDllb, CD14, CSF1 receptor, CD15, CD33 and CD66b.
- the targets list below may, if appropriate, be encoded in BiTE according to the present disclore or alternatively may be provided as a further therapeutic transgene, or both.
- the transgene or transgenes independently encode a protein, peptide, RNA molecule, such as an RNA molecule.
- the transgene can be delivered intra- cellularly and can subsequently be transcribed and if appropriate translated.
- Examples of genetic material encoded by a transgene include, for example antibodies or binding fragments thereof, chemokines, cytokines, immunmodulators, enzymes (for example capable of converting pro-drug in the active agent) and an RNAi molecule.
- Peptide as employed herein refers to an amino acid sequence of 2 to 50 residues, for example 5 to 20 residues.
- Polypeptide as employed herein refers to an amino acid sequence of more than 50 residues without tertiary structure, in particular without secondary and tertiary structure.
- Protein refers to an amino acid sequence of more than 50 residues, with secondary and/or tertiary structure, in particular with second and tertiary structure.
- the coding sequence encodes a therapeutic RNA, therapeutic peptide, therapeutic polypeptide or therapeutic protein (i.e. is a therapeutic gene).
- Immunomodulator gene or transgene as employed here means a gene that encodes a peptide or protein molecule that can qualitatively or quantitatively modify an activity or activities of cells of the immune system.
- Therapeutic gene as employed herein means a gene that encodes an entity that may be useful in the treatment, amelioration or prevention of disease, for example the gene expresses a therapeutic protein, polypeptide, peptide or RNA, which at least slows down, halts or reverses the progression of a disease, such as cancer.
- the entity encoded by the transgene when transcribed or translated in a cell increases production of danger signals by the cell.
- Dannger signals refers to a variety of molecules produced by cells undergoing injury, stress or non- apoptotic death that act as alarm signals, for example by stimulating cells of the innate immune system to respond directly as well as serving to enhance activation of cells of the adaptive immune system.
- tumours often changes such that natural human immune responses are down regulated.
- the ability to re-start the immune responses from within the tumour is potentially very interesting in the treatment of cancer.
- the encoded therapeutic peptide or protein is designed to be secreted into the extracellular environment.
- the functional RNA, peptide, polypeptide or protein, such as the antibody is released into the external microenvironment of the cell, for example into the culture supernatant, or in vivo: tissue, stroma, circulation, blood and/or lymphatic system.
- the peptide, polypeptide or protein (including a BiTE according to the present disclosure), encoded by the transgene comprises a signal sequence.
- Signal peptide as employed herein refers to a short 13-36 residue peptide sequence located at the N-terminal of proteins which assist the entry of the protein into the secretory pathway for secretion or membrane expression.
- the leader sequence (signal peptide) has the amino acid sequence of SEQ ID NO: 66 or 67.
- the encoded therapeutic peptide or protein, such as an antibody is designed to be expressed as a membrane-anchored form in the surface membrane of the cell, for example by including encoding a transmembrane domain in the protein or a site for attachment of a lipid membrane anchor.
- the BiTE or BiTEs of the present disclosure are not expressed as a cell surface anchor format.
- the functional RNA, peptide, polypeptide or protein, such as an antibody is released from the cell infected by the adenovirus, for example by active secretion or as a result of cell lysis.
- the adenovirus lyses the cell, thereby releasing the functional RNA, peptide, polypeptide or protein, such as the antibody.
- the encoded further therapeutic peptide or protein, such as an antibody is designed to be retained within the intact cell.
- RNA, peptide, polypeptide or protein such as antibodies expressed by adenoviruses of the present disclosure can be detected in tissue in vivo as both mRNA and antibody protein.
- the expressed functional RNA, peptide or protein, such as the antibody can bind its ligand in ELISA.
- the functional RNA, peptide, polypeptide or protein, such as the antibody is detectable early (e.g. within 3 days of infection) and the expression is sustained over several weeks.
- adenoviruses of the present disclosure express functional RNA, peptide, polypeptide or protein, such as antibodies within about 3 days or more of infection, such as within about 36, 48, 60 or 72 hours, or such as 2, 3, 4, 5 or 6 days.
- adenoviruses of the present disclosure express functional RNA, peptide, polypeptide or protein, such as antibodies for several weeks, such as about 1, 2, 3, 4, 5 or 6 weeks. Such as 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 days.
- RNA, peptide or protein expression is sufficiently high to be able to detect the functional RNA, peptide, polypeptide or protein, such as the antibody in the blood.
- RNA, peptide or protein such as antibodies expressed by the adenovirus of the present disclosure enter the blood stream and/or lymphatic system.
- the adenovirus of the present disclosure is an oncolytic virus which has an enhanced therapeutic index for cancer cells.
- the coding sequence further encodes functional RNA, for example therapeutic RNA.
- RNA refers to RNA which has a function other than to encode a protein or peptide and includes for examples include RNA constructs suitable for inhibiting or reducing gene activity, including RNAi, such as shRNA and miRNA.
- shRNA refers to short hairpin RNA which is a sequence of RNA that makes a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi).
- miRNA miRNA as employed herein refers to a small non-coding RNA molecule (containing about 22 nucleotides) which functions, via base-pairing with complementary sequences within mRNA molecules, to regulate gene expression at the transcriptional or post-transcriptional level.
- miRNA strands bound by miRNA are silenced because they can no longer be translated into proteins by ribosomes, and such complexes are often actively disassembled by the cell.
- the transgene encodes a protein.
- Protein as employed herein includes a protein ligand, a protein receptor, or an antibody molecule.
- Protein ligand as employed herein refers to cell surface membrane or secreted proteins binding fragments thereof, that bind to or otherwise engage with the cellular receptors to influence the function of the cell, for example by stimulating intracellular signalling and modulating gene transcription within the cell.
- the protein expressed is engineered to be expressed on the surface of the cell and/or secreted from the cell.
- the protein encoded is a bi-specific antibody, such as a BiTE.
- the transgene further encodes an enzyme, for example an enzyme that assists in degrading the extra-cellular matrix of the tumour, for example a DNAse, a collagenase, a matrix metalloproteinase (such as MMP2 or 14) or similar.
- an enzyme for example an enzyme that assists in degrading the extra-cellular matrix of the tumour, for example a DNAse, a collagenase, a matrix metalloproteinase (such as MMP2 or 14) or similar.
- Suitable antibodies and antibody fragments may be agonistic or antagonistic and include those with anticancer activity and those which modify host cell responses to the cancer, for example: an agonist or antagonistic antibody or antibody fragment may decrease vascularization or normalise vascularization of the tumour.
- agonistic antibodies or other encoded proteins may render the host cell more visible to the host's innate and adaptive immune responses, for example by expressing antigens, danger signals, cytokines or chemokines to attract and activate the same, or by binding to co-stimulatory or checkpoint pathway molecules to enhance adaptive immune responses.
- Therapeutic antibody or antibody-binding fragment as employed herein refers to antibody or antibody-binding fragment which, when inserted in to the oncolytic virus, has a beneficial impact on a pathology in the patient, for example on the cancer being treated.
- Beneficial impact as employed herein refers to a desirable and/or advantageous effect of the antibody being expressed in vivo.
- Classes of therapeutic antibodies and antibody-binding fragments include: anti-EGF antibodies, anti-VEGF antibodies, anti-PDGF antibodies, anti-CTLA antibodies, anti-PDl antibodies, anti-PDLl antibodies and anti-FGF antibodies.
- Registered therapeutic antibodies suitable for incorporation into viruses of the present disclosure include: abciximab, adalimumab, alemtzumab, basiliximab, belimumab, bevacizumab, brentuximab vedotin, canakinumab, cetuximab, certolzumab, daclizumab, denosumab, eculzumab, efalixumab, gemtuzumab, golimumab, ibritumomab tiuxetan, infliximab, ipilimumab, muromonab- CD3, ofatumumab, palivizumab, panitumumab, ranibizumab, rituximab, tocilizumab, tositumomab and trastuzumab.
- the antibody variable region sequences of an antibody or antibody fragment employed are between 95 and 100% similar or identical to the variable regions of bevacizumab (also known as Avastin®), such as 96, 97, 98 or 99% similar or identical.
- the coding sequences for those antibodies and binding fragments thereof which are approved for a cancer indications for example trastuzumab, tositumomab, rituximab, panitumumab, ofatumumab, ipilimumab, ibritumomab tiuxetan, gemtuzumab, denosumab, cetuximab, brentuximab vedotin, avastin and adalimumab.
- the antibody variable region sequences of an antibody or antibody fragment employed are between 95 and 100% similar or identical to the variable regions of a known antibody or an antibody disclosed herein.
- antibody molecule includes antibodies and binding fragments thereof.
- Antibody as employed herein generally refers to a full length antibody and bispecific or multi-specific formats comprising the same.
- Antibody-binding fragments includes an antibody fragment able to target the antigen with the same, similar or better specificity to the original "antibody” from which it was derived.
- Antibody fragments include: Fab, modified Fab, Fab', modified Fab', F(ab') 2, Fv, single domain antibodies (e.g. VH or VL or VHH), scFv, bi, tri or tetra-valent antibodies, Bis-scFv, diabodies, triabodies, tetrabodies and epitope-binding fragments of any of the above (see for example Holliger and Hudson, 2005, Nature Biotech. 23(9):1126-1136; Adair and Lawson, 2005, Drug Design Reviews - Online 2(3), 209- 217).
- antibody fragments for use in the present invention include the Fab and Fab' fragments described in international patent applications WO2005/003169, WO2005/003170 and WO2005/003171.
- Multivalent antibodies may comprise multiple specificities e.g. bispecific or may be monospecific (see for example WO 92/22853, WO05/113605, WO2009/040562 and WO2010/035012).
- Specific as employed herein is intended to refer to an antibody or fragment that only recognises the antigen to which it is specific or to an antibody or fragment that has significantly higher binding affinity to the antigen to which is specific in comparison to its binding affinity to antigens to which it is not specific, for example 5, 6, 7, 8, 9, 10 times higher binding affinity.
- Fab, Fab' or scFv fragment can be employed to generate alternative antibody formats with the same CDRs or the same variable regions, for example, a full-length antibody can readily be converted into a Fab, Fab' or scFv fragment.
- antibody molecules from non-human animals including human antibody molecules, humanised antibody molecules and chimeric antibody molecules.
- the antibody or binding fragment is monoclonal.
- Monoclonal antibodies may be prepared by any method known in the art such as the hybridoma technique (Kohler & Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, 1983, Immunology Today, 4:72) and the EBV-hybridoma technique (Cole et al, Monoclonal Antibodies and Cancer Therapy, pp77-96, Alan R Liss, Inc., 1985).
- the antibody or binding fragment is non-human, i.e. completely from non-human origin. This is possible because the antibodies and fragments can be delivered inside the cancer cell by the virus.
- the antibody is chimeric, for example has human constant region(s) and non-human variable regions.
- the antibody or binding fragment is human, i.e. from completely human origin. In one embodiment, the antibody or binding fragment is humanised.
- Humanised antibodies (which include CDR-grafted antibodies) are antibody molecules having one or more complementarity determining regions (CDRs) from a non-human species and a framework region from a human immunoglobulin molecule (see, for example US 5,585,089; WO91/09967). It will be appreciated that it may only be necessary to transfer the specificity determining residues of the CDRs rather than the entire CDR (see for example, Kashmiri et al, 2005, Methods, 36, 25-34). Humanised antibodies may optionally further comprise one or more framework residues derived from the non-human species, for example from which the CDRs were derived.
- the coding sequence encodes an antibody heavy chain an antibody light chain or an antibody fragment.
- Heavy chain (HC) as employed herein refers to the large polypeptide subunit of an antibody.
- Light chain (LC) as employed herein refers to the small polypeptide subunit of an antibody.
- the antibody light chain comprises a CL domain, either kappa or lambda.
- Antibodies for use in the present disclosure may be obtained using any suitable a method known in the art.
- the antigen polypeptide/protein including fusion proteins, including cells (recombinantly or naturally) expressing the polypeptide (such as activated T cells) can be used to produce antibodies which specifically recognise the antigen.
- the polypeptide may be the 'mature' polypeptide or a biologically active fragment or derivative thereof.
- Screening for antibodies can be performed using assays to measure binding to antigen and/or assays to measure the ability to antagonise the receptor.
- An example of a binding assay is an ELISA, in particular, using a fusion protein (optionally comprising a reporter), which is immobilized on plates, and employing a conjugated secondary antibody to detect anti-antigen antibody bound to the fusion protein.
- the constant region domains of the antibody molecule of the present invention may be selected having regard to the proposed function of the antibody molecule, and in particular the effector functions which may be required.
- the constant region domains may be human IgA, IgD, IgE, IgG or IgM domains.
- human IgG constant region domains may be used, especially of the IgGl and IgG3 isotypes when the antibody molecule is intended for therapeutic uses and antibody effector functions are required.
- IgG2 and IgG4 isotypes may be used when the antibody molecule is intended for therapeutic purposes and antibody effector functions are not required, e.g. for simply agonising activity or for target neutralization.
- IgG4 molecules in which the serine at position 241 has been changed to proline as described in Angal et al, Molecular Immunology, 1993, 30 (1), 105-108 may be used.
- the adenoviruses of the present disclosure can express full length antibodies, antibody fragments such as scFvs, multispecific antibodies, in particular bispecific antibodies such as BiTEs as described herein.
- the sequence encoding the antibody or antibody fragment (such as a BiTE according to the present disclosure) comprise or further comprises an internal ribosome entry sequence.
- Internal ribosome entry sequence as employed herein means a nucleotide sequence that allows for translation initiation in the middle of a messenger RNA (mRNA) sequence.
- the encoded therapeutic proteins or peptides are target specific proteins, polypeptides or peptides.
- Target specific proteins or peptides refers to either the target proteins themselves, or different proteins or peptides that directly bind (for example are specific to the target) to or otherwise modify the levels of the target proteins or peptides.
- An example of the former would be a cytokine, whilst an example of the latter would be an antibody against that cytokine.
- Targets of interest generally relate to particular cells, cellular products, antigens or signalling pathways associated with disease, particularly cancer.
- Target depending on the context, also relates to mRNA or similar transcribed from the gene encoding the protein or polypeptide, which for example can be inhibited by RNAi type technology.
- RNAi RNAi type technology
- the target is the mRNA which is encoded by the gene of the target.
- targets of interest include, but are not limited to, stimulatory T-cell co-receptors and ligands thereto, checkpoint inhibitory T-cell co-receptor molecules and ligands thereto, receptors and ligands thereto expressed by regulatory T-cells, myeloid derived suppressor cells and immunosuppressive immune cells, dendritic cell and antigen-presenting cell receptors and ligands thereto, antigen processing and presentation mediators, cytokines and cytokine receptors, chemokines and chemokine receptors, transcription factors and regulators of transcription, intracellular trafficking molecules and regulators of cell function, tumour cell and tumour microenvironmental receptors and products, intracellular tumour cell enzymes such as IDO, antigens for recognition by immune cells.
- stimulatory T-cell co-receptors and ligands thereto checkpoint inhibitory T-cell co-receptor molecules and ligands thereto, receptors and ligands thereto expressed by regulatory T-cells, myeloid derived suppressor
- target as employed herein refers to a protein or polypeptide which can, for example be inhibited, neutralised or activated by, for example an antibody or binding fragment there, as appropriate.
- Target in the context of cytokines refers to a cytokine per se or an antibody or binding fragment thereof specific to the cytokine.
- the virus may encode and express the cytokine itself as release of thereof may stimulate "host" immune responses.
- mutated forms of the ligand can be encoded by the virus which compete with the natural ligand to bind the receptor.
- the mutated ligand may have increased binding affinity for the receptor, for example such that it has a slow off-rate thereby occupying the receptor and increasing or decreasing signalling therefrom.
- the activity of the mutated ligand may be reduced in comparison to the wild-type ligand, thereby reducing the binding and overall activity through the receptor from the natural ligand.
- the virus or construct according to the present disclosure encodes a pro- drug, an immunomodulator and/or an enzyme.
- Pro-drug as employed herein means a molecule that is administered as an inactive (or less than fully active) derivative that is subsequently converted to an active pharmacological agent in the body, often through normal metabolic processes.
- a pro-drug serves as a type of precursor to the intended drug.
- a pro-drug converting enzyme serves as the enzyme that converts a pro-drug to its pharmacologically active form.
- Immunomodulator as employed herein means a modulator of immune response. Immunomodulators function in adjustment of the immune response to a desired level, as in immunopotentiation, immunosuppression, or induction of immunologic tolerance.
- co-stimulatory molecule as employed herein means a molecule that provides a complementary signal to the antigen-specific signal required by T cells for activation, proliferation and survival.
- co-stimulatory molecules include but are not limited to CD28, CD80, CD86, CD83 and 4-1BB.
- Enzyme as employed herein means a substance that acts as a catalyst in living organisms, regulating the rate at which chemical reactions proceed without itself being altered in the process.
- the target is a checkpoint protein, such as an immune checkpoint or cell cycle checkpoint protein.
- checkpoint proteins include but are not limited to: CTLA-4, PD-1, PD-L1, PD-L2, VISTA, B7-H3, B7-H4, HVEM, ILT-2, ILT-3, ILT-4, TIM-3, LAG-3, BTLA, LIGHT or CD160, for example CTLA-4, PD-1, PD-L1 and PD-L2.
- an antibody or binding fragment thereof which is specific to one of the same.
