WO2018083258A1

WO2018083258A1 - Oncolytic adenovirus encoding at least three transgenes

Info

Publication number: WO2018083258A1
Application number: PCT/EP2017/078217
Authority: WO
Inventors: Brian Robert Champion; Alice Claire Noel BROMLEY
Original assignee: Psioxus Therapeutics Limited
Priority date: 2016-11-03
Filing date: 2017-11-03
Publication date: 2018-05-11

Abstract

The present disclosure relates to an oncolytic adenovirus, comprising: (i) a first transgene comprising a DNA sequence which encodes a first protein, (ii) a second transgene encoding a protein or fragment comprising a transmembrane domain or GPI anchor, and (iii) a third transgene encoding a third protein; wherein the three transgenes are located between the virus fibre gene L5 and the virus E4 gene and wherein the said transgenes are under the control of a promoter endogenous to the virus, such as the major late promoter, and the relative location of the second transgene is between the first and third transgene, compositions comprising the same; and use of the virus and compositions in treatment, particularly in the treatment of cancer.

Description

ONCOLYTIC ADENOVIRUS ENCODING AT LEAST THREE TRANSGENES

The present disclosure relates to a replication competent oncolytic adenovirus encoding at least three transgenes in the same location compositions comprising the same; and use of the virus and compositions in treatment, particularly in the treatment of cancer.

BACKGROUND

Cancer is still a huge social burden to society in terms of the hardship and suffering of patients and their loved ones, and also in terms of the high financial cost of treating, caring for and supporting patients. It is now thought that the immune system of healthy individuals clears cancerous cells routinely. However, in those patients with cancer one or more of the defense mechanisms involved in this clearance is / are down regulated or turned off completely.

It is now known that tumors change their microenvironment to make it more permissive to their growth. This occurs by the tumor releasing extracellular signals that, for example, promote tumor angiogenesis and/or induce local immune suppression or immune tolerance.

The present inventors have engineered certain oncolytic adenoviruses, to express a protein or proteins on the surface of a cancer cell it infects. Some early work they did three transgenes in an expression cassette was constructed with the transmembrane domain of the relevant protein at a terminal end of the encoding polynucleotide, i.e. in the format:

gene 1 -gene 2 -gene 3

wherein gene 1 and gene 2 are soluble proteins and gene 3 is a transmembrane anchored protein.

The proteins are expressed as one long polypeptide and require post-translational modification to release the individual proteins.

In addition, the soluble proteins encoded where small because it is known in the art at the viruses have limited "space" ability to accommodate transgenes. Furthermore, all the transgenes are driven by one endogenous promoter and the said promoter may have reduced efficiency at the furthest extremity of the cassette.

Thus, this cassette format was designed to ensure the virus was not overloaded with genetic material and was able to express the proteins, without adversely affecting the virus life cycle, for example if the virus becomes inefficient the replication of the virus may be reduced or inhibited.

It is important the life cycle of the virus is not adversely affected because the gene expression and oncolytic properties are closely linked to the virus life cycle. That is to the say the advantageous therapeutic properties of the virus may be lost, if virus replication is halted.

Surprisingly the present inventors have established that transgenes which encode proteins for cancer cell surface expression (i.e. proteins comprising a transmembrane l domain or GPI anchor], such as CD80 are expressed better when the virus comprises at least one further transgenes (even where the further transgene encodes a soluble/secreted protein] in comparison to where the virus only comprises a transgene encoding a surface anchored protein.

The expression of the surface anchored protein is even improved when the surface expressed transgene is sandwiched in the middle of the cassette and only released as an individual protein by a post-translational modification.

In addition, the expression is still better when four, five or six transgenes are co- located in the cassette. Surprisingly the virus can handle expressing all these transgenes.

SUMMARY OF DISCLOSURE

Accordingly, there is provided in one aspect a replication deficient or replication capable oncolytic adenovirus, comprising:

(i] a first transgene comprising a DNA sequence which encodes a first protein, (ii] a second transgene comprising encoding a protein or fragment comprising a transmembrane domain or GPI anchor, and

(iii] a third transgene comprising a third protein;

wherein the three transgenes are located between the virus fibre gene L5 and the virus E4 gene and wherein the said transgenes are under the control of a promoter endogenous to the virus, such as the major late promoter.

In one embodiment the three transgenes are located within a single transgene cassette.

In one embodiment the first protein is an antibody or binding fragment thereof. In one embodiment the antibody or binding fragment of part i] is human or humanised.

In one embodiment the antibody or antibody binding fragment is a cell membrane- anchored form, for example wherein the antibody or binding fragment comprises a transmembrane domain sequence or GPI anchor, such as a transmembrane domain from a PDGF receptor.

In one embodiment the third protein is a cytokine.

In one embodiment the virus is a group B adenovirus, such as Adl l.

In one embodiment the virus is a chimeric virus, for example wherein the virus comprises a modified E2B region.

In one embodiment the virus is enadenotucirev (EnAd].

In one embodiment the virus has a formula (I] :

5'ITR-B I-B_A-B2-BX-B_B-BY-B3-3'ITR (I]

Bi comprises: E1A, E 1B or E 1A-E 1B;

BA is E2B-L1-L2-L3-E2A-L4;

B2 is a bond or comprises E3 or a transgene, for example under an endogenous or exogenous promoter; Βχ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both;

Bg comprises L5;

Βγ comprises the transgene cassette according to the present disclosure; and

B3 is a bond or comprises E4.

In one embodiment the transgene cassette comprises one or more high efficiency self- cleavable sequences, for example two high efficiency cleavable sequences, for example independently selected from P2A, F2A, E2A and T2A, in particular selected from P2A, T2A and combinations thereof.

In one aspect, there is provided a pharmaceutical composition comprising a replication deficient or replication competent oncolytic adenovirus as described above, and a diluent or carrier.

In one aspect, there is provided a method of treating a patient comprising administering a therapeutically effective amount of a replication deficient or replication competent adenovirus or a composition as described above.

In one aspect, there is provided a replication deficient or replication competent adenovirus or a composition as described above for use in treatment, for example for the treatment of cancer.

In one aspect, there is provided a use of a replication deficient or replication competent adenovirus or a composition as described above for use in the manufacture of a medicament, for example for the treatment of cancer.

In one aspect, there is provided a method of generating a replication competent adenovirus as described above by replication in a host cell. BRIEF DESCRIPTION OF FIGURES

Figure 1A is a schematic of the transgene cassette employed in the plasmid pNG-500. Figure IB is a graph showing the oncolytic potency of NG-500 compared to EnAd. Figure 1C is a bar chart showing the viral genome replication capability of NG-500 compared to EnAd.

Figure 2A is a series of scatter-plots showing the cell surface expression of CD80 in A549 cells infected with NG-500 vs EnAd.

Figure 2B is a bar chart showing the production of secreted ΜΙΡΙα in NG-500 vs EnAd infected A549 cells.

Figure 3 shows the results of a Jurkat Dual reporter assay demonstrating the functional activity of the CD80 and anti-CD3 ScFv transgenes in the NG-500 virus vs NG-348 virus.

Figure 4 is a series of scatter-plots showing the cell surface expression of CD107a in

A549 cells infected with NG-500 vs NG-348 and EnAd. (A) CD3+CD8- cells (B) CD3+CD8+ cells. Figure 5 is a bar chart showing the secretion of IFNy in NG-500, NG-348 and EnAd infected A549 cells.

SUMMARY OF SEQUENCES

SEQ ID NO: 1 CD80 amino acid sequence

SEQ ID NO: 2 Membrane anchored form of the anti-human CD3 single chain Fv

SEQ ID NO: 3 Human Macrophage Inflammatory protein la amino acid sequence

(LD78P isoform)

SEQ ID NO: 4 High efficiency self-cleavable P2A peptide sequence

SEQ ID NO: 5 High efficiency self-cleavable T2A peptide sequence

SEQ ID NO: 6 Poly-adenylation sequence (SV40 late polyA sequence)

SEQ ID NO: 7 NG-500 genome sequence

SEQ ID NO: 8 Transgene cassette sequence for NG-500

SEQ ID NO: 9 ] iF TM domain

SEQ ID NO: 10 Splice Acceptor Sequence

SEQ ID NO: 11 Splice Acceptor Sequence

SEQ ID NO: 12 NG-348 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes a membrane-anchored chimeric form of the single chain Fv anti-human CD3e and the T lymphocyte activation antigen, CD80.

SEQ ID NO: 13 Transgene Cassette sequence for NG-348

SEQ ID NO: 14 Membrane anchored form of the anti-human CD3 scFv with C- terminal V5 tag

SEQ ID NO: 15 Membrane tethered OKT3-ScFv nucleic acid sequence

SEQ ID NO: 16 V5 tag (9 amino acid variant)

SEQ ID NO: 17 EnAd Genome

SEQ ID NO: 18 E2B region of EnAd genome (BP 10355-5068)

SEQ ID NO: 19 E3 region from EnAd

SEQ ID NO: 20 Sequence comprising a start codon

SEQ ID NO: 21 High efficiency self-cleavable E2A peptide sequence

SEQ ID NO: 22 c-myc tag

SEQ ID NO: 23 c-myc tag with amino acid spacer at the N and C terminal

SEQ ID NO: 24 spacer - c-myc tag -spacer PDGF TM domain

SEQ ID NO: 25 G₄S linker

SEQ ID NO: 26 PDGFR Receptor A amino acid sequence

SEQ ID NO: 27 PDGFR Receptor B amino acid sequence

SEQ ID NO: 28 Insulin-like Growth Factor 1 amino acid sequence

SEQ ID NO: 29 IL6-R amino acid sequence

SEQ ID NO: 30 CD28 amino acid sequence

SEQ ID NOs: 31 to 40 Hinge linkers SEQ ID NOs: 41 to 80 Flexible linkers

SEQ ID NO: 81 to 83 Rigid linkers

SEQ ID NO: 84 to 97 Other linkers

SEQ ID NO: 98 Non-coding sequence suitable for inclusion into Bx

SEQ ID NO: 99 Non-coding sequence suitable for inclusion into BY

SEQ ID NO: 100 Restriction site cut by I-Crel

SEQ ID NO: 101 Restriction site cut by I-Ceul

SEQ ID NO: 102 Restriction site cut by I-Scel

SEQ ID NO: 103 High efficiency self-cleavable F2A peptide sequence

SEQ ID NO: 104 Leader sequence

DETAILED DESCRIPTION

In the oncolytic virus of the present disclosure the first transgene is located closer to L5 than the second transgene, in particular the relative orientation of the genes is as shown in as the simplified representation (wherein not all regulatory elements, etc are shown):

First-transgene-Second transgene-Third transgene

In one embodiment the "first transgene" is the transgene encoding a therapy entity located after L5 in the direction toward the E4 region, in particular the relative orientation of the genes is as shown in as the simplified representation (wherein not all regulatory elements, etc are shown):

L5- First-transgene-Second transgene-Third transgen-E4

In one embodiment the oncolytic virus encodes a fourth transgene, for example co- located with the first, second and third transgene.

In one embodiment the oncolytic virus encodes a fifth transgene, for example co- located with the first, second and third transgene, such as co-located with the first, second, third and fourth transgene.

In one embodiment the oncolytic virus encodes a sixth transgene, for example co- located with the first, second and third transgene, such as co-located with the first, second, third, fourth and fifth transgene.

In one embodiment the first transgene is protein is independently selected from an antibody or binding fragment thereof (such as an antagonistic antibody or binding fragment), a chemokine, a cytokine, an immunomodulator and an enzyme.

In one embodiment the second transgene is protein is independently selected from an antibody or binding fragment thereof (such as an antagonistic antibody or binding fragment), a chemokine, a cytokine, an immunomodulator and an enzyme.

In one embodiment the third transgene is protein is independently selected from an antibody or binding fragment thereof (such as an antagonistic antibody or binding fragment), a chemokine, a cytokine, an immunomodulator and an enzyme. In one embodiment the fourth transgene is protein is independently selected from an RNAi, an antibody or binding fragment thereof (such as an antagonistic antibody or binding fragment), a chemokine, a cytokine, an immunomodulator and an enzyme.

In one embodiment the fifth transgene is protein is independently selected from an RNAi, an antibody or binding fragment thereof (such as an antagonistic antibody or binding fragment), a chemokine, a cytokine, an immunomodulator and an enzyme.

In one embodiment the sixth transgene is protein is independently selected from an RNAi, an antibody or binding fragment thereof (such as an antagonistic antibody or binding fragment), a chemokine, a cytokine, an immunomodulator and an enzyme.

In one embodiment a B7-1 protein is encoded in an oncolytic viruses of the present disclosure, which can be useful because the extracellular domain of the protein family member generally modulates a biological function, for example the B7-1 (CD80) extracellular domain may be employed to prime or stimulate T cells. In addition, B7-1 may include the ability to bind CD28 and/or CTLA-4, and in particular to signal or activate the relevant signaling cascade or cascades.

In addition the transmembrane domain of B7-1 protein can be employed to direct proteins encoded by a virus of the present disclosure to the surface of a cancer cell, for example by fusing the transmembrane domain to the C-terminus of B7-1.

Alternatively or additionally, B7-1 may be secreted from the oncolytic virus by omitting a transmembrane domain.

B7-1 protein or CD80 as employed herein, unless the context indicates otherwise, refers to the full length sequence of the B7-1 protein or a sequence at least 95% similar or identical thereto (such as 96%, 97%, 98%, 99% or 100% similar or identical thereto along the entirety of the relevant sequence). When the full length protein is employed then at least one normal biological function of the protein will generally be present.

Full length protein as employed herein, refers to at least the extracellular domain of the protein in question. Also included are chimeric B7-1 proteins wherein the sequence of the chimaera has the structure and a function of a B7-1 protein and wherein the sequences that make up the chimaera are selected from B7-1 in combination with other proteins from the B7 family. The B7 family includes B7-1, B7-2, B7-DC, B7-H1, B7-H2, B7-H3, B7-H4, B7- H5, B7-H6 and B7-H7. Accordingly, the elements in a fragment or full length B7-1 protein may be from the same or different B7 proteins. Thus in one embodiment the B7 fragment or protein is chimeric.

The chimeric B7-1 proteins as employed herein refer to where substantially all the sequences making up the chimaera are from a B7-1 protein, for example at least 98% of the sequence of the chimaera is fragments of B7-1 proteins fused together. Thus, a chimeric fragment as employed herein refers a fragment comprising a sequence from two or more different B7 proteins.

Chimeric as employed herein may also refer to B7-1 proteins comprising fragments from human B7-1 and non-human (such as mammalian) B7-1. In one embodiment the full length B7-1 protein comprises the extracellular domain and the transmembrane domain, for example from the same B7-1 protein or alternatively the extracellular domain from another B7 protein (such as B7-2) and a transmembrane domain or equivalent, such as lipid membrane anchor, from a completely different protein.

In one embodiment a full length chimeric B7-1 protein may comprise an extracellular domain of B7-1 protein and the transmembrane from a different B7 protein.

In one embodiment the full length B7-1 protein comprises the extracellular domain, the transmembrane domain and intracellular domain, for example all from the same B7-1 protein or from two or more different B7 proteins, such as B7-1 and B7-2.

Active fragment as employed herein refers to a fragment of a relevant full length protein that has at least one function of the full length protein. For example, a B7-1 active fragment may for example bind CD28 or perform some other biological function of the full length B7-1 protein.

In one embodiment the fragment has at least 50% of the activity of the full-length protein, such as 60, 65, 70, 75, 80, 85, 90, 95 or 100% of the activity of the full-length protein.

In one embodiment the active fragment comprises or consists of a B7-1 extracellular domain or a sequence at least 95% similar or identical thereto, such as 96, 97, 98, 99 or 100% similar or identical.

In one embodiment the B7-1 fragment comprises or consists of a transmembrane domain from a B7 protein in particular one described herein, such as B7-1. Employing the latter is thought to contribute expression on the cell surface.

In one embodiment the active B7-1 fragment maybe part of an extracellular domain. An active fragment, for example a transmembrane fragment or a larger fragment comprising B7-1 and other B7 domains may be employed in a fusion protein with an additional protein, for example to facilitate expression of the additional protein on the cancer cell surface.

