WO2013006838A1 - Immunogenic combination compositions and uses thereof - Google Patents
Immunogenic combination compositions and uses thereof Download PDFInfo
- Publication number
- WO2013006838A1 WO2013006838A1 PCT/US2012/045847 US2012045847W WO2013006838A1 WO 2013006838 A1 WO2013006838 A1 WO 2013006838A1 US 2012045847 W US2012045847 W US 2012045847W WO 2013006838 A1 WO2013006838 A1 WO 2013006838A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antigen
- polypeptide
- immunogenic composition
- rna
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/23—Parvoviridae, e.g. feline panleukopenia virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/763—Herpes virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/245—Herpetoviridae, e.g. herpes simplex virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55566—Emulsions, e.g. Freund's adjuvant, MF59
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
- C12N2710/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14211—Erythrovirus, e.g. B19 virus
- C12N2750/14223—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14211—Erythrovirus, e.g. B19 virus
- C12N2750/14234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/36011—Togaviridae
- C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
- C12N2770/36141—Use of virus, viral particle or viral elements as a vector
- C12N2770/36143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- Combination vaccines merge antigens that prevent different diseases or that protect against multiple strains of infectious agents causing the same disease into a single product. Thus, they reduce the number of injections required to prevent some diseases.
- Potential advantages of combination vaccines include a) reducing the cost of stocking and administering separate vaccines, b) reducing the cost for extra health-care visits, and c) facilitating the addition of new vaccines into immunization programs.
- Nucleic acid based vaccines are an attractive approach to vaccination.
- intramuscular (IM) immunization of plasmid DNA encoding an antigen can induce cellular and humoral immune responses and protect against challenge.
- DNA vaccines offer certain advantages over traditional vaccines using protein antigens, or attenuated pathogens.
- DNA vaccines can be more effective in producing a properly folded antigen in its native conformation, and in generating a cellular immune response.
- DNA vaccines also do not have some of the safety problems associated with killed or attenuated pathogens.
- a killed viral preparation may contain residual live viruses, and an attenuated virus may mutate and revert to a pathogenic phenotype.
- DNA vaccines are generally effective in generating cell mediated immunity (such as interferon- ⁇ secreting antigen-specific T-cells and antigen-specific cytotoxic T-cells), but less effective in generating antibodies against the encoded and expressed antigen.
- WO 97/28818 discloses a vaccine that delivers a nucleic acid and a protein antigen to antigen presenting cells.
- the nucleic acid may encode the same protein as the protein antigen.
- the nucleic acid and protein are "complexed," e.g., by covalent conjugation.
- the complex may be formulated as a synthetic virus-like particle. It is also suggested that liposomal systems may be used.
- U.S. Pat. No. 7,604,803 discloses the co-delivery of nucleic acid and its encoded protein to the same cell using a liposomal system.
- the DNA molecule and its encoded protein are entrapped within the same liposomal vehicle, such that the two entities arrive at antigen-presenting cells together, resulting in the processing and presentation of the protein form of the antigen, together with the expression of the DNA-encoded form of the antigen in the same cell.
- WO 2009/074861 discloses a vaccine comprising (i) a nucleic acid sequence encoding at least one influenza virus antigen coated onto carrier particles, and (ii) an assistor protein for sequential or concomitant administration.
- the assistor protein and the antigen encoded by the nucleic acid molecule share at least one common epitope.
- non-coding plasmid DNA has an immuno-adjuvant action when co-entrapped with peptides in liposomal vesicles (Gursel, M. et al. Vaccine (1999) 17: 1376-1383) and that DNA with CpG motifs has an adjuvant effect on naked DNA and peptide vaccines (Klinman, D. M. et al. Vaccine (1999) 17: 19-25).
- RNA molecules encoding an antigen or a derivative thereof may also be used as vaccines.
- RNA vaccines offer certain advantages as compared to DNA vaccines. However, compared with DNA-based vaccines, relatively minor attention has been given to RNA-based vaccines. RNAs are highly susceptible to degradation by nucleases when administered as a therapeutic or vaccine. See, e.g., Vajdy, M., et al, Mucosal adjuvants and delivery systemsfor protein-, DNA- and RNA-based vaccines, Immunol Cell Biol, 2004. 82(6): p. 617-27.
- TLRs Toll-like receptors
- PAMPS pathogen-associated molecular patterns
- Many TLRs have been identified in humans, mice, and other mammalian species.
- DNA molecules such as bacterial or viral DNA
- RNA molecules such as single stranded viral RNA
- T-cells and B-cells recognize antigens in different ways.
- T-cells recognize peptide fragments of proteins that are embedded in class-II or class-I MHC molecules at the surface of cells
- B-cells recognize surface features of an unprocessed antigen, via immunoglobulin-like cell surface receptors. The difference in antigen recognition
- T-cell epitopes which comprise peptides of about 8-12 amino acids in length
- B-cells recognize surface features of an antigen or a pathogen
- T-cell epitopes (which comprise peptides of about 8-12 amino acids in length) can be "internal” as well as “surface” when viewed in the context of the three-dimensional structure of the antigen.
- a B-cell epitope is preferably exposed on the surface of the antigen or pathogen, and can be linear or conformational, whereas a T-cell epitope is typically linear but is not required to be available or on the surface of the antigen.
- U.S. Patent No. 7,862,829 discloses a method of producing an immune response by administering to an antigen and an alpha- virus-based adjuvant.
- the method is basedon the discovery that alphavirus, a (+) ssRNA virus, can act as an adjuvant to enhance an immune response against an antigen, even though the antigen is not presented on or expressed by the virus.
- the alphavirus particles may be delivered by liposomal system.
- This invention generally relates to immunogenic compositions that comprise an RNA component and a polypeptide component.
- the immunogenic compositions deliver a combination of antigenic epitopes in two different forms - a first epitope from a pathogen, in RNA-coded form; and a second epitope from a different pathogen, in polypeptide form - and can induce an immune response to both pathogens (e.g., without the need for a separate adjuvant).
- a practical benefit of the immunogenic compositions described herein is that the total number of immunogenic compositions needed to be administered to the patient is reduced due to the combination of two or more antigens in a single immunogenic composition. This is especially beneficial for infants and children who receive a large number of routine vaccinations.
- the invention also relates to methods for treating or preventing two or more infectious diseases, methods for inducing an immune response against two or more pathogens, or methods of vaccinating a subject, by co-delivery of an RNA molecule and a polypeptide molecule (co-administration).
- the invention provides an immunogenic composition comprising (i) a first polypeptide antigen, and (ii) a self-replicating RNA molecule that encodes a second polypeptide antigen, wherein the first and second antigens are antigens from different pathogens.
- the first polypeptide antigen is a
- Cytomegalovirus (CMV) antigen In some embodiments, the second polypeptide antigen is a Parvovirus antigen.
- the second polypeptide antigen can be in the form of a virus-like particle (CLP).
- the first polypeptide antigen is a soluble polypeptide
- the second polypeptide antigen is a soluble or membrane anchored polypeptide
- the self-replicating RNA is an alphavirus-derived RNA replicon.
- the self-replicating RNA molecule may comprise one or more modified nucleotides.
- the immunogenic composition further comprises a cationic lipid, a liposome, a cochleate, a virosome, an immune-stimulating complex, a microparticle, a microsphere, a nanosphere, a unilamellar vesicle, a multilamellar vesicle, an oil-in-water emulsion, a water-in-oil emulsion, an emulsome, a polycationic peptide or a cationic nanoemulsion.
- the RNA molecule is encapsulated in, bound to or adsorbed on a cationic lipid, a liposome, a cochleate, a virosome, an immune-stimulating complex, a microparticle, a microsphere, a nanosphere, a unilamellar vesicle, a multilamellar vesicle, an oil-in-water emulsion, a water-in-oil emulsion, an emulsome, a polycationic peptide, a cationic nanoemulsion, or combinations thereof.
- the first and second polypeptide antigens are independently derived from a viral pathogen, a bacterial pathogen, a fungal pathogen, a protozoan pathogen, and a multi-cellular parasitic pathogen.
- the first polypeptide antigen and the second polypeptide antigen can both be viral antigens.
- one viral antigen can be from CMV.
- one viral antigen can be from Parvovirus.
- the parvovirus antigen can comprise an amino acid sequence selected from SEQ ID NOs:25- 26.
- the viral antigen from CMV can be a gB antigen, a gH antigen, or a gL antigen.
- the viral antigen from CMV can be a gH antigen or a gL antigen.
- the RNA molecule encodes a gH antigen and a gL antigen.
- the immunogenic composition comprises a gH polypeptide antigen and gL polypeptide antigen.
- the immunogenic composition further comprises an adjuvant.
- the invention also relates to immunogenic compositions that comprise (i) a Parvovirus polypeptide antigen, and (ii) a self-replicating RNA molecule that encodes a CMV polypeptide antigen.
- the invention also relates to immunogenic compositions and a
- the invention also relates to methods for treating or preventing an infectious disease.
- a therapeutically effective amount of an immunogenic composition is administered to a subject.
- the invention also relates to methods for inducing an immune response in a subject.
- a therapeutically effective amount of an immunogenic composition is administered to the subject.
- the invention also relates to methods of vaccinating a subject.
- an immunogenic composition is administered to the subject.
- RNA molecules are self-adjuvanting.
- RNA molecules can induce the production of cytokines, which can enhance the host immune response to the protein antigen that is encoded by the RNA molecule.
- RNA molecules promote type 1 T helper responses (Thl, IFN- ⁇ 111 , IL-4 lG ), whereas protein molecules promote type 2 T helper responses.
- RNA molecules may be delivered to cells using delivery systems such as liposomes or oil-in-water emulsions.
- Liposomes and oil-in-water emulsions are also known to have adjuvant activities.
- the adjuvant activity of the RNA together with adjuvant activity of the delivery system can act synergistically to enhance the immune response to one or both antigens.
- the invention relates to immunogenic compositions that comprise an RNA component from a first pathogen and a polypeptide component from a second pathogen.
- Immunogenic compositions that deliver antigenic epitopes in two different forms - a first epitope from one pathogen, in RNA -coded form; and a second epitope from a different pathogen, in polypeptide form - can enhance the immune response to one or both pathogens.
- RNA molecule that encodes a CMV antigen a self-replicating RNA molecule that encodes a CMV antigen
- Parvovirus polypeptide antigen a Parvovirus polypeptide antigen
- the immunogenic compositions described herein can be formulated as a vaccine to induce or enhance the host immune response to a pathogen, such as to induce protective immunity. Also provided herein are methods of using the immunogenic compositions of the invention to induce or enhance an immune response in a subject in need thereof.
- the invention provides an immunogenic composition comprising: (i) a self-replicating RNA molecule that encodes a first polypeptide antigen; and (ii) a second polypeptide antigen; wherein said first and second polypeptide antigens are from different pathogens.
- the RNA molecule may encode a first polypeptide antigen comprising a full-length protein from a pathogen (e.g., a viral protein), or an antigenic portion thereof, optionally fused with a tag sequence that may facilitate the expression, purification and/or detection of thel protein.
- the second polypeptide antigen may be a recombinant protein comprising a full-length protein from a different pathogen, or an antigenic portion thereof, optionally fused with a tag sequence that may facilitate the production, purification or detection of the protein.
- the first polypeptide antigen, the second polypeptide antigen, or both, may comprise a mutation variant of a protein from a pathogen (e.g., a viral protein having amino acid substitution(s), addition(s), or deletion(s)).
- the first polypeptide antigen is a soluble or membrane anchored polypeptide
- the second polypeptide antigen is a soluble polypeptide.
- the wild type viral protein is a transmembrane surface protein
- the RNA molecule may comprise the full-length coding sequence to produce the first (membrane- anchored) antigen, while the transmembrane region of the viral protein may be deleted to produce the second polypeptide antigen (which is soluble).
- the first antigen or the second antigen is a fusion polypeptide further comprising a third epitope.
- the third epitope may be from a different pathogen, or from a different antigen of the same pathogen.
- the self-replicating RNA molecule that encodies a first polypeptide antigent can be in the form of a VRP.
- the second polypeptide antigen can be in the form of a VLP.
- Antigens suitable for inclusion in the immunogenic compositions described herein may be derived from any pathogen (e.g., a bacterial pathogen, a viral pathogen, a fungal pathogen, a protozoan pathogen, or a multi-cellular parasitic pathogen), allergen or tumor.
- pathogen e.g., a bacterial pathogen, a viral pathogen, a fungal pathogen, a protozoan pathogen, or a multi-cellular parasitic pathogen
- the first and/or second antigens are derived from a viral pathogen.
- viral pathogens include, e.g., respiratory syncytial virus (RSV), hepatitis B virus (HBV), hepatitis C virus (HCV), Dengue virus, herpes simplex virus (HSV; e.g., HSV-I, HSV-II), molluscum contagiosum virus, vaccinia virus, variola virus, lentivirus, human immunodeficiency virus (HIV), human papilloma virus (HPV), cytomegalovirus (CMV), varicella zoster virus (VZV), rhino virus, enterovirus, adenovirus, coronavirus (e.g., SARS), influenza virus (flu), para-influenza virus, mumps virus, measles virus, papovavirus, hepadnavirus, flavivirus, retrovirus, arenavirus (e.g.,
- RSV respiratory sy
- the antigen can be CMV glycoprotein gH, or gL; Parvovirus; HIV glycoprotein gpl20 or gpl40, HIV p55 gag, pol; or RSV-F antigen, etc.
- the first and/or second antigens are derived from a virus which infects fish, such as: infectious salmon anemia virus (ISAV), salmon pancreatic disease virus (SPDV), infectious pancreatic necrosis virus (IPNV), channel catfish virus (CCV), fish lymphocystis disease virus (FLDV), infectious hematopoietic necrosis virus (IHNV), koi herpesvirus, salmon picorna-like virus (also known as picorna-like virus of atlantic salmon), landlocked salmon virus (LSV), atlantic salmon rotavirus (ASR), trout strawberry disease virus (TSD), coho salmon tumor virus (CSTV), or viral hemorrhagic septicemia virus (VHSV).
- infectious salmon anemia virus ISAV
- SPDV salmon
- the first and/or second antigens are derived from a parasite from the Plasmodium genus, such as P. falciparum, P.vivax, P.malariae or P. ovale.
- the invention may be used for immunizing against malaria.
- the first and/or second antigens are derived from a parasite from the Caligidae family, particularly those from the Lepeophtheirus and Caligus genera e.g. sea lice such as
- first and/or second antigens are derived from a bacterial pathogen.
- bacterial pathogens include, e.g., Neisseria spp, including N. gonorrhea and . meningitides; Streptococcus spp, including S. pneumoniae, S. pyogenes, S. agalactiae, S. mutans; Haemophilus spp, including H. influenzae type B, non typeable H. influenzae, H. ducreyi; Moraxella spp, including M. catarrhalis, also known as Branhamella catarrhalis; Bordetella spp, including B. pertussis, B. parapertussis and B. bronchiseptica; Mycobacterium spp., including M. tuberculosis, M. bovis, M. leprae, M. avium, M.
- paratuberculosis M. smegmatis
- Legionella spp including L. pneumophila
- Escherichia spp including enterotoxic E. coli, enterohemorragic E. coli, enteropathogenic E. coli
- Vibrio spp including V. cholera, Shigella spp, including S. sonnei, S. dysenteriae, S. flexnerii
- Yersinia spp including Y. enterocolitica, Y. pestis, Y. pseudotuberculosis, Campylobacter spp, including C. jejuni and C. coli
- Salmonella spp including S. typhi, S. paratyphi, S.
- choleraesuis S. enteritidis
- Listeria spp. including L. monocytogenes
- Helicobacter spp including H pylori
- Pseudomonas spp including P. aeruginosa
- Staphylococcus spp. including S. aureus, S. epidermidis
- Enterococcus spp. including E. faecalis, E. faecium
- Clostridium spp. including C. tetani, C. botulinum, C. difficile
- Bacillus spp. including B. anthracis
- Corynebacterium spp. including C. diphtheriae
- Borrelia spp. including B.
- Ehrlichia spp. including E. equi and the agent of the Human Granulocytic Ehrlichiosis; Rickettsia spp, including R. rickettsii; Chlamydia spp., including C. trachomatis, C. neumoniae, C. psittaci; Leptsira spp., including L. interrogans; Treponema spp., including T. pallidum, T. denticola, T. hyodysenteriae.
- first and/or second antigens are derived from a fungal pathogen (e.g., a yeast or mold pathogen).
- a fungal pathogen e.g., a yeast or mold pathogen.
- Exemplary fungal pathogens include, e.g., Aspergillus fumigatus, A. flavus, A. niger, A. terreus, A. nidulans, Coccidioides immitis, Coccidioides posadasii, Cryptococcus neoformans, Histoplasma capsulatum, Candida albicans, and Pneumocystis jirovecii.
- first and/or second antigens are derived from a protozoan pathogen.
- protozoan pathogens include, e.g., Toxoplasma gondii, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale and Plasmodium malariae.
- the first and/or second antigens are derived from a multi-cellular parasitic pathogen.
- exemplary multicellular parasitic pathogens include, e.g., trematodes (flukes), cestodes (tapeworms), nematodes (roundworms), and arthropods.
- the first and/or second antigens are derived from an allergen, such as pollen allergens (tree-, herb, weed-, and grass pollen allergens); insect or arachnid allergens (inhalant, saliva and venom allergens, e.g. mite allergens, cockroach and midges allergens, hymenopthera venom allergens); animal hair and dandruff allergens (from e.g. dog, cat, horse, rat, mouse, etc.); and food allergens (e.g. a gliadin).
- pollen allergens tree-, herb, weed-, and grass pollen allergens
- insect or arachnid allergens inhalant, saliva and venom allergens, e.g. mite allergens, cockroach and midges allergens, hymenopthera venom allergens
- animal hair and dandruff allergens from e.
- Important pollen allergens from trees, grasses and herbs are such originating from the taxonomic orders of Fagales, Oleales, Pinales and platanaceae including, but not limited to, birch (Betula), alder (Alnus), hazel (Corylus), hornbeam (Carpinus) and olive (Olea), cedar (Cryptomeria and Juniperus), plane tree (Platanus), the order of Poales including grasses of the genera Lolium, Phleum, Poa, Cynodon, Dactylis, Holcus, Phalaris, Secale, and Sorghum, the orders of Asterales and Urticales including herbs of the genera Ambrosia, Artemisia, and Parietaria.
- Other important inhalation allergens are those from house dust mites of the genus
- Dermatophagoides and Euroglyphus storage mite e.g. Lepidoglyphys, Glycyphagus and Tyrophagus, those from cockroaches, midges and fleas e.g. Blatella, Periplaneta, Chironomus and Ctenocepphalides, and those from mammals such as cat, dog and horse, venom allergens including such originating from stinging or biting insects such as those from the taxonomic order of Hymenoptera including bees (Apidae), wasps (Vespidea), and ants (Formicoidae).
- the first and/or second antigens are derived from a tumor antigen selected from: (a) cancer-testis antigens such as NY-ESO-1, SSX2, SCP1 as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-1, GAGE-2, MAGE-1, MAGE-2, MAGE-3, MAGE-4, MAGE-5, MAGE-6, and MAGE- 12 (which can be used, for example, to address melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumors; (b) mutated antigens, for example, p53 (associated with various solid tumors, e.g., colorectal, lung, head and neck cancer), p21/Ras (associated with, e.g., melanoma, pancreatic cancer and colorectal cancer), CDK4 (associated with, e.g., melanoma), MUMl (associated with,
- cancer-testis antigens
- tumor immunogens include, but are not limited to, pi 5, Hom/Mel-40, H-Ras, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens, including E6 and E7, hepatitis B and C virus antigens, human T-cell lymphotropic virus antigens, TSP-180, pl85erbB2, pl80erbB-3, c-met, mn-23Hl, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, pl6, TAGE, PSCA, CT7, 43-9F, 5T4, 791 Tgp72, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29 ⁇ BCAA), CA 195, CA 242, CA-50, CAM43, CD68 ⁇ KP1, CO-029,
- the first or second antigen is from CMV.
- the first or second antigen is derived from a capsid protein, an envelope glycoprotein (such as gB, gH, gL, gM, gN), or a tegument protein.
- the first or second antigen is derived from one or more of the following proteins: pp65, IE1, gB, gD, gH, gL, gM, gN, gO, UL128, UL129, gUL130, UL150, UL131, UL33, UL78, US27, US28, RL5A, RL6, RL10, RLl 1, RL12, RL13, ULl, UL2, UL4, UL5, UL6, UL7, UL8, UL9, UL10, ULl 1, UL14, ULl 5 A, UL16, UL17, UL18, UL22A, UL38, UL40, UL41A, UL42, ULl 16, ULl 19, UL120, UL121, UL124, UL132, UL147A, UL148, UL142, UL144, UL141, UL140, UL135, UL136, UL
- the CMV antigen may also be a fusion polypeptide of one or more CMV proteins, such as pp65/IEl (Reap et ah, Vaccine (2007) 25:7441-7449), gH/gL (Chowdary et al, Nature Structural & Molecular Biology, 17, 882-888 (2010)).
- CMV proteins such as pp65/IEl (Reap et ah, Vaccine (2007) 25:7441-7449), gH/gL (Chowdary et al, Nature Structural & Molecular Biology, 17, 882-888 (2010)).
- Suitable CMV antigens include gB, gH, gL, gO, and can be from any CMV strain.
- CMV proteins can be from Merlin, AD 169, VR1814, Towne, Toledo, TR, PH, TB40, or Fix strains of CMV. Exemplary sequences of CMV proteins that may be used for the invention are shown in Table 1.
- CMV gL FL Full length gL polypeptide (CMV gL FL) SEQ ID NO: 12
- CMV gO FL Full length gO polynucleotide
- CMV gO FL Full length gO polypeptide
- CMV gH sol polynucleotide
- CMV gH sol polynucleotide
- CMV gH sol SEQ ID NO: 9
- CMV gH sol SEQ ID NO: 10
- CMV gB FL Full length gB polynucleotide
- CMV gB FL Full length gB polypeptide
- CMV gB sol 750 polynucleotide
- CMV gB 750 polypeptide
- CMV gB 750 polypeptide
- SEQ ID NO:4 gB sol 692 polynucleotide
- CMV gB 692 SEQ ID NO: 5 gB sol 692 polypeptide
- CMV gM FL Full length gM polynucleotide
- CMV gM FL Full length gM polypeptide
- CMV gN FL Full length gN polynucleotide
- CMV gN FL Full length gN polypeptide (CMV gN FL) SEQ ID NO: 16
- the first or second antigen may be a gB antigen.
- a gB antigen can be full length gB protein or can omit one or more regions of the protein. Alternatively, fragments of a gB protein can be used.
- gB amino acids are numbered according to the full-length gB amino acid sequence (CMV gB FL) shown in SEQ ID NO: 2, which is 907 amino acids long.
- Suitable regions of a gB protein which can be excluded from the full-length protein or included as fragments include: the signal sequence (amino acids 1- 24), a gB-DLD disintegrin-like domain (amino acids 57-146), a furin cleavage site (amino acids 459-460), a heptad repeat region (679-693), a membrane spanning domain (amino acids 751-771), and a cytoplasmic domain from amino acids 771-906.
- a gB antigen includes amino acids 67-86 (Neutralizing Epitope AD2) and/or amino acids 532-635 (Immunodominant Epitope AD1).
- gB antigens include "gB sol 692,” which includes the first 692 amino acids of gB, and "gB sol 750,” which includes the first 750 amino acids of gB.
- the signal sequence, amino acids 1-24, can be present or absent from gB sol 692 and gB sol 750 as desired.
- the gB antigen is a gB fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, or 875 amino acids.
- the invention may also use a gB antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 2 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 2).
- gB antigens comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 2 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 2).
- the first or second antigen may be a gH antigen.
- a gH antigen can be a full-length gH protein (CMV gH FL, SEQ ID NO: 8, for example, which is a 743 amino acid protein).
- gH has a membrane spanning domain and a cytoplasmic domain starting at position 716 to position 743. Removing amino acids from 717 to 743 provides a soluble gH (e.g., CMV gH sol, SEQ ID NO: 10).
- the gH antigen is a gH fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, or 725 amino acids.
- the invention may also use a gH antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 8 or 10 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 8 or 10).
- gL Antigens [0060]
- the first or second antigen may be a gL antigen.
- a gH antigen can be a full-length gL protein (CMV gL FL, SEQ ID NO: 12, for example, which is a 278 amino acid protein).
- a gL fragment can be used.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, or 250 amino acids.
- the invention may also use a gL antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 12 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 12).
- gO Antigens comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 12 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 12).
- the first or second antigen may be a gO antigen.
- a gO antigen can be a full-length gO protein (CMV gO FL, SEQ ID NO: 18, for example, which is a 472 amino acid protein).
- the gO antigen can be a gO fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, or 450 amino acids.
- the invention may also use a gO antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 18 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 18).
- gM Antigens comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 18 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 18).
- the first or second antigen may be a gM antigen.
- a gM antigen can be a full-length gM protein (CMV gM FL, SEQ ID NO: 14, for example, which is a 371 amino acid protein).
- the gM antigen can be a gM fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, or 350 amino acids.
- the invention may also use a gM antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 14 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14).
- gM antigens comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 14 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14).
- the first or second antigen may be a gN antigen.
- a gN antigen can be a full-length gN protein (CMV gN FL, SEQ ID NO: 16, for example, which is a 135 amino acid protein).
- the gN antigen can be a gN fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 125 amino acids.
- the invention may also use a gN antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 16 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 16).
- the first or second antigen may be a UL128 antigen.
- a UL128 antigen can be a full-length UL128 protein (CMV UL128 FL, SEQ ID NO:20, for example, which is a 171 amino acid protein).
- the UL128 antigen can be a UL128 fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, or 150 amino acids.
- the invention may also use a UL128 antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 20 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 20).
- the first or second antigen may be a UL130 antigen.
- a UL130 antigen can be a full-length UL130 protein (CMV UL130 FL, SEQ ID NO:22, for example, which is a 214 amino acid protein).
- the UL130 antigen can be a UL130 fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, or 200 amino acids.
- the invention may also use a UL130 antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 22 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 22).
- the first or second antigen may be a UL131 antigen.
- a UL131 antigen can be a full-length UL131 protein (CMV UL131, SEQ ID NO:24, for example, which is a 129 amino acid protein).
- the UL131 antigen can be a UL131 fragment of 10 amino acids or longer.
- the number of amino acids in the fragment can comprise 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, or 200 amino acids.
- the invention may also use a UL131 antigen comprising an amino acid sequence that is at least 75% identical to SEQ ID NO: 24 (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 24).
- the CMV antigen may be a fusion polypeptide.
- the antigen may comprise a first domain and a second domain, wherein (i) the first domain comprises a first CMV antigen and (ii) the second domain comprises a second CMV antigen.
- the first CMV antigen and the second CMV antigen are independently selected from a gB, gH, gL, gO, gM, gN, UL128, UL130, or UL131 antigen described above.
- Two or more CMV antigens may also be co-delivered so that they form a complex in vivo (e.g., gH/gL complex, gM/gN complex, gH/gL/UL128/UL130/UL131 pentameric complex).
- the immunogenic composition may comprise an RNA molecule that encode two separate antigens, gH and gL.
- the immunogenic composition may also comprise two polypeptide antigens, gH and gL.
- the polypeptide antigen is derived from Parvovirus.
- the parvovirus infects humans, i.e., is of the Dependovirus, Erythrovirus, or Bocavirus genus.
- the parvovirus is parvovirus B 19.
- the parvovirus is from the Parvovirus genus.
- Parvovirus B 19 belongs to the Erythroviruses genus of the Parvoviridae family of small DNA viruses. It is a non- enveloped, icosahedral virus that contains a single-stranded linear DNA genome.
- the parvovirus B19 virion is 20-25 nm in diameter and has a genome of 5.6 kb (Clewley, 1984, Cotmore & Tattersall, 1984).
- the parvovirus B 19 capsid consists of an 83 kDa minor structural protein, VPl, and a 58 kDa major structural protein, VP2. It has a non-segmented single stranded DNA genome surrounded by a protein shell containing two structural proteins, VP l and VP2 in a ⁇ 5% to -95% ratio (Ozawa et al, 1987).
- sequences of the two proteins are co-linear, with VP2 being identical to the carboxyl-terminal region of VP l; however, VPl comprises an additional 227 amino acids at the amino-terminus. Long lasting antibody responses are directed to both VPl and VP2 proteins and thus these proteins alone are expected to raise a significant immune response.
- parvovirus B19 genome contains three open reading frames: a nonstructural 77 kDa protein, NS 1, is encoded by nucleotides 436-2451 ; the minor structural protein, VP l is encoded by nucleotides 2444-4787, and the major structural protein, VP2, is encoded by nucleotides 3125-4787 (Corcoran et al., J. Med. Microb., 2004).