- a transgene or transgene cassette encodes an antibody or antibody fragment specific to CTLA-4, PD- 1, PD-L1 or PD-L2.
- the adenovirus expresses an antibody or antibody fragment specific to CTLA-4, PD-1, PD-L1 or PD-L2.
- the antibody is a checkpoint inhibitor antibody, for example anti-PD-Ll.
- the adenovirus expresses full length anti-human PD-L1 antibody.
- the expression of full length anti-human PD-L1 antibody is under the control of an endogenous promoter, such as the major late promoter (MLP), in particular in position ⁇ .
- MLP major late promoter
- the adenovirus expresses the scFv form of anti-human PD-L1 antibody.
- the expression of a scFv form of anti-human PD-L1 antibody is under the control of an endogenous promoter, such as the Major late promoter, in particular in position ⁇ .
- virus or construct encoding an antibody or binding fragment thereof, for a full-length antibody or scFv specific to CTLA-4, for example as exemplified herein.
- the target is one or more independently selected from the group comprising CD16, CD25, CD33, CD332, CD127, CD31, CD43, CD44, CD162, CD301a, CD301b and Galectin-3.
- an antibody or binding fragment thereof specific thereto for example a full-length antibody or a scFv.
- the target for example which may be targeted by an antibody or binding fragment, is one or more independently selected from the group comprising: FLT-3, FLT-3 ligand, TLRs, TLR l igands, CCR7, CD la, CD lc, CD l lb, CD 11c, CD80, CD83, CD86, CD 123, CD 172a, CD205, CD207, CD209, CD273, CD281, CD283, CD286, CD289, CD287, CXCR4, GITR Ligand, IFN-a2, IL-12, IL-23, ILT1, ILT2, ILT3, ILT4, ILT5, ILT7, TSLP Receptor, CD141, CD303, CADM1, CLEC9a, XCR1 and CD304.
- the target, of a BiTE employed in the present disclosure is a tumour cell antigen.
- the target is one or more independently selected from the group comprising: CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y , Le x , Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2, ErbB3.
- the target, of a BiTE employed in the present disclosure is a tumour stroma antigen.
- the target of a BiTE employed in the present disclosure is one or more independently selected from the group comprising: FAP, TREM1, IGFBP7, FSP-1, platelet-derived growth factor-a receptor (PDGFR-a), platelet-derived growth factor- ⁇ receptor (PDGFR- ⁇ ) and vimentin.
- the target for example which may be targeted by an antibody or binding fragment (such as a BiTE), is a cancer target.
- the target is one or more independently selected from the group comprising: OX40, OX40 ligand, CD27, CD28, CD30, CD40, CD40 ligand, TL1A, CD70, CD137, GITR, 4- IBB, ICOS or ICOS ligand, for example CD40 and CD40 ligand.
- the transgene cassette encodes a ligand comprising CD40 or CD40 ligand, or an antibody, antibody fragment or shRNA targeted to CD40 or CD40 ligand.
- the adenovirus expresses a ligand comprising CD40 or CD40 ligand, or an antibody, antibody fragment or shRNA targeted to (specific to) CD40 or CD40 ligand.
- the target is one or more cytokines independently selected from the group comprising: IL-l a, IL- ⁇ , IL-6, IL-9, IL-12, IL-13, IL-17, IL-18, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-33, IL-35.
- the transgene cassette encodes an antibody or antibody fragment specific to IL-12, IL-18, IL-22, IL-7, IL-15, IL-21, IFNa, IFNy, TNFa, TGF or lymphotoxin a (LTA).
- the adenovirus expresses IL-12, IL-18, IL-22, IL-7, IL-15, IL-21, IFNa, IFNy, TNFa, TGF or lymphotoxin a (LTA).
- the amino acid sequence of IFNy is SEQ ID NO: 68. In one embodiment the amino acid sequence of IFNa is SEQ ID NO: 69. In one embodiment the amino acid sequence of TNFa is SEQ ID NO: 70.
- the target is a chemokine, for example one or more independently selected from the group comprising: IL-8, CCL3, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, CXCR2, CCR2, CCR4, CCR5, CCR6, CCR7, CCR8, CXCR3, CXCR4, CXCR5 and CRTH2.
- the transgene cassette encodes an antibody or antibody fragment specific to CCL5, CXCL9, CXCL12, CCL2, CCL19, CCL21, CXCR2, CCR2, CCR4 or CXCR4.
- the chemokines target includes where the viruses encodes and expresses the chemokine, for example to induce or augment host immune responses to the cancer.
- the adenovirus expresses an antibody or antibody fragment specific to CCL5, CXCL9, CXCL12, CCL2, CCL19, CCL21, CXCR2, CCR2, CCR4 or CXCR4.
- the target is one or more independently selected from the group comprising: STAT3, STAT1, STAT4, STAT6, CTIIA, MyD88 and NF B family members, for example the protein is targeted with an inhibitor, for example an antibody or bind fragment thereof, or mRNA transcribed from the relevant gene is inhibited by a mechanism, such as RNAi.
- the target is HSp70 or a regulator of cell survival and death such as survivin
- the protein is targeted with an inhibitor, for example an antibody or bind fragment thereof, or mRNA transcribed from the relevant gene is inhibited by a mechanism, such as RNAi.
- the target is one or more independently selected from the group comprising: amphiregulin, BTC, NRGla, NRGlb, NRG3, TGFa, LRIG1, LRIG3, EGF, EGF-L6, Epigen, HB-EGF, EGFR, Her2, Her3 and Her4, for example the protein is targeted with an inhibitor, for example an antibody or bind fragment thereof, or mRNA transcribed from the relevant gene is inhibited by a mechanism, such as RNAi.
- an inhibitor for example an antibody or bind fragment thereof, or mRNA transcribed from the relevant gene is inhibited by a mechanism, such as RNAi.
- the target is a ligand or receptor for one or more independently selected from the group comprising: hedgehog, FGF, IGF, Wnt, VEGF, TNF, TGFp, PDGF and Notch.
- the antibody is an anti-VEGF antibody.
- the adenovirus expresses full length anti-human VEGF antibody.
- the expression of full length anti-human VEGF antibody is under the control of an endogenous promoter, such as the Major late promoter (MLP), in particular in position ⁇ .
- MLP Major late promoter
- the adenovirus expresses the scFv form of anti-human VEGF antibody.
- the expression of the scFv form of anti-human VEGF antibody is under the control of an endogenous promoter, such as the Major late promoter, in particular in position ⁇ .
- the target is IDO.
- the target is an antigen for recognition by immune cells (such as a T cell engaged by a BiTE) is one or more proteins or peptides independently selected from the group comprising: immunogenic proteins from infectious organisms, such as cytomegalovirus antigens, influenza antigens, hepatitis B surface and core antigens, diphtheria toxoid, Crml97, tetanus toxoid; peptides derived from such antigens which are known T-cell or antibody epitopes, or genetically engineered composites or multimers of such antigens; tumour-derived proteins as antigens; peptides derived from such antigens which are known T-cell or antibody epitopes; and genetically engineered composites or multimers of such antigens for example WT1, MUC1, LMP2, idiotype, HPV E6&E7, EGFRvIII, HER-2/neu, MAGE A3, p53 nonmutant, p53 mutant, NY-ESO-1
- nucleic acid sequences that encode a given amino acid sequence due to codon redundancy, that silent nucleic acid base pair mutations are tolerated and all nucleic acid sequences that encode a given amino acid sequence as defined in any of the SEQ ID NO's are envisioned by the present disclosure.
- the peptide, polypeptide or protein encoded by a transgene is a mimotope.
- a mimotope is a molecule, often a peptide, which mimics the structure of an epitope. The latter property causes an antibody response similar to the one elicited by the epitope. An antibody for a given epitope antigen will recognize a mimotope which mimics that epitope. Mimotopes are commonly obtained from phage display libraries through biopanning. Vaccines utilizing mimotopes are being developed.
- antibodies of known specificity may be used to screen libraries (e.g peptide libraries in phage display - for example Ab sequence libraries or non-antibody peptide libraries, particularly those optimized for producing peptides with more stable 3D conformations) - Generation of mimotopes is well described in the art (see Tribbick G, Rodda S. Combinatorial methods for discovery of peptide ligands which bind to antibody-like molecules. J Mol Recognit. 2002 15(5):306-10; Masuko T, Ohno Y, Masuko K, Yagi H, Uejima S, Takechi M, Hashimoto Y. Towards therapeutic antibodies to membrane oncoproteins by a robust strategy using rats immunized with transfectants expressing target molecules fused to green fluorescent protein. Cancer Sci. 2011 102(l):25-35).
- a mimotope or other designed vaccine antigens are encoded by a transgene and expressed in order to induce an antibody response in the recipient patient, wherein the antibodies induced have the desired therapeutic effect.
- GFP-peptide fusion proteins with peptide sequences from desired human ligand, are used to induce anti-self target antibody responses, for example a peptide region of PD-L1 that is known to be important for binding to target molecule PD-1 may be genetically linked with GFP or other highly immunogenic foreign carrier proteins such that an immune antibody response to the peptide includes antibodies that cross-react with the native PDL1 molecule and thus serve to block PD-L1:PD-1 interactions in the same way as directly encoding an anti-PDLl antibody would.
- the transgene employed encodes a sequence shown in any one of SEQ ID NOs: 2, 4, 7, 11 or 16.
- the transgene employed encodes a sequence which excludes the deca-His affinity tag at the C-terminal end for example as shown in a virus set forth in any one of SEQ ID NOs: 72 to 78.
- adenoviruses of the present disclosure express and release antibody forms (such as a BiTE) and other proteins, such as cytokines, encoded by a transgene therein into the culture supernatant in vitro or into tumour tissue stroma in vivo.
- Leader sequences may assist the encoded proteins/polypeptide or peptide exiting the cancer cell. Therefore, in one embodiment the encoded "protein” comprises a leader sequence.
- Leader sequence as employed herein refers to a polynucleotide sequence located between the promoter sequence and the coding region which can regulate gene expression at the level of transcription or translation.
- the coding sequence encodes a peptide.
- Peptide as employed herein refers to an amino acid chain which is not a complete functional protein. Typically, a fragment which retains some or all of the function of the protein that it is a fragment of, or can be recognized by the immune system, for example peptides of 8 or more amino acids that can be recognized by T-cells.
- the transgene is a reporter gene encoding, for example an imaging agent including bioluminescent, fluorescent imaging agents (including activatable fluorescent imaging agents), such as luciferase, GFP or eGFP or red fluorescent protein.
- an imaging agent including bioluminescent, fluorescent imaging agents (including activatable fluorescent imaging agents), such as luciferase, GFP or eGFP or red fluorescent protein.
- Reporter gene or reporter sequence as employed herein means a gene or DNA sequence that produces a product easily detected in eukaryotic cells and may be used as a marker to determine the activity of another gene with which its DNA has been closely linked or combined. Reporter genes confer characteristics on cells or organisms expressing them that are easily identified and measured, or are selectable markers. Reporter genes are often used as an indication of whether a certain gene has been taken up by or expressed in the cell or organism population.
- reporter genes include, but are not limited to, LacZ, luciferase, GFP, eGFP, neomycin phosphotransferase, chloramphenicol acetyltransferase, sodium iodide symporter (NIS), nitroreductase (e.g. NfsA, NfsB) intracellular metalloproteins, HSVl-tk or oestrogen receptor.
- the genetic material in particular the transgene does not encode or express a reporter gene such as an imaging agent, luciferase, GFP or eGFP.
- Viruses according to the present disclosure can be investigated for their preference for a specific tumour type by examination of its lytic potential in a panel of tumour cells, for example colon tumour cell lines include HT-29, DLD-1, LS174T, LS1034, SW403, HCT116, SW48, and Colo320DM. Any available colon tumour cell lines would be equally useful for such an evaluation.
- Prostate cell lines include DU145 and PC-3 cells.
- Pancreatic cell lines include Panc-1 cells.
- Breast tumour cell lines include MDA231 cell line and ovarian cell lines include the OVCAR-3 cell line.
- Hemopoietic cell lines include, but are not limited to, the Raji and Daudi B-lymphoid cells, K562 erythroblastoid cells, U937 myeloid cells, and HSB2 T-lymphoid cells. Other available tumour cell lines are equally useful.
- the present disclosure also extends to novel sequences disclosed herein.
- the virus is shown in any one of sequences disclosed herein, for example any one of SEQ ID NOs: 34 to 37 or a sequence at least 95% identical thereto, for example as set forth in any one of SEQ ID NOs: 79 to 82.
- the present disclosure relates also extends to a pharmaceutical formulation of a virus as described herein.
- liquid parenteral formulation for example for infusion or injection, of a replication capable oncolytic according to the present disclosure wherein the formulation provides a dose in the range of lxlO 10 to lxlO 14 viral particles per volume of dose.
- Parenteral formulation means a formulation designed not to be delivered through the GI tract. Typical parenteral delivery routes include injection, implantation or infusion. In one embodiment the formulation is provided in a form for bolus delivery.
- parenteral formulation is in the form of an injection.
- Injection includes intravenous, subcutaneous, intra-tumoural or intramuscular injection.
- Injection as employed herein means the insertion of liquid into the body via a syringe.
- the method of the present disclosure does not involve intra-tumoural injection.
- parenteral formulation is in the form of an infusion.
- Infusion as employed herein means the administration of fluids at a slower rate by drip, infusion pump, syringe driver or equivalent device.
- the infusion is administered over a period in the range of 1.5 minutes to 120 minutes, such as about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 15, 16, 17, 18, 19 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 65, 80, 85, 90, 95, 100, 105, 110 or 115 minutes.
- one dose of the formulation less than lOOmls, for example 30mls, such as administered by a syringe driver. In one embodiment one dose of the formulation is less than 10 mis, for example 9, 8, 7, 6, 5, 4, 3, 2 or 1 mis. In one embodiment one dose of the formulation is less than 1 ml, such as 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2 or 0.1 mis.
- the injection is administered as a slow injection, for example over a period of 1.5 to 30 minutes.
- the formulation is for intravenous (i.v.) administration.
- This route is particularly effective for delivery of oncolytic virus because it allows rapid access to the majority of the organs and tissue and is particular useful for the treatment of metastases, for example established metastases especially those located in highly vascularised regions such as the liver and lungs.
- Therapeutic formulations typically will be sterile and stable under the conditions of manufacture and storage.
- the composition can be formulated as a solution, microemulsion, liposome, or other parenteral formulation suitable for administration to a human and may be formulated as a pre-filled device such as a syringe or vial, particular as a single dose.
- the formulation will generally comprise a pharmaceutically acceptable diluent or carrier, for example a non-toxic, isotonic carrier that is compatible with the virus, and in which the virus is stable for the requisite period of time.
- a pharmaceutically acceptable diluent or carrier for example a non-toxic, isotonic carrier that is compatible with the virus, and in which the virus is stable for the requisite period of time.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
- the proper fluidity can be maintained, for example, by the use of a dispersant or surfactant such as lecithin or a non-ionic surfactant such as polysorbate 80 or 40.
- a dispersant or surfactant such as lecithin or a non-ionic surfactant such as polysorbate 80 or 40.
- isotonic agents include sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
- parenteral formulations employed may comprise one or more of the following a buffer, for example 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid, a phosphate buffer and/or a Tris buffer, a sugar for example dextrose, mannose, sucrose or similar, a salt such as sodium chloride, magnesium chloride or potassium chloride, a detergent such as a non-ionic surfactant such as briji, PS-80, PS-40 or similar.
- the formulation may also comprise a preservative such as EDTA or ethanol or a combination of EDTA and ethanol, which are thought to prevent one or more pathways of possible degradation.
- the formulation will comprise purified oncolytic virus according to the present disclosure, for example lxlO 10 to lxlO 14 viral particles per dose, such as lxlO 10 to lxlO 12 viral particles per dose.
- concentration of virus in the formulation is in the range 2 x 10 8 to 2 x 10 14 vp/mL, such as 2 x 10 12 vp/ml.
- the parenteral formulation comprises glycerol.
- the formulation comprises oncolytic adenovirus as described herein, HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), glycerol and buffer.
- the parenteral formulation consists of virus of the disclosure, HEPES for example 5mM, glycerol for example 5-20% (v/v), hydrochloric acid, for example to adjust the pH into the range 7-8 and water for injection.
- HEPES for example 5mM
- glycerol for example 5-20% (v/v)
- hydrochloric acid for example to adjust the pH into the range 7-8 and water for injection.
- 0.7 mL of virus of the disclosue at a concentration of 2 x 10 12 vp/mL is formulated in 5 mM HEPES, 20% glycerol with a final pH of 7.8.
- the formulation is provided as a formulation for topical administrations including inhalation.
- Suitable inhalable preparations include inhalable powders, metering aerosols containing propellant gases or inhalable solutions free from propellant gases.
- Inhalable powders according to the disclosure will generally contain a virus as described herein with a physiologically acceptable excipient.
- These inhalable powders may include monosaccharides (e.g. glucose or arabinose), disaccharides (e.g. lactose, saccharose, maltose), oligo- and polysaccharides (e.g. dextranes), polyalcohols (e.g. sorbitol, mannitol, xylitol), salts (e.g. sodium chloride, calcium carbonate) or mixtures of these with one another.
- monosaccharides e.g. glucose or arabinose
- disaccharides e.g. lactose, saccharose, maltose
- oligo- and polysaccharides e.g. dextranes
- polyalcohols e.g. sorbitol, mannitol, xylitol
- salts e.g. sodium chloride, calcium carbonate
- Particles for deposition in the lung require a particle size less than 10 microns, such as 1-9 microns for example from 0.1 to 5 ⁇ , in particular from 1 to 5 ⁇ .
