Connect public, paid and private patent data with Google Patents Public Datasets



Publication number
WO1998040100A1 PCT/US1998/004703 US9804703W WO1998040100A1 WO 1998040100 A1 WO1998040100 A1 WO 1998040100A1 US 9804703 W US9804703 W US 9804703W WO 1998040100 A1 WO1998040100 A1 WO 1998040100A1
Grant status
Patent type
Prior art keywords
Prior art date
Application number
Other languages
French (fr)
Heather L. Davis
Joachim Schorr
Arthur M. Krieg
Original Assignee
Ottawa Civic Loeb Research Institute
Qiagen Gmbh
The University Of Iowa Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date



    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/29Hepatitis virus
    • A61K39/292Serum hepatitis virus, hepatitis B virus, e.g. Australia antigen
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505Inorganic adjuvants
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/5555Muramyl dipeptides
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/57Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • C12N2730/00Reverse Transcribing DNA Viruses
    • C12N2730/00011Reverse Transcribing DNA Viruses
    • C12N2730/10011Hepadnaviridae
    • C12N2730/10111Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein


The present invention is based on the finding that nucleic acids containing at least one unmethylated cytosine-guanine (CpG) dinucleotide affect immune responses in a subject. These nucleic acids containing at least one unmethylated cytosine-guanine (CpG) dinucleotide can be used to induce an immune response in a subject. The method includes administering to the subject a therapeutically effective amount of nucleic acid encoding an antigenic polypeptide, and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide. The invention also provides a method for treating a subject having or at risk of having viral-mediated disorder, comprising administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.



HELD OF THE INVENTION This invention relates to generally to adjuvants, and specifically to the use of oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) as an adjuvant.

BACKGROUND OF THE INVENTION Bacterial DNA, but not vertebrate DNA, has direct immunostimulatory effects on peripheral blood mononuclear cells (PBMC) in vitro (Krieg et al., 1995). This lymphocyte activation is due to unmethylated CpG dinucleotides, which are present at the expected frequency in bacterial DNA (1/16), but are under-represented (CpG suppression, 1/50 to 1/60) and methylated in vertebrate DNA. Activation may also be triggered by addition of synthetic oligodeoxynucleotides (ODN) that contain an unmethylated CpG dinucleotide in a particular sequence context. It appears likely that the rapid immune activation in response to CpG DNA may have evolved as one component of the innate immune defense mechanisms that recognize structural patterns specific to microbial molecules.

CpG DNA induces proliferation of almost all (>95%) B cells and increases immunoglobulin (Ig) secretion. This B cell activation by CpG DNA is T cell independent and antigen non-specific. However, B cell activation by low concentrations of CpG DNA has strong synergy with signals delivered through the B cell antigen receptor for both B cell proliferation and Ig secretion (Krieg et al., 1995). This strong synergy between the B cell signaling pathways triggered through the B cell antigen receptor and by CpG DNA promotes antigen specific immune responses. In addition to its direct effects on B cells, CpG DNA also directly activates monocytes, macrophages, and dendritic cells to secrete a variety of cytokines, including high levels of IL-12 (Klinman et al., 1996; Halpern et al, 1996; Cowdery et al., 1996). These cytokines stimulate natural killer (NK) cells to secrete g-interferon (IFN-g) and have increased lytic activity (Klinman et al., 1996, supra', Cowdery et al, 1996, supra; Yamamoto et al, 1992; Ballas et al, 1996). Overall, CpG DNA induces a Thl like pattern of cytokine production dominated by IL-12 and IFN-g with little secretion of Th2 cytokines (Klinman et al, 1996). The strong direct effects (T cell independent) of CpG DNA on B cells, as well as the induction of cytokines which could have indirect effects on B-cells via T-help pathways, suggests utility of CpG DNA in the form of ODN as a vaccine adjuvant.

A DNA vaccine induces immune responses against an antigenic protein expressed in vivo from an introduced gene. The DNA vaccine is most often in the form of a plasmid DNA expression vector produced in bacteria and then purified and delivered to muscle or skin (see Vogel and Sarver, 1995; Brazolot Millan and Davis, 1997; Donnelly eta , 1996). DNA vaccines have been demonstrated to show efficacy against numerous viral, bacterial and parasitic diseases in animal models. Almost all studies show induction of very strong and long-lasting humoral and cell-mediated immune responses, and protection against live pathogen challenge (where it could be evaluated). The efficacy of DNA vaccines is attributed, at least in part, to the continuous in vivo synthesis of antigen that leads to efficient antigen presentation. In particular, endogenously-synthesized antigen is presented by class I MHC, leading to induction of CD8+ cytotoxic T lymphocytes (CTL). In contrast, most whole killed and subunit vaccines, where antigen is processed solely in the exogenous form, often fail to induce CTL. More recently however, it has been shown that the presence of unmethylated CpG motifs in the DNA vaccines is essential for the induction of immune responses against the antigen (Sato et al, 1996).

Hepatitis B virus (HBV) poses a serious world- wide health problem. The current HBV vaccines are subunit vaccines containing particles of HBV envelope protein(s) which include several B and T cell epitopes known collectively as HBV surface antigen (HBsAg). The HBsAg particles may be purified from the plasma of chronically infected individuals or more commonly are produced as recombinant proteins. These vaccines induce antibodies against HBsAg (anti-HBs), which confer protection if present in titers 10 milli-International Units per milliliter (mlU/ml) (Ellis, 1993). While the subunit vaccines are safe and generally efficacious, they fail to meet all current vaccination needs. For example, early vaccination of infants bom to chronically infected mothers, as well as others in endemic areas, drastically reduces the rate of infection, but a significant proportion of these babies will still become chronically infected themselves. This could possibly be reduced if high titers of ariti-HBs antibodies could be induced earlier and if there were HBV-specific CTL. In addition, there are certain individuals who fail to respond (non-responders) or do not attain protective levels of immunity (hypo-responders). Finally, there is an urgent need for an effective treatment for the estimated 350 million chronic carriers of HBV and a therapeutic vaccine could meet this need.


The present invention is based on the finding that nucleic acids containing at least one unmethylated cytosine-guanine (CpG) dinucleotide affect the immune response in a subject by activating natural killer cells (NK) or redirecting a subject's immune response from a Th2 to a Thl response by inducing monocytic and other cells to produce Thl cytokines. These nucleic acids containing at least one unmethylated CpG can be used as an adjuvant, specifically to induce an immune response against an antigenic protein.

In one embodiment, the invention provides a method of inducing an immune response in a subject by administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic protein and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.

In another embodiment, the invention provides a method for treating a subject having or at risk of having a virally mediated disorder by administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.

In further embodiment, the invention provides a method for treating a subject having or at risk of having a chronic viral infection by administering to the subject an effective amount of an antigenic polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.

In another embodiment, a pharmaceutical composition containing an immumostimulatory CpG oligonucleotide and a nucleic acid encoding an antigenic protein in a pharmaceutically acceptable carrier is provided.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph illustrating humoral responses in BALB/c mice immunized with

1 g recombinant HBsAg protein alone, adsorbed onto alum (25 mg Al3+/mg HBsAg), with 100 g of immunostimulatory CpG ODN, or with both alum and CpG ODN. Each point represents the group mean (n=10) for titers of anti-HBs (total IgG) as determined in triplicate by end-point dilution ELISA assay. End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of control non-immune plasma with a cut-off value of 0.05. The upper graph shows results on a linear scale and the lower graph shows results on a logarithmic scale (log10).

FIG. 2 is a graph illustrating humoral responses in BALB/c mice immunized with 1 g recombinant HBsAg protein with alum and with 0, 10, 100 or 500 g of CpG ODN added.

Each point represents the group mean (n=10) for anti-HBs titers (total IgG) as determined by end-point dilution ELISA assay. FIG. 3 is a graph of humoral responses in C57BL/6 mice immunized with 1 g recombinant HBsAg protein without adjuvant, with alum, with 100 g of CpG ODN, or with both alum and CpG ODN. Mice were boosted in the identical fashion after 6 weeks. Each point represents the group mean (n=5) for anti-HBs titers (total IgG) as determined by end-point dilution ELISA assay.

FIG. 4 is a graph of humoral responses in C57BL/6 mice immunized with 1 g recombinant HBsAg protein without adjuvant, or with 1, 10 or 100 g of CpG ODN. Mice were boosted in the identical fashion after 6 weeks. Each point represents the group mean (n=5) for anti-HBs titers (total IgG) as determined by end-point dilution ELISA assay.

FIG. 5 is a graph of humoral responses in B10.S hypo-responder mice immunized with 1 g recombinant HBsAg protein without adjuvant, with alum, and/or with 10 g of CpG ODN. Each point represents the group mean (n=5) for anti-HBs titers (total IgG) as determined by end-point dilution ELISA assay.

FIG. 6 is a graph of humoral responses in C2D non-responder mice immunized with 1 g recombinant HBsAg protein with alum or with alum plus 10 g of CpG ODN. Each point represents the group mean (n=5) for anti-HBs titers (total IgM or IgG) as determined by end-point dilution ELISA assay.

FIG. 7 is a bar graph illustrating humoral responses in C57BL/6 mice at 8 weeks after immunization with 1 g recombinant HBsAg protein without adjuvant, with alum, with 100 g of CpG ODN, or with both alum and CpG ODN. Mice had been boosted in the identical fashion at 6 weeks. Each point represents the group mean (n=5) for anti-HBs titers

(IgGl and IgG2a isotypes) as determined by end-point dilution ELISA assay.

FIG. 8 is a graph of humoral responses in BALB/c mice immunized with 10 g HBsAg-expressing DNA vaccine (pCMV-S) injected alone or with 100 or 500 g of CpG ODN added. Each point represents the group mean (n=10) for anti-HBs titers (total IgG) as determined by end-point dilution ELISA assay.

FIG. 9 is a graph of humoral responses in B10.S mice immunized with 2 g recombinant HBsAg protein without adjuvant or with 50 g pCMV-S DNA vaccine. Each point represents the group mean (n=5) for anti-HBs titers (total IgG) as determined by end-point dilution ELISA assay.

FIG. 10 is a graph of humoral responses in newborn BALB/c mice immunized with 1 g recombinant HBsAg protein with alum or with 10 g pCMV-S DNA vaccine on the day of birth or 7 days later. Each point represents the group mean (n=10) for anti-HBs titers (total IgG) as determined by end-point dilution ELISA assay.

FIG. 1 1 is a graph of humoral responses in BALB/c mice primed with 10 g HBsAg-expressing DNA vaccine (pCMV-S) and given 2 g recombinant HBsAg protein at the same time in the same or a different muscle or given the HBsAg 2 or 8 weeks later. Each point represents the group mean (n=10) for anti-HBs titers (total IgG) as determined by end-point dilution ELISA assay.


It is to be understood that this invention is not limited to the particular methodology, protocols, sequences, models and reagents described as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the oligonucleotides and methodologies which are described in the publications which might be used in connection with the presently described invention. The binding of DNA to cells has been shown to be similar to a ligand receptor interaction: binding is saturable, competitive, and leads to DNA endocytosis and degradation into oligonucleotides (Bennet, R.M., et al, J. Clin. Invest. 76:2182, 1985). Like DNA, oligodeoxyribonucleotides are able to enter cells in a process which is sequence, temperature, and energy independent (Jaroszewski and Cohen, Ad. Drug Del. Rev. 6:235,

1991). An "oligodeoxyribonucleotide" as used herein is a deoxyribonucleic acid sequence from about 3-50 bases in length. Lymphocyte oligodeoxyribonucleotide uptake has been shown to be regulated by cell activation (Krieg, A.M., et al, Antisense Research and Development 161 , 1991 ). The present invention is based on the finding that certain oligonucleotides (ODN) containing at least one unmethylated cytosine-guanine (CpG) dinucleotide activate the immune response.

In one embodiment, the invention provides a method for stimulating an immune response in a subject by administering a therapeutically effective amount of a nucleic acid sequence containing at least one unmethylated CpG. The term "nucleic acid" or

"oligonucleotide" refers to a polymeric form of nucleotides at least five bases in length. The nucleotides of the invention can be deoxyribonucleotides, ribonucleotides, or modified forms of either nucleotide. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules have increased activity.

The nucleic acid molecule can include the use of phosphorothioate or phosphorodithioate rather than phosphodiesterase linkages within the backbone of the molecule, or methylphosphorothioate terminal linkages (Krieg, A.M., et al, Antisense and Nucl Acid Drug Dev 6: 133-9, 1996; Boggs, R.T., et al. , Antisense and Nucl Acid Drug Dev, 7:461-71, 1997). The phosphate backbone modification can occur at the 5' end of the nucleic acid, for example at the first two nucleotides of the 5' end of the nucleic acid. The phosphate backbone modification may occur at the 3' end of the nucleic acid, for example at the last five nucleotides of the 3' end of the nucleic acid. International Patent Application WO 95/26204, entitled "Immune stimulation by phosphorothioate oligonucleotide analogs" reports the nonsequence-specific immunostimulatory effect of phosphorothioate modified oligonucleotides. Nontraditional bases such as inosine and queosine, as well as acetyl-, thio- and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine can also be included, which are not as easily recognized by endogenous endonucleases. Other stabilized nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl- phosphonates (in which the charged oxygen moiety is alkylated). Nucleic acid molecules which contain a diol, such as tetrahyleneglycol or hexaethyleneglycol, at either or both termini are also included. The term "oligonucleotide" includes both single and double- stranded forms of DNA.

A "CpG" or "CpG motif refers to a nucleic acid having a cytosine followed by a guanine linked by a phosphate bond. The term "methylated CpG" refers to the methylation of the cytosine on the pyrimidine ring, usually occurring the 5-position of the pyrimidine ring. The term "unmethylated CpG" refers to the absence of methylation of the cytosine on the pyrimidine ring. Methylation, partial removal, or removal of an unmethylated CpG motif in an oligonucleotide of the invention is believed to reduce its effect. Methylation or removal of all unmethylated CpG motifs in an oligonucleotide substantially reduces its effect. The effect of methylation or removal of a CpG motif is "substantial" if the effect is similar to that of an oligonucleotide that does not contain a CpG motif.

Preferably the CpG oligonucleotide is in the range of about 8 to 30 bases in size.

For use in the instant invention, the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage, S.L., and Caruthers, M.H., 7et. Let. 22:1859, 1981); nucleoside H-phosphonate method (Garegg et al, Tet. Let. 27:4051-4054, 1986; Froehler et al, Nucl Acid. Res. 14:5399-5407, 1986, ; Garegg et al, Tet. Let. 22:4055-4058, 1986,

Gafδiey et al, Tet. Let. 29:2619-2622, 1988). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market. Alternatively, CpG dinucleotides can be produced on a large scale in plasmids, (see Sambrook, T., et al, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor laboratory Press, New York, 1989) which after being administered to a subject are degraded into oligonucleotides. Oligonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.

For use in vivo, nucleic acids are preferably relatively resistant to degradation (e.g. , via endo-and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.

Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and

Peyman, A., Chem. Rev. 90:544, 1990; Goodchild, J., Bioconjugate Chem. 1:165, 1990).

For administration in vivo, nucleic acids may be associated with a molecule that results in higher affinity binding to target cell (e.g., B-cell, monocytic cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells to form a "nucleic acid delivery complex." Nucleic acids can be ionically or covalently associated with appropriate molecules using techniques which are well known in the art. A variety of coupling or cross-linking agents can be used, e.g., protein A, carbodiimide, and N-succinimidyl- 3-(2-pyridyldithio) propionate (SPDP). Nucleic acids can alternatively be encapsulated in liposomes or virosomes using well-known techniques.

In one embodiment, the nucleic acid sequences useful in the methods of the invention are represented by the formula:

wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or thymidine; X2 is cytosine or thymine, N is any nucleotide and N, + N2 is from about 0-26 bases. In a preferred embodiment, N, and N2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length. However, nucleic acids of any size (even may kb long) can be used in the invention if CpGs are present, as larger nucleic acids are degraded into oligonucleotides inside cells. Preferred synthetic oligonucleotides do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5' or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome. A "palindromic sequence" or "palindrome" means an inverted repeat (i.e., a sequence such as ABCDEE'D'C'B'A', in which A and A' are bases capable of forming the usual Watson-Crick base pairs.

In another embodiment, the method of the invention includes the use of an oligonucleotide which contains a CpG motif represented by the formula: 5' N^.X GXΛ^ y (SEQ ID NO:2) wherein at least one nucleotide separates consecutive CpGs; X|X2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X3 X4 is selected from the group consisting of TpT or CpT; N is any nucleotide and N, + N2 is from about 0-26 bases. In a preferred embodiment, N, and N2 do not contain a CCGG quadmer or more than one CCG or CGG trimer. CpG ODN are also preferably in the range of 8 to 30 bases in length, but may be of any size (even many kb long) if sufficient motifs are present, since such larger nucleic acids are degraded into oligonucleotides inside of cells. Preferred synthetic oligonucleotides of this formula do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5' and/or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome. Other CpG oligonucleotides can be assayed for efficacy using methods described herein. An exemplary nucleic acid sequence of the invention is S'-TCCATGACGTTCCTGACGTT-S' (SEQ ID NO:3).