- Parvovirus B 19 uses a single promoter, p6, which is capable of expressing structural and non-structural genes differentially (Blundell et al., 1987, Ozawa et al., 1987).
- the Parvovirus antigen is a VLP.
- the VLP can contain VPl and VP2 from any desired parvovirus, or any desired combination.
- the VPl and VP2 proteins can have an amino acid sequence that is the same as or substantially the same as a naturally occurring parvovirus VP 1 or VP2, or can contain one or more amino acid substitutions, deletions or additions.
- VP l can be mutated to inactivate its phospholipase activity.
- the amino acid sequence of VPl may contain a point mutation (e.g., His l53Ala), or any of the mutations described in WO 06/032697, EP 1791858 or US 20070286870.
- the VLP contains VP l and VP2 are from a parvovirus that infects humans, i.e., a parvovirus of the Dependovirus, Erythrovirus, or Bocavirus genus.
- the VLP contains parvovirus B 19 VP l and parvovirus B 19 VP2.
- the VLP comprises VP l in lower abundance relative to VP2 (e.g., soluble VPl is produced in lower abundance than soluble VP2), as a result of the individual control elements that are operably linked to the nucleic acids that encode VP l and VP2 and/or as a result of other features of the recombinant nucleic acids that encode VP l and VP2, such as optimized codon usage and deoptimized codon usage.
- control elements e.g., promoters
- features e.g., codon usage
- the pathogen is RSV.
- RSV is an enveloped non- segmented negative-strand RNA virus in the family Paramyxoviridae, genus Pneumovirus .
- paramyxoviruses such as RSV, like other enveloped viruses such as influenza virus and HIV, require fusion of the viral membrane with a host cell's membrane.
- the conserved fusion protein (RSV-F glycoprotein) fuses the viral and cellular membranes by coupling irreversible protein refolding with juxtaposition of the membranes. In current models based on paramyxovirus studies, the RSV-F protein initially folds into a metastable "pre-fusion" conformation.
- pre-fusion conformation undergoes refolding and conformational changes to its stable "post-fusion” conformation. See, also, Swanson et al, PNAS USA 108(23):9619-9624 (2011) regarding pre-fusion and post-fusion RSV-F structures.
- the first and second antigens are from RSV.
- the first and second antigens can independently be derived from the RSV surface glycoproteins Fusion (F), Glycoprotein (G), Small Hydrophobic protein (SH), the matrix proteins M and M2, the nucleocapsid proteins N, P and L, and the nonstructural proteins NS 1 and NS2.
- the first and second antigens are each an RSV-F antigen.
- the F glycoprotein of RSV is a type I single-pass integral membrane protein having four general domains: N-terminal ER-translocating signal sequence (SS), ectodomain (ED), transmembrane domain (TM), and a cytoplasmic tail (CT).
- SS N-terminal ER-translocating signal sequence
- ED ectodomain
- TM transmembrane domain
- CT cytoplasmic tail
- the RSV-F glycoprotein is translated from mRNA into an approximately 574 amino acid protein designated F 0 .
- Post-translational processing of Fo includes removal of an N-terminal signal peptide by a signal peptidase in the endoplasmic reticulum.
- Fo is also cleaved at two sites (approximately 109/110 and approximately 136/137) by cellular proteases (in particular furin) in the trans-Golgi. This cleavage results in the removal of a short intervening sequence and generates two subunits designated Fi (-50 kDa; C-terminal; approximately residues 137-574) and F 2 (-20 kDa; N- terminal; approximately residues 1- 109) that remain associated with each other.
- Fi contains a hydrophobic fusion peptide at its N-terminus and also two amphipathic heptad-repeat regions (HRA and HRB). HRA is near the fusion peptide and HRB is near the transmembrane domain. Three F1-F2 heterodimers are assembled as homotrimers of F1-F2 in the virion.
- RSV-F antigens suitable for inclusion in the immunogenic compositions described herein, either in R A enconded form or as polypeptides include RSV-F glycoprotein and RSV-F glycoprotein variants.
- Suitable RSV-F glycoprotein variants include, for example, full length F protein and truncated variants such as soluble ecto- domains, each optionally containing one or more mutations, such as furin-cleavage mutations, trypsin-cleavage mutations, fusion peptide mutations (e.g., deletions in whole or in part), mutations that stabilize the HRB trimer, and mutations that destabilize the HRA trimer.
- WO201 1/008974 which disclose exemplary RSV-F antigens that can be used, in RNA form or as polypeptides, in the immunogenic compositions: (i) page 15, line 20 through page 16, line 27, which describes RSV-F, its amino acid sequence and domain structure; (ii) page 16, line 28 through page 18, line 1 1, which describes soluble ectodomains of RSV-F; (iii) page 18, line 14 through page 20, line 15, which describes furin-cleavage mutations, trypsin- cleavage mutations, fusion peptide mutations; (iv) page 20, line 16 through page 21, line 8, and page 26, line 29 through page 30, line 14, which describe optional oligomerization sequences; (v) page 20, lines 9-24, which describe introduced protease cleavage sites; (vi) and page 30, line 18 through page 32, line 18, which describe mutations that stabilize the HRB trimer, destabilize the HRA trimer and other mutations that can be included.
- the immunogenic composition described herein comprises an RNA component and a polypeptide component.
- the RNA is a self-replicating RNA.
- the composition can contain more than one RNA molecule encoding an antigen, e.g., two, three, five, ten or more RNA molecules.
- one RNA molecule may also encode more than one antigen, e.g., a bicistronic, or tricistronic RNA molecule that encodes different or identical antigens.
- the sequence of the RNA molecule may be codon optimized or deoptimized for expression in a desired host, such as a human cell.
- the sequence of the RNA molecule may be modified if desired, for example to increase the efficacy of expression or replication of the RNA, or to provide additional stability or resistance to degradation.
- the RNA sequence can be modified with respect to its codon usage, for example, to increase translation efficacy and half-life of the RNA.
- a poly A tail e.g., of about 30 adenosine residues or more
- the 5' end of the RNA may be capped with a modified ribonucleotide with the structure m7G (5') ppp (5') N (cap 0 structure) or a derivative thereof, which can be incorporated during RNA synthesis or can be enzymatically engineered after RNA transcription (e.g., by using Vaccinia Virus Capping Enzyme (VCE) consisting of mRNA triphosphatase, guanylyl- transferase and guanine-7- methytransferase, which catalyzes the construction of N7-monomethylated cap 0 structures).
- VCE Vaccinia Virus Capping Enzyme
- Cap 0 structure plays an important role in maintaining the stability and translational efficacy of the RNA molecule.
- the 5' cap of the RNA molecule may be further modified by a 2 '-0- Methyltransferase which results in the generation of a cap 1 structure (m7Gppp [m2 '- ⁇ ] N), which may further increases translation efficacy.
- the RNA molecule can comprise one or more modified nucleotides in addition to any 5 ' cap structure.
- modified nucleoside modifications found on mammalian RNA. See, e.g., Limbach et ah, Nucleic Acids Research, 22(12):2183-2196 (1994).
- the preparation of nucleotides and modified nucleotides and nucleosides are well-known in the art, e.g. from US Patent Numbers
- nucleosides and nucleotides and be present in the RNA molecules include: m5C (5- methylcytidine), m5U (5-methyluridine), m6A (N6-methyladenosine), s2U (2-thiouridine), Um (2'-0-methyluridine), mlA (1-methyladenosine); m2A (2-methyladenosine); Am (2-1-0- methyladenosine); ms2m6A (2-methylthio-N6-methyladenosine); i6A (N6- isopentenyladenosine); ms2i6A (2-methylthio-N6isopentenyladenosine); io6A (N6-(cis- hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine); ms2io6A (2-methyl
- ac6A N6-acetyladenosine
- hypoxanthine inosine
- 8-oxo-adenine 7- substituted derivatives thereof, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5- aminouracil, 5-(Ci-C6)-alkyluracil, 5-methyluracil, 5-(C2-C6)-alkenyluracil, 5-(C 2 -Ce)- alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5- hydroxycytosine, 5-(Ci-C6 )-alkylcytosine, 5-methylcytosine, 5-(C2-C6)-alkenylcytosine, 5- (C2-C6)-alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N 2
- the RNA molecule can contain phosphoramidate
- the RNA molecule does not include modified nucleotides, e.g., does not include modified nucleobases, and all of the nucleotides in the RNA molecule are conventional standard ribonucleotides A, U, G and C, with the exception of an optional 5' cap that may include, for example, 7-methylguanosine.
- modified nucleotides e.g., does not include modified nucleobases
- all of the nucleotides in the RNA molecule are conventional standard ribonucleotides A, U, G and C, with the exception of an optional 5' cap that may include, for example, 7-methylguanosine.
- the RNA may include a 5' cap comprising a 7'-methylguanosine, and the first 1, 2 or 3 5' ribonucleotides may be methylated at the 2' position of the ribose.
- the cationic oil in water emulsion contains a self- replicating RNA molecule.
- the self-replicating RNA molecule is derived from or based on an alphavirus.
- Self-replicating RNA molecules are well known in the art and can be produced by using replication elements derived from, e.g., alphaviruses, and substituting the structural viral proteins with a nucleotide sequence encoding a protein of interest.
- Cells transfected with self-replicating RNA briefly produce of antigen before undergoing apoptotic death. This death is a likely result of requisite double-stranded (ds) RNA intermediates, which also have been shown to super-activate Dendritic Cells.
- ds double-stranded
- the enhanced immunogenicity of self-replicating RNA may be a result of the production of proinflammatory dsRNA, which mimics an RNA-virus infection of host cells.
- the cell's machinery is used by self-replicating RNA molecules to generate an exponential increase of encoded gene products, such as proteins or antigens, which can accumulate in the cells or be secreted from the cells.
- Encodingd gene products such as proteins or antigens
- Overexpression of proteins or antigens by self-replicating RNA molecules takes advantage of the
- immunostimulatory adjuvant effects including stimulation of toll-like receptors (TLR) 3, 7 and 8 and non TLR pathways (e.g, RIG-1, MD-5) by the products of RNA replication and amplification, and translation which induces apoptosis of the transfected cell.
- TLR toll-like receptors
- RIG-1 non TLR pathways
- the self-replicating RNA generally contains at least one or more genes selected from the group consisting of viral replicases, viral proteases, viral helicases and other nonstructural viral proteins, and also comprise 5'- and 3'-end cz ' s-active replication sequences, and if desired, a heterologous sequences that encode a desired amino acid sequences (e.g., an antigen of interest).
- a subgenomic promoter that directs expression of the heterologous sequence can be included in the self-replicating RNA.
- the heterologous sequence e.g., an antigen of interest
- the self-replicating RNA molecule is not encapsulated in a virus-like particle.
- Self-replicating RNA molecules of the invention can be designed so that the self-replicating RNA molecule cannot induce production of infectious viral particles. This can be achieved, for example, by omitting one or more viral genes encoding structural proteins that are necessary for the production of viral particles in the self- replicating RNA.
- the self-replicating RNA molecule is based on an alpha virus, such as Sinebis virus (SIN), Semliki forest virus and Venezuelan equine encephalitis virus (VEE), one or more genes encoding viral structural proteins, such as capsid and/or envelope glycoproteins, can be omitted.
- an alpha virus such as Sinebis virus (SIN), Semliki forest virus and Venezuelan equine encephalitis virus (VEE)
- Sindbis virus SIN
- Semliki forest virus Semliki forest virus
- VEE Venezuelan equine encephalitis virus
- self-replicating RNA molecules of the invention can also be designed to induce production of infectious viral particles that are attenuated or virulent, or to produce viral particles that are capable of a single round of subsequent infection.
- a self-replicating RNA molecule When delivered to a vertebrate cell, a self-replicating RNA molecule can lead to the production of multiple daughter RNAs by transcription from itself (or from an antisense copy of itself).
- the self-replicating RNA can be directly translated after delivery to a cell, and this translation provides a RNA-dependent RNA polymerase which then produces transcripts from the delivered RNA.
- the delivered RNA leads to the production of multiple daughter RNAs.
- These transcripts are antisense relative to the delivered RNA and may be translated themselves to provide in situ expression of a gene product, or may be transcribed to provide further transcripts with the same sense as the delivered RNA which are translated to provide in situ expression of the gene product.
- Alphaviruses comprise a set of genetically, structurally, and serologically related arthropod-borne viruses of the Togaviridae family. Twenty-six known viruses and virus subtypes have been classified within the alphavirus genus, including, Sindbis virus, Semliki Forest virus, Ross River virus, and Venezuelan equine encephalitis virus.
- the self-replicating RNA of the invention may incorporate a RNA replicase derived from semliki forest virus (SFV) , Sindbis virus (SIN), Venezuelan equine encephalitis virus (VEE), Ross-River virus (RRV), or other viruses belonging to the alphavirus family.
- SFV semliki forest virus
- SI Sindbis virus
- VEE Venezuelan equine encephalitis virus
- RRV Ross-River virus
- alphavirus-based "replicon" expression vectors can be used in the invention.
- Replicon vectors may be utilized in several formats, including DNA, RNA, and recombinant replicon particles.
- Such replicon vectors have been derived from alphaviruses that include, for example, Sindbis virus (Xiong et al. (1989) Science 243 : 1 188-1 191;
- Alphaviruses-derived replicons are generally quite similar in overall characteristics (e.g., structure, replication), individual alphaviruses may exhibit some particular property (e.g., receptor binding, interferon sensitivity, and disease profile) that is unique. Therefore, chimeric alphavirus replicons made from divergent virus families may also be useful.
- Alphavirus-based replicons are (+)-stranded replicons that can be translated after delivery to a cell to give of a replicase (or replicase-transcriptase).
- the replicase is translated as a polyprotein which auto-cleaves to provide a replication complex which creates genomic (-)-strand copies of the +-strand delivered RNA.
- These (-)-strand transcripts can themselves be transcribed to give further copies of the (+)-stranded parent RNA and also to give a subgenomic transcript which encodes the desired gene product. Translation of the subgenomic transcript thus leads to in situ expression of the desired gene product by the infected cell.
- Suitable alphavirus replicons can use a replicase from a Sindbis virus, a semliki forest virus, an eastern equine encephalitis virus, a Venezuelan equine encephalitis virus, etc.
- a preferred self-replicating RNA molecule thus encodes (i) a RNA-dependent RNA polymerase which can transcribe RNA from the self-replicating RNA molecule and (ii) a polypeptide antigen.
- the polymerase can be an alphavirus replicase e.g. comprising alphavirus protein nsP4.
- an alphavirus based self-replicating RNA molecule of the invention does not encode alphavirus structural proteins.
- the self-replicating RNA can lead to the production of genomic RNA copies of itself in a cell, but not to the production of RNA-containing alphavirus virions.
- the inability to produce these virions means that, unlike a wild-type alphavirus, the self-replicating RNA molecule cannot perpetuate itself in infectious form.
- alphavirus structural proteins which are necessary for perpetuation in wild-type viruses are absent from self-replicating RNAs of the invention and their place is taken by gene(s) encoding the desired gene product, such that the subgenomic transcript encodes the desired gene product rather than the structural alphavirus virion proteins.
- a self-replicating RNA molecule useful with the invention may have two open reading frames.
- the first (5') open reading frame encodes a replicase; the second (3') open reading frame encodes a polypeptide antigen.
- the RNA may have additional (downstream) open reading frames e.g. that encode another desired gene products.
- a self-replicating RNA molecule can have a 5' sequence which is compatible with the encoded replicase.
- the self-replicating RNA molecule is derived from or based on a virus other than an alphavirus, preferably, a positive-stranded RNA virus, and more preferably a picornavirus, flavivirus, rubivirus, pestivirus, hepacivirus, calicivirus, or coronavirus.
- a virus other than an alphavirus preferably, a positive-stranded RNA virus, and more preferably a picornavirus, flavivirus, rubivirus, pestivirus, hepacivirus, calicivirus, or coronavirus.
- Suitable wild-type alphavirus sequences are well-known and are available from sequence depositories, such as the American Type Culture Collection, Rockville, Md.
- alphaviruses include Aura (ATCC VR-368), Bebaru virus (ATCC VR-600, ATCC VR-1240), Cabassou (ATCC VR-922), Chikungunya virus (ATCC VR-64, ATCC VR-1241), Eastern equine encephalomyelitis virus (ATCC VR-65, ATCC VR-1242), Fort Morgan (ATCC VR-924), Getah virus (ATCC VR-369, ATCC VR- 1243), Kyzylagach (ATCC VR-927), Mayaro (ATCC VR-66), Mayaro virus (ATCC VR- 1277), Middleburg (ATCC VR-370), Mucambo virus (ATCC VR-580, ATCC VR-1244), Ndumu (ATCC VR-371), Pixuna virus (ATCC VR-372, ATCC VR-1245), Ross River virus (ATCC VR-373, ATCC VR-1246), Semliki Forest (ATCC VR-67, ATCC VR-1247), Sindbis virus (ATCC VR-68, ATCC
- the self-replicating RNA molecules of the invention are larger than other types of RNA (e.g. mRNA).
- the self-replicating RNA molecules of the invention contain at least about 4kb.
- the self-replicating RNA can contain at least about 5kb, at least about 6kb, at least about 7kb, at least about 8kb, at least about 9kb, at least about lOkb, at least about 1 lkb, at least about 12kb or more than 12kb.
- the self-replicating RNA is about 4kb to about 12kb, about 5kb to about 12kb, about 6kb to about 12kb, about 7kb to about 12kb, about 8kb to about 12kb, about 9kb to about 12kb, about lOkb to about 12kb, about 1 lkb to about 12kb, about 5kb to about 1 lkb, about 5kb to about lOkb, about 5kb to about 9kb, about 5kb to about 8kb, about 5kb to about 7kb, about 5kb to about 6kb, about 6kb to about 12kb, about 6kb to about 1 lkb, about 6kb to about lOkb, about 6kb to about 9kb, about 6kb to about 8kb, about 6kb to about 7kb, about 7kb to about 1 lkb, about 6kb to about lOkb, about 6kb to about 9kb
- the self-replicating RNA molecules of the invention may comprise one or more modified nucleotides (e.g., pseudouridine, N6-methyladenosine, 5-methylcytidine, 5- methyluridine).
- the self-replicating RNA molecule may encode a single polypeptide antigen or, optionally, two or more of polypeptide antigens linked together in a way that each of the sequences retains its identity (e.g., linked in series) when expressed as an amino acid sequence.
- the polypeptides generated from the self-replicating RNA may then be produced as a fusion polypeptide or engineered in such a manner to result in separate polypeptide or peptide sequences.
- the self-replicating RNA of the invention may encode one or more polypeptide antigens that contain a range of epitopes.
- epitopes capable of eliciting either a helper T-cell response or a cytotoxic T-cell response or both.
- the self-replicating RNA molecules described herein may be engineered to express multiple nucleotide sequences, from two or more open reading frames, thereby allowing co-expression of proteins, such as a two or more antigens together with cytokines or other immunomodulators, which can enhance the generation of an immune response.
- proteins such as a two or more antigens together with cytokines or other immunomodulators, which can enhance the generation of an immune response.
- Such a self-replicating RNA molecule might be particularly useful, for example, in the production of various gene products (e.g., proteins) at the same time, for example, as a bivalent or multivalent vaccine.
- the self-replicating RNA molecules of the invention can be prepared using any suitable method. Several suitable methods are known in the art for producing RNA molecules that contain modified nucleotides. For example, a self-replicating RNA molecule that contains modified nucleotides can be prepared by transcribing (e.g., in vitro
- RNA-dependent RNA polymerase such as T7 phage RNA polymerase, SP6 phage RNA polymerase, T3 phage RNA polymerase, and the like, or mutants of these polymerases which allow efficient incorporation of modified nucleotides into RNA molecules.
- the transcription reaction will contain nucleotides and modified nucleotides, and other components that support the activity of the selected polymerase, such as a suitable buffer, and suitable salts.
- nucleotide analogs into a self-replicating RNA may be engineered, for example, to alter the stability of such RNA molecules, to increase resistance against RNases, to establish replication after introduction into appropriate host cells ("infectivity" of the RNA), and/or to induce or reduce innate and adaptive immune responses.
- Suitable synthetic methods can be used alone, or in combination with one or more other methods (e.g., recombinant DNA or RNA technology), to produce a self- replicating RNA molecule of the invention. Suitable methods for de novo synthesis are well- known in the art and can be adapted for particular applications.
- Exemplary methods include, for example, chemical synthesis using suitable protecting groups such as CEM (Masuda et ah, (2007) Nucleic Acids Symposium Series 57:3-4), the ⁇ -cyanoethyl phosphoramidite method (Beaucage S L et ah (1981) Tetrahedron Lett 22: 1859); nucleoside H-phosphonate method (Garegg P et ah (1986) Tetrahedron Lett 27:4051-4; Froehler B C et ah (1986) Nucl Acid Res 14:5399-407; Garegg P et ah (1986) Tetrahedron Lett 27:4055-8; Gaffney B et ah (1988) Tetrahedron Lett 29:2619-22).
- CEM Mesuda et ah, (2007) Nucleic Acids Symposium Series 57:3-4
- ⁇ -cyanoethyl phosphoramidite method Beau
- Nucleic acid synthesis can also be performed using suitable recombinant methods that are well-known and conventional in the art, including cloning, processing, and/or expression of polynucleotides and gene products encoded by such polynucleotides. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic polynucleotides are examples of known techniques that can be used to design and engineer polynucleotide sequences.
- Site-directed mutagenesis can be used to alter nucleic acids and the encoded proteins, for example, to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations and the like. Suitable methods for transcription, translation and expression of nucleic acid sequences are known and conventional in the art. (See generally, Current Protocols in Molecular Biology, Vol. 2, Ed. Ausubel, et ah, Greene Publish. Assoc. & Wiley Interscience, Ch. 13, 1988; Glover, DNA Cloning, Vol. II, IRL Press, Wash., D.C., Ch.
- a self-replicating RNA can be digested to monophosphates (e.g., using nuclease PI) and dephosphorylated (e.g., using a suitable phosphatase such as CIAP), and the resulting nucleosides analyzed by reversed phase HPLC (e.g., usings a YMC Pack ODS-AQ column (5 micron, 4.6 X 250 mm) and elute using a gradient, 30% B (0-5 min) to 100 % B (5 - 13 min) and at 100 % B (13-40) min, flow Rate (0.7 ml/min), UV detection (wavelength: 260 nm), column temperature (30°C). Buffer A (20mM acetic acid - ammonium acetate pH 3.5), buffer B (20mM acetic acid - ammonium a
- the self-replicating RNA molecules of the invention may include one or more modified nucleotides so that the self-replicating RNA molecule will have less immunomodulatory activity upon introduction or entry into a host cell (e.g., a human cell) in comparison to the corresponding self-replicating RNA molecule that does not contain modified nucleotides.
- a host cell e.g., a human cell
- the self-replicating RNA molecules can be screened or analyzed to confirm their therapeutic and prophylactic properties using various in vitro or in vivo testing methods that are known to those of skill in the art.
- vaccines comprising self-replicating RNA molecule can be tested for their effect on induction of proliferation or effector function of the particular lymphocyte type of interest, e.g., B cells, T cells, T cell lines, and T cell clones.
- lymphocyte type of interest e.g., B cells, T cells, T cell lines, and T cell clones.
- spleen cells from immunized mice can be isolated and the capacity of cytotoxic T lymphocytes to lyse autologous target cells that contain a self replicating RNA molecule that encodes a polypeptide antigen.
- T helper cell differentiation can be analyzed by measuring proliferation or production of TH1 (IL-2 and IFN- ⁇ ) and /or TH2 (IL-4 and IL-5) cytokines by ELISA or directly in CD4+ T cells by cytoplasmic cytokine staining and flow cytometry.
- TH1 IL-2 and IFN- ⁇
- TH2 IL-4 and IL-5
- Self-replicating RNA molecules that encode a polypeptide antigen can also be tested for ability to induce humoral immune responses, as evidenced, for example, by induction of B cell production of antibodies specific for an antigen of interest.
- These assays can be conducted using, for example, peripheral B lymphocytes from immunized individuals. Such assay methods are known to those of skill in the art.
- Other assays that can be used to characterize the self-replicating RNA molecules of the invention can involve detecting expression of the encoded antigen by the target cells.
- FACS can be used to detect antigen expression on the cell surface or intracellularly. Another advantage of FACS selection is that one can sort for different levels of expression; sometimes-lower expression may be desired.
- RNA molecules of the present invention can be introduced into target cells or subjects using any suitable technique, e.g., by direct injection, microinjection, electroporation, lipofection, biolystics, and the like.
- the immunogenic composition described herein comprises a polypeptide component and an RNA component.
- the polypeptide component may be a polypeptide complex or a VLP.
- Suitable antigens that can be used as the polypeptide component (the "second polypeptide antigen") of the immunogenic composition include proteins and peptides from any pathogen, such as a bacterial pathogen, a viral pathogen, a fungal pathogen, a protozoan pathogen, or a multi-cellular parasitic pathogen.
- Exemplary antigens include any one of the antigens described above, such as an antigen derived from RSV, HIV, Parvovirus or CMV.
- the composition can contain more than one polypeptide antigen.
- the polypeptide may also be a fusion polypeptide comprising two or more epitopes from two different proteins of the same pathogen, or two or more epitopes from two different pathogens.
- the polypeptide antigen may include additional sequences, such as a sequence to facilitate purification or detection (e.g., a poly-His sequence).
- polypeptide antigen will usually be isolated or purified. Thus, they will not be associated with molecules with which they are normally, if applicable, found in nature.
- Polypeptides will usually be prepared by expression in a recombinant host system. Generally, they are produced by expression of recombinant constructs that encode the ecto-domains in suitable recombinant host cells, although any suitable method can be used.
- Suitable recombinant host cells include, for example, insect cells (e.g., Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni), mammalian cells (e.g., human, non-human primate, horse, cow, sheep, dog, cat, and rodent (e.g., hamster), avian cells (e.g., chicken, duck, and geese), bacteria (e.g., E.
- insect cells e.g., Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni
- mammalian cells e.g., human, non-human primate, horse, cow, sheep, dog, cat, and rodent (e.g., ham
- yeast cells e.g., Saccharomyces cerevisiae, Candida albicans, Candida maltosa, Hansenual poiymorpha, Kluyveromyces fragiiis, Kluyveromyces lactis, Pichia guiiierimondii, Pichia pastoris, Schizosaccharomyces pombe and Yarrowia Upolytica
- Tetrahymena cells e.g., Tetrahymena thermophila
- Many suitable insect cells and mammalian cells are well-known in the art.
- Suitable insect cells include, for example, Sf9 cells, Sf21 cells, Tn5 cells, Schneider S2 cells, and High Five cells (a clonal isolate derived from the parental Trichoplusia ni BTI-TN-5B1-4 cell line (Invitrogen)).
- Suitable mammalian cells include, for example, Chinese hamster ovary (CHO) cells, human embryonic kidney cells (HEK293 cells, typically transformed by sheared adenovirus type 5 DNA), NIH-3T3 cells, 293-T cells, Vero cells, HeLa cells, PERC.6 cells (ECACC deposit number 96022940), Hep G2 cells, MRC-5 (ATCC CCL-171), WI-38 (ATCC CCL-75), fetal rhesus lung cells (ATCC CL-160), Madin-Darby bovine kidney (“MDBK”) cells, Madin-Darby canine kidney (“MDCK”) cells (e.g., MDCK (NBL2), ATCC CCL34; or MDCK 33016, DSM ACC 2219), baby hamster kidney (BHK) cells, such as BHK21 -F, HKCC cells, and the like.
- CHO Chinese hamster ovary
- HEK293 cells human embryonic kidney cells
- Suitable avian cells include, for example, chicken embryonic stem cells (e.g., EBx® cells), chicken embryonic fibroblasts, chicken embryonic germ cells, duck cells (e.g., AGE1.CR and AGEl.CR.pIX cell lines (ProBioGen) which are described, for example, in Vaccine 27:4975-4982 (2009) and WO2005/042728), EB66 cells, and the like.
- chicken embryonic stem cells e.g., EBx® cells
- chicken embryonic fibroblasts e.g., chicken embryonic germ cells
- duck cells e.g., AGE1.CR and AGEl.CR.pIX cell lines (ProBioGen) which are described, for example, in Vaccine 27:4975-4982 (2009) and WO2005/042728
- EB66 cells e.g., EB66 cells, and the like.
- Suitable insect cell expression systems such as baculovirus systems, are known to those of skill in the art and described in, e.g., Summers and Smith, Texas
- baculovirus/insect cell expression systems are commercially available in kit form from, inter alia, Invitrogen, San Diego CA.
- Avian cell expression systems are also known to those of skill in the art and described in, e.g., U.S. Patent Nos. 5,340,740; 5,656,479; 5,830,510; 6, 114, 168; and 6,500,668; European Patent No. EP 0787180B; European Patent Application No. EP03291813.8 ;WO 03/043415; and WO 03/076601.