- the particle size of the carrying the virus is of primary importance and thus in one embodiment the virus according to the present disclosure may be adsorbed or absorbed onto a particle, such as a lactose particle of the given size.
- the propellant gases which can be used to prepare the inhalable aerosols are known in the art.
- Suitable propellant gases are selected from among hydrocarbons such as n-propane, n-butane or isobutane and halohydrocarbons such as chlorinated and/or fluorinated derivatives of methane, ethane, propane, butane, cyclopropane or cyclobutane.
- hydrocarbons such as n-propane, n-butane or isobutane
- halohydrocarbons such as chlorinated and/or fluorinated derivatives of methane, ethane, propane, butane, cyclopropane or cyclobutane.
- the above-mentioned propellant gases may be used on their own or in mixtures thereof.
- Particularly suitable propellant gases are halogenated alkane derivatives selected from among TG 11, TG 12, TG 134a and TG227.
- halogenated alkane derivatives selected from among TG 11, TG 12, TG 134a and TG227.
- TG134a 1,1,1,2-tetrafluoroethane
- TG227 1,1,2,3,3,3-heptafluoropropane
- mixtures thereof are particularly suitable.
- the propellant gas-containing inhalable aerosols may also contain other ingredients, such as cosolvents, stabilisers, surface-active agents (surfactants), antioxidants, lubricants and means for adjusting the pH. All these ingredients are known in the art.
- the propellant gas-containing inhalable aerosols according to the invention may contain up to 5 % by weight of active substance. Aerosols according to the invention contain, for example, 0.002 to 5 % by weight, 0.01 to 3 % by weight, 0.015 to 2 % by weight, 0.1 to 2 % by weight, 0.5 to 2 % by weight or 0.5 to 1 % by weight of active ingredient.
- topical administrations to the lung may also be by administration of a liquid solution or suspension formulation, for example employing a device such as a nebulizer, for example, a nebulizer connected to a compressor (e.g., the Pari LC-Jet Plus(R) nebulizer connected to a Pari Master (R) compressor manufactured by Pari Respiratory Equipment, Inc., Richmond, Va.).
- a nebulizer for example, a nebulizer connected to a compressor (e.g., the Pari LC-Jet Plus(R) nebulizer connected to a Pari Master (R) compressor manufactured by Pari Respiratory Equipment, Inc., Richmond, Va.).
- the virus of the invention can be delivered dispersed in a solvent, e.g. in the form of a solution or a suspension, for example as already described above for parenteral formulations. It can be suspended in an appropriate physiological solution, e.g., saline or other pharmacologically acceptable solvent or a buffered solution.
- a physiological solution e.g., saline or other pharmacologically acceptable solvent or a buffered solution.
- Buffered solutions known in the art may contain 0.05 mg to 0.15 mg disodium edetate, 8.0 mg to 9.0 mg NaCl, 0.15 mg to 0.25 mg polysorbate, 0.25 mg to 0.30 mg anhydrous citric acid, and 0.45 mg to 0.55 mg sodium citrate per 1 ml of water so as to achieve a pH of about 4.0 to 5.0.
- the therapeutic suspensions or solution formulations can also contain one or more excipients.
- Excipients are well known in the art and include buffers (e.g., citrate buffer, phosphate buffer, acetate buffer and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (e.g., serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. Solutions or suspensions can be encapsulated in liposomes or biodegradable microspheres.
- the formulation will generally be provided in a substantially sterile form employing sterile manufacture processes.
- This may include production and sterilization by filtration of the buffered solvent/solution used for the formulation, aseptic suspension of the antibody in the sterile buffered solvent solution and dispensing of the formulation into sterile receptacles by methods familiar to those of ordinary skill in the art.
- Nebulisable formulation according to the present disclosure may be provided, for example, as single dose units (e.g., sealed plastic containers or vials) packed in foil envelopes. Each vial contains a unit dose in a volume, e.g., 2 mL, of solvent/solution buffer.
- the present disclosure extends to a virus or a formulation thereof as described herein for use in treatment, in particular for the treatment of cancer.
- the method of treatment is for use in the treatment of a tumour, in particular a solid tumour.
- Tumour as employed herein is intended to refer to an abnormal mass of tissue that results from excessive cell division that is uncontrolled and progressive, also called a neoplasm. Tumours may be either benign (not cancerous) or malignant. Tumour encompasses all forms of cancer and metastases.
- the tumour is a solid tumour.
- the solid tumour may be localised or metastasised.
- the tumour is of epithelial origin.
- the tumour is a malignancy, such as colorectal cancer, hepatoma, prostate cancer, pancreatic cancer, breast cancer, ovarian cancer, thyroid cancer, renal cancer, bladder cancer, head and neck cancer or lung cancer.
- a malignancy such as colorectal cancer, hepatoma, prostate cancer, pancreatic cancer, breast cancer, ovarian cancer, thyroid cancer, renal cancer, bladder cancer, head and neck cancer or lung cancer.
- the tumour is a colorectal malignancy.
- Malignancy as employed herein means cancerous cells.
- the oncolytic adenovirus is employed in the treatment or prevention of metastasis.
- the method or formulation herein is employed in the treatment of drug resistant cancers.
- the virus is administered in combination with the administration of a further cancer treatment or therapy.
- virus or formulation according to the present disclosure for use in the manufacture of a medicament for the treatment of cancer, for example a cancer described above.
- a method of treating cancer comprising administering a therapeutically effective amount of a virus or formulation according to the present disclosure to a patient in need thereof, for example a human patient.
- the oncolytic virus or formulation herein is administered in combination with another therapy.
- Cancer therapy includes surgery, radiation therapy, targeted therapy and/or chemotherapy.
- Cancer treatment refers to treatment with a therapeutic compound or biological agent, for example an antibody intended to treat the cancer and/or maintenance therapy thereof.
- the cancer treatment is selected from any other anti-cancer therapy including a chemotherapeutic agent, a targeted anticancer agent, radiotherapy, radio-isotope therapy or any combination thereof.
- the virus of the present disclosure such as an oncolytic adenovirus may be used as a pre-treatment to the therapy, such as a surgery (neoadjuvant therapy), to shrink the tumour, to treat metastasis and/or prevent metastasis or further metastasis.
- the oncolytic adenovirus may be used after the therapy, such as a surgery (adjuvant therapy), to treat metastasis and/or prevent metastasis or further metastasis.
- the administration of the additional cancer treatment at the same time or approximately the same time as the oncolytic adenovirus formulation.
- the treatment may be contained within the same formulation or administered as a separate formulation.
- the virus is administered in combination with the administration of a chemotherapeutic agent.
- Chemotherapeutic agent as employed herein is intended to refer to specific antineoplastic chemical agents or drugs that are selectively destructive to malignant cells and tissues.
- alkylating agents for example, alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumour agents.
- Other examples of chemotherapy include doxorubicin, 5-fluorouracil (5- FU), paclitaxel, capecitabine, irinotecan, and platins such as cisplatin and oxaliplatin.
- the preferred dose may be chosen by the practitioner based on the nature of the cancer being treated.
- the therapeutic agent is ganciclovir, which may assist in controlling immune responses and/or tumour vascularisation.
- one or more therapies employed in the method herein are metronomic, that is a continuous or frequent treatment with low doses of anticancer drugs, often given concomitant with other methods of therapy.
- Subgroup B oncolytic adenoviruses in particular Adll and those derived therefrom such as EnAd may be particularly synergistic with chemotherapeutics because they seem to have a mechanism of action that is largely independent of apoptosis, killing cancer cells by a predominantly necrolytic mechanism. Moreover, the immunosuppression that occurs during chemotherapy may allow the oncolytic virus to function with greater efficiency.
- Therapeutic dose as employed herein refers to the amount of virus, such as oncolytic adenovirus that is suitable for achieving the intended therapeutic effect when employed in a suitable treatment regimen, for example ameliorates symptoms or conditions of a disease.
- a dose may be considered a therapeutic dose in the treatment of cancer or metastases when the number of viral particles may be sufficient to result in the following: tumour or metastatic growth is slowed or stopped, or the tumour or metastasis is found to shrink in size, and/or the life span of the patient is extended.
- Suitable therapeutic doses are generally a balance between therapeutic effect and tolerable toxicity, for example where the side-effect and toxicity are tolerable given the benefit achieved by the therapy.
- a virus or therapeutic construct according to the present disclosure is administered weekly, for example one week 1 the dose is administered on day 1, 3, 5, followed by one dose each subsequent week.
- a virus or therapeutic construct according to the present disclosure is administered bi-weekly or tri-weekly, for example is administered in week 1 one on days 1, 3 and 5, and on week 2 or 3 is also administered on days 1, 3 and 5 thereof.
- This dosing regimen may be repeated as many times as appropriate.
- a virus or therapeutic construct according to the present disclosure is administered monthly.
- the viruses and constructs of the present disclosure are prepared by recombinant techniques.
- the armed adenovirus genome can be manufactured by other technical means, including entirely synthesising the genome or a plasmid comprising part of all of the genome.
- the region of insertion may not comprise the restriction site nucleotides as the latter are artefacts following insertion of genes using cloning methods.
- the armed adenovirus genome is entirely synthetically manufactured, for example as per SEQ ID NOs: 34 to 37.
- the disclosure herein further extends to an adenovirus of formula (I) or a subformula thereof, obtained or obtainable from inserting a transgene or transgene cassette.
- Embodiments of the invention comprising certain features/elements are also intended to extend to alternative embodiments "consisting" or “consisting essentially” of the relevant elements / features.
- FIG. 1 (A) schematic representation of a BiTE antibody of the present disclosure comprising or lacking an optional decahistidine affinity tag.
- Ig SP signal peptide
- lOHis decahistidine affinity tag
- L GS linker
- VL variable light domain
- VH variable heavy domain (B) plasmid map for pSF-CMV-EpCAMBiTE.
- C plasmid map for pSF- CMV-FAPBiTE.
- D plasmid map for pSF-CMV-ControlBiTE.
- Figure 2 (A) dot blot showing the quantification of the recombinant BiTEs. (B) shows a graph showing the ELISA results for FAP. (C) graph showing the ELISA results for EpCAM.
- Figure 3 shows a graph showing the expression levels of CD69 (A) and CD25 (B) for T cells co-cultured alone or with NHDF cells in the presence of FAP BiTE and control BiTE measured using flow cytometry.
- A graph showing the levels of IFN y expression for T cells co-cultured alone or with NHDF cells in the presence of FAP BiTE and control BiTE measured by intracellular cytokine staining.
- Graphs (B) & (C) show the expression levels of CD69 and CD25 for T cells co-cultured alone or with DLD cells in the presence of EpCAM BiTE and control BiTE measured using flow cytometry.
- FIG. 1 shows a graph showing T-cell activation (based onCD69 and CD25 expression levels) by CHO vs CHO-FAP cells, analysed using flow cytometry.
- FIG. 1 shows graph showing T-cell activation (based onCD69 and CD25 expression levels) by CHO vs CHO-EpCAM cells, analysed using flow cytometry.
- A graph showing the ability of FAP BiTE to activate CD4+ or CD8+ T-cells (based on CD69 and CD25 expression levels), analysed using flow cytometry.
- B graph showing the results of a LDH assay showing the cytoxicity of NHDF cells which have been co-cultured with CD4+ or CD8+ T cells and FAP BiTE or control BiTE.
- FIG. 6 shows still frame images from timelapse videos of lysis of NHDF cells by NG-607, NG- 608, NG-609 or NG-610.
- FIG. 1 shows a graph showing T-cell activation (based on CD69 and CD25 expression levels) by EnAd, NG-601, NG-602, NG-603 and NG-604, analysed by flow cytometry, shows the results of experiments to determine the ability of NG-601 to kill DLD tumour cells at varying multiplicity of infection (MOI) in the presence or absence of CD3 + T-cells, assessed using xCELLigence.
- MOI multiplicity of infection
- FIG. 1 shows a graph showing T-cell activation (based on CD69 and CD25 expression levels) by EnAd, NG-601, NG-602, NG-603 and NG-604 co-cultured with SKOV tumour cells, analysed using flow cytometry.
- FIG. 1 shows a graph showing T-cell activation (based on CD69 and CD25 expression levels) by EnAd, NG-601, NG-602, NG-603 and NG-604 co-cultured with ascites cells, analysed using flow cytometry.
- FIG. 1 shows microscopy images of ascites cells obtained from a patient, infected with viruses of the present disclosure and stained with EnAd-CMV-GFP and EnAd-SA-GFP as a reporters to determine infection and late stage viral gene expression.
- FIG. 1 shows microscopy images of ascites cells obtained from a cancer patient, infected with viruses of the present disclosure and stained with EnAd-CMV-GFP and EnAd- SA-GFP as a reporters to determine infection and late stage viral gene expression, shows a graph indicating the number of CD3+ T cells in ascites samples obtained from a cancer patient and infected with viruses of the present disclosure, shows a graph indicating the CD25 expression levels on CD3+ T cells in ascites samples obtained from a cancer patient and infected with viruses of the present disclosure.
- FIG. 1 shows a graph indicating the number of FAP+ cells in ascites samples obtained from a cancer patient and infected with viruses of the present disclosure.
- EpCAM BiTE Characterisation of EpCAM BiTE and its effects on PBMC-derived T cells
- A Schematic of the structure of the EpCAM-targeted BiTE and non-specific control BiTE. The VL and VH domains are connected with flexible peptide linkers (L) rich in serine and glycine for flexibility and solubility. Ig SP, Light chain immunoglobulin signal peptide; lOHis, decahistidine affinity tag.
- B Induction of activation markers CD69 and
- CD25 CD25 on CD3-purified PBMC cultured alone or with DLD cells (5:1) in the presence of BiTE-containing supernatants. CD69 and CD25 were measured by flow cytometry after 24 h of co-culture.
- D Percent of IFNy-positive T-cells after 6 h in co-culture with DLD cells (5:1) and BiTE-containing supernatants.
- E Proliferation, represented by division index and percentage of parental T cell population entering proliferation, of CFSE-stained T- cells in co-culture with DLD cells (5:1) and BiTE-containing supernatants. Fluorescence was measured by flow cytometry 5 days after co-culture. Division index was modelled using Flowjo proliferation tool.
- F Degranulation of T-cells, measured by CD107a externalisation, in co-culture with DLD cells (5:1) and BiTE- containing supernatants.
- A Induction of activation marker CD25 on CD3+ T-cells in co-culture with CHO or CHO-EpCAM cells (5:1) and BiTE-containing supernatants, measured by FACS analysis after 24 h of co-culture.
- B Cytotoxicity of CHO or CHO-EpCAM cells cultured with BiTE-containing supernatants alone or in coculture with T-cells. Cytotoxicity was assessed by release of LDH into the culture supernatants after 24 h of incubation.
- C Cytotoxicity of multiple EpCAM-positive carcinoma cells after 24 h in co-culture with T-cells (1:5) and BiTE-containing supernatants.
- Viability was measured by MTS assay after 24 h of co-culture.
- AC Each condition was measured in biological triplicate and represented as mean ⁇ SD. Significance was assessed versus untreated or T-cell only controls using a one-way ANOVA test with Tukey's Post Hoc analysis, *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
- SKOV3 cells were incubated with EnAd or recombinant viruses in the absence (A) or presence (B) of T cells and cytotoxicity was measured by LDH release at the specified time-points. Significance was assessed by comparison to uninfected control wells using a one-way ANOVA test with Tukey's Post Hoc analysis, ***p ⁇ 0.001
- Cytotoxicity for infected DLD cells in absence (A) or presence of T-cells B. DLD cells were infected and co-cultured with T-cells and cytotoxicity was measured by LDH release at the specified timepoints.
- C-D T-cells from (B) were harvested and stained for activation markers CD69 (C) or CD25 (D) and analysed via flow cytometry.
- E-F Quantification of EpCAM BiTE-produced from DLD cells infected with recombinant viruses. Standard curve of LDH released (Abs) of DLD in co-culture with CD3+ cells and varying known quantities of recombinant EpCAM BiTE (E).
- DLD cells were infected with parental EnAd or recombinant virus (100 vp/cell) and wells harvested at 24 or 72 h. Replication was assessed by measuring genomes using qPCR against viral hexon.
- B Cytotoxicity of DLD cells infected with EnAd or recombinant virus at increasing concentrations of virus. Cytotoxicity was measured by MTS assay after 5 days infection.
- C Supernatants from day 3 uninfected or virus- infected HEK293A cells were assessed for transgene expression by immunoblot analysis and probed with an anti-His antibody.
- E Cytotoxicity of CHO or CHO-EpCAM cells incubated with HEK293A supernatants from (D) alone or in co-culture with CD3-purified PBMC (E:T 5:1). HEK293A supernatants were diluted 300-fold. Cytotoxicity was assessed by LDH released into the supernatant after 24 h incubation. Each condition was measured in biological triplicate and represented as mean ⁇ SD. Significance was assessed using a one-way ANOVA test with Tukey's Post Hoc analysis with each condition compared to untreated, *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
- T cells were harvested and analysed for surface expression of CD69 (C) or CD25 (D) by flow cytometry.