A prolonged effect can be obtained using stabilized oligonucleotides, where the oligonucleotide incorporates a phosphate backbone modification (e.g. , a phosphorothioate or phbsphorodithioate modification). More particularly, the phosphate backbone modification occurs at the 5' end of the nucleic acid for example, at the first two nucleotides of the 5' end of the nucleic acid. Further, the phosphate backbone modification may occur at the 3' end of the nucleic acid for example, at the last five nucleotides of the 3* end of the nucleic acid. Preferred nucleic acids containing an unmethylated CpG have a relatively high stimulation with regard to B cell, monocyte, and/or natural killer cell responses (e.g., induction of cytokines, proliferative responses, lytic responses, among others).

Nucleic acids containing an unmethylated CpG can be effective in any mammal, preferably a human. Different nucleic acids containing an unmethylated CpG can cause optimal immune stimulation depending on the mammalian species. Thus an oligonucleotide causing optimal stimulation in humans may not cause optimal stimulation in a mouse. One of skill in the art can identify the optimal oligonucleotides useful for a particular mammalian species of interest.

The "stimulation index" is a measure of a CpG ODN to effect an immune response which can be tested in various immune cell assays. The stimulation of the immune response can be assayed by measuring various immune parameters, e.g., measuring the antibody- forming capacity, number of lymphocyte subpopulations, mixed leukocyte response assay, lymphocyte proliferation assay. The stimulation of the immune response can also be measured in an assay to determine resistance to infection or tumor growth. Methods for measuring a stimulation index are well known to one of skill in the art. For example, one assay is the incorporation of 3H uridine in a murine B cell culture, which has been contacted with a 20μM of oligonucleotide for 20h at 37°C and has been pulsed with 1 μCi of3H uridine; and harvested and counted 4h later. The induction of secretion of a particular cytokine can also be used to assess the stimulation index. Without meaning to be bound by theory, for use in vivo, for example to treat a subject at risk of exposure to a hepatitis virus, it is important that the CpG ODN be capable of effectively inducing cytokine secretion by monocytic cells and/or Natural Killer (NK) cell lytic activity. In one method, the stimulation index of the CpG ODN with regard to B-cell proliferation is at least about 5, preferably at least about 10, more preferably at least about 15 and most preferably at least about 20, while recognizing that there are differences in the stimulation index among individuals.

The CpG ODN of the invention stimulate cytokine production (e.g., IL-6, IL-12,

IFN-γ, TNF-α and GM-CSF). Exemplary sequences include:



TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:6). The CpG ODN of the invention are also useful for stimulating natural killer cell (NK) lytic activity in a subject such as a human. Specific, but nonlimiting examples of such sequences include:






TCGTCGTCGTCGTT (SEQ ID NO: 12). The nucleic acid sequences of the invention are also useful for stimulating B cell proliferation. Specific, but nonlimiting examples of such sequences include:






TGTCGTTGTCGTTGTCGTT (SEQ ID NO: 11). Preferred CpG ODN can effect at least about 500 pg/ml of TNF-α, 15 pg/ml IFN-γ, 70 pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the therapeutic indication. These cytokines can be measured by assays well known in the art. The ODNs listed above or other preferred CpG ODN can effect at least about 10%, more preferably at least about 15% and most preferably at least about 20% YAC-1 cell specific lysis or at least about 30%, more preferably at least about 35%, and most preferably at least about 40% 2C11 cell specific lysis, in assays well known in the art.

An "antigenic polypeptide" is any polypeptide that can, under appropriate - conditions, induce an immune response. Antigenic polypeptides include, but are not limited to, viral proteins, or fragments thereof. Minor modifications of the primary amino acid sequences of a viral polypeptide may also result in a polypeptide which have substantially equivalent antigenic activity as compared to the unmodified counteφart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as antigenicity still exists. One non-limiting example of an antigenic viral polypeptide is the hepatitis B surface antigen.

The term "substantially purified" as used herein refers to a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify viral polypeptides using standard techniques for protein purification. The substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel. The purity of the viral polypeptide can also be determined by amino-terminal amino acid sequence analysis.

The invention utilizes polynucleotides encoding the antigenic polypeptides. These polynucleotides include DNA, cDNA and RNA sequences which encode an antigenic polypeptide. Such polynucleotides include naturally occurring, synthetic, and intentionally manipulated polynucleotides. For example, polynucleotide enocing an antigenic polypeptide may be subjected to site-directed mutagenesis, so long as the polypeptide remains antigenic.

The term "polynucleotide" or "nucleic acid sequence" refers to a polymeric form of nucleotides at least 10 bases in length. By "isolated polynucleotide" is meant a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g. a cDNA) independent of other sequences. The nucleotides of the invention can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. The term includes single and double forms of DNA.

In the present invention, the polynucleotide sequences encoding an antigenic polypeptide may be inserted into an expression vector. The term "expression vector" refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incorporation of the genetic sequences encoding the antigenic polypeptide. Polynucleotide sequence which encode the antigenic polypeptide can be operatively linked to expression control sequences. "Operatively linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. An expression control sequence operatively linked to a coding sequence is ligated such that expression of the coding sequence is achieved under conditions compatible with the expression control sequences. As used herein, the term "expression control sequences" refers to nucleic acid sequences that regulate the expression of a nucleic acid sequence to which it is operatively linked. Expression control sequences are operatively linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence. Thus expression control sequences can include appropriate promoters, enhancers, transcription terminators, as start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons. The term "control sequences" is intended to included, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. Expression control sequences can include a promoter.

By "promoter" is meant minimal sequence sufficient to direct transcription. Also included in the invention are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell-type specific, tissue-specific, or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the gene. Both constitutive and inducible promoters, are included in the invention (see e.g., Bitter et al, 1987, Methods in Enzymology 153:516-544). Promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the retrovirus long terminal repeat; the adenovirus late promoter; the vaccinia virus 7.5K promoter) may be used. Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the nucleic acid sequences of the invention.

By "therapeutically effective amount" is meant the quantity of a compound according to the invention necessary to prevent, to cure or at least partially arrest symptoms in a subject. A subject is any mammal, preferably a human. Amounts effective for therapeutic use will, of course, depend on the severity of the disease and the weight and general state of the subject. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders.

Various considerations are described, e.g., in Gilman et al, eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics. 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences. 17th ed., Mack Publishing Co., Easton, Pa., 1990, each of which is herein incorporated by reference. An oligonucleotide containing at least one unmethylated CpG can be used alone to activate the immune response or can be administered in combination with another adjuvant. An "adjuvant" is any molecule or compound which can stimulate the humoral and/or cellular immune response. For example, when the oligonucleotide containing at least one unmethylated CpG is administered in conjunction with another adjuvant, the oligonucleotide can be administered before, after, and/or simultaneously with the other adjuvant. The oligonucleotide containing at least one unmethylated CpG can have an additional efficacy (e.g., through antisense or other means) in addition to its ability to activate the immune response.

The invention further provides a method of modulating the level of a cytokine. The term "modulate" envisions the suppression of expression of a particular cytokine when it is overexpressed, or augmentation of the expression of a particular cytokine when it is underexpressed. Modulation of a particular cytokine can occur locally or systemically. It is believed that the CpG oligonucleotides do not directly activate purified NK cells, but rather render them competent to respond to IL-l 2 with a marked increase in their IFN-γ production. By inducing IL-12 production and the subsequent increased IFN-γ secretion by NK cells, the immunostimulatory nucleic acids also promote a Thl type immune response. No direct activation of proliferation or cytokine secretion by highly purified T cells has been found. Cytokine profiles determine T cell regulatory and effector functions in immune responses.

Cytokines also play a role in directing the T cell response. Helper (CD4+) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including other T cells. Most mature CD4+ T helper cells express one of two cytokine profiles: Thl or Th2. Thl cells secrete IL-2, IL-3, IFN-γ, TNF-β, GM-CSF and high levels of TNF-α. Th2 cells express IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, GM-CSF and low levels of TNF-α. The Thl subset promotes delayed-type hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG2a. The Th2 subset induces humoral immunity by activating B cells, promoting antibody production, and inducing class switching to IgG, and IgE.

Several factors have been shown to influence commitment to Thl or Th2 profiles. The best characterized regulators are cytokines. IL-12 and IFN-γ are positive Thl and negative Th2 regulators. IL-12 promotes IFN-γ production, and IFN-γ provides positive feedback for IL-12. IL-4 and IL-10 appear to be required for the establishment of the Th2 cytokine profile and to down-regulate Thl cytokine production; the effects of IL-4 are in some cases dominant over those of IL-12. IL-13 was shown to inhibit expression of inflammatory cytokines, including IL-12 and TNF-α by LPS-induced monocytes, in a way similar to IL-4. The IL-12 p40 homodimer binds to the IL-12 receptor and antagonizes IL-12 biological activity; thus it blocks the pro-Thl effects of IL-12.

This invention further provides administering to a subject having or at risk of having an virally mediated disorder, a therapeutical ly effective dose of a pharmaceutical composition containing the compounds of the present invention and a pharmaceutically acceptable carrier. "Administering" the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan.

The pharmaceutical compositions according to the invention are in general administered topically, intravenously, orally, parenterally or as implants, and even rectal use is possible in principle. Suitable solid or liquid pharmaceutical preparation forms are, for example, granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, aerosols, drops or injectable solution in ampule form and also preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer, Science 249:1527-1533. 1990, which is incorporated herein by reference. The pharmaceutical compositions are preferably prepared and administered in dose units. Solid dose units are tablets, capsules and suppositories. For treatment of a patient, depending on activity of the compound, manner of administration, nature and severity of the disorder, age and body weight of the patient, different daily doses are necessary. Under certain circumstances, however, higher or lower daily doses may be appropriate. The administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administration of subdivided doses at specific intervals.

The pharmaceutical compositions according to the invention may be administered locally or systemically. By "therapeutically effective dose" is meant the quantity of a compound according to the invention necessary to prevent, to cure or at least partially arrest the symptoms of the disorder and its complications. Amounts effective for this use will, of course, depend on the severity of the disease and the weight and general state of the patient. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders. Various considerations are described, e.g., in Gilman et al, eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics. 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences. 17th ed., Mack Publishing Co., Easton, Pa., 1990, each of which is herein incoφorated by reference.

The following examples are intended to illustrate but not to limit the invention in any manner, shape, or form, either explicitly or implicitly. While they are typical of those that might be used, other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used. EXAMPLES

Here we evaluate the use of CpG ODN as an adjuvant for immunization of mice against hepatitis B virus surface antigen (HbsAg) given as a recombinant protein or expressed in vivo from a DNA vaccine.

Compared with the recombinant protein vaccine alone, addition of either CpG ODN or alum alone resulted in a 10-100 fold increase in the level of antibodies against HBsAg (anti-HBs). However when used together, these two adjuvants resulted in 500-1000 times higher levels of anti-HBs, indicating a strong synergistic response. Immunization with HBsAg alone or with alum resulted in a strong Th2-type response with almost all IgG being of the IgGl isotype. CpG ODN induced a high proportion of IgG2a, indicative of a Thl-type response, even in the presence of alum.

DNA "vaccines" also induce potent Thl-type immune responses and this is likely due in large part to the presence of CpG motifs in the bacterial ly-derived plasmid DNA. We show here that responses are further augmented by the addition of CpG ODN to the DNA vaccine. The DNA vaccine but not the protein subunit vaccine was able to induce anti-HBs in mice injected on the day of birth. A combination approach of DNA prime and protein boost appears to be particularly effective for vaccination puφoses, although a sufficient period (>2 weeks) must elapse before a boosting response is seen. These studies demonstrate that the addition of CpG ODN to protein or DNA vaccines is a valid new adjuvant approach to improve efficacy.


Experiments on adult mice were carried out using female BALB/c (H-2d, good responder), C57BL/6 (B 10, H-2b, fair responder) and B10.S (H-2S ,MHC-restricted hypo-responder to HBsAg) mice (Charles River, Montreal, QC) at 6-8 weeks of age. Mice with class II MHC deficiency (C2D, H-2b, GenPharm, Mountain View, CA) due to gene knockout were used as a model of a non-responder. Newborn mice were obtained through breeding male and female BALB/c mice (Charles River) in our own animal facility (Loeb Research Institute, Ottawa Civic Hospital, Ottawa, ON). Pregnant females were monitored daily to ensure accurate recording of the date of birth. Both male and female neonates were used for immunization.

HbsAg subunit vaccination of mice

The subunit vaccine consisted of HBsAg (ay subtype) which had been produced as a recombinant protein in yeast cells (Medix Biotech #ABH0905). This was diluted in saline for use without adjuvant. HBsAg was also formulated with alum and/or CpG ODN as adjuvant. HBsAg protein was mixed with aluminum hydroxide (Alhydrogel 85, [Al2O3],

Superfos Biosector, Vedbaek, Denmark) in the same ratio of 25 mg Al3+ per mg protein as used in the commercial vaccines (i.e., 2.5 1 2% Al2O3 per g HBsAg). The protein and alum were mixed with a vortex and then left on ice for at least 30 minutes prior to use to allow the protein to adsorb onto the Al2O3. This solution was mixed again immediately prior to injection by drawing up into the syringe 3-5 times.

For groups treated with CpG ODN, an appropriate volume of synthetic oligodeoxynucleotide (ODN #1826) of the sequence TCCATGACGTTCCTGACGTT synthesized with a phosphorothioate backbone (Oligos Etc. & Oligo Therapeutics, Wilsonville, OR) was added alone or with alum to HBsAg on the day of injection. Adult mice received a single intramuscular (IM) injection into the left tibialis anterior (TA) muscle of 1 or 2 g HBsAg, without or with adjuvant (alum and/or CpG ODN), in 50 1 vehicle. When CpG DNA was added, each animal received a total of 1 , 10, 100 or 500 g ODN. Newborn mice were immunized within 24 hours of birth or 7 days after birth by bilateral injection of a total of 1 g HBsAg into the posterior thigh muscles (2 x 10 1 @ 0.05 mg/ml). All injections were carried out with a 0.3 ml insulin syringe which has a fused 29G needle (Becton Dickenson, Franklin Lakes, NJ). For injection of adults, the needle was fitted with a collar of polyethylene (PE) tubing to limit penetration of the needle to about 3 mm. All intramuscular injections were carried out through the skin (unshaved) and under general anesthesia (Halothane, Halocarbon Laboratories, River Edge, NJ). DNA-based immunization of mice

Mice were immunized against HBsAg using plasmid constructs encoding the major protein (S) of the HBV envelope. The plasmid pCPIO, containing two copies of the HBV genome (ayw subtype; GeneBank reference HPBAYW) as a head-to-tail fusion (Dubois et al, 1980), was the source of the envelope coding sequences and the 3' untranslated sequences which include the viral polyadenylation signal. A 1.9 kb J hol-BglTl restriction fragment from pCPIO (containing the S coding sequences) was cloned into the corresponding sites of a modified p Bluescript SK vector containing extra restriction sites in the polylinker (kindly provided by Dr. Shahragim Tajbakhsh, Pasteur Institute). A mKpril-BssHΩ. restriction fragment was then removed and cloned into the pRc/CMV expression vector (Invitrogen) using the Kpnl site of the polylinker and the ZtøsHII site within the neomycin gene of the vector. This cloning step places the envelope sequences under the control of the CM V promoter and removes the bovine growth hormone polyadenylation sequences, the fl origin, the SV40 promoter and origin, and most of the neomycin gene. An SV40 polyadenylation signal from the pRc/CMV vector is found after the transcribed HBV sequences. This construct has been described previously (Davis et al, 1993) and is designated here as pCMV-S.

DNA was purified on Qiagen anion-exchange chromatography columns (Qiagen GmbH, Hilden, Germany). This method, which yields predominantly supercoiled, double-stranded, closed circular DNA, results in virtually no contamination with chromosomal DNA, RNA or protein and very low contamination with endotoxin. The DNA was resuspended in sterile saline (0.15M NaCl, BDH) and the concentration of DNA was calculated based on absorbance of ultraviolet light (OD 260). The final concentration was adjusted to 0.1 to 1 mg/ml and the DNA solutions were stored at -20C until required for injection.

Direct gene transfer in adult mice was carried out by unilateral or bilateral IM injection into the TA muscle of DNA in 50 1 such that each animal received a total of 1, 10 or 100 g DNA. Newborn mice received a total of 10 g DNA by bilateral injection into the posterior thigh muscles (2 x 10 1 @ 0.5 mg/ml). Injections were with a 0.3 ml insulin syringe which has a fused 29G needle, and for injection of adults the needle was fitted with a collar of PE tubing to limit penetration of the needle to about 2 mm. All intramuscular injections were carried out (through shaved skin for adults) under general anesthesia (Halothane)

Experimental groups

Comparison of alum and CpG ODN as adjuvant, with HBsAg subunit vaccine

Six groups of adult BALB/c mice (n=10) were injected with 1 g HBsAg (i) alone, (ii) mixed with alum, (iii) mixed with 100 g CpG ODN, or (iv, v, vi) mixed with both alum and 10, 100 or 500 g CpG ODN. These mice were bled at 1, 2, 3 and 4 weeks after immunization and the plasma was assayed for anti-HBs. Groups of adult C57BL/6 (B10), B10.S and C2D mice (n=5) were injected 1 g HBsAg (i) alone, (ii) mixed with alum, (iii, iv, v) mixed with 1, 10 or 100 g CpG ODN, or (vi, vii) mixed with both alum and 10 or 100 g CpG ODN. Each animal was boosted by the identical procedure at 6 weeks. The mice were bled at 1, 2, 4, 6 and 8 weeks after immunization and the plasma was assayed for anti-HBs.