Larger fragment as employed herein does not refer to size or weight per se but to a larger repertoire of sequence information (i.e. the fragment comprises sequences from at least B7-1 and other B7 domains) which in turn may provide more functionality.

In one embodiment the larger fragment comprises some biological activity of the relevant B7 protein. In one embodiment an active B7-1 fragment is a fragment that retains the essential biological activity of the full-length protein, for example the ability to prime or activate T cells.

The activity of a given protein fragment may be analysed in a relevant in vitro assay, for example using full-length protein as a comparator, for example employing an assay described in the Examples herein. Where the active fragment is a transmembrane domain the activity can be assessed by analysing the surface expression on cells of the relevant protein to which the transmembrane domain is attached, for example using an assay described in the Examples herein. When the full-length B7-1 protein is part of a fusion protein then the B7-1 portion may be linked to the additional protein by an amide bond between the end of one sequence and the beginning of the next protein sequence or connected by a linker. Examples of linkers are given below.

A full length B7-1 protein comprising a transmembrane domain can be employed to present the extracellular domain of the B7-1 protein and the protein or fragment fused or linked thereto on the surface of the infected cancer cell. Generally in this embodiment the B7-1 protein will be attached to the surface of the cancer cell and the "other" protein will be at the N -terminus and on the extracellular side of the cancer cell surface.

Having said that the proteins can be arrange as desired, for example with the B7-1 extracellular domain at the N-terminal, fused or linked at its C-terminal to the next protein or fragment, which in turn is fused or linked at the C-terminal to the transmembrane domain, for example a transmembrane domain from a B7 protein.

Generally when a full-length B7-1 protein is employed in a fusion protein then both the B7-1 protein and the additional protein will have a biological function.

Fusion protein as employed herein refers to at least two proteins or fragments or a combination of at least one protein and at least one fragment fused directly or connected to each other, for example by a linker.

Fused as employed herein generally refers to an amide bond between the end of one polypeptide (or protein/fragment] and the beginning of the next polypeptide (or protein/fragment).

Linked, unless the context indicates otherwise, refers to wherein two entities, such as two polypeptide sequences are connected via a linker. A linker is a sequence which is not naturally present in either polypeptide or a sequence, which is not present in that particular position relative to both polypeptides.

In one embodiment the fusion protein comprises a B7-1 protein or an active fragment thereof. Fusion proteins comprising B7-1 fragments or protein and additional proteins are not referred to as chimeric proteins herein. Generally fusion protein as employed herein refers to a combination of a B7-1 protein or fragment thereof, optionally other B7 proteins/fragment and another non-B7-protein/fragment.

Only proteins containing fragments from different B7 proteins are referred to as chimeric herein, as described supra.

Thus viruses of the present disclosure may encode entities in addition to the B7-1 protein or active fragment thereof, such entities include further proteins.

B7 Family

The B7 family includes B7-1, B7-2, B7-DC, B7-H1, B7-H2, B7-H3, B7-H4, B7-H5, B7- H6, B7-H7, active fragments of the same, and combinations thereof. In one embodiment the B7 protein is B7-1 (CD80], B7-2 (CD86] or an active fragment of any of the same and combinations thereof, in particular B7-1 or an active fragment thereof. B7-l(also known as CD80 uniprot number P33681] and B7-2 (also known as CD86 uniprot number P42081 are known to bind CD28 and CTLA-4. The amino acid sequence is shown in SEQ ID NO: 1.

Other B7 proteins include B7-DC (also known as PDCD1LG2 and PD-L2 uniprot number Q9BQ51], B7-H1 (also known as PD-L1 and CD274: Uniprot number Q9NZQ7]. Both these proteins bind PD-1.

Other B7 proteins include B7-H2 (also known as ICOSLG, B7RP1, CD275: Uniprot number 075144] which binds ICOS, B7-H3 (also known as CD276: Uniprot number Q5ZPR3), B7-H4 (also known as VTCN1: Uniprot number Q727D3), B7-H5 (also known as VISTA, Platelet receptor Gi24, SISP1], B7-H6 (also known as NCR3LG1, NR3L1] which binds NKp30, B7-H7 (also known as HHLA2] which binds CD28H.

In one embodiment the fragment only comprises the transmembrane domain of any one B7-H2, B7-H3, B7-H4, B7-H5, B7-H6 and B7-H7.

Individual proteins include single proteins, that is proteins or active fragments thereof that are not part of a fusion protein (including chimeric proteins], and also fusion proteins. In one embodiment the individual proteins are single proteins (including active fragments thereof).

In one embodiment the cytoplasmic domain of the B7-1 protein is present. In one embodiment the cytoplasmic domain is absent. The absence of the cytoplasmic domain may reduce or eliminate intracellular signaling to the cancer cell, which is relevant to one or more embodiments discussed below.

"Transmembrane Domains"

In one embodiment a transmembrane domain other than one derived from a B7-1 protein is employed to express a protein (including a fusion protein] encoded by a virus of the present disclosure on the surface of an infected cancer cell, for example the transmembrane domain can be employed to present an active B7 protein fragment or another protein of interest, such as an antibody or binding fragment thereof, on the surface of the infected cancer cell. Alternatively, it can be employed to present a fusion protein, for example comprising a B7 protein or active fragment thereof on said surface. In one embodiment the transmembrane domain from a PDGF receptor or fragment thereof is employed to express a B7 and/or another protein (such as an antibody or binding fragment thereof] on the cancer cell surface.

In one embodiment a transmembrane tether/anchor sequence employed comprises a PDGFR TM domain (e.g.ala513-arg561], such as shown in SEQ ID NO: 9.

In one embodiment a tether or anchor sequence employed in the present disclosure comprises a tag attached, for example to a PDGF receptor or fragment thereof, such as PDGFR TM domain, in particular SEQ ID NO: 9. Suitable tags include His-tags, Flag-tags, c-myc tag and the like. More specifically the tether or anchor may comprise a c-myc tag eg. of SEQ ID NO: 22 followed by a PDGFR TM domain is employed, (for example ala513-arg561), such as shown in SEQ ID NO: 9.

In one embodiment the c-myc tag comprises a spacer or spacer amino acids at the 3' and/or 5' end, for example gsEQKLISEEDLn (SEQ ID NO: 23 wherein the lower case letters represent the amino acids which are added to the tag as spacers).

In one embodiment the tether or anchor sequence employed is gsEQKLISEEDLnAVGQDTQEVIVVPHSLPFKVVVISAILALVVLTIISLIILIMLWQKKPR (SEQ ID NO: 24) wherein the lower case letter represent amino acid spacers).

Generally the protein/polypeptide to which the tether or anchor is attached does not comprise a stop codon.

An exogenous protein or proteins encoded by the virus according to the present disclosure will generally comprise a leader sequence (also referred to as a signal peptide). A leader sequence is, for example a sequence about 5 to 30 amino acids long located at the N-terminal of the protein or polypeptide.

In one embodiment the leader sequence for the protein to be expressed on the cancer cell surface is human, for example HuVHSS (SEQ ID NO: 104).

In one embodiment the structure of the ORF cassette is as follows:

LS-POLY-TAG-TM_D

wherein

LS is a leader sequence, for example a human leader sequence;

POLY is a polynucleotide encoding polypeptide or proteins of interest, in particular one disclosed herein;

TAG is a tag for example one disclosed herein, such as c-myc, in particular SEQ ID NO: 22 or 23;

TM_D is a TM domain for example a PDGFR TM domain, for example SEQ ID NO: 2.

When the polypeptide is a scFv then the ORF may be as follows:

LS-VARi-LINK-VAR₂-TAG-TM_D

wherein

LS is a leader sequence, for example a human leader sequence;

VARi is a polynucleotide encoding a variable region such as VH region;

LINK is a linker, for example as disclosed herein, such as a linker based on the units of G₄S, in particular SEQ ID NO: 25 GGGGSGGGGSGGGGS;

VAR2 is a polynucleotide encoding a variable region, such as a VL region;

TAG is a tag, for example one disclosed herein, such as c-myc, in particular SEQ ID NO: 22 or 23;

TM_D is a TM domain for example a PDGFR TM domain, for example SEQ ID NO: 9.

The disclosure also extends to embodiments, in particular those described specifically herein, which comprise a tag at the N- or C-termini of the polypeptide chains, such that it resides inside or on the outside of the membrane. Thus a C-termini tag located inside the membrane is advantageous because it is not likely to interfere with the binding or function of the polypeptide.

Having said this expressing the tag on the N-terminal of a surface expressed protein may be useful in some situations because it may facilitate isolation, identification and purification of cells expressing the protein.

In one embodiment a combination of a transmembrane domain and a secretory signal sequence is employed to express a protein encoded by the virus (for example as described herein] on the surface of an infected cancer cell. The present inventors have shown that the proteins encoded are expressed only on cells which are permissive to infection by the oncolytic virus, i.e. cancer cells.

In one embodiment the oncolytic adenovirus of the present disclosure comprises a fragment employed to express the protein on the surface of the infected cancer cell (such as the transmembrane fragment] is selected from about 20 to 25 hydrophobic amino acids which form a transmembrane alpha helix, for example from the proteins including PDGF receptor, insulin-like growth factor receptor, IL-6 receptor, CD28, glycophorin, LDL receptor, influenza HA protein, insulin receptor, Asialoglycoprotein receptor, Transferrin receptor.

In one embodiment the fragment employed to express the protein on the surface of the infected cancer cell (such as the transmembrane fragment] is selected from the group comprising TM domain sequences (minimal portions] given in SEQ ID NO: 26, 27, 28, 29 or 30:

In one embodiment the transmembrane domain employed is derived from a G protein-coupled receptor or S antigen from hepatitis B.

Alternatives to transmembrane domains for expressing proteins on the surface of the infected cancer cell include approaches employing glycophospholipid anchor (also referred to as a GPI anchor] attached to the C-terminal amino acid of the extracellular protein or fragment (Low et al 1986, Cross 1987, Low and Saltiel 1988, Ferguson and William 1988]. Suitable glycophospholipid anchors, for use in the present disclosure include those from Thy-1, N-CAM and DAF.

In one embodiment a fusion protein comprising a full length extracellular domain of a B7-1 protein or fragment and also a transmembrane domain derived from a protein other than B7-1 is arranged such that the B7-1 protein is located at the terminal end of the fusion protein distal from the cancer cell surface, that is on the outside of the cancer cell facing the extracellular space.

Having the transgenes according to the present disclosure under the control of an endogenous promoter is also advantageous because the proteins are expressed in accordance with the virus life cycle as opposed to being constitutively expressed. In the present situation continuous expression under an exogenous promoter, for example a strong promoter like the CMV promoter, may produce more B7-1 or ΜΙΡ-Ια protein than is necessary for a therapeutic effect and may result in off-target effects. In addition, using an endogenous promoter reduces the size of the transgene or transgene cassette since there is no need to include an exogenous promoter.

The transgene(s) or transgene cassette is locations other than between L5 and the E4 region may be under the control of an exogenous promoter such as CMV, which may be advantageous because it can strongly and constitutively express the transgene which may be particularly useful in some situations, for example wherein the patient has a very pervasive cancer.

In one embodiment the oncolytic virus according to present disclosure is an adenovirus, for example a group B adenovirus. In one embodiment the virus according to the present disclosure is a chimeric virus, for example EnAd. In one embodiment the adenovirus is replication competent.

In one embodiment the virus is replication deficient and provided as a viral vector.

In one embodiment the transgenes according to the present disclosure are located between the stop codon and polyA recognition site of the adenoviral gene L5 and the stop codon and polyA recognition site of the gene E4.

In one embodiment the transgenes according to the present disclosure are located between about bp 29356 and about 29357 of the EnAd genome, for example as shown in SEQ ID NO: 17, or a position equivalent thereto. The skilled person will understand that the absolute numerical value of the location can change based on how the numbering is allocated. However, the relative position of the inserted gene remains the same irrespective of the absolute numerical values employed.

In one embodiment the oncolytic adenovirus according to the present disclosure has a formula (I):

5'ITR-B I-BA-B2-BX-B_B-B_Y-B3-3'ITR (I)

wherein:

Bi is a bond or comprises: E1A, E1B or E1A-E1B (in particular E1A, E1B or E1A-E1B); B_A is E2B-L1-L2-L3-E2A-L4;

B2 is a bond or comprises E3 or a transgene, for example under an endogenous or exogenous promoter;

Βχ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both;

Bg comprises L5;

Βγ comprises the transgene cassette which encodes the B7-1 protein or an active fragment thereof; and

B3 is a bond or comprises E4.

In one embodiment the oncolytic virus has a formula (la):

5'ITR-B₁-B_A-B₂-B_B-B_Y-B3-3'ITR (la)

wherein: Bi is a bond or comprises: El A, E1B or E1A-E1B (in particular El A, E1B or E1A-E1B);

B_A is E2B-L1-L2-L3-E2A-L4;

B2 is a bond or comprises E3;

Bg comprises L5;

B3 is a bond or comprises E4.

In one embodiment the virus genome in constructs of formula (I) and/or (la) is from Adl l or EnAd, in particular EnAd.

In one embodiment the transgene cassette is under the control of an endogenous promoter, for example the major late promoter.

Regulatory Elements

In one embodiment By comprises a transgene cassette and a regulatory element or elements are required, and for example may be associated with each transgene.

In one embodiment the regulatory element is splice acceptor sequence.

In one embodiment the regulatory element is a Kozak sequence.

In one embodiment, for example where the transgene encodes a polycistronic RNA molecule, the regulatory element is an IRES sequence.

In one embodiment the regulatory sequence is a high efficiency self-cleavable peptide sequence such as P2A, T2A, F2A, E2A.

In one embodiment the regulatory sequence is a polyA tail.

In one embodiment there are at least two regulatory sequences, for example a splice acceptor and a Kozak sequence or a splice acceptor and a polyA tail, or a splice acceptor and an IRES sequence, or a splice acceptor and a P2A sequence.

In one embodiment there are at least three regulator sequences, for example a splice acceptor sequence, a Kozak sequence and polyA tail, or a splice acceptor sequence an IRES or 2A sequence and a polyA tail; or a splice acceptor sequence, Kozak sequence and an IRES or 2A sequence.

In one embodiment there are at least four regulatory sequences, for example a splice acceptor sequence, a Kozak sequence, an IRES or 2A sequence and a polyA tail, in particular located between L5 and E4 in the order splice acceptor sequence, Kozak sequence, IRES or 2A sequence and a polyA tail.

In one embodiment the transgene encodes a polycistronic RNA molecule comprising both an IRES and a 2A regulatory sequence.

Proteins Encoded By the Virus

In one embodiment the virus of the present disclosure encodes multiple proteins, for example 3 proteins independently for expression on the surface of the infected cancer cell or secretion into the extracellular space, for example independently selected from the group comprising a protein, an antibody or binding fragment thereof (such as an antagonistic antibody or binding fragment), a chemokine, a cytokine, an immunomodulator and an enzyme.

In one embodiment a transgene (such as the first, second and/or third transgene) independently encodes an antibody or binding fragment thereof (for example in a form suitable for expression on the surface of a cancer cell and/or a soluble form) is specifically binds an antigen selected from CD3, CD28, CD80, CD86, 4-1BB, GITR, 0X40, CD27, CD40 VEGF, and a T cell deactivation factors, such as CTLA-4, PD1 or PDL1.

In one embodiment a transgene (such as the first, second and/or third transgene) independently encodes a cytokine, or soluble variant thereof selected from the group comprising IL-2, IFNa, IFN , IFNy, GM-CSF, IL-15, IL-12 and fms-related tyrosine kinase 3 ligand (FLT3L).

In one embodiment a transgene (such as the first, second and/or third transgene) encodes a chemokine, selected from the group comprising MlPl-alpha, IL-8, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19 and CCL21.

In one embodiment at least one transgene encodes a B7-1 protein or an active fragment thereof, one is an anti-human CD3 antibody or antibody fragment (such as a CD3e antibody or antibody fragment) and one is ΜΙΡ-Ι or an active fragment thereof as described herein. In addition to these 3 protein, the virus may encode additional proteins, such a fourth, fifth or sixth protein.