- bacterial and mammalian cell expression systems are also known in the art and described in, e.g., Yeast Genetic Engineering (Barr et al, eds., 1989) Butterworths, London.
- Recombinant constructs encoding a polypeptide can be prepared in suitable vectors using conventional methods.
- a number of suitable vectors for expression of recombinant proteins in insect or mammalian cells are well-known and conventional in the art.
- Suitable vectors can contain a number of components, including, but not limited to one or more of the following: an origin of replication; a selectable marker gene; one or more expression control elements, such as a transcriptional control element (e.g., a promoter, an enhancer, a terminator), and/or one or more translation signals; and a signal sequence or leader sequence for targeting to the secretory pathway in a selected host cell (e.g., of mammalian origin or from a heterologous mammalian or non-mammalian species).
- a transcriptional control element e.g., a promoter, an enhancer, a terminator
- a signal sequence or leader sequence for targeting to the secretory pathway in a selected host cell (e.g.,
- baculovirus expression vector such as pFastBac (Invitrogen)
- pFastBac Invitrogen
- the baculovirus particles are amplified and used to infect insect cells to express recombinant protein.
- a vector that will drive expression of the construct in the desired mammalian host cell e.g., Chinese hamster ovary cells
- Polypeptides can be purified using any suitable methods. For example, methods for purifying polypeptides by immunoaffinity chromatography are known in the art. Ruiz-Arguello et al, J. Gen. Virol, 55:3677-3687 (2004). Suitable methods for purifying desired proteins including precipitation and various types of chromatography, such as hydrophobic interaction, ion exchange, affinity, chelating and size exclusion are well-known in the art. Suitable purification schemes can be created using two or more of these or other suitable methods. If desired, the polypeptides can include a "tag" that facilitates purification, such as an epitope tag or a HIS tag. Such tagged polypeptides can conveniently be purified, for example from conditioned media, by chelating chromatography or affinity
- RNA component In addition to the protein compontent and the RNA component, additional components, such as lipids, polymers or other compounds may be optionally included in the immunogenic composition as described herein to facilitate the entry of RNA into target cells.
- additional components such as lipids, polymers or other compounds may be optionally included in the immunogenic composition as described herein to facilitate the entry of RNA into target cells.
- RNA can be delivered as naked RNA (e.g. merely as an aqueous solution of RNA), to enhance entry into cells and also subsequent intercellular effects, the RNA molecule is preferably administered in combination with a delivery system, such as a particulate or emulsion delivery system.
- a delivery system such as a particulate or emulsion delivery system.
- a large number of delivery systems are well known to those of skill in the art.
- the RNA molecule may be introduced into cells by way of receptor-mediated endocytosis. See e.g., U.S. Pat. No. 6,090,619; Wu and Wu, J. Biol.
- U.S. Pat. No. 6,083,741 discloses introducing an exogenous nucleic acid into mammalian cells by associating the nucleic acid to a polycation moiety (e.g., poly-L-lysine having 3-100 lysine residues), which is itself coupled to an integrin receptor-binding moiety (e.g., a cyclic peptide having the sequence Arg-Gly-Asp).
- a polycation moiety e.g., poly-L-lysine having 3-100 lysine residues
- an integrin receptor-binding moiety e.g., a cyclic peptide having the sequence Arg-Gly-Asp.
- RNA molecule of the present invention can be delivered into cells via amphiphiles. See e.g., U.S. Pat. No. 6,071,890.
- a nucleic acid molecule may form a complex with the cationic amphiphile. Mammalian cells contacted with the complex can readily take it up.
- Three particularly useful delivery systems are (i) liposomes (ii) non-toxic and biodegradable polymer microparticles (iii) cationic submicron oil-in- water emulsions.
- RNA-containing aqueous core can have an anionic, cationic or zwitterionic hydrophilic head group. Formation of liposomes from anionic phospholipids dates back to the 1960s, and cationic liposome- forming lipids have been studied since the 1990s. Some phospholipids are anionic whereas other are zwitterionic.
- Suitable classes of phospholipid include, but are not limited to, phosphatidylethanolamines, phosphatidylcholines, phosphatidylserines, and phosphatidylglycerols, and some useful phospholipids are listed in Table 2.
- Useful cationic lipids include, but are not limited to, dioleoyl trimethylammonium propane (DOTAP), l,2-distearyloxy-N,N-dimethyl-3- aminopropane (DSDMA), l,2-dioleyloxy-N,Ndimethyl-3-aminopropane (DODMA), 1,2- dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA), l,2-dilinolenyloxy-N,N-dimethyl- 3-aminopropane (DLenDMA).
- DOTAP dioleoyl trimethylammonium propane
- DSDMA distearyloxy-N,N-dimethyl-3- aminopropane
- DODMA l,2-dioleyloxy-N,Ndimethyl-3-aminopropane
- DLinDMA 1,2- dilinoleyloxy-N,N-di
- Zwitterionic lipids include, but are not limited to, acyl zwitterionic lipids and ether zwitterionic lipids.
- Examples of useful zwitterionic lipids are DPPC, DOPC and dodecylphosphocholine.
- the lipids can be saturated or unsaturated.
- Liposomes can be formed from a single lipid or from a mixture of lipids.
- a mixture may comprise (i) a mixture of anionic lipids (ii) a mixture of cationic lipids (iii) a mixture of zwitterionic lipids (iv) a mixture of anionic lipids and cationic lipids (v) a mixture of anionic lipids and zwitterionic lipids (vi) a mixture of zwitterionic lipids and cationic lipids or (vii) a mixture of anionic lipids, cationic lipids and zwitterionic lipids.
- a mixture may comprise both saturated and unsaturated lipids.
- a mixture may comprise DSPC (zwitterionic, saturated), DlinDMA (cationic, unsaturated), and/or DMPG (anionic, saturated).
- DSPC zwitterionic, saturated
- DlinDMA cationic, unsaturated
- DMPG anionic, saturated
- the hydrophilic portion of a lipid can be PEGylated (i.e. modified by covalent attachment of a polyethylene glycol). This modification can increase stability and prevent non-specific adsorption of the liposomes.
- lipids can be conjugated to PEG using techniques such as those disclosed in Heyes et al. (2005) J Controlled Release 107:276-87..
- a mixture of DSPC, DlinDMA, PEG-DMPG and cholesterol is used in the examples.
- a separate aspect of the invention is a liposome comprising DSPC, DlinDMA, PEG-DMG and cholesterol.
- This liposome preferably encapsulates RNA, such as a self- replicating RNA e.g. encoding an immunogen.
- Liposomes are usually divided into three groups: multilamellar vesicles (MLV); small unilamellar vesicles (SUV); and large unilamellar vesicles (LUV).
- MLVs have multiple bilayers in each vesicle, forming several separate aqueous compartments.
- SUVs and LUVs have a single bilayer encapsulating an aqueous core; SUVs typically have a diameter ⁇ 50nm, and LUVs have a diameter >50nm.
- Liposomes useful with of the invention are ideally LUVs with a diameter in the range of 50-220nm.
- compositions comprising a population of LUVs with different diameters: (i) at least 80% by number should have diameters in the range of 20-220nm, (ii) the average diameter (Zav, by intensity) of the population is ideally in the range of 40-200nm, and/or (iii) the diameters should have a polydispersity index ⁇ 0.2.
- Liposomes Methods and Protocols, Volume 1 : Pharmaceutical Nanocarriers: Methods and Protocols, (ed. Weissig). Humana Press, 2009. ISBN 160327359X; Liposome
- One useful method involves mixing (i) an ethanolic solution of the lipids (ii) an aqueous solution of the nucleic acid and (iii) buffer, followed by mixing, equilibration, dilution and purification (Heyes et al. (2005) J Controlled Release 107:276-87.).
- RNA is preferably encapsulated within the liposomes, and so the liposome forms a outer layer around an aqueous RNA-containing core. This encapsulation has been found to protect RNA from RNase digestion.
- the liposomes can include some external RNA (e.g. on the surface of the liposomes), but at least half of the RNA (and ideally all of it) is encapsulated.
- RNA molecules can form microparticles to encapsulate or adsorb RNA.
- the use of a substantially non-toxic polymer means that a recipient can safely receive the particles, and the use of a biodegradable polymer means that the particles can be metabolised after delivery to avoid long-term persistence.
- Useful polymers are also sterilisable, to assist in preparing pharmaceutical grade formulations.
- Suitable non-toxic and biodegradable polymers include, but are not limited to, poly(a-hydroxy acids), polyhydroxy butyric acids, polylactones (including
- polycaprolactones polydioxanones, polyvalerolactone, polyorthoesters, polyanhydrides, polycyanoacrylates, tyrosine-derived polycarbonates, polyvinyl-pyrrolidinones or polyester- amides, and combinations thereof.
- the microparticles are formed from poly(a-hydroxy acids), such as a poly(lactides) (“PLA”), copolymers of lactide and glycolide such as a poly(D,L-lactide-co-glycolide) (“PLG”), and copolymers of D,L-lactide and caprolactone.
- PLG polymers include those having a lactide/glycolide molar ratio ranging, for example, from 20:80 to 80:20 e.g. 25:75, 40:60, 45:55, 55:45, 60:40, 75:25.
- Useful PLG polymers include those having a molecular weight between, for example, 5,000-200,000 Da e.g. between 10,000-100,000, 20,000-70,000, 40,000-50,000 Da.
- the microparticles ideally have a diameter in the range of 0.02 ⁇ to 8 ⁇ .
- a composition comprising a population of microparticles with different diameters at least 80% by number should have diameters in the range of 0.03-7 ⁇ .
- microparticles Techniques for preparing suitable microparticles are well known in the art e.g. see Functional Polymer Colloids and Microparticles volume 4 (Microspheres, microcapsules & liposomes), (eds. Arshady & Guyot). Citus Books, 2002; Polymers in Drug Delivery, (eds. Uchegbu & Schatzlein). CRC Press, 2006. (in particular chapter 7) and Microparticulate Systems for the Delivery of Proteins and Vaccines, (eds. Cohen &
- a microparticle may include a cationic surfactant and/or lipid e.g. as disclosed in O'Hagan et al. (2001) J Virology! 5:9037- 9043; and Singh et al. (2003) Pharmaceutical Research 20: 247-251.
- An alternative way of making polymeric microparticles is by molding and curing e.g. as disclosed in
- Microparticles of the invention can have a zeta potential of between 40-100 mV.
- RNA can be adsorbed to the microparticles, and adsorption is facilitated by including cationic materials (e.g. cationic lipids) in the microparticle.
- Oil-in-water emulsions are known for adjuvanting influenza vaccines e.g. the MF59TM adjuvant in the FLUADTM product, and the AS03 adjuvant in the
- RNA delivery according to the present invention can utilise an oil-in-water emulsion, provided that the emulsion includes one or more cationic molecules.
- a cationic lipid can be included in the emulsion to provide a positive droplet surface to which negatively-charged RNA can attach.
- the emulsion comprises one or more oils.
- Suitable oil(s) include those from, for example, an animal (such as fish) or a vegetable source.
- the oil is ideally biodegradable (metabolisable) and biocompatible.
- Sources for vegetable oils include nuts, seeds and grains. Peanut oil, soybean oil, coconut oil, and olive oil, the most commonly available, exemplify the nut oils.
- Jojoba oil can be used e.g. obtained from the jojoba bean.
- Seed oils include safflower oil, cottonseed oil, sunflower seed oil, sesame seed oil and the like.
- corn oil is the most readily available, but the oil of other cereal grains such as wheat, oats, rye, rice, teff, triticale and the like may also be used.
- 6-10 carbon fatty acid esters of glycerol and 1,2-propanediol, while not occurring naturally in seed oils, may be prepared by hydrolysis, separation and esterification of the appropriate materials starting from the nut and seed oils. Fats and oils from mammalian milk are metabolizable and so may be used. The procedures for separation, purification, saponification and other means necessary for obtaining pure oils from animal sources are well known in the art.
- cod liver oil cod liver oil
- shark liver oils and whale oil such as spermaceti exemplify several of the fish oils which may be used herein.
- a number of branched chain oils are synthesized biochemically in 5-carbon isoprene units and are generally referred to as terpenoids.
- Squalene can also be obtained from yeast or other suitable microbes. In some embodiments, Squalene is preferably obtained from non-animal sources, such as from olives, olive oil or yeast. Squalane, the saturated analog to squalene, can also be used. Fish oils, including squalene and squalane, are readily available from commercial sources or may be obtained by methods known in the art. [00152] Other useful oils are the tocopherols, particularly in combination with squalene. Where the oil phase of an emulsion includes a tocopherol, any of the ⁇ , ⁇ , ⁇ , ⁇ , ⁇ or ⁇ tocopherols can be used, but a-tocopherols are preferred. D-a-tocopherol and
- DL-a-tocopherol can both be used.
- a preferred a-tocopherol is DL-a-tocopherol.
- An oil combination comprising squalene and a tocopherol (e.g. DL-a-tocopherol) can be used.
- the oil in the emulsion may comprise a combination of oils e.g. squalene and at least one further oil.
- the aqueous component of the emulsion can be plain water (e.g. w.f.i.) or can include further components e.g. solutes. For instance, it may include salts to form a buffer e.g. citrate or phosphate salts, such as sodium salts.
- Typical buffers include: a phosphate buffer; a Tris buffer; a borate buffer; a succinate buffer; a histidine buffer; or a citrate buffer.
- a buffered aqueous phase is preferred, and buffers will typically be included in the 5-20mM range.
- the emulsion also includes a cationic lipid.
- this lipid is a surfactant so that it can facilitate formation and stabilisation of the emulsion.
- Useful cationic lipids generally contains a nitrogen atom that is positively charged under physiological conditions e.g. as a tertiary or quaternary amine. This nitrogen can be in the hydrophilic head group of an amphiphilic surfactant.
- Useful cationic lipids include, but are not limited to: 1,2- dioleoyloxy-3-(trimethylammonio)propane (DOTAP), 3'-[N-(N',N'-Dimethylaminoethane)- carbamoyl] Cholesterol (DC Cholesterol), dimethyldioctadecyl-ammonium (DDA e.g. the bromide), l,2-Dimyristoyl-3-Trimethyl-AmmoniumPropane (DMTAP),
- DOTAP 1,2- dioleoyloxy-3-(trimethylammonio)propane
- DC Cholesterol 3'-[N-(N',N'-Dimethylaminoethane)- carbamoyl] Cholesterol
- DDA dimethyldioctadecyl-ammonium
- DMTAP l,2-Dimyristoyl-3-Trimethyl-AmmoniumPropane
- Other useful cationic lipids are: benzalkonium chloride (BAK), benzethonium chloride, cetramide (which contains tetradecyltrimethylammonium bromide and possibly small amounts of dedecyltrimethylammonium bromide and hexadecyltrimethyl ammonium bromide), cetylpyridinium chloride (CPC), cetyl trimethylammonium chloride (CTAC), ⁇ , ⁇ ', ⁇ '-polyoxyethylene (10)-N-tallow-l,3 -diaminopropane,
- BAK benzalkonium chloride
- cetramide which contains tetradecyltrimethylammonium bromide and possibly small amounts of dedecyltrimethylammonium bromide and hexadecyltrimethyl ammonium
- dodecyltrimethylammonium bromide dodecyltrimethylammonium bromide, hexadecyltrimethyl-ammonium bromide, mixed alkyl- trimethyl-ammonium bromide, benzyldimethyldodecylammonium chloride, benzyldimethylhexadecyl-ammonium chloride, benzyltrimethylammonium methoxide, cetyldimethylethylammonium bromide, dimethyldioctadecyl ammonium bromide (DDAB), methylbenzethonium chloride, decamethonium chloride, methyl mixed trialkyl ammonium chloride, methyl trioctylammonium chloride), N,N-dimethyl-N-[2 (2-methyl-4- (1,1,3,3 tetramethy lbuty 1)- phenoxy ] -ethoxy)ethy 1] -benzenemet
- acyl group dimyristoyl, dipalmitoyl, distearoyl, dioleoyl), 1,2- dioleoyl-3-(4'-trimethyl- ammonio)butanoyl-sn-glycerol, 1,2-dioleoyl 3-succinyl-sn-glycerol choline ester, cholesteryl (4'-trimethylammonio) butanoate), N-alkyl pyridinium salts (e.g.
- cetylpyridinium bromide and cetylpyridinium chloride N-alkylpiperidinium salts, dicationic bolaform electrolytes (C12Me6; C12BU6), dialkylglycetylphosphorylcholine, lysolecithin, L- ⁇ dioleoylphosphatidylethanolamine, cholesterol hemisuccinate choline ester, lipopolyamines, including but not limited to dioctadecylamidoglycylspermine (DOGS), dipalmitoyl phosphatidylethanol-amidospermine (DPPES), lipopoly-L (or D)- lysine (LPLL, LPDL), poly (L (or D)-lysine conjugated to N- glutarylphosphatidylethanolamine, didodecyl glutamate ester with pendant amino group (C A GluPhCn ), ditetradecyl glutamate ester with pendant amino group (C14
- the cationic lipid is preferably biodegradable (metabolisable) and biocompatible.
- an emulsion can include a non-ionic surfactant and/or a zwitterionic surfactant.
- surfactants include, but are not limited to: the polyoxyethylene sorbitan esters surfactants (commonly referred to as the Tweens), especially polysorbate 20 and polysorbate 80; copolymers of ethylene oxide (EO), propylene oxide (PO), and/or butylene oxide (BO), sold under the DOWFAXTM tradename, such as linear EO/PO block copolymers; octoxynols, which can vary in the number of repeating ethoxy (oxy-l,2-ethanediyl) groups, with octoxynol-9 (Triton X-100, or t-octylphenoxypolyethoxyethanol) being of particular interest;
- octylphenoxy polyethoxyethanol
- phospholipids such as phosphatidylcholine (lecithin); polyoxyethylene fatty ethers derived from lauryl, cetyl, stearyl and oleyl alcohols (known as Brij surfactants), such as triethyleneglycol monolauryl ether (Brij 30); polyoxyethylene-9-lauryl ether; and sorbitan esters (commonly known as the Spans), such as sorbitan trioleate (Span 85) and sorbitan monolaurate.
- Preferred surfactants for including in the emulsion are polysorbate 80 (Tween 80; polyoxyethylene sorbitan monooleate), Span 85 (sorbitan trioleate), lecithin and Triton X-100.
- Mixtures of these surfactants can be included in the emulsion e.g. Tween 80/Span 85 mixtures, or Tween 80/Triton-X100 mixtures.
- Tween 80/Span 85 mixtures or Tween 80/Triton-X100 mixtures.
- Tween 80/Triton-X100 mixtures A combination of a
- polyoxyethylene sorbitan ester such as polyoxyethylene sorbitan monooleate (Tween 80) and an octoxynol such as t-octylphenoxy -poly ethoxy ethanol (Triton X-100) is also suitable.
- Another useful combination comprises laureth 9 plus a polyoxyethylene sorbitan ester and/or an octoxynol.
- Useful mixtures can comprise a surfactant with a HLB value in the range of 10- 20 (e.g. polysorbate 80, with a HLB of 15.0) and a surfactant with a HLB value in the range of 1-10 (e.g. sorbitan trioleate, with a HLB of 1.8).
- Preferred amounts of oil (% by volume) in the final emulsion are between 2-20% e.g. 5-15%, 6-14%, 7-13%, 8-12%.
- a squalene content of about 4-6% or about 9-11% is particularly useful.
- Preferred amounts of surfactants (% by weight) in the final emulsion are between 0.001% and 8%.
- polyoxyethylene sorbitan esters such as polysorbate 80
- polysorbate 80 0.2 to 4%, in particular between 0.4-0.6%, between 0.45-0.55%, about 0.5% or between 1.5-2%, between 1.8-2.2%, between 1.9-2.1%, about 2%, or 0.85-0.95%, or about 1%;
- sorbitan esters such as sorbitan trioleate 0.02 to 2%, in particular about 0.5% or about 1%
- octyl- or nonylphenoxy polyoxyethanols such as Triton X-100
- polyoxyethylene ethers such as laureth 9) 0.1 to 8%, preferably 0.1 to 10% and in particular 0.1 to 1% or about 0.5%.
- the most effective emulsions have a droplet size in the submicron range.
- the droplet sizes will be in the range 50-750nm.
- the average droplet size is less than 250nm e.g. less than 200nm, less than 150nm.
- the average droplet size is usefully in the range of 80-180nm.
- at least 80% (by number) of the emulsion's oil droplets are less than 250 nm in diameter, and preferably at least 90%.
- Apparatuses for determining the average droplet size in an emulsion, and the size distribution are commercially available. These these typically use the techniques of dynamic light scattering and/or single-particle optical sensing e.g. the AccusizerTM and NicompTM series of instruments available from Particle Sizing Systems (Santa Barbara, USA), or the ZetasizerTM instruments from Malvern Instruments (UK), or the Particle Size Distribution Analyzer instruments from Horiba (Kyoto, Japan).
- the distribution of droplet sizes has only one maximum i.e. there is a single population of droplets distributed around an average (mode), rather than having two maxima.
- Preferred emulsions have a polydispersity of ⁇ 0.4 e.g. 0.3, 0.2, or less.
- Suitable emulsions with submicron droplets and a narrow size distribution can be obtained by the use of microfluidisation.
- This technique reduces average oil droplet size by propelling streams of input components through geometrically fixed channels at high pressure and high velocity. These streams contact channel walls, chamber walls and each other. The results shear, impact and cavitation forces cause a reduction in droplet size.
- thermal methods can be used to cause phase inversion. These methods can also provide a submicron emulsion with a tight particle size distribution.
- Preferred emulsions can be filter sterilised i.e. their droplets can pass through a 220nm filter. As well as providing a sterilisation, this procedure also removes any large droplets in the emulsion.
- the cationic lipid in the emulsion is DOTAP.
- the cationic oil-in-water emulsion may comprise from about 0.5 mg/ml to about 25 mg/ml DOTAP.
- the cationic oil-in-water emulsion may comprise DOTAP at from about 0.5 mg/ml to about 25 mg/ml, from about 0.6 mg/ml to about 25 mg/ml, from about 0.7 mg/ml to about 25 mg/ml, from about 0.8 mg/ml to about 25 mg/ml, from about 0.9 mg/ml to about 25 mg/ml, from about 1.0 mg/ml to about 25 mg/ml, from about 1.1 mg/ml to about 25 mg/ml, from about 1.2 mg/ml to about 25 mg/ml, from about 1.3 mg/ml to about 25 mg/ml, from about 1.4 mg/ml to about 25 mg/ml, from about 1.5 mg/ml to about 25 mg/ml, from about 1.6 mg/ml to about 25 mg/ml, from about 1.7 mg/ml to about 25 mg/ml, from about 0.5 mg/ml to about 24 mg/ml, from about 0.5 mg/ml to about
- the cationic oil-in- water emulsion comprises from about 0.8 mg/ml to about 1.6 mg/ml DOTAP, such as 0.8 mg/ml, 1.2 mg/ml, 1.4 mg/ml or 1.6 mg/ml.
- the cationic lipid is DC Cholesterol.
- the cationic oil-in-water emulsion may comprise DC Cholesterol at from about 0.1 mg/ml to about 5 mg/ml DC Cholesterol.
- the cationic oil-in-water emulsion may comprise DC Cholesterol from about 0.1 mg/ml to about 5 mg/ml, from about 0.2 mg/ml to about 5 mg/ml, from about 0.3 mg/ml to about 5 mg/ml, from about 0.4 mg/ml to about 5 mg/ml, from about 0.5 mg/ml to about 5 mg/ml, from about 0.62 mg/ml to about 5 mg/ml, from about 1 mg/ml to about 5 mg/ml, from about 1.5 mg/ml to about 5 mg/ml, from about 2 mg/ml to about 5 mg/ml, from about 2.46 mg/ml to about 5 mg/ml, from about 3 mg/ml to about 5 mg/ml, from about 3.5 mg/ml to about 5 mg/ml, from about 4 mg/ml to about 5 mg/ml, from about 4.5 mg/ml to about 5 mg/ml, from about 0.1 mg/ml to about 4.92 mg
- the cationic lipid is DDA.
- the cationic oil-in- water emulsion may comprise from about 0.1 mg/ml to about 5 mg/ml DDA.
- the cationic oil-in-water emulsion may comprise DDA at from about 0.1 mg/ml to about 5 mg/ml, from about 0.1 mg/ml to about 4.5 mg/ml, from about 0.1 mg/ml to about 4 mg/ml, from about 0.1 mg/ml to about 3.5 mg/ml, from about 0.1 mg/ml to about 3 mg/ml, from about 0.1 mg/ml to about 2.5 mg/ml, from about 0.1 mg/ml to about 2 mg/ml, from about 0.1 mg/ml to about 1.5 mg/ml, from about 0.1 mg/ml to about 1.45 mg/ml, from about 0.2 mg/ml to about 5 mg/ml, from about 0.3 mg/ml to about 5 mg/ml, from about
- the cationic oil-in-water emulsion may comprise DDA at about 20 mg/ml, about 21 mg/ml, about 21.5 mg/ml, about 21.6 mg/ml, about 25 mg/ml.
- the cationic oil-in- water emulsion comprises from about 0.73 mg/ml to about 1.45 mg/ml DDA, such as 1.45 mg/ml.
- RNA molecules of the invention can also be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by re-implantation of the cells into a patient, usually after selection for cells which have been transfected with the RNA molecule.
- cells ex vivo such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by re-implantation of the cells into a patient, usually after selection for cells which have been transfected with the RNA molecule.
- the appropriate amount of cells to deliver to a patient will vary with patient conditions, and desired effect, which can be determined by a skilled artisan. See e.g., U.S. Pat. Nos. 6,054,288; 6,048,524; and 6,048,729.
- the cells used are autologous,
- the immunogenic compositions provided herein include or optionally include one or more immunoregulatory agents such as adjuvants.
- Exemplary adjuvants include, but are not limited to, a THl adjuvant and/or a TH2 adjuvant, further discussed below.
- the adjuvants used in the immunogenic compositions include, but are not limited to:
- PCPP Polyphosphazene
- Immunostimulatory polynucleotide such as RNA or DNA; e.g., CpG-containing oligonucleotides
- Mineral containing compositions suitable for use as adjuvants include mineral salts, such as aluminum salts and calcium salts.
- the immunogenic composition may include mineral salts such as hydroxides (e.g., oxyhydroxides), phosphates (e.g., hydroxyphosphates, orthophosphates), sulfates, etc. (see, e.g., VACCINE DESIGN: THE SUBUNIT AND ADJUVANT APPROACH (Powell, M.F. and Newman, MJ. eds.) (New York: Plenum Press) 1995, Chapters 8 and 9), or mixtures of different mineral compounds (e.g.
- the mineral containing compositions may also be formulated as a particle of metal salt (WO 00/23105).
- Aluminum salts may be included in vaccines of the invention such that the dose of Al 3+ is between 0.2 and 1.0 mg per dose.
- the aluminum based adjuvant is alum (aluminum potassium sulfate (A1K(S0 4 ) 2 ), or an alum derivative, such as that formed in-situ by mixing an antigen in phosphate buffer with alum, followed by titration and precipitation with a base such as ammonium hydroxide or sodium hydroxide.
- Aluminum-based adjuvant suitable for use in vaccine formulations is aluminum hydroxide adjuvant (Al(OH) 3 ) or crystalline aluminum oxyhydroxide (AIOOH), which is an excellent adsorbant, having a surface area of approximately 500m 2 /g.
- the aluminum based adjuvant can be aluminum phosphate adjuvant (A1P0 4 ) or aluminum hydroxyphosphate, which contains phosphate groups in place of some or all of the hydroxyl groups of aluminum hydroxide adjuvant.
- A1P0 4 aluminum phosphate adjuvant
- aluminum hydroxyphosphate which contains phosphate groups in place of some or all of the hydroxyl groups of aluminum hydroxide adjuvant.
- Preferred aluminum phosphate adjuvants provided herein are amorphous and soluble in acidic, basic and neutral media.
- the adjuvant comprises both aluminum phosphate and aluminum hydroxide.
- the adjuvant has a greater amount of aluminum phosphate than aluminum hydroxide, such as a ratio of 2: 1, 3 : 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1 or greater than 9: 1, by weight aluminum phosphate to aluminum hydroxide.
- aluminum salts in the vaccine are present at 0.4 to 1.0 mg per vaccine dose, or 0.4 to 0.8 mg per vaccine dose, or 0.5 to 0.7 mg per vaccine dose, or about 0.6 mg per vaccine dose.
- the preferred aluminum-based adjuvant(s), or ratio of multiple aluminum-based adjuvants, such as aluminum phosphate to aluminum hydroxide is selected by optimization of electrostatic attraction between molecules such that the antigen carries an opposite charge as the adjuvant at the desired pH.