Use of CpG ODN as adjuvant, with HBsAg-e.xpressing DNA vaccine

Three groups of adult BALB/c mice (n=10) were injected with a total of 10 g pCMV-S DNA alone or with 100 or 500 g CpG ODN added, divided between two injection sites. Groups of hypo-responder (B10.S) and congenic (B10) mice (n=10) were immunized with 50 g pCMV-S DNA divided between two sites.

Immunization ofneonates with subunit or DNA vaccine Groups of newborn BALB/c mice (n=10) aged <24 hours or 7 days were injected with a total of 1 g HBsAg with alum or with 10 g pCMV-S DNA. Plasma was obtained at 4, 8, 12 and 16 weeks for assay of anti-HBs. Combined DNA prime with protein boost

Five groups of BALB/c mice (n=10) were first immunized with a single injection into the left TA of 10 g pCMV-S, and received (i) no other treatment, or received 2 g pure HBsAg (no adjuvant) (ii) at the same time at the same site, (iii) at the same time and at a different site (left quadriceps), (iii) 2 weeks later at the different site or (iv) 8 weeks later at the different site. Mice were bled at 1, 2. 4, 6, 8, 12, 20 and 24 weeks.

Evaluation of immune response to HbsAg

Heparinized blood was collected by retrobulbar puncture of lightly anaesthetized mice as described elsewhere (Michel et al. , 1995). Plasma was recovered by centrifugation

(7 min @ 13,000 φm). Antibodies specific to HBsAg in plasma were detected and quantified by end-point dilution ELISA assay (in triplicate) on individual samples. Ten-fold serial dilutions of plasma were first added to 96-well microtiter plates with a solid phase consisting of plasma-derived HBsAg particles (100 1/well of HBsAg ay subtype at 1 g/ml, coated overnight at RT) and incubated for 1 hr at 37C. The bound antibodies were then detected by incubation for 1 hr at 37C with HRP-conjugated goat anti-mouse IgG, IgM, IgGl or IgG2a (1 :4000 in PBS-Tween, 10% FCS; 100 1/well, Southern Biotechnology Inc., Birmingham, AL), followed by incubation with OPD solution (100 1/well, Sigma, St. Louis, MO) for 30 minutes at RT in the dark. The reaction was stopped by the addition of sulfuric acid (50 1 of 4N H2S04). End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of non-immune plasma with a cut-off value of 0.05. Anti-HBs titers were expressed as group means of individual animal values, which were themselves the average of triplicate assays.


CpG ODN versus alum as adjuvant for HBV subunit vaccine

Strength and kinetics of humoral response Immunization of BALB/c mice with HBsAg alone elicited only low titers of anti-HBs (<100) by 4 weeks. These titers were 10-fold higher with the addition of alum as adjuvant, 60-fold higher with CpG ODN and more than 500-fold higher with both alum and CpG ODN (FIG. 1). When combined with alum, there is a dose-response for CpG ODN with the best results being obtained with an intermediate dose (100 g) and similar-somewhat poorer results being obtained with lower and higher doses (10 or 500 g) (FIG. 2).

Nevertheless, all doses of CpG ODN greatly improved the titers compared to alum alone.

In the C57BL/6 strain of mouse, antibody titers 4 weeks after HBsAg prime were about 10-times lower than those seen in BALB/c mice, but when boosted at 6 weeks rose to similar levels within 2 weeks. When used alone, alum and CpG ODN (100 g) each augmented the humoral response about 100-fold but when used together increased titers about 1000-fold. A dose-response for CpG ODN was also noted in these mice (in the absence of alum) with 100 g being superior to either 10 or 1 g, although all doses had an adjuvant effect (FIG. 4).

In the hypo-responder B 10.S mice no anti-HBs antibodies were detected with HBsAg alone and low titers were obtained if either CpG ODN or alum are added. The use of alum and CpG together gives the best result although the synergy is less evident than in the BALB/c and C57BL/6 mice (FIG. 5). Non-responder (C2D) mice have no detectable anti-HBs after immunization with HBsAg alone. There are low levels of IgM with addition of alum and this is increased 4-fold with further addition of CpG ODN. There is essentially no detectable IgG after injection of HBsAg + alum, but low titers with both alum and CpG ODN (FIG. 6). Treatment with CpG DNA was well tolerated by all mice, even those receiving the 500 g dose. There was no apparent ruffling of fur, diarrhea or other signs of toxicity. Thl versus Th2 responses

Immunization with either HBsAg alone or with alum induces a predominantly Th2-type humoral response with almost all (>99%) antibodies being of the IgGl isotype. CpG ODN induces significantly more IgG2a antibodies, which are indicative of a Thl-type response, although IgGl still predominate. Remarkably, the combination of alum and CpG

ODN induces about ten-times more IgG2a than IgGl, indicating a real shift from Th2 to Thl (FIG. 7).

CpG ODN as adjuvant to HBV DNA vaccine DNA vaccines induced higher levels of anti-HBs more rapidly than did HBsAg, even when alum was included (compare FIG.s 1 and 8). Addition of CpG ODN to the pCMV-S DNA vaccine increased anti-HBs titers a further five-fold by 4 weeks. The 500 g dose was slightly better than the 100 g dose (FIG. 8). The DNA vaccine was also superior to the HBsAg subunit vaccine in hypo-responder mice. A single injection of DNA induced earlier appearance of anti-HBs, and these reached higher titers than with two doses of protein given at 0 and 4 weeks (FIG. 9).

Antigen versus DNA-based immunization of neonates

Mice immunized with HBsAg plus alum on the day of birth had no detectable anti-HBs even up to 16 weeks later. In contrast, those injected with the DNA vaccine had low levels of anti-HBs by 4 weeks and a good titer (103) by 16 weeks. Immunization of 7 day old mice with either DNA or protein induced anti-HBs, although these appeared much earlier and were much higher with the DNA vaccine. In fact, the DNA vaccine at one day was superior to the protein vaccine given at 7 days (FIG. 10).

Combined DNA- and antigen-based immunization

Co-administration of pure recombinant HBsAg and the DNA vaccine at either the same or different sites did not significantly improve titers of anti-HBs over those induced by the DNA vaccine alone. Nor was a boosting response seen when the HBsAg protein was given two weeks after the DNA vaccine. However, administration of the protein vaccine 8 weeks after the DNA vaccine gave a strong boosting response with titers increasing more than 10-fold over those with the DNA vaccine alone (FIG. 1 1).


CpG ODN versus alum as adjuvant with HBV subunit vaccine in mice

CpG ODN is as good as or superior to alum when each is used alone as adjuvant with the HBsAg subunit vaccine in mice, This indicates that CpG ODN could be used to replace alum in vaccine formulations, which could be desirable to avoid associated side-effects due to local irritation in the muscle. Furthermore, for certain live-attenuated or multivalent vaccines, it is not possible to use alum which through chemical interactions interferes with the efficacy of the vaccine. This should not occur with CpG ODN.

Of even greater interest is the strong synergistic response when CpG ODN and alum are used together to adjuvant the HBsAg subunit vaccine. In humans, this could result in a much higher proportion of individuals attaining protective titers of anti-HBs after two or possibly even one dose of vaccine. Furthermore, protective titers should be reached more quickly and this would be beneficial for immunization in endemic areas. There is a fairly weak dose response to CpG ODN whether or not alum is present, indicating that a wide range of CpG ODN could be useful to adjuvant vaccines in humans.

CpG ODN induces Thl response even in presence of alum

Aluminum hydroxide (alum) is currently the only adjuvant approved for human use. An important disadvantage of alum is that it induces a Th2- rather than a Thl-type immune response, and this may interfere with induction of CTL. Indeed, in mice immunized with recombinant HBsAg, the addition of alum selectively blocked activation of CD8+ CTL (Schirmbeck et al, 1994). Although not essential for protective immunity against HBV, CTL may nevertheless play an important role. For example, a lack of HBV-specific CTL is thought to contribute to the chronic carrier state. In contrast, one of the primary advantages of CpG DNA over alum as an adjuvant is the Thl-bias of the responses and thus the possibility to induce CTL. A striking finding from the present study is that CpG can completely counteract the Th2-bias of alum when the two adjuvants are delivered together. This could allow one to capitalize on the strong synergistic action of the two adjuvants on the humoral response while still allowing CTL.

The use of alum has been linked to Th2-type diseases. The much higher prevalence of asthma (another Th2-type disease) in more highly developed nations may be linked to the high hygiene level and rapid treatment of childhood infections (Cookson and Moffatt, 1997). Early exposure to bacterial DNA (and immunostimulatory CpG motifs) pushes the immune system away from Th2- and towards a Thl-type response and this may account for the lower incidence of asthma in less developed countries, where there is a much higher frequency of upper respiratory infections during childhood. Addition of CpG ODN as adjuvant to all pediatric vaccines could re-establish a Thl -type response thereby reducing the incidence of asthma.

CpG dinucleotides and DNA vaccines

More recently however, it has been shown that the presence of unmethylated CpG motifs in the DNA vaccines is essential for the induction of immune responses against the antigen, which is expressed only in very small quantities (Sato et al. , 1996). As such, the DNA vaccine provides its own adjuvant in the form of CpG DNA. Since single-stranded but not double-stranded DNA can induce immunostimulation in vitro (Krieg et al, unpublished observation), the CpG adjuvant effect of DNA vaccines in vivo is likely due to oligonucleotides resulting from plasmid degradation by nucleases. Only a small portion of the plasmid DNA injected into a muscle actually enters a myofiber and is expressed, the majority of the plasmids is degraded in the extracellular space.

CpG and HBV vaccines for human use

Prophylactic vaccine

Fewer than 20% of healthy individuals attain protective levels of anti-HBs (10 mlU/ml) after a single dose of subunit HBV vaccine and only 60-70% reach this level after two doses. Thus, three doses (usually given at 0, 1 and 6 months) are required to seroconvert >90% of vaccinated individuals. The three dose regime is frequently not completed owing to poor patient compliance, and in endemic areas, protective levels may not be induced quickly enough. Thus there is a need for a prophylactic vaccine that can induce protective immunity more quickly and with fewer doses. This might be possible with the addition of CpG ODN as an adjuvant to the subunit vaccine. Another possibility is an HBsAg-expressing DNA vaccine, which could be optimized by addition of CpG dinucleotide motifs. DNA vaccines would offer additional advantages such as relatively low cost and ease of manufacturing, and heat-stability which circumvents the requirement for a cold-chain.

Neonates bom in endemic areas require particularly rapid induction of strong HBV-specific immunity owing to the high rate of chronicity resulting from infection at a young age. Without immunoprophylaxis, 70-90% of infants bom to mothers positive for both HBsAg and the e antigen (HBeAg) become infected and almost all of these become chronic carriers (Stevens et al. , 1987). Even when vaccinated with a four dose regime of the HBV subunit vaccine commencing on the day of birth, 20% of such infants became chronically infected and this was reduced to only 15% if they were also given HBV-specific immunoglobulin (Chen et al. , 1996). Subunit or DNA vaccines with CpG adjuvant should reduce this further owing to a more rapid appearance and higher titers of anti-HBs antibodies and the induction of HBV-specific CTL, which could help clear virus from the liver of babies infected in utero, and which likely account for most of the failures with neonatal vaccination. DNA vaccines could be particularly effective if coupled with a protein boost.

Non-responders and hypo-responders

Between 5 and 10% of individuals are non-responders or hypo-responders to the subunit HBsAg vaccine. This may be MHC-restricted (Kruskall et al, 1992) and is thought to result from a failure to recognize T-helper epitopes. In certain immunocompromised individuals (e.g., kidney dialysis patients, alcoholics) the rate of non-response can approach 50%. In the present study, alum plus CpG ODN gave higher anti-HBs titers than alum alone in a strain of mice which has MHC-restricted hypo-responsiveness to HBsAg, thought to result in a failure to recognize T-helper epitopes. CpG ODN also overcame non-response in mice genetically incapable of providing T-help owing to an absence of class II MHC (Milich, 1988). These results support the in vitro finding that CpG ODN drives the T cell independent activation of B cells. Use of CpG DNA as an adjuvant may increase the response rate to HBsAg in humans. A link between MHC phenotype and non-responsiveness to HBsAg has been demonstrated in humans (Kruskall et al, 1992).

Chronic carriers of HBV

HBV chronicity results in 10-15% of individuals infected as adolescents or adults, but 90-95% for those infected (either vertically or horizontally) as infants. HBV chronicity eventually leads to cirrhosis and increased risk of hepatocellular carcinoma and an estimated one million people die each year from HBV-related liver disease. Persistent HBV infection of the liver results when acute infection fails to launch an appropriate immune response to clear the virus. Such chronic carriers have circulating HBsAg and HBV core antigen (HBcAg/HBeAg) without specific immunity. It is thought that the absence of HBV-specific CTL may contribute to the establishment and maintenance of the chronic carrier state. Indeed, many previously infected individuals, even years after clinical and serological recovery, have traces of HBV in their blood and HBV-specific CTL that express activation markers indicative of recent contact with antigen (Rehermann et al, 1996). These results suggest that sterilizing immunity may not occur after HBV infection and that chronic activation of CTL is responsible for keeping the virus under control.

There is currently no cure for the HBV chronic infection. Interferon is used currently but this cures only 10-20% of treated individuals (Niederau et al, 1996). Anti-viral drugs (e.g., lamivudine) can reduce circulating virus to undetectable levels, however these return to pretreatment levels if the drug is stopped. Each of these types of treatment is also expensive and has certain undesirable side-effects. The possibility to induce a strong Thl-type response with CpG ODN added to a subunit vaccine may help overcome the chronic carrier state. For this application, it might be desirable to include additional B and T cell epitopes encoded by other domains of the HBV envelope protein (e.g., pre-Sl and pre-S2). Since the pre-Sl polypeptide may prevent secretion, it might be desirable to encode a truncated version of this such as that described by Li et al. (1994) with only amino acids 21-47 which include the hepatocyte receptor-binding site and induce anti-preSl immune responses yet still maintain particle secretion. Repeated doses of a subunit vaccine containing the middle HBV envelope protein (preS2 + S) reduced viral replication in 50% of vaccinated chronic carriers (Pol et al , 1993). Addition of CpG ODN would presumably improve these results through its strong

Thl bias.

A DNA vaccine might also prove very effective as a therapeutic vaccine for HBV chronic carriers. We have previously shown that an HBsAg-expressing DNA vaccine could break tolerance to HBsAg in transgenic mice expressing HBsAg in the liver from before birth (Mancini et al. , 1996). This response appears to be mediated by T cells via a non-lytic mechanism. Addition of CpG dinucleotide motifs that preferentially induce Thl cytokines and strong CTL responses could further improve DNA vaccines for application to HBV chronic carriers.


ODN containing CpG dinucleotides, in the proper base context to cause immune activation, are useful as an adjuvant to protein vaccines (whole pathogen or subunit). The CpG ODN could be used alone or in combination with alum. Used alone, it will allow the possibility to adjuvant vaccines that cannot be mixed with alum (e.g., live attenuated pathogens, multivalent vaccines). Used together, it will capitalize on the synergistic effect to induce very potent immune responses, yet still maintain the Thl bias of CpG DNA. CpG dinucleotides also act to adjuvant DNA vaccines. Additional CpG given as ODN or cloned into the plasmid vector could further augment immune responses. With respect to vaccines against HBV, CpG ODN could be added as an adjuvant to recombinant HBsAg subunit vaccines, either alone or in combination with alum, or can be cloned into an HBsAg-expressing DNA vaccine. These improved vaccines can (i) induce higher titers more quickly and reduce the number of doses required to induce protective immunity from three to two, (ii) overcome hypo- or non- responsiveness to HBsAg, (iii) control the chronic carrier state through induction of CTL, and (iv) induce rapid and stronger immunity in neonates in HBV endemic areas.


Chen D.S. et al (1996). Cancer Causes & Control 7: 305-311.

Cookson, W.O.C.M. & Moffatt, M.F. (1997). Science 275: 41-42.

Cowdery, J.S. et al. (1996). J. Immunol 156: 4570.

Davis, H.L. etal (1993). Human Molec. Genet. 2: 1847-1851.

Davis, H.L. et al (1995). Human Gene Ther. 6: 1447-1456.

Davis, H.L. et al (1996). Proc. Natl. Acad. Sci. USA 93: 7213-7218.

Davis, H.L. et al. (1996). Vaccine 14: 910-915.

Davis, H.L. et al (1997). Gene Ther. (in press).

Davis, H.L. & Brazolot MiUan, CL. (1997). Blood Cell Biochem. (in press)

Donnelly, J.J. et al. (1996). Life Sciences. 60: 163-172.

Dubois, M.-F. et al. (1980). Proc. Natl. Acad. Sci. USA 77: 4549-4553.

Ellis, R. W. (Ed.) (1993). Hepatitis B Vaccines in Clinical Practise. New York: Marcel-Dekker.

Halpern, M.D. et al. (1996). Cell. Immunol. 167: 72.

Klinman, D.M. et al (1996). Proc. Natl. Acad. Sci. USA 93: 2879-2883.

Krieg, A.M. et al. (1995). Nature 374: 546-549.

Kruskall, M.S. et al. (1992). J. Exp. Med. 175: 495-502.

Li et al. , (1994). J. Gen. Virol. 75: 3673-3677.

Mancini, M. et al. (1996). Proc. Natl. Acad. Sci. USA 93: 12496-12501. Michel, M.-L. et al (1984) Proc. Natl. Acad. Sci. USA 81: 7708-7712.

Michel, M.-L. et al. (1995). Proc. Natl. Acad. Sci. USA 92: 5307-5311.