Protein in this context includes a fusion protein. In one embodiment the virus of the present disclosure encodes two different B7 proteins, active fragments thereof or combinations of the same, for example both for expression on a cancer cell surface.

In one embodiment the virus according to the present disclosure encodes one or two protein for cell surface expression and one or two proteins which are not capable of being anchored on the cell surface, for example are intended to act with the cancer cell or are for secretion/release from the cells.

In one embodiment a B7-1 protein or active fragment is encoded by the virus of the present disclosure for expression on the surface of the cancer cell and a soluble form, which is released or secreted from the cell, of the same B7-1 protein or a different B7 protein (including active fragments) is also encoded by the virus.

In one embodiment at least two different B7 proteins or active fragments are encoded by a virus of the present disclosure.

In one embodiment at least one protein expressed on the cell surface is a B7-1 protein and at least one non-cell-anchored (e.g .secreted) proteins is a non-B7-l protein, for example ΜΙΡ-Ια. Alternatively, the non-B7-l protein, such as MIP-lcc may be anchored. This can be achieved for example by fusing MIP-l with a transmembrane domain.

Thus, in one embodiment the MIP-la (for example having an amino acid sequence given in SEQ ID NO: 3 or a sequence at least 95% identical thereto) is non-cell anchored and is secreted. In another embodiment, the ΜΙΡ-Ι is cell anchored and expressed on the surface of the cancer cell.

Thus, in one embodiment the anti-CD3 antibody, such as an anti-CD3s antibody having an amino acid sequence as set forth in SEQ ID NO: 2 or a sequence at least 95% identical thereto is cell anchored and expressed on the surface of the cancer. In another embodiment, the anti-CD3 antibody is secreted and non-cell anchored.

In one embodiment the anti-CD3 antibody is fully human or humanised.

In one embodiment the multiple proteins may be encoded to be expressed as separate proteins which are independently processed and expressed in the cancer cell membrane. The independence of the proteins on the surface of the cancer cell may make a positive contribution to the immune activation. Whilst not wishing to be bound by theory, lipid packing can influence the fluidity (i.e. the viscosity) of the lipid bilayer in the membrane of the cancer cell. Viscosity of the membrane can affect the rotation and orientation of proteins and other bio-molecules within the membrane, thereby affecting the functions of these molecules. Thus when the proteins encoded by the virus are located as individual and separate proteins within the membrane of the infected cancer cell, the fluidity of the lipid bilayer allows independent movement of the molecules which may be a particularly suitable format, for example similar to a natural format that is conducive to biological function.

In one embodiment the independently processed and expressed proteins are located

(anchored) in different locations, such as physically separate locations, in the cancer cell membrane.

In one embodiment one or more proteins (for example all the proteins) encoded by the virus and expressed on the surface of the infected cancer cell are not fusion proteins.

As described supra in some embodiment the proteins are expressed as a fusion protein.

In one embodiment the virus of the present disclosure provides one or more separate independent proteins for cell surface expression and one or more fusion proteins for cell surface expression.

Thus in one embodiment the virus according to the present disclosure comprises

DNA sequences encoding said multiple proteins for expression, for example on the surface or the infected cancer cell.

In one embodiment the multiple proteins (including fusion proteins) are encoded in different locations in the virus genome, for example in E3, Βχ and/or Βγ and are expressed separately on the surface of the infected cancer cell.

In one embodiment the multiple proteins (including fusion proteins) are encoded in the same location in the virus genome and expressed together on the infected cancer cell surface, for example where the proteins encoded are provided as a fusion protein, in particular wherein the fusion protein comprises a B7-1 protein or an active fragment thereof. In one embodiment the multiple proteins are encoded in the same location in the virus and are expressed as one or more fusion proteins together on the surface of the infected cancer cell.

When the location of the gene(s) encoding a protein or protein(s) of interest in the virus is the same then the genes may, for example be linked by an IRES sequence or a 2A peptide.

In one embodiment the virus according to the present disclosure comprises a fourth transgene and optionally a fifth transgene, i.e. one or more of said multiple proteins, for example encoding a polypeptide selected from the group comprising a cytokine, a chemokine, a ligand, and an antibody molecule, such as an antagonistic antibody molecule, and an agonistic antibody molecule.

In one embodiment the additional protein or proteins is/are independently selected from the group comprising an antibody, antibody fragment or protein ligand that binds CD 3, CD28, CD80, CD86, 4-1BB, GITR, 0X40, CD27, CD40 and combinations, in particular CD80, for example in forms suitable for expression on the surface of a cancer cell.

In one embodiment the protein is an anti-CD3 antibody, for example independently selected from a Muromonab-CD3 (also known as 0KT3), otelixizumab (also known as TRX4], teplizumab (also known as hOKT3yl (Ala-Ala] ], or visilizumab.

In one embodiment the anti-CD3 antibody, such as an anti-CD3s is in the form of an antibody fragment, for example an scFv that is part of a fusion protein with the transmembrane region of another protein, for example the transmembrane domain from the PDGF receptor or from the cell surface form of IgG

Thus in one embodiment the protein is an anti-human CD3s scFv such as one having the amino acid sequence as set forth in SEQ ID NO: 2 or a sequence at least 95% identical thereto.

In one embodiment the antibody molecule is an inhibitor (antagonistic antibody) is independently selected from the group comprising an inhibitor of an angiogenesis factor, such as an anti-VEGF antibody molecule, and inhibitor of T cell deactivation factors, such as an anti-CTLA-4, anti-PDl or anti-PDLl antibody molecule. In one embodiment the antibody molecule is an agonist independently selected from the group comprising antibodies to CD40, GITR, OX40, CD27 and 4-1BB.

In one embodiment an additional transgene encodes a chemokine, selected from the group comprising MIP-la, IL-8, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19 and CCL21. Advantageously, one or more of this group of proteins is expressed by the virus as a free protein which may be secreted from the cancer cell may be particularly suitable for attracting immune cells and stimulating an immune response to the cancer cell in vivo.

In one embodiment, the transgene encodes MIP-la, for example having the amino acid sequence as set forth in SEQ ID NO: 3 or a sequence at least 95% identical thereto. In one embodiment an additional transgene encodes a cytokine, or soluble variant thereof selected from the group comprising IL-2, IFN , IFNp, IFNy, GM-CSF, IL-15, IL-12 and fms-related tyrosine kinase 3 ligand (FLT3L). Advantageously, one or more of this group of proteins expressed by the virus, in particular as a free protein secreted from the cancer cell, may be particularly suitable for stimulating an immune response in vivo to the cancer cell.

In one embodiment in addition to at least the B7-1 protein or active fragment thereof expressed on the surface of the infected cancer cell, one or more molecules are also expressed on the surface and/or secreted.

Thus, in one embodiment the virus encodes B7-1 and B7-2 or an active fragment of any one of the same or a combination thereof.

Thus, in one embodiment the virus encodes the B7-1 or an active fragment thereof for expression on the surface of the infected cancer cell and an anti-CD3 (agonist), such as anti-CD3s antibody or antibody binding fragment (for example as a scFv, for example having the amino acid sequence set forth in SEQ ID NO: 2 or a sequence at least 95% identical thereto) also for expression on the cancer cell surface, in particular where the proteins are expressed as individual proteins on the cell surface.

Thus, in one embodiment the virus encodes B7-1 or an active fragment thereof for expression on the surface of the infected cancer cell and an anti-CD3e, and an anti-VEGF (antagonist) antibody or a binding fragment thereof also for expression on the cancer cell surface or for release from the cancer cell, for example by secretion or after lysis/death of the infected cancer cell.

Thus, in one embodiment the virus encodes B7-1 or an active fragment thereof for expression on the surface of the infected cancer cell and an antibody, antibody fragment or protein ligand that binds CD3, CD28, CD80, CD86, 4-1BB, GITR, OX40, CD27, CD40, in particular CD80, also for expression on the cancer cell surface or for release from the cancer cell, for example by secretion or release after lysis/death of the infected cancer cell.

Thus, in one embodiment the virus encodes B7-1 or an active fragment of thereof for expression on the surface of the infected cancer cell and a cytokine selected from IL-2, IFN- alpha, IFN-beta, IFN-gamma, GM-CSF, IL-15, IL-12, and FLT3L, for example for release from the cancer cell, in particular by secretion or release after cell lysis/death of the infected cancer cell.

Thus, in one embodiment the virus encodes B7-1 or an active fragment thereof for expression on the surface of the infected cancer cell and a chemokine selected from ΜΙΡ-Ι , IL-8, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, in particular MIP-lcx, for example for release from the cancer cell, in particular by secretion or release after cell lysis/death of the infected cancer cell.

Thus in one embodiment the virus encodes B 7-1 or an active fragment of any one of the same or a combination thereof for expression on the surface of the infected cancer cell and an anti-CD3, such as an anti-CD3s (agonist) antibody or antibody binding fragment (such as a scFv, for example having the amino acid sequence set forth in SEQ ID NO: 2 or a sequence at least 95% identical thereto] also for expression on the cancer cell surface (in particular where the proteins are expressed as individual proteins on the cell surface] and further encodes a cytokine or chemokine selected from IL-2, IFN-alpha, IFN-gamma, GM- CSF, IL-15, IL-12, FLT3L, MIP-la, IL-8, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, in particular MIP-la, for example for release from the cancer cell, in particular by secretion or after cell lysis/death of the infected cancer cell.

Thus in one embodiment the virus encodes B7-1 or an active fragment thereof for expression on the surface of the infected cancer cell and an anti-CD3 (agonist) antibody or antibody fragment (such as a scFv, for example having the amino acid sequence set forth in SEQ ID NO: 2 or a sequence at least 95% identical thereto) also for expression on the cancer cell surface (in particular where the proteins are expressed as individual proteins on the cell surface) and further encodes an antibody, antibody fragment or protein ligand that binds CD28, CD80, CD86, 4-1BB, GITR, 0X40, CD27, CD40 or an anti-VEGF (antagonist) antibody, in particular CD80, also for expression on the cancer cell surface or for release from the cancer cell, for example by secretion or release after lysis/death of the infected cancer cell.

Thus in one embodiment the virus encodes B7-1 or an active fragment thereof for expression on the surface of the infected cancer cell and two different cytokines or chemokines selected from IL-2, IFNa, IFNp, IFNy, GM-CSF, IL-15, and IL-12, FLT3L, ΜΙΡΙα, IL-8, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, in particular MIP-la, for example for release from the cancer cell, in particular by secretion of after cell lysis/death of the infected cancer cell.

Thus in one embodiment the virus encodes B7-1 or an active fragment thereof for expression on the surface of the infected cancer cell and an anti-CD3 (agonist) antibody or antibody binding fragment (such as a scFv, for example having the amino acid sequence set forth in SEQ ID NO: 2 or a sequence at least 95% identical thereto) also for expression on the cancer cell surface (in particular where the proteins are expressed as individual proteins on the cell surface) and further encodes a cytokine independently selected from IL-2, IFNa, IFNy, GM-CSF, IL-15, and IL-12, and or a chemokine selected from RANTES (CCL5), MIP-la (LD78a (CCL3), ΙΌ78β (CCL3L1) isoforms)or ΜΙΡΙβ, in particular MIP-la, which can be released from the cancer cell, in particular by secretion before and release after cell lysis/death of the infected cancer cell.

In one embodiment, which in particular may be combined with any of the embodiments above, the virus further encodes an anti-PD-1 antibody (an antagonist).

In one embodiment the protein or proteins encoded in the transgene cassette for cell membrane expression may also comprise a peptide linker or spacer between the transmembrane domain and the extracellular ligand binding domain. Such linkers or spacers may add flexibility to the cell surface expressed protein that enhances the ability of the protein to interact with its target molecule, for example on an adjacent cell. Such linkers or spacers may also be designed or selected to promote dimerisation or trimerisation of the proteins at the cell surface, via disulphide bond formation or protein-protein interactions.

For example the hinge regions of immunoglobulin molecules or CD8 may be employed to enhance both flexibility and dimerisation.

In one embodiment the protein or proteins encoded in the transgene cassette may also comprise a peptide tag. The peptide tag may include c-myc, poly-histidine, V5 or FLAG tags and can be located on the N-terminus or C-terminus of the polypeptide, either intracellularly or extracellularly, or may be encoded within the protein for example in an extracellular loop or between the transmembrane domain and the extracellular domain. Peptide tags can be used as spacers or linkers between different protein domains, for example the transmembrane and the extracellular domain, and can be used for detection or purification or detection of the protein, or cells expressing the protein.

In one embodiment the one or more additional transgenes is under the control of an exogenous or endogenous promoter, for example an endogenous promoter. In one embodiment a transgene in the E3 region (B2) is under control of an exogenous promoter.

In one embodiment the one or more additional transgenes genes are between the E3 region and the fibre L5 in the adenovirus genome, for example at a position Βχ in the construct of formula (I], in particular under the control of an exogenous promoter. Thus in one embodiment a transgene in Βχ is under the control of an exogenous promoter.

In one embodiment the one or more additional transgenes genes are between the E4 region and the fibre L5 in the adenovirus genome, for example at a position Βγ in the construct of formula (I] or [la], in particular under the control of an endogenous promoter, such as the major late promoter. This may be in addition to a B7-1 protein or active fragment thereof encoded in the region By.

In one embodiment there is provided a composition comprising an oncolytic adenovirus according to the present disclosure, for example a pharmaceutical composition, in particular comprising a pharmaceutically acceptable excipient, such as a diluent or carrier.

In one embodiment there is provided an oncolytic adenovirus according to the present disclosure or a composition comprising the same, for use in treatment, in particular for use in the treatment of cancer.

In one embodiment there is provided a method of treating a patient in need thereof comprising administering a therapeutically effective amount of an oncolytic virus according to the present disclosure or a composition, such as a pharmaceutical composition comprising the same.

In one embodiment there is provided use of an oncolytic adenovirus according to the present disclosure or a composition comprising the same for the manufacture of a medicament for the treatment of cancer, in particular carcinomas, for example colorectal, lung, bladder, renal, pancreatic, hepatic, head and neck, breast or ovarian cancer. In one embodiment there is provided a polynucleotide comprising a genomic sequence of at least 50% of a virus according to the present disclosure (for example 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%) and comprising a sequence encoding a transgene cassette according to the present disclosure. In one embodiment the polynucleotide sequence is in the form of a plasmid.

In one embodiment there is provided a host cell, for example a mammalian cell, such as a HEK293 cell or a derivative thereof, comprising an oncolytic virus according to the present disclosure or a polynucleotide sequence according to the present disclosure.

In one embodiment there is provided a process for preparing an oncolytic adenovirus according to the present disclosure comprising a step of inserting a polynucleotide encoding the transgenes according to the present disclosure into an oncolytic adenovirus.

In one embodiment there is provided a process of replicating a virus according to the present disclosure comprising the step of culture host cells in the presence of the virus under conditions suitable for replication. Generally the method will comprise a further step of harvesting the virus, for example from the supernatant or after lysis of the host cells.

Definitions

Oncolytic virus with selectivity for cancer cells as employed herein refers to a virus that preferentially kills cancer cells, for example because it preferentially infects cancer cells and/or the virus life cycle is dependent on a gene, such as p53 that is disregulated, for example over-expressed in cancer cells. In one embodiment the oncolytic virus preferentially infects cancer cells and goes on to replicate its genome and produce capsid proteins to generate new virus particles, for example as per EnAd.

The selectivity for cancer cells (therapeutic index) can be tested as described in

WO2005/118825 incorporated herein by reference.

Transgene as employed herein refers to a gene that has been inserted into the genome sequence of the adenovirus, wherein the gene is unnatural to the virus (exogenous) or not normally found in that particular location in the virus. Examples of transgenes are given herein. Transgene as employed herein also includes a functional fragment of the gene that is a portion of the gene which when inserted is suitable to perform the function or most of the function of the full-length gene, for example 50% of the function or more.

Transgene and coding sequence are used interchangeably herein in the context of inserts into the viral genome, unless the context indicates otherwise. Coding sequence as employed herein means, for example a DNA sequence encoding a functional RNA, peptide, polypeptide or protein. Typically the coding sequence is cDNA for the transgene that encodes the functional RNA, peptide, polypeptide or protein of interest. Functional RNA, peptides, polypeptide and proteins of interest are described below.