- pretreatment of aluminum hydroxide with phosphate lowers its isoelectric point, making it a preferred adjuvant for more basic antigens.
- Oil-emulsion compositions and formulations suitable for use as adjuvants include squalene-water emulsions, such as MF59 (5%
- Particularly preferred oil-emulsion adjuvants for use in the compositions are submicron oil-in-water emulsions.
- Preferred submicron oil-in-water emulsions for use herein are squalene/water emulsions optionally containing varying amounts of MTP-PE, such as a submicron oil-in-water emulsion containing 4-5% w/v squalene, 0.25-1.0% w/v Tween 80TM (polyoxyethylenesorbitan monooleate), and/or 0.25-1.0% Span 85TM (sorbitan trioleate), and, optionally, N-acetylmuramyl-L-alanyl-D-isogluatminyl-L-alanine-2-(r-2'- dipalmitoyl- SM-glycero-3 -huydroxyphosphophoryloxy)-ethylamine (MTP-PE), for example, the submicron oil-in-water
- MF59 contains 4-5% w/v Squalene (e.g. 4.3%), 0.25- 0.5% w/v Tween 80TM, and 0.5% w/v Span 85TM and optionally contains various amounts of MTP-PE, formulated into submicron particles using a microfluidizer such as Model 11 OY microfluidizer
- MTP-PE may be present in an amount of about 0-500 ⁇ g/dose, more preferably 0-250 ⁇ g/dose and most preferably, 0-100 ⁇ g/dose.
- MF59-0 refers to the above submicron oil-in-water emulsion lacking MTP- PE
- MF59-MTP denotes a formulation that contains MTP-PE.
- MF59-100 contains 100 ⁇ g MTP-PE per dose, and so on.
- MF69 another submicron oil-in- water emulsion for use herein, contains 4.3% w/v squalene, 0.25% w/v Tween 80TM, and 0.75% w/v Span 85TM and optionally MTP-PE.
- MF75 also known as SAF, containing 10% squalene, 0.4% Tween 80TM, 5% pluronic - blocked polymer L121, and thr-MDP, also microfluidized into a submicron emulsion.
- MF75- MTP denotes an MF75 formulation that includes MTP, such as from 100-400 ⁇ g MTP-PE per dose.
- CFA Complete Freund's adjuvant
- IF A incomplete Freund's adjuvant
- Saponins are a heterologous group of sterol glycosides and triterpenoid glycosides that are found in the bark, leaves, stems, roots and even flowers of a wide range of plant species. Saponins isolated from the bark of the Quillaia saponaria Molina tree have been widely studied as adjuvants. Saponins can also be commercially obtained from Smilax ornata (sarsaprilla), Gypsophilla paniculata (brides veil), and Saponaria officianalis (soap root). Saponin adjuvant formulations include purified formulations, such as QS21, as well as lipid formulations, such as ISCOMs. Saponin adjuvant formulations include STIMULON ® adjuvant (Antigenics, Inc., Lexington, MA).
- the saponin is QS21.
- a method of production of QS21 is disclosed in U.S. Patent No. 5,057,540.
- Saponin formulations may also comprise a sterol, such as cholesterol (see WO 96/33739).
- Saponin formulations may include sterols, cholesterols and lipid formulations. Combinations of saponins and cholesterols can be used to form unique particles called Immunostimulating Complexes (ISCOMs). ISCOMs typically also include a phospholipid such as phosphatidylethanolamine or phosphatidylcholine. Any known saponin can be used in ISCOMs. Preferably, the ISCOM includes one or more of Quil A, QHA and QHC. ISCOMs are further described in EP 0 109 942, WO 96/1 1711 and WO 96/33739. Optionally, the ISCOMS may be devoid of (an) additional detergent(s). See WO 00/07621.
- Virosomes and Virus Like Particles generally contain one or more proteins from a virus optionally combined or formulated with a phospholipid. They are generally non-pathogenic, non-replicating and generally do not contain any of the native viral genome. The viral proteins may be recombinantly produced or isolated from whole viruses.
- viral proteins suitable for use in virosomes or VLPs include proteins derived from influenza virus (such as HA or NA), Hepatitis B virus (such as core or capsid proteins), Hepatitis E virus, measles virus, Sindbis virus, Rotavirus, Foot-and-Mouth Disease virus, Retrovirus, Norwalk virus, human Papilloma virus, HIV, RNA-phages, Q -phage (such as coat proteins), GA-phage, fr-phage, AP205 phage, and Ty (such as retrotransposon Ty protein pi).
- influenza virus such as HA or NA
- Hepatitis B virus such as core or capsid proteins
- Hepatitis E virus measles virus
- Sindbis virus Rotavirus
- Foot-and-Mouth Disease virus Retrovirus
- Norwalk virus Norwalk virus
- human Papilloma virus HIV
- RNA-phages Q -phage (such as coat proteins)
- Immunopotentiating reconstituted influenza virosomes are used as the subunit antigen delivery system in the intranasal trivalent TNFLEXALTM product (Mischler and Metcalfe (2002) VACCINE 20 Suppl 5:B17-B23) and the TNFLUVAC PLUSTM product.
- Bacterial or microbial derivatives suitable for use as adjuvants include, but are not limited to:
- Non-toxic derivatives of enterobacterial lipopolysaccharide include Monophosphoryl lipid A (MPL) and 3-O-deacylated MPL (3dMPL).
- MPL Monophosphoryl lipid A
- 3dMPL 3-O-deacylated MPL
- 3dMPL is a mixture of 3 De-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains.
- a preferred "small particle” form of 3 De-O-acylated monophosphoryl lipid A is disclosed in EP 0 689 454.
- Such "small particles" of 3dMPL are small enough to be sterile filtered through a 0.22 micron membrane (see EP 0 689 454).
- LPS derivatives include monophosphoryl lipid A mimics, such as aminoalkyl glucosaminide phosphate derivatives, e.g., RC-529. See Johnson et al. (1999) Bioorg. Med. Chem. Lett. 9:2273-2278.
- Lipid A derivatives include derivatives of lipid A from Escherichia coli such as OM- 174.
- OM- 174 is described for example in Meraldi et al. (2003) Vaccine 21 :2485-2491; and Pajak et al. (2003) Vaccine 21 :836-842.
- Another exemplary adjuvant is the synthetic phospholipid dimer, E6020 (Eisai Co. Ltd., Tokyo, Japan), which mimics the physicochemical and biological properties of many of the natural lipid A's derived from Gram-negative bacteria.
- oligonucleotides or polymeric molecules suitable for use as adjuvants in the invention include nucleotide sequences containing a CpG motif (a sequence containing an unmethylated cytosine followed by guanosine and linked by a phosphate bond). Bacterial double stranded RNA or oligonucleotides containing palindromic or poly(dG) sequences have also been shown to be immunostimulatory.
- the CpG 's can include nucleotide modifications/analogs such as phosphorothioate modifications and can be double-stranded or single-stranded.
- the guanosine may be replaced with an analog such as 2'-deoxy-7- deazaguanosine.
- an analog such as 2'-deoxy-7- deazaguanosine.
- the CpG sequence may be directed to TLR9, such as the motif GTCGTT or TTCGTT. See Kandimalla et al. (2003) Biochem. Soc. Trans. 31 (part 3):654-658.
- the CpG sequence may be specific for inducing a ThI immune response, such as a CpG-A ODN, or it may be more specific for inducing a B cell response, such a CpG-B ODN.
- CpG-A and CpG-B ODNs are discussed in Blackwell et al. (2003) J. Immunol. 170(8):4061-4068; Krieg (2002) TRENDS Immunol. 23(2): 64-65; and WO 01/95935.
- the CpG is a CpG-A ODN.
- the CpG oligonucleotide is constructed so that the 5' end is accessible for receptor recognition.
- two CpG oligonucleotide sequences may be attached at their 3' ends to form "immunomers". See, for example, Kandimalla et al. (2003) BBRC 306:948-953; Kandimalla et al. (2003) Biochem. Soc. Trans. 3 l(part 3):664-658' Bhagat et al. (2003) BBRC 300:853-861 ; and WO03/035836.
- Immunostimulatory oligonucleotides and polymeric molecules also include alternative polymer backbone structures such as, but not limited to, polyvinyl backbones (Pitha et al. (1970) Biochem. Biophys. Acta 204(l):39-48; Pitha et al. (1970) Biopolymers 9(8):965-977), and morpholino backbones (U.S. Patent No. 5, 142,047; U.S. Patent No.
- Adjuvant IC31 Intercell AG, Vienna, Austria, is a synthetic formulation that contains an antimicrobial peptide, KLK, and an immunostimulatory oligonucleotide, ODNIa.
- the two component solution may be simply mixed with antigens (e.g., particles in accordance with the invention with an associated antigen), with no conjugation required.
- ADP-ribosylating toxins and detoxified derivatives thereof Bacterial ADP- ribosylating toxins and detoxified derivatives thereof may be used as adjuvants in the invention.
- the protein is derived from E. coli (i.e., E. coli heat labile enterotoxin "LT"), cholera ("CT"), or pertussis ("PT").
- E. coli heat labile enterotoxin
- CT cholera
- PT pertussis
- the use of detoxified ADP- ribosylating toxins as mucosal adjuvants is described in WO 95/1721 1 and as parenteral adjuvants in WO 98/42375.
- the adjuvant is a detoxified LT mutant such as LT-K63, LT-R72, and LTR192G.
- LT-K63 a detoxified LT mutant
- LTR192G a detoxified LT mutant
- ADP-ribosylating toxins and detoxified derivatives thereof, particularly LT-K63 and LT-R72, as adjuvants can be found in the following references: Beignon et al. (2002) Infect. Immun. 70(6):3012-3019; Pizza et al. (2001) Vaccine 19:2534-2541 ; Pizza et al.
- Numerical reference for amino acid substitutions is preferably based on the alignments of the A and B subunits of ADP-ribosylating toxins set forth in Domenighini et al. (1995) MoT Microbiol. 15(6): 1 165-1 167.
- Bioadhesives and mucoadhesives may also be used as adjuvants.
- Suitable bioadhesives include esterified hyaluronic acid microspheres (Singh et al. (2001) J. Cont. Release 70:267-276) or mucoadhesives such as cross-linked derivatives of polyacrylic acid, polyvinyl alcohol, polyvinyl pyrollidone, polysaccharides and carboxymethylcellulose.
- Chitosan and derivatives thereof may also be used as adjuvants in the invention (see WO 99/27960).
- liposome formulations suitable for use as adjuvants are described in U.S. Patent No. 6,090,406; U.S. Patent No. 5,916,588; and EP Patent Publication No. EP 0 626 169.
- Adjuvants suitable for use in the invention include polyoxyethylene ethers and polyoxyethylene esters (see, e.g., WO 99/52549). Such formulations further include polyoxyethylene sorbitan ester surfactants in combination with an octoxynol (WO 01/21207) as well as polyoxyethylene alkyl ethers or ester surfactants in combination with at least one additional non-ionic surfactant such as an octoxynol (WO 01/21152). Preferred
- polyoxyethylene ethers are selected from the following group: polyoxyethylene-9-lauryl ether (laureth 9), polyoxyethylene-9-steoryl ether, polyoxytheylene-8-steoryl ether,
- polyoxyethylene-4-lauryl ether polyoxyethylene-35- lauryl ether, and polyoxyethylene-23- lauryl ether.
- PCPP formulations suitable for use as adjuvants are described, for example, in Andrianov et al. (1998) Biomaterials 19(1-3): 109-115; and Payne et al. (1998) Adv. Drug Del. Rev. 31(3): 185-196.
- muramyl peptides suitable for use as adjuvants include N- acetyl- muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-l-alanyl-d- isoglutamine (nor-MDP), and N-acetylmuramyl-l-alanyl-d-isoglutaminyl-l-alanine-2-(l'- 2'- dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE).
- thr-MDP N- acetyl- muramyl-L-threonyl-D-isoglutamine
- nor-MDP N-acetyl-normuramyl-l-alanyl-d-isoglutaminyl-l-alanine-2-(l'- 2'- dipalmitoyl
- imidazoquinoline compounds suitable for use as adjuvants include Imiquimod and its analogues, which are described further in Stanley (2002) Clin. Exp. Dermatol. 27(7):571-577; Jones (2003) Curr. Opin. Investig. Drugs 4(2):214-218; and U.S. Patent Nos. 4,689,338; 5,389,640; 5,268,376; 4,929,624; 5,266,575; 5,352,784;
- thiosemicarbazone compounds suitable for use as adjuvants, as well as methods of formulating, manufacturing, and screening for such compounds, include those described in WO 04/60308.
- the thiosemicarbazones are particularly effective in the stimulation of human peripheral blood mononuclear cells for the production of cytokines, such as TNF-a.
- tryptanthrin compounds suitable for use as adjuvants include those described in WO 04/64759.
- the tryptanthrin compounds are particularly effective in the stimulation of human peripheral blood mononuclear cells for the production of cytokines, such as TNF-a.
- examples of benzonaphthyridine compounds suitable for use as adjuvants include:
- benzonaphthyridine compounds suitable for use as adjuvants include those described in WO 2009/11 1337.
- Lipopeptides suitable for use as adjuvants are described above.
- Other exemplary lipopeptides include, e.g., LP 40, which is an agonist of TLR2. See, e.g., Akdis, et al, EUR. J. IMMUNOLOGY, 33 : 2717-26 (2003).
- Murein lipopeptides are lipopeptides derived from E. coli. See, Hantke, et al, Eur. J. Biochem., 34: 284-296 (1973).
- Murein lipopeptides comprise a peptide linked to N-acetyl muramic acid, and are thus related to Muramyl peptides, which are described in Baschang, et al, Tetrahedron, 45(20): 6331-6360 (1989).
- the human immunomodulators suitable for use as adjuvants include, but are not limited to, cytokines, such as, by way of example only, interleukins (IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12), interferons (such as, by way of example only, interferon- ⁇ ), macrophage colony stimulating factor, and tumor necrosis factor.
- cytokines such as, by way of example only, interleukins (IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12
- interferons such as, by way of example only, interferon- ⁇
- macrophage colony stimulating factor such as, by way of example only, macrophage colony stimulating factor, and tumor necrosis factor.
- Microparticles suitable for use as adjuvants include, but are not limited to, microparticles formed from materials that are biodegradable and non-toxic (e.g. a
- microparticles are treated to have a negatively-charged surface (e.g. with SDS) or a positively-charged surface (e.g. with a cationic detergent, such as CTAB).
- the microparticles suitable for use as adjuvants have a particle diameter of about 100 nm to about 150 ⁇ in diameter. In certain embodiments, the particle diameter is about 200 nm to about 30 ⁇ , and in other embodiments the particle diameter is about 500 nm to 10 ⁇ .
- kits wherein the RNA molecule encoding the first polypeptide antigen and the second polypeptide antigen are in separate containers.
- the kit can contain a first container comprising a composition comprising the RNA molecule encoding the first polypeptide antigen, and a second container comprising a composition comprising the second polypeptide antigen.
- kits described may be used for co-delivery of the RNA component and the polypeptide component of the immunogenic compositions described herein (e.g., the RNA component and the polypeptide component may be mixed prior to administration for simultaneous delivery).
- composition that comprises the polypeptide or the RNA molecule can be in liquid form or can be in solid form (e.g., lyophilized).
- suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes. Containers can be formed from a variety of materials, including glass or plastic.
- a container may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- the kit can further comprise a third container comprising a
- the kit may further include a fourth container comprising an adjuvant (such as an aluminum containing adjuvant or MF59).
- an adjuvant such as an aluminum containing adjuvant or MF59.
- the kit can also comprise a package insert containing written instructions for methods of inducing immunity or for treating infections.
- the package insert can be an unapproved draft package insert or can be a package insert approved by the Food and Drug Administration (FDA) or other regulatory body.
- FDA Food and Drug Administration
- the invention also provides a delivery device pre-filled with the immunogenic compositions, the priming componsitions, or the boosting compositions described above.
- the invention relates to immunogenic compositions comprising: (i) a first polypeptide antigen, and (ii) a self-replicating RNA molecule that encodes a second polypeptide antigen; wherein said first and second polypeptide antigens are from different pathogens.
- the immunogenic compositions typically include a pharmaceutically acceptable carrier and/or a suitable delivery system as described herein, such as liposomes, nanoemulsions, PLG micro- and nanoparticles, lipoplexes, chitosan micro- and nanoparticles and other polyplexes. If desired other pharmaceutically acceptable components can be included, such as excipients and adjuvants. These compositions can be used as anti-viral vaccines.
- compositions are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of immunogenic compositions of the present invention. A variety of aqueous carriers can be used. Suitable pharmaceutically acceptable carriers for use in the immunogenic compositions include plain water (e.g. w.f.i.) or a buffer e.g. a phosphate buffer, a Tris buffer, a borate buffer, a succinate buffer, a histidine buffer, or a citrate buffer. Buffer salts will typically be included in the 5-20mM range.
- the immunogenic compositions are preferably sterile, and may be sterilized by conventional sterilization techniques.
- compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, and tonicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like.
- the immunogenic compositions of the invention may have a pH between 5.0 and 9.5, e.g. between 6.0 and 8.0.
- Immunogenic compositions of the invention may include sodium salts (e.g. sodium chloride) to give tonicity.
- a concentration of 10+2 mg/ml NaCl is typical e.g. about 9 mg/ml.
- Immunogenic compositions of the invention may have an osmolality of between 200 mOsm/kg and 400 mOsm/kg, e.g. between 240-360 mOsm/kg, or between 290- 310 mOsm/kg.
- Immunogenic compositions of the invention may include one or more preservatives, such as thiomersal or 2-phenoxyethanol.
- preservatives such as thiomersal or 2-phenoxyethanol.
- Mercury-free compositions are preferred, and preservative-free vaccines can be prepared.
- Immunogenic compositions of the invention are preferably non-pyrogenic e.g. containing ⁇ 1 EU (endotoxin unit, a standard measure) per dose, and preferably ⁇ 0.1 EU per dose.
- Immunogenic compositions of the invention are preferably gluten free.
- the concentrations of the polypeptide molecule and the RNA molecule in the immunogenic compositions can vary, and will be selected based on fluid volumes, viscosities, body weight and other considerations in accordance with the particular mode of administration selected and the intended recipient's needs.
- the immunogenic compositions are formulated to provide an effective amount of RNA + polypeptide, such as an amount (either in a single dose or as part of a series) that is effective for treatment or prevention. This amount varies depending upon the health and physical condition of the individual to be treated, age, the taxonomic group of individual to be treated (e.g.
- RNA content of compositions will generally be expressed in terms of the amount of RNA per dose.
- a preferred dose has ⁇ 200 ⁇ g, ⁇ 100 ⁇ g, ⁇ 50 ⁇ g, or ⁇ 10 ⁇ g RNA, and expression can be seen at much lower levels e.g. ⁇ ⁇ g/dose, ⁇ lOOng/dose, ⁇ lOng/dose, ⁇ lng/dose, etc.
- the amount of polypeptide in each dose will generally comprise from about 0.1 to about 100 ⁇ g of polypeptide, with from about 5 to about 50 ⁇ g being preferred and from about 5 to about 25 ⁇ g/dose being alternatively preferred.
- the amount of adjuvant if any, will be an amount that will induce an immunomodulating response without significant adverse side effect.
- An optional amount for a particular vaccine can be ascertained by standard studies involving observation of a vaccine's antibody titers and their virus neutralization capabilities.
- the amount of adjuvant will be from about 1 to about 100 ⁇ g/dose, with from about 5 to about 50 ⁇ g/dose being preferred, and from about 20 to about 50 ⁇ g/dose being alternatively preferred.
- Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
- the formulations can be presented in unit- dose or multi-dose sealed containers, such as ampoules and vials.
- Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets. Cells transduced by the RNA molecules can also be administered intravenously or parenterally.
- Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the packaged nucleic acid suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions.
- liquid solutions such as an effective amount of the packaged nucleic acid suspended in diluents, such as water, saline or PEG 400
- capsules, sachets or tablets each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin
- suspensions in an appropriate liquid such as water, saline or PEG 400
- Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, tragacanth, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers.
- Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.
- a flavor usually sucrose and acacia or tragacanth
- pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.
- polypeptide and RNA molecules when administered orally, must be protected from digestion. Protection of polypeptide and RNA molecules can typically be accomplished either by complexing the RNA molecule or the polypeptide molecule with a composition to render the RNA/polypeptide resistant to acidic and enzymatic hydrolysis, or by packaging the RNA molecule or the polypeptide molecule in an
- appropriately resistant carrier such as a liposome.
- Means of protecting nucleic acids (such as RNA molecules) and polypeptides from digestion are well known in the art.
- the immunogenic compositions can be encapsulated, e.g., in liposomes, or in a formulation that provides for slow release of the active ingredient.
- the RNA molecule may be formulated as lioposomes, then administered as a priming
- liposome-formulated RNA may be mixed with the polypeptide molecule to produce the RNA + polypeptide immunogenic composition of the invention.
- the RNA molecule and the polypeptide molecule can be co-encapsulated in liposomes.
- compositions described herein can be made into aerosol formulations (e.g., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
- Suitable suppository formulations may contain the RNA, the polypeptide, or the polypeptide and RNA combination as described herein, and a suppository base.
- Suitable suppository bases include natural or synthetic triglycerides or paraffin hydrocarbons. It is also possible to use gelatin rectal capsules filled with the polypeptide and RNA molecules as described herein, and a suitable base, for example, liquid triglycerides, polyethylene glycols, and paraffin hydrocarbons.
- the invention provides a method for inducing, generating or enhancing an immune response in a subject in need thereof, such as a vertebrate, preferably a mammal, comprising administering an effective amount of an immunogenic composition comprising: (i) a self-replicating RNA molecule that encodes a first polypeptide antigen, and (ii) a second polypeptide antigen; wherein said first and second polypeptide antigens are from different pathogens.
- the immune response is preferably protective and preferably involves antibodies and/or cell-mediated immunity.
- the immunogenic compositions disclosed herein may be used in the manufacture of a medicament for inducing, generating, or enhancing an immune response in a subject in need thereof, such as a vertebrate, preferably a mammal.
- the invention provides a method for treating or preventing an infectious disease in a subject (such as a vertebrate, preferably a mammal) in need thereof, comprising administering an effective amount of an immunogenic composition comprising: (i) a self-replicating RNA molecule that encodes a first polypeptide antigen, and (ii) a second polypeptide antigen; wherein said first and second polypeptide antigens are from different pathogens.
- compositions disclosed herein may be used in the manufacture of a medicament for treating or preventing an infectious disease in a subject in need thereof, such as a vertebrate, preferably a mammal.
- the invention provides a method for vaccinating a subject, such as a vertebrate, preferably a mammal, or immunizing a subject against a pathogen (e.g., a bacterial pathogen, a viral pathogen, a fungal pathogen, a protozoan pathogen, or a multi-cellular parasitic pathogen), comprising administering to a subject in need thereof an effective amount of an immunogenic composition comprising: (i) a self- replicating RNA molecule that encodes a first polypeptide antigen, and (ii) a second polypeptide antigen; wherein said first and second polypeptide antigens are from different pathogens.
- a pathogen e.g., a bacterial pathogen, a viral pathogen, a fungal pathogen, a protozoan pathogen, or a multi-cellular parasitic pathogen
- compositions disclosed herein may be used in the manufacture of a medicament for vaccinating a subject in need thereof, such as a vertebrate, preferably a mammal.
- Suitable animal subjects include, for example, fish, birds, cattle, pigs, horses, deer, sheep, goats, bison, rabbits, cats, dogs, chickens, ducks, turkeys, and the like.
- the mammal is preferably a human.
- the human is preferably a child (e.g., a toddler or infant), a teenager, or an adult; where the vaccine is for therapeutic use, the human is preferably a teenager or an adult.
- a vaccine intended for children may also be administered to adults, e.g., to assess safety, dosage, immunogenicity, etc.
- One way of checking efficacy of therapeutic treatment involves monitoring pathogen infection after administration of the compositions or vaccines disclosed herein.
- One way of checking efficacy of prophylactic treatment involves monitoring immune responses, systemically (such as monitoring the level of IgGl and IgG2a production) and/or mucosally (such as monitoring the level of IgA production), against the antigen.
- immune responses systemically (such as monitoring the level of IgGl and IgG2a production) and/or mucosally (such as monitoring the level of IgA production)
- antigen-specific serum antibody responses are determined post-immunization but pre-challenge whereas antigen-specific mucosal antibody responses are determined post-immunization and post-challenge.
- nucleic acid molecule e.g., the RNA
- the nucleic acid molecule encodes a protein antigen
- Another way of assessing the immunogenicity of the compositions or vaccines disclosed herein where the nucleic acid molecule (e.g., the RNA) encodes a protein antigen is to express the protein antigen recombinantly for screening patient sera or mucosal secretions by immunoblot and/or microarrays. A positive reaction between the protein and the patient sample indicates that the patient has mounted an immune response to the protein in question. This method may also be used to identify immunodominant antigens and/or epitopes within protein antigens.
- compositions can also be determined in vivo by challenging appropriate animal models of the pathogen of interest infection.
- RNA molecule and the polypeptide molecule are coadministered, it may still be desirable to package the polypeptide molecule and RNA molecule separately.
- the two components may be combined, e.g., within about 72 hours, about 48 hours, about 24 hours, about 12 hours, about 10 hours, about 9 hours, about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 45 minutes, about 30 minutes, about 15 minutes, about 10 minutes, or about 5 minutes prior to administration.
- the polypeptide molecule and RNA molecule can be combined at a patient's bedside.
- Dosage can be by a single dose schedule or a multiple dose schedule. Multiple doses may be used in a primary immunization schedule and/or in a booster immunization schedule. In a multiple dose schedule the various doses may be given by the same or different routes, e.g., a parenteral prime and mucosal boost, a mucosal prime and parenteral boost, etc. Multiple doses will typically be administered at least 1 week apart (e.g., about 2 weeks, about 3 weeks, about 4 weeks, about 6 weeks, about 8 weeks, about 10 weeks, about 12 weeks, about 16 weeks, etc.).
- the immunogenic compositions disclosed herein may be used as the prime and/or boost, regardless of whether the immunogenic composition administered as a prime or boost comprised a single pathogen vaccine.
- compositions disclosed herein that include one or more antigens or are used in conjunction with one or more antigens may be used to treat both children and adults.
- a human subject may be less than 1 year old, 1-5 years old, 5-15 years old, 15-55 years old, or at least 55 years old.
- Preferred subjects for receiving the compositions are the elderly (e.g., >50 years old, >60 years old, and preferably >65 years), the young (e.g., ⁇ 5 years old), hospitalized patients, healthcare workers, armed service and military personnel, pregnant women, the chronically ill, or immunodeficient patients.
- the compositions are not suitable solely for these groups, however, and may be used more generally in a population.
- Preferred routes of administration include, but are not limited to, intramuscular, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterial, and intraoccular injection. Oral and transdermal administration, as well as administration by inhalation or suppository is also contemplated. Particularly preferred routes of administration include intramuscular, intradermal and subcutaneous injection. According to some embodiments of the present invention, the composition is administered to a host animal using a needleless injection device, which are well-known and widely available.
- a vaccine that targets a particular target cell type (e.g., an antigen presenting cell or an antigen processing cell).
- a particular target cell type e.g., an antigen presenting cell or an antigen processing cell.
- RNA molecules of the invention can also be introduced directly into a tissue, such as muscle. See, e.g., U.S. Pat. No. 5,580,859.
- RNA into cells of a mammal are also suitable for introduction of RNA into cells of a mammal.
- biolistic or particle-mediated transformation (see, e.g., Sanford et al, U.S. Pat. No. 4,945,050; U.S. Pat. No. 5,036,006) are also suitable for introduction of RNA into cells of a mammal. These methods are useful not only for in vivo introduction of RNA into a mammal, but also for ex vivo modification of cells for reintroduction into a mammal.
- the present invention includes the use of suitable delivery systems, such as liposomes, polymer microparticles or submicron emulsion microparticles with encapsulated or adsorbed RNA, or RNA + polypeptide, to deliver the RNA, or RNA + polypeptide, to elicit an immune response.
- suitable delivery systems such as liposomes, polymer microparticles or submicron emulsion microparticles with encapsulated or adsorbed RNA, or RNA + polypeptide, to deliver the RNA, or RNA + polypeptide, to elicit an immune response.
- the invention includes liposomes, microparticles, submicron emulsions, or combinations thereof, with adsorbed and/or encapsulated RNA, or RNA + polypeptide,.
- compositions disclosed herein that include one or more antigens, or are used in conjunction with one or more antigens may be administered to patients at substantially the same time as (e.g., during the same medical consultation or visit to a healthcare professional or vaccination centre) other vaccines, e.g., at substantially the same time as a measles vaccine, a mumps vaccine, a rubella vaccine, a MMR vaccine, a varicella vaccine, a MMRV vaccine, a diphtheria vaccine, a tetanus vaccine, a pertussis vaccine, a DTP vaccine, a conjugated H.