Milich, D.R. (1988). Immunol Today 9: 380-386.

Niederau et al (1996). New Eng. J. Med. 334: 1422-1427.

Pol, S. etal. (1993). C. R. Acad. Sci. (Paris) 316: 688-691.

Rehermann, B. et al (1996). Nature Med. 2: 1104-1108.

Sato, Y., et al. (1996). Science 273: 352-354.

Schirmbeck, R. et al (1994). J. Immunol. 152: 1110-11 19.

Stevens, CE. et al. (1987). J. m. Med. Assoc.257: 2612-2616.

Vogel, F.R. & Sarver, Ν. (1995). Clin. Microbiol Rev. 8: 406-410.

1. A method of inducing an immune response in a subject, said method comprising: administering to the subject a therapeutically effective amount of nucleic acid encoding an antigenic polypeptide, and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.

2. The method of claim 1 , wherein the oligonucleotide is from 8-30 bases in length.

3. The method of claim 1 , wherein the subject is human.

4. The method of claim 1 , wherein said nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide are administered in a vector.

5. The method of claim 1 , wherein said nucleic acid encoding an antigenic protein encodes a viral antigen.

6. The method of claim 5, wherein said viral antigen is a hepatitis viral antigen.

7. The method of claim 6, wherein said hepatitis viral antigen is a hepatitis B virus surface antigen.

8. The method of claim 1, further comprisimg administering an adjuvant.

9. The method of claim 8, wherein the adjuvant is aluminum hydroxide.

10. The method of claim 1 , wherein the oligonucleotide has a formula: S'NΛCGX^' (SEQ ID NO: 1 ) wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or thymidine; X2 is cytosine or thymine, N is any nucleotide and N, + N2 is from about 0-26 bases. 11. The method of claim 10, wherein N, and N2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.

12. The method of claim 1, wherein the oligonucleotide has a formula: 5' N,X,X2CGX3X4N23' (SEQ ID NO:2) wherein at least one nucleotide separates consecutive CpGs; X,X2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X3 X4 is selected from the group consisting ofTpT or CpT; N is any nucleotide and N, +N2 is from about 0-26 bases.

13. The method of claim 12, wherein N, and N2 do not contain a CCGG quadmer or more than one CCG or CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.

14. The method of claim 12, wherein said oligonucleotide is 5'- TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3).

15. The method of claim 1 , said further comprising: administering to the subject an therapeutically effective amount of the antigenic polypeptide.

16. A method for treating a subj ect having or at risk of having a viral-mediated disorder, comprising administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.

17. The method of claim 16, wherein the oligonucleotide is from 8-30 bases in length.

18. The method of claim 16, wherein the subject is human. 19. The method of claim 16, wherein said nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide are administered in a vector.

20. The method of claim 16, said further comprising administering to the subject an therapeutically effective amount of the antigenic polypeptide .

21. The method of claim 16, where i n said nucleic acid encoding an antigenic polypeptide encodes a viral aniigen.

22. The method of claim 20, wherein said viral antigen is a hepatitis antigen.

23. The method of claim 22, wherein said hepatitis antigen is a hepatitis B surface antigen.

24. The method of claim 16, further comprisimg administering an adjuvant.

1 25. The method of claim 24, wherein the adjuvant is aluminum hydroxide.

1 26. The method of claim 16, wherein the oligonucleotide has a formula:

2 5*N,X,CGX2N23' (SEQ ID NO: 1)

3 wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or

4. thymidine; X2 is cytosine or thymine, N is any nucleotide and N, + N2 is from about 0-26

5 bases.

1 27. The method of claim 26, wherein N, and N2 do not contain a CCGG quadmer or

2 more than one CGG trimer; and the nucleic acid sequence is from about 8-30

3 bases in length.


8. The method of claim 16, wherein the oligonucleotide has a formula: 5' N,X,X2CGX3X4N23' (SEQ ID NO:2) wherein at least one nucleotide separates consecutive CpGs; X,X2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X3 X4 is selected from the group consisting of TpT or CpT; N is any nucleotide and N, + N2 is from about 0-26 bases.
29. The method of claim 28, wherein N, and N2 do not contain a CCGG quadmer or more than one CCG or CGG tri er; and the nucleic acid sequence is from about 8-30 bases in length.
30. The method of claim 28, wherein Said oligonucleotide is 5'- TCCATGACGTTCCTGACG1T-3' (SEQ ID NO:3).
31. A method for treating a subject having or at risk of having a chronic viral infection, said method comprising administering to the subject an effective amount of a nucleic acid encocl ing an antigenic polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
32. The method of claim 31, wherein the oligonucleotide is from 8-30 bases in length.
33. The method of claim 31, wherein the subject is human.
34. The method of claim 31 , said further comprising administering to the subject an therapeutically effective amount of the antigenic polypeptide .
35. The method of claim 31 , further comprisimg administering an adjuvant.
36. The method of claim 34, wherein the adjuvant is aluminum hydroxide.
37. The method of claim 31 , wherein said antigenic protein is a viral antigen.
38. The method of claim 37, wherei n said viral antigen is a hepatitis viral antigen.
39. The method of claim 38, wherein said hepatitis viral antigen is a hepatitis B surface antigen.
40. The method of claim 31 , wherein the oligonucleotide has a formula: wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or thymidine; X2 is cytosine or thymine, N is any nucleotide and N, + N2 is from about 0-26 bases.
41. The method of claim 40, wherein N, and N2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
42. The method of claim 31 , wherein the oligonucleotide has a formula: 5' N,X,X2CGX3X4N23' (SEQ ID NO:2) wherein at least one nucleotide separates consecutive CpGs; X,X2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X3 X4 is selected from the group consisting of TpT or CpT; N is any nucleotide and N, + N2 is from about 0-26 bases.
43. The method of claim 42, wherein N! and N2 do not contain a CCGG quadmer or more than one CCG or CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
44. The method of claim 42, wherein said oligonucleotide is 5'-TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3).
5. A pharmaceutical composition comprising an immumostimulaotry CpG oligonucletide and a nucleic acid encoding an antigenic protein in a phamaceutically acceptable carrier.
[received by the International Bureau on 14 August 1998 ( 14.08.98) ; original claims 1 -45 cancel led ; new claims 1 -136 added ( 15 pages) ]
1. A method of inducing protective immune response in a subject having or at risk of having infection with an infectious organism, said method comprising administering to the subject a therapeutically effective amount of an antigen, and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
2. The method of claim 1, wherein said infectious organism is a bacteria or a parasite.
3. The method of claim 1 , wherein said infectious organism is a virus.
4. The method of claim 3, wherein said vims is a hepatitis virus.
5. The method of claim 4, wherein said hepatitis virus is a hepatitis B vims.
6. The method of claim 1, wherein the oligonucleotide is from 8-30 bases in length.
7. The method of claim 1, wherein the oligonucleotide is contained within a plasmid made with a natural phosphodiester backbone.
8. The method of claim 1 , wherein the oligonucleotide is made completely or partially with a synthetic backbone.
9. The method of claim 8, wherein the oligonucleotide is made completely with a synthetic phosphorothioate backbone.
10. The method of claim 8, wherein the oligonucleotide is made with a chimeric backbone with synthetic phosphorothioate linkages at the 3' and 5' ends and natural phosphodiester linkages in the CpG-containing center.
11. The method of claim 10, wherein the said chimeric oligonucleotide is made with synthetic phosphorothioate linkages for five linkages at the 3' end and two linkages at the 5' end, and with natural phosphodiester linkages in between.
12. The method of claim 1, wherein the oligonucleotide has a formula:
5"N1X1CGX2N23' (SEQ ID NO: 1) wherein at least one nucleotide separates consecutive CpGs; Xl is adeπine, guanine or thymidine; X2 is cytosine or thymine; N is any nucleotide and Nl + N2 is from about 0-26 bases.
13. The method of claim 12, wherein the Nl + N2 do not contain a CCGG quadmer or more than one CGG trimer, and the nucleic acid sequence is from about 8-30 bases in length.
14. The method of claim 1, wherein the oligonucleotide has a formula: 5'N1X1X2CGX3X4N23' (SEQ ID NO: 2) wherein at least one nucleotide separates consecutive CpGs; X1X2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X3X4 is selected from the group consisting of TpT and CpT; N is any nucleotide and Nl + N2 is from about 0-26 bases.
15. The method of claim 14, wherein the Nl + N2 do not contain a CCGG quadmer or more than one CGG trimer, and the nucleic acid sequence is from about 8-30 bases in length.
16. The method of claim 14, wherein said oligonucleotide is
17. The method of claim 1 , wherein the antigen is a polypeptide.
18. The method of claim 17, wherein said antigenic polypeptide is from a virus.
19. The method of claim 18, wherein said viral antigen is a hepatitis viral antigen.
20. The method of claim 1 , wherein said hepatitis viral antigen is a hepatitis B viral antigen.
5 21, The method of claim 20, wherein said hepatitis B viral antigen is a hepatitis
B virus surface antigen.
22. The method of claim 1 , further comprising at least one additional adjuvant.
23. The method of claim 22, wherein the additional adjuvant contains aluminum (alum).
10 24. The method of claim 23, wherein the aluminum-containing adjuvant is aluminum hydroxide.
25. The method of claim 1, wherein the antigen and the CpG containing oligonucleotide are administered in a delivery vector or vehicle.
26. The method of claim 1 , wherein the subject is a mammal.
15 27. The method of claim 1, wherein the subject is a human.
28. A method of inducing an immune response in a subject, said method comprising: administering to the subject a therapeutically effective amount of nucleic acid encoding an antigenic polypeptide, and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated
20 CpG dinucleotide.
29. The method of claim 28, wherein said immune response is to prevent infection by an infectious organism.
30. The method of claim 29, wherein said infectious organism is a virus.
31. The method of claim 30, wherein said virus is a hepatitis virus.
5 32. The method of claim 31, wherein said hepatitis virus is a hepatitis B virus.
33. The method of claim 28, wherein said nucleic acid vector is a DNA vector
34. The method of claim 33, wherein the CpG containing oligonucleotide is cloned into said vector.
35. The method of claim 33, wherein said DNA vector is plasmid DNA.
10 36. The method of claim 28, wherein the CpG-containing oligonucleotide is a separate entity from the antigen-encoding nucleic acid vector.
37. The method of claim 36, wherein the CpG oligonucleotide is contained in a plasmid with a phosphodiester backbone.
38. The method of claim 36, wherein said CpG-containing oligonucleotide has 15 a partially synthetic backbone.
39. The method of claim 38, wherein said oligonucleotide is made with a chimeric backbone with synthetic phosphorothioate linkages at the 3' and 5' ends and natural phosphodiester linkages in the CpG-containing center.
40. The method of claim 39, wherein said chimeric oligonucleotide is made with synthetic phosphorothioate linkages for five linkages at the 3' end and two linkages at the 5' end, and with natural phosphodiester linkages in between.
41. The method of claim 28, wherein the oligonucleotide has a formula: 5TSriXlCGX2N23' (SEQ ID NO: 1) wherein at least one nucleotide separates consecutive CpGs; XI is adenine, guanine or thymidine; X2 is cytosine or thymine; N is any nucleotide and Nl + N2 is from about 0-26 bases.
42. The method of claim 41, wherein the Nl + N2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8- 1000 bases in length.
43. The method of claim 28, wherein the oligonucleotide has a formula: 5TNUX1X2CGX3X4N23' (SEQ ID NO: 2) wherein at least one nucleotide separates consecutive CpGs; X1X2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X3X4 is selected from the group consisting of TpT and CpT; N is any nucleotide and Nl + N2 is from about 0-26 bases.
44. The method of claim 43, wherein the Nl + N2 do not contain a CCGG quadmer or more than one CGG trimer, and the nucleic acid sequence is from about 8-1000 bases in length.
45. The method of claim 43, wherein said oligonucleotide is S'-TCCATGACGTTCCTGACGTT-S' (SEQ ID NO:3).
46. The method of claim 28, wherein said antigen-encoding nucleic acid encodes a viral antigen.
47. The method of claim 46, wherein said viral antigen is a hepatitis viral antigen.
48. The method of claim 47, wherein said hepatitis viral antigen is a hepatitis B viral antigen.
49. The method of claim 48, wherein said hepatitis B viral antigen is a hepatitis
B virus surface antigen.
50. The method of claim 28, wherein the antigen-encoding nucleic acid and the CpG-dinucleotide are administered in a delivery vector or vehicle.
51. The method of claim 28 , wherein the antigen-encoding nucleic acid and the CpG-dinucleotide are administered with an additional adjuvant.
52. The method of claim 28, wherein the subject is a mammal.
53. The method of claim 28, wherein the subject is a human.
54. A method of inducing an immune response in a subject, said method comprising administering to the subject a therapeutically effective amount of nucleic acid encoding an antigenic polypeptide, a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide, and a therapeutically effective amount of an antigen.
55. The method of claim 54, wherein the CpG dinucleotide is contained in same plasmid as that encoding the antigen and this is administered mixed together with the antigen.
56. The method of claim 54, wherein said antigen-encoding and CpG dinucleotide-containing nucleic acid is given at a different site than said antigen plus CpG dinucleotide-containing oligonucleotide.
57. The method of claim 54, wherein the said antigen-encoding and CpG 5 dinucleotide-containing nucleic acid is given at a different time from said antigen plus CpG dinucleotide-containing oligonucleotide.
58. The method of claim 57, wherein the immune response is primed by said antigen-encoding and CpG dinucleotide-containing nucleic acid and the response is boosted by said antigen plus CpG dinucleotide-containing
10 oligonucleotide.
59. The method of claim 54, wherein said antigenic polypeptide is the same as that encoded by the antigen-encoding nucleic acid.
60. The method of claim S4, wherein said antigenic polypeptide is different than that encoded by the antigen-encoding nucleic acid.
15 61. A method of treating a subject having an infectious disorder that is chronic or likely to become chronic, said method comprising: administering to the subject a therapeutically effective amount of an antigen, and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
20 62. The method of claim 1 , wherein said infectious disease is viral.
63. The method of claim 62 wherein said viral disease is hepatitis.
64. The method of claim 63, wherein said hepatitis disease is hepatitis B.
65. The method of claim 61, wherein the oligonucleotide is from 8-30 bases in length.
66. The method of claim 61, wherein the oligonucleotide is contained within a plasmid made with a natural phosphodiester backbone.
67. The method of claim 61 , wherein the oUgonucleotide is made completely or partially with a synthetic backbone.
68. The method of claim 67, wherein the oligonucleotide is made completely with a synthetic phosphorothioate backbone.
69. The method of claim 67, wherein the oligonucleotide is made with a chimeric backbone with synthetic phosphorothioate linkages at the 3' and 5' ends and natural phosphodiester linkages in the CpG-containing center.
70. The method of claim 69, wherein the oligonucleotide is made with a chimeric backbone with synthetic phosphorothioate linkages for five linkages at the 3' end and two linkages at the 5' end, and with natural phosphodiester linkages in between.
71. The method of claim 61, wherein the oligonucleotide has a formula: 5"N1X1CGX2N23' (SEQ ID NO: 1) wherein at least one nucleotide separates consecutive CpGs; XI is adenine, guanine or thymidine; X2 is cytosine or thymine; N is any nucleotide and Nl + N2 is from about 0-26 bases.
72. The method of claim 71, wherein the Nl + N2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
73. The method of claim 61, wherein the oligonucleotide has a foπnula: 5'N1X1X2CGX3X4N23' (SEQ ID NO: 2) wherein at least one nucleotide separates consecutive CpGs; X1X2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X3X4 is selected from the group consisting
5 of TpT and CpT; N is any nucleotide and Nl + N2 is from about 0-26 bases.
74. The method of claim 73, wherein the Nl + N2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
75. The method of claim 73, wherein said oligonucleotide is 10 S'-TCCATGACGTTCCTGACGTT-S' (SEQ ID NO:3).
76. The method of claim 61 , wherein the antigen is a polypeptide.
77. The method of claim 76, wherein said antigenic polypeptide is from a virus.
78. The method of claim 77, wherein said viral antigen is a hepatitis viral antigen.
15 79. The method of claim 78, wherein said hepatitis viral antigen is a hepatitis B viral antigen.
80. The method of claim 79, wherein said hepatitis B viral antigen is a hepatitis B virus surface antigen.
81. The method of claim 61 , further comprising at least one additional adjuvant.
20 82. The method of claim 81 , wherein the additional adjuvant contains aluminum
83. The method of claim 82, wherein the additional aluminum-containing adjuvant is aluminum hydroxide.
84. The method of claim 61, wherein the antigen and the CpG containing oligonucleotide are administered in a delivery vector or vehicle.
5 85. The method of claim 61 , wherein the subj ect is a mammal.
86. The method of claim 61 , wherein the subject is a human.
87. A method of treating a subject having an infectious disorder that is chronic or likely to become chronic, said method comprising administering to the subject a therapeutically effective amount of nucleic acid encoding an
10 antigenic polypeptide, and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
88. The method of claim 87, wherein said infectious disease is viral.
89. The method of claim 88, wherein said viral disease is hepatitis.
90. The method of claim 89, wherein said hepatitis disease is hepatitis B.
15 91. The method of claim 87, wherein said nucleic acid vector is a DNA vector
92. The method of claim 91, wherein the CpG containing oligonucleotide is cloned into said vector.
93. The method of claim 91 , wherein said DNA vector is plasmid DNA.
94. The method of claim 87, wherein the CpG-containing oligonucleotide is a separate entity from the antigen-encoding nucleic acid vector.
95. The method of claim 94, wherein said CpG-containing oligonucleotide has a completely or partially synthetic backbone.
5 96. The method of claim 95, wherein said oligonucleotide is made with a chimeric backbone with synthetic phosphorothioate linkages at the 3' and 5' ends and natural phosphodiester linkages in the CpG-containing center.
97. The method of claim 96, wherein said chimeric oligonucleotide is made with synthetic phosphorothioate linkages for five linkages at the 3' end and two
10 linkages at the 5' end, and with natural phosphodiester linkages in between.
98. The method of claim 87, wherein the oligonucleotide has a formula: 5N1X1 CGX2N23' (SEQ ID NO: 1) wherein at least one nucleotide separates consecutive CpGs; XI is adenine, guanine or thymidine; X2 is cytosine or thymine; N is any nucleotide and Nl + N2 is from about 0-26 bases.
15 99. The method of claim 98, wherein the Nl + N2 do not contain a CCGG quadmer or more than one CGG trimer, and the nucleic acid sequence is from about 8-1 00 bases in length.
100. The method of claim 87, wherein the oligonucleotide has a formula:
5'N1X1X2CGX3X4N23' (SEQ ID NO: 2) wherein at least one nucleotide
20 separates consecutive CpGs; XI X2 is selected from the group consisting of
GpT, GpG, GpA ApT and ApA; X3X4 is selected from the group consisting of TpT and CpT; N is any nucleotide and Nl + N2 is from about 0-26 bases,
101. The method of claim 100, wherein the Nl + N2 do not contain a CCGG quadmer or more than one CGG trimer, and the nucleic acid sequence is from about 8-1000 bases in length.
102. The method of claim 100, wherein said oligonucleotide is 5 5'-TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3).
103. The method of claim 87, wherein said antigen-encoding nucleic acid encodes a viral antigen.
104. The method of claim 103, wherein said viral antigen is a hepatitis viral antigen.
10 105. The method of claim 104, wherein said hepatitis viral antigen is a hepatitis
B viral antigen.
106. The method of claim 105, wherein said hepatitis B viral antigen is a hepatitis B virus surface antigen.
107. The method of claim 87, wherein the antigen-encoding nucleic acid and the 15 CpG-dinucleotide are administered in a delivery vector or vehicle.
108. The method of claim 87, wherein the antigen-encoding nucleic acid and the CpG-dinucleotide are administered with an additional adjuvant.
109. The method of claim 87, wherein the subject is a mammal.
110. The method of claim 87, wherein the subject is a human.
111. A method of treating a subject having an infectious disorder that is chronic or likely to become chronic, said method comprising: administering to the subject a tlierapeutically effective amount of nucleic acid encoding an antigenic polypeptide, a therapeutically effective amount of an oligonucleo- tide containing at least one unmethylated CpG dinucleotide, and a therapeutically effective amount of an antigen.
112. The method of claim 111, wherein the CpG dinucleotide is contained in the same plasmid as that encoding the antigen.
113. The method of claim 112, wherein said antigen-encoding and CpG dinucleo- tide-containing nucleic acid is given mixed together with said antigen.
114. The method of claim 111, wherein said antigen-encoding and CpG dinucleotide-containing nucleic acid is given at a different site than said antigen plus CpG dinucleotide-containing oligonucleotide.
115. The method of claim 111, wherein the CpG-containing oligonucleotide is a separate entity from the nucleic acid encoding an antigenic polypeptide.
116. The method of claim 115, wherein said CpG-containing oligonucleotide is contained within a plasmid,
117. The method of claim 115, wherein said CpG-containing oligonucleotide is made with a completely or partially synthetic backbone.
118. The method of claim 111, wherein the said antigen-encoding and CpG dinucleotide-containing nucleic acid is given at a different time from said antigen plus CpG dinucleotide-containing oUgonucleotide,
119. The method of claim 118, wherein the immune response is primed by said antigen-encoding and CpG dinucleotide-containing nucleic acid and the response is boosted by said antigen plus CpG dinucleotide-containing oligonucleotide.
120. The method of claim 111, wherein said antigenic polypeptide is the same as that encoded by the antigen-encoding nucleic acid.
121. The method of claim 111, wherein said antigenic polypeptide is different than that encoded by the antigen-encoding nucleic acid,
12 . A pharmaceutical composition comprising an antigen and an oligonucleotide containing an immunostimulatory CpG motif in a pharmaceuticaUy acceptable carrier.
123. The composition of claim 122, wherein the said antigen is a viral antigen.
124. The composition of claim 123, wherein the said viral antigen is a hepatitis viral antigen.
125. The composition of claim 124, wherein the said viral hepatitis antigen is a hepatitis B antigen.
126. The composition of claim 125, wherein the said hepatitis B antigen is a hepatitis B surface antigen.
127. A pharmaceutical composition comprising a nucleic acid encoding an antigenic protein and an oUgonucleotide containing an immunostimulatory
CpG motif in a pharmaceutically acceptable carrier.
128. The composition of claim 127, wherein the said antigen is a viral antigen.
129. The composition of claim 128, wherein the said viral antigen is a hepatitis viral antigen,
130. The composition of claim 129, wherein the said viral hepatitis antigen is a 5 hepatitis B antigen.
131. The composition of claim 130, wherein the said hepatitis B antigen is a hepatitis B surface antigen.
132. A pharmaceutical composition comprising a nucleic acid encoding an antigenic protein and an antigen in a pharmaceutically acceptable carrier.
10 133. The composition of claim 132, wherein the said antigen is a viral antigen
134. The composition of claim 133, wherein the said viral antigen is a hepatitis viral antigen.
135. The composition of claim 134, wherein the said viral hepatitis antigen is a hepatitis B antigen.
15 136. The composition of claim 135, wherein the said hepatitis B antigen is a hepatitis B surface antigen.