- E Time-lapse sequences showing co-cultures of SKOV3 carcinoma cells (unstained), NHDF fibroblasts (red) and CD3-purified PBMC (blue), infected with EnAd, EnAd- CMVEpCAMBiTE or uninfected. Apoptosis was visualised using CellEvent Caspase 3/7 detection reagent (green). Images were taken on a Nikon TE 2000-E Eclipse inverted microscope at intervals of 15 min covering a period of 96 h. Representative images were recorded at the times displayed; original magnification xlO; scale bar 100 ⁇ .
- B-D Unpurified total cells from pleural effusions (from three different patients) were incubated in 100% fluid from the same pleural exudate in the presence of free BiTE, EnAd or recombinant virus. After 5 days, the total cell population was harvested, and the number of (B) CD3+ T cells and those which were (C) CD25+ were quantified.
- EpCAM BiTE can selectively kill primary human tumour cells from chemotherapy-pretreated patients
- ure 56 EpCAM BiTE can overcome immune suppressive effects of ascites fluid and activate endogenous T cells
- PBMC-derived T cells were incubated with anti-CD3 antibodies in RPMI culture medium or the presence of 100% peritoneal ascites fluid from five ovarian cancer patients.
- A At 24 h induction of T cell activation markers CD69 and CD25 were analysed, and (B) degranulation of T-cells measured by CD107a externalisation, using flow cytometry.
- C Viability of MCF7 cells were monitored in real-time over 60 h by xCELLigence-based cytotoxicity assay. MCF7 cells were seeded and incubated with control or EpCAM BiTE at 25 h, in the presence of RPMI medium or 100% ascites fluid #1 or #2. Untreated cells served as a negative control.
- CD3-purified PBMC (5:1) were added at the same time and impedance was measured at 15 min intervals.
- D Endogenous unpurified total cells from peritoneal ascites were incubated in 100% ascites fluid in the presence of free EpCAM or control BiTE. After 24 h, the total cell population was harvested, and the number of CD3+/CD69+ and CD3+/CD25+ cells measured by flow cytometry. Each condition was measured in biological triplicate and represented as mean ⁇ SD. Significance was assessed by comparison to RPMI (A+B), untreated (D) or control BiTE (E) using a oneway ANOVA test with Tukey's Post Hoc analysis, *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
- EnAd expressing EpCAM BiTE can activate endogenous T cells to kill endogenous tumour cells within malignant pleural exudates
- Unpurified total cells from pleural effusions (from four different patients) were incubated in 100% fluid from the same pleural exudate in the presence of free BiTE, EnAd or recombinant virus. After 5 days, the total cell population was harvested, and the number of (A) CD3+ T cells and those which were (B) CD25+ were quantified. (C) The number of EpCAM+ cells was measured using flow cytometry. (D) Representative images (magnification xlO; scale bar 100 ⁇ ) and flow cytometry analysis of pleural effusion cells of Patient 3 (cancer cells and lymphocytes) following treatment with EnAd or EnAd-CMVEpCAM BiTE.
- IL-10 shows quantity of IL-10 measured in normal serum (NS) or patient malignant exudate fluids (A: peritoneal ascites, P: pleural effusions) using Human IL-10 ELISA MAX kit (Biolegend, 430604).
- FIG. 1 shows CD3/28 bead-mediated PBMC T-cell degranulation (based on CD107a expression) in patient fluids.
- EpCAM BiTE bead-mediated PBMC T-cell activation (based on CD69/CD25 expression) in patient fluids.
- EpCAM BiTE-mediated T-cell activation (based on CD25/CD69 expression) in RPMI media vs ascites fluid. shows the ability of EnAd-SA-EpCAMBiTE and EnAd-SA-ControlBiTE to induce T cell-mediated target cell lysis in RPMI media vs ascites fluid.
- FAP-targeted BiTE induces T-cell degranulation and specific cytotoxicity of FAP+ cells
- EnAd expressing FAP BiTE selectively kills FAP + fibroblasts and decreases TGFb in peritoneal ascites samples
- A,B Number of of FAP + fibroblasts (A) and EpCAM + tumour cells (B) after 72 h culture with PBMC-derived T-cells and EnAd or recombinant viruses. Ascites cells were first isolated from three patients ascites and expanded ex vivo. Cell number was measured at 72 h post-infection by flow cytometry.
- C Induction of activation marker CD25 on PBMC-derived CD3 cells from (A) was measured at 72 h postinfection.
- D Levels of TGFb were measured by ELISA using supernatants harvested from (A).
- T cell activation measured by CD25 expression.
- B residual number of FAP+ cells measured by flow cytometry.
- C Quantity of interferon gamma in culture supernatants from (B, D) measured by ELISA.
- A The expression of PD-1 by endogenous T cells following isolation from healthy donors or malignant exudate cancer biopsy samples. PD-1 expression was measured by flow cytometry.
- B The proportion of CD3 + cells within the unpurified cell population of PBMC and cancer biopsy samples as measured by flow cytometry.
- C Levels of interferon gamma measured by ELISA in culture supernatants harvested from (B) at 120 h post-treatment.
- D Viability of NHDF fibroblasts were monitored in real time over 130 h by xCELLigence cytotoxicity assay in co-culture with PBMC or total cancer biopsy cells (1:5) and BiTE-containing supernatant.
- Figure 74 shows the effect of immunosuppressive ascites fluid samples on FAP BiTE- and anti- CD3/CD28 bead-mediated activation of PBMC T-cells.
- A PBMC T cells activated with anti-CD3/Cd28 Dynabeads.
- B PBMC T cells activated with control or FAP BITEs in the presence of NHDF cells.
- NS normal serum
- A peritoneal ascites.
- Figure 75 FAP BiTE expressing EnAd polarises CDllb + macrophage in patient ascites to a more inflammatory phenotype
- A EpCAM staining
- B CD8 staining
- C FAP staining
- D Representative immunohistochemistry images of CD25 induction within prostate tumour slices following treatment with BiTE expressing viruses. Tumour cores were sliced at 300 uM thickness with a Leica vibratome, cultured and infected in inserts and harvested after 7 days treatment.
- E Levels of IFNg in tissue slice culture medium measured by ELISA. Supernatants were harvested from slices cultures of malignant and benign tissue at the specified time-point.
- F Levels of IL-2 in tissue culture medium of malignant and benign tissue measured by ELISA.
- Figure 77A-C shows a schematic representation of the transgene cassettes used in Example 33. shows a graph indicating the number of viral genomes detected per cell in NG-611, NG-612 and NG-617 treated tumour cells.
- FIG. 1 shows schematic representation of transgene cassettes, (a) NG-615, (b) NG-640, (c) NG-641.
- FIG. 1 shows the expression of IFNa, MlPla and Flt3 L in the cellular supernatant of NG- 615 vs the supernatant of enadenotucirev and untreated control tumour cells, shows the number of T cells expressing CD69 (a), CD25 (b) HLA-DR (c), CD40L (d) or cell surface CD107a (e) ) following co-culture with FAP expressing MRC-5 cells and supernantants harvested from A549 cells at 24, 48 or 72hrs post-treatment with NG-615 viurs particles compared to NG-612, enadenotucirev or untreated control supernatants.
- FIG. 1 shows the detection of surface FAP expression on MRC-5 cells (a) or EpCam expression on SKOV cells (b) following incubation with supernatants harvested from A549 cells at 72hrs post-treatment with NG-611, NG-612, NG-615 or enadenotucirev virus particles. shows the percentage of T cells expressing CD24 (a), CD40L (b) or cell surface CD107a (c) following co-culture with FAP expressing MRC-5 cells and supernatants harvested from A549 cells at 72hrs post-treatment with NG-618 virus particles compared to enadenotucirev or untreated controls.
- SEQ ID NO: 2 Anti-EpCAM BiTE protein sequence, with N-terminal signal sequence and C- terminal deca-His affinity tag
- SEQ ID NO: 4 Anti-FAP BiTE amino acid sequence, with N-terminal signal sequence and C- terminal deca-His affinity tag
- SEQ ID NO: 5 Control (Anti-FHA) BiTE DNA coding sequence, with N-terminal signal sequence and C-terminal deca-His affinity tag
- SEQ ID NO: 6 Control (Anti-FHA) BiTE amino acid sequence with N-terminal signal
- SEQ ID NO: 7 Anti-CD3 ScFv amino acid sequence
- SEQ ID NO: 8 Anti-CD3 VH
- SEQ ID NO: 10 Anti-CD3 ScFv linker sequence
- SEQ ID NO: 11 Anti-FAP ScFv
- SEQ ID NO: 12 Anti-FAP VL domain
- SEQ ID NO: 13 Anti-FAP VH domain
- SEQ ID NO: 14 Anti-FAP and Anti-EpCAM linker sequence
- SEQ ID NO: 15 BiTE leader sequence
- SEQ ID NO: 16 Anti-EpCAM ScFv
- SEQ ID NO: 17 Anti-EpCAM VL
- SEQ ID NO: 18 Anti-EpCAM VH
- SEQ ID NO: 19 Control BiTE (Anti-FHA)
- SEQ ID NO: 20 Control (Anti-FHA) ScFv
- SEQ ID NO: 21 Control (Anti-FHA) VL
- SEQ ID NO: 22 Control (Anti-FHA) VH
- SEQ ID NO: 23 Control (Anti-FHA) ScFv linker sequence
- SEQ ID NO: 24 Deca-His Tag sequence
- SEQ ID NO: 27 Human EpCAM DNA coding sequence
- SEQ ID NO: 28 Human EpCAM amino acid sequence
- SEQ ID NO: 29 Human FAP DNA coding sequence
- SEQ ID NO: 30 Human FAP amino acid sequence
- SEQ ID NO: 31 CMV promoter sequence
- SEQ ID NO: 32 SV40 late polyadenylation sequence
- SEQ ID NO: 34 Null sequence
- SEQ ID NO: 35 Null sequence
- SEQ ID NO: 36 Null sequence
- SEQ ID NO: 37 Null sequence
- SEQ ID NO: 39 DNA sequence corresponding to and including bp 28166-28366 of the
- SEQ ID NO: 40 DNA sequence corresponding to and including bp 29345-29379 of the
- SEQ ID NO: 42 Splice acceptor sequence.
- SEQ ID NO: 45 FAP BiTE nucleic acid sequence (OKT3)
- SEQ ID NO: 46 FAP BiTE nucleic acid sequence (aCD3)
- SEQ ID NO: 56 splice acceptor (SA) DNA sequence
- SEQ ID NO: 65 polyadenylation (polyA) sequence
- SEQ ID NO: 72 Anti-EpCAM BiTE DNA coding sequence, with N-terminal signal sequence and C-terminal deca-His affinity tag
- SEQ ID NO: 73 Anti-EpCAM BiTE protein sequence, with N-terminal signal sequence without C-terminal deca-His affinity tag
- SEQ ID NO: 74 Anti-FAP BiTE DNA coding sequence, with N-terminal signal sequence without C-terminal deca-His affinity tag
- SEQ ID NO: 75 Anti-FAP BiTE amino acid sequence, with N-terminal signal sequence without C-terminal deca-His affinity tag
- SEQ ID NO: 76 Control (Anti-FHA) BiTE DNA coding sequence, with N-terminal signal sequence without C-terminal deca-His affinity tag
- SEQ ID NO: 77 Control (Anti-FHA) BiTE amino acid sequence with N-terminal signal sequence without C-terminal deca-His affinity tag
- SEQ ID NO: 78 Control BiTe (Anti-FHA) without C-terminal deca-His affinity tag
- SEQ ID NO: 79 Null sequence
- SEQ ID NO: 80 Null sequence
- SEQ ID NO: 81 Null sequence
- SEQ ID NO: 82 Null sequence
- SEQ ID NO: 83 EpCam BiTE nucleic acid sequence (OKT3)
- SEQ ID NO: 84 Null sequence
- SEQ ID NO: 85 FAP BiTE nucleic acid sequence (OKT3)
- SEQ ID NO: 86 Null sequence
- SEQ ID NO: 87 FAP BiTE nucleic acid sequence (aCD3)
- SEQ ID NO: 93 EpCam BiTE amino acid sequence (OKT3)
- SEQ ID NO: 94 FAP BiTE amino acid sequence (OKT3)
- SEQ ID NO: 95 FAP BiTE amino acid sequence (aCD3]
- SEQ ID NO: 96 Null sequence
- SEQ ID NO: 97 Null sequence
- SEQ ID NO: 98 Null sequence
- SEQ ID NO: 99 Null sequence
- SEQ ID NO: 100 Null sequence
- SEQ ID NO: 101 Null sequence
- SEQ ID NO: 102 Null sequence
- SEQ ID NO: 103 Null sequence
- SEQ ID NO: 124 to 297 are linker sequences
- adenovirus encoding a EpCam BiTE in position BY under the control of a CMV promoter
- adenovirus encoding a EpCam BiTE and splice acceptor in position BY adenovirus encoding a FAP BiTE in position BY under the control of a CMV promoter
- adenovirus encoding a FAP BiTE and splice acceptor in position BY NG-611 adenovirus encoding a EpCam BiTE and SSA in position BY
- NG-612 adenovirus encoding a FAP BiTE and SSA in position BY
- NG-613 adenovirus encoding a FAP BiTE and SA in position BY
- NG-614 adenovirus encoding a FAP BiTE and SA in position BY (with different CD3
- NG-615 adenovirus encoding a FAP BiTE, FLt3 Ligand, interferon alpha, MIP alpha, ans SSA in position BY.
- NG-616 adenovirus encoding a FAP BiTE, FLt3 Ligand, interferon alpha, MIP alpha, ans SA in position BY.
- NG-617 adenovirus encoding FAP BiTE and SSA in position BY
- NG-640 adenovirus econding FAP BiTE, CXCL10, CXCL9 and SSA in position BY.
- NG-641 adenovirus encoding FAP BiTE, CXCL10, CXCL9 and interferon alphap in position
- BiTEs are generated by joining two single chain antibody fragments (ScFv) of different specificities with a flexible Gh/4Ser linker. ScFv's are created by the joining of V H and V L domains from parental monoclonal antibodies by a linker.
- Each BiTE was designed with an N-terminal signal sequence for mammalian secretion and a C-terminal decahistidine affinity tag for detection and purification.
- BiTEs were engineered by standard DNA cloning techniques and inserted into protein expression vectors ( Figure 1).
- the anti-EpCAM BiTE is that from patent WO 2005040220 (SEQ ID NO: 63 therein), with a signal sequence and affinity tag added.
- the anti-FAP BiTE was created de novo using the anti-FAP ScFv from patent WO2010037835A2 and the anti-CD3 ScFv from patent WO 2005040220 (SEQ ID 63 therein), with a signal sequence and affinity tag added.
- a control BiTE used the anti-FHA (filamentous haemagglutinin from Bordetella pertussis) ScFv from Hussein et al, 2007 (Hussein AH et al (2007) "Construction and characterization of single-chain variable fragment antibodies directed against the Bordetella pertussis surface adhesins filamentous hemagglutinin and pertactin".
- Recombinant BiTE proteins were produced by cloning the respective sequences into the pSF-CMV vector using a CMV promoter (SEQ ID NO: 31) to drive protein expression ( Figure 1).
- Empty pSF-CMV vector is included as a negative control. 54.7 ⁇ g of each was diluted with 4 mL OptiMEM.
- PEI linear, MW 25000, Polysciences, USA
- DNA:PEI ratio 1:2 (w/w)
- the complex mixture was topped up to 18 mL with OptiMEM and this transfection mixture was added to a T175 flask containing Ad293 cells at 90% confluency.
- p employed as a prefix in naming constructs indicates that the construct is a plasmid.
- the C-terminal decahistidine affinity tag can be probed with an anti-His antibody using the technique of western blotting.
- Protein samples were adjusted with lysis buffer to a final volume of 15 ⁇ ., including 2,5 ⁇ ., 6x Laemmli SDS Sample Buffer which contains ⁇ -mercaptoethanol and SDS. Samples were incubated for 5 minutes at 95 °C to denature proteins and loaded onto 15- well 10% precast polyacrylamide gels (Mini-PROTEAN TGX Precast Gels, BioRad, UK). Gels were run at 180 V for 45 minutes in 1 x running buffer within a Mini-PROTEAN Tetra System (BioRad, UK).
- Proteins from the SDS gels were transferred onto nitrocellulose membranes by wet electroblotting at 300 mA and 4 °C for 90 minutes in 1 x transfer buffer within a Mini Trans-Blot Cell (BioRad, UK). Transfer was performed in presence of an ice pack to limit heat. The nitrocellulose membrane was then blocked with 5% milk in PBS-T on a shaker for 1 hour at room temperature, and probed with anti-His (C-term) antibody (mouse a-6xHis, clone 3D5, Invitrogen, UK, #46-0693), diluted 1:5000 in PBS/5% milk.
- C-term antibody mouse a-6xHis, clone 3D5, Invitrogen, UK, #46-0693
- the FAP-binding activity of the FAP BiTE and control (anti-FHA) BiTE (SEQ ID NOs: 4 and 6) secreted from cells transfected with pSF-CMV-FAPBiTE or pSF-CMV-ControlBiTE was assessed by enzyme- linked immunosorbent assay (ELISA). Empty pSF-CMV vector supernatants were included as a negative control.
- ELISA plates (Nunc Immuno MaxiSorp 96 well microplate) were prepared by coating overnight at 4°C with human FAP/seprase protein (lOOng/well, Sino Biological Inc, 10464- H07H-10) in PBS buffer. Plates were washed between all subsequent binding steps with PBS 0.05% Tween 20.