In one embodiment transgene as employed herein refers to a segment of DNA containing a gene or cDNA sequence that has been isolated from one organism and is introduced into a different organism i.e. the virus of the present disclosure. In one embodiment this non-native segment of DNA will generally retain the ability to produce functional RNA, peptide, polypeptide or protein. Transgenes employed may for example encode a single proteins or active fragment thereof, chimeric protein or a fusion protein.

Clearly the virus genome contains coding sequences of DNA. Endogenous (naturally occurring genes) in the genomic sequence of the virus are not considered a transgene, within the context of the present specification unless then have been modified by recombinant techniques such as that they are in a non-natural location or in a non-natural environment.

Thus in one embodiment the transgene(s) inserted encodes a human or humanised protein, polypeptide or peptide. The transgene(s) may be located within a transgene cassette for example.

In one embodiment the transgene comprises a DNA sequence encoding a B7-1 protein or an active fragment thereof. The present disclosure provides that the B7-1 protein or activate fragment thereof may be provided in one or more formats independently selected from a fusion protein, a simple B7 protein or an active fragment thereof.

Simple B7-1 protein or an active fragment thereof as employed herein refers to proteins which are essentially wild-type proteins, for example which are not part of a fusion protein and which has a sequence identical or similar to the relevant known protein, in particular the known human protein. Simple gene also includes wherein 10% of the amino acids are substituted or deleted over the whole length of the relevant protein.

GPI anchor as employed herein refers to is a glycolipid that can be attached to the C- terminus of a protein during posttranslational modification. It is composed of a phosphatidylinositol group linked through a carbohydrate-containing linker (glucosamine and mannose glycosidically bound to the inositol residue) and via an ethanolamine phosphate (EtNP) bridge to the C-terminal amino acid of a mature protein. The two fatty acids within the hydrophobic phosphatidyl-inositol group anchor the protein to the cell membrane.

Glypiated (GPI-linked) proteins generally contain a signal peptide, thus directing them into the endoplasmic reticulum (ER). The C-terminus is composed of hydrophobic amino acids that stay inserted in the ER membrane. The hydrophobic end is then cleaved off and replaced by the GPI-anchor. As the protein progresses through the secretory pathway, it is transferred via vesicles to the Golgi apparatus and finally to the extracellular space where it remains attached to the exterior leaflet of the cell membrane. Since the glypiation is the sole means of attachment of such proteins to the membrane, cleavage of the group by phospholipases will result in controlled release of the protein from the membrane. The latter mechanism is used in vitro; i.e., the membrane proteins released from the membranes in the enzymatic assay are glypiated protein.

Phospholipase C (PLC) is an enzyme that is known to cleave the phospho-glycerol bond found in GPI-anchored proteins. Treatment with PLC will cause release of GPI-linked proteins from the outer cell membrane. The T-cell marker Thy-1 and acetylcholinesterase, as well as both intestinal and placental alkaline phosphatases, are known to be GPI-linked and are released by treatment with PLC. GPI-linked proteins are thought to be preferentially located in lipid rafts, suggesting a high level of organization within plasma membrane microdomains.

A review of GPI anchors written by Ferguson, Kinoshita and Hart is available in Chapter 11 of Essentials of Glycobiology 2^nd Edition.

Viruses

Replication competent in the context of the present specification refers to a virus that possesses all the necessary machinery to replicate in cells in vitro and in vivo, i.e. without the assistance of a packaging cell line. A viral vector, for example deleted in at least the EIA region, capable of replicating in a complementary packaging cell line is not a replication competent virus in the present context.

A viral vector is a replication deficient virus, which requires a packaging cell line (comprising a transgene) to replicate.

A replication capable virus as employed herein refers to a replication competent virus or a virus whose replication is dependent on a factor in the cancer cells, for example an upregulated factor, such as p53 or similar.

In one embodiment the adenovirus is a human adenovirus. "Adenovirus", "serotype" or adenoviral serotype" as employed herein refers to any adenovirus that can be assigned to any of the over 50 currently known adenoviral serotypes, which are classified into subgroups A-F, and further extends to any, as yet, unidentified or unclassified adenoviral serotypes. See, for example, Strauss, "Adenovirus infections in humans," in The Adenoviruses, Ginsberg, ea., Plenum Press, New York, NY, pp. 451-596 (1984) and Shenk, "Adenoviridae: The Viruses and Their Replication," in Fields Virology, Vol.2, Fourth Edition,

Adenoviruses are grouped based on their capsid.

In one embodiment the adenovirus is a subgroup B, for example independently selected from the group comprising or consisting of: Ad3, Ad7, Adll, Adl4, Adl6, Ad21, Ad34 and Ad51, such as Adll, in particular Ad lip (the Slobitski strain). In one embodiment the adenovirus of the invention has the capsid, such as the hexon and/or fibre of a subgroup B adenovirus, such as Adll, in particular Adllp. In one embodiment the adenovirus is Adll or has the fibre and/or hexon and/or penton of Adll, such as Adllp.

In one embodiment the virus of the present disclosure is not a group A virus.

In one embodiment the virus of the present disclsoure does not comprise an adeno death protein (ADP).

In one embodiment the virus of the present disclosure is not a group C virus.

In one embodiment the virus of the present disclosure does not comprise an adenovirus death protein.

Enadenotucirev [EnAd] is a chimeric oncolytic adenovirus, formerly known as ColoAdl (WO2005/118825], with fibre, penton and hexon from Adllp, hence it is a subgroup B virus. It has a chimeric E2B region, which comprises DNA from Adllp and Ad3. Almost all of the E3 region and part of the E4 region is deleted in EnAd. Therefore, it has significant space in the genome to accommodate additional genetic material whilst remaining viable. Furthermore, because EnAd is a subgroup B adenovirus, pre-existing immunity in humans is less common than, for example, Ad5. Other examples of chimeric oncolytic viruses with Adll fibre, penton and hexon include OvAdl and OvAd2 (see WO2006/060314).

EnAd seems to preferentially infect tumour cells, replicates rapidly in these cells and causes cell lysis. This, in turn, can generate inflammatory immune responses thereby stimulating the body to also fight the cancer. Part of the success of EnAd is hypothesised to be related to the fast replication of the virus in vivo.

Importantly, it has been demonstrated clinically that EnAd can be administered systemically (e.g. by intravenous or intraperitoneal injection or infusion) and then subsequently selectively infect and express proteins within tumour cells. This property of EnAd, which may be shared by Adllp and other group B adenoviruses in particular those expressing the capsid proteins of Adllp (such as those described herein), makes it possible to express proteins on the surface of cancer cells without having to directly inject the transgenes into the tumour, which is not feasible for many cancers.

Whilst EnAd selectively lyses tumour cells, it may be possible to introduce further beneficial properties, for example increasing the therapeutic activity of the virus or reducing side-effects of the virus by arming it with transgenes, such as a transgene which encodes a cell signalling protein or an antibody, or a transgene which encodes an entity which stimulates a cell signalling protein (s).

Advantageously arming a virus, with DNA encoding certain proteins that can be expressed inside the cancer cell, may enable the body's own defenses to be employed to combat tumour cells more effectively, for example by making the cells more visible to the immune system or by delivering a therapeutic gene/protein preferentially to target tumour cells. In one embodiment the oncolytic adenovirus of the present disclosure stimulates the patient's immune system to fight the tumor, for example by reducing the cancers ability to suppress immune responses.

In one embodiment the oncolytic virus has a fibre, hexon and penton proteins from the same serotype, for example Adll, in particular Adllp, for example found at positions 30812-31789, 18254-21100 and 13682-15367 of the genomic sequence of the latter wherein the nucleotide positions are relative to Genbank ID 217307399 (accession number: GC689208).

In one embodiment the adenovirus is enadenotucirev (also known as EnAd and formerly as ColoAdl]. Enadenotucirev as employed herein refers the chimeric adenovirus of SEQ ID NO: 21. It is a replication competent oncolytic chimeric adenovirus which has enhanced therapeutic properties compared to wild type adenoviruses (see WO2005/118825]. EnAd has a chimeric E2B region, which features DNA from Adllp and Ad3, and deletions in E3/E4. The structural changes in enadenotucirev result in a genome that is approximately 3.5kb smaller than Adllp thereby providing additional "space" for the insertion of transgenes.

Antibody or Antibody fragment

The term antibody as used herein refers to an immunoglobulin molecule capable of specific binding to a target antigen, such as a carbohydrate, polynucleotide, lipid, polypeptide, peptide etc., via at least one antigen recognition site (also referred to as a binding site herein], located in the variable region of the immunoglobulin molecule.

As used herein antibody molecule includes antibodies and binding fragments thereof.

Antigen binding site as employed herein refers to a portion of the molecule, which comprises a pair of variable regions, in particular a cognate pair that interact specifically with the target antigen.

Antibody binding fragmentSpecifically as employed herein is intended to refer to a binding site that only recognises the antigen to which it is specific or a binding site that has significantly higher binding affinity to the antigen to which is specific compared to affinity to antigens to which it is non-specific, for example 5, 6, 7, 8, 9, 10 times higher binding affinity.

Antibody molecules as employed may comprise a complete antibody molecule having full length heavy and light chains, bispecific antibody format comprising full length antibodies or a fragment of any one of the same including, but are not limited to Fab, modified Fab, Fab', modified Fab', F(ab')2, Fv, single domain antibodies (e.g. VH or VL or VHH], scFv, bi, tri or tetra-valent antibodies, Bis-scFv, diabodies, triabodies, tetrabodies and epitope-binding fragments of any of the above (see for example Holliger and Hudson, 2005, Nature Biotech. 2 (9): 1126-1136; Adair and Lawson, 2005, Drug Design Reviews - Online 2(3], 209-217]. The methods for creating and manufacturing these antibody fragments are well known in the art [see for example Verma et al., 1998, Journal of Immunological Methods, 216, 165-181). Other antibody fragments for use in the present invention include the Fab and Fab' fragments described in International patent

applications WO2005/003169, WO2005/003170 and WO2005/003171. Multi-valent antibodies may comprise multiple specificities e.g bispecific or may be monospecific [see for example WO 92/22853, WO05/113605, WO2009/040562 and WO2010/035012).

Humanised [which include CDR-grafted antibodies) as employed herein refers to molecules having one or more complementarity determining regions [CDRs) from a non- human species and a framework region from a human immunoglobulin molecule [see, e.g. US 5,585,089; WO91/09967). It will be appreciated that it may only be necessary to transfer the specificity determining residues of the CDRs rather than the entire CDR [see for example, Kashmiri et al., 2005, Methods, 36, 25-34). Humanised antibodies may optionally further comprise one or more framework residues derived from the non-human species from which the CDRs were derived.

As used herein, the humanised antibody refers to an antibody molecule wherein the heavy and/or light chain contains one or more CDRs [including, if desired, one or more modified CDRs) from a donor antibody [e.g. a murine monoclonal antibody) grafted into a heavy and/or light chain variable region framework of an acceptor antibody [e.g. a human antibody). For a review, see Vaughan et al, Nature Biotechnology, 16, 535-539, 1998. In one embodiment rather than the entire CDR being transferred, only one or more of the specificity determining residues from any one of the CDRs described herein above are transferred to the human antibody framework [see for example, Kashmiri et al., 2005, Methods, 36, 25-34). In one embodiment only the specificity determining residues from one or more of the CDRs described herein above are transferred to the human antibody framework. In another embodiment only the specificity determining residues from each of the CDRs described herein above are transferred to the human antibody framework.

When the CDRs or specificity determining residues are grafted, any appropriate acceptor variable region framework sequence may be used having regard to the class/type of the donor antibody from which the CDRs are derived, including mouse, primate and human framework regions. Suitably, the humanised antibody according to the present disclosure has a variable domain comprising human acceptor framework regions as well as one or more of the CDRs provided herein.

Examples of human frameworks which can be used in the present disclosure are KOL, NEWM, REI, EU, TUR, TEI, LAY and POM [Kabat et al., supra). For example, KOL and NEWM can be used for the heavy chain, REI can be used for the light chain and EU, LAY and POM can be used for both the heavy chain and the light chain. Alternatively, human germline sequences may be used; these are available at: http://vbase.mrc-cpe.cam.ac.uk/

In a humanised antibody of the present disclosure, the acceptor heavy and light chains do not necessarily need to be derived from the same antibody and may, if desired, comprise composite chains having framework regions derived from different chains. The framework regions need not have exactly the same sequence as those of the acceptor antibody. For instance, unusual residues may be changed to more frequently- occurring residues for that acceptor chain class or type. Alternatively, selected residues in the acceptor framework regions may be changed so that they correspond to the residue found at the same position in the donor antibody (see Reichmann et al., 1998, Nature, 332, 323-324). Such changes should be kept to the minimum necessary to recover the affinity of the donor antibody. A protocol for selecting residues in the acceptor framework regions which may need to be changed is set forth in W091/09967.

In one embodiment the antibody molecules of the present disclosure are fully human, in particular one or more of the variable domains are fully human.

Fully human molecules are those in which the variable regions and the constant regions (where present) of both the heavy and the light chains are all of human origin, or substantially identical to sequences of human origin, not necessarily from the same antibody. Examples of fully human antibodies may include antibodies produced, for example by the phage display methods described above and antibodies produced by mice in which the murine immunoglobulin variable and optionally the constant region genes have been replaced by their human counterparts eg. as described in general terms in EP0546073 Bl, US 5,545,806, US 5,569,825, US 5,625,126, US 5,633,425, US 5,661,016, US5,770,429, EP 0438474 and EP0463151.

Suitable antibodies and antibody fragments may be agonistic or antagonistic and include those with anticancer activity and those which modify host cell responses to the cancer, for example: an agonist or antagonistic antibody or antibody fragment may decrease vascularization or normalise vascularization of the tumour.

In one embodiment agonistic antibodies or other encoded proteins may render the host cell more visible to the host's innate and adaptive immune responses, for example by expressing antigens, danger signals, cytokines or chemokines to attract and activate the same, or by binding to co-stimulatory or checkpoint pathway molecules to enhance adaptive immune responses.

Therapeutic antibody or antibody-binding fragment as employed herein refers to antibody or antibody-binding fragment which, when inserted in to the oncolytic virus, has a beneficial impact on a pathology in the patient, for example on the cancer being treated.

Beneficial impact as employed herein refers to a desirable and/or advantageous effect of the antibody being expressed in vivo.

Classes of therapeutic antibodies and antibody -binding fragments include: anti-EGF antibodies, anti-VEGF antibodies, anti-PDGF antibodies, anti-CTLA antibodies, anti-PDl antibodies, anti-PDLl antibodies and anti-FGF antibodies.

Registered therapeutic antibodies suitable for incorporation into viruses of the present disclosure include: abciximab, adalimumab, alemtzumab, basiliximab, belimumab, bevacizumab, brentuximab vedotin, canakinumab, cetuximab, certolzumab, daclizumab, denosumab, eculzumab, efalixumab, gemtuzumab, golimumab, ibritumomab tiuxetan, infliximab, ipilimumab, muromonab-CD3, ofatumumab, palivizumab, panitumumab, ranibizumab, rituximab, tocilizumab, tositumomab and trastuzumab.

In one embodiment the antibody variable region sequences of an antibody or antibody fragment employed are between 95 and 100% similar or identical to the variable regions of bevacizumab (also known as Avastin®), such as 96, 97, 98 or 99% similar or identical.

Also suitable for incorporation into viruses of the present disclosure are the coding sequences for those antibodies and binding fragments thereof which are approved for a cancer indications, for example trastuzumab, tositumomab, rituximab, panitumumab, ofatumumab, ipilimumab, ibritumomab tiuxetan, gemtuzumab, denosumab, cetuximab, brentuximab vedotin, avastin and adalimumab.

In one embodiment the antibody variable region sequences of an antibody or antibody fragment employed are between 95 and 100% similar or identical to the variable regions of a known antibody or an antibody disclosed herein.