Priority Applications (2)

Application Number Priority Date Filing Date Title
US4037697 true 1997-03-10 1997-03-10
US60/040,376 1997-03-10

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
JP53973098A JP5087758B2 (en) 1997-03-10 1998-03-10 Use of a nucleic acid containing an unmethylated CpG dinucleotide as an adjuvant
EP19980912919 EP1005368B1 (en) 1997-03-10 1998-03-10 Use of nucleic acids containing unmethylated CpG dinucleotide in combination with alum as adjuvants
CA 2283557 CA2283557A1 (en) 1997-03-10 1998-03-10 Use of nucleic acids containing unmethylated cpg dinucleotide as an adjuvant
DK98912919T DK1005368T3 (en) 1997-03-10 1998-03-10 Use of nucleic acids containing unmethylated CpG dinucleotide in combination with alum as adjuvants
DE1998641122 DE69841122D1 (en) 1997-03-10 1998-03-10 Use of non-methylated CpG dinucleotide in combination with aluminum as adjuvants
US10023909 US7488490B2 (en) 1997-03-10 2001-12-18 Method of inducing an antigen-specific immune response by administering a synergistic combination of adjuvants comprising unmethylated CpG-containing nucleic acids and a non-nucleic acid adjuvant

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15461498 A-371-Of-International 1998-09-16 1998-09-16
US09325193 Continuation-In-Part US6406705B1 (en) 1997-03-10 1999-06-03 Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant

Publications (1)

Publication Number Publication Date
WO1998040100A1 true true WO1998040100A1 (en) 1998-09-17



Family Applications (1)

Application Number Title Priority Date Filing Date

Country Status (7)

Country Link
JP (2) JP5087758B2 (en)
CA (1) CA2283557A1 (en)
DE (1) DE69841122D1 (en)
DK (1) DK1005368T3 (en)
EP (2) EP1005368B1 (en)
ES (1) ES2333069T3 (en)
WO (1) WO1998040100A1 (en)