- other vaccines e.g., at substantially the same time as a measles vaccine, a mumps vaccine, a rubella vaccine, a MMR vaccine, a varicella vaccine, a MMRV vaccine, a diphtheria vaccine, a tetanus vaccine, a pertussis vaccine, a DTP vaccine, a conjugated H.
- influenzae type b vaccine an inactivated poliovirus vaccine, a hepatitis B virus vaccine, a meningococcal conjugate vaccine (such as a tetravalent A C W135 Y vaccine), a respiratory syncytial virus vaccine, etc.
- an "antigen” refers to a molecule containing one or more epitopes (either linear, conformational or both).
- polypeptide antigen refers to a polypeptide comprising one or more epitopes (either linear, conformational or both), that elicits an immunological response.
- Polypeptide antigens include, for example, a naturally-occurring protein, a mutational variant of a naturally-occurring protein (e.g., a protein that has amino acid substitution(s), addition(s), or deletion(s)), a truncated form of a naturally-occurring protein (e.g., an intracellular domain or extracellular domain of a membrane-anchored protein), as well as a fusion protein (a protein that is derived from at least two different naturally occurring proteins or polypeptide chains).
- polypeptide antigens also encompass polypeptides that comprise one or more amino acid stereoisomers, derivatives, or analogues.
- amino acid derivatives include, e.g., chemical modifications of amino acids such as alkylation, acylation, carbamylation, iodination, etc.
- Amino acid analogues include, e.g., compounds that have the same basic chemical structure as a naturally occurring amino acid, such as homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium.
- Polypeptide antigens also encompass polypeptides that are modified post-translationally (such as acetylated, phosphorylated, or glycosylated polypeptides). Therefore, an epitope of a polypeptide antigen is not limited to a peptide.
- an epitope of a glycosylated polypeptide may be a saccharide group that is attached to the polypeptide chain.
- fusion polypeptide refers to a single polypeptide in which the amino acid sequence is derived from at least two different naturally occurring proteins or polypeptide chains.
- An “epitope” is a portion of an antigen that is recognized by the immune system (e.g., by an antibody, an immunoglobulin receptor, a B cell receptor, or a T cell receptor).
- An epitope can be linear or conformational. Commonly, an epitope is a polypeptide or polysaccharide in a naturally occurring antigen. In artificial antigens it can be a low molecular weight substance such as an arsanilic acid derivative. Normally, a B-cell epitope will include at least about 5 amino acids but can be as small as 3-4 amino acids.
- a T- cell epitope, such as a CTL epitope will typically include at least about 7-9 amino acids, and a helper T-cell epitope will typically include at least about 12-20 amino acids.
- amino acid structural protein or “minor structural polypeptide” or “minor capsid protein” or “minor capsid polypeptide” or “VP 1" in reference to a parvovirus refer to a polypeptide comprising a sequence homologous or identical to the ORF2-encoded polypeptide of a parvovirus, and includes sequences displaying at least about 80-100% sequence identity thereto, including any percent identity within these ranges, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% sequence identity thereto.
- the terms "major structural protein” or “major structural polypeptide” or “major capsid protein” or “major capsid polypeptide” or “VP2" in reference to a Parvovirus refer to a polypeptide comprising a sequence homologous or identical to the ORF3-encoded polypeptide of a Parvovirus, and include sequences displaying at least about 80-100% sequence identity thereto, including any percent identity within these ranges, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% sequence identity thereto.
- naked refers to nucleic acids that are
- a "naked" nucleic acid such as a self-replicating RNA, is not formulated with other macromolecules to improve cellular uptake. Accordingly, a naked nucleic acid is not encapsulated in, absorbed on, or bound to a liposome, a microparticle or nanoparticle, a cationic emulsion, and the like.
- nucleotide analog or “modified nucleotide” refers to a nucleotide that contains one or more chemical modifications (e.g., substitutions) in or on the nitrogenous base of the nucleoside (e.g., cytosine (C), (thymine (T) or uracil (U)), adenine (A) or guanine (G)).
- a nucleotide analog can contain further chemical modifications in or on the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, six-membered sugar analog, or open-chain sugar analog), or the phosphate.
- parvovirus refers to all parvoviruses associated with mammalian species (e.g., human, canine, chicken, feline, murine, porcine, raccoon, mink, kilham rat, lapine) and broadly to all genus of the Parvoviridae family (i.e., Parvovirus (e.g., canine parvovirus), Dependovirus (e.g., adeno-associated virus), Erythrovirus (e.g., parvovirus B19) and Bocavirus).
- Parvovirus also includes isolates not characterized at the time of filing.
- parvovirus antigen refers to a molecule derived from a parvovirus, including, without limitation, any of the various isolates of parvovirus. The molecule need not be physically derived from the particular isolate in question, but may be synthetically or recombinantly produced.
- pathogen refers to a virus, eukaryote, prokaryote or archaea that is capable of proliferation, and causes a disease or illness in a host organism, such as a vertebrate (e.g., a mammal).
- a pathogen can be a viral, bacterial, protozoan, or fungal species, as well as a multi-cellular parasitic species.
- treat include alleviating, abating or ameliorating disease or condition symptoms, preventing additional symptoms, ameliorating or preventing the underlying metabolic causes of symptoms, inhibiting the disease or condition, e.g., arresting the development of the disease or condition, relieving the disease or condition, causing regression of the disease or condition, relieving a condition caused by the disease or condition, or stopping the symptoms of the disease or condition.
- the terms “treat,” “treating” or “treatment”, include, but are not limited to, prophylactic and/or therapeutic treatments.
- VRP viral replicon particle
- virus-like particle refers to a structure formed by viral coat proteins (e.g., a capsid) and optionally an evelope, but having no genetic material.
- a VLP resembles a viral particle.
- mice 60 animals total, were divided into 6 groups (10 animals per group). Ten BALB/c mice, per group, were bled before immunization to collect pre-immune sera. Mice were given bilateral intramuscular vaccinations (50 ⁇ ⁇ per leg) on days 0, 21 and 42 with the formulation indicated in Table 1.
- the LNP (RV01(15) had the following composition: 40% DlinDMA, 10% DSPC, 48% Choi, 2% PEG DMG 2000 and an N:P ratio of 8: 1. Serum was collected for immunological analysis on days 21 (3wpl), 42 (3wp2) and 63 (3wp3).
- mice Three weeks after the immunization the mice were bled again, and sera collected for testing. The following day mice received a second immunization with the same vaccine previously administered to them. Three weeks after the second immunization, the mice were bled and sera collected for testing. A third immunization was administed to the mice the following day. Three weeks after the third immunization, the mice were bled and sera collected for testing.
- CMV serum neutralization titers of BALB/c mice 10 animals per group, after intramuscular vaccinations on days 0, 21 and 42. Serum was collected for analysis on days 42 (3wp2) and 63 (3wp3) and incubated with TB40 virus on ARPE-19 cells without complement
- the neutralization titer is defined as the reciprocal of the serum dilution producing a 50% reduction in number of positive virus foci per well, relative to controls.
- CMV gB FL ( SEQ ID NO : l ) 1 - atggaaagccggatctggtgcctggtcgtgtgcgtgaacctgtgcatcgtgtgcctgggagc cgccgtgagcagcagcaccagaggcaccagcgccacacacagccacagccacagccacagccaca ccacctctgccgcccacagcagatccggcagcgtgtcccagagagtgaccagcagccagacc gtgtcccacggcgtgaacgagacaatctacaacaccaccctgaagtacggcgacgtcgtggg cgtgaataccaccaccaagtacccctacagagtgtgtgcagcatggcccagggcaccgacctgatca gattcgagcgga
- CMV gB sol 750 (SEQ ID NO: 3)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/130,899 US11896636B2 (en) | 2011-07-06 | 2012-07-06 | Immunogenic combination compositions and uses thereof |
| EP21152462.4A EP3854413A1 (en) | 2011-07-06 | 2012-07-06 | Immunogenic combination compositions and uses thereof |
| CA2840989A CA2840989A1 (en) | 2011-07-06 | 2012-07-06 | Immunogenic combination compositions and uses thereof |
| EP12735420.7A EP2729165B1 (en) | 2011-07-06 | 2012-07-06 | Immunogenic combination compositions and uses thereof |
| ES12735420.7T ES2656050T3 (es) | 2011-07-06 | 2012-07-06 | Composiciones de combinación inmunogénica y usos de las mismas |
| JP2014519089A JP2014522842A (ja) | 2011-07-06 | 2012-07-06 | 免疫原性組み合わせ組成物およびその使用 |
| US18/463,099 US20240082329A1 (en) | 2011-07-06 | 2023-09-07 | Immunogenic combination compositions and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161505093P | 2011-07-06 | 2011-07-06 | |
| US61/505,093 | 2011-07-06 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/130,899 A-371-Of-International US11896636B2 (en) | 2011-07-06 | 2012-07-06 | Immunogenic combination compositions and uses thereof |
| US18/463,099 Continuation US20240082329A1 (en) | 2011-07-06 | 2023-09-07 | Immunogenic combination compositions and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013006838A1 true WO2013006838A1 (en) | 2013-01-10 |
Family
ID=46513883
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/045847 Ceased WO2013006838A1 (en) | 2011-07-06 | 2012-07-06 | Immunogenic combination compositions and uses thereof |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US11896636B2 (https=) |
| EP (3) | EP2729165B1 (https=) |
| JP (1) | JP2014522842A (https=) |
| CA (1) | CA2840989A1 (https=) |
| ES (1) | ES2656050T3 (https=) |
| WO (1) | WO2013006838A1 (https=) |
Cited By (65)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8664194B2 (en) | 2011-12-16 | 2014-03-04 | Moderna Therapeutics, Inc. | Method for producing a protein of interest in a primate |
| US8710200B2 (en) | 2011-03-31 | 2014-04-29 | Moderna Therapeutics, Inc. | Engineered nucleic acids encoding a modified erythropoietin and their expression |
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| WO2014140211A1 (en) | 2013-03-15 | 2014-09-18 | Novartis Ag | Rna purification methods |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| US8999380B2 (en) | 2012-04-02 | 2015-04-07 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| WO2015138424A1 (en) | 2014-03-10 | 2015-09-17 | University Of Louisville Research Foundaton, Inc. | Compositions and methods for treating, including preventing, parvovirus infections and related diseases |
| WO2015183895A1 (en) * | 2014-05-27 | 2015-12-03 | University Of Rochester | Novel arenavirus vaccine |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9334328B2 (en) | 2010-10-01 | 2016-05-10 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9428535B2 (en) | 2011-10-03 | 2016-08-30 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| WO2017070613A1 (en) * | 2015-10-22 | 2017-04-27 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US10195156B2 (en) | 2015-12-22 | 2019-02-05 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of agents |
| US10207010B2 (en) | 2015-12-10 | 2019-02-19 | Modernatx, Inc. | Compositions and methods for delivery of agents |
| US10266485B2 (en) | 2015-09-17 | 2019-04-23 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US10323076B2 (en) | 2013-10-03 | 2019-06-18 | Modernatx, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| WO2019123169A1 (en) | 2017-12-20 | 2019-06-27 | Glaxosmithkline Biologicals Sa | Epstein-barr virus antigen constructs |
| US10449244B2 (en) | 2015-07-21 | 2019-10-22 | Modernatx, Inc. | Zika RNA vaccines |
| US10493143B2 (en) | 2015-10-22 | 2019-12-03 | Modernatx, Inc. | Sexually transmitted disease vaccines |
| US10611800B2 (en) | 2016-03-11 | 2020-04-07 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| US10653767B2 (en) | 2017-09-14 | 2020-05-19 | Modernatx, Inc. | Zika virus MRNA vaccines |
| US10695419B2 (en) | 2016-10-21 | 2020-06-30 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10857105B2 (en) | 2017-03-15 | 2020-12-08 | MordernaTX, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US10925958B2 (en) | 2016-11-11 | 2021-02-23 | Modernatx, Inc. | Influenza vaccine |
| US11045540B2 (en) | 2017-03-15 | 2021-06-29 | Modernatx, Inc. | Varicella zoster virus (VZV) vaccine |
| US11066355B2 (en) | 2019-09-19 | 2021-07-20 | Modernatx, Inc. | Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents |
| US11103578B2 (en) | 2016-12-08 | 2021-08-31 | Modernatx, Inc. | Respiratory virus nucleic acid vaccines |
| EP3888676A1 (en) | 2014-06-13 | 2021-10-06 | GlaxoSmithKline Biologicals S.A. | Immunogenic combinations |
| EP3904522A1 (en) * | 2013-12-03 | 2021-11-03 | Hookipa Biotech GmbH | Cmv vaccines |
| US11203569B2 (en) | 2017-03-15 | 2021-12-21 | Modernatx, Inc. | Crystal forms of amino lipids |
| US11235052B2 (en) | 2015-10-22 | 2022-02-01 | Modernatx, Inc. | Chikungunya virus RNA vaccines |
| US11351242B1 (en) | 2019-02-12 | 2022-06-07 | Modernatx, Inc. | HMPV/hPIV3 mRNA vaccine composition |
| US11364292B2 (en) | 2015-07-21 | 2022-06-21 | Modernatx, Inc. | CHIKV RNA vaccines |
| US11406703B2 (en) | 2020-08-25 | 2022-08-09 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US11464848B2 (en) | 2017-03-15 | 2022-10-11 | Modernatx, Inc. | Respiratory syncytial virus vaccine |
| US11524023B2 (en) | 2021-02-19 | 2022-12-13 | Modernatx, Inc. | Lipid nanoparticle compositions and methods of formulating the same |
| US11547764B2 (en) | 2011-06-08 | 2023-01-10 | Translate Bio, Inc. | Lipid nanoparticle compositions and methods for MRNA delivery |
| US11576961B2 (en) | 2017-03-15 | 2023-02-14 | Modernatx, Inc. | Broad spectrum influenza virus vaccine |
| US11583504B2 (en) | 2016-11-08 | 2023-02-21 | Modernatx, Inc. | Stabilized formulations of lipid nanoparticles |
| EP4159741A1 (en) | 2014-07-16 | 2023-04-05 | ModernaTX, Inc. | Method for producing a chimeric polynucleotide encoding a polypeptide having a triazole-containing internucleotide linkage |
| US11629172B2 (en) | 2018-12-21 | 2023-04-18 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| US11643441B1 (en) | 2015-10-22 | 2023-05-09 | Modernatx, Inc. | Nucleic acid vaccines for varicella zoster virus (VZV) |
| US11744801B2 (en) | 2017-08-31 | 2023-09-05 | Modernatx, Inc. | Methods of making lipid nanoparticles |
| US11752206B2 (en) | 2017-03-15 | 2023-09-12 | Modernatx, Inc. | Herpes simplex virus vaccine |
| US11786607B2 (en) | 2017-06-15 | 2023-10-17 | Modernatx, Inc. | RNA formulations |
| US11793843B2 (en) | 2019-01-10 | 2023-10-24 | Janssen Biotech, Inc. | Prostate neoantigens and their uses |
| US11857622B2 (en) | 2020-06-21 | 2024-01-02 | Pfizer Inc. | Human cytomegalovirus GB polypeptide |
| US11905525B2 (en) | 2017-04-05 | 2024-02-20 | Modernatx, Inc. | Reduction of elimination of immune responses to non-intravenous, e.g., subcutaneously administered therapeutic proteins |
| US11911453B2 (en) | 2018-01-29 | 2024-02-27 | Modernatx, Inc. | RSV RNA vaccines |
| US11969506B2 (en) | 2017-03-15 | 2024-04-30 | Modernatx, Inc. | Lipid nanoparticle formulation |
| US12018289B2 (en) | 2019-11-18 | 2024-06-25 | Janssen Biotech, Inc. | Vaccines based on mutant CALR and JAK2 and their uses |
| US12070495B2 (en) | 2019-03-15 | 2024-08-27 | Modernatx, Inc. | HIV RNA vaccines |
| US12077501B2 (en) | 2017-06-14 | 2024-09-03 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of agents |
| US12090235B2 (en) | 2018-09-20 | 2024-09-17 | Modernatx, Inc. | Preparation of lipid nanoparticles and methods of administration thereof |
| US12151029B2 (en) | 2018-09-19 | 2024-11-26 | Modernatx, Inc. | PEG lipids and uses thereof |
| US12263248B2 (en) | 2018-09-19 | 2025-04-01 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US12295997B2 (en) | 2020-07-06 | 2025-05-13 | Janssen Biotech, Inc. | Prostate neoantigens and their uses |
| US12383508B2 (en) | 2018-09-19 | 2025-08-12 | Modernatx, Inc. | High-purity peg lipids and uses thereof |
| US12569552B2 (en) * | 2020-06-09 | 2026-03-10 | Km Biologics Co., Ltd. | Fusion protein of pentamer and gB of cytomegalovirus, and vaccine containing said fusion protein |
| US12595226B2 (en) | 2019-09-19 | 2026-04-07 | Modernatx, Inc. | Carbonate containing lipid compounds and compositions for intracellular delivery of therapeutic agents |
Families Citing this family (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL2591114T3 (pl) | 2010-07-06 | 2017-08-31 | Glaxosmithkline Biologicals Sa | Immunizacja dużych ssaków małymi dawkami rna |
| HUE047796T2 (hu) | 2010-07-06 | 2020-05-28 | Glaxosmithkline Biologicals Sa | RNS bevitele több immunútvonal bekapcsolására |
| HUE026646T2 (en) | 2010-07-06 | 2016-07-28 | Glaxosmithkline Biologicals Sa | Preferred liposomes containing lipids of PKA value for delivery of RNA |
| PT3970742T (pt) | 2010-08-31 | 2022-06-27 | Glaxosmithkline Biologicals Sa | Lipossomas peguilados para entrega de arn codificador de imunogénio |
| JP2013544504A (ja) | 2010-10-11 | 2013-12-19 | ノバルティス アーゲー | 抗原送達プラットフォーム |
| WO2013006838A1 (en) * | 2011-07-06 | 2013-01-10 | Novartis Ag | Immunogenic combination compositions and uses thereof |
| US9512456B2 (en) | 2012-08-14 | 2016-12-06 | Modernatx, Inc. | Enzymes and polymerases for the synthesis of RNA |
| MX2015005505A (es) * | 2012-10-30 | 2016-01-08 | Redvax Gmbh | Vacunas basadas en particular recombinantes contra la infeccion de citomegalovirus humano. |
| EP2943221A1 (en) * | 2013-01-10 | 2015-11-18 | Novartis AG | Influenza virus immunogenic compositions and uses thereof |
| US9974850B2 (en) * | 2013-01-25 | 2018-05-22 | Board Of Regents, The University Of Texas System | Immunogenic compositions and uses thereof |
| EP2968391A1 (en) | 2013-03-13 | 2016-01-20 | Moderna Therapeutics, Inc. | Long-lived polynucleotide molecules |
| EP2971010B1 (en) | 2013-03-14 | 2020-06-10 | ModernaTX, Inc. | Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions |
| SG10201912038TA (en) | 2014-04-23 | 2020-02-27 | Modernatx Inc | Nucleic acid vaccines |
| CN105031661A (zh) * | 2015-05-28 | 2015-11-11 | 杭州优玛达生物科技有限公司 | 生物膜、具有生物膜性的闭合结构或细胞区室作为基因转染试剂或者基因治疗试剂的应用 |
| AU2016336344A1 (en) | 2015-10-05 | 2018-04-19 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| JP2019511255A (ja) | 2016-01-11 | 2019-04-25 | バーンダリ,インク. | マイクロニードル組成物およびそれを使用する方法 |
| WO2017162265A1 (en) | 2016-03-21 | 2017-09-28 | Biontech Rna Pharmaceuticals Gmbh | Trans-replicating rna |
| US12491261B2 (en) | 2016-10-26 | 2025-12-09 | Acuitas Therapeutics, Inc. | Lipid nanoparticle formulations |
| MA47790A (fr) | 2017-03-17 | 2021-05-05 | Modernatx Inc | Vaccins à base d'arn contre des maladies zoonotiques |
| MX2019013259A (es) | 2017-05-08 | 2020-01-13 | Gritstone Oncology Inc | Vectores de neoantigeno de alfavirus. |
| CA3073020A1 (en) | 2017-08-16 | 2019-02-21 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
| EP3735271A4 (en) | 2018-01-04 | 2022-06-15 | Iconic Therapeutics, Inc. | ANTI-TISSUE FACTOR ANTIBODIES, ANTIBODY DRUG CONJUGATES AND RELATED METHODS |
| MX2021014525A (es) | 2019-05-30 | 2022-03-17 | Gritstone Bio Inc | Adenovirus modificados. |
| WO2021183563A1 (en) | 2020-03-09 | 2021-09-16 | Arcturus Therapeutics, Inc. | Coronavirus vaccine compositions and methods |
| US12558415B2 (en) * | 2020-04-14 | 2026-02-24 | The Regents Of The University Of California | Broad-spectrum multi-antigen pan-coronavirus vaccine |
| WO2022016070A1 (en) | 2020-07-16 | 2022-01-20 | Acuitas Therapeutics, Inc. | Cationic lipids for use in lipid nanoparticles |
| KR20230046313A (ko) | 2020-08-06 | 2023-04-05 | 그릿스톤 바이오, 인코포레이티드 | 다중에피토프 백신 카세트 |
| US12178921B2 (en) | 2020-08-14 | 2024-12-31 | Arcturus Therapeutics, Inc. | Method of lyophilizing lipid nanoparticles |
| CA3242402A1 (en) | 2021-12-16 | 2023-06-22 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
| AU2024270076A1 (en) * | 2023-05-10 | 2025-11-27 | Seqirus Inc. | Combination vaccine |
Citations (84)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4186745A (en) | 1976-07-30 | 1980-02-05 | Kauzlarich James J | Porous catheters |
| US4373071A (en) | 1981-04-30 | 1983-02-08 | City Of Hope Research Institute | Solid-phase synthesis of polynucleotides |
| EP0109942A2 (en) | 1982-10-18 | 1984-05-30 | Bror Morein | Immunogenic protein or peptide complex, method of producing said complex and the use thereof as an immune stimulant and as a vaccine |
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US4500707A (en) | 1980-02-29 | 1985-02-19 | University Patents, Inc. | Nucleosides useful in the preparation of polynucleotides |
| US4668777A (en) | 1981-03-27 | 1987-05-26 | University Patents, Inc. | Phosphoramidite nucleoside compounds |
| US4689338A (en) | 1983-11-18 | 1987-08-25 | Riker Laboratories, Inc. | 1H-Imidazo[4,5-c]quinolin-4-amines and antiviral use |
| EP0329181A2 (en) | 1988-02-19 | 1989-08-23 | Sanyo Electric Co., Ltd. | Device for driving reel supports |
| US4929624A (en) | 1989-03-23 | 1990-05-29 | Minnesota Mining And Manufacturing Company | Olefinic 1H-imidazo(4,5-c)quinolin-4-amines |
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US4973679A (en) | 1981-03-27 | 1990-11-27 | University Patents, Inc. | Process for oligonucleo tide synthesis using phosphormidite intermediates |
| WO1990014837A1 (en) | 1989-05-25 | 1990-12-13 | Chiron Corporation | Adjuvant formulation comprising a submicron oil droplet emulsion |
| US5036006A (en) | 1984-11-13 | 1991-07-30 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5047524A (en) | 1988-12-21 | 1991-09-10 | Applied Biosystems, Inc. | Automated system for polynucleotide synthesis and purification |
| US5057540A (en) | 1987-05-29 | 1991-10-15 | Cambridge Biotech Corporation | Saponin adjuvant |
| US5132418A (en) | 1980-02-29 | 1992-07-21 | University Patents, Inc. | Process for preparing polynucleotides |
| US5142047A (en) | 1985-03-15 | 1992-08-25 | Anti-Gene Development Group | Uncharged polynucleotide-binding polymers |
| US5153319A (en) | 1986-03-31 | 1992-10-06 | University Patents, Inc. | Process for preparing polynucleotides |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5238944A (en) | 1988-12-15 | 1993-08-24 | Riker Laboratories, Inc. | Topical formulations and transdermal delivery systems containing 1-isobutyl-1H-imidazo[4,5-c]quinolin-4-amine |
| US5262530A (en) | 1988-12-21 | 1993-11-16 | Applied Biosystems, Inc. | Automated system for polynucleotide synthesis and purification |
| US5266575A (en) | 1991-11-06 | 1993-11-30 | Minnesota Mining And Manufacturing Company | 2-ethyl 1H-imidazo[4,5-ciquinolin-4-amines |
| US5268376A (en) | 1991-09-04 | 1993-12-07 | Minnesota Mining And Manufacturing Company | 1-substituted 1H-imidazo[4,5-c]quinolin-4-amines |
| US5340740A (en) | 1992-05-15 | 1994-08-23 | North Carolina State University | Method of producing an avian embryonic stem cell culture and the avian embryonic stem cell culture produced by the process |
| US5352784A (en) | 1993-07-15 | 1994-10-04 | Minnesota Mining And Manufacturing Company | Fused cycloalkylimidazopyridines |
| EP0626169A2 (en) | 1988-08-25 | 1994-11-30 | The Liposome Company, Inc. | A dosage form comprising an antigen and a salt form of an organic acid derivative of a sterol |
| US5389640A (en) | 1991-03-01 | 1995-02-14 | Minnesota Mining And Manufacturing Company | 1-substituted, 2-substituted 1H-imidazo[4,5-c]quinolin-4-amines |
| US5395937A (en) | 1993-01-29 | 1995-03-07 | Minnesota Mining And Manufacturing Company | Process for preparing quinoline amines |
| US5397307A (en) | 1993-12-07 | 1995-03-14 | Schneider (Usa) Inc. | Drug delivery PTCA catheter and method for drug delivery |
| WO1995017211A1 (en) | 1993-12-22 | 1995-06-29 | Biocine S.P.A. | Non-toxic mucosal adjuvant |
| EP0689454A1 (en) | 1993-03-23 | 1996-01-03 | Smithkline Beecham Biolog | VACCINE COMPOSITIONS CONTAINING 3-O DESACETYL MONOPHOSPHORYLIC LIPID |
| US5482936A (en) | 1995-01-12 | 1996-01-09 | Minnesota Mining And Manufacturing Company | Imidazo[4,5-C]quinoline amines |
| US5494916A (en) | 1993-07-15 | 1996-02-27 | Minnesota Mining And Manufacturing Company | Imidazo[4,5-C]pyridin-4-amines |
| WO1996011711A1 (en) | 1994-10-12 | 1996-04-25 | Iscotec Ab | Saponin preparations and use thereof in iscoms |
| US5547472A (en) | 1994-01-20 | 1996-08-20 | Terumo Kabushiki Kaisha | Catheter with medicament injection pores |