Other Transgenes

In one embodiment a transgene may encode a protein independently selected from the group comprising: IL la, IL-Ιβ, IL-6, IL-9, IL-12, IL-13, IL-17, IL-18, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-33, IL-35, Interleukin-2 (IL-2), IL-4, IL-5, IL-7, IL-10, IL-15, IL-21, IL- 25, IL-1RA, IFNa, IFNp, IFNy, TNFa, TGFp, lymphotoxin a (LTA] and GM-CSF or an active fragment of any one of the same.

In one embodiment a chemokine encoded by a transgene according to the present disclosure is independently selected from the group comprising: IL-8, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, CXCR2, CCR2, CCR4, CCR5, CCR6, CCR7, CCR8, CXCR3, CXCR4, CXCR5 and CRTH2 or an active fragment of any one of the same.

In one embodiment a transgene according to the present disclosure encodes a protein independently selected from STAT3, STAT1, STAT4, STAT6, CTIIA, MyD88 and NFKB family or an active fragment of any one of the same.

In one embodiment a transgene may encode a cytokine independently selected from the TNF superfamily.

In one embodiment a transgene according to the present disclosure encodes MIP- la.

Linkers

Linkers suitable for use in fusion proteins of the present disclosure include hinge linker sequences disclosed in SEQ ID NO: 31 to 39 and flexible linker sequences disclosed in SEQ ID NO: 40 to 80, where (S) is optional in sequences 42 to 46.

Examples of rigid linkers include the peptide sequences GAPAPAAPAPA (SEQ ID NO: 81), PPPP (SEQ ID NO: 82) and PPP (SEQ ID NO: 83). Other linkers are shown in SEQ ID NO: 84 to 97. Definitions Relevant to Formula (I) and (la)

A bond refers to a covalent bond connecting the one DNA sequence to another DNA sequence, for example connecting one section of the virus genome to another. Thus when a variable in formula (I) and (la) herein represents a bond the feature or element represented by the bond is absent i.e. deleted.

As the structure of adenoviruses is, in general, similar the elements below are discussed in terms of the structural elements and the commonly used nomenclature referring thereto, which are known to the skilled person. When an element is referred to herein then we refer to the DNA sequence encoding the element or a DNA sequence encoding the same structural protein of the element in an adenovirus. The latter is relevant because of the redundancy of the DNA code. The viruses' preference for codon usage may need to be considered for optimised results.

Any structural element from an adenovirus employed in the viruses of the present disclosure may comprise or consist of the natural sequence or may have similarity over the given length of at least 95%, such as 96%, 97%, 98%, 99% or 100%. The original sequence may be modified to omit 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the genetic material. The skilled person is aware that when making changes the reading frames of the virus must be not disrupted such that the expression of structural proteins is disrupted.

In one embodiment the given element is a full-length sequence i.e. the full-length gene. Full length gene as employed herein refers to at least the entirety of the coding sequence of a gene, but may include any associated non-coding regions, especially if they are relevant to the function of the gene.

In one embodiment the given element is less than a full-length and retains the same or corresponding function as the full-length sequence.

In one embodiment for a given element which is optional in the constructs of the present disclosure, the DNA sequence may be less than a full-length and have no functionality, for example the E3 region may be totally or partly deleted. However, it may be useful to delete essentially all the E3 region as this optimises the space available for inserting transgenes.

The structural genes encoding structural or functional proteins of the adenovirus are generally linked by non-coding regions of DNA. Thus there is some flexibility about where to "cut" the genomic sequence of the structural element of interest (especially non-coding regions thereof) for the purpose of inserting a transgene into the viruses of the present disclosure. Thus for the purposes of the present specification, the element will be considered a structural element of reference to the extent that it is fit for purpose and does not encode extraneous material. Thus, if appropriate the gene will be associated with suitable non-coding regions, for example as found in the natural structure of the virus.

Thus in one embodiment an insert, such as DNA encoding a restriction site and/or transgene, is inserted into a non-coding region of genomic virus DNA, such as an intron or intergenic sequence. Having said this some non-coding regions of adenovirus may have a function, for example in alternative splicing, transcription regulation or translation regulation, and this may need to be taken into consideration.

The sites identified herein, that are associated with the L5 region, are suitable for accommodating a variety of DNA sequences encoding complex entities such as RNAi, cytokines, single chain or multimeric proteins, such as antibodies.

Gene as employed herein refers to coding and any non-coding sequences associated therewith, for example introns and associated exons. In one embodiment a gene comprises or consists of only essential structural components, for example coding region.

Below follows a discussion relating to specific structural elements of adenoviruses. The Inverted Terminal Repeat (ITR] sequences are common to all known adenoviruses (so named because of their symmetry) and are the viral chromosome origins of replication. Another property of these sequences is their ability to form a hairpin.

The 5'ITR as employed herein refers to part or all of an ITR from the 5' end of an adenovirus, which retains the function of the ITR when incorporated into an adenovirus in an appropriate location. In one embodiment the 5'ITR comprises or consists of the sequence from about lbp to 138bp of SEQ ID NO: 21 or a sequence 90, 95, 96, 97, 98 or 99% identical thereto along the whole length, in particular the sequence consisting of from about lbp to 138bp of SEQ ID NO: 17.

The 3'ITR as employed herein refers to part or all of an ITR from 3' end of an adenovirus which retains the function of the ITR when incorporated into an adenovirus in an appropriate location. In one embodiment the 3'ITR comprises or consists of the sequence from about 32189bp to 32326bp of SEQ ID NO: 17 or a sequence 90, 95, 96, 97, 98 or 99% identical thereto along the whole length, in particular the sequence consisting of from about 32189bp to 32326bp of SEQ ID NO: 17.

Bl as employed herein refers to the DNA sequence encoding: part or all of an EIA from an adenovirus, part or all of the EIB region of an adenovirus, and independently part or all of EIA and EIB region of an adenovirus.

When Bl is a bond then EIA and EIB sequences will be omitted from the virus. In one embodiment Bl is a bond and thus the virus is a vector.

In one embodiment B 1 further comprises a transgene. It is known in the art that the

El region can accommodate a transgene which may be inserted in a disruptive way into the E 1 region (i.e. in the "middle" of the sequence) or part or all of the E 1 region may be deleted to provide more room to accommodate genetic material.

EIA as employed herein refers to the DNA sequence encoding part or all of an adenovirus EIA region. The latter here is referring to the polypeptide/protein EIA. It may be mutated such that the protein encoded by the EIA gene has conservative or non- conservative amino acid changes (e.g. 1, 2, 3, 4 or 5 amino acid changes, additions and/or deletions over the whole length) such that it has: the same function as wild-type (i.e. the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein; or has a new function in comparison to wild-type protein or a combination of the same as appropriate.

E1B as employed herein refers to the DNA sequence encoding part or all of an adenovirus E1B region [i.e. polypeptide or protein), it may be mutated such that the protein encoded by the E1B gene/region has conservative or non-conservative amino acid changes[e.g. 1, 2, 3, 4 or 5 amino acid changes, additions and/or deletions over the whole length) such that it has: the same function as wild-type (i.e. the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein; or has a new function in comparison to wild-type protein or a combination of the same as appropriate.

Thus Bl can be modified or unmodified relative to a wild-type El region, such as a wild-type E1A and/or E1B. The skilled person can easily identify whether E1A and/or E1B are present or (part) deleted or mutated.

Wild-type as employed herein refers to a known adenovirus or a sequence from a known adenovirus. A known adenovirus is one that has been identified and named, regardless of whether the sequence information is available.

In one embodiment Bl has the sequence from 139bp to 3932bp of SEQ ID NO: 17. B^ as employed herein refers to the DNA sequence encoding the E2B-L1-L2-L3-E2A-

L4 regions including any non-coding sequences, as appropriate (in particular corresponding to the natural sequence from an adenovirus). Generally this sequence will not comprise a transgene. In one embodiment the sequence is substantially similar or identical to a contiguous sequence from a known adenovirus, for example a serotype shown in Table 1, in particular a group B virus, for example Ad3, Ad7, Adll, Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll or a combination thereof. In one embodiment is E2B-L1-L2-L3-E2A-L4 refers to comprising these elements and other structural elements associated with the region, for example BA will generally include the sequence encoding the protein IV2a, for example as follows: IV2A IV2a-E2B-Ll-L2-L3-E2A- L4.

In one embodiment the E2B region is chimeric. That is, comprises DNA sequences from two or more different adenoviral serotypes, for example from Ad3 and Adl l, such as Adl lp. In one embodiment the E2B region has the sequence from 5068bp to 10355bp of SEQ ID NO: 17 or a sequence 95%, 96%, 97%, 98% or 99% identical thereto over the whole length.

In one embodiment the E2B in component B^ comprises the sequences shown in SEQ ID NO: 18 (which corresponds to SEQ ID NO: 3 disclosed in WO2005/118825).

In one embodiment B^ has the sequence from 3933bp to 27184bp of SEQ ID NO: 18.

E3 as employed herein refers to the DNA sequence encoding part or all of an adenovirus E3 region (i.e. protein/polypeptide), it may be mutated such that the protein encoded by the E3 gene has conservative or non-conservative amino acid changes (e.g. 1, 2, 3, 4 or 5 amino acid changes, additions and/or deletions over the whole length), such that it has the same function as wild-type (the corresponding unmutated protein]; increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein or has a new function in comparison to wild-type protein or a combination of the same, as appropriate.

In one embodiment the E3 region is form an adenovirus serotype given in Table 1 or a combination thereof, in particular a group B serotype, for example Ad3, Ad7, Adl l (in particular Adl lp], Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll (in particular Adllp) or a combination thereof.

In one embodiment the E3 region has a sequence shown in SEQ ID NO: 19.

In one embodiment the E3 region is partially deleted, for example is 95%, 90%, 85%,

80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% deleted.

In one embodiment E=2 is a bond, wherein the DNA encoding the E3 region is absent.

In one embodiment the DNA encoding the E3 region can be replaced or interrupted by a transgene. As employed herein "E3 region replaced by a transgene as employed herein includes part or all of the E3 region is replaced with a transgene.

In one embodiment the E=2 region comprises the sequence from 27185bp to

28165bp of SEQ ID NO: 98.

In one embodiment E>2 consists of the sequence from 27185bp to 28165bp of SEQ ID NO: 98.

Βχ as employed herein refers to the DNA sequence in the vicinity of the 5' end of the

L5 gene in BB. In the vicinity of or proximal to the 5' end of the L5 gene as employed herein refers to: adjacent (contiguous) to the 5' end of the L5 gene or a non-coding region inherently associated herewith i.e. abutting or contiguous to the 5' prime end of the L5 gene or a non-coding region inherently associated therewith. Alternatively, in the vicinity of or proximal to may refer to being close the L5 gene, such that there are no coding sequences between the BX region and the 5' end of L5 gene.

Thus in one embodiment Βχ is joined directly to a base of L5 which represents, for example the start of a coding sequence of the L5 gene.

Thus in one embodiment Βχ is joined directly to a base of L5 which represents, for example the start of a non-coding sequence, or joined directly to a non-coding region naturally associated with L5. A non-coding region naturally associated L5 as employed herein refers to part of all of a non-coding regions which is part of the L5 gene or contiguous therewith but not part of another gene.

In one embodiment Βχ comprises the sequence of SEQ ID NO: 98. This sequence is an artificial non-coding sequence wherein a DNA sequence, for example comprising a transgene (or transgene cassette), a restriction site or a combination thereof may be inserted therein. This sequence is advantageous because it acts as a buffer in that allows some flexibility on the exact location of the transgene whilst minimising the disruptive effects on virus stability and viability. The insert(s] can occur anywhere within SEQ ID NO: 98 from the 5' end, the 3' end or at any point between bp 1 to 201, for example between base pairs 1/2, 2/3, 3/4, 4/5, 5/6,

6/7, 7/8, 8/9, 9/10, 10/11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19,

19/20, 20/21, 21/22, 22/23, 23/24, 24/25, 25/26, 26/27, 27/28, 28/29, 29/30, 30/31,

31/32, 32/33, 33/34, 34/35, 35/36, 36/37, 37/38, 38/39, 39/40, 40/41, 41/42, 42/43,

43/44, 44/45, 45/46, 46/47, 47/48, 48/49, 49/50, 50/51, 51/52, 52/53, 53/54, 54/55,

55/56, 56/57, 57/58, 58/59, 59/60, 60/61, 61/62, 62/63, 63/64, 64/65, 65/66, 66/67,

67/68, 68/69, 69/70, 70/71, 71/72, 72/73, 73/74, 74/75, 75/76, 76/77, 77/78, 78/79,

79/80, 80/81, 81/82, 82/83, 83/84, 84/85, 85/86, 86/87, 87/88, 88/89, 89/90, 90/91,

91/92, 92/93, 93/94, 94/95, 95/96, 96/97, 97/98, 98/99, 99/100, 100/101, 101/102,

102/103, 103/104, 104/105, 105/106, 106/107, 107/108, 108/109, 109/110, 110/111,

111/112, 112/113, 113/114, 114/115, 115/116, 116/117, 117/118, 118/119, 119/120,

120/121, 121/122, 122/123, 123/124, 124/125, 125/126, 126/127, 127/128, 128/129,

129/130, 130/131, 131/132, 132/133, 133/134, 134/135, 135/136, 136/137, 137/138,

138/139, 139/140, 140/141, 141/142, 142/143, 143/144, 144/145, 145/146, 146/147,

147/148, 148/149, 150/151, 151/152, 152/153, 153/154, 154/155, 155/156, 156/157,

157/158, 158/159, 159/160, 160/161, 161/162, 162/163, 163/164, 164/165, 165/166,

166/167, 167/168, 168/169, 169/170, 170/171, 171/172, 172/173, 173/174, 174/175,

175/176, 176/177, 177/178, 178/179, 179/180, 180/181, 181/182, 182/183, 183/184,

184/185, 185/186, 186/187, 187/188, 189/190, 190/191, 191/192, 192/193, 193/194,

194/195, 195/196, 196/197, 197/198, 198/199, 199/200 or 200/201.

In one embodiment Βχ comprises SEQ ID NO: 98 with a DNA sequence inserted between bp 27 and bp 28 or a place corresponding to between positions 28192bp and

28193bp of SEQ ID NO: 98.

In one embodiment Βχ has the sequence from 28166bp to 28366bp of SEQ ID NO:

21. In one embodiment Βχ is a bond.

BR as employed herein refers to the DNA sequence encoding the L5 region. As employed herein the L5 region refers to the DNA sequence containing the gene encoding the fibre polypeptide/protein, as appropriate in the context. The fibre gene/region encodes the fibre protein which is a major capsid component of adenoviruses. The fibre functions in receptor recognition and contributes to the adenovirus' ability to selectively bind and infect cells.

In viruses of the present disclosure the fibre can be from any adenovirus serotype and adenoviruses which are chimeric as result of changing the fibre for one of a different serotype are also envisaged with the present disclosure. In one embodiment the fibre is from a group B virus, in particular Adll, such as Adl lp.

In one embodiment BR has the sequence from 28367bp to 29344bp of SEQ ID NO:

17.

DNA sequence in relation to Βγ as employed herein refers to the DNA sequence in the vicinity of the 3' end of the L5 gene of BR. In the vicinity of or proximal to the 3' end of the L5 gene as employed herein refers to: adjacent (contiguous] to the 3' end of the L5 gene or a non-coding region inherently associated therewith i.e. abutting or contiguous to the 3' prime end of the L5 gene or a non-coding region inherently associated therewith (i.e. all or part of an non-coding sequence endogenous to L5]. Alternatively, in the vicinity of or proximal to may refer to being close the L5 gene, such that there are no coding sequences between the Βγ region and the 3' end of the L5 gene.

Thus in one embodiment By is joined directly to a base of L5 which represents the

"end" of a coding sequence.

Thus in one embodiment By is joined directly to a base of L5 which represents the "end" of a non-coding sequence, or joined directly to a non-coding region naturally associated with L5.

Inherently and naturally are used interchangeably herein. In one embodiment By comprises the sequence of SEQ ID NO: 99. This sequence is a non-coding sequence wherein a DNA sequence, for example comprising a transgene (or transgene cassette], a restriction site or a combination thereof may be inserted. This sequence is advantageous because it acts a buffer in that allows some flexibility on the exact location of the transgene whilst minimising the disruptive effects on virus stability and viability.