Cited By (242)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000015256A2 (en) * 1998-09-11 2000-03-23 Aventis Pasteur Immunostimulant emulsion
WO2000067023A1 (en) * 1999-04-29 2000-11-09 Coley Pharmaceutical Gmbh Screening for immunostimulatory dna functional modifyers
WO2000067787A2 (en) * 1999-05-06 2000-11-16 The Immune Response Corporation Hiv immunogenic compositions and methods
WO2001000231A2 (en) * 1999-06-29 2001-01-04 Smithkline Beecham Biologicals S.A. Use of cpg as an adjuvant for malaria vaccine
WO2001015726A2 (en) * 1999-08-27 2001-03-08 Inex Pharmaceuticals Corp. Compositions for stimulating cytokine secretion and inducing an immune response
WO2001022972A2 (en) * 1999-09-25 2001-04-05 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US6218371B1 (en) 1998-04-03 2001-04-17 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US6225292B1 (en) 1997-06-06 2001-05-01 The Regents Of The University Of California Inhibitors of DNA immunostimulatory sequence activity
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
WO2001051500A1 (en) * 2000-01-14 2001-07-19 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
WO2001095935A1 (en) * 2000-01-20 2001-12-20 Ottawa Health Research Institute Immunostimulatory nucleic acids for inducing a th2 immune response
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6429199B1 (en) 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US6444233B1 (en) 1998-05-19 2002-09-03 Research Development Foundation Triterpene compositions and methods for use thereof
JP2002537353A (en) * 1999-02-26 2002-11-05 カイロン エセ.ピー.アー. Enhancement of Neisseria antigen bactericidal activity using an oligonucleotide comprising a CG motif
WO2003014316A2 (en) 2001-08-07 2003-02-20 Dynavax Technologies Corporation Immunomodulatory compositions, formulations, and methods for use thereof
JP2003508494A (en) * 1999-09-07 2003-03-04 スミスクライン ビーチャム バイオロジカルズ ソシエテ アノニム New composition
US6544518B1 (en) 1999-04-19 2003-04-08 Smithkline Beecham Biologicals S.A. Vaccines
WO2003028656A2 (en) 2001-10-03 2003-04-10 Chiron Corporation Adjuvant compositions
US6558670B1 (en) 1999-04-19 2003-05-06 Smithkline Beechman Biologicals S.A. Vaccine adjuvants
US6589940B1 (en) 1997-06-06 2003-07-08 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
WO2003066649A1 (en) * 2002-02-04 2003-08-14 Biomira Inc. Immunostimulatory, covalently lipidated oligonucleotides
WO2003070909A2 (en) 2002-02-20 2003-08-28 Chiron Corporation Microparticles with adsorbed polypeptide-containing molecules
JP2003526673A (en) * 2000-03-10 2003-09-09 ダイナバックス テクノロジーズ コーポレイション The method reduces papilloma virus infection with an immunomodulatory polynucleotide sequences
JP2003526670A (en) * 2000-03-10 2003-09-09 ダイナバックス テクノロジーズ コーポレイション Remission Method symptoms of herpes infection using immunomodulatory polynucleotide sequences
JP2003526672A (en) * 2000-03-10 2003-09-09 ダイナバックス テクノロジーズ コーポレイション Method for the prophylaxis and treatment of immunoregulatory polynucleotides using sequence respiratory viral infections
WO2003030934A3 (en) * 2001-10-06 2003-11-06 Qiagen Gmbh Cpg formulations and related methods
JP2003535043A (en) * 2000-03-10 2003-11-25 ダイナバックス テクノロジーズ コーポレイション How to prevent and treat viral infections using an immunomodulatory polynucleotide sequences
WO2004011650A2 (en) 2002-07-24 2004-02-05 Intercell Ag Antigens encoded by alternative reading frame from pathogenic viruses
US6727230B1 (en) 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US6737066B1 (en) 1999-05-06 2004-05-18 The Immune Response Corporation HIV immunogenic compositions and methods
WO2004074454A2 (en) 2003-02-20 2004-09-02 University Of Connecticut Health Center Methods and compositions for the treatment of cancer and infectious disease using alpha (2) macroglobulin-antigenic molecule complexes
WO2004084938A1 (en) 2003-03-24 2004-10-07 Intercell Ag Improved vaccines
WO2004092360A2 (en) 2003-04-10 2004-10-28 Chiron Corporation The severe acute respiratory syndrome coronavirus
US6821957B2 (en) 1997-05-20 2004-11-23 University Of Iowa Research Foundation Vectors and methods for immunization or therapeutic protocols
US6887464B1 (en) 1999-02-02 2005-05-03 Biocache Pharmaceuticals, Inc. Advanced antigen presentation platform
US6943240B2 (en) 2000-09-15 2005-09-13 Coley Pharmaceuticals Gmbh Nucleic acids for high throughput screening of CpG-based immuno-agonist/antagonist
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US6964769B2 (en) * 2000-05-05 2005-11-15 Cytos Biotechnology Ag Molecular antigen array
US7001890B1 (en) 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US7038029B2 (en) 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7049302B1 (en) 1998-08-10 2006-05-23 Antigenics Inc. Compositions of CPG and saponin adjuvants and uses thereof
WO2006086799A2 (en) 2005-02-11 2006-08-17 Novartis Vaccines And Diagnostics Inc. Prion-specific peptide reagents
US7094409B2 (en) 2001-01-19 2006-08-22 Cytos Biotechnology Ag Antigen arrays for treatment of allergic eosinophilic diseases
WO2006110655A2 (en) 2005-04-08 2006-10-19 Chimerix, Inc. Compounds, compositions and methods for the treatment of poxvirus infections
US7125857B2 (en) 1997-08-29 2006-10-24 The Regents Of The University Of California Modulators of DNA cytosine-5 methyltransferase and methods for use thereof
US7129222B2 (en) 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
EP1746159A2 (en) * 1996-10-30 2007-01-24 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
WO2007052058A1 (en) * 2005-11-04 2007-05-10 Novartis Vaccines And Diagnostics Srl Influenza vaccines including combinations of particulate adjuvants and immunopotentiators
US7223398B1 (en) 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US7250403B2 (en) 2000-03-10 2007-07-31 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US7255868B2 (en) 2001-06-21 2007-08-14 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—I
US7279165B2 (en) 2002-07-19 2007-10-09 Cytos Biotechnology Ag Amyloid β1-6 antigen arrays
EP1841777A1 (en) * 2005-01-28 2007-10-10 Kwon, Hyung-Joo Oligonucleotides derived from mycobacterium for stimulating immune function, treating immune-related diseases, atopic dermatitis and/or protecting normal immune cell
US7282476B2 (en) 2001-08-24 2007-10-16 University Of Victoria Innovation And Development Corporation Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer
WO2007119815A1 (en) 2006-04-14 2007-10-25 Kyowa Hakko Kirin Co., Ltd. Toll-like receptor 9 agonists
WO2008020335A2 (en) 2006-06-09 2008-02-21 Novartis Ag Immunogenic compositions for streptococcus agalactiae
WO2008042024A2 (en) 2006-06-01 2008-04-10 Elan Pharmaceuticals, Inc. Neuroactive fragments of app
US7378234B2 (en) 2002-09-13 2008-05-27 Intercell Ag Method for isolating hepatitis C virus peptides
KR100863630B1 (en) * 1999-09-25 2008-10-15 유니버시티 오브 아이오와 리써치 파운데이션 Immunostimulatory Nucleic Acids
EP1985702A2 (en) 2000-12-08 2008-10-29 Coley Pharmaceuticals GmbH CPG-like nucleic acids and methods of use thereof
EP1992635A1 (en) 2002-12-23 2008-11-19 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US7479285B1 (en) 1999-08-19 2009-01-20 Dynavax Technologies Corporation Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein
WO2009034473A2 (en) 2007-09-12 2009-03-19 Novartis Ag Gas57 mutant antigens and gas57 antibodies
US7514415B2 (en) 2002-08-01 2009-04-07 The United States Of America As Represented By The Department Of Health And Human Services Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides
US7514414B2 (en) 2001-09-24 2009-04-07 The United States Of America As Represented By The Department Of Health And Human Services Suppressors of CpG oligonucleotides and methods of use
US7517520B2 (en) 2003-03-26 2009-04-14 Cytos Biotechnology Ag Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
US7534772B2 (en) * 2000-06-22 2009-05-19 University Of Iowa Research Foundation Methods for enhancing antibody-induced cell lysis and treating cancer
US7537767B2 (en) 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
WO2009086539A2 (en) 2007-12-28 2009-07-09 Elan Pharmaceuticals, Inc. Treatment and prophylaxis of amyloidosis
US7597908B2 (en) 1997-01-30 2009-10-06 Novartis Vaccines And Diagnostics, Inc. Use of microparticles with adsorbed antigen to stimulate immune responses
EP2108374A1 (en) 2004-04-30 2009-10-14 Novartis Vaccines and Diagnostics S.r.l. Combined meningococcal conjugates with common carrier protein
EP2149583A1 (en) 2004-09-24 2010-02-03 Intercell AG Modified VP1-capsid protein of parvovirus B19
WO2010032138A2 (en) 2008-09-18 2010-03-25 Novartis Ag Vaccine adjuvant combinations
EP2168597A1 (en) 2001-07-26 2010-03-31 Novartis Vaccines and Diagnostics S.r.l. Vaccines comprising aluminium adjuvants and histidine
EP2179729A1 (en) 2003-06-02 2010-04-28 Novartis Vaccines and Diagnostics, Inc. Immunogenic compositions based on microparticles comprising adsorbed toxoid and a polysaccharide-containing antigen
US7727712B2 (en) 2000-03-10 2010-06-01 Dynavax Technologies Corporation Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
EP2193810A1 (en) 2005-01-14 2010-06-09 Novartis Vaccines and Diagnostics S.r.l. Meningococcal conjugate vaccination
WO2010067286A2 (en) 2008-12-09 2010-06-17 Pfizer Vaccines Llc IgE CH3 PEPTIDE VACCINE
WO2010079464A1 (en) 2009-01-12 2010-07-15 Novartis Ag Cna_b domain antigens in vaccines against gram positive bacteria
WO2010100632A2 (en) 2009-03-06 2010-09-10 Novartis Ag Chlamydia antigens
WO2010109323A1 (en) 2009-03-24 2010-09-30 Novartis Ag Adjuvanting meningococcal factor h binding protein
WO2010115118A2 (en) 2009-04-03 2010-10-07 Antigenics, Inc. Methods for preparing and using multichaperone-antigen complexes
WO2010138193A2 (en) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Targeted synthetic nanocarriers with ph sensitive release of immunomodulatory agents
EP2258717A2 (en) 2002-11-22 2010-12-08 Novartis Vaccines and Diagnostics S.r.l. Variant form of meningococcal NadA
EP2258390A1 (en) 2002-08-30 2010-12-08 Novartis Vaccines and Diagnostics S.r.l. Improved bacterial outer membrane vesicles
EP2263688A1 (en) 2001-06-20 2010-12-22 Novartis AG Neisseria meningitidis combination vaccines
EP2263687A1 (en) 2002-12-27 2010-12-22 Novartis Vaccines&Diagnostics, Inc. Immunogenic compositions containing phospholipid
WO2010146414A1 (en) 2009-06-15 2010-12-23 National University Of Singapore Influenza vaccine, composition, and methods of use
US7858588B2 (en) 2001-05-21 2010-12-28 Intercell Ag Immunostimulatory oligodeoxynucleic molecules
EP2267036A1 (en) 2003-10-02 2010-12-29 Novartis Vaccines and Diagnostics S.r.l. Hypo- and Hyper-Acetylated Meningococcal Capsular Saccharides
US7867499B2 (en) 2004-11-05 2011-01-11 Novartis Ag Methods of treating dementia by administering virus-like particles coupled to Aβ
EP2272531A2 (en) 2004-04-30 2011-01-12 Novartis Vaccines and Diagnostics S.r.l. Integration of meningococcal conjugate vaccination
EP2272539A2 (en) 2004-10-19 2011-01-12 Elan Pharmaceuticals, Inc. Truncated fragments of alpha-synuclein in lewy body disease
WO2011008974A2 (en) 2009-07-15 2011-01-20 Novartis Ag Rsv f protein compositions and methods for making same
WO2011007257A1 (en) 2009-07-16 2011-01-20 Novartis Ag Detoxified escherichia coli immunogens
EP2277895A1 (en) 2000-10-27 2011-01-26 Novartis Vaccines and Diagnostics S.r.l. Nucleic acids and proteins from streptococcus groups A & B
EP2277538A1 (en) 2003-10-02 2011-01-26 Novartis Vaccines and Diagnostics S.r.l. Combined meningitis vaccines
EP2279747A1 (en) 2004-10-29 2011-02-02 Novartis Vaccines and Diagnostics S.r.l. Immunogenic bacterial vesicles with outer membrane proteins
EP2279746A2 (en) 2002-11-15 2011-02-02 Novartis Vaccines and Diagnostics S.r.l. Surface proteins in neisseria meningitidis
WO2011013034A1 (en) 2009-07-30 2011-02-03 Pfizer Vaccines Llc Antigenic tau peptides and uses thereof
EP2286792A1 (en) 1999-02-26 2011-02-23 Novartis Vaccines and Diagnostics, Inc. Microemulsions with an adsorbent surface, comprising a microdroplet emulsion
EP2289546A2 (en) 2003-01-30 2011-03-02 Novartis Vaccines and Diagnostics S.r.l. Injectable vaccines against multiple meningococcal serogroups
EP2289547A1 (en) 2003-09-12 2011-03-02 Antigenics Inc. Vaccine for treatment and prevention of herpes simplex virus infection
EP2289941A2 (en) 2002-02-25 2011-03-02 Elan Pharmaceuticals Inc. Administration of agents for the treatment of inflammation
WO2011024072A2 (en) 2009-08-27 2011-03-03 Novartis Ag Hybrid polypeptides including meningococcal fhbp sequences
WO2011024071A1 (en) 2009-08-27 2011-03-03 Novartis Ag Adjuvant comprising aluminium, oligonucleotide and polycation
US7901907B2 (en) 1996-01-04 2011-03-08 The Provost Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin Process for production of Helicobacter pylori bacterioferritin
EP2292247A2 (en) 2002-03-05 2011-03-09 Ramot at Tel Aviv University Ltd. Immunizing composition and method for inducing an immune response against the beta-secretase cleavage site of amyloid precursor protein
WO2011027257A2 (en) 2009-09-03 2011-03-10 Pfizer Vaccines Llc Pcsk9 vaccine
WO2011030218A1 (en) 2009-09-10 2011-03-17 Novartis Ag Combination vaccines against respiratory tract diseases
EP2298795A1 (en) 2005-02-18 2011-03-23 Novartis Vaccines and Diagnostics, Inc. Immunogens from uropathogenic escherichia coli
WO2011036562A1 (en) 2009-09-28 2011-03-31 Novartis Vaccines Institute For Global Health Srl Purification of bacterial vesicles
WO2011036564A2 (en) 2009-09-28 2011-03-31 Novartis Vaccines Institute For Global Health Srl Hyperblebbing shigella strains
EP2305302A2 (en) 1999-05-28 2011-04-06 Janssen Alzheimer Immunotherapy Prevention and treatment of amyloidogenic disease
WO2011039631A2 (en) 2009-09-30 2011-04-07 Novartis Ag Expression of meningococcal fhbp polypeptides
WO2011048561A1 (en) 2009-10-20 2011-04-28 Novartis Ag Diagnostic and therapeutic methods for rheumatic heart disease based upon group a streptococcus markers
WO2011051893A1 (en) 2009-10-27 2011-05-05 Novartis Ag Modified meningococcal fhbp polypeptides
WO2011058302A1 (en) 2009-11-10 2011-05-19 Guy's And St Thomas's Nhs Foundation Trust Bacteremia-associated antigen from staphylococcus aureus
EP2327719A1 (en) 2001-09-06 2011-06-01 Novartis Vaccines and Diagnostics S.r.l. Hybrid and tandem expression of neisserial proteins
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
EP2329843A2 (en) 2005-04-18 2011-06-08 Novartis Vaccines and Diagnostics, Inc. Expressing Hepatitis B Virus surface antigen for vaccine preparation
WO2011077309A2 (en) 2009-12-22 2011-06-30 Pfizer Vaccines Llc Vaccine compositions
EP2341069A1 (en) 2004-05-14 2011-07-06 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP1950296A3 (en) * 2000-01-14 2011-07-06 The Government of the United States of America, as represented by the Secretary of Health and Human Services Oligodeoxynucleotide and its use to induce an immune response
EP2351579A1 (en) 2002-10-11 2011-08-03 Novartis Vaccines and Diagnostics S.r.l. Polypeptide vaccines for broad protection against hypervirulent meningococcal lineages
EP2351772A1 (en) 2005-02-18 2011-08-03 Novartis Vaccines and Diagnostics, Inc. Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli
EP2357000A1 (en) 2005-10-18 2011-08-17 Novartis Vaccines and Diagnostics, Inc. Mucosal and systemic immunizations with alphavirus replicon particles
EP2357184A1 (en) 2006-03-23 2011-08-17 Novartis AG Imidazoquinoxaline compounds as immunomodulators
EP2360175A2 (en) 2005-11-22 2011-08-24 Novartis Vaccines and Diagnostics, Inc. Norovirus and Sapovirus virus-like particles (VLPs)
EP2361928A1 (en) 2003-05-19 2011-08-31 Elan Pharmaceuticals Inc. Truncated fragments of alpha-synuclein in Lewy body disease
EP2361629A1 (en) 2002-11-01 2011-08-31 Elan Pharmaceuticals Inc. Prevention and treatment of synucleinopathic disease
WO2011104632A1 (en) 2010-02-26 2011-09-01 Novartis Ag Immunogenic proteins and compositions
EP2364719A1 (en) 1999-06-01 2011-09-14 Janssen Alzheimer Immunotherapy Prevention and treatment of amyloidogenic diseases
EP2368572A2 (en) 2005-11-04 2011-09-28 Novartis Vaccines and Diagnostics S.r.l. Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture
WO2011121576A2 (en) 2010-04-01 2011-10-06 Novartis Ag Immunogenic proteins and compositions
WO2011127316A1 (en) 2010-04-07 2011-10-13 Novartis Ag Method for generating a parvovirus b19 virus-like particle
EP2377552A2 (en) 2005-11-04 2011-10-19 Novartis Vaccines and Diagnostics S.r.l. Influenza vaccines with reduced amount of emulsion adjuvant
EP2377551A2 (en) 2005-11-04 2011-10-19 Novartis Vaccines and Diagnostics S.r.l. Adjuvanted influenza vaccines including cytokine-inducing agents
WO2011130379A1 (en) 2010-04-13 2011-10-20 Novartis Ag Benzonapthyridine compositions and uses thereof
US8043622B2 (en) 2002-10-08 2011-10-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides
EP2382988A1 (en) 2006-03-31 2011-11-02 Novartis AG Combined mucosal and parenteral immunization against HIV
EP2382987A1 (en) 2006-03-24 2011-11-02 Novartis Vaccines and Diagnostics GmbH Storage of influenza vaccines without refrigeration
EP2385126A1 (en) 2005-11-25 2011-11-09 Novartis Vaccines and Diagnostics S.r.l. Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870
WO2011138636A1 (en) 2009-09-30 2011-11-10 Novartis Ag Conjugation of staphylococcus aureus type 5 and type 8 capsular polysaccharides
WO2011149564A1 (en) 2010-05-28 2011-12-01 Tetris Online, Inc. Interactive hybrid asynchronous computer game infrastructure
WO2011154878A1 (en) 2010-06-07 2011-12-15 Pfizer Vaccines Llc Ige ch3 peptide vaccine
WO2011154863A1 (en) 2010-06-07 2011-12-15 Pfizer Inc. Her-2 peptides and vaccines
WO2011161551A2 (en) 2010-06-11 2011-12-29 Novartis Ag Omv vaccines
WO2011161653A1 (en) 2010-06-25 2011-12-29 Novartis Ag Combinations of meningococcal factor h binding proteins
WO2012006359A1 (en) 2010-07-06 2012-01-12 Novartis Ag Delivery of self-replicating rna using biodegradable polymer particles
WO2012006293A1 (en) 2010-07-06 2012-01-12 Novartis Ag Norovirus derived immunogenic compositions and methods
WO2012009442A2 (en) 2010-07-14 2012-01-19 Merck Sharp & Dohme Corp. Anti-addl monoclonal antibody and uses thereof
WO2012020326A1 (en) 2010-03-18 2012-02-16 Novartis Ag Adjuvanted vaccines for serogroup b meningococcus
WO2012035519A1 (en) 2010-09-16 2012-03-22 Novartis Ag Immunogenic compositions
EP2433647A2 (en) 2005-01-27 2012-03-28 Children's Hospital & Research Center at Oakland GNA1870-based vesicle vaccines for broad spectrum protection against diseases caused by Neisseria meningitidis
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US8158768B2 (en) 2002-12-23 2012-04-17 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
WO2012049662A1 (en) 2010-10-15 2012-04-19 Novartis Vaccines Institute For Global Health Srl Hyperblebbing salmonella strains
EP2450056A1 (en) 2005-07-19 2012-05-09 Elan Pharma International Limited Prevention and treatment of synucleinopathic and amyloidogenic disease
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
EP2465872A2 (en) 2004-10-25 2012-06-20 Merck Sharp & Dohme Corporation Anti-ADDL Antibodies and uses thereof
WO2012085668A2 (en) 2010-12-24 2012-06-28 Novartis Ag Compounds
US8222225B2 (en) 2008-05-21 2012-07-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating pneumoconiosis with oligodeoxynucleotides
EP2478916A1 (en) 2006-01-27 2012-07-25 Novartis Vaccines and Diagnostics GmbH Influenza vaccines containing hemagglutinin and matrix proteins
WO2012103361A1 (en) 2011-01-26 2012-08-02 Novartis Ag Rsv immunization regimen
EP2484377A1 (en) 2007-06-27 2012-08-08 Novartis AG Low-additive influenza vaccines
EP2497495A2 (en) 2006-09-11 2012-09-12 Novartis AG Making influenza virus vaccines without using eggs
WO2012131504A1 (en) 2011-03-02 2012-10-04 Pfizer Inc. Pcsk9 vaccine
EP2510947A1 (en) 2009-04-14 2012-10-17 Novartis AG Compositions for immunising against Staphylococcus aureus
EP2514437A1 (en) 2006-07-20 2012-10-24 Novartis AG Frozen stockpiling of influenza vaccines
WO2012143902A1 (en) 2011-04-22 2012-10-26 Wyeth Llc Compositions relating to a mutant clostridium difficile toxin and methods thereof
WO2012158613A1 (en) 2011-05-13 2012-11-22 Novartis Ag Pre-fusion rsv f antigens
EP2532362A1 (en) 2006-12-06 2012-12-12 Novartis AG Vaccines including antigen from four strains of influenza virus
EP2537857A2 (en) 2007-12-21 2012-12-26 Novartis AG Mutant forms of streptolysin O
WO2013006842A2 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic compositions and uses thereof
WO2013006838A1 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic combination compositions and uses thereof
EP2545931A1 (en) 2004-03-19 2013-01-16 Herbs Spring, LLC Herbal therapy for the treatment of food allergy
WO2013009564A1 (en) 2011-07-08 2013-01-17 Novartis Ag Tyrosine ligation process
EP2548895A1 (en) 2007-01-11 2013-01-23 Novartis AG Modified saccharides
WO2013016460A1 (en) 2011-07-25 2013-01-31 Novartis Ag Compositions and methods for assessing functional immunogenicity of parvovirus vaccines
US8372413B2 (en) 2000-12-27 2013-02-12 Dynavax Technologies Corporation Immunomodulatory polynucleotides and methods of using the same
WO2013030783A1 (en) 2011-08-30 2013-03-07 Novartis Ag Immunogenic proteins and compositions
WO2013038375A2 (en) 2011-09-14 2013-03-21 Novartis Ag Methods for making saccharide-protein glycoconjugates
WO2013038385A2 (en) 2011-09-14 2013-03-21 Novartis Ag Escherichia coli vaccine combination
EP2572726A1 (en) 2007-08-01 2013-03-27 Novartis AG Compositions comprising pneumococcal antigens
EP2583978A2 (en) 2007-02-23 2013-04-24 The Regents of the University of California Prevention and treatment of synucleinopathic and amyloidogenic disease
EP2586790A2 (en) 2006-08-16 2013-05-01 Novartis AG Immunogens from uropathogenic Escherichia coli
WO2013068949A1 (en) 2011-11-07 2013-05-16 Novartis Ag Carrier molecule comprising a spr0096 and a spr2021 antigen
WO2013084071A2 (en) 2011-12-08 2013-06-13 Novartis Ag Clostridium difficile toxin-based vaccine
EP2612679A1 (en) 2004-07-29 2013-07-10 Novartis Vaccines and Diagnostics, Inc. Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
EP2614835A1 (en) 2007-11-26 2013-07-17 Novartis AG Vaccination with multiple clades of H5 influenza A virus
EP2614709A1 (en) 2005-07-18 2013-07-17 Novartis AG Small animal model for HCV replication
WO2013108272A2 (en) 2012-01-20 2013-07-25 International Centre For Genetic Engineering And Biotechnology Blood stage malaria vaccine
EP2631245A1 (en) 2008-03-10 2013-08-28 Children's Hospital & Research Center at Oakland Chimeric factor H binding proteins (fHBP) containing a heterologous B domain and methods of use
WO2013124473A1 (en) 2012-02-24 2013-08-29 Novartis Ag Pilus proteins and compositions
WO2013160335A2 (en) 2012-04-26 2013-10-31 Novartis Ag Antigens and antigen combinations
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
EP2659912A2 (en) 2007-07-17 2013-11-06 Novartis AG Conjugate purification
WO2013164754A2 (en) 2012-05-04 2013-11-07 Pfizer Inc. Prostate-associated antigens and vaccine-based immunotherapy regimens
DE202005022108U1 (en) 2004-03-09 2013-11-12 Novartis Vaccines And Diagnostics, Inc. Influenza virus vaccines
WO2013174832A1 (en) 2012-05-22 2013-11-28 Novartis Ag Meningococcus serogroup x conjugate
WO2014005958A1 (en) 2012-07-06 2014-01-09 Novartis Ag Immunogenic compositions and uses thereof
US8691209B2 (en) 2001-09-14 2014-04-08 Cytos Biotechnology Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
WO2014053612A1 (en) 2012-10-03 2014-04-10 Novartis Ag Immunogenic composition
WO2014060898A2 (en) 2012-10-21 2014-04-24 Pfizer Inc. Compositions and methods relating to a mutant clostridium difficile toxin
US8808692B2 (en) 2001-12-21 2014-08-19 Csl Limited Compositions comprising immunoreactive reagents and saponins, and methods of use thereof
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US8895521B2 (en) 2004-05-06 2014-11-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods and compositions for the treatment of uveitis
EP2811027A1 (en) 2004-05-21 2014-12-10 Novartis Vaccines and Diagnostics, Inc. Alphavirus vectors for RSV and PIV vaccines
US8916161B2 (en) 2005-06-14 2014-12-23 Sophiris Bio Inc. Method of treating or preventing benign prostatic hyperplasia using modified pore-forming proteins
US8932605B2 (en) 2008-04-18 2015-01-13 Vaxinnate Corporation Deletion mutants of flagellin and methods of use
WO2015022401A1 (en) * 2013-08-14 2015-02-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Immunoadjuvant compositions and uses thereof
US9006218B2 (en) 2010-02-12 2015-04-14 Chimerix Inc. Nucleoside phosphonate salts
WO2015063647A1 (en) 2013-11-01 2015-05-07 Pfizer Inc. Vectors for expression of prostate-associated antigens
WO2015068129A1 (en) 2013-11-08 2015-05-14 Novartis Ag Salmonella conjugate vaccines
WO2015075635A2 (en) 2013-11-19 2015-05-28 Prothena Biosciences Limited Monitoring immunotherapy of lewy body disease from constipation symptoms
EP2886551A2 (en) 2008-02-21 2015-06-24 Novartis AG Meningococcal fhbp polypeptides
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
EP2889042A2 (en) 2008-03-18 2015-07-01 Novartis AG Improvements in preparation of influenza virus vaccine antigens
EP2891498A1 (en) 2007-12-20 2015-07-08 Novartis AG Fermentation processes for cultivating streptococci and purification processes for obtaining CPS therefrom
WO2015123291A1 (en) 2014-02-11 2015-08-20 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Pcsk9 vaccine and methods of using the same
US9126996B2 (en) 2011-06-01 2015-09-08 Janus Biotherapeutics, Inc. Immune system modulators
WO2015136469A1 (en) 2014-03-12 2015-09-17 Prothena Biosciences Limited Anti-mcam antibodies and associated methods of use
WO2015136470A1 (en) 2014-03-12 2015-09-17 Prothena Biosciences Limited Anti-mcam antibodies and associated methods of use
US9200042B2 (en) 2006-03-07 2015-12-01 Vaxinnate Corporation Flagellin fusion proteins
EP2952524A1 (en) 2007-10-17 2015-12-09 Janssen Sciences Ireland UC Immunotherapy regimes dependent on apoe status
US9353115B2 (en) 2011-06-01 2016-05-31 Janus Biotherapeutics, Inc. Immune system modulators
EP3067048A1 (en) 2007-12-07 2016-09-14 Novartis Ag Compositions for inducing immune responses
EP3067066A1 (en) 2007-02-23 2016-09-14 Prothena Biosciences Limited Prevention and treatment of synucleinopathic and amyloidogenic disease
WO2016183486A1 (en) 2015-05-13 2016-11-17 Agenus Inc. Vaccines for treatment and prevention of cancer
WO2016207853A2 (en) 2015-06-26 2016-12-29 Seqirus UK Limited Antigenically matched influenza vaccines
US9539217B2 (en) 2013-04-03 2017-01-10 Allertein Therapeutics, Llc Nanoparticle compositions
US9597385B2 (en) 2012-04-23 2017-03-21 Allertein Therapeutics, Llc Nanoparticles for treatment of allergy
WO2017046776A2 (en) 2015-09-16 2017-03-23 Prothena Biosciences Limited Use of anti-mcam antibodies for treatment or prophylaxis of giant cell arteritis, polymyalgia rheumatica or takayasu's arteritis
WO2017046774A2 (en) 2015-09-16 2017-03-23 Prothena Biosciences Limited Use of anti-mcam antibodies for treatment or prophylaxis of giant cell arteritis, polymyalgia rheumatica or takayasu's arteritis
WO2017125844A1 (en) 2016-01-19 2017-07-27 Pfizer Inc. Cancer vaccines
WO2017153953A1 (en) 2016-03-09 2017-09-14 Prothena Biosciences Limited Use of anti-mcam antibodies for treatment or prophylaxis of granulomatous lung diseases
WO2017153955A1 (en) 2016-03-09 2017-09-14 Prothena Biosciences Limited Use of anti-mcam antibodies for treatment or prophylaxis of granulomatous lung diseases
US9764027B2 (en) 2012-09-18 2017-09-19 Glaxosmithkline Biologicals Sa Outer membrane vesicles
US9809824B2 (en) 2004-12-13 2017-11-07 The United States Of America, Represented By The Secretary, Department Of Health And Human Services CpG oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
US9873694B2 (en) 2012-10-03 2018-01-23 Janus Biotherapeutics, Inc. Imidazole quinoline-based immune system modulators