- the plates were blocked for 1 hour at room temperature with 5% BSA in PBS 0.05% Tween 20. Aliquots of BiTE protein, or protein harvested from empty pSF-CMV vector-transfected wells, were diluted 10-fold into PBS/5% BSA/0.05% Tween 20. All samples were added to the FAP coated plates and incubated for 2 hr at room temperature.
- the detection antibody, anti-His (C-term) antibody was diluted 1:1000 and applied for 1 hour at room temperature.
- HRP conjugated anti-mouse-Fc (1:1000 in PBS/5% milk, Dako) was then applied for 1 hr at room temperature before HRP detection was performed with HRP substrate solution 3.3.5.5'-teramethylethylenediamine (TMB, Thermo-Fisher). Stop solution was used for terminating the reaction and the developed colour was measured at 450nm on a plate reader. Absorbance at 450nm was plotted for FAP BiTE, control BiTE and empty vector supernatants, demonstrating specific binding of the FAP BiTE to FAP protein. The results ( Figure 2B) show the specific binding of the FAP BiTE and not control BiTE to recombinant FAP protein.
- EpCAM-binding activity of the EpCAM BiTE and control BiTE (SEQ ID NOs: 2 and 6) secreted from cells transfected with pSF-CMV-EpCAMBiTE or pSF-CMV-ControlBiTE was assessed by enzyme-linked immunosorbent assay (ELISA). Empty pSF-CMV vector supernatants are included as a negative control.
- ELISA plates A Nunc Immuno MaxiSorp 96 well microplate) were prepared by coating overnight at 4°C with human EpCAM/TROP-1 protein (50ng/well, Sino Biological Inc, #10694-H02H-50) in PBS buffer. Plates were washed between all subsequent binding steps with PBS 0.05% Tween 20.
- the plates were blocked for 1 hour at room temperature with 5% BSA in PBS 0.05% Tween 20. Aliquots of BiTE protein, or protein harvested from empty pSF-CMV vector- transfected wells, were diluted 10-fold into PBS/5% BSA/0.05% Tween 20. All samples were added to the EpCAM coated plates and incubated for 2 hr at room temperature.
- the detection antibody anti-His (C-term) antibody (mouse anti-6xHis, clone 3D5, Invitrogen, UK, #46-0693) was diluted 1:5000 and applied for 1 hour at room temperature.
- HRP conjugated anti-mouse-Fc (1:1000 in PBS/5% milk, Dako,) was then applied for 1 hr at room temperature before HRP detection was performed with HRP substrate solution 3.3.5.5'-teramethylethylenediamine (TMB, Thermo-Fisher). Stop solution was used for terminating the reaction and the developed colour was measured at 450nm on a plate reader. Absorbance at 450nm was plotted for EpCAM BiTE, control BiTE and empty vector supernatants demonstrating specific binding of EpCAM BiTE to recombinant EpCAM. The results ( Figure 2C) show the specific binding of the EpCAM BiTE and not control BiTE to recombinant EpCAM protein.
- PBMCs peripheral blood mononuclear cells
- Human PBMCs were isolated by density gradient centrifugation either from fresh human blood samples of healthy donors or from whole blood leukocyte cones, obtained from the NHS Blood and Transplant UK in Oxford. In either case, the samples were diluted 1:2 with PBS and 25 mL of this mixture was layered onto 13 mL Ficoll (1.079g/mL, Ficoll-Paque Plus, GE Healthcare) in a 50 mL Falcon tube. Samples were centrifuged (Allegra X-15R, Beckman Coulter) at 1600 rpm for 30 minutes at 22 °C with the lowest deceleration setting to preserve phase separation.
- PBMCs Plasma-derived myeloma cells
- Ficoll layer a layer of red blood cells and granulocytes at the bottom.
- the PBMCs were collected using a Pasteur pipette and washed twice with PBS (1200 rpm for 10 minutes at room temperature) and re-suspended in RPMI medium supplemented with 10% FBS.
- CD3-positive (CD3 + ) T-cells were extracted from PBMCs by depletion of non-CD3 cells using a Pan T Cell Isolation Kit (Miltenyi Biotec, #130-096-535), according to the manufacturer's protocol.
- All cell lines were maintained in DMEM (Sigma-Aldrich, UK) or RPMI medium (Sigma-Aldrich, UK) as specified in Table 3, supplemented with 10% (v/v) foetal bovine serum (FBS, GibcoTM) and 1% (v/v) Penicillin/Streptomycin (10 mg/mL, Sigma-Aldrich, UK), in a humidified incubator (MCO- 17AIC, Sanyo) at 37°C and 5% CO2, unless otherwise specified. Cells were split every 2 to 3 days before reaching confluency by enzymatic dissociation with Trypsin/EDTA (0.05% trypsin 0,02% EDTA, Sigma-Aldrich, UK).
- culture medium was aspirated and cells were washed with 15 ml of PBS and subsequently cells were treated with 2 mL of Trypsin/EDTA for 2-10 minutes at 37 °C. Trypsin was neutralized with 10 mL of DMEM containing 10% FBS and a portion of the cells was transferred into new flasks containing fresh medium.
- media was supplemented with 10% FBS, for infections and virus plasmid transfections with 2% FBS and for recombinant BiTE plasmid transfections with no FBS supplement.
- the ability of the FAP BiTE to induce T-cell activation in the presence or absence of normal human dermal fibroblast (NHDF) cells was compared.
- Human CD3 + T-cells (70,000 cells per well in 96-well U-bottom plates) were co-cultured alone or with NHDF cells (10:1 T:NHDF) in the presence of media alone or 300 ng/mL FAP or control BiTE. Cells were co-cultured for 24 hours at 37°C and subsequently harvested with enzyme-free cell dissociation buffer (Thermo, #13151014).
- T-cells were assessed by intracellular cytokine staining 6 hr after co-culture with NHDF cells (200,000 CD3 + cells plus 40,000 NHDF in wells of a 96-well plate) and 300ng/mL FAP or control BiTE.
- CD45 + T-cells were intracellularly stained for IFNy expression with Brefeldin A added into the culture medium 5 hours before harvest.
- T-cells were stimulated with soluble PMA (lOng/mL) and ionomycin (l ⁇ g/mL).
- the results shown in Figure 4A indicate that the FAP BiTE in the presence of NHDF resulted in a significantly higher number of IFNy expressing T-cells compared to the control BiTE.
- EpCAM BiTE The ability of the EpCAM BiTE to induce T-cell activation in the presence or absence of the EpCAM- positive DLD cell line was compared.
- Human CD3 + T-cells (70,000 cells per well in 96-well U-bottom plates) were co-cultured alone or with DLD cells (10:1 T:DLD) in the presence of media alone or 600 ng/mL EpCAM or control BiTE. Cells were co-cultured for 24 hours at 37 °C and subsequently harvested with enzyme-free cell dissociation buffer. The expression levels of CD69 and CD25 on CD45 + T-cells were then analysed by antibody staining and flow cytometry and data represented as geometric mean fluorescence (gMFI) values.
- gMFI geometric mean fluorescence
- Plate-immobilised anti-CD3 antibody (7 ⁇ g/mL) was used as positive control for T cell activation.
- the EpCAM BiTE selectively induced the expression of activation markers CD69 and CD25 on T-cells, indicating that it was able to activate T cells ( Figure 4B & C).
- T-cells were assessed by intracellular cytokine staining 6 hr after co-culture with DLD cells (200,000 CD3 + T-cells plus 40,000 DLD cells per well of a 96-well plate) and 300ng/mL EpCAM or control BiTE.
- CD45 + T-cells were intracellularly stained for IFNy expression with Brefeldin A added into the culture medium 5 hours before harvest.
- T cells were stimulated with soluble PMA (lOng/mL) and ionomycin ( ⁇ g/mL). The results showed that the EpCAM BiTE in the presence of DLD resulted in a significantly higher number of IFNy expressing T-cells compared to the control BiTE (Figure 5A).
- PBMCs from 8 different blood donors were used to evaluate donor- dependent variations in BiTE-mediated T-cell activation.
- DLD 7,000 cells
- PBMC peripheral blood mononuclear cell
- EpCAM BiTE EpCAM BiTE
- Cells were co-cultured for 24 hours at 37°C and subsequently harvested.
- the expression levels of CD69 and CD25 on CD45 + T-cells were then analysed by antibody staining and flow cytometry and data represented as geometric mean fluorescence (gMFI) values.
- the results showed that the EpCAM BiTE induced the expression of activation markers CD69 and CD25 in CD3 + T-cells from all 8 donors ( Figure 5B & C).
- FAP BiTE induces T cell-mediated lysis ofFAP-positive cell lines and primary cells
- NHDF 7,000 cells were co-cultured with 70,000 T-cells in wells of a U-bottom 96 well plate in the presence of media alone or 300 ng/mL of control or FAP BiTE. After 24 hours of co-culture, supernatants were harvested and cytotoxicity determined by LDH assay following the manufacturer's instructions. The results are in Figure 6A show that the FAP BiTE significantly increased lysis of NHDF cells.
- the dose-response relationship for FAP BiTE-mediated cell lysis was evaluated by co-culturing 8,000 NHDF cells with 40,000 T-cells and BiTE concentrations ranging from 2xl0 3 to 2x l0 2 ng/mL. After co-culture for 24 hours at 37°C, an LDH assay was performed on supernatants to determine target cell cytotoxicity. Dose response curves were fitted using a four parameter non-linear fit model integrated into GraphPad Prism, generating an EC50 value for the FAP BiTE of 3.2ng/mL. The results ( Figure 8A) show a dose-dependent relationship between FAP BiTE concentration and cytotoxicity as measured by LDH assay (shown as Abs 4 go).
- EpCAM BiTE induces T cell-mediated lysis of EpCAM-positive cell lines
- DLD tumour cells (7,000 cells) were co-cultured with 70,000 T-cells in wells of a U-bottom 96 well plate in the presence of media alone or 300ng/mL of control or EpCAM BiTE. After 24 hours of co- culture, supernatants were harvested and cytotoxicity determined by LDH assay.
- the results in Figure 8B show that the EpCAM BiTE significantly increased lysis of DLD cells (EpCAM expression on DLD cells is shown in Figure 8C).
- the dose-response relationship for EpCAM BiTE-mediated cell lysis was evaluated by co-culturing 8,000 DLD with 40,000 T-cells and EpCAM or control BiTE concentrations ranging from 2xl0 3 to 2xl0 2 ng/mL. After co-culture for 24 hours at 37°C, an LDH assay was performed on supernatants to determine target cell cytotoxicity. Dose response curves were fitted using a four parameter nonlinear fit model integrated into GraphPad Prism, generating an EC50 value for the EpCAM BiTE of 7.4ng/mL. The results in Figure 10 show a dose dependent relationship between EpCAM BiTE concentration and cytotoxicity.
- Stable FAP expressing CHO and Ad293 cell lines were generated as a means to demonstrate the FAP antigen specificity of the FAP BiTE by comparing to parental untransfected cells.
- the protein sequence of the FAP gene was obtained from the NCBI database (SEQ ID 30), reverse transcribed to generate a DNA coding sequence that was synthesised by Oxford Genetics Ltd (Oxford, UK).
- the FAP gene was cloned into pSF-Lenti vector by standard cloning techniques producing the pSF-Lenti-FAP vector.
- HEK293T cells were transfected with the lentivirus FAP expression vector alongside pSF-CMV-HIV-Gag-Pol, pSF-CMV-VSV-G, pSF-CMV-HIV-Rev.
- Lipofectamine 2000 was used as a transfection reagent and was added to the vector DNA at a DNA:lipofectamine ratio of 1:2, and incubated with the cells at 37°C.
- Supernatant containing lentivirus was harvested 48 hours later and mixed with polybrene (final concentration, 8 ⁇ g/mL).
- the Lentivirus/polybrene mixture was added to seeded Ad293 or CHO cells and incubated at 37°C. On day 4, the supernatant was exchanged for media containing puromycin for CHO).
- Stable variants were then clonally selected and FAP expression of the parental cell lines or stable-transfected variant was determined by staining with FAP or isotope control antibody and analysed by flow cytometry ( Figure 11A).
- FAP BiTE-mediated target cell lysis is specific to FAP-expressing cells
- CHO or CHO-FAP cells (7,000 cells) were co-cultured alone or with human T-cells (70,000) in the presence of media alone or 2 ⁇ g/mL control or FAP BiTE in wells of a U-bottom 96-well plate. After 24 hours incubation, supernatants were harvested and target cell cytotoxicity measured by LDH cytotoxicity assay as described in example 4 ( Figure 11B). T-cell activation was also determined by analysing the expression levels of CD69 and CD25 via flow cytometry ( Figure 12). Cytotoxicity was only observed when CHO-FAP cells were cultured with T-cells and FAP BiTE. This indicates that FAP BiTE mediated T-cell activation and target cell lysis is highly specific and limited to FAP-expressing cells, and not the FAP-negative parental cell line.
- Example 7 Example 7
- Stable EpCAM expressing CHO amd Ad293 cell lines were generated as a means to demonstrate the EpCAM antigen specificity of the EpCAM BiTE by comparing to parental untransfected cells.
- the protein sequence of the EpCAM gene was obtained from NCBI database (SEQ ID 28), reverse transcribed to generate a DNA coding sequence that was synthesised by Oxford Genetics Ltd (Oxford, UK).
- the EpCAM gene was cloned into pSF-Lenti vector by standard cloning techniques producing the pSF-Lenti-EpCAM vector.
- HEK293T cells were transfected with lentivirus EpCAM expression vector alongside pSF-CMV-HIV-Gag-Pol, pSF-CMV-VSV-G, pSF-CMV-HIV-Rev.
- Lipofectamine 2000 was used as a transfection reagent and was added to the vector DNA at a DNA:lipofectamine ratio of 1:2, and incubated with the cells at 37°C.
- Supernatant containing lentivirus was harvested 48 hours later and mixed with polybrene (final concentration, 8 ⁇ g/mL).
- the Lentivirus/polybrene mixture was added to seeded Ad293 or CHO cells and incubated at 37°C. On day 4, the supernatant was exchanged for media containing puromycin ⁇ g/mL for Ad293 and 7 ⁇ g/mL for CHO).
- Stable variants were then clonally selected and EpCAM expression of the parental cell lines or stable- transfected variant was determined by staining with EpCAM or isotope control antibody and analysed by flow cytometry ( Figure 13A).
- EpCAM BiTE-mediated target cell lysis is specific to EpCAM-expressing cells
- CHO or CHO-EpCAM cells (7,000 cells) were co-cultured alone or with human T-cells (70,000) in the presence of media alone or 2 ⁇ g/mL control or EpCAM BiTE in wells of a U-bottom 96-well plate. After 24 hours incubation, supernatants were harvested and target cell cytotoxicity measured by LDH cytotoxicity assay ( Figure 13B). T-cell activation was also determined by analysing the expressions levels of CD69 and CD25 via flow cytometry ( Figure 14). Cytotoxicity was only observed when CHO-EpCAM cells were cultured with T-cells and EpCAM BiTE. This indicates that EpCAM BiTE mediated T-cell activation and target cell lysis is highly specific and limited to EpCAM-expressing cells, and not the EpCAM-negative parental cell line.
- CD4 + T-cells were extracted from CD3-purified cells by positive selection using a CD4 T Cell Isolation Kit (Miltenyi Biotec, #130-045-101), according to the manufacturer's protocol, with the CD8 cells within non-isolated flow-through.
- 7,000 NHDF were co-cultured with 35,000 CD4 + or CD8 + T-cells together with 300ng/mL of control or FAP BiTE and incubated at 37°C. After 24 hours, supernatants were harvested and target cell cytotoxicity measured by LDH cytotoxicity assay.
- the results ( Figure 15B) show that the FAP BiTE induced both CD4 + and CD8 + T-cells to kill NHDF cells.
- CD3 + T-cells (35,000) were co-cultured with 7,000 DLD cells in the presence of 300ng/mL control or EpCAM BiTE in wells of a U-bottom 96 well plate, and incubated at 37°C for 24 hours. Cells were harvested and stained with antibodies for CD4 or CD8 and CD69 and CD25, and analysed by flow cytometry.
- Figure 16A demonstrated that the EpCAM BiTE induced an increase in activation markers CD69 and CD25 in both CD4 + and CD8 + T-cells.
- CD4 + T-cells were extracted from CD3-purified cells by positive selection using CD4 T Cell Isolation Kit according to the manufacturer's protocol, with the CD8 cells within non-selected flow- through.
- 7,000 DLD were co-cultured with 35,000 CD4 + or CD8 + T-cells with 300ng/mL of control or EpCAM BiTE and incubated at 37°C. After 24 hours, supernatants were harvested and target cell cytotoxicity measured by LDH cytotoxicity assay (Figure 16B). The results show that the EpCAM BiTE induced both CD4 + and CD8 + T-cells to kill DLD cells.
- BiTE-expressing Enadenotucirev EnAd is a replication competent chimeric group B adenovirus that contains frequent nonhomologous nucleotide substitutions of Ad3 for Adllp in the E2B region, a nearly complete E3 deletion and a smaller E4 deletion mapped to E4orf4 (Kuhn et al, Directed evolution generates a novel oncolytic virus for the treatment of colon cancer, PLoS One, 2008 Jun 18; 3(6) : e2409).
- a schematic representation of the genome of the adenoviruses used in this study is shown in Figure 18 A.