The insert(s] can occur anywhere within SEQ ID NO: 18 from the 5' end, the 3' end or at any point between bp 1 to 35, for example between base pairs 1/2, 2/3, 3/4, 4/5, 5/6, 6/7, 7/8, 8/9, 9/10, 10/11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19,

31/32, 32/33, 33/34, or 34/35.

In one embodiment Βγ comprises SEQ ID NO: 99 with a DNA sequence inserted between positions bp 12 and 13 or a place corresponding to 29356bp and 29357bp in SEQ ID NO: 17. In one embodiment the insert is a restriction site insert. In one embodiment the restriction site insert comprises one or two restriction sites. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site. In one embodiment the restriction site insert comprises one or two restriction sites and at least one transgene, for example one or two or three transgenes, such as one or two transgenes. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites and at least one transgene, for example one or two transgenes. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site and at least one transgene, for example one or two transgenes. In one embodiment two restriction sites sandwich one or more, such as two transgenes (for example in a transgene cassette]. In one embodiment when By comprises two restrictions sites the said restriction sites are different from each other. In one embodiment said one or more restrictions sites in By are non-naturally occurring (such as unique] in the particular adenovirus genome into which they have been inserted. In one embodiment said one or more restrictions sites in By are different to other restrictions sites located elsewhere in the adenovirus genome, for example different to naturally occurring restrictions sites or restriction sites introduced into other parts of the genome, such as Βχ. Thus in one embodiment the restriction site or sites allow the DNA in the section to be cut specifically.

In one embodiment By has the sequence from 29345bp to 29379bp of SEQ ID NO:

17. In one embodiment By is a bond.

In one embodiment the insert is after bp 12 in SEQ ID NO: 99.

In one embodiment the insert is at about position 29356bp of SEQ ID NO: 17.

In one embodiment the insert is a transgene cassette comprising one or more transgenes, for example 1, 2 or 3, such as 1 or 2.

E4 as employed herein refers to the DNA sequence encoding part or all of an adenovirus E4 region (i.e. polypeptide/protein region), which may be mutated such that the protein encoded by the E4 gene has conservative or non-conservative amino acid changes (e.g. 1, 2, 3, 4 or 5 amino acid changes, additions and/or deletions), and has the same function as wild-type (the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein or has a new function in comparison to wild-type protein or a combination of the same as appropriate.

In one embodiment the E4 region is partially deleted, for example is 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% deleted. In one embodiment the E4 region has the sequence from 32188bp to 29380bp of SEQ ID NO: 17.

In one embodiment E4 is present except for the E4orf4 region which is deleted. In one embodiment B3 is a bond, i.e. wherein E4 is absent.

In one embodiment B3 has the sequence consisting of from 32188bp to 29380bp of

SEQ ID NO: 17.

As employed herein number ranges are inclusive of the end points.

The skilled person will appreciate that the elements in the formulas herein, such as formula (I), (la) are contiguous and may embody non-coding DNA sequences as well as the genes and coding DNA sequences (structural features) mentioned herein. In one or more embodiments the formulas of the present disclosure are attempting to describe a naturally occurring sequence in the adenovirus genome. In this context it will be clear to the skilled person that the formula is referring to the major elements characterising the relevant section of genome and is not intended to be an exhaustive description of the genomic stretch of DNA.

E1A, E1B, E3 and E4 as employed herein each independently refer to the wild-type and equivalents thereof, mutated or partially deleted forms of each region as described herein, in particular a wild-type sequence from a known adenovirus. "Insert" as employed herein refers to a DNA sequence that is incorporated either at the 5' end, the 3' end or within a given DNA sequence reference segment such that it interrupts the reference sequence. A reference sequence employed as a reference point relative to which the insert is located. In the context of the present disclosure inserts generally occur within either SEQ ID NO: 98 or SEQ ID NO: 99. An insert can be either a restriction site insert, a transgene cassette or both. When the sequence is interrupted the virus will still comprise the original sequence, but generally it will be as two fragments sandwiching the insert.

In one embodiment the transgene or transgene cassette does not comprise a non- biased inserting transposon, such as a TN7 transposon or part thereof. Tn7 transposon as employed herein refers to a non-biased insertion transposon as described in WO2008/080003.

In one embodiment the transgene or transgene cassette further comprises a regulatory element or sequence.

Restriction Sites

Restriction sites in the locations disclosed here (for example in Βχ and/or Βγ) are useful in viruses and constructs of the present disclosure, such as plasmids, because they allow the transgene to be changed rapidly and, for example selectively when the restriction sites around the transgene (s) are unique.

Unique as employed herein refers to only one occurrence in the whole of the virus or construct.

In one embodiment the transgene or transgene cassette comprises a restriction site at each terminus, thereby allowing the cassette to be replaced.

A restriction site is a location in a DNA sequence that can be cut by a restriction enzyme, usually an enzyme specific to the sequence. In one embodiment the restriction site comprises 3 to 22 base pairs, for example 4 to 22, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 base pairs. Examples of restriction sites cut by restriction enzymes include but are not limited to:

· sequence GCGGCCGC cut by Notl and CciNI leaving 5' -GGCC overhangs

• sequence GGCCGGCC cut by Fsel and Rigl leaving 3' -CCGG overhangs

• sequence GCGATCGC cut by AsiSI, Rgal, Sgfl and SfaAI leaving 3' -AT overhangs

• sequence CCTGCAGG cut by Sbfl, Sdal and Sse83871 leaving 3' - TGCA overhangs

• sequence TGATCA cut by Bell, Fbal, Ksp221 and BsiQl leaving 5' - GATC overhangs · sequence CAAAACGTCGTGAGACAGTTTG [SEQ ID NO: 100] cut by I-Crel leaving 3'

- GTGA overhangs

• sequence TAACTATAACGGTCCTAAGGTAGCGAA [SEQ ID NO: 101] cut by I-Ceul leaving 3' CTAA overhangs

• sequence TAGGGATAACAGGGTAAT [SEQ ID NO: 102] cut by I-Scel leaving 3'

ATAA overhangs • sequence GCCCGGGC cut by Srfl leaving blunt ends

• sequence GTTTAAAC cut by Mssl, Pmel leaving blunt ends

• sequence ATTTAAAT cut by Swal, Smil leaving blunt ends

• sequence GGCGCGCC cut by Ascl, PalAl and Sgsl leaving 5' CGCG overhangs

Other restriction enzymes that cut the same recognition sites may also be suitable.

In one embodiment one or more restrictions sites in Βχ and By are independently selected from a restriction site specific to an enzyme described herein, for example Notl,

Fse\, AsiS\, Sgfi and Sbj\, in particular the restriction sites inserted are all different, such as sites specific for Notl and sites specific for Fsel located in Βχ and Sgfl and Sbfl located in By.

In one embodiment the region Βχ and/or Βγ do not comprise a restriction site.

Advantageously, the viruses and constructs of the present disclosure can be prepared without restriction sites, for example using synthetic techniques. These techniques allow a great flexibility in the creation of the viruses and constructs. Furthermore, the present inventors have established that the properties of the viruses and constructs are not diminished when they are prepared by synthetic techniques.

Promoters

Promoter as employed herein means a region of DNA that initiates transcription of a particular gene or genes. Promoters are generally located proximal to the genes they transcribe, on the same strand and upstream (i.e. 5') on the DNA. Proximal as employed in this context means sufficiently close to function as a promoter. In one embodiment the promoter is within 100 bp of the transcription start site. Thus endogenous promoter as employed herein refers to a promoter that naturally occurs in (i.e. is native to) the adenovirus (or construct) into which the transgene, is being inserted. In one or more embodiments the endogenous promoter employed is the naturally occurring promoter in the virus in its original location in the virus genome, in particular this is the primary or only promoter employed in the expression of the transgene or transgenes. In one embodiment the endogenous promoter used to promote the translation and optionally the transcription of the transgene is one resident, i.e. is one integrated in the genome of the adenovirus and not previously introduced by recombinant techniques.

Under the control of an endogenous promoter as employed herein refers to where the transgene/transgene cassette is inserted in the appropriate orientation to be under the control of said endogenous promoter. That is, where the promoter is generally on the antisense strand, the cassette is inserted, for example in the antisense orientation.

Having said this, genes can be expressed in one of two orientations. However, generally one orientation provides increased levels of expression over the other orientation, for a given (particular) transgene.

In one embodiment the cassette is in the sense orientation. That is, is transcribed in a 5' to 3' direction. In one embodiment the cassette is in the antisense orientation. That is, transcribed in the 3' to 5' orientation. The endogenous promoters in the virus can, for example, be utilised by employing a gene encoding a transgene and a splice acceptor sequence. Thus in one embodiment the cassette will comprise a splice acceptor sequence when under the control of an endogenous promoter. Thus in one embodiment the coding sequence, for example the sequence encoding the antibody or antibody binding fragment further comprises a splice acceptor sequence.

In one embodiment the transgene, transgenes, or transgene cassette are under the control of an E4 promoter or a major late promoter, such as the major late promoter (ML promoter).

Under the control of as employed herein means that the transgene is activated, i.e. transcribed, when a particular promoter dictates.

The Major Late Promoter (ML promoter or MLP) as employed herein refers to the adenovirus promoter that controls expression of the "late expressed" genes, such as the L5 gene. The MLP is a "sense strand" promoter. That is, the promoter influences genes that are downstream of the promoter in the 5'-3' direction. The major late promoter as employed herein refers the original major late promoter located in the virus genome.

E4 promoter as employed herein refers to the adenovirus promoter of the E4 region. The E4 region is an antisense region; therefore the promoter is an antisense promoter. That is, the promoter is upstream of the E4 region in the 3'-5' direction. Therefore any transgene cassette under control of the E4 promoter may need to be oriented appropriately. In one embodiment the cassette under the control of the E4 promoter is in the antisense orientation. In one embodiment the cassette is under the control of the E4 promoter in the sense orientation. The E4 promoter as employed herein refers to the original E4 promoter located in the virus genome.

Thus in one embodiment there is provided a replication competent oncolytic adenovirus serotype 11 (such as Adllp) or virus-derivative thereof wherein the fibre, hexon and capsid are serotype 11 (such as Adllp), wherein the virus genome comprises a DNA sequence encoding a therapeutic antibody or antibody-binding fragment, wherein said DNA sequence under the control of a promoter endogenous to the adenovirus selected from consisting of E4 and the major late promoter (i.e. the E4 promoter or the major late promoter), such that the transgene does not interfere with virus replication, for example is associated with the L5 region (i.e. before or after said region), such as located after L5 in the virus genome.

In one embodiment an endogenous promoter is introduced into the viral genome at a desired location by recombinant techniques, for example is introduced in the transgene cassette. However, in the context of the present specification this arrangement will generally be referred to as an exogenous promoter.

In one embodiment a transgene cassette employed in the virus comprises an exogenous promoter. Exogenous promoter as employed herein refers to a promoter that is not naturally occurring in the adenovirus into which the transgene is being inserted. Typically, exogenous promoters are from other viruses or are mammalian promoters. Exogenous promoter as employed herein means a DNA element, usually located upstream of the gene of interest, that regulates the transcription of the gene.

In one embodiment the regulator of gene expression is an exogenous promoter, for example CMV (cytomegalovirus promoter), CBA (chicken beta actin promoter) or PGK (phosphoglycerate kinase 1 promoter), such as CMV promoter.

In one embodiment there is provided a replication competent oncolytic adenovirus serotype 11 (such as Adllp) or virus-derivative thereof wherein the fibre, hexon and capsid are serotype 11 (such as Adllp), wherein the virus genome comprises a DNA sequence encoding a therapeutic antibody or antibody-binding fragment located in a part of the virus genome which is expressed late in the virus replication cycle and such that the transgene does not interfere with virus replication, wherein said DNA sequence under the control of a promoter exogenous to the adenovirus (for example the CMV promoter). In one embodiment the DNA sequence encoding an antibody or fragment is associated with the L5 region as described elsewhere herein.

Other Regulatory Sequences

"Regulator of gene expression" (or regulator/regulatory element) as employed herein refers to a genetic element, such as a promoter, enhancer or a splice acceptor sequence that plays a role in gene expression, typically by initiating or enhancing transcription or translation.

"Splice acceptor sequence", "splice acceptor" or "splice site" as employed herein refers to a regulatory sequence determining when an mRNA molecule will be recognised by small nuclear ribonucleoproteins of the spliceosome complex. Once assembled the spliceosome catalyses splicing between the splice acceptor site of the mRNA molecule to an upstream splice donor site producing a mature mRNA molecule that can be translated to produce a single polypeptide or protein.

Different sized splice acceptor sequences may be employed in the present invention and these can be described as short splice acceptor (small), splice acceptor (medium) and branched splice acceptor (large).

SSA as employed herein refers to a short splice acceptor, typically comprising just the splice site, for example 4 bp. SA as employed herein refers to a splice acceptor, typically comprising the short splice acceptor and the polypyrimidine tract, for example 16 bp. bSA as employed herein refers to a branched splice acceptor, typically comprising the short splice acceptor, polypyrimidine tract and the branch point, for example 26 bp.

In one embodiment the splice acceptor employed in the constructs of the disclosure are CAGG or SEQ ID NO: 10 or 11. In one embodiment the SSA has the nucleotide sequence of CAGG. In one embodiment the SA has the nucleotide sequence of SEQ ID NO: 10. In one embodiment the bSA has the nucleotide sequence of cagg. In one embodiment the splice acceptor sequence is independently selected from the group comprising: tgctaatctt cctttctctc ttcagg (SEQ ID NO: 10), tttctctctt cagg (SEQ ID NO: 11), and cagg.

In one embodiment the splice site is immediately proceeded (i.e. followed in a 5' to 3' direction) by a consensus Kozak sequence comprising CCACC. In one embodiment the splice site and the Kozak sequence are interspersed (separated) by up to 100 or less bp. In one embodiment the Kozak sequence has the nucleotide sequence of CCACC.

Typically, when under the control of an endogenous or exogenous promoter (such as an endogenous promoter), the coding sequence will be immediately preceded by a Kozak sequence. The start of the coding region is indicated by the initiation codon (AUG), for example is in the context of the sequence (gcc)gccRccAUGg [SEQ ID NO: 20] the start of the start of the coding sequences is indicated by the bases in bold. A lower case letter denotes common bases at this position (which can nevertheless vary) and upper case letters indicate highly-conserved bases, i.e. the 'AUGG' sequence is constant or rarely, if ever, changes; 'R' indicates that a purine (adenine or guanine) is usually observed at this position and the sequence in brackets (gcc) is of uncertain significance. Thus in one embodiment the initiation codon AUG is incorporated into a Kozak sequence.

Internal Ribosome Entry DNA Sequence as employed herein refers to a DNA sequence encoding an Internal Ribosome Entry Sequence (IRES). IRES as employed herein means a nucleotide sequence that allows for initiation of translation a messenger RNA (mRNA) sequence, including initiation starting within an mRNA sequence. This is particularly useful when the cassette encodes polycistronic mRNA. Using an IRES results in a polycistronic mRNA that is translated into multiple individual proteins or peptides. In one embodiment the Internal Ribosome Entry DNA sequence has the nucleotide sequence of SEQ ID NO: 6. In one embodiment a particular IRES is only used once in the genome. This may have benefits with respect to stability of the genome.

"High self-cleavage efficiency 2A peptide" or "2A peptide" as employed herein refers to a peptide which is efficiently cleaved following translation. Suitable 2A peptides include P2A, F2A, E2A and T2A. The present inventors have noted that once a specific DNA sequence encoding a given 2A peptide is used once, the same specific DNA sequence may not be used a second time. However, redundancy in the DNA code may be utilised to generate a DNA sequence that is translated into the same 2A peptide. Using 2A peptides is particularly useful when the cassette encodes polycistronic mRNA. Using 2A peptides results in a single polypeptide chain being translated which is modified post-translation to generate multiple individual proteins or peptides.