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000045847A8 (en) * 1999-02-05 2010-12-02 Alk-Abelló A/S Novel mucosal delivery system
DE602006015963D1 (en) 2005-07-01 2010-09-16 Index Pharmaceuticals Ab process immunostimulatory
DE602006008473D1 (en) 2005-07-01 2009-09-24 Index Pharmaceuticals Ab Modulating the response to steroids
US8895522B2 (en) 2005-10-28 2014-11-25 Index Pharmaceuticals Ab Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease
US20140086849A1 (en) * 2012-09-21 2014-03-27 Elizabeth McKenna Naturally-Occurring CpG Oligonucleotide Compositions and Therapeutic Applications Thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0092574A1 (en) 1981-10-23 1983-11-02 Molecular Biosystems Inc Oligonucleotide therapeutic agent and methods of making same.
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5663153A (en) * 1994-03-25 1997-09-02 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1997040163A1 (en) * 1996-04-19 1997-10-30 Metin Colpan Nucleic acid vaccination for parvoviral infections

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
ES2267100T5 (en) * 1994-07-15 2011-04-08 Coley Pharmaceutical Group, Inc. Immunomodulatory oligonucleotides.
US5780448A (en) * 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
CA2244946C (en) * 1996-01-30 2010-04-13 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
DE69733020D1 (en) * 1996-10-11 2005-05-19 Univ California immuno oligonucleotidekonjugate
EP0855184A1 (en) * 1997-01-23 1998-07-29 Klaus Prof.-Dr. Heeg Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
EP0092574A1 (en) 1981-10-23 1983-11-02 Molecular Biosystems Inc Oligonucleotide therapeutic agent and methods of making same.
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5663153A (en) * 1994-03-25 1997-09-02 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1997040163A1 (en) * 1996-04-19 1997-10-30 Metin Colpan Nucleic acid vaccination for parvoviral infections

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
BRANDA R. F., ET AL.: "AMPLIFICATION OF ANTIBODY PRODUCTION BY PHOSPHOROTHIOATE OLIGODEOXYNUCLEOTIDES.", JOURNAL OF LABORATORY AND CLINICAL MEDICINE, vol. 128., no. 03., 1 September 1996 (1996-09-01), pages 329 - 338., XP002910128, ISSN: 0022-2143, DOI: 10.1016/S0022-2143(96)90035-9 *
CHU R. S., ET AL.: "CPG OLIGODEOXYNUCLEOTIDES ACT AS ADJUVANTS THAT SWITCH ON T HELPER 1 (TH1) IMMUNITY.", THE JOURNAL OF EXPERIMENTAL MEDICINE, ROCKEFELLER UNIVERSITY PRESS, US, vol. 186., no. 10., 1 November 1997 (1997-11-01), US, pages 1623 - 1631., XP002910130, ISSN: 0022-1007, DOI: 10.1084/jem.186.10.1623 *
GOODCHILD, J., BIOCONJUGATE CHEM., vol. I, 1990, pages 165
See also references of EP1005368A4 *
UHLMANN, E; PEYMAN, A., CHEM. REV, vol. 90, 1990, pages 544