| WO1996033739A1 (en) | 1995-04-25 | 1996-10-31 | Smithkline Beecham Biologicals S.A. | Vaccines containing a saponin and a sterol |
| US5580859A (en) | 1989-03-21 | 1996-12-03 | Vical Incorporated | Delivery of exogenous DNA sequences in a mammal |
| WO1997028818A1 (en) | 1996-02-12 | 1997-08-14 | Cobra Therapeutics Limited | Novel methods of vaccination and vaccines therefore comprising a nucleic acid encoding a first epitope and a peptide containing a second epitope |
| US5674192A (en) | 1990-12-28 | 1997-10-07 | Boston Scientific Corporation | Drug delivery |
| US5700642A (en) | 1995-05-22 | 1997-12-23 | Sri International | Oligonucleotide sizing using immobilized cleavable primers |
| WO1998040100A1 (en) | 1997-03-10 | 1998-09-17 | Ottawa Civic Loeb Research Institute | USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE AS AN ADJUVANT |
| WO1998042375A1 (en) | 1997-03-21 | 1998-10-01 | Chiron Corporation | Detoxified mutants of bacterial adp-ribosylating toxins as parenteral adjuvants |
| WO1999027960A1 (en) | 1997-11-28 | 1999-06-10 | West Pharmaceutical Services | Vaccine compositions for mucosal administration comprising chitosan |
| US5916588A (en) | 1984-04-12 | 1999-06-29 | The Liposome Company, Inc. | Peptide-containing liposomes, immunogenic liposomes and methods of preparation and use |
| WO1999052549A1 (en) | 1998-04-09 | 1999-10-21 | Smithkline Beecham Biologicals S.A. | Adjuvant compositions |
| WO1999062923A2 (en) | 1998-06-05 | 1999-12-09 | Dynavax Technologies Corporation | Immunostimulatory oligonucleotides with modified bases and methods of use thereof |
| WO2000007621A2 (en) | 1998-08-05 | 2000-02-17 | Smithkline Beecham Biologicals S.A. | Vaccine comprising an iscom consisting of sterol and saponin which is free of additional detergent |
| US6048729A (en) | 1987-05-01 | 2000-04-11 | Transkaryotic Therapies, Inc. | In vivo protein production and delivery system for gene therapy |
| US6048524A (en) | 1991-11-05 | 2000-04-11 | Transkaryotic Therapies, Inc. | In vivo production and delivery of erythropoietin for gene therapy |
| US6054288A (en) | 1991-11-05 | 2000-04-25 | Transkaryotic Therapies, Inc. | In vivo protein production and delivery system for gene therapy |
| WO2000023105A2 (en) | 1998-10-16 | 2000-04-27 | Smithkline Beecham Biologicals S.A. | Adjuvant systems and vaccines |
| US6071890A (en) | 1994-12-09 | 2000-06-06 | Genzyme Corporation | Organ-specific targeting of cationic amphiphile/DNA complexes for gene therapy |
| US6083741A (en) | 1994-11-17 | 2000-07-04 | Imperial College Of Science Technology And Medicine | Internalisation of DNA, using conjugates of poly-l-lysine and an integrin receptor ligand |
| US6090406A (en) | 1984-04-12 | 2000-07-18 | The Liposome Company, Inc. | Potentiation of immune responses with liposomal adjuvants |
| US6090619A (en) | 1997-09-08 | 2000-07-18 | University Of Florida | Materials and methods for intracellular delivery of biologically active molecules |
| US6114168A (en) | 1994-10-21 | 2000-09-05 | Institute National De La Recherche Agronomique | Active retinoic acid-free culture medium for chicken embryonic stem cells |
| US6129705A (en) | 1997-10-01 | 2000-10-10 | Medtronic Ave, Inc. | Drug delivery and gene therapy delivery system |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| WO2001021207A2 (en) | 1999-09-24 | 2001-03-29 | Smithkline Beecham Biologicals S.A. | Use of combination of polyoxyethylene sorbitan ester and octoxynol as adjuvant and its use in vaccines |
| WO2001021152A1 (en) | 1999-09-24 | 2001-03-29 | Smithkline Beecham Biologicals S.A. | Adjuvant comprising a polyxyethylene alkyl ether or ester and at least one nonionic surfactant |
| US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| WO2001095935A1 (en) | 2000-01-20 | 2001-12-20 | Ottawa Health Research Institute | Immunostimulatory nucleic acids for inducing a th2 immune response |
| WO2002009645A2 (en) * | 2000-08-01 | 2002-02-07 | The Johns Hopkins University | Intercellular transport protein linked to an antigen as a molecular vaccine |
| WO2002026757A2 (en) | 2000-09-26 | 2002-04-04 | Hybridon, Inc. | Modulation of immunostimulatory activity of immunostimulatory oligonucleotide analogs by positional chemical changes |
| US6429199B1 (en) | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
| WO2003024481A2 (en) | 2001-09-14 | 2003-03-27 | Cytos Biotechnology Ag | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
| WO2003024480A2 (en) | 2001-09-14 | 2003-03-27 | Cytos Biotechnology Ag | In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles |
| WO2003035836A2 (en) | 2001-10-24 | 2003-05-01 | Hybridon Inc. | Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5' ends |
| WO2003043415A1 (fr) | 2001-11-22 | 2003-05-30 | Vivalis | Systeme d'expression de proteines exogenes dans un systeme aviaire |
| WO2003076601A1 (fr) | 2002-03-08 | 2003-09-18 | Vivalis | Lignées de cellules aviaires utiles pour la production de substances d'intérêt |
| WO2004060308A2 (en) | 2002-12-27 | 2004-07-22 | Chiron Corporation | Thiosemicarbazones as anti-virals and immunopotentiators |
| WO2004064759A2 (en) | 2003-01-21 | 2004-08-05 | Chiron Corporation | Use of tryptanthrin compounds for immune potentiation |
| WO2005042728A2 (en) | 2003-11-03 | 2005-05-12 | Probiogen Ag | Immortalized avian cell lines for virus production |
| WO2006032697A2 (en) | 2004-09-24 | 2006-03-30 | Intercell Ag | MODIFIED VPl-CAPSID PROTEIN OF PARVOVIRUS B19 |
| US20080057080A1 (en) | 2004-05-18 | 2008-03-06 | Vical Incorporated | Influenza virus vaccine composition and methods of use |
| US20080085870A1 (en) | 2002-12-23 | 2008-04-10 | Vical Incorporated | Codon-optimized polynucleotide-based vaccines against human cytomegalovirus infection |
| WO2009074861A2 (en) | 2007-12-10 | 2009-06-18 | Powderject Research Limited | Improved vaccine |
| WO2009111337A1 (en) | 2008-03-03 | 2009-09-11 | Irm Llc | Compounds and compositions as tlr activity modulators |
| US7604803B2 (en) | 2002-07-05 | 2009-10-20 | Lipoxen Technologies Limited | Method to enhance an immune response of nucleic acid vaccination |
| WO2009132206A1 (en) | 2008-04-25 | 2009-10-29 | Liquidia Technologies, Inc. | Compositions and methods for intracellular delivery and release of cargo |
| US7862829B2 (en) | 2004-07-09 | 2011-01-04 | University Of North Carolina At Chapel Hill | Viral adjuvants |
| WO2011005799A2 (en) | 2009-07-06 | 2011-01-13 | Novartis Ag | Self replicating rna molecules and uses thereof |
| WO2011008974A2 (en) | 2009-07-15 | 2011-01-20 | Novartis Ag | Rsv f protein compositions and methods for making same |
| WO2011127316A1 (en) * | 2010-04-07 | 2011-10-13 | Novartis Ag | Method for generating a parvovirus b19 virus-like particle |
Family Cites Families (231)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4853228A (en) | 1987-07-28 | 1989-08-01 | Micro-Pak, Inc. | Method of manufacturing unilamellar lipid vesicles |
| US6867195B1 (en) | 1989-03-21 | 2005-03-15 | Vical Incorporated | Lipid-mediated polynucleotide administration to reduce likelihood of subject's becoming infected |
| FR2645020B1 (fr) | 1989-03-28 | 1994-06-10 | Vila Jorge | Medicament pour le traitement des maladies infectieuses dues aux retrovirus ainsi que pour le traitement des tumeurs |
| US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US5279833A (en) | 1990-04-04 | 1994-01-18 | Yale University | Liposomal transfection of nucleic acids into animal cells |
| US5264618A (en) | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| FR2676072B1 (fr) | 1991-05-03 | 1994-11-18 | Transgene Sa | Vecteur de delivrance d'arn. |
| US5693535A (en) | 1992-05-14 | 1997-12-02 | Ribozyme Pharmaceuticals, Inc. | HIV targeted ribozymes |
| US5750390A (en) | 1992-08-26 | 1998-05-12 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for treatment of diseases caused by expression of the bcl-2 gene |
| EP0646178A1 (en) | 1992-06-04 | 1995-04-05 | The Regents Of The University Of California | expression cassette with regularoty regions functional in the mammmlian host |
| WO1994002595A1 (en) | 1992-07-17 | 1994-02-03 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for treatment of animal diseases |
| US5474914A (en) | 1992-07-29 | 1995-12-12 | Chiron Corporation | Method of producing secreted CMV glycoprotein H |
| US20020102273A1 (en) | 1995-08-08 | 2002-08-01 | Robert B. Grieve | Use of alphavirus expression vectors to produce parasite anitgens |
| EP0702516A4 (en) | 1993-06-01 | 1998-04-22 | Life Technologies Inc | GENETIC IMMUNIZATION WITH CATIONIC LIPIDS |
| US6015686A (en) | 1993-09-15 | 2000-01-18 | Chiron Viagene, Inc. | Eukaryotic layered vector initiation systems |
| JPH08511956A (ja) | 1994-04-07 | 1996-12-17 | アクゾ・ノベル・エヌ・ベー | Rnaを含む凍結乾燥組成物 |
| US5993850A (en) | 1994-09-13 | 1999-11-30 | Skyepharma Inc. | Preparation of multivesicular liposomes for controlled release of encapsulated biologically active substances |
| US5885613A (en) | 1994-09-30 | 1999-03-23 | The University Of British Columbia | Bilayer stabilizing components and their use in forming programmable fusogenic liposomes |
| AU4594996A (en) | 1994-11-30 | 1996-06-19 | Chiron Viagene, Inc. | Recombinant alphavirus vectors |
| US5965434A (en) | 1994-12-29 | 1999-10-12 | Wolff; Jon A. | Amphipathic PH sensitive compounds and delivery systems for delivering biologically active compounds |
| US5792462A (en) | 1995-05-23 | 1998-08-11 | University Of North Carolina At Chapel Hill | Alphavirus RNA replicon systems |
| US5981501A (en) | 1995-06-07 | 1999-11-09 | Inex Pharmaceuticals Corp. | Methods for encapsulating plasmids in lipid bilayers |
| US7422902B1 (en) | 1995-06-07 | 2008-09-09 | The University Of British Columbia | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| AU727923B2 (en) | 1995-09-27 | 2001-01-04 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Production of infectious respiratory syncytial virus from cloned nucleotide sequences |
| DE19605548A1 (de) | 1996-02-15 | 1997-09-04 | Boehringer Ingelheim Int | Zusammensetzung für die Transfektion höherer eukaryotischer Zellen |
| US6451592B1 (en) | 1996-04-05 | 2002-09-17 | Chiron Corporation | Recombinant alphavirus-based vectors with reduced inhibition of cellular macromolecular synthesis |
| WO1998000110A1 (en) | 1996-07-03 | 1998-01-08 | University Of Pittsburgh | Emulsion formulations for hydrophilic active agents |
| WO1998001148A1 (en) | 1996-07-09 | 1998-01-15 | President And Fellows Of Harvard College | Use of papillomavirus e2 protein in treating papillomavirus-infected cells and compositions containing the protein |
| US7384923B2 (en) | 1999-05-14 | 2008-06-10 | Lipoxen Technologies Limited | Liposomes |
| AU728581B2 (en) | 1996-09-13 | 2001-01-11 | Lipoxen Limited | Liposomes |
| US6395302B1 (en) | 1996-11-19 | 2002-05-28 | Octoplus B.V. | Method for the preparation of microspheres which contain colloidal systems |
| CA2289702C (en) | 1997-05-14 | 2008-02-19 | Inex Pharmaceuticals Corp. | High efficiency encapsulation of charged therapeutic agents in lipid vesicles |
| US6048546A (en) | 1997-07-31 | 2000-04-11 | Sandia Corporation | Immobilized lipid-bilayer materials |
| US6060308A (en) | 1997-09-04 | 2000-05-09 | Connaught Laboratories Limited | RNA respiratory syncytial virus vaccines |
| US6009406A (en) | 1997-12-05 | 1999-12-28 | Square D Company | Methodology and computer-based tools for re-engineering a custom-engineered product line |
| GB9726555D0 (en) | 1997-12-16 | 1998-02-11 | Smithkline Beecham Plc | Vaccine |
| US6432925B1 (en) | 1998-04-16 | 2002-08-13 | John Wayne Cancer Institute | RNA cancer vaccine and methods for its use |
| WO2000000616A2 (en) | 1998-06-29 | 2000-01-06 | U.S. Medical Research Institute Of Infectious Diseases | Marburg virus vaccines |
| WO2000003683A2 (en) | 1998-07-20 | 2000-01-27 | Inex Pharmaceuticals Corporation | Liposomal encapsulated nucleic acid-complexes |
| WO2000039302A2 (en) | 1998-12-31 | 2000-07-06 | Chiron Corporation | Improved expression of hiv polypeptides and production of virus-like particles |
| ATE289630T1 (de) | 1999-09-09 | 2005-03-15 | Curevac Gmbh | Transfer von mrnas unter verwendung von polykationischen verbindungen |
| DE60038622D1 (de) | 1999-10-20 | 2008-05-29 | Univ Johns Hopkins Med | Chimäre immunogene zusammensetzungen und dafür kodierende nukleinsäure |
| US8541008B2 (en) | 1999-11-19 | 2013-09-24 | Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center | Pharmaceutical compositions and methods to vaccinate against candidiasis |
| US20030212022A1 (en) | 2001-03-23 | 2003-11-13 | Jean-Marie Vogel | Compositions and methods for gene therapy |
| EP1287015A1 (en) | 2000-04-18 | 2003-03-05 | Human Genome Sciences, Inc. | Extracellular matrix polynucleotides, polypeptides, and antibodies |
| CN1254234C (zh) | 2000-06-09 | 2006-05-03 | 莱古伦公司 | 质粒dna(lipogenestm)和含细胞核定位信号/促融合肽缀合物的治疗剂包封到定向脂质体复合体中 |
| WO2002002606A2 (en) | 2000-07-03 | 2002-01-10 | Chiron S.P.A. | Immunisation against chlamydia pneumoniae |
| US20040142474A1 (en) | 2000-09-14 | 2004-07-22 | Expression Genetics, Inc. | Novel cationic lipopolymer as a biocompatible gene delivery agent |
| MXPA03002640A (es) | 2000-09-28 | 2003-06-19 | Chiron Corp | Microparticulas para la distribucion de acidos nucleicos heterologos. |
| DK1328543T3 (da) | 2000-10-27 | 2009-11-23 | Novartis Vaccines & Diagnostic | Nukleinsyrer og proteiner fra streptococcus-gruppe A & B |
| US7731975B2 (en) | 2001-01-31 | 2010-06-08 | The United States Of America As Represented By The Secretary Of The Army | Chimeric filovirus glycoprotein |
| AU2002242016A1 (en) | 2001-02-01 | 2002-08-12 | The Johns Hopkins University | Nucleic acid derived vaccine that encodes an antigen linked to a polypeptide that promotes antigen presentation |
| US20030040498A1 (en) | 2001-03-14 | 2003-02-27 | Ansardi David Calvert | Oncolytic RNA replicons |
| JP2004535388A (ja) | 2001-04-30 | 2004-11-25 | ターゲティッド ジェネティクス コーポレイション | 脂質含有薬物送達複合体およびそれらの生成方法 |
| US20030077251A1 (en) | 2001-05-23 | 2003-04-24 | Nicolas Escriou | Replicons derived from positive strand RNA virus genomes useful for the production of heterologous proteins |
| ATE490267T1 (de) | 2001-06-05 | 2010-12-15 | Curevac Gmbh | Stabilisierte mrna mit erhöhtem g/c-gehalt, kodierend für ein virales antigen |
| JP2005506322A (ja) | 2001-08-31 | 2005-03-03 | カイロン ソチエタ ア レスポンサビリタ リミタータ | Helicobacterpyloriワクチン接種 |
| WO2003023026A1 (en) | 2001-09-06 | 2003-03-20 | Alphavax, Inc. | Alphavirus replicon vector systems |
| US20050163832A1 (en) | 2002-02-13 | 2005-07-28 | Vladimir Torchilin | Intracellular delivery of therapeutic agents |
| DE10207177A1 (de) | 2002-02-19 | 2003-09-04 | Novosom Ag | Fakultativ kationische Lipide |
| US7901708B2 (en) | 2002-06-28 | 2011-03-08 | Protiva Biotherapeutics, Inc. | Liposomal apparatus and manufacturing methods |
| EP1530585A2 (en) | 2002-08-22 | 2005-05-18 | Cytos Biotechnology AG | Inducible alphaviral/orip based gene expression system |
| EP2330194A3 (en) | 2002-09-13 | 2011-10-12 | Replicor, Inc. | Non-sequence complementary antiviral oligonucleotides |
| US20040208848A1 (en) * | 2002-12-13 | 2004-10-21 | Smith Jonathan F. | Multi-antigenic alphavirus replicon particles and methods |
| US8338583B2 (en) | 2003-02-04 | 2012-12-25 | Bar-Ilan University | Snornai-small nucleolar RNA degradation by RNA interference in trypanosomatids |
| US20040228842A1 (en) | 2003-02-27 | 2004-11-18 | Shan Lu | Compositions and methods for cytomegalovirus treatment |
| CN1791678A (zh) * | 2003-03-20 | 2006-06-21 | 阿尔法瓦克斯公司 | 改进的甲病毒复制子和辅助构建体 |
| DE10319208B4 (de) | 2003-04-29 | 2005-10-20 | Grenzebach Bsh Gmbh | Furniermessermaschine |
| CA2527301A1 (en) | 2003-05-30 | 2004-12-09 | Nippon Shinyaku Co., Ltd. | Oligonucleic acid-bearing composite and pharmaceutical composition containing the composite |
| CN1812809A (zh) | 2003-06-26 | 2006-08-02 | 希龙公司 | 用于沙眼衣原体的免疫原性组合物 |
| DE602004021260D1 (de) | 2003-07-11 | 2009-07-09 | Alphavax Inc | Cytomegalovirusimpfstoffe, die auf dem alphavirus basieren |
| US7368537B2 (en) | 2003-07-15 | 2008-05-06 | Id Biomedical Corporation Of Quebec | Subunit vaccine against respiratory syncytial virus infection |
| ES2559828T3 (es) | 2003-07-16 | 2016-02-16 | Protiva Biotherapeutics Inc. | ARN de interferencia encapsulado en lípidos |
| JP4875490B2 (ja) | 2003-07-31 | 2012-02-15 | ノバルティス バクシンズ アンド ダイアグノスティックス,インコーポレーテッド | StreptococcusPyogenesについての免疫原組成物 |
| EP1512393A1 (de) | 2003-09-08 | 2005-03-09 | BOEHRINGER INGELHEIM PHARMA GMBH & CO. KG | Verfahren zur Herstellung von homogenen Liposomen und Lipoplexen |
| WO2005046621A2 (en) | 2003-11-12 | 2005-05-26 | The United States Of America As Represented By The Secretary Of The Navy | Enhancement of vaccine-induced immune responses and protection by heterologous boosting with alphavirus replicon vaccines |
| US7303881B2 (en) | 2004-04-30 | 2007-12-04 | Pds Biotechnology Corporation | Antigen delivery compositions and methods of use |
| GB0410866D0 (en) | 2004-05-14 | 2004-06-16 | Chiron Srl | Haemophilius influenzae |
| EP1751289B1 (en) | 2004-05-18 | 2009-01-14 | Alphavax, Inc. | Tc-83-derived alphavirus vectors, particles and methods |
| US20090104226A1 (en) | 2004-05-21 | 2009-04-23 | Novartis Vaccines And Diagnostics Inc. | Alphavirus Vectors for Respiratory Pathogen Vaccines |
| GB0411428D0 (en) | 2004-05-21 | 2004-06-23 | Got A Gene Ab | Vectors |
| US7799565B2 (en) | 2004-06-07 | 2010-09-21 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering RNA |
| US7745651B2 (en) | 2004-06-07 | 2010-06-29 | Protiva Biotherapeutics, Inc. | Cationic lipids and methods of use |
| WO2006007712A1 (en) | 2004-07-19 | 2006-01-26 | Protiva Biotherapeutics, Inc. | Methods comprising polyethylene glycol-lipid conjugates for delivery of therapeutic agents |
| EP1794183A2 (en) | 2004-10-01 | 2007-06-13 | Novartis Vaccines and Diagnostics S.r.l. | Hepatitis c virus replication system |
| EP1811960A2 (en) | 2004-11-19 | 2007-08-01 | Novosom AG | Improvements in or relating to pharmaceutical compositions for local administration |
| GB2421025A (en) | 2004-12-09 | 2006-06-14 | Oxxon Therapeutics Ltd | HSV vaccination vectors |
| US7404969B2 (en) | 2005-02-14 | 2008-07-29 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| JP5042863B2 (ja) | 2005-02-14 | 2012-10-03 | サーナ・セラピューティクス・インコーポレイテッド | 生物学的に活性な分子をデリバリーするための脂質ナノ粒子系組成物および方法 |
| AU2006214064B2 (en) | 2005-02-18 | 2012-04-26 | J. Craig Venter Institute, Inc. | Proteins and nucleic acids from meningitis/sepsis-associated escherichia coli |
| NZ599345A (en) | 2005-02-18 | 2013-07-26 | Novartis Vaccines & Diagnostic | Immunogens from uropathogenic Escherichia Coli |
| AU2006219717B2 (en) | 2005-03-02 | 2009-05-21 | The Secretary Of State For Defence | Pharmaceutical composition |
| GB0504436D0 (en) | 2005-03-03 | 2005-04-06 | Glaxosmithkline Biolog Sa | Vaccine |
| CN101687025A (zh) | 2005-03-30 | 2010-03-31 | 诺华疫苗和诊断公司 | B型流感嗜血杆菌 |
| US7618393B2 (en) | 2005-05-03 | 2009-11-17 | Pharmajet, Inc. | Needle-less injector and method of fluid delivery |
| EP1891096A2 (en) | 2005-05-12 | 2008-02-27 | Novartis Vaccines and Diagnostics, Inc. | Immunogenic compositions for chlamydia trachomatis |
| US8703095B2 (en) | 2005-07-07 | 2014-04-22 | Sanofi Pasteur S.A. | Immuno-adjuvant emulsion |
| WO2007014754A1 (en) | 2005-08-02 | 2007-02-08 | I.D.M. Immuno-Designed Molecules | Process for the preparation of liposomal formulations |
| US7951384B2 (en) | 2005-08-05 | 2011-05-31 | University Of Massachusetts | Virus-like particles as vaccines for paramyxovirus |
| EP3611266B1 (en) | 2005-08-23 | 2022-11-09 | The Trustees of the University of Pennsylvania | Rna containing modified nucleosides and methods of use thereof |
| EP1764089A1 (en) | 2005-09-15 | 2007-03-21 | Novosom AG | Serum stable liposomes comprising amphoter II lipid mixtures |
| DE102005046490A1 (de) | 2005-09-28 | 2007-03-29 | Johannes-Gutenberg-Universität Mainz | Modifikationen von RNA, die zu einer erhöhten Transkriptstabilität und Translationseffizienz führen |
| ATE493405T1 (de) | 2005-09-29 | 2011-01-15 | Elan Pharm Inc | Pyrimidinylamidverbindungen, die die durch vla-4 vermittelte leukozytenadhäsion inhibieren |
| CA2626253A1 (en) | 2005-10-18 | 2007-04-26 | Novartis Vaccines And Diagnostics, Inc. | Mucosal and systemic immunizations with alphavirus replicon particles |
| JP2007112768A (ja) | 2005-10-24 | 2007-05-10 | Kyoto Univ | 肝指向性リポソーム組成物 |
| CA2627302A1 (en) | 2005-10-25 | 2007-05-03 | Novartis Vaccines And Diagnostics S.R.L. | Compositions comprising yersinia pestis antigens |
| CA2630220C (en) | 2005-11-22 | 2020-10-13 | Doris Coit | Norovirus and sapovirus antigens |
| WO2008051245A2 (en) | 2005-12-02 | 2008-05-02 | Novartis Ag | Nanoparticles for use in immunogenic compositions |
| EP2004141A2 (en) | 2006-03-17 | 2008-12-24 | Novosom AG | An efficient method for loading amphoteric liposomes with nucleic acid active substances |
| EP3031469B1 (en) | 2006-06-07 | 2023-08-23 | The Trustees Of Princeton University | Cytomegalovirus surface protein complex for use in vaccines and as a drug target |
| US7915399B2 (en) | 2006-06-09 | 2011-03-29 | Protiva Biotherapeutics, Inc. | Modified siRNA molecules and uses thereof |
| PL2035581T3 (pl) | 2006-06-21 | 2013-01-31 | Scripps Research Inst | Kompozycja DNA przeciwko FAP - antygenowi zrębowemu nowotworu i sposoby jej stosowania |
| WO2008020330A2 (en) | 2006-08-16 | 2008-02-21 | Novartis Ag | Immunogens from uropathogenic escherichia coli |
| ES2646545T3 (es) | 2006-09-07 | 2017-12-14 | Arthur E. Frankel | Métodos y composiciones basadas en conjugados de toxina diftérica-interleucina-3 |
| NZ575901A (en) | 2006-09-12 | 2012-04-27 | Alphavax Inc | Alphavirus replicon particles matched to protein antigens as immunological adjuvants |
| DE102007001370A1 (de) | 2007-01-09 | 2008-07-10 | Curevac Gmbh | RNA-kodierte Antikörper |
| US20100015218A1 (en) | 2007-02-16 | 2010-01-21 | Vasant Jadhav | Compositions and methods for potentiated activity of biologically active molecules |
| WO2008109806A2 (en) | 2007-03-08 | 2008-09-12 | Massachusetts Institute Of Technology | Electrostatic coating of particles for drug delivery |
| US8877206B2 (en) | 2007-03-22 | 2014-11-04 | Pds Biotechnology Corporation | Stimulation of an immune response by cationic lipids |
| AU2008232891B2 (en) | 2007-03-29 | 2012-01-12 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of a gene from the Ebola |
| US8748591B2 (en) | 2007-04-17 | 2014-06-10 | The Board Of Regents Of The University Of Texas System | Chimeric sindbis-western equine encephalitis virus and uses thereof |
| CA2686735A1 (en) | 2007-05-04 | 2008-11-13 | Mdrna, Inc. | Amino acid lipids and uses thereof |
| MX2009012635A (es) | 2007-05-23 | 2012-09-13 | Mannkind Corp | Vectores multicistronicos y metodos para su diseño. |
| DE102007029471A1 (de) | 2007-06-20 | 2008-12-24 | Novosom Ag | Neue fakultativ kationische Sterole |
| DK2947149T3 (en) | 2007-06-21 | 2018-06-06 | Alphavax Inc | ALPHAVIRUS REPLICATION PARTICLES FOR USE IN VACCINATION |
| US8202518B2 (en) | 2007-07-04 | 2012-06-19 | Ribovax Biotechnologies S.A. | Antibodies against human cytomegalovirus (HCMV) |
| GB0714963D0 (en) | 2007-08-01 | 2007-09-12 | Novartis Ag | Compositions comprising antigens |
| WO2009026328A2 (en) | 2007-08-21 | 2009-02-26 | Immune Disease Institute, Inc. | Methods of delivery of agents to leukocytes and endothelial cells |
| GB0717187D0 (en) | 2007-09-04 | 2007-10-17 | Novartis Ag | Compositions comprising yersinia pestis antigens |
| US20090162395A1 (en) | 2007-09-26 | 2009-06-25 | Crowe Jr James E | Vaccine for rsv and mpv |
| EP2042193A1 (en) | 2007-09-28 | 2009-04-01 | Biomay AG | RNA Vaccines |
| US20090091591A1 (en) | 2007-10-07 | 2009-04-09 | Yohanan Sivan | Printing Systems And Methods For Generating Relief Images |
| JP5627464B2 (ja) | 2007-11-26 | 2014-11-19 | ノバルティス アーゲー | アルファウイルス粒子を生成する方法 |
| EP2067749A1 (en) | 2007-11-29 | 2009-06-10 | Total Petrochemicals France | Process for purification of an aqueous phase containing polyaromatics |
| US20110165223A1 (en) | 2008-01-02 | 2011-07-07 | The Johns Hopkins University | Antitumor Immunization by Liposomal Delivery of Vaccine to the Spleen |
| WO2009086558A1 (en) | 2008-01-02 | 2009-07-09 | Tekmira Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
| ITMI20081249A1 (it) | 2008-07-09 | 2010-01-09 | Novartis Vaccines & Diagnostic | Immunogeni di escherichia coli con solubilità migliorata. |
| EP2268659A2 (en) | 2008-03-06 | 2011-01-05 | Novartis AG | Mutant forms of chlamydia htra |
| AU2009238175C1 (en) | 2008-04-15 | 2023-11-30 | Arbutus Biopharma Corporation | Novel lipid formulations for nucleic acid delivery |