In one embodiment the encoded P2A peptide employed has the amino acid sequence of SEQ ID NO: 4. In one embodiment the encoded F2A peptide employed has the amino acid sequence of SEQ ID NO: 103. In one embodiment the encoded E2A peptide employed has the amino acid sequence of SEQ ID NO: 21. In one embodiment the encoded T2A peptide employed has the amino acid sequence of SEQ ID NO: 5. In one embodiment an mRNA or each mRNA encoded by transgene is/are comprise a polyadenylation signal sequence, such as typically at the end of an mRNA sequence, for example as shown in SEQ ID NO: 6. Thus in one embodiment the transgene or the transgene cassette comprises at least one sequence encoding a polyadenylation signal sequence.

"PolyA", "Polyadenylation signal" or "polyadenylation sequence" as employed herein means a DNA sequence, usually containing an AATAAA site, that once transcribed can be recognised by a multiprotein complex that cleaves and polyadenylates the nascent mRNA molecule.

In one embodiment the polyadenylation sequence has the nucleotide sequence of SEQ ID NO: 6.

In one embodiment the construct does not include a polyadenylation sequence. In one embodiment the regulator of gene expression is a splice acceptor sequence.

In one embodiment the sequence encoding a protein/polypeptide/peptide, such as an antibody or antibody binding fragment further comprises a polyadenylation signal.

In one embodiment there is provided a virus or construct with a sequence disclosed herein, for example wherein the virus is NG-500 (SEQ ID NO: 7).

Formulations

The present disclosure relates also extends to a pharmaceutical formulation of a virus as described herein.

In one embodiment there is provided a liquid parenteral formulation, for example for infusion or injection, of a replication capable oncolytic according to the present disclosure wherein the formulation provides a dose in the range of lxlO¹⁰ to lxlO¹⁴ viral particles per volume of dose.

Parenteral formulation means a formulation designed not to be delivered through the GI tract. Typical parenteral delivery routes include injection, implantation or infusion. In one embodiment the formulation is provided in a form for bolus delivery.

In one embodiment the parenteral formulation is in the form of an injection. Injection includes intravenous, subcutaneous, intra-tumoral or intramuscular injection. Injection as employed herein means the insertion of liquid into the body via a syringe. In one embodiment the method of the present disclosure does not involve intra-tumoral injection.

In one embodiment the parenteral formulation is in the form of an infusion.

Infusion as employed herein means the administration of fluids at a slower rate by drip, infusion pump, syringe driver or equivalent device. In one embodiment the infusion is administered over a period in the range of 1.5 minutes to 120 minutes, such as about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 65, 80, 85, 90, 95, 100, 105, 110 or 115 minutes.

In one embodiment one dose of the formulation less than lOOmls, for example 30mls, such as administered by a syringe driver. In one embodiment the injection is administered as a slow injection, for example over a period of 1.5 to 30 minutes.

In one embodiment the formulation is for intravenous (i.v.) administration. This route is particularly effective for delivery of oncolytic virus because it allows rapid access to the majority of the organs and tissue and is particular useful for the treatment of metastases, for example established metastases especially those located in highly vascularised regions such as the liver and lungs.

Therapeutic formulations typically will be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other parenteral formulation suitable for administration to a human and may be formulated as a pre-filled device such as a syringe or vial, particular as a single dose.

The formulation will generally comprise a pharmaceutically acceptable diluent or carrier, for example a non-toxic, isotonic carrier that is compatible with the virus, and in which the virus is stable for the requisite period of time.

The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a dispersant or surfactant such as lecithin or a non-ionic surfactant such as polysorbate 80 or 40. In dispersions the maintenance of the required particle size may be assisted by the presence of a surfactant. Examples of isotonic agents include sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.

In one embodiment parenteral formulations employed may comprise one or more of the following a buffer, for example 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid, a phosphate buffer and/or a Tris buffer, a sugar for example dextrose, mannose, sucrose or similar, a salt such as sodium chloride, magnesium chloride or potassium chloride, a detergent such as a non-ionic surfactant such as brij, PS-80, PS-40 or similar. The formulation may also comprise a preservative such as EDTA or ethanol or a combination of EDTA and ethanol, which are thought to prevent one or more pathways of possible degradation.

In one embodiment the formulation will comprise purified oncolytic virus according to the present disclosure, for example lxlO¹⁰ to lxlO¹⁴ viral particles per dose, such as 1 xlO¹⁰ to lxlO¹² viral particles per dose. In one embodiment the concentration of virus in the formulation is in the range 2xl0⁸ to 2xl0¹⁴ vp/ml, such as 2 x 10¹² vp/ml.

In one embodiment the parenteral formulation comprises glycerol.

In one embodiment the formulation comprises oncolytic adenovirus as described herein, HEPES (N-2-hydroxyethylpiperazine-N^'-2-ethanesulfonic acid), glycerol and buffer.

In one embodiment the parenteral formulation consists of virus of the disclosure, HEPES for example 5mM, glycerol for example 5-20% (v/v), hydrochloric acid, for example to adjust the pH into the range 7-8 and water for injection. In one embodiment 0.7 mL of virus of the disclosure at a concentration of 2 x 10^1Z vp/mL is formulated in 5 mM HEPES, 20% glycerol with a final pH of 7.8.

A thorough discussion of pharmaceutically acceptable carriers is available in Remington's Pharmaceutical Sciences (Mack Publishing Company, N.J. 1991).

In one embodiment the formulation is provided as a formulation for topical administrations including inhalation.

Suitable inhalable preparations include inhalable powders, metering aerosols containing propellant gases or inhalable solutions free from propellant gases. Inhalable powders according to the disclosure will generally contain a virus as described herein with a physiologically acceptable excipient.

These inhalable powders may include monosaccharides (e.g. glucose or arabinose), disaccharides (e.g. lactose, saccharose, maltose), oligo- and polysaccharides (e.g. dextranes), polyalcohols (e.g. sorbitol, mannitol, xylitol), salts (e.g. sodium chloride, calcium carbonate) or mixtures of these with one another. Mono- or disaccharides are suitably used, such as lactose or glucose, particularly but not exclusively in the form of their hydrates.

Particles for deposition in the lung require a particle size less than 10 microns, such as 1-9 microns for example from 0.1 to 5 μηι, in particular from 1 to 5 μιη. The size of the particle carrying the virus is of primary importance and thus in one embodiment the virus according to the present disclosure may be adsorbed or absorbed onto a particle, such as a lactose particle of the given size.

The propellant gases which can be used to prepare the inhalable aerosols are known in the art. Suitable propellant gases are selected from among hydrocarbons such as n- propane, n-butane or isobutane and halohydrocarbons such as chlorinated and/or fluorinated derivatives of methane, ethane, propane, butane, cyclopropane or cyclobutane. The above-mentioned propellant gases may be used on their own or in mixtures thereof.

Particularly suitable propellant gases are halogenated alkane derivatives selected from among TG 11, TG 12, TG 134a and TG227. Of the abovementioned halogenated hydrocarbons, TG134a (1,1,1,2-tetrafluoroethane) and TG227 (1,1,1,2,3,3,3- heptafluoropropane) and mixtures thereof are particularly suitable.

The propellant gas-containing inhalable aerosols may also contain other ingredients, such as co-solvents, stabilisers, surface-active agents (surfactants), antioxidants, lubricants and means for adjusting the pH. All these ingredients are known in the art.

The propellant gas-containing inhalable aerosols according to the invention may contain up to 5 % by weight of active substance. Aerosols according to the invention contain, for example, 0.002 to 5 % by weight, 0.01 to 3 % by weight, 0.015 to 2 % by weight, 0.1 to 2 % by weight, 0.5 to 2 % by weight or 0.5 to 1 % by weight of active ingredient.

Alternatively, topical administrations to the lung may also be by administration of a liquid solution or suspension formulation, for example employing a device such as a nebulizer, for example, a nebulizer connected to a compressor (e.g., the Pari LC-Jet Plus(R) nebulizer connected to a Pari Master(R] compressor manufactured by Pari Respiratory Equipment, Inc., Richmond, Va.).

The virus of the invention can be delivered dispersed in a solvent, e.g. in the form of a solution or a suspension, for example as already described above for parenteral formulations. It can be suspended in an appropriate physiological solution, e.g., saline or other pharmacologically acceptable solvent or a buffered solution. Buffered solutions known in the art may contain 0.05 mg to 0.15 mg disodium edetate, 8.0 mg to 9.0 mg NaCl, 0.15 mg to 0.25 mg polysorbate, 0.25 mg to 0.30 mg anhydrous citric acid, and 0.45 mg to 0.55 mg sodium citrate per 1 ml of water so as to achieve a pH of about 4.0 to 5.0.

The therapeutic suspensions or solution formulations can also contain one or more excipients. Excipients are well known in the art and include buffers (e.g., citrate buffer, phosphate buffer, acetate buffer and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (e.g., serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. Solutions or suspensions can be encapsulated in liposomes or biodegradable microspheres. The formulation will generally be provided in a substantially sterile form employing sterile manufacture processes.

This may include production and sterilization by filtration of the buffered solvent/solution used for the formulation, aseptic suspension of the antibody in the sterile buffered solvent solution and dispensing of the formulation into sterile receptacles by methods familiar to those of ordinary skill in the art.

Nebulisable formulation according to the present disclosure may be provided, for example, as single dose units (e.g., sealed plastic containers or vials) packed in foil envelopes. Each vial contains a unit dose in a volume, e.g., 2 mL, of solvent/solution buffer.

The present disclosure also extends to liquid solutions or suspensions delivered intra-nasally, for example employing a device as disclosed in W02009/068877 and US2004/0153033 both incorporated herein by reference.

Treatment

In a further aspect the present disclosure extends to a virus or a formulation thereof as described herein for use in treatment, in particular for the treatment of cancer.

In one embodiment the method of treatment is for use in the treatment of a tumour. Tumour as employed herein is intended to refer to an abnormal mass of tissue that results from excessive cell division that is uncontrolled and progressive, also called a neoplasm. Tumours may be either benign (not cancerous) or malignant. Tumour encompasses all forms of cancer and metastases. In one embodiment the tumour is cancerous.

In one embodiment the tumour is a solid tumour. The solid tumour may be localised or metastasised.

In one embodiment the tumour is of epithelial origin. In one embodiment the tumour is a malignancy, such as colorectal cancer, hepatoma, prostate cancer, pancreatic cancer, breast cancer, ovarian cancer, thyroid cancer, renal cancer, bladder cancer, head and neck cancer or lung cancer.

In one embodiment the tumour is a colorectal malignancy.

Malignancy as employed herein refers to cancerous cells.

In one embodiment the oncolytic adenovirus is employed in the treatment or prevention of metastasis.

In one embodiment the method or formulation herein is employed in the treatment of drug resistant cancers.

In one embodiment the virus is administered in combination with the administration of a further cancer treatment or therapy.

In one embodiment there is provided a virus or formulation according to the present disclosure for use in the manufacture of a medicament for the treatment of cancer, for example a cancer described above.

In a further aspect there is provide a method of treating cancer comprising administering a therapeutically effective amount of a virus or formulation according to the present disclosure to a patient in need thereof, for example a human patient.

In one embodiment the oncolytic virus or formulation herein is administered in combination with another therapy.

"In combination" as employed herein is intended to encompass where the oncolytic virus is administered before, concurrently and/or post cancer treatment or therapy. However, generally the treatment regimens for the combination therapy.

Cancer therapy includes surgery, radiation therapy, targeted therapy and/or chemotherapy.

Cancer treatment as employed herein refers to treatment with a therapeutic compound or biological agent, for example an antibody intended to treat the cancer and/or maintenance therapy thereof.

In one embodiment the cancer treatment is selected from any other anti-cancer therapy including a chemotherapeutic agent; a targeted anticancer agent, such as an antibody drug conjugate; radiotherapy, radio-isotope therapy or any combination thereof.

In one embodiment the virus of the present disclosure such as an oncolytic adenovirus may be used as a pre-treatment to the therapy, such as a surgery (neoadjuvant therapy], to shrink the tumour, to treat metastasis and/or prevent metastasis or further metastasis. The oncolytic adenovirus may be used after the therapy, such as a surgery (adjuvant therapy], to treat metastasis and/or prevent metastasis or further metastasis.

In one embodiment a virus or formulation of the present disclosure is employed in maintenance therapy.

Concurrently as employed herein is the administration of the additional cancer treatment at the same time or approximately the same time as the oncolytic adenovirus formulation. The treatment may be contained within the same formulation or administered as a separate formulation.

In one embodiment the virus is administered in combination with the administration of a chemotherapeutic agent.

Chemotherapeutic agent as employed herein is intended to refer to specific antineoplastic chemical agents or drugs that are selectively destructive to malignant cells and tissues. For example, alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumour agents. Examples of specific chemotherapeutic agents include doxorubicin, 5-fluorouracil (5-FU), paclitaxel, capecitabine, irinotecan, and platins such as cisplatin and oxaliplatin. The dose may be chosen by the practitioner based on the nature of the cancer being treated.

In one embodiment the therapeutic agent is ganciclovir, which may assist in controlling immune responses and/or tumour vascularisation.

In one embodiment one or more therapies employed in the method herein are metronomic, that is a continuous or frequent treatment with low doses of anticancer drugs, often given concomitant with other methods of therapy.

Subgroup B oncolytic adenoviruses, in particular Adll and those derived therefrom such as EnAd may be particularly synergistic with chemotherapeutics because they seem to have a mechanism of action that is largely independent of apoptosis, killing cancer cells by a predominantly necrolytic mechanism. Moreover, the immunosuppression that occurs during chemotherapy may allow the oncolytic virus to function with greater efficiency.

Therapeutic dose as employed herein refers to the amount of virus, such as oncolytic adenovirus that is suitable for achieving the intended therapeutic effect when employed in a suitable treatment regimen, for example ameliorates symptoms or conditions of a disease, in particular without eliciting dose limiting side effects. A dose may be considered a therapeutic dose in the treatment of cancer or metastases when the number of viral particles may be sufficient to result in the following: tumour or metastatic growth is slowed or stopped, or the tumour or metastasis is found to shrink in size, and/or the life span of the patient is extended. Suitable therapeutic doses are generally a balance between therapeutic effect and tolerable toxicity, for example where the side-effect and toxicity are tolerable given the benefit achieved by the therapy.

In one embodiment there is provided systemically administering multiple doses of a parenteral formulation of an oncolytic adenovirus according to the present disclosure in a single treatment cycle, for example wherein the total dose given in each administration is in the range of lxlO¹⁰ to lxlO¹⁴ viral particles per dose.

In one embodiment one or more doses [for example each dose) of virus or composition comprising the same is administered such that the rate of viral particle delivery is in the range of 2xl0¹⁰ particles per minute to 2xl0¹² particles per minute.

In one embodiment a virus or therapeutic construct according to the present disclosure (including a formulation comprising same) is administered weekly, for example one week 1 the dose is administered on day 1, 3, 5, followed by one dose each subsequent week.

In one embodiment a virus or therapeutic construct according to the present disclosure (including a formulation comprising same) is administered bi-weekly or tri- weekly, for example is administered in week 1 one on days 1, 3 and 5, and on week 2 or 3 is also administered on days 1, 3 and 5 thereof. This dosing regimen may be repeated as many times as appropriate.

In one embodiment a virus or therapeutic construct according to the present disclosure (including a formulation comprising same) is administered monthly, for example in a treatment cycle or as maintenance therapy.

In one embodiment the viruses and constructs of the present disclosure are prepared by recombinant techniques. The skilled person will appreciate that the armed adenovirus genome can be manufactured by other technical means, including entirely synthesising the genome or a plasmid comprising part of all of the genome. The skilled person will appreciate that in the event of synthesising the genome the region of insertion may not comprise the restriction site nucleotides as the latter are artefacts following insertion of genes using cloning methods.

In one embodiment the armed adenovirus genome is entirely synthetically manufactured, for example as per SEQ ID NO: 7, which was employed with transgene cassettes in SEQ ID NO: 8.

The disclosure herein further extends to an adenovirus of formula (I) or a sub- formula thereof, obtained or obtainable from inserting a transgene or transgene cassette.

"Is" as employed herein means comprising.