- the plasmid pEnAd2.4 was used to generate the plasmids pEnAd2.4-CMV-EpCAMBiTE, pEnAd2.4- SA-EpCAMBiTE, pEnAd2.4-CMV-FAPBiTE, pEnAd2.4-SA-FAPBiTE, pEnAd2.4-CMV-ControlBiTE, pEnAd2.4-SA-ControlBiTE (Table 4) by direct insertion of a cassette encoding the EpCAM BiTE (SEQ ID NO: 1), FAP BiTE (SEQ ID NO: 3) or Control BiTE (SEQ ID NO: 5).
- the transgene cassette contained a 5' short splice acceptor sequence (SEQ ID NO: 33) or an exogenous CMV promoter (SEQ ID NO: 31), the EpCAM, FAP or control BiTE cDNA sequence and a 3' polyadenylation sequence (SEQ ID NO: 32). Construction of the plasmid was confirmed by DNA sequencing.
- the exogenous CMV promoter is constitutively active and thus leads to early expression of transgenes.
- the splice acceptor sequence drives expression under the control of the viral major late promoter and leads to later transgene expression following initiation of virus genome replication. The kinetics of this promotor-driven expression can be observed in Figure 18B, in which GFP was used as the transgene.
- the plasmids EnAd2.4-CMV-EpCAMBiTE, pEnAd2.4-SA-EpCAMBiTE, pEnAd2.4-CMV-FAPBiTE, pEnAd2.4-SA-FAPBiTE, pEnAd2.4-CMV-ControlBiTE, pEnAd2.4-SA-ControlBiTE were linearised by restriction digestion with the enzyme Ascl to produce the liner virus genome. Digested DNA was purified by isopropanol extraction and precipitated for 16hrs, -20°C in 300 ⁇ 1 >95% molecular biology grade ethanol and 10 ⁇ 3M Sodium Acetate.
- the precipitated DNA was pelleted by centrifuging at 14000rpm, 5 mins and was washed in 500 ⁇ 1 70% ethanol, before centrifuging again, 14000rpm, 5mins.
- the clean DNA pellet was air dried and resuspended in ⁇ , water. 6.25 ⁇ g DNA was mixed with 15.6 ⁇ _, lipofectamine transfection reagent in OptiMEM and incubated for 20 mins, RT. The transfection mixture was then added to a T-25 flask containing Ad293 cells grown to 80% confluency.
- NG-601, NG-602, NG-603, NG-604, NG-605 and NG-606 virus stocks were titred by micoBCA assay (Life Technologies), following manufacturer's instructions (Table 5).
- NG-601, NG-602, NG-603, NG-604, NG-605 and NG-606 viruses were characterised using the methods described below.
- NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 or EnAd to replicate was analysed by infection of A549 lung carcinoma cells and assessed by qPCR.
- A549 cells were seeded in wells of a 24-well plate at a cell density of 2x10 s cells/well. Plates were incubated for 18 hrs, 37°C, 5% CO2, before cells were either infected with 100 virus particles per cell (ppc) or were left uninfected. Wells were harvested 24, 48 or 72 hrs post infection and DNA purified using PureLink genomic DNA mini kit (Invitrogen) according to the manufacturer's protocol. Total viral genomes were quantified by qPCR with each extracted sample or standard using an EnAd hexon gene specific primer-probe set in the reaction mix detailed in Table 6. qPCR was performed as per the programme in Table 7. Table 6
- Oncolytic activity of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 or EnAd was assessed by infection of A549 (Figure 19B).
- A549 cells were seeded in 96-well plate at a cell density of 1.5xl0 4 cells/well. Plates were incubated for 18 hrs, 37°C, 5% CO2, before cells were infected with increasing ppc of virus (5-fold serial dilution, 4.1xl0 7 to 5000 virus ppc) or were left uninfected.
- A549 cytotoxicity was measured on day 5 by CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (Promega, # G3582).
- IC50 values generated for each virus demonstrated that the oncolytic activities of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 and EnAd was comparable for each virus.
- T- cell activation assays using CHO, CHO-EpCAM and CHO-FAP cell lines as target cells were performed. 10,000 target cells were co-cultured with 50,000 CD3 + T-cells in wells of a U-bottom 96-well plate with Ad293 viral supernatants diluted 100-fold in culture medium and incubated for 24 hrs, 37°C, 5% CO2. T-cells were harvested and stained with antibodies specific for CD25 and CD69 and analysed by flow cytometry.
- Figures 20A and 20B indicated that the viruses NG-601 and NG-602 expressed a functional BiTE transgene that activated T cells when co-cultured with CHO-EpCAM cells, and NG-605 and NG-606 expressed a functional BiTE transgene that activated T cells when co- cultured with CHO-FAP cells, but not when co-cultured with CHO cells.
- Quantification of BiTE expression in a colon carcinoma cell line The quantity of BiTE expression by NG-601, NG-602, NG-605, NG-606 infection of the human colon carcinoma cell line DLD was assessed.
- DLD cells were seeded in 6 well culture plates at a density of 1.2xl0 6 cells per well. 18 hrs post-seeding, DLD cells were infected with EnAd, NG-601, NG-602, NG- 603, NG-604, NG-605, NG-606 at 100 ppc. Cells were cultured for 72 hrs before the supernatants were collected from the wells and centrifuged for 5 mins, 1200rpm to remove cell debris. The clarified supernatants were then used for a killing assay, with cytotoxicity compared to a standard curve generated with a recombinant BiTE of known concentration, allowing determination of quantity of BiTE in viral supernatants.
- a cytotoxicity assay was performed in which 8,000 NHDF were co-cultured with 40,000 CD3 + T-cells and DLD viral supernatants diluted 1 inlO 3 , 1 in 10 4 and 1 in 10 s .
- a standard curve was generated by incubating NHDF and CD3 + T-cells with FAP or control BiTE at 10-fold serial dilutions from 3333 to 3.33xl0 4 ng/ ⁇ .
- Supernatants were harvested 24 hour post-treatment and cytotoxicity measured by LDH assay. Quantity of BiTE expressed was determined by comparing cytotoxicity of viral supernatants to that of the recombinant BiTE standard curve.
- the results ( Figure 21) indicated that the viruses NG-605 and NG-606 produced 9.8 and 49.2 ⁇ g FAP BiTE per million DLD cells, respectively.
- EpCAM BiTE produced from NG-601 and NG-602
- a cytotoxicity assay was performed in which 8,000 DLD cells were co-cultured with 40,000 CD3 + T-cells and DLD viral supernatants diluted 1 inlO 3 , 1 in 10 4 and 1 in 10 s .
- a standard curve was generated by incubating DLD and CD3 + T-cells with EpCAM or control BiTE at 10-fold serial dilutions from 3333 to 3.33x10- 4 ng ⁇ L.
- Supernatants were harvested 24 hour post-treatment and cytotoxicity measured by LDH assay (Figure 22). Quantity of BiTE expressed was determined by comparing cytotoxicity of viral supernatants to that of the recombinant BiTE standard curve. The results indicated that the viruses NG-601 and NG-602 produced 165 and 50.3 ⁇ g EpCAM BiTE per million DLD cells, respectively.
- the NG-607, NG-608, NG-609, NG-610 viruses also carry a red fluorescent protein (RFP) transgene for visualization of infected cells using fluorescent microscopy methods (SEQ ID NOS: 25 & 26, Table 4).
- RFP red fluorescent protein
- viruses NG-607, NG-608, NG-609 and NG-610 were assessed by infection of Ad293 cells.
- Ad293 cells were plated in a 6-well plate at lxlO 6 cells/well. Plates were incubated for 24 hrs, 37°C, 5% CO2, before cells were infected with viruses at 100 ppc or were left uninfected. At 48 hours post-infection, plaques were irradiated with a fluorescent mercury lamp and photographed ( Figure 23). The results suggested that the viruses NG-607, NG- 608, NG-609 and NG-610 express the RFP transgene.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (29)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP17771343.5A EP3503918B1 (en) | 2016-08-29 | 2017-08-29 | Adenovirus armed with bispecific t cell engager (bite) |
| US16/329,125 US12258417B2 (en) | 2016-08-29 | 2017-08-29 | Adenovirus armed with bispecific T cell engager |
| CN202410956740.6A CN119614520A (zh) | 2016-08-29 | 2017-08-29 | 携带双特异性t细胞衔接器的腺病毒 |
| JP2019507924A JP2019532621A (ja) | 2016-08-29 | 2017-08-29 | 二重特異性T細胞エンゲージャー(BiTE)で武装したアデノウイルス |
| CN201780056486.2A CN109862912B (zh) | 2016-08-29 | 2017-08-29 | 携带双特异性t细胞衔接器的腺病毒 |
| CA3033267A CA3033267A1 (en) | 2016-08-29 | 2017-08-29 | Adenovirus armed with bispecific t cell engager (bite) |
| SG11201901716TA SG11201901716TA (en) | 2016-08-29 | 2017-08-29 | Adenovirus armed with bispecific t cell engager (bite) |
| KR1020207005898A KR20200037826A (ko) | 2017-08-28 | 2018-08-28 | 이중특이성 T 세포 관여자(BiTE)를 갖춘 아데노바이러스 |
| EP18773082.5A EP3675904A1 (en) | 2017-08-28 | 2018-08-28 | Adenovirus armed with bispecific t cell engager (bite) |
| EA202090124A EA202090124A1 (ru) | 2017-08-28 | 2018-08-28 | Аденовирус, вооруженный биспецифическим рекрутером t-клеток (bite) |
| JP2020511748A JP7280244B2 (ja) | 2017-08-28 | 2018-08-28 | 二重特異性t細胞アクチベーターを搭載したアデノウイルス |
| MYPI2020000962A MY197586A (en) | 2017-08-28 | 2018-08-28 | Adenovirus armed with bispecific t cell engager (bite) |
| CN201880055171.0A CN111712257B (zh) | 2017-08-28 | 2018-08-28 | 携带双特异性T细胞衔接器(BiTE)的腺病毒 |
| EP24173800.4A EP4403227A3 (en) | 2017-08-28 | 2018-08-28 | Adenovirus armed with bispecific t cell engager (bite) |
| MX2020002158A MX2020002158A (es) | 2017-08-28 | 2018-08-28 | Adenovirus armado con captador biespecifico de linfocitos t (bite). |
| UAA202000400A UA126972C2 (uk) | 2017-08-28 | 2018-08-28 | Аденовірус, озброєний біспецифічним рекрутером t-клітин (bite) |
| BR112020003842-3A BR112020003842A2 (pt) | 2017-08-28 | 2018-08-28 | adenovírus armado com aglutinante biespecífico de células t (bite) |
| AU2018322776A AU2018322776B2 (en) | 2017-08-28 | 2018-08-28 | Adenovirus armed with bispecific T cell engager (BiTE) |
| CA3073480A CA3073480A1 (en) | 2017-08-28 | 2018-08-28 | Adenovirus armed with bispecific t cell engager (bite) |
| CN202311294743.XA CN119432918A (zh) | 2017-08-28 | 2018-08-28 | 携带双特异性T细胞衔接器(BiTE)的腺病毒 |
| SG11202001537QA SG11202001537QA (en) | 2017-08-28 | 2018-08-28 | Adenovirus armed with bispecific t cell engager (bite) |
| PCT/EP2018/073160 WO2019043020A1 (en) | 2017-08-28 | 2018-08-28 | ADENOVIRUS EQUIPPED WITH A BISPECIFIC T CELL ACTIVATOR (BITE) |
| US16/641,696 US11840702B2 (en) | 2017-08-28 | 2018-08-28 | Adenovirus armed with bispecific T cell activator |
| ZA2020/00388A ZA202000388B (en) | 2017-08-28 | 2020-01-20 | Adenovirus armed with bispecific t cell engager (bite) |
| CONC2020/0001930A CO2020001930A2 (es) | 2017-08-28 | 2020-02-21 | Adenovirus armado con captador biespecífico de linfocitos t (bite) |
| IL272872A IL272872B (en) | 2017-08-28 | 2020-02-24 | Pentavirus with bispecific t-cell activator (bite) |
| SA520411426A SA520411426B1 (ar) | 2017-08-28 | 2020-02-27 | فيروس غدّي مزود بموصل خلايا تائية ثنائية النوعية |
| PH12020500386A PH12020500386A1 (en) | 2017-08-28 | 2020-02-27 | Adenovirus armed with bispecific t cell engager (bite) |
| US18/481,833 US20240175052A1 (en) | 2017-08-28 | 2023-10-05 | Adenovirus armed with bispecific T cell activator |
Applications Claiming Priority (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB1614607.8A GB201614607D0 (en) | 2016-08-29 | 2016-08-29 | Modified adenovirus |
| GB1614607.8 | 2016-08-29 | ||
| GB1700663.6 | 2017-01-13 | ||
| GBGB1700663.6A GB201700663D0 (en) | 2017-01-13 | 2017-01-13 | Modified adenovirus |
| GB1706219.1 | 2017-04-19 | ||
| GBGB1706219.1A GB201706219D0 (en) | 2017-04-19 | 2017-04-19 | Modified adenovirus |
| GB1713765.4 | 2017-08-28 | ||
| GBGB1713765.4A GB201713765D0 (en) | 2017-08-28 | 2017-08-28 | Modified adenovirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018041827A1 true WO2018041827A1 (en) | 2018-03-08 |
Family
ID=59923381
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/071655 Ceased WO2018041827A1 (en) | 2016-08-29 | 2017-08-29 | Adenovirus armed with bispecific t cell engager (bite) |
| PCT/EP2017/071674 Ceased WO2018041838A1 (en) | 2016-08-29 | 2017-08-29 | Adenovirus armed with bispecific t cell engager (bite) |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/071674 Ceased WO2018041838A1 (en) | 2016-08-29 | 2017-08-29 | Adenovirus armed with bispecific t cell engager (bite) |
Country Status (18)
| Country | Link |
|---|---|
| US (3) | US12258417B2 (enExample) |
| EP (3) | EP3503919B1 (enExample) |
| JP (4) | JP7212620B2 (enExample) |
| KR (2) | KR102491752B1 (enExample) |
| CN (4) | CN119592523A (enExample) |
| AU (2) | AU2017320776B2 (enExample) |
| BR (1) | BR112019003866A2 (enExample) |
| CA (2) | CA3033267A1 (enExample) |
| CL (1) | CL2019000510A1 (enExample) |
| CO (1) | CO2019002371A2 (enExample) |
| ES (1) | ES2983916T3 (enExample) |
| IL (2) | IL303187A (enExample) |
| MX (2) | MX2019002328A (enExample) |
| MY (1) | MY197324A (enExample) |
| PH (1) | PH12019500436A1 (enExample) |
| SG (2) | SG11201901716TA (enExample) |
| WO (2) | WO2018041827A1 (enExample) |
| ZA (1) | ZA201900644B (enExample) |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109709341A (zh) * | 2019-01-17 | 2019-05-03 | 浙江大学 | 骨关节炎第二亚型的生物标记物以及用途 |
| WO2020051345A1 (en) * | 2018-09-05 | 2020-03-12 | Memorial Sloan-Kettering Cancer Center | Pleural effusion-based methods for assessing immunoresponsive cell activity |
| WO2020172259A1 (en) * | 2019-02-20 | 2020-08-27 | Research Institute At Nationwide Children's Hospital | Cancer-targeted, virus-encoded, regulatable t (catvert) or nk cell (catvern) linkers |
| US10849945B2 (en) | 2015-04-30 | 2020-12-01 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a B7 protein or active fragment |
| US11155622B2 (en) | 2015-12-17 | 2021-10-26 | Psioxus Therapeutics Limited | Virus encoding an anti-TCR-complex antibody or fragment |
| WO2022067005A1 (en) * | 2020-09-27 | 2022-03-31 | Genentech, Inc. | High throughput multiparametric immune cell engager screening assay |
| WO2022171853A1 (en) | 2021-02-13 | 2022-08-18 | Psioxus Therapeutics Limited | Adenovirus encoding 1l-15 |
| US11439678B2 (en) | 2013-10-25 | 2022-09-13 | Psioxus Therapeutics Limited | Oncolytic adenoviruses armed with heterologous genes |
| US11617767B2 (en) | 2020-11-20 | 2023-04-04 | Simcere Innovation, Inc. | Armed dual CAR-T compositions and methods for cancer immunotherapy |