| WO2009127230A1 (en) | 2008-04-16 | 2009-10-22 | Curevac Gmbh | MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION |
| WO2009132131A1 (en) | 2008-04-22 | 2009-10-29 | Alnylam Pharmaceuticals, Inc. | Amino lipid based improved lipid formulation |
| US20100040650A1 (en) | 2008-05-30 | 2010-02-18 | Crowe Jr James E | Virus-Like paramyxovirus particles and vaccines |
| EP2130912A1 (en) | 2008-06-04 | 2009-12-09 | Institut für Viruskrankeiten und Immunprophylaxe | Pestivirus replicons providing an RNA-based viral vector system |
| JP5712126B2 (ja) | 2008-06-25 | 2015-05-07 | ノバルティス アーゲー | 遅延型追加刺激免疫処置に対する迅速な応答 |
| EP2310494A1 (en) | 2008-06-25 | 2011-04-20 | ProBioGen AG | Cell line for propagation of highly attenuated alphaviruses |
| PE20141435A1 (es) | 2008-07-16 | 2014-10-22 | Inst Research In Biomedicine | Anticuerpos neutralizantes de citomegalovirus humano |
| EP2303923B1 (en) | 2008-07-16 | 2015-06-24 | Institute for Research in Biomedicine | Human cytomegalovirus neutralising antibodies and use thereof |
| JP2010025644A (ja) | 2008-07-16 | 2010-02-04 | Kochi Univ Of Technology | 硝酸イオンの呈色試薬並びにこれを用いた硝酸イオンの検出及び定量方法 |
| CA2733147A1 (en) * | 2008-08-06 | 2010-02-11 | Novartis Ag | Microparticles for use in immunogenic compositions |
| CL2008002322A1 (es) | 2008-08-07 | 2009-06-05 | Univ Concepcion | Formulacion farmaceutica veterinaria que comprende un sistema vectorial viral constituido por una particula recombinante de arn que codifica una cu/zn superoxido dismutasa de la bacteria patogena de bovinos brucella abortus, y al menos un alfavirus arn perteneciente a la familia del virus semliki forest (sfv), util como vacuna. |
| WO2010019718A2 (en) | 2008-08-13 | 2010-02-18 | California Institute Of Technology | Carrier nanoparticles and related compositions, methods and systems |
| US20110177122A1 (en) | 2008-09-26 | 2011-07-21 | The United States Of America, As Represented By The Secretary, Dept. Of Health & Human Services | Dna prime/activated vaccine boost immunization to influenza virus |
| CN104119242B (zh) | 2008-10-09 | 2017-07-07 | 泰米拉制药公司 | 改善的氨基脂质和递送核酸的方法 |
| ES2646630T3 (es) | 2008-11-07 | 2017-12-14 | Massachusetts Institute Of Technology | Lipidoides aminoalcohólicos y usos de los mismos |
| HUE037082T2 (hu) | 2008-11-10 | 2018-08-28 | Arbutus Biopharma Corp | Új lipidek és készítmények terápiás hatóanyagok szállítására |
| US20120093855A1 (en) | 2008-11-18 | 2012-04-19 | Ligocyte Pharmaceuticals, Inc. | RSV F VLPs AND METHODS OF MANUFACTURE AND USE THEREOF |
| EP3243504A1 (en) | 2009-01-29 | 2017-11-15 | Arbutus Biopharma Corporation | Improved lipid formulation |
| MX2011010735A (es) | 2009-04-14 | 2012-01-25 | Novartis Ag | Composiciones para inmunizacion contra staphylococcus aureus. |
| JP5889783B2 (ja) | 2009-05-05 | 2016-03-22 | テクミラ ファーマシューティカルズ コーポレイションTekmira Pharmaceuticals Corporation | 免疫細胞へオリゴヌクレオチドを送達する方法 |
| MX342785B (es) | 2009-06-10 | 2016-10-12 | Alnylam Pharmaceuticals Inc | Formulacion mejorada de lipido. |
| ES2613498T3 (es) | 2009-07-01 | 2017-05-24 | Protiva Biotherapeutics Inc. | Nuevas formulaciones de lípidos para el suministro de agentes terapéuticos a tumores sólidos |
| WO2011001780A1 (ja) | 2009-07-02 | 2011-01-06 | コニカミノルタホールディングス株式会社 | 特定分散剤を含有する外水相を利用する二段階乳化法によるリポソームの製造方法、ならびに当該リポソームの製造方法を用いるリポソーム分散液またはその乾燥粉末の製造方法およびそれにより製造されるリポソーム分散液またはその乾燥粉末 |
| US8277919B2 (en) | 2009-07-23 | 2012-10-02 | VMO Systems, Inc. | Reflective coating for an optical disc |
| BR112012002291A2 (pt) | 2009-07-31 | 2016-11-29 | Ethris Gmbh | "polirribonucleotídeo com uma sequência que codifica uma proteína ou fragmento de proteína, implante, e, processo para a seleção de sequências de nucleotídeos" |
| ES2443952T3 (es) * | 2009-09-02 | 2014-02-21 | Novartis Ag | Composiciones inmunógenas que incluyen moduladores de la actividad de TLR |
| JO3257B1 (ar) * | 2009-09-02 | 2018-09-16 | Novartis Ag | مركبات وتركيبات كمعدلات لفاعلية tlr |
| US20110070260A1 (en) * | 2009-09-09 | 2011-03-24 | Baric Ralph S | Multivalent Immunogenic Compositions Against Noroviruses and Methods of Use |
| CA2816925C (en) | 2009-11-04 | 2023-01-10 | The University Of British Columbia | Nucleic acid-containing lipid particles and related methods |
| HUE042177T2 (hu) | 2009-12-01 | 2019-06-28 | Translate Bio Inc | Szteroidszármazék mRNS szállítására humán genetikai betegségekben |
| WO2011071860A2 (en) | 2009-12-07 | 2011-06-16 | Alnylam Pharmaceuticals, Inc. | Compositions for nucleic acid delivery |
| KR20240136456A (ko) | 2009-12-07 | 2024-09-13 | 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 | 세포 리프로그래밍을 위한 정제된 변형 rna를 포함하는 rna 제제 |
| CA2784568A1 (en) | 2009-12-18 | 2011-06-23 | The University Of British Columbia | Lipid particles for delivery of nucleic acids |
| WO2011076807A2 (en) | 2009-12-23 | 2011-06-30 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
| ES2536429T3 (es) * | 2010-01-24 | 2015-05-25 | Novartis Ag | Micropartículas de polímero biodegradables irradiadas |
| US20130195961A1 (en) | 2010-03-09 | 2013-08-01 | Kejian Yang | Novel mucosal vaccination approach for herpes simplex virus type-2 |
| HUE047796T2 (hu) | 2010-07-06 | 2020-05-28 | Glaxosmithkline Biologicals Sa | RNS bevitele több immunútvonal bekapcsolására |
| RS63817B1 (sr) | 2010-07-06 | 2023-01-31 | Glaxosmithkline Biologicals Sa | Čestice za isporuku slične virionu za molekule samoreplicirajuće rnk |
| US9770463B2 (en) | 2010-07-06 | 2017-09-26 | Glaxosmithkline Biologicals Sa | Delivery of RNA to different cell types |
| PL2591114T3 (pl) | 2010-07-06 | 2017-08-31 | Glaxosmithkline Biologicals Sa | Immunizacja dużych ssaków małymi dawkami rna |
| HUE026646T2 (en) | 2010-07-06 | 2016-07-28 | Glaxosmithkline Biologicals Sa | Preferred liposomes containing lipids of PKA value for delivery of RNA |
| EP2590625B1 (en) * | 2010-07-06 | 2017-09-20 | GlaxoSmithKline Biologicals SA | Cationic oil-in-water emulsions |
| US9192661B2 (en) * | 2010-07-06 | 2015-11-24 | Novartis Ag | Delivery of self-replicating RNA using biodegradable polymer particles |
| AU2011276328C1 (en) * | 2010-07-06 | 2016-01-21 | Novartis Ag | Norovirus derived immunogenic compositions and methods |
| US8898852B2 (en) | 2010-08-04 | 2014-12-02 | Honeywell International Inc. | Air burst to clear detection window |
| WO2012019168A2 (en) | 2010-08-06 | 2012-02-09 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| ES2727583T3 (es) | 2010-08-31 | 2019-10-17 | Glaxosmithkline Biologicals Sa | Lípidos adecuados para la administración liposómica de ARN que codifica proteínas |
| RS63890B1 (sr) | 2010-08-31 | 2023-02-28 | Glaxosmithkline Biologicals Sa | Mali lipozomi za isporuku rnk koja kodira imunogen |
| PT3970742T (pt) | 2010-08-31 | 2022-06-27 | Glaxosmithkline Biologicals Sa | Lipossomas peguilados para entrega de arn codificador de imunogénio |
| US20130164289A1 (en) * | 2010-09-09 | 2013-06-27 | Virginia Commonwealth University | Human cytomegalovirus vaccine |
| RU2013120302A (ru) | 2010-10-01 | 2014-11-20 | Модерна Терапьютикс, Инк. | Сконструированные нуклеиновые кислоты и способы их применения |
| JP2013544504A (ja) | 2010-10-11 | 2013-12-19 | ノバルティス アーゲー | 抗原送達プラットフォーム |
| MX341185B (es) | 2010-10-25 | 2016-08-09 | Stepan Co | Aminas grasas cuaternizadas, amidoaminas, y sus derivados de la metatesis de aceite natural. |
| US20120177701A1 (en) | 2010-12-31 | 2012-07-12 | Selecta Biosciences, Inc. | Compositions comprising immunostimulatory nucleic acids and related methods |
| AU2012211278B2 (en) * | 2011-01-26 | 2016-11-10 | Glaxosmithkline Biologicals Sa | RSV immunization regimen |
| JP6099573B2 (ja) | 2011-01-31 | 2017-03-22 | ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア | 新規なヘルペス抗原をコードする核酸分子、それを含むワクチン及びその使用方法 |
| WO2012116714A1 (en) | 2011-03-02 | 2012-09-07 | Curevac Gmbh | Vaccination in elderly patients |
| EP2691101A2 (en) | 2011-03-31 | 2014-02-05 | Moderna Therapeutics, Inc. | Delivery and formulation of engineered nucleic acids |
| DK2707385T3 (da) * | 2011-05-13 | 2017-11-20 | Glaxosmithkline Biologicals Sa | RSV-F-præfusionsantigener |
| WO2012158736A1 (en) | 2011-05-17 | 2012-11-22 | modeRNA Therapeutics | Engineered nucleic acids and methods of use thereof for non-human vertebrates |
| EP3354644A1 (en) | 2011-06-08 | 2018-08-01 | Translate Bio, Inc. | Cleavable lipids |
| PL3586861T3 (pl) | 2011-06-08 | 2022-05-23 | Translate Bio, Inc. | Kompozycje nanocząstek lipidowych i sposoby dostarczania mrna |
| US11058762B2 (en) | 2011-07-06 | 2021-07-13 | Glaxosmithkline Biologicals Sa | Immunogenic compositions and uses thereof |
| CA2840965C (en) | 2011-07-06 | 2021-03-02 | Novartis Ag | Cationic oil-in-water emulsions |
| WO2013006838A1 (en) * | 2011-07-06 | 2013-01-10 | Novartis Ag | Immunogenic combination compositions and uses thereof |
| SG10201605512WA (en) * | 2011-07-06 | 2016-09-29 | Novartis Ag | Oil-in-water emulsions that contain nucleic acids |
| US20140141070A1 (en) | 2011-07-06 | 2014-05-22 | Andrew Geall | Liposomes having useful n:p ratio for delivery of rna molecules |
| EP3508220A1 (en) | 2011-08-31 | 2019-07-10 | GlaxoSmithKline Biologicals S.A. | Pegylated liposomes for delivery of immunogen-encoding rna |
| EP3384938A1 (en) | 2011-09-12 | 2018-10-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| RU2648950C2 (ru) | 2011-10-03 | 2018-04-02 | Модерна Терапьютикс, Инк. | Модифицированные нуклеозиды, нуклеотиды и нуклеиновые кислоты и их применение |
| BR112014008694A2 (pt) * | 2011-10-11 | 2017-06-20 | Novartis Ag | moléculas de ácido nucleico policistrônico recombinante |
| WO2013054199A2 (en) * | 2011-10-12 | 2013-04-18 | Novartis Ag | Cmv antigens and uses thereof |
| US20140378538A1 (en) | 2011-12-14 | 2014-12-25 | Moderma Therapeutics, Inc. | Methods of responding to a biothreat |
| CN104114572A (zh) | 2011-12-16 | 2014-10-22 | 现代治疗公司 | 经修饰的核苷、核苷酸和核酸组合物 |
| JP2015510495A (ja) | 2011-12-21 | 2015-04-09 | モデルナ セラピューティクス インコーポレイテッドModerna Therapeutics,Inc. | 器官または器官移植片の生存可能性または寿命を延長する方法 |
| AU2013243948A1 (en) | 2012-04-02 | 2014-10-30 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with human disease |
| CA2868391A1 (en) | 2012-04-02 | 2013-10-10 | Stephane Bancel | Polynucleotides comprising n1-methyl-pseudouridine and methods for preparing the same |
| WO2014081507A1 (en) | 2012-11-26 | 2014-05-30 | Moderna Therapeutics, Inc. | Terminally modified rna |
| EP2943221A1 (en) * | 2013-01-10 | 2015-11-18 | Novartis AG | Influenza virus immunogenic compositions and uses thereof |
| US9504747B2 (en) * | 2013-03-08 | 2016-11-29 | Novartis Ag | Lipids and lipid compositions for the delivery of active agents |
| EP2971010B1 (en) | 2013-03-14 | 2020-06-10 | ModernaTX, Inc. | Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions |
| WO2014160243A1 (en) | 2013-03-14 | 2014-10-02 | The Trustees Of The University Of Pennsylvania | Purification and purity assessment of rna molecules synthesized with modified nucleosides |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| ES2895651T3 (es) | 2013-12-19 | 2022-02-22 | Novartis Ag | Lípidos y composiciones lipídicas para la administración de agentes activos |
| EP4286012A3 (en) | 2015-09-17 | 2024-05-29 | ModernaTX, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| IL307179A (en) | 2015-10-28 | 2023-11-01 | Acuitas Therapeutics Inc | Novel lipids and lipid nanoparticle formulations for delivery of nucleic acids |
| MX2019005470A (es) | 2016-11-10 | 2019-11-21 | Translate Bio Inc | Formulación de nanopartículas lipídicas basadas en ice mejorada para el suministro de arnm. |
| US11045540B2 (en) | 2017-03-15 | 2021-06-29 | Modernatx, Inc. | Varicella zoster virus (VZV) vaccine |
| MX2021005969A (es) | 2018-11-21 | 2021-09-14 | Translate Bio Inc | Tratamiento de la fibrosis quística mediante el suministro de arnm que codifica cftr nebulizado. |
| US12533318B2 (en) | 2019-08-30 | 2026-01-27 | Glaxosmithkline Biologicals Sa | Jet mixing lipid nanoparticle manufacturing process |
| DE102019214469A1 (de) | 2019-09-23 | 2021-03-25 | Henkel Ag & Co. Kgaa | Kit und Verfahren zum Färben von keratinischem Material mit Aminosilikon und farbgebender Verbindung |
| WO2022137133A1 (en) | 2020-12-22 | 2022-06-30 | Curevac Ag | Rna vaccine against sars-cov-2 variants |
-
2012
- 2012-07-06 WO PCT/US2012/045847 patent/WO2013006838A1/en not_active Ceased
- 2012-07-06 JP JP2014519089A patent/JP2014522842A/ja active Pending
- 2012-07-06 CA CA2840989A patent/CA2840989A1/en not_active Abandoned
- 2012-07-06 US US14/130,899 patent/US11896636B2/en active Active
- 2012-07-06 EP EP12735420.7A patent/EP2729165B1/en not_active Revoked
- 2012-07-06 ES ES12735420.7T patent/ES2656050T3/es active Active
- 2012-07-06 EP EP21152462.4A patent/EP3854413A1/en active Pending
- 2012-07-06 EP EP17200076.2A patent/EP3332802A1/en not_active Withdrawn
-
2023
- 2023-09-07 US US18/463,099 patent/US20240082329A1/en active Pending
Patent Citations (94)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4186745A (en) | 1976-07-30 | 1980-02-05 | Kauzlarich James J | Porous catheters |
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US4500707A (en) | 1980-02-29 | 1985-02-19 | University Patents, Inc. | Nucleosides useful in the preparation of polynucleotides |
| US5132418A (en) | 1980-02-29 | 1992-07-21 | University Patents, Inc. | Process for preparing polynucleotides |
| US4973679A (en) | 1981-03-27 | 1990-11-27 | University Patents, Inc. | Process for oligonucleo tide synthesis using phosphormidite intermediates |
| US4668777A (en) | 1981-03-27 | 1987-05-26 | University Patents, Inc. | Phosphoramidite nucleoside compounds |
| US4373071A (en) | 1981-04-30 | 1983-02-08 | City Of Hope Research Institute | Solid-phase synthesis of polynucleotides |
| EP0109942A2 (en) | 1982-10-18 | 1984-05-30 | Bror Morein | Immunogenic protein or peptide complex, method of producing said complex and the use thereof as an immune stimulant and as a vaccine |
| US4689338A (en) | 1983-11-18 | 1987-08-25 | Riker Laboratories, Inc. | 1H-Imidazo[4,5-c]quinolin-4-amines and antiviral use |
| US5916588A (en) | 1984-04-12 | 1999-06-29 | The Liposome Company, Inc. | Peptide-containing liposomes, immunogenic liposomes and methods of preparation and use |
| US6090406A (en) | 1984-04-12 | 2000-07-18 | The Liposome Company, Inc. | Potentiation of immune responses with liposomal adjuvants |
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5036006A (en) | 1984-11-13 | 1991-07-30 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5142047A (en) | 1985-03-15 | 1992-08-25 | Anti-Gene Development Group | Uncharged polynucleotide-binding polymers |
| US5153319A (en) | 1986-03-31 | 1992-10-06 | University Patents, Inc. | Process for preparing polynucleotides |
| US6048729A (en) | 1987-05-01 | 2000-04-11 | Transkaryotic Therapies, Inc. | In vivo protein production and delivery system for gene therapy |
| US5057540A (en) | 1987-05-29 | 1991-10-15 | Cambridge Biotech Corporation | Saponin adjuvant |
| EP0329181A2 (en) | 1988-02-19 | 1989-08-23 | Sanyo Electric Co., Ltd. | Device for driving reel supports |
| EP0626169A2 (en) | 1988-08-25 | 1994-11-30 | The Liposome Company, Inc. | A dosage form comprising an antigen and a salt form of an organic acid derivative of a sterol |
| US5238944A (en) | 1988-12-15 | 1993-08-24 | Riker Laboratories, Inc. | Topical formulations and transdermal delivery systems containing 1-isobutyl-1H-imidazo[4,5-c]quinolin-4-amine |
| US5262530A (en) | 1988-12-21 | 1993-11-16 | Applied Biosystems, Inc. | Automated system for polynucleotide synthesis and purification |
| US5047524A (en) | 1988-12-21 | 1991-09-10 | Applied Biosystems, Inc. | Automated system for polynucleotide synthesis and purification |
| US5580859A (en) | 1989-03-21 | 1996-12-03 | Vical Incorporated | Delivery of exogenous DNA sequences in a mammal |
| US4929624A (en) | 1989-03-23 | 1990-05-29 | Minnesota Mining And Manufacturing Company | Olefinic 1H-imidazo(4,5-c)quinolin-4-amines |
| US6451325B1 (en) | 1989-05-25 | 2002-09-17 | Chiron Corporation | Adjuvant formulation comprising a submicron oil droplet emulsion |
| US6299884B1 (en) | 1989-05-25 | 2001-10-09 | Chiron Corporation | Adjuvant formulation comprising a submicron oil droplet emulsion |
| WO1990014837A1 (en) | 1989-05-25 | 1990-12-13 | Chiron Corporation | Adjuvant formulation comprising a submicron oil droplet emulsion |
| US5674192A (en) | 1990-12-28 | 1997-10-07 | Boston Scientific Corporation | Drug delivery |
| US5389640A (en) | 1991-03-01 | 1995-02-14 | Minnesota Mining And Manufacturing Company | 1-substituted, 2-substituted 1H-imidazo[4,5-c]quinolin-4-amines |
| US5346905A (en) | 1991-09-04 | 1994-09-13 | Minnesota Mining And Manufacturing Company | 1-substituted 1H-imidazo-[4,5-C]quinolin-4-amines |
| US5268376A (en) | 1991-09-04 | 1993-12-07 | Minnesota Mining And Manufacturing Company | 1-substituted 1H-imidazo[4,5-c]quinolin-4-amines |
| US5525612A (en) | 1991-09-04 | 1996-06-11 | Minnesota Mining And Manufacturing Company | 1-substituted 1H-imidazo-[4,5-c]quinolin-4-amines |
| US6048524A (en) | 1991-11-05 | 2000-04-11 | Transkaryotic Therapies, Inc. | In vivo production and delivery of erythropoietin for gene therapy |
| US6054288A (en) | 1991-11-05 | 2000-04-25 | Transkaryotic Therapies, Inc. | In vivo protein production and delivery system for gene therapy |
| US5266575A (en) | 1991-11-06 | 1993-11-30 | Minnesota Mining And Manufacturing Company | 2-ethyl 1H-imidazo[4,5-ciquinolin-4-amines |
| US5830510A (en) | 1992-05-15 | 1998-11-03 | North Carolina State University | Veterinary pharmaceutical formulation containing avian embryonic stem cells |
| US5656479A (en) | 1992-05-15 | 1997-08-12 | North Carolina State University | Avian embryonic stem cells |
| US5340740A (en) | 1992-05-15 | 1994-08-23 | North Carolina State University | Method of producing an avian embryonic stem cell culture and the avian embryonic stem cell culture produced by the process |
| US5395937A (en) | 1993-01-29 | 1995-03-07 | Minnesota Mining And Manufacturing Company | Process for preparing quinoline amines |
| EP0689454A1 (en) | 1993-03-23 | 1996-01-03 | Smithkline Beecham Biolog | VACCINE COMPOSITIONS CONTAINING 3-O DESACETYL MONOPHOSPHORYLIC LIPID |
| US5352784A (en) | 1993-07-15 | 1994-10-04 | Minnesota Mining And Manufacturing Company | Fused cycloalkylimidazopyridines |
| US5494916A (en) | 1993-07-15 | 1996-02-27 | Minnesota Mining And Manufacturing Company | Imidazo[4,5-C]pyridin-4-amines |
| US5397307A (en) | 1993-12-07 | 1995-03-14 | Schneider (Usa) Inc. | Drug delivery PTCA catheter and method for drug delivery |
| WO1995017211A1 (en) | 1993-12-22 | 1995-06-29 | Biocine S.P.A. | Non-toxic mucosal adjuvant |
| US5547472A (en) | 1994-01-20 | 1996-08-20 | Terumo Kabushiki Kaisha | Catheter with medicament injection pores |
| US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US6429199B1 (en) | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| WO1996011711A1 (en) | 1994-10-12 | 1996-04-25 | Iscotec Ab | Saponin preparations and use thereof in iscoms |
| US6500668B2 (en) | 1994-10-21 | 2002-12-31 | Jacques Samarut | Culture medium for avian embryonic cells |
| US6114168A (en) | 1994-10-21 | 2000-09-05 | Institute National De La Recherche Agronomique | Active retinoic acid-free culture medium for chicken embryonic stem cells |
| EP0787180B1 (fr) | 1994-10-21 | 2002-09-04 | Institut National De La Recherche Agronomique (Inra) | Milieu de culture de cellules embryonnaires totipotentes aviaires, depourvu d'acide retinoique actif |
| US6083741A (en) | 1994-11-17 | 2000-07-04 | Imperial College Of Science Technology And Medicine | Internalisation of DNA, using conjugates of poly-l-lysine and an integrin receptor ligand |
| US6071890A (en) | 1994-12-09 | 2000-06-06 | Genzyme Corporation | Organ-specific targeting of cationic amphiphile/DNA complexes for gene therapy |
| US5482936A (en) | 1995-01-12 | 1996-01-09 | Minnesota Mining And Manufacturing Company | Imidazo[4,5-C]quinoline amines |
| WO1996033739A1 (en) | 1995-04-25 | 1996-10-31 | Smithkline Beecham Biologicals S.A. | Vaccines containing a saponin and a sterol |
| US5700642A (en) | 1995-05-22 | 1997-12-23 | Sri International | Oligonucleotide sizing using immobilized cleavable primers |
| WO1997028818A1 (en) | 1996-02-12 | 1997-08-14 | Cobra Therapeutics Limited | Novel methods of vaccination and vaccines therefore comprising a nucleic acid encoding a first epitope and a peptide containing a second epitope |
| WO1998040100A1 (en) | 1997-03-10 | 1998-09-17 | Ottawa Civic Loeb Research Institute | USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE AS AN ADJUVANT |
| WO1998042375A1 (en) | 1997-03-21 | 1998-10-01 | Chiron Corporation | Detoxified mutants of bacterial adp-ribosylating toxins as parenteral adjuvants |
| US6090619A (en) | 1997-09-08 | 2000-07-18 | University Of Florida | Materials and methods for intracellular delivery of biologically active molecules |
| US6129705A (en) | 1997-10-01 | 2000-10-10 | Medtronic Ave, Inc. | Drug delivery and gene therapy delivery system |
| WO1999027960A1 (en) | 1997-11-28 | 1999-06-10 | West Pharmaceutical Services | Vaccine compositions for mucosal administration comprising chitosan |
| WO1999052549A1 (en) | 1998-04-09 | 1999-10-21 | Smithkline Beecham Biologicals S.A. | Adjuvant compositions |
| WO1999062923A2 (en) | 1998-06-05 | 1999-12-09 | Dynavax Technologies Corporation | Immunostimulatory oligonucleotides with modified bases and methods of use thereof |
| WO2000007621A2 (en) | 1998-08-05 | 2000-02-17 | Smithkline Beecham Biologicals S.A. | Vaccine comprising an iscom consisting of sterol and saponin which is free of additional detergent |
| WO2000023105A2 (en) | 1998-10-16 | 2000-04-27 | Smithkline Beecham Biologicals S.A. | Adjuvant systems and vaccines |
| WO2001021152A1 (en) | 1999-09-24 | 2001-03-29 | Smithkline Beecham Biologicals S.A. | Adjuvant comprising a polyxyethylene alkyl ether or ester and at least one nonionic surfactant |
| WO2001021207A2 (en) | 1999-09-24 | 2001-03-29 | Smithkline Beecham Biologicals S.A. | Use of combination of polyoxyethylene sorbitan ester and octoxynol as adjuvant and its use in vaccines |
| WO2001095935A1 (en) | 2000-01-20 | 2001-12-20 | Ottawa Health Research Institute | Immunostimulatory nucleic acids for inducing a th2 immune response |
| WO2002009645A2 (en) * | 2000-08-01 | 2002-02-07 | The Johns Hopkins University | Intercellular transport protein linked to an antigen as a molecular vaccine |
| WO2002026757A2 (en) | 2000-09-26 | 2002-04-04 | Hybridon, Inc. | Modulation of immunostimulatory activity of immunostimulatory oligonucleotide analogs by positional chemical changes |
| WO2003024481A2 (en) | 2001-09-14 | 2003-03-27 | Cytos Biotechnology Ag | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
| WO2003024480A2 (en) | 2001-09-14 | 2003-03-27 | Cytos Biotechnology Ag | In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles |
| WO2003035836A2 (en) | 2001-10-24 | 2003-05-01 | Hybridon Inc. | Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5' ends |
| WO2003043415A1 (fr) | 2001-11-22 | 2003-05-30 | Vivalis | Systeme d'expression de proteines exogenes dans un systeme aviaire |
| WO2003076601A1 (fr) | 2002-03-08 | 2003-09-18 | Vivalis | Lignées de cellules aviaires utiles pour la production de substances d'intérêt |
| US7604803B2 (en) | 2002-07-05 | 2009-10-20 | Lipoxen Technologies Limited | Method to enhance an immune response of nucleic acid vaccination |
| US20080085870A1 (en) | 2002-12-23 | 2008-04-10 | Vical Incorporated | Codon-optimized polynucleotide-based vaccines against human cytomegalovirus infection |
| WO2004060308A2 (en) | 2002-12-27 | 2004-07-22 | Chiron Corporation | Thiosemicarbazones as anti-virals and immunopotentiators |
| WO2004064759A2 (en) | 2003-01-21 | 2004-08-05 | Chiron Corporation | Use of tryptanthrin compounds for immune potentiation |
| WO2005042728A2 (en) | 2003-11-03 | 2005-05-12 | Probiogen Ag | Immortalized avian cell lines for virus production |
| US20080057080A1 (en) | 2004-05-18 | 2008-03-06 | Vical Incorporated | Influenza virus vaccine composition and methods of use |
| US7862829B2 (en) | 2004-07-09 | 2011-01-04 | University Of North Carolina At Chapel Hill | Viral adjuvants |
| US20070286870A1 (en) | 2004-09-23 | 2007-12-13 | Intercell Ag | Modified Vp1-Capsid Protein Of Parvovirus B19 |
| EP1791858A2 (en) | 2004-09-24 | 2007-06-06 | Intercell AG | Modified vp1-capsid protein of parvovirus b19 |
| WO2006032697A2 (en) | 2004-09-24 | 2006-03-30 | Intercell Ag | MODIFIED VPl-CAPSID PROTEIN OF PARVOVIRUS B19 |
| WO2009074861A2 (en) | 2007-12-10 | 2009-06-18 | Powderject Research Limited | Improved vaccine |
| WO2009111337A1 (en) | 2008-03-03 | 2009-09-11 | Irm Llc | Compounds and compositions as tlr activity modulators |