In the context of this specification "comprising" is to be interpreted as "including". Embodiments of the invention comprising certain features/elements are also intended to extend to alternative embodiments "consisting" or "consisting essentially" of the relevant elements/features.

Where technically appropriate, embodiments of the invention may be combined. Technical references such as patents and applications are incorporated herein by reference.

Any embodiments specifically and explicitly recited herein may form the basis of a disclaimer either alone or in combination with one or more further embodiments.

Heading herein are employed to divide the document into sections and are not intended to be used to construe the meaning of the disclosure provided herein.

The present application claims priority from GB1618573.8, incorporated herein by reference. A correction to an error(s) in this specification may be based on said GB priority document.

The present invention is further described by way of illustration only in the following examples. EXAMPLES

Example 1: Production of an enadenotucirev (EnAd) virus expressing the T cell activating antigens CD80 and a membrane-anchored single chain Fv fragment antibody to the ε chain of the human CD3 complex (CD3e) together with the chemokine, ΜΙΡΙα as a third transgene

The plasmid pEnAd2.4 was used to generate the plasmid pNG-500 by direct insertion of a cassette encoding the human T cell activating antigen CD80 (SEQ ID NO: 1), a membrane-anchored chimeric form of the single chain Fv anti-human CD3e [SEQ ID NO: 2) and the human macrophage inflammatory protein la (MlPla, isoform ίϋ78β, SEQ ID NO: 3). The pNG-500 cassette contains; a 5' short splice acceptor sequence (CAGG); membrane- anchored anti-human CD3e ScFv cDNA; a high efficiency self-cleavable P2A peptide sequence (SEQ ID NO: 4); human CD80 cDNA sequence; a high efficiency self-cleavable T2A peptide sequence (SEQ ID NO: 5) and a 3' polyadenylation sequence (SEQ ID NO: 6]. A Schematic of the inserted transgene cassette is shown in Figure 1A. Construction of the plasmid was confirmed by DNA sequencing.

Virus production and characterisation

The plasmid pNG-500 was linearised by restriction digest with the enzyme Ascl to produce the virus genome NG-500 (SEQ ID NO: 7). The virus NG-500 was amplified and purified according to the methods given below.

Digested DNA was purified by phenol/chloroform extraction and precipitated for

16hrs, -20°C in 300μ1 >95% molecular biology grade ethanol and ΙΟμΙ 3M Sodium Acetate. The precipitated DNA was pelleted by centrifuging at 14000rpm, 5 mins and was washed in 500μ1 70% ethanol, before centrifuging again, 14000rpm, 5mins. The clean DNA pellet was air dried, resuspended in 500μ1 OptiMEM containing 15 μΐ lipofectamine transfection reagent and incubated for 30 mins, RT. The transfection mixture was then added drop wise to a T-25 flask containing 293 cells grown to 70% confluency. After incubation of the cells with the transfection mix for 2hrs at 37°C, 5% C0₂ 4mls of cell media (DMEM high glucose with glutamine supplemented with 2% FBS) was added to the cells and the flasks was incubated 37°C, 5% COz.

The transfected 293 cells were monitored every 24hrs and were supplemented with additional media every 48-72hrs. The production of virus was monitored by observation of a significant cytopathic effect (CPE] in the cell monolayer. Once extensive CPE was observed the NG-500 virus was harvested from 293 cells by three freeze-thaw cycles. The harvested viruses were used to re-infect 293 cells in order to amplify the virus stocks. Viable virus production during amplification was confirmed by observation of significant CPE in the cell monolayer. Once CPE was observed the virus was harvested from 293 cells by three freeze- thaw cycles. The amplified stock was used for further amplification before the virus was purified by double caesium chloride banding to produce a NG-500 virus stock (lot number NG-500-R01 was used in the experiments described in Examples 2-6). Example 2: Oncolytic activity and replication of the NG-500 virus in colon carcinoma cells

Virus oncolytic potency

HT-29 colon carcinoma cells were seeded in 96 well plates at a cell density of 2.5e4 cells/well. Plates were incubated for 4 hrs, 37°C, 5% CC , before cells were either infected with EnAd or NG-500 virus particles at an infection density range of 100-0.39 particles per cell (ppc). HT-29 cell viability was assessed using Cell Titre 96 MTS Reagent (Promega: G3581) 72 hrs post infection. Quantification of the % cell survival at each infection density demonstrated that NG-500 oncolytic potency was comparable to the non-transgene expressing parental virus, EnAd [Figure IB).

Virus genome replication assessed by qPCR

A549 lung carcinoma cells infected for 24 or 48 hrs with lOOppc EnAd or NG-500 or left uninfected (UIC) were used for quantification of viral DNA by qPCR. Cell supernatants were collected and clarified by centrifuging for 5 mins, 1200rpm. DNA was extracted from ΙΟμί, of supernatant using the Sigma Genelute DNA extraction Kit, according to the manufacturer's protocol. A standard curve using EnAd virus particles (2.5el0-2.5e5vp) was also prepared and extracted using the Sigma Genelute Kit. Each extracted sample or standard was analysed by qPCR using an EnAd E3 gene specific primer-probe set.

Quantification of the number of detected virus genomes per cell demonstrated that NG-500 and EnAd virus replication was comparable in A549 cell lines (Figure 1C). No virus genomes could be detected in uninfected cells (data not shown).

Example 3: Cell surface expression of the T cell activating antigen, CD80, NG-500 infected A549 cell line

CD80 transgene expression (assessed by flow cytometry) was compared in NG-500 and EnAd treated A549 lung carcinoma cells. A549 cells were seeded in 12 well plates at cell densities of 7.5e5 cells/well. Plates were incubated for 18 hrs, 37°C, 5% CO2, before cells were either infected with EnAd or NG-500 virus at 100 particles per cell (ppc) or were left uninfected. CD80 protein expression was compared on the surface of A549 cells at 24 and 46 hrs post-infection. At each time point cells were harvested and stained according to methods detailed below.

Cells were washed once with PBS before trypsin-EDTA was used to detach the cells and the trypsin was deactivated using FBS. The cells were then removed from the well, washed once with 5% BSA buffer, then incubated at 5°C for 15 mins with either buffer, mouse isotype control antibody conjugated to PE or anti-human CD80 antibody conjugated to PE (clone 2D10). All samples were also co-stained with Zombie Aqua (Biolegend) live/dead to differentiate viable cells. Samples were washed twice with 5% BSA/PBS before analysis by flow cytometry (FACS, Attune) for cell viability and CD80 protein expression on the cell surface. CD80 expression could only be detected on A549 cells infected with NG- 500 virus. Analysis of CD80 expression at 46 hrs post infection showed CD80 could be detected on the surface of >95% of NG-500 treated cells. By 48 hrs approximately 70% of the A549 cells treated with either EnAd or NG-500 were dead (leaky membranes) but still intact, as defined by the live/dead staining (Figure 2A).

Example 4: Production of secreted ΜΙΡ-Ια in NG-500 infected carcinoma cell lines Culture supernatants of A549 cells lines infected for 24 hrs or 48 hrs with lOOppc of

EnAd or NG-500 or left uninfected were analysed for expression of secreted ΜΙΡ Ια by ELISA. Culture supernatants were collected and clarified by centrifuging for 5 mins, 1200rpm. Supernatants were diluted into 5% BSA/PBS assay buffer (1 :4, 1:8 1: 16 or 1: 32) and ELISA was carried out using the human CCL3 Quantikine ELISA kit (R & D systems) according to the manufacturer's protocol.

The concentrations of secreted ΜΙΡΙα were determined by interpolating from the standard curve. The results showed that ΜΙΡΙ expression was detected in NG-500 treated but was undetectable in EnAd treated cells both 24 and 48 hrs post infection (Figure 2B) . Example 5: Jurkat Reporter assay

A Jurkat T-cell reporter cell line (Jurkat Dual™ cells, InVivogen), which permits study of NF- B pathway activation by analysis of the activity of a secreted luciferase reporter protein driven by an NF-KB transcriptional response element, was used to study the functional activity of the CD80 and anti-CD3 ScFv transgenes in the NG-500 virus. The activity was compared to another virus, NG-348, which expresses CD80 and anti-CD3 ScFv but not ΜΙΡΙα. A549 cells were seeded into 96 well plates at a density of 8e4 cells/well. Plates were incubated for 5 hrs, 37°C, 5% C02, before cells were either infected with NG- 500 or NG-348 at 10 ppc or were left uninfected. At 48 hrs post-infection, A549 cell culture supernatant was removed and 4e5 Jurkat reporter cells were added to the A549 cell monolayers. The co-culture was carried out for 16hrs, at which point cellular supernatants were collected and centrifuged at 1600rpm for 5 mins. 10 of the co-culture cell supernatants were added to 50 μί luciferase substrate (Quanti-Luc, Promega) and luminescence subsequently detected using a plate reader (Biotek) . Activity of NG-500 virus particles in this assay was indistinguishable from that of NG-348 (Figure 3).

Example 6: Human T-cell activation and degranulation mediated by NG-500 infected carcinoma cell lines

A549 lung carcinoma cells, either infected with NG-500, NG-348 or EnAd virus particles or left uninfected, were co-cultured with CD3+ T-cells isolated from human PBMC donors. Both NG-348 and NG-500 viruses express the membrane-anchored chimeric form of the single chain Fv anti-human CO3e and CD80 but, unlike NG-500, NG-348 does not also encode MIPlcc. T-cell activation was assessed by analysing cell surface activation marker CD25 (by Flow cytometry), CD107a cell surface expression as a marker for degranulation (by Flow cytometry) and secretion of stimulatory cytokine, IFNy (by ELISA) .

A549 cells were seeded into 12 well plates at a density of 5e5 cells/well. Plates were incubated for 18 hrs, 37°C, 5% C0₂, before cells were either infected with EnAd, NG-500 or NG-348 at 10 ppc or were left uninfected. At 48 hrs post-infection CD3⁺ T-cells, isolated by negative selection from PBMCs (MACs), were added to the A549 cell monolayers at a ratio of 8 T-cells: 1 tumour cell. The co-culture was carried out for 16 hrs, after which point cellular supernatants were collected for ELISA analysis and T-cells harvested for Flow cytometry analysis.

Culture media containing non-adherent cells was removed from co-culture wells and centrifuged (300xg). The supernatant was carefully removed, diluted 1 in 2 with PBS 5% BSA and stored for ELISA analysis. The adherent cell monolayers were washed once with PBS and then detached using trypsin. The trypsin was inactivated using complete media and the cells were added to the cell pellets that had been collected from the culture supernatants. The cells were centrifuged (300xg), the supernatant discarded and the cell pellet washed in 200 μί of PBS. The cells were centrifuged again and then re-suspended in 50μί of FACs buffer (5% BSA PBS) containing Live/Dead Aqua (Life tech) for 15 mins at room temperature. The cells were washed once in FACs buffer before staining with panels of directly conjugated antibodies: anti-CD3 conjugated to BV605; anti-CD25 conjugated to BV421; anti-CD 107a conjugated to FITC. A sample of cells from each co-culture condition was also stained with relevant isotype control antibodies. All staining was carried out in FACs buffer in a total volume of ΒΟμΙ/ννβΜ for 15 mins, 4°C. Cells were then washed with FACs buffer (200μί) before resuspension in 200μί of FACs buffer and analysis by Flow cytometry (Attune).

Upregulation of T-cell activation and degranulation markers

Flow cytometry analysis of T-cell activation was assessed by expression of the T-cell activation marker CD25 and the marker for T-cell degranulation, CD107a on live, CD3⁺, single cells. These data showed that the number of CD4+ (CD3+CD8-) and CD3+CD8+ T- cells expressing CD25 and CD107a was significantly higher for T cells cultured with NG-500 infected A549 cells than EnAd or uninfected controls and NG-500 and NG-348 demonstrated equivalent levels of T cell activation (Figure 4A and 4B).

Secretion of the stimulatory cytokine IFNy

For detection of IFNy expression, co-culture supernatants were diluted into 5% BSA/PBS assay buffer (in a range of 1:100 to 1: 1000) and ELISA was carried out using the Human IFN gamma Ready Set Go kit (Affymetrix) according to the manufacturer's protocol. The concentration of secreted IFNy was determined by interpolating from the standard curve. Expression of IFNy could only be detected in the supernatants of co-cultures using NG-348 or NG-500 infected A549 cells and was not detectable in either the EnAd, or untreated controls (Figure 5).

In summary, the above examples demonstrate that the oncolytic adenovirus of the present disclosure, NG-500 i) retains the oncolytic properties and replication competency of the original parental adenovirus EnAd; ii) successfully expressed CD80 on the cell surface of the cancer cells it infected; iii) successfully produced secreted ΜΙΡ-Ια in the cancer cells it infected; and iv) were able to upregulate T cell activation to a significantly greater extent than EnAd.

Claims

A replication deficient or replication capable oncolytic adenovirus, comprising:

(i a first transgene comprising a DNA sequence which encodes a first protein,

(ii) a second transgene encoding a protein or fragment comprising a transmembrane domain or GPI anchor, and

(iii) a third transgene encoding a third protein;

wherein the three transgenes are located between the virus fibre gene L5 and the virus E4 gene and wherein the said transgenes are under the control of a promoter endogenous to the virus, such as the major late promoter, and the relative location of the second transgene is between the first and third transgene.

A replication deficient or replication capable oncolytic adenovirus according to claim 1, wherein the three transgenes are located within a single transgene cassette. A replication deficient or replication capable oncolytic adenovirus according to claim 1 or 2, wherein the first protein is an antibody or binding fragment thereof. A replication deficient or replication capable oncolytic adenovirus according to any one of claims 1 to 3, wherein the antibody or binding fragment of part i) is human or humanised.

A replication deficient or replication capable oncolytic virus according to any one of claims 1 to 4, wherein the antibody or antibody binding fragment is a cell membrane-anchored form, for example wherein the antibody or binding fragment comprises a transmembrane domain sequence or GPI anchor, such as a transmembrane domain from a PDGF receptor.

A replication deficient or replication capable oncolytic virus according to any one of claims 1 to 5, wherein the third protein is a cytokine.

A replication deficient or replication capable oncolytic virus according to any one of claims 1 to 6, which comprises a fourth transgene.

A replication deficient or replication capable oncolytic virus according to any one of claims 1 to 7, which comprises a fifth transgene.

A replication deficient or replication capable oncolytic virus according to any one of claims 1 to 8, which further comprises a sixth transgene.

A replication deficient or replication capable oncolytic virus according to any one of claims 1 to 9, wherein the virus is a group B adenovirus, such as Adll.

A replication competent oncolytic virus according to any one of claims 1 to 10, wherein the virus is a chimeric virus, for example wherein the virus comprises a modified E2B region.

A replication competent oncolytic virus according to claims 11, wherein the virus is enadenotucirev (EnAd).

A replication competent oncolytic virus according to any one of claims 1 to 12, wherein the virus has a formula (I):

5'ITR-B₁-B_A-B₂-Bx-B_B-B_Y-B3-3'ITR (I) Bi comprises: E1A, E1B or E1A-E1B;

B_A is E2B-L1-L2-L3-E2A-L4;

Bg comprises L5;

By comprises the transgene cassette according to the present disclosure; and B3 is a bond or comprises E4.

14. A replication competent oncolytic virus according to any one of claims 1 to 13, wherein the transgene cassette comprises one or more high efficiency self- cleavable sequences, for example two high efficiency cleavable sequences, in particular selected from P2A, T2A and combinations thereof.

15. A pharmaceutical composition comprising a replication deficient or replication competent oncolytic adenovirus according to any one of claims 1 to 14, and a diluent or carrier.

16. A method of treating a patient comprising administering a therapeutically effective amount of a replication deficient or replication competent adenovirus according to any one of claims 1 to 14 or a composition according to claim 15.

17. A replication deficient or replication competent adenovirus according to claim 1 to 14 or a composition according to claim 15 for use in treatment, for example for the treatment of cancer.

18. Use of a replication deficient or replication competent adenovirus according to claim 1 to 14 or a composition according to claim 15 for use in the manufacture of a medicament, for example for the treatment of cancer.

19. A method of generating a replication deficient or replication competent adenovirus according to claim 1 to 14 by replication in a host cell.