| WO2023161457A1 (en) | 2022-02-27 | 2023-08-31 | Evobright Gmbh | Bispecific antibodies against cd277 and a tumor-antigen |
| US11840702B2 (en) | 2017-08-28 | 2023-12-12 | Akamis Bio Limited | Adenovirus armed with bispecific T cell activator |
| WO2024022602A1 (en) | 2022-07-28 | 2024-02-01 | Akamis Bio Ltd | Virus encoding transgenes to complement cellular therapy |
| WO2024047114A1 (en) | 2022-08-31 | 2024-03-07 | Universität Zürich | Adenoviral-based in situ delivery of bispecific t cell engagers |
| US12049513B2 (en) | 2016-08-29 | 2024-07-30 | Akamis Bio Limited | Oncolytic group B adenovirus expressing a stroma-targeted bispecific t-cell engager |
| RU2827779C2 (ru) * | 2019-02-20 | 2024-10-02 | Рисёрч Институт Эт Нейшнуайд Чилдрен'З Хоспитал | Вирус-кодируемые регулируемые агенты, связывающие T-клетки (CATVERT) или NK-клетки (CATVERN), нацеленные на рак |
| WO2024243578A1 (en) | 2023-05-25 | 2024-11-28 | Dispatch Biotherapeutics, Inc. | Synthetic cancer antigens as targets for treating cancers |
| WO2025171383A2 (en) | 2024-02-09 | 2025-08-14 | Dispatch Biotherapeutics, Inc. | Engineered cancer antigens and related methods and uses |
| WO2025171388A1 (en) | 2024-02-09 | 2025-08-14 | Dispatch Biotherapeutics, Inc. | Engineered cancer antigens with modified domains and related methods and uses |
Families Citing this family (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12466897B2 (en) | 2011-10-10 | 2025-11-11 | Xencor, Inc. | Heterodimeric human IgG1 polypeptides with isoelectric point modifications |
| CA2898100C (en) | 2013-01-14 | 2023-10-10 | Xencor, Inc. | Novel heterodimeric proteins |
| US9605084B2 (en) | 2013-03-15 | 2017-03-28 | Xencor, Inc. | Heterodimeric proteins |
| US10968276B2 (en) | 2013-03-12 | 2021-04-06 | Xencor, Inc. | Optimized anti-CD3 variable regions |
| US11053316B2 (en) | 2013-01-14 | 2021-07-06 | Xencor, Inc. | Optimized antibody variable regions |
| US10858417B2 (en) | 2013-03-15 | 2020-12-08 | Xencor, Inc. | Heterodimeric proteins |
| JP6775422B2 (ja) | 2014-03-28 | 2020-10-28 | ゼンコー・インコーポレイテッドXencor、 Inc. | Cd38及びcd3に結合する二重特異性抗体 |
| JP2017536830A (ja) | 2014-11-26 | 2017-12-14 | ゼンコー・インコーポレイテッドXencor、 Inc. | Cd3及びcd38に結合するヘテロ二量体抗体 |
| US10259887B2 (en) | 2014-11-26 | 2019-04-16 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
| SG11201704283PA (en) | 2014-11-26 | 2017-06-29 | Xencor Inc | Heterodimeric antibodies that bind cd3 and tumor antigens |
| JP7058219B2 (ja) | 2015-12-07 | 2022-04-21 | ゼンコア インコーポレイテッド | Cd3及びpsmaに結合するヘテロ二量体抗体 |
| MA45255A (fr) | 2016-06-14 | 2019-04-17 | Xencor Inc | Anticorps inhibiteurs de points de contrôle bispécifiques |
| KR20190020341A (ko) | 2016-06-28 | 2019-02-28 | 젠코어 인코포레이티드 | 소마토스타틴 수용체 2에 결합하는 이종이량체 항체 |
| RU2771110C2 (ru) * | 2017-07-26 | 2022-04-26 | Онкорус, Инк. | Онколитические вирусные векторы и их применение |
| AU2018366199A1 (en) | 2017-11-08 | 2020-05-28 | Xencor, Inc. | Bispecific and monospecific antibodies using novel anti-PD-1 sequences |
| AU2018390418B2 (en) | 2017-12-19 | 2023-12-21 | Xencor, Inc. | Engineered IL-2 Fc fusion proteins |
| EP3731850A4 (en) * | 2017-12-29 | 2021-12-01 | Oncorus, Inc. | ONCOLYTIC VIRUS DELIVERY OF THERAPEUTIC POLYPEPTIDES |
| AU2019247415A1 (en) * | 2018-04-04 | 2020-10-22 | Xencor, Inc. | Heterodimeric antibodies that bind fibroblast activation protein |
| US12233135B2 (en) * | 2018-04-11 | 2025-02-25 | Precision Molecular Inc. | Therapeutic constructs for treating cancer |
| CA3097593A1 (en) | 2018-04-18 | 2019-10-24 | Xencor, Inc. | Pd-1 targeted heterodimeric fusion proteins containing il-15/il-15ra fc-fusion proteins and pd-1 antigen binding domains and uses thereof |
| JP2021520829A (ja) | 2018-04-18 | 2021-08-26 | ゼンコア インコーポレイテッド | IL−15/IL−15RA Fc融合タンパク質およびTIM−3抗原結合ドメインを含む、TIM−3標的化ヘテロ二量体融合タンパク質 |
| SG11202103192RA (en) | 2018-10-03 | 2021-04-29 | Xencor Inc | Il-12 heterodimeric fc-fusion proteins |
| WO2020180726A1 (en) | 2019-03-01 | 2020-09-10 | Xencor, Inc. | Heterodimeric antibodies that bind enpp3 and cd3 |
| BR112021022682A2 (pt) | 2019-05-14 | 2022-02-22 | Provention Bio Inc | Métodos e composições para prevenir diabetes do tipo 1 |
| EP3901168A1 (en) * | 2020-04-21 | 2021-10-27 | Universität Duisburg-Essen | Interferon alpha 2 variants and uses thereof |
| WO2021231976A1 (en) | 2020-05-14 | 2021-11-18 | Xencor, Inc. | Heterodimeric antibodies that bind prostate specific membrane antigen (psma) and cd3 |
| US12006366B2 (en) | 2020-06-11 | 2024-06-11 | Provention Bio, Inc. | Methods and compositions for preventing type 1 diabetes |
| CN116322728A (zh) * | 2020-08-14 | 2023-06-23 | 上海行深生物科技有限公司 | 水疱性口炎病毒及其治疗用途 |
| CA3192204A1 (en) | 2020-08-19 | 2022-02-24 | Xencor, Inc. | Anti-cd28 and/or anti-b7h3 compositions |
| WO2022148736A1 (en) * | 2021-01-05 | 2022-07-14 | Transgene | Vectorization of muc1 t cell engager |
| KR20230156079A (ko) | 2021-03-09 | 2023-11-13 | 젠코어 인코포레이티드 | Cd3과 cldn6에 결합하는 이종이량체 항체 |
| US11859012B2 (en) | 2021-03-10 | 2024-01-02 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and GPC3 |
| CN115161293B (zh) * | 2021-04-01 | 2024-11-15 | 南京惟亚德生物医药有限公司 | 一种编码双特异性t细胞衔接子的溶瘤痘苗病毒及其制备方法和应用 |
| WO2022251253A1 (en) | 2021-05-24 | 2022-12-01 | Provention Bio, Inc. | Methods for treating type 1 diabetes |
| JP2024540461A (ja) * | 2021-11-19 | 2024-10-31 | 武▲漢▼友芝友生物制▲薬▼股▲ふん▼有限公司 | 二重特異性抗体及びその用途 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014138314A1 (en) * | 2013-03-05 | 2014-09-12 | Baylor College Of Medicine | Oncolytic virus |
| WO2015059303A1 (en) * | 2013-10-25 | 2015-04-30 | Psioxus Therapeutics Limited | Oncolytic adenoviruses armed with heterologous genes |
| WO2015155370A1 (en) * | 2014-04-12 | 2015-10-15 | Psioxus Therapeutics Limited | Group b adenovirus modified in the e4orf4 region |
| WO2016146894A1 (en) * | 2015-03-17 | 2016-09-22 | Tilt Biotherapeutics Oy | Oncolytic adenoviruses coding for bi-specific antibodies and methods and uses related thereto |
Family Cites Families (98)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0170269A3 (en) | 1984-08-02 | 1987-09-23 | Kao Corporation | Medicated cosmetic compositions |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| GB8928874D0 (en) | 1989-12-21 | 1990-02-28 | Celltech Ltd | Humanised antibodies |
| GB9113120D0 (en) | 1991-06-18 | 1991-08-07 | Kodak Ltd | Photographic processing apparatus |
| US5358866A (en) | 1991-07-03 | 1994-10-25 | The United States Of America As Represented By The Department Of Health And Human Services | Cytosine deaminase negative selection system for gene transfer techniques and therapies |
| US5801029A (en) | 1993-02-16 | 1998-09-01 | Onyx Pharmaceuticals, Inc. | Cytopathic viruses for therapy and prophylaxis of neoplasia |
| FR2705361B1 (fr) | 1993-05-18 | 1995-08-04 | Centre Nat Rech Scient | Vecteurs viraux et utilisation en thérapie génique. |
| CN1115414C (zh) | 1993-07-13 | 2003-07-23 | 罗纳-布朗克罗莱尔股份有限公司 | 用于基因治疗的病毒载体 |
| US5631236A (en) | 1993-08-26 | 1997-05-20 | Baylor College Of Medicine | Gene therapy for solid tumors, using a DNA sequence encoding HSV-Tk or VZV-Tk |
| US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
| US5830686A (en) | 1994-01-13 | 1998-11-03 | Calydon | Tissue-specific enhancer active in prostate |
| US5677170A (en) | 1994-03-02 | 1997-10-14 | The Johns Hopkins University | In vitro transposition of artificial transposons |
| US5587299A (en) | 1994-04-20 | 1996-12-24 | Memorial Sloan-Kettering Cancer Center | Isolated nucleic acid molecule coding for fibroblast activation protein alpha and uses thereof |
| DE19648650C2 (de) | 1996-01-29 | 1998-07-02 | Schering Ag | Puffersysteme und deren Verwendung zur Stabilisierung pharmazeutischer Zubereitung |
| US5877011A (en) | 1996-11-20 | 1999-03-02 | Genzyme Corporation | Chimeric adenoviral vectors |
| US7732129B1 (en) | 1998-12-01 | 2010-06-08 | Crucell Holland B.V. | Method for the production and purification of adenoviral vectors |
| CN1242051A (zh) | 1996-12-31 | 2000-01-19 | 昂尼克斯药物公司 | 用于肿瘤治疗和预防的致细胞病变病毒 |
| EP1036183B1 (en) | 1997-02-20 | 2007-10-03 | The Johns Hopkins University School Of Medicine | Mutations in atp-dependent transposition proteins that reduce target-site specificity |
| NZ503664A (en) | 1997-10-09 | 2002-08-28 | Pro Virus Inc | A method for purifying an RNA virus comprising generating a clonal virus and purifying the clonal virus by ultracentrifugation without pelleting |
| US20030044384A1 (en) | 1997-10-09 | 2003-03-06 | Pro-Virus, Inc. | Treatment of neoplasms with viruses |
| US6291214B1 (en) | 1998-05-11 | 2001-09-18 | Glaxo Wellcome Inc. | System for generating recombinant viruses |
| US20020019051A1 (en) | 1998-05-27 | 2002-02-14 | Monika Lusky | Chimeric adenoviral vectors |
| US20030017138A1 (en) | 1998-07-08 | 2003-01-23 | Menzo Havenga | Chimeric adenoviruses |
| CN1110553C (zh) | 1998-07-15 | 2003-06-04 | 杭州赛狮生物技术开发有限公司 | 基因工程腺病毒及其用途 |
| US6455314B1 (en) | 1998-09-11 | 2002-09-24 | Genvec, Inc. | Alternatively targeted adenovirus |
| JP4409097B2 (ja) | 1998-12-09 | 2010-02-03 | アメリカ合衆国 | 複数の共刺激分子を発現する組換えベクターおよびその利用 |
| WO2000050573A1 (fr) | 1999-02-22 | 2000-08-31 | Transgene S.A. | Procede d'obtention d'une preparation virale purifiee |
| JP2002541792A (ja) | 1999-04-09 | 2002-12-10 | アベンテイス・フアルマ・ソシエテ・アノニム | 感染性の組換えアデノウイルスの保存用組成物 |
| ES2372823T3 (es) | 1999-05-17 | 2012-01-26 | Crucell Holland B.V. | Adenovirus recombinante del serotipo ad11. |
| AU5464000A (en) | 1999-06-01 | 2000-12-18 | University Of Washington | Recombinant adenoviral vectors for cell specific infection and genome integration and expressing chimeric fiber proteins |
| EP2369002A1 (en) | 1999-08-09 | 2011-09-28 | Targeted Genetics Corporation | Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms intrastrand base pairs |
| US7396679B2 (en) | 1999-11-15 | 2008-07-08 | Onyx Pharmaceuticals, Inc. | Oncolytic adenovirus |
| ATE312189T1 (de) | 2000-01-21 | 2005-12-15 | Biovex Ltd | Virusstämme für die onkolytische behandlung von krebs |
| US7456009B2 (en) | 2000-03-07 | 2008-11-25 | Merck & Co., Inc. | Adenovirus formulations |
| AU2001265154A1 (en) | 2000-05-31 | 2001-12-11 | Genvec, Inc. | Method and composition for targeting an adenoviral vector |
| US20030031675A1 (en) | 2000-06-06 | 2003-02-13 | Mikesell Glen E. | B7-related nucleic acids and polypeptides useful for immunomodulation |
| WO2001094413A2 (en) | 2000-06-06 | 2001-12-13 | Bristol-Myers Squibb Company | B7-related nucleic acids and polypeptides and their uses for immunomodulation |
| US7459153B2 (en) | 2001-01-04 | 2008-12-02 | Wadell Goeran | Viral vectors for gene therapy |
| US20050175589A1 (en) | 2001-07-13 | 2005-08-11 | Btg International Limited | Anti-neoplastic viral agents |
| AR039067A1 (es) | 2001-11-09 | 2005-02-09 | Pfizer Prod Inc | Anticuerpos para cd40 |
| EP1327688A1 (en) | 2002-01-14 | 2003-07-16 | Vereniging Voor Christelijk Wetenschappelijk Onderwijs | Adenoviruses with enhanced lytic potency |
| EP1470233A1 (en) | 2002-02-01 | 2004-10-27 | Transgene S.A. | Adenoviral vectors for modulating the cellular activities associated with pods |
| AU2003223775A1 (en) | 2002-04-30 | 2003-11-17 | Duke University | Adeno-associated viral vectors and methods for their production from hybrid adenovirus and for their use |
| US20040167088A1 (en) | 2003-02-25 | 2004-08-26 | Genvec, Inc. | Method of using adenoviral vectors with increased persistence in vivo |
| US20040213764A1 (en) | 2003-03-28 | 2004-10-28 | William Wold | Adenovirus replication-competent vectors expressing trail |
| US20050136035A1 (en) | 2003-06-03 | 2005-06-23 | Derek Ko | Cell specific replication-competent viral vectors comprising a self processing peptide cleavage site |
| GB0315457D0 (en) | 2003-07-01 | 2003-08-06 | Celltech R&D Ltd | Biological products |
| HUE026278T2 (en) | 2003-07-01 | 2016-05-30 | Ucb Biopharma Sprl | Modified Fab antibody fragments |
| GB0315450D0 (en) | 2003-07-01 | 2003-08-06 | Celltech R&D Ltd | Biological products |
| CA2527369A1 (en) | 2003-07-18 | 2005-02-03 | Onyx Pharmaceuticals, Inc. | Subgroup b adenoviral vectors for treating disease |
| ZA200601699B (en) | 2003-10-16 | 2007-05-30 | Micromet Ag | Multispecific deimmunized CD3-binders |
| WO2005086922A2 (en) | 2004-03-10 | 2005-09-22 | Board Of Regents, University Of Texas System | Oncolytic adenovirus armed with therapeutic genes |
| US20080292592A1 (en) | 2004-04-30 | 2008-11-27 | Sunil Chada | Oncolytic Adenovirus Armed with Therapeutic Genes |
| GB0411186D0 (en) | 2004-05-19 | 2004-06-23 | Celltech R&D Ltd | Biological products |
| WO2005118825A2 (en) | 2004-05-26 | 2005-12-15 | Schering Aktiengesellschaft | Chimeric adenoviruses for use in cancer treatment |
| CN100361710C (zh) | 2004-06-07 | 2008-01-16 | 成都康弘生物科技有限公司 | 肿瘤细胞专一表达免疫调节因子gm-csf的溶瘤性腺病毒重组体的构建及其应用 |
| US20060292682A1 (en) | 2004-07-22 | 2006-12-28 | Hawkins Lynda K | Addition of transgenes into adenoviral vectors |
| JP2008511336A (ja) | 2004-09-01 | 2008-04-17 | アメリカ合衆国 | 免疫原性が増加したアデノウイルスベクターをインビボで用いる方法 |
| EP1819823A2 (en) | 2004-12-01 | 2007-08-22 | Bayer Schering Pharma Aktiengesellschaft | Generation of replication competent viruses for therapeutic use |
| US20060205080A1 (en) | 2005-03-01 | 2006-09-14 | David Frey | Formulations for therapeutic viruses having enhanced storage stability |
| AU2006284756B2 (en) | 2005-08-31 | 2012-06-07 | Genvec, Inc. | Adenoviral vector-based malaria vaccines |
| CN1961961B (zh) | 2005-11-11 | 2010-05-26 | 深圳市源兴生物医药科技有限公司 | 一种药物制剂及其制备方法 |
| DE102005055128B4 (de) | 2005-11-15 | 2015-04-02 | Universität Rostock | Viraler Vektor, dessen Verwendung zur Therapie von Leberzellkarzinomen und pharmazeutische Mittel umfassend den Vektor |
| ES2304281B1 (es) | 2006-02-01 | 2009-08-12 | Dnatrix Inc. | Adenovirus oncoliticos para el tratamiento del cancer. |
| EP2094284A2 (en) | 2006-12-22 | 2009-09-02 | Bayer Schering Pharma AG | Generation of oncolytic adenoviruses and uses thereof |
| US8629246B2 (en) | 2007-09-26 | 2014-01-14 | Ucb Pharma S.A. | Dual specificity antibody fusions |