| WO2009132206A1 (en) | 2008-04-25 | 2009-10-29 | Liquidia Technologies, Inc. | Compositions and methods for intracellular delivery and release of cargo |
| WO2011005799A2 (en) | 2009-07-06 | 2011-01-13 | Novartis Ag | Self replicating rna molecules and uses thereof |
| WO2011008974A2 (en) | 2009-07-15 | 2011-01-20 | Novartis Ag | Rsv f protein compositions and methods for making same |
| WO2011127316A1 (en) * | 2010-04-07 | 2011-10-13 | Novartis Ag | Method for generating a parvovirus b19 virus-like particle |
Non-Patent Citations (86)
| Title |
|---|
| "Current Protocols in Molecular Biology", vol. 2, 1988, GREENE PUBLISH. ASSOC. & WILEY INTERSCIENCE |
| "Functional Polymer Colloids and Microparticles", vol. 4, 2002, CITUS BOOKS |
| "Liposome Technology", vol. I, II &, 2006, INFORMA HEALTHCARE |
| "Liposomes: Methods and Protocols, Volume 1: Pharmaceutical Nanocarriers: Methods and Protocols", 2009, HUMANA PRESS |
| "Microparticulate Systems for the Delivery of Proteins and Vaccines", 1996, CRC PRESS |
| "Polymers in Drug Delivery", 2006, CRC PRESS |
| "The Molecular Biology of the Yeast Saccharomyces", vol. I, II, 1982, COLD SPRING HARBOR PRESS |
| "Yeast Genetic Engineering", 1989, BUTTERWORTHS |
| AKDIS ET AL., EUR. J. IMMUNOLOGY, vol. 33, 2003, pages 2717 - 26 |
| ANDRIANOV ET AL., BIOMATERIALS, vol. 19, no. 1-3, 1998, pages 109 - 115 |
| BARR ET AL., ADV. DRUG DEL. REV., vol. 32, 1998, pages 247 - 271 |
| BASCHANG ET AL., TETRAHEDRON, vol. 45, no. 20, 1989, pages 6331 - 6360 |
| BEAUCAGE S L ET AL., TETRAHEDRON LETT, vol. 22, 1981, pages 1859 |
| BEIGNON ET AL., INFECT. IMMUN., vol. 70, no. 6, 2002, pages 3012 - 3019 |
| BERGLUND ET AL., NAT. BIOTECH., vol. 16, 1998, pages 562 - 565 |
| BERNSTEIN D I ET AL: "Randomized, double-blind, Phase 1 trial of an alphavirus replicon vaccine for cytomegalovirus in CMV seronegative adult volunteers", VACCINE, ELSEVIER LTD, GB, vol. 28, no. 2, 11 December 2009 (2009-12-11), pages 484 - 493, XP026791388, ISSN: 0264-410X, [retrieved on 20091024] * |
| BHAGAT ET AL., BBRC, vol. 300, 2003, pages 853 - 861 |
| BITTER ET AL., METHODS IN ENZYMOLOGY, vol. 153, 1987, pages 516 - 544 |
| BLACKWELL ET AL., J. IMMUNOL., vol. 170, no. 8, 2003, pages 4061 - 4068 |
| CHOWDARY ET AL., NATURE STRUCTURAL & MOLECULAR BIOLOGY, vol. 17, 2010, pages 882 - 888 |
| CORCORAN ET AL., J. MED. MICROB., 2004 |
| CURIEL ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 8850 |
| DOMENIGHINI ET AL., MOL. MICROBIOL., vol. 15, no. 6, 1995, pages 1165 - 1167 |
| DUBENSKY ET AL., J. VIROL., vol. 70, 1996, pages 508 - 519 |
| FLEETON M N ET AL: "Self-replicative RNA vaccines elicit protection against influenza A virus, respiratory syncytial virus, and a tickborne encephalitis virus", JOURNAL OF INFECTIOUS DISEASES, UNIVERSITY OF CHICAGO PRESS, CHICAGO, IL, vol. 183, no. 9, 1 May 2001 (2001-05-01), pages 1395 - 1398, XP002224503, ISSN: 0022-1899, DOI: 10.1086/319857 * |
| FREY ET AL., VACCINE, vol. 21, 2003, pages 4234 - 4237 |
| FROEHLER B C ET AL., NUCL ACID RES, vol. 14, 1986, pages 5399 - 407 |
| GAFFNEY B L ET AL., TETRAHEDRON LETT, vol. 29, 1988, pages 2619 - 22 |
| GAREGG P ET AL., TETRAHEDRON LETT, vol. 27, 1986, pages 4051 - 4 |
| GAREGG P ET AL., TETRAHEDRON LETT, vol. 27, 1986, pages 4055 - 8 |
| GERBER ET AL., J. VIROL., vol. 75, no. 10, 2001, pages 4752 - 4760 |
| GLOVER: "DNA Cloning", vol. II, 1986, IRL PRESS |
| GOODCHILD J, BIOCONJUGATE CHEM, vol. 1, 1990, pages 165 |
| GURSEL, M. ET AL., VACCINE, vol. 17, 1999, pages 1376 - 1383 |
| HANTKE ET AL., EUR. J. BIOCHEM., vol. 34, 1973, pages 284 - 296 |
| HARIHARAN ET AL., J. VIROL., vol. 72, 1998, pages 950 - 958 |
| HEYES ET AL., J CONTROLLED RELEASE, vol. 107, 2005, pages 276 - 87 |
| JOHNSON ET AL., BIOORG. MED. CHEM. LETT., vol. 9, 1999, pages 2273 - 2278 |
| JONES, CURR. OPIN. INVESTIG. DRUGS, vol. 4, no. 2, 2003, pages 214 - 218 |
| KANDIMALLA ET AL., BBRC, vol. 306, 2003, pages 948 - 953 |
| KANDIMALLA ET AL., BIOCHEM. SOC. TRANS., vol. 3, 2003, pages 664 - 658 |
| KANDIMALLA ET AL., BIOCHEM. SOC. TRANS., vol. 31, 2003, pages 654 - 658 |
| KANDIMALLA ET AL., NUCL. ACIDS RES., vol. 31, no. 9, 2003, pages 2393 - 2400 |
| KIM ET AL., J MED VIROL, vol. 79, 2007, pages 820 - 828 |
| KLINMAN, D. M. ET AL., VACCINE, vol. 17, 1999, pages 19 - 25 |
| KRIEG, NAT. MED., vol. 9, no. 7, 2003, pages 831 - 835 |
| KRIEG, TRENDS IMMUNOL., vol. 23, no. 2, 2002, pages 64 - 65 |
| LENZ ET AL., J. IMMUNOL., vol. 166, no. 9, 2001, pages 5346 - 5355 |
| LILJESTROM, BIO/TECHNOLOGY, vol. 9, 1991, pages 1356 - 1361 |
| LIMBACH ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, no. 12, 1994, pages 2183 - 2196 |
| MASUDA ET AL., NUCLEIC ACIDS SYMPOSIUM SERIES, vol. 51, 2007, pages 3 - 4 |
| MCCLUSKIE ET AL., FEMS IMMUNOL. MED. MICROBIOL., vol. 32, 2002, pages 179 - 185 |
| MERALDI ET AL., VACCINE, vol. 21, 2003, pages 2485 - 2491 |
| MISCHLER; METCALFE, VACCINE, vol. 20, no. 5, 2002, pages B17 - B23 |
| NIIKURA ET AL., VIROLOGY, vol. 293, 2002, pages 273 - 280 |
| O'HAGAN ET AL., J VIROLOGY, vol. 75, 2001, pages 9037 - 9043 |
| OTT ET AL.: "Vaccine Design: The Subunit and Adjuvant Approach", 1995, PLENUM PRESS, article "MF59 - Design and Evaluation of a Safe and Potent Adjuvant for Human Vaccines", pages: 277 - 296 |
| PAJAK ET AL., VACCINE, vol. 21, 2003, pages 836 - 842 |
| PARTIDOS ET AL., IMMUNOL. LETT., vol. 67, no. 3, 1999, pages 209 - 216 |
| PAYNE ET AL., ADV. DRUG DEL. REV., vol. 31, no. 3, 1998, pages 185 - 196 |
| PEPPOLONI ET AL., VACCINES, vol. 2, no. 2, 2003, pages 285 - 293 |
| PINE ET AL., J. CONTROL RELEASE, vol. 85, no. 1-3, 2002, pages 263 - 270 |
| PINTO ET AL., J. INFECT. DIS., vol. 188, 2003, pages 327 - 338 |
| PITHA ET AL., BIOCHEM. BIOPHYS. ACTA, vol. 204, no. 1, 1970, pages 39 - 48 |
| PITHA ET AL., BIOPOLYMERS, vol. 9, no. 8, 1970, pages 965 - 977 |
| PIZZA ET AL., J. MED. MICROBIOL., vol. 290, no. 4-5, 2000, pages 455 - 461 |
| PIZZA ET AL., VACCINE, vol. 19, 2001, pages 2534 - 2541 |
| PODDA, VACCINE, vol. 19, 2001, pages 2673 - 2680 |
| POLO ET AL., PNAS, vol. 96, 1999, pages 4598 - 4603 |
| PUSHKO ET AL., VIROLOGY, vol. 239, 1997, pages 389 - 401 |
| REAPET, VACCINE, vol. 25, 2007, pages 7441 - 7449 |
| RUIZ-ARGUELLO ET AL., J. GEN. VIRAL., vol. 85, 2004, pages 3677 - 3687 |
| RYAN ET AL., INFECT. IMMUN., vol. 67, no. 12, 1999, pages 6270 - 6280 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS |
| SCHARTON-KERSTEN ET AL., INFECT. IMMUN., vol. 68, no. 9, 2000, pages 5306 - 5313 |
| SINGH ET AL., J. CONT. RELEASE, vol. 70, 2001, pages 267 - 276 |
| SINGH ET AL., PHARMACEUTICAL RESEARCH, vol. 20, 2003, pages 247 - 251 |
| SJOLANDER ET AL., ADV. DRUG DEL. REV., vol. 32, 1998, pages 321 - 338 |
| STANLEY, CLIN. EXP. DERMATOL., vol. 27, no. 7, 2002, pages 571 - 577 |
| SUMMERS; SMITH, TEXAS AGRICULTURAL EXPERIMENT STATION BULLETIN NO. 1555, 1987 |
| SWANSON ET AL., PNAS USA, vol. 108, no. 23, 2011, pages 9619 - 9624 |
| UHLMANN ET AL., CHEM REV, vol. 90, 1990, pages 544 - 84 |
| VACCINE, vol. 27, 2009, pages 4975 - 4982 |
| VAJDY, M. ET AL.: "Mucosal adjuvants and delivery systemsfor protein-, DNA- and RNA-based vaccines", IMMUNOL CELL BIOL, vol. 82, no. 6, 2004, pages 617 - 27 |
| WU; WU, J. BIOL. CHEM., vol. 263, 1988, pages 14621 |
| XIONG ET AL., SCIENCE, vol. 243, 1989, pages 1188 - 1191 |
Cited By (150)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9447164B2 (en) | 2010-08-06 | 2016-09-20 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9937233B2 (en) | 2010-08-06 | 2018-04-10 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9181319B2 (en) | 2010-08-06 | 2015-11-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US10064959B2 (en) | 2010-10-01 | 2018-09-04 | Modernatx, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9657295B2 (en) | 2010-10-01 | 2017-05-23 | Modernatx, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9334328B2 (en) | 2010-10-01 | 2016-05-10 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9950068B2 (en) | 2011-03-31 | 2018-04-24 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US8710200B2 (en) | 2011-03-31 | 2014-04-29 | Moderna Therapeutics, Inc. | Engineered nucleic acids encoding a modified erythropoietin and their expression |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US11951179B2 (en) | 2011-06-08 | 2024-04-09 | Translate Bio, Inc. | Lipid nanoparticle compositions and methods for MRNA delivery |
| US11951181B2 (en) | 2011-06-08 | 2024-04-09 | Translate Bio, Inc. | Lipid nanoparticle compositions and methods for mRNA delivery |
| US11951180B2 (en) | 2011-06-08 | 2024-04-09 | Translate Bio, Inc. | Lipid nanoparticle compositions and methods for MRNA delivery |
| US11730825B2 (en) | 2011-06-08 | 2023-08-22 | Translate Bio, Inc. | Lipid nanoparticle compositions and methods for mRNA delivery |
| US12121592B2 (en) | 2011-06-08 | 2024-10-22 | Translate Bio, Inc. | Lipid nanoparticle compositions and methods for mRNA delivery |
| US11547764B2 (en) | 2011-06-08 | 2023-01-10 | Translate Bio, Inc. | Lipid nanoparticle compositions and methods for MRNA delivery |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US10751386B2 (en) | 2011-09-12 | 2020-08-25 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US10022425B2 (en) | 2011-09-12 | 2018-07-17 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9428535B2 (en) | 2011-10-03 | 2016-08-30 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9271996B2 (en) | 2011-12-16 | 2016-03-01 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US8680069B2 (en) | 2011-12-16 | 2014-03-25 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of G-CSF |
| US8754062B2 (en) | 2011-12-16 | 2014-06-17 | Moderna Therapeutics, Inc. | DLIN-KC2-DMA lipid nanoparticle delivery of modified polynucleotides |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| US8664194B2 (en) | 2011-12-16 | 2014-03-04 | Moderna Therapeutics, Inc. | Method for producing a protein of interest in a primate |
| US9295689B2 (en) | 2011-12-16 | 2016-03-29 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US9782462B2 (en) | 2012-04-02 | 2017-10-10 | Modernatx, Inc. | Modified polynucleotides for the production of proteins associated with human disease |
| US9089604B2 (en) | 2012-04-02 | 2015-07-28 | Moderna Therapeutics, Inc. | Modified polynucleotides for treating galactosylceramidase protein deficiency |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9255129B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 |
| US9301993B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding apoptosis inducing factor 1 |
| US9303079B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9149506B2 (en) | 2012-04-02 | 2015-10-06 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding septin-4 |
| US9233141B2 (en) | 2012-04-02 | 2016-01-12 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9192651B2 (en) | 2012-04-02 | 2015-11-24 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9221891B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | In vivo production of proteins |
| US9114113B2 (en) | 2012-04-02 | 2015-08-25 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding citeD4 |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9587003B2 (en) | 2012-04-02 | 2017-03-07 | Modernatx, Inc. | Modified polynucleotides for the production of oncology-related proteins and peptides |
| US10501512B2 (en) | 2012-04-02 | 2019-12-10 | Modernatx, Inc. | Modified polynucleotides |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9095552B2 (en) | 2012-04-02 | 2015-08-04 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1 |
| US9675668B2 (en) | 2012-04-02 | 2017-06-13 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding hepatitis A virus cellular receptor 2 |
| US9220792B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aquaporin-5 |
| US9814760B2 (en) | 2012-04-02 | 2017-11-14 | Modernatx, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9828416B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9827332B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of proteins |
| US9878056B2 (en) | 2012-04-02 | 2018-01-30 | Modernatx, Inc. | Modified polynucleotides for the production of cosmetic proteins and peptides |
| US9216205B2 (en) | 2012-04-02 | 2015-12-22 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding granulysin |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| US9061059B2 (en) | 2012-04-02 | 2015-06-23 | Moderna Therapeutics, Inc. | Modified polynucleotides for treating protein deficiency |
| US9220755B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9050297B2 (en) | 2012-04-02 | 2015-06-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator |
| US8999380B2 (en) | 2012-04-02 | 2015-04-07 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| WO2014140211A1 (en) | 2013-03-15 | 2014-09-18 | Novartis Ag | Rna purification methods |
| EP3521429A1 (en) | 2013-03-15 | 2019-08-07 | GlaxoSmithKline Biologicals SA | Rna purification methods |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10323076B2 (en) | 2013-10-03 | 2019-06-18 | Modernatx, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| EP3904522A1 (en) * | 2013-12-03 | 2021-11-03 | Hookipa Biotech GmbH | Cmv vaccines |
| US11554169B2 (en) | 2013-12-03 | 2023-01-17 | Hookipa Biotech Gmbh | CMV vaccines |
| EP4154908A1 (en) * | 2014-03-10 | 2023-03-29 | University Of Louisville Research Foundation, Inc. | Compositions and methods for treating, including preventing, parvovirus infections and related diseases |
| US11008367B2 (en) | 2014-03-10 | 2021-05-18 | University Of Louisville Research Foundation, Inc. | Compositions and methods for treating, including preventing, parvovirus infections and related diseases |
| EP3116540A4 (en) * | 2014-03-10 | 2018-02-21 | University Of Louisville Research Foundation, Inc. | Compositions and methods for treating, including preventing, parvovirus infections and related diseases |
| US10214565B2 (en) | 2014-03-10 | 2019-02-26 | University Of Louisville Research Foundation, Inc. | Compositions and methods for treating, including preventing, parvovirus infections and related diseases |
| WO2015138424A1 (en) | 2014-03-10 | 2015-09-17 | University Of Louisville Research Foundaton, Inc. | Compositions and methods for treating, including preventing, parvovirus infections and related diseases |
| US10342861B2 (en) | 2014-05-27 | 2019-07-09 | University Of Rochester | Arenavirus vaccine |
| WO2015183895A1 (en) * | 2014-05-27 | 2015-12-03 | University Of Rochester | Novel arenavirus vaccine |
| EP3888676A1 (en) | 2014-06-13 | 2021-10-06 | GlaxoSmithKline Biologicals S.A. | Immunogenic combinations |
| EP4159741A1 (en) | 2014-07-16 | 2023-04-05 | ModernaTX, Inc. | Method for producing a chimeric polynucleotide encoding a polypeptide having a triazole-containing internucleotide linkage |
| US10702597B2 (en) | 2015-07-21 | 2020-07-07 | Modernatx, Inc. | CHIKV RNA vaccines |
| US11007260B2 (en) | 2015-07-21 | 2021-05-18 | Modernatx, Inc. | Infectious disease vaccines |
| US10449244B2 (en) | 2015-07-21 | 2019-10-22 | Modernatx, Inc. | Zika RNA vaccines |
| US11364292B2 (en) | 2015-07-21 | 2022-06-21 | Modernatx, Inc. | CHIKV RNA vaccines |
| US10442756B2 (en) | 2015-09-17 | 2019-10-15 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US10392341B2 (en) | 2015-09-17 | 2019-08-27 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US12151995B2 (en) | 2015-09-17 | 2024-11-26 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US12404232B2 (en) | 2015-09-17 | 2025-09-02 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US10266485B2 (en) | 2015-09-17 | 2019-04-23 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US11220476B2 (en) | 2015-09-17 | 2022-01-11 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US10493143B2 (en) | 2015-10-22 | 2019-12-03 | Modernatx, Inc. | Sexually transmitted disease vaccines |
| US11643441B1 (en) | 2015-10-22 | 2023-05-09 | Modernatx, Inc. | Nucleic acid vaccines for varicella zoster virus (VZV) |
| US11484590B2 (en) | 2015-10-22 | 2022-11-01 | Modernatx, Inc. | Human cytomegalovirus RNA vaccines |
| WO2017070613A1 (en) * | 2015-10-22 | 2017-04-27 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US10383937B2 (en) | 2015-10-22 | 2019-08-20 | Modernatx, Inc. | Human cytomegalovirus RNA vaccines |
| US10716846B2 (en) | 2015-10-22 | 2020-07-21 | Modernatx, Inc. | Human cytomegalovirus RNA vaccines |
| US11278611B2 (en) | 2015-10-22 | 2022-03-22 | Modernatx, Inc. | Zika virus RNA vaccines |
| US10064935B2 (en) | 2015-10-22 | 2018-09-04 | Modernatx, Inc. | Human cytomegalovirus RNA vaccines |
| US11235052B2 (en) | 2015-10-22 | 2022-02-01 | Modernatx, Inc. | Chikungunya virus RNA vaccines |
| US11285222B2 (en) | 2015-12-10 | 2022-03-29 | Modernatx, Inc. | Compositions and methods for delivery of agents |
| US10485885B2 (en) | 2015-12-10 | 2019-11-26 | Modernatx, Inc. | Compositions and methods for delivery of agents |
| US10207010B2 (en) | 2015-12-10 | 2019-02-19 | Modernatx, Inc. | Compositions and methods for delivery of agents |
| US10556018B2 (en) | 2015-12-10 | 2020-02-11 | Modernatx, Inc. | Compositions and methods for delivery of agents |
| US12491260B2 (en) | 2015-12-10 | 2025-12-09 | Modernatx, Inc. | Compositions and methods for delivery of agents |
| US10195156B2 (en) | 2015-12-22 | 2019-02-05 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of agents |
| US12396961B2 (en) | 2015-12-22 | 2025-08-26 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of agents |
| US10799463B2 (en) | 2015-12-22 | 2020-10-13 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of agents |
| US10611800B2 (en) | 2016-03-11 | 2020-04-07 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| US11197927B2 (en) | 2016-10-21 | 2021-12-14 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US10695419B2 (en) | 2016-10-21 | 2020-06-30 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US11541113B2 (en) | 2016-10-21 | 2023-01-03 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US12144895B2 (en) | 2016-11-08 | 2024-11-19 | Modernatx, Inc. | Stabilized formulations of lipid nanoparticles |
| US11583504B2 (en) | 2016-11-08 | 2023-02-21 | Modernatx, Inc. | Stabilized formulations of lipid nanoparticles |
| US11696946B2 (en) | 2016-11-11 | 2023-07-11 | Modernatx, Inc. | Influenza vaccine |
| US12409218B2 (en) | 2016-11-11 | 2025-09-09 | Modernatx, Inc. | Influenza vaccine |
| US10925958B2 (en) | 2016-11-11 | 2021-02-23 | Modernatx, Inc. | Influenza vaccine |
| US12318443B2 (en) | 2016-11-11 | 2025-06-03 | Modernatx, Inc. | Influenza vaccine |
| US11103578B2 (en) | 2016-12-08 | 2021-08-31 | Modernatx, Inc. | Respiratory virus nucleic acid vaccines |
| US11752206B2 (en) | 2017-03-15 | 2023-09-12 | Modernatx, Inc. | Herpes simplex virus vaccine |
| US11969506B2 (en) | 2017-03-15 | 2024-04-30 | Modernatx, Inc. | Lipid nanoparticle formulation |
| US12324859B2 (en) | 2017-03-15 | 2025-06-10 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US10857105B2 (en) | 2017-03-15 | 2020-12-08 | MordernaTX, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US11045540B2 (en) | 2017-03-15 | 2021-06-29 | Modernatx, Inc. | Varicella zoster virus (VZV) vaccine |
| US11576961B2 (en) | 2017-03-15 | 2023-02-14 | Modernatx, Inc. | Broad spectrum influenza virus vaccine |
| US11464848B2 (en) | 2017-03-15 | 2022-10-11 | Modernatx, Inc. | Respiratory syncytial virus vaccine |
| US11203569B2 (en) | 2017-03-15 | 2021-12-21 | Modernatx, Inc. | Crystal forms of amino lipids |
| US12552738B2 (en) | 2017-03-15 | 2026-02-17 | Modernatx, Inc. | Crystal forms of amino lipids |
| US11918644B2 (en) | 2017-03-15 | 2024-03-05 | Modernatx, Inc. | Varicella zoster virus (VZV) vaccine |
| US11905525B2 (en) | 2017-04-05 | 2024-02-20 | Modernatx, Inc. | Reduction of elimination of immune responses to non-intravenous, e.g., subcutaneously administered therapeutic proteins |
| US12077501B2 (en) | 2017-06-14 | 2024-09-03 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of agents |
| US11786607B2 (en) | 2017-06-15 | 2023-10-17 | Modernatx, Inc. | RNA formulations |
| US11744801B2 (en) | 2017-08-31 | 2023-09-05 | Modernatx, Inc. | Methods of making lipid nanoparticles |
| US12357575B2 (en) | 2017-08-31 | 2025-07-15 | Modernatx, Inc. | Methods of making lipid nanoparticles |
| US11207398B2 (en) | 2017-09-14 | 2021-12-28 | Modernatx, Inc. | Zika virus mRNA vaccines |
| US10653767B2 (en) | 2017-09-14 | 2020-05-19 | Modernatx, Inc. | Zika virus MRNA vaccines |
| WO2019123169A1 (en) | 2017-12-20 | 2019-06-27 | Glaxosmithkline Biologicals Sa | Epstein-barr virus antigen constructs |
| US12453766B2 (en) | 2018-01-29 | 2025-10-28 | Modernatx, Inc. | RSV RNA vaccines |
| US11911453B2 (en) | 2018-01-29 | 2024-02-27 | Modernatx, Inc. | RSV RNA vaccines |
| US12151029B2 (en) | 2018-09-19 | 2024-11-26 | Modernatx, Inc. | PEG lipids and uses thereof |
| US12263248B2 (en) | 2018-09-19 | 2025-04-01 | Modernatx, Inc. | Compounds and compositions for intracellular delivery of therapeutic agents |
| US12383508B2 (en) | 2018-09-19 | 2025-08-12 | Modernatx, Inc. | High-purity peg lipids and uses thereof |
| US12090235B2 (en) | 2018-09-20 | 2024-09-17 | Modernatx, Inc. | Preparation of lipid nanoparticles and methods of administration thereof |
| US11629172B2 (en) | 2018-12-21 | 2023-04-18 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| US11793843B2 (en) | 2019-01-10 | 2023-10-24 | Janssen Biotech, Inc. | Prostate neoantigens and their uses |
| US12582683B2 (en) | 2019-01-10 | 2026-03-24 | Janssen Biotech, Inc. | Prostate neoantigens and their uses |
| US11351242B1 (en) | 2019-02-12 | 2022-06-07 | Modernatx, Inc. | HMPV/hPIV3 mRNA vaccine composition |
| US12070495B2 (en) | 2019-03-15 | 2024-08-27 | Modernatx, Inc. | HIV RNA vaccines |
| US11066355B2 (en) | 2019-09-19 | 2021-07-20 | Modernatx, Inc. | Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents |
| US12312293B2 (en) | 2019-09-19 | 2025-05-27 | Modernatx, Inc. | Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents |
| US11597698B2 (en) | 2019-09-19 | 2023-03-07 | Modernatx, Inc. | Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents |
| US12595226B2 (en) | 2019-09-19 | 2026-04-07 | Modernatx, Inc. | Carbonate containing lipid compounds and compositions for intracellular delivery of therapeutic agents |
| US12018289B2 (en) | 2019-11-18 | 2024-06-25 | Janssen Biotech, Inc. | Vaccines based on mutant CALR and JAK2 and their uses |
| US12569552B2 (en) * | 2020-06-09 | 2026-03-10 | Km Biologics Co., Ltd. | Fusion protein of pentamer and gB of cytomegalovirus, and vaccine containing said fusion protein |
| US11857622B2 (en) | 2020-06-21 | 2024-01-02 | Pfizer Inc. | Human cytomegalovirus GB polypeptide |
| US12295997B2 (en) | 2020-07-06 | 2025-05-13 | Janssen Biotech, Inc. | Prostate neoantigens and their uses |
| US11406703B2 (en) | 2020-08-25 | 2022-08-09 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US11524023B2 (en) | 2021-02-19 | 2022-12-13 | Modernatx, Inc. | Lipid nanoparticle compositions and methods of formulating the same |
| US11622972B2 (en) | 2021-02-19 | 2023-04-11 | Modernatx, Inc. | Lipid nanoparticle compositions and methods of formulating the same |
| US12508278B2 (en) | 2021-02-19 | 2025-12-30 | Modernatx, Inc. | Lipid nanoparticle compositions and methods of formulating the same |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2729165B1 (en) | 2017-11-08 |
| US20240082329A1 (en) | 2024-03-14 |
| US11896636B2 (en) | 2024-02-13 |
| EP3332802A1 (en) | 2018-06-13 |
| EP3854413A1 (en) | 2021-07-28 |
| JP2014522842A (ja) | 2014-09-08 |
| CA2840989A1 (en) | 2013-01-10 |
| ES2656050T3 (es) | 2018-02-22 |
| EP2729165A1 (en) | 2014-05-14 |
| US20140227346A1 (en) | 2014-08-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240082329A1 (en) | Immunogenic combination compositions and uses thereof | |
| US20210290755A1 (en) | Immunogenic compositions and uses thereof | |
| US11813323B2 (en) | RSV immunization regimen | |
| JP6305925B2 (ja) | 組換え自己複製ポリシストロニックrna分子 | |
| CA2804591C (en) | Cationic oil-in-water emulsions | |
| EP2591117B1 (en) | Delivery of self-replicating rna using biodegradable polymer particles | |
| CA2840913C (en) | Oil-in-water emulsions that contain nucleic acids | |
| US20150140068A1 (en) | Immunogenic compositions and uses thereof | |
| HK40086859A (en) | Rsv immunization regimen | |
| HK40086431A (en) | Rsv immunization regimen | |
| HK40086431B (en) | Rsv immunization regimen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12735420 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2014519089 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2840989 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012735420 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012735420 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14130899 Country of ref document: US |