| WO2009097443A2 (en) | 2008-01-29 | 2009-08-06 | Remedy Pharmaceuticals, Inc. | Liquid formulations of compounds active at sulfonylurea receptors |
| TW200951143A (en) | 2008-05-27 | 2009-12-16 | Oncolytics Biotech Inc | Modulating interstitial pressure and oncolytic viral delivery and distribution |
| WO2010035012A1 (en) | 2008-09-26 | 2010-04-01 | Ucb Pharma S.A. | Biological products |
| SG194399A1 (en) | 2008-10-01 | 2013-11-29 | Amgen Res Munich Gmbh | Cross-species-specific pscaxcd3, cd19xcd3, c-metxcd3, endosialinxcd3, epcamxcd3, igf-1rxcd3 or fapalpha xcd3 bispecific single chain antibody |
| CN101381742A (zh) | 2008-10-23 | 2009-03-11 | 浙江理工大学 | 晚期启动子靶向性调控溶瘤腺病毒pCN305载体及其构建方法与应用 |
| ES2385251B1 (es) | 2009-05-06 | 2013-05-06 | Fundació Privada Institut D'investigació Biomèdica De Bellvitge | Adenovirus oncolíticos para el tratamiento del cáncer. |
| US20100297072A1 (en) | 2009-05-19 | 2010-11-25 | Depinho Ronald A | Combinations of Immunostimulatory Agents, Oncolytic Virus, and Additional Anticancer Therapy |
| JP2013506664A (ja) | 2009-10-02 | 2013-02-28 | ルードヴィッヒ インスティテュート フォー キャンサー リサーチ リミテッド | 抗線維芽細胞活性化タンパク質抗体並びにその方法及び使用 |
| UY33492A (es) * | 2010-07-09 | 2012-01-31 | Abbott Lab | Inmunoglobulinas con dominio variable dual y usos de las mismas |
| CN103237889B (zh) | 2010-08-16 | 2017-04-05 | 萨克生物研究学院 | 腺病毒组装方法 |
| EP3321286B1 (en) | 2011-08-23 | 2021-01-06 | Roche Glycart AG | Bispecific t cell activating antigen binding molecules |
| WO2013074507A2 (en) | 2011-11-14 | 2013-05-23 | Regenerative Sciences, Llc | Suspended particle delivery systems and methods |
| CN102586327B (zh) | 2012-01-18 | 2013-09-11 | 陕西师范大学 | 一步法构建携带外源基因的d24纤维蛋白修饰的条件复制型腺病毒载体及其应用 |
| MX366965B (es) * | 2012-02-03 | 2019-07-31 | Hoffmann La Roche | Moleculas de anticuerpos biespecificos con celulas t transfectadas por antigeno y su uso en medicina. |
| RU2737765C2 (ru) | 2012-05-04 | 2020-12-02 | Пфайзер Инк. | Простатоассоциированные антигены и иммунотерапевтические схемы на основе вакцин |
| US9314519B2 (en) | 2012-08-21 | 2016-04-19 | Intervet Inc. | Liquid stable virus vaccines |
| JP2016513497A (ja) | 2013-03-06 | 2016-05-16 | サイモン、アダム、ジェイ. | 脳の健康の多様式の生理学的な評価に関する形態要素 |
| GB201322851D0 (en) | 2013-12-23 | 2014-02-12 | Psioxus Therapeutics Ltd | Method |
| GB201318793D0 (en) | 2013-10-24 | 2013-12-11 | Plaquetec Ltd | Vascular Biomarkers |
| KR20160137946A (ko) | 2013-11-22 | 2016-12-02 | 디엔에이트릭스, 인코포레이티드 | 면역 세포 자극성 수용체 작용제(들)를 발현하는 아데노바이러스 |
| IL292311A (en) | 2014-04-03 | 2022-06-01 | Igm Biosciences Inc | J-chain qualified |
| WO2016030489A2 (en) | 2014-08-27 | 2016-03-03 | Psioxus Therapeutics Limited | A process for the production of adenovirus |
| GB201503500D0 (en) | 2015-03-02 | 2015-04-15 | Ucl Business Plc | Cell |
| SG11201708604TA (en) | 2015-04-30 | 2017-11-29 | Psioxus Therapeutics Ltd | Oncolytic adenovirus encoding a b7 protein |
| EA201891022A1 (ru) | 2015-12-17 | 2019-01-31 | Псайоксус Терапьютикс Лимитед | Вирус, кодирующий антитело к комплексу tcr или фрагмент указанного антитела |
| SG11201808058PA (en) | 2016-03-18 | 2018-10-30 | Nantcell Inc | Multimodal vector for dendritic cell infection |
| MY197324A (en) | 2016-08-29 | 2023-06-13 | Akamis Bio Ltd | Adenovirus armed with bispecific t cell activator |
| GB201713765D0 (en) | 2017-08-28 | 2017-10-11 | Psioxus Therapeutics Ltd | Modified adenovirus |
| AU2017345764A1 (en) | 2016-10-20 | 2019-05-02 | Alpine Immune Sciences, Inc. | Secretable variant immunomodulatory proteins and engineered cell therapy |
| WO2018083259A1 (en) | 2016-11-03 | 2018-05-11 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding transgenes |
| WO2018083257A1 (en) | 2016-11-03 | 2018-05-11 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding transgenes |
| WO2018083258A1 (en) | 2016-11-03 | 2018-05-11 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding at least three transgenes |
-
2017
- 2017-08-29 MY MYPI2019000750A patent/MY197324A/en unknown
- 2017-08-29 AU AU2017320776A patent/AU2017320776B2/en active Active
- 2017-08-29 IL IL303187A patent/IL303187A/en unknown
- 2017-08-29 CA CA3033267A patent/CA3033267A1/en not_active Abandoned
- 2017-08-29 CN CN202410962886.1A patent/CN119592523A/zh active Pending
- 2017-08-29 SG SG11201901716TA patent/SG11201901716TA/en unknown
- 2017-08-29 BR BR112019003866-3A patent/BR112019003866A2/pt unknown
- 2017-08-29 CN CN201780056486.2A patent/CN109862912B/zh active Active
- 2017-08-29 US US16/329,125 patent/US12258417B2/en active Active
- 2017-08-29 IL IL264902A patent/IL264902B2/en unknown
- 2017-08-29 JP JP2019532192A patent/JP7212620B2/ja active Active
- 2017-08-29 KR KR1020227026101A patent/KR102491752B1/ko active Active
- 2017-08-29 CN CN202410956740.6A patent/CN119614520A/zh active Pending
- 2017-08-29 US US16/329,098 patent/US12049513B2/en active Active
- 2017-08-29 EP EP17771344.3A patent/EP3503919B1/en active Active
- 2017-08-29 CA CA3034517A patent/CA3034517A1/en active Pending
- 2017-08-29 EP EP23170482.6A patent/EP4273252A3/en active Pending
- 2017-08-29 CN CN201780057768.4A patent/CN110214025B/zh active Active
- 2017-08-29 EP EP17771343.5A patent/EP3503918B1/en active Active
- 2017-08-29 JP JP2019507924A patent/JP2019532621A/ja active Pending
- 2017-08-29 MX MX2019002328A patent/MX2019002328A/es unknown
- 2017-08-29 KR KR1020197008941A patent/KR102427563B1/ko active Active
- 2017-08-29 WO PCT/EP2017/071655 patent/WO2018041827A1/en not_active Ceased
- 2017-08-29 SG SG11201901715UA patent/SG11201901715UA/en unknown
- 2017-08-29 ES ES17771344T patent/ES2983916T3/es active Active
- 2017-08-29 WO PCT/EP2017/071674 patent/WO2018041838A1/en not_active Ceased
-
2019
- 2019-01-30 ZA ZA2019/00644A patent/ZA201900644B/en unknown
- 2019-02-26 CL CL2019000510A patent/CL2019000510A1/es unknown
- 2019-02-26 MX MX2023008779A patent/MX2023008779A/es unknown
- 2019-02-28 PH PH12019500436A patent/PH12019500436A1/en unknown
- 2019-03-14 CO CONC2019/0002371A patent/CO2019002371A2/es unknown
-
2022
- 2022-08-17 JP JP2022130173A patent/JP7525558B2/ja active Active
-
2024
- 2024-06-14 US US18/744,059 patent/US20250026851A1/en active Pending
- 2024-07-18 JP JP2024114614A patent/JP2024147722A/ja active Pending
-
2025
- 2025-01-09 AU AU2025200140A patent/AU2025200140A1/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014138314A1 (en) * | 2013-03-05 | 2014-09-12 | Baylor College Of Medicine | Oncolytic virus |
| WO2015059303A1 (en) * | 2013-10-25 | 2015-04-30 | Psioxus Therapeutics Limited | Oncolytic adenoviruses armed with heterologous genes |
| WO2015155370A1 (en) * | 2014-04-12 | 2015-10-15 | Psioxus Therapeutics Limited | Group b adenovirus modified in the e4orf4 region |
| WO2016146894A1 (en) * | 2015-03-17 | 2016-09-22 | Tilt Biotherapeutics Oy | Oncolytic adenoviruses coding for bi-specific antibodies and methods and uses related thereto |
Non-Patent Citations (6)
| Title |
|---|
| ALBERTO FAJARDO CARLOS ET AL: "Bi-specific T-cell engager-armed oncolytic adenoviruses as a strategy to improve antitumor efficacy", HUMAN GENE THE, MARY ANN LIEBERT, INC. PUBLISHERS, US, vol. 26, no. 9, 1 September 2015 (2015-09-01), pages A13 - A14, XP008180451, ISSN: 1043-0342 * |
| BRIAN CHAMPION: "Abstract 295: Delivery of checkpoint inhibitor antibodies and other therapeutics directly to tumors by encoding them within the oncolytic adenovirus enadenotucirev | Cancer Research", AACR 106TH ANNUAL MEETING 2015; APRIL 18-22, 2015; PHILADELPHIA, PA, vol. 75 (15:Suppl), 18 April 2015 (2015-04-18), pages A295, XP055430850 * |
| BRIAN R CHAMPION ET AL: ""Arming" the chimeric oncolytic adenovirus enadenotucirev to deliver checkpoint inhibitors and other therapeutics directly to tumours", JOURNAL FOR IMMUNOTHERAPY OF CANCER, vol. 2, no. Suppl 3, 1 January 2014 (2014-01-01), pages P46, XP055168248, ISSN: 2051-1426, DOI: 10.1186/2051-1426-2-S3-P46 * |
| JOSHUA D FREEDMAN ET AL: "Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies", EMBO MOLECULAR MEDICINE MAR 2011, vol. 9, no. 8, 20 June 2017 (2017-06-20), pages 1067 - 1087, XP055430764, ISSN: 1757-4684, DOI: 10.15252/emmm.201707567 * |
| RAUM TOBIAS J ET AL: "Novel primate-crossreactive BiTE antibodies that eliminate cancer cells expressing cMet, IGFR-1, FAP-alpha, PSCA, Endosialin, CAIX or Her2/neu", PROCEEDINGS OF THE ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESE, vol. 51, 15 April 2010 (2010-04-15), pages 590, XP008181797, ISSN: 0197-016X, [retrieved on 20100415], DOI: 10.1158/1538-7445.AM10-2434 * |
| ROCIO GARCIA-CARBONERO ET AL: "Phase 1 study of intravenous administration of the chimeric adenovirus enadenotucirev in patients undergoing primary tumor resection", JOURNAL FOR IMMUNOTHERAPY OF CANCER, BIOMED CENTRAL LTD, LONDON, UK, vol. 5, no. 1, 19 September 2017 (2017-09-19), pages 1 - 13, XP021248903, DOI: 10.1186/S40425-017-0277-7 * |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11938159B2 (en) | 2013-10-25 | 2024-03-26 | Akamis Bio Limited | Oncolytic adenoviruses armed with heterologous genes |
| US11439678B2 (en) | 2013-10-25 | 2022-09-13 | Psioxus Therapeutics Limited | Oncolytic adenoviruses armed with heterologous genes |
| US11000559B2 (en) | 2015-04-30 | 2021-05-11 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a B7 protein |
| US10849945B2 (en) | 2015-04-30 | 2020-12-01 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a B7 protein or active fragment |
| US11155622B2 (en) | 2015-12-17 | 2021-10-26 | Psioxus Therapeutics Limited | Virus encoding an anti-TCR-complex antibody or fragment |
| US11970536B2 (en) | 2015-12-17 | 2024-04-30 | Akamis Bio Limited | Group B adenovirus encoding an anti-TCR-complex antibody or fragment |
| US12049513B2 (en) | 2016-08-29 | 2024-07-30 | Akamis Bio Limited | Oncolytic group B adenovirus expressing a stroma-targeted bispecific t-cell engager |
| US12258417B2 (en) | 2016-08-29 | 2025-03-25 | Akamis Bio Limited | Adenovirus armed with bispecific T cell engager |
| US11840702B2 (en) | 2017-08-28 | 2023-12-12 | Akamis Bio Limited | Adenovirus armed with bispecific T cell activator |
| EP4403227A2 (en) | 2017-08-28 | 2024-07-24 | Akamis Bio Limited | Adenovirus armed with bispecific t cell engager (bite) |
| EP4403227A3 (en) * | 2017-08-28 | 2024-10-30 | Akamis Bio Limited | Adenovirus armed with bispecific t cell engager (bite) |
| WO2020051345A1 (en) * | 2018-09-05 | 2020-03-12 | Memorial Sloan-Kettering Cancer Center | Pleural effusion-based methods for assessing immunoresponsive cell activity |
| CN109709341A (zh) * | 2019-01-17 | 2019-05-03 | 浙江大学 | 骨关节炎第二亚型的生物标记物以及用途 |
| JP2022521183A (ja) * | 2019-02-20 | 2022-04-06 | リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル | がんを標的とする、ウイルスによってコードされる、調節可能なt(catvert)またはnk細胞(catvern)リンカー |
| JP7603013B2 (ja) | 2019-02-20 | 2024-12-19 | リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル | がんを標的とする、ウイルスによってコードされる、調節可能なt(catvert)またはnk細胞(catvern)リンカー |
| JP2025026612A (ja) * | 2019-02-20 | 2025-02-21 | リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル | がんを標的とする、ウイルスによってコードされる、調節可能なt(catvert)またはnk細胞(catvern)リンカー |
| WO2020172259A1 (en) * | 2019-02-20 | 2020-08-27 | Research Institute At Nationwide Children's Hospital | Cancer-targeted, virus-encoded, regulatable t (catvert) or nk cell (catvern) linkers |
| CN113646334B (zh) * | 2019-02-20 | 2025-09-16 | 国家儿童医院研究所 | 癌症靶向的、病毒编码的、可调节的t细胞(catvert)或nk细胞(catvern)接头 |
| RU2827779C2 (ru) * | 2019-02-20 | 2024-10-02 | Рисёрч Институт Эт Нейшнуайд Чилдрен'З Хоспитал | Вирус-кодируемые регулируемые агенты, связывающие T-клетки (CATVERT) или NK-клетки (CATVERN), нацеленные на рак |
| CN113646334A (zh) * | 2019-02-20 | 2021-11-12 | 国家儿童医院研究所 | 癌症靶向的、病毒编码的、可调节的t细胞(catvert)或nk细胞(catvern)接头 |
| WO2022067005A1 (en) * | 2020-09-27 | 2022-03-31 | Genentech, Inc. | High throughput multiparametric immune cell engager screening assay |
| US11617767B2 (en) | 2020-11-20 | 2023-04-04 | Simcere Innovation, Inc. | Armed dual CAR-T compositions and methods for cancer immunotherapy |
| WO2022171853A1 (en) | 2021-02-13 | 2022-08-18 | Psioxus Therapeutics Limited | Adenovirus encoding 1l-15 |
| WO2023161457A1 (en) | 2022-02-27 | 2023-08-31 | Evobright Gmbh | Bispecific antibodies against cd277 and a tumor-antigen |
| WO2024022602A1 (en) | 2022-07-28 | 2024-02-01 | Akamis Bio Ltd | Virus encoding transgenes to complement cellular therapy |
| WO2024047114A1 (en) | 2022-08-31 | 2024-03-07 | Universität Zürich | Adenoviral-based in situ delivery of bispecific t cell engagers |
| WO2024243578A1 (en) | 2023-05-25 | 2024-11-28 | Dispatch Biotherapeutics, Inc. | Synthetic cancer antigens as targets for treating cancers |
| WO2025171383A2 (en) | 2024-02-09 | 2025-08-14 | Dispatch Biotherapeutics, Inc. | Engineered cancer antigens and related methods and uses |
| WO2025171388A1 (en) | 2024-02-09 | 2025-08-14 | Dispatch Biotherapeutics, Inc. | Engineered cancer antigens with modified domains and related methods and uses |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250026851A1 (en) | Adenovirus armed with bispecific t cell activator | |
| US11938159B2 (en) | Oncolytic adenoviruses armed with heterologous genes | |
| EP3389683A1 (en) | Virus encoding an anti-tcr-complex antibody or fragment | |
| HK40104373A (en) | Adenovirus armed with bispecific t cell engager (bite) | |
| HK40011114A (en) | Adenovirus armed with bispecific t cell engager | |
| NZ791667A (en) | Adenovirus armed with bispecific T-cell activator | |
| EA043895B1 (ru) | Аденовирус, вооруженный биспецифичным активатором т-клеток | |
| HK1260835A1 (en) | Oncolytic adenoviruses armed with heterologous genes | |
| HK1224946A1 (en) | Oncolytic adenoviruses armed with heterologous genes | |
| HK1224946B (en) | Oncolytic adenoviruses armed with heterologous genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17771343 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3033267 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019507924 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2017771343 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 16329125 Country of ref document: US |