Cited By (372)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6727230B1 (en) 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US7888327B2 (en) 1994-07-15 2011-02-15 University Of Iowa Research Foundation Methods of using immunostimulatory nucleic acid molecules to treat allergic conditions
US8258106B2 (en) * 1994-07-15 2012-09-04 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6429199B1 (en) 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US7901907B2 (en) 1996-01-04 2011-03-08 The Provost Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin Process for production of Helicobacter pylori bacterioferritin
EP2322615A1 (en) * 1996-10-30 2011-05-18 University Of Iowa Research Foundation Use of unmethylated CpG oligonucleotides for the treatment of allergy
EP1746159A3 (en) * 1996-10-30 2009-11-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
EP2360252A1 (en) * 1996-10-30 2011-08-24 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules comprising GTCGTT motifs
EP1746159A2 (en) * 1996-10-30 2007-01-24 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7001890B1 (en) 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US7597908B2 (en) 1997-01-30 2009-10-06 Novartis Vaccines And Diagnostics, Inc. Use of microparticles with adsorbed antigen to stimulate immune responses
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6821957B2 (en) 1997-05-20 2004-11-23 University Of Iowa Research Foundation Vectors and methods for immunization or therapeutic protocols
US6589940B1 (en) 1997-06-06 2003-07-08 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US8729039B2 (en) 1997-06-06 2014-05-20 The Regents Of The University Of California Use of inhibitory oligonucleotides to treat autoimmune disease
US6225292B1 (en) 1997-06-06 2001-05-01 The Regents Of The University Of California Inhibitors of DNA immunostimulatory sequence activity
US7138384B1 (en) 1997-08-29 2006-11-21 The Regents Of The University Of California Modulators of DNA cytosine-5 methyltransferase and methods for use thereof
US7125857B2 (en) 1997-08-29 2006-10-24 The Regents Of The University Of California Modulators of DNA cytosine-5 methyltransferase and methods for use thereof
US6218371B1 (en) 1998-04-03 2001-04-17 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US7985435B2 (en) 1998-05-19 2011-07-26 Research Development Foundation Triterpene compositions and methods for use thereof
US6444233B1 (en) 1998-05-19 2002-09-03 Research Development Foundation Triterpene compositions and methods for use thereof
US8324177B2 (en) 1998-05-19 2012-12-04 Research Development Foundation Triterpene compositions and methods for use thereof
US7105186B2 (en) 1998-05-19 2006-09-12 Research Development Foundation Triterpene compositions and methods for use thereof
US6689398B2 (en) 1998-05-19 2004-02-10 Research Development Foundation Triterpene compositions and methods for use thereof
US6962720B2 (en) 1998-05-19 2005-11-08 Research Development Foundation Triterpene compositions and methods for use thereof
US7670632B2 (en) 1998-05-19 2010-03-02 Research Development Foundation Triterpene compositions and methods for use thereof
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US7049302B1 (en) 1998-08-10 2006-05-23 Antigenics Inc. Compositions of CPG and saponin adjuvants and uses thereof
US7858589B2 (en) 1998-08-10 2010-12-28 Antigenics Inc. Compositions of CpG and saponin adjuvants and uses thereof
WO2000015256A2 (en) * 1998-09-11 2000-03-23 Aventis Pasteur Immunostimulant emulsion
WO2000015256A3 (en) * 1998-09-11 2000-07-13 Pasteur Merieux Serums Vacc Immunostimulant emulsion
US7279555B2 (en) 1999-02-02 2007-10-09 Virginia Commonwealth University Advanced antigen presentation platform
US6887464B1 (en) 1999-02-02 2005-05-03 Biocache Pharmaceuticals, Inc. Advanced antigen presentation platform
JP2002537353A (en) * 1999-02-26 2002-11-05 カイロン エセ.ピー.アー. Enhancement of Neisseria antigen bactericidal activity using an oligonucleotide comprising a CG motif
JP4812942B2 (en) * 1999-02-26 2011-11-09 ノバルティス ヴァクシンズ アンド ダイアグノスティクス エスアールエル Enhancement of Neisseria antigen bactericidal activity using an oligonucleotide comprising a CG motif
US8221761B1 (en) 1999-02-26 2012-07-17 Novartis Ag Enhancement of bactericidal activity of neisseria antigens with oligonucleotides containing CG motifs
JP2010174044A (en) * 1999-02-26 2010-08-12 Chiron Srl Enhancement of bactericidal activity of neisseria antigen with oligonucleotide containing cg motif
EP2286792A1 (en) 1999-02-26 2011-02-23 Novartis Vaccines and Diagnostics, Inc. Microemulsions with an adsorbent surface, comprising a microdroplet emulsion
US7399472B2 (en) 1999-04-19 2008-07-15 Smithkline Beecham Biologicals Vaccines
US6544518B1 (en) 1999-04-19 2003-04-08 Smithkline Beecham Biologicals S.A. Vaccines
US6558670B1 (en) 1999-04-19 2003-05-06 Smithkline Beechman Biologicals S.A. Vaccine adjuvants
WO2000067023A1 (en) * 1999-04-29 2000-11-09 Coley Pharmaceutical Gmbh Screening for immunostimulatory dna functional modifyers
WO2000067787A2 (en) * 1999-05-06 2000-11-16 The Immune Response Corporation Hiv immunogenic compositions and methods
WO2000067787A3 (en) * 1999-05-06 2001-04-26 Immune Response Corp Inc Hiv immunogenic compositions and methods
US6737066B1 (en) 1999-05-06 2004-05-18 The Immune Response Corporation HIV immunogenic compositions and methods
EP2305302A2 (en) 1999-05-28 2011-04-06 Janssen Alzheimer Immunotherapy Prevention and treatment of amyloidogenic disease
EP2364719A1 (en) 1999-06-01 2011-09-14 Janssen Alzheimer Immunotherapy Prevention and treatment of amyloidogenic diseases
WO2001000231A2 (en) * 1999-06-29 2001-01-04 Smithkline Beecham Biologicals S.A. Use of cpg as an adjuvant for malaria vaccine
WO2001000231A3 (en) * 1999-06-29 2001-07-05 Smithkline Beecham Biolog Use of cpg as an adjuvant for malaria vaccine
US8333980B2 (en) 1999-08-19 2012-12-18 Dynavax Technologies Corporation Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein
US7479285B1 (en) 1999-08-19 2009-01-20 Dynavax Technologies Corporation Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein
JP2003509341A (en) * 1999-08-27 2003-03-11 イネックス ファーマスーティカルズ コーポレイション Inducing composition of secretion stimulation and immune response of cytokines
WO2001015726A3 (en) * 1999-08-27 2001-07-26 Inex Pharmaceuticals Corp Compositions for stimulating cytokine secretion and inducing an immune response
WO2001015726A2 (en) * 1999-08-27 2001-03-08 Inex Pharmaceuticals Corp. Compositions for stimulating cytokine secretion and inducing an immune response
JP2003508494A (en) * 1999-09-07 2003-03-04 スミスクライン ビーチャム バイオロジカルズ ソシエテ アノニム New composition
JP4694745B2 (en) * 1999-09-07 2011-06-08 グラクソスミスクライン バイオロジカルズ ソシエテ アノニム New composition
WO2001022972A3 (en) * 1999-09-25 2002-01-17 Univ Iowa Res Found Immunostimulatory nucleic acids
EP1700603A2 (en) * 1999-09-25 2006-09-13 Coley Pharmaceutical GmbH Immunostimulatory nucleic acids
KR100863630B1 (en) * 1999-09-25 2008-10-15 유니버시티 오브 아이오와 리써치 파운데이션 Immunostimulatory Nucleic Acids
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
WO2001022972A2 (en) * 1999-09-25 2001-04-05 University Of Iowa Research Foundation Immunostimulatory nucleic acids
EP1700603A3 (en) * 1999-09-25 2007-06-13 Coley Pharmaceutical GmbH Immunostimulatory nucleic acids
JP2003510282A (en) * 1999-09-25 2003-03-18 コーリー ファーマシューティカル ゲーエムベーハー Immunostimulatory nucleic acid
US7776344B2 (en) 1999-09-27 2010-08-17 University Of Iowa Research Foundation Methods related to immunostimulatory nucleic acid-induced interferon
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US7628990B2 (en) 1999-11-15 2009-12-08 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US7223398B1 (en) 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US8232259B2 (en) 2000-01-14 2012-07-31 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Multiple CpG oligodeoxynucleotide and their use to induce an immune response
US7919477B2 (en) 2000-01-14 2011-04-05 The United States Of America As Represented By The Department Of Health And Human Services Multiple CpG oligodeoxynucleotides and their use to induce an immune response
WO2001051500A1 (en) * 2000-01-14 2001-07-19 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
EP1950296A3 (en) * 2000-01-14 2011-07-06 The Government of the United States of America, as represented by the Secretary of Health and Human Services Oligodeoxynucleotide and its use to induce an immune response
WO2001095935A1 (en) * 2000-01-20 2001-12-20 Ottawa Health Research Institute Immunostimulatory nucleic acids for inducing a th2 immune response
US8669237B2 (en) 2000-03-10 2014-03-11 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US7157437B2 (en) 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US7129222B2 (en) 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
JP2003526673A (en) * 2000-03-10 2003-09-09 ダイナバックス テクノロジーズ コーポレイション The method reduces papilloma virus infection with an immunomodulatory polynucleotide sequences
US7183111B2 (en) 2000-03-10 2007-02-27 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US8124590B2 (en) 2000-03-10 2012-02-28 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
JP2003526670A (en) * 2000-03-10 2003-09-09 ダイナバックス テクノロジーズ コーポレイション Remission Method symptoms of herpes infection using immunomodulatory polynucleotide sequences
JP2003526672A (en) * 2000-03-10 2003-09-09 ダイナバックス テクノロジーズ コーポレイション Method for the prophylaxis and treatment of immunoregulatory polynucleotides using sequence respiratory viral infections
US7727712B2 (en) 2000-03-10 2010-06-01 Dynavax Technologies Corporation Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
US7250403B2 (en) 2000-03-10 2007-07-31 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US8226957B2 (en) 2000-03-10 2012-07-24 Dynavax Technologies Corporation Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences
JP2003535043A (en) * 2000-03-10 2003-11-25 ダイナバックス テクノロジーズ コーポレイション How to prevent and treat viral infections using an immunomodulatory polynucleotide sequences
EP2067487A2 (en) 2000-03-10 2009-06-10 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US6964769B2 (en) * 2000-05-05 2005-11-15 Cytos Biotechnology Ag Molecular antigen array
US7534772B2 (en) * 2000-06-22 2009-05-19 University Of Iowa Research Foundation Methods for enhancing antibody-induced cell lysis and treating cancer
US6943240B2 (en) 2000-09-15 2005-09-13 Coley Pharmaceuticals Gmbh Nucleic acids for high throughput screening of CpG-based immuno-agonist/antagonist
US7820379B2 (en) 2000-09-15 2010-10-26 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
EP2277894A1 (en) 2000-10-27 2011-01-26 Novartis Vaccines and Diagnostics S.r.l. Nucleic acids and proteins from streptococcus groups A & B
EP2277896A1 (en) 2000-10-27 2011-01-26 Novartis Vaccines and Diagnostics S.r.l. Nucleic acids and proteins from streptococcus groups A & B
EP2284182A1 (en) 2000-10-27 2011-02-16 Novartis Vaccines and Diagnostics S.r.l. Nucleic acids and proteins from streptococcus groups A and B
EP2896629A1 (en) 2000-10-27 2015-07-22 Novartis Vaccines and Diagnostics S.r.l. Nucleic acids and proteins from streptococcus group A & B
EP2284181A1 (en) 2000-10-27 2011-02-16 Novartis Vaccines and Diagnostics S.r.l. Nucleic acids and proteins from streptococcus groups A and B
EP2284183A1 (en) 2000-10-27 2011-02-16 Novartis Vaccines and Diagnostics S.r.l. Nucleic acids and proteins from streptococcus groups A and B
EP2277895A1 (en) 2000-10-27 2011-01-26 Novartis Vaccines and Diagnostics S.r.l. Nucleic acids and proteins from streptococcus groups A & B
EP1985702A2 (en) 2000-12-08 2008-10-29 Coley Pharmaceuticals GmbH CPG-like nucleic acids and methods of use thereof
US8372413B2 (en) 2000-12-27 2013-02-12 Dynavax Technologies Corporation Immunomodulatory polynucleotides and methods of using the same
US7094409B2 (en) 2001-01-19 2006-08-22 Cytos Biotechnology Ag Antigen arrays for treatment of allergic eosinophilic diseases
US7858588B2 (en) 2001-05-21 2010-12-28 Intercell Ag Immunostimulatory oligodeoxynucleic molecules
EP2277539A2 (en) 2001-06-20 2011-01-26 Novartis AG Neisseria meningitidis conjugate combination vaccine
EP2263688A1 (en) 2001-06-20 2010-12-22 Novartis AG Neisseria meningitidis combination vaccines
EP2277537A2 (en) 2001-06-20 2011-01-26 Novartis AG Neisseria meningitidis conjugate combination vaccine
EP2277536A2 (en) 2001-06-20 2011-01-26 Novartis AG Purification of bacterial capsular polysaccharides
US7255868B2 (en) 2001-06-21 2007-08-14 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—I
EP2423335A2 (en) 2001-06-21 2012-02-29 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same
US9028845B2 (en) 2001-06-21 2015-05-12 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same-IV
EP2255827A1 (en) 2001-07-26 2010-12-01 Novartis Vaccines and Diagnostics S.r.l. Vaccines comprising aluminium adjuvants and histidine
EP2168597A1 (en) 2001-07-26 2010-03-31 Novartis Vaccines and Diagnostics S.r.l. Vaccines comprising aluminium adjuvants and histidine
EP2266605A1 (en) 2001-07-26 2010-12-29 Novartis Vaccines and Diagnostics S.r.l. Vaccines comprising aluminium adjuvants and histidine
WO2003014316A2 (en) 2001-08-07 2003-02-20 Dynavax Technologies Corporation Immunomodulatory compositions, formulations, and methods for use thereof
US8586555B2 (en) 2001-08-07 2013-11-19 Dynavax Technologies Corporation Immunomodulatory compositions, formulations, and methods for use thereof
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US7282476B2 (en) 2001-08-24 2007-10-16 University Of Victoria Innovation And Development Corporation Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer
US7838266B2 (en) 2001-08-24 2010-11-23 University Of Victoria Innovation And Development Corporation Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer
US7745395B2 (en) 2001-08-24 2010-06-29 University of Victoria Innovatiion and Development Corporation Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer
EP2829549A2 (en) 2001-09-06 2015-01-28 Novartis Vaccines and Diagnostics S.r.l. Hybrid and tandem expression of neisserial derived proteins
EP2360176A2 (en) 2001-09-06 2011-08-24 Novartis Vaccines and Diagnostics S.r.l. Hybrid and tandem expression of neisserial derived proteins
EP2327719A1 (en) 2001-09-06 2011-06-01 Novartis Vaccines and Diagnostics S.r.l. Hybrid and tandem expression of neisserial proteins
US8691209B2 (en) 2001-09-14 2014-04-08 Cytos Biotechnology Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
US8580944B2 (en) 2001-09-24 2013-11-12 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Suppressors of CpG oligonucleotides and methods of use
US9163244B2 (en) 2001-09-24 2015-10-20 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Suppressors of CpG oligonucleotides and methods of use
US8227438B2 (en) 2001-09-24 2012-07-24 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Suppressors of CpG oligonucleotides and methods of use
US7514414B2 (en) 2001-09-24 2009-04-07 The United States Of America As Represented By The Department Of Health And Human Services Suppressors of CpG oligonucleotides and methods of use
WO2003028656A2 (en) 2001-10-03 2003-04-10 Chiron Corporation Adjuvant compositions
WO2003030934A3 (en) * 2001-10-06 2003-11-06 Qiagen Gmbh Cpg formulations and related methods
US8808692B2 (en) 2001-12-21 2014-08-19 Csl Limited Compositions comprising immunoreactive reagents and saponins, and methods of use thereof
US7741297B2 (en) 2002-02-04 2010-06-22 Oncothyreon Inc. Immunostimulatory, covalently lipidated oligonucleotides
WO2003066649A1 (en) * 2002-02-04 2003-08-14 Biomira Inc. Immunostimulatory, covalently lipidated oligonucleotides
WO2003070909A2 (en) 2002-02-20 2003-08-28 Chiron Corporation Microparticles with adsorbed polypeptide-containing molecules
EP2572707A2 (en) 2002-02-20 2013-03-27 Novartis Vaccines and Diagnostics, Inc. Microparticles with adsorbed polypeptide-containing molecules
EP3173426A1 (en) 2002-02-25 2017-05-31 Biogen MA Inc. Administration of agents for the treatment of inflammation
EP2289941A2 (en) 2002-02-25 2011-03-02 Elan Pharmaceuticals Inc. Administration of agents for the treatment of inflammation
EP2336184A2 (en) 2002-02-25 2011-06-22 Elan Pharmaceuticals Inc. Administration of agents for the treatment of inflammation
EP2360185A2 (en) 2002-02-25 2011-08-24 Elan Pharmaceuticals Inc. Administration of agents for the treatment of inflammation
EP2292247A2 (en) 2002-03-05 2011-03-09 Ramot at Tel Aviv University Ltd. Immunizing composition and method for inducing an immune response against the beta-secretase cleavage site of amyloid precursor protein
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US8658607B2 (en) 2002-04-04 2014-02-25 Zoetis Belgium Immunostimulatory G, U-containing oligoribonucleotides
US9428536B2 (en) 2002-04-04 2016-08-30 Zoetis Belgium Sa Immunostimulatory G, U-containing oligoribonucleotides
US7038029B2 (en) 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7381807B2 (en) 2002-05-30 2008-06-03 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7943316B2 (en) 2002-05-30 2011-05-17 David Horn, Llc Immunostimulatory oligonucleotides and uses thereof
US7279165B2 (en) 2002-07-19 2007-10-09 Cytos Biotechnology Ag Amyloid β1-6 antigen arrays
US7528223B2 (en) 2002-07-24 2009-05-05 Intercell Ag Antigens encoded by alternative reading frames from pathogenic viruses
WO2004011650A2 (en) 2002-07-24 2004-02-05 Intercell Ag Antigens encoded by alternative reading frame from pathogenic viruses
US7514415B2 (en) 2002-08-01 2009-04-07 The United States Of America As Represented By The Department Of Health And Human Services Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides
US8557789B2 (en) 2002-08-01 2013-10-15 The United States of America as represented by the Secretary of the Development of Health and Human Services Method of treating inflammatory arthropathies with supressors of CPG oligonucleotides
US7951786B2 (en) 2002-08-01 2011-05-31 The United States Of America As Represented By The Department Of Health And Human Services Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides
US8288359B2 (en) 2002-08-01 2012-10-16 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides
EP2258390A1 (en) 2002-08-30 2010-12-08 Novartis Vaccines and Diagnostics S.r.l. Improved bacterial outer membrane vesicles
EP2258388A1 (en) 2002-08-30 2010-12-08 Novartis Vaccines and Diagnostics S.r.l. Improved bacterial outer membrane vesicles
EP2258389A1 (en) 2002-08-30 2010-12-08 Novartis Vaccines and Diagnostics S.r.l. Improved bacterial outer membrane vesicles
US7378234B2 (en) 2002-09-13 2008-05-27 Intercell Ag Method for isolating hepatitis C virus peptides
EP2402026A2 (en) 2002-09-13 2012-01-04 Intercell AG Method for isolating hepatitis C virus peptides
US8501188B2 (en) 2002-10-08 2013-08-06 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides
US9006203B2 (en) 2002-10-08 2015-04-14 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of reducing inflammatory infiltration in subjects with inflammatory lung disease
US8043622B2 (en) 2002-10-08 2011-10-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides
EP2353608A1 (en) 2002-10-11 2011-08-10 Novartis Vaccines and Diagnostics S.r.l. Polypeptide-vaccines for broad protection against hypervirulent meningococcal lineages
EP2351579A1 (en) 2002-10-11 2011-08-03 Novartis Vaccines and Diagnostics S.r.l. Polypeptide vaccines for broad protection against hypervirulent meningococcal lineages
EP2361629A1 (en) 2002-11-01 2011-08-31 Elan Pharmaceuticals Inc. Prevention and treatment of synucleinopathic disease
EP2279746A2 (en) 2002-11-15 2011-02-02 Novartis Vaccines and Diagnostics S.r.l. Surface proteins in neisseria meningitidis
EP2261239A2 (en) 2002-11-22 2010-12-15 Novartis Vaccines and Diagnostics S.r.l. Multiple variants of meningococcal protein NMB1870
EP2258716A2 (en) 2002-11-22 2010-12-08 Novartis Vaccines and Diagnostics S.r.l. Multiple variants of meningococcal protein NMB1870
EP2258717A2 (en) 2002-11-22 2010-12-08 Novartis Vaccines and Diagnostics S.r.l. Variant form of meningococcal NadA
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
EP1992635A1 (en) 2002-12-23 2008-11-19 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US8158768B2 (en) 2002-12-23 2012-04-17 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US7745606B2 (en) 2002-12-23 2010-06-29 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US9422564B2 (en) 2002-12-23 2016-08-23 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US8871732B2 (en) 2002-12-23 2014-10-28 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
EP2263687A1 (en) 2002-12-27 2010-12-22 Novartis Vaccines&Diagnostics, Inc. Immunogenic compositions containing phospholipid
EP2289546A2 (en) 2003-01-30 2011-03-02 Novartis Vaccines and Diagnostics S.r.l. Injectable vaccines against multiple meningococcal serogroups
WO2004074454A2 (en) 2003-02-20 2004-09-02 University Of Connecticut Health Center Methods and compositions for the treatment of cancer and infectious disease using alpha (2) macroglobulin-antigenic molecule complexes
US8784837B2 (en) 2003-03-24 2014-07-22 Valneva Austria Gmbh Vaccines comprising an immunostimulatory peptide and an immunostimulatory oligodeoxynucleic acid molecule
US7704514B2 (en) 2003-03-24 2010-04-27 Intercell Ag Vaccines
EP2345420A1 (en) 2003-03-24 2011-07-20 Intercell AG Use of a TH1 immune response inducing adjuvant for enhancing immune responses
WO2004084938A1 (en) 2003-03-24 2004-10-07 Intercell Ag Improved vaccines
US7537767B2 (en) 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
US7517520B2 (en) 2003-03-26 2009-04-14 Cytos Biotechnology Ag Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
WO2004092360A2 (en) 2003-04-10 2004-10-28 Chiron Corporation The severe acute respiratory syndrome coronavirus
EP2361928A1 (en) 2003-05-19 2011-08-31 Elan Pharmaceuticals Inc. Truncated fragments of alpha-synuclein in Lewy body disease
EP2179729A1 (en) 2003-06-02 2010-04-28 Novartis Vaccines and Diagnostics, Inc. Immunogenic compositions based on microparticles comprising adsorbed toxoid and a polysaccharide-containing antigen
EP2289547A1 (en) 2003-09-12 2011-03-02 Antigenics Inc. Vaccine for treatment and prevention of herpes simplex virus infection
EP2277538A1 (en) 2003-10-02 2011-01-26 Novartis Vaccines and Diagnostics S.r.l. Combined meningitis vaccines
EP2267036A1 (en) 2003-10-02 2010-12-29 Novartis Vaccines and Diagnostics S.r.l. Hypo- and Hyper-Acetylated Meningococcal Capsular Saccharides
DE202005022108U1 (en) 2004-03-09 2013-11-12 Novartis Vaccines And Diagnostics, Inc. Influenza virus vaccines
EP2545931A1 (en) 2004-03-19 2013-01-16 Herbs Spring, LLC Herbal therapy for the treatment of food allergy
EP2108374A1 (en) 2004-04-30 2009-10-14 Novartis Vaccines and Diagnostics S.r.l. Combined meningococcal conjugates with common carrier protein
EP2272531A2 (en) 2004-04-30 2011-01-12 Novartis Vaccines and Diagnostics S.r.l. Integration of meningococcal conjugate vaccination
US8895521B2 (en) 2004-05-06 2014-11-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods and compositions for the treatment of uveitis
EP2351774A1 (en) 2004-05-14 2011-08-03 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP2341069A1 (en) 2004-05-14 2011-07-06 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP2343313A1 (en) 2004-05-14 2011-07-13 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP2351773A1 (en) 2004-05-14 2011-08-03 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP2848692A1 (en) 2004-05-21 2015-03-18 Novartis Vaccines and Diagnostics, Inc. Alphavirus vectors for influenza virus vaccines
EP2811027A1 (en) 2004-05-21 2014-12-10 Novartis Vaccines and Diagnostics, Inc. Alphavirus vectors for RSV and PIV vaccines
EP2612679A1 (en) 2004-07-29 2013-07-10 Novartis Vaccines and Diagnostics, Inc. Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
EP2149583A1 (en) 2004-09-24 2010-02-03 Intercell AG Modified VP1-capsid protein of parvovirus B19
EP2371396A1 (en) 2004-10-19 2011-10-05 Elan Pharmaceuticals Inc. Truncated fragments of alpha synuclein in lewy body disease
EP2272539A2 (en) 2004-10-19 2011-01-12 Elan Pharmaceuticals, Inc. Truncated fragments of alpha-synuclein in lewy body disease
EP2465872A2 (en) 2004-10-25 2012-06-20 Merck Sharp & Dohme Corporation Anti-ADDL Antibodies and uses thereof
EP2279747A1 (en) 2004-10-29 2011-02-02 Novartis Vaccines and Diagnostics S.r.l. Immunogenic bacterial vesicles with outer membrane proteins
US8617566B2 (en) 2004-11-05 2013-12-31 Novartis Ag Composition comprising VLP and amyloid beta peptide
US7867499B2 (en) 2004-11-05 2011-01-11 Novartis Ag Methods of treating dementia by administering virus-like particles coupled to Aβ
US8460676B2 (en) 2004-11-05 2013-06-11 Novartis Ag Composition comprising VLP and amyloid beta peptide
US9809824B2 (en) 2004-12-13 2017-11-07 The United States Of America, Represented By The Secretary, Department Of Health And Human Services CpG oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
EP2193810A1 (en) 2005-01-14 2010-06-09 Novartis Vaccines and Diagnostics S.r.l. Meningococcal conjugate vaccination
EP2433647A2 (en) 2005-01-27 2012-03-28 Children's Hospital & Research Center at Oakland GNA1870-based vesicle vaccines for broad spectrum protection against diseases caused by Neisseria meningitidis
EP1841777A1 (en) * 2005-01-28 2007-10-10 Kwon, Hyung-Joo Oligonucleotides derived from mycobacterium for stimulating immune function, treating immune-related diseases, atopic dermatitis and/or protecting normal immune cell
EP1841777A4 (en) * 2005-01-28 2008-10-29 Kwon Hyung Joo Oligonucleotides derived from mycobacterium for stimulating immune function, treating immune-related diseases, atopic dermatitis and/or protecting normal immune cell
US7902161B2 (en) 2005-01-28 2011-03-08 Hyung-Joo Kwon Oligonucleotides derived from mycobacterium for stimulating immune function, treating immune-related diseases, atopic dermatitis and/or protecting normal immune cell
WO2006086799A2 (en) 2005-02-11 2006-08-17 Novartis Vaccines And Diagnostics Inc. Prion-specific peptide reagents
EP2351772A1 (en) 2005-02-18 2011-08-03 Novartis Vaccines and Diagnostics, Inc. Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli
EP2298795A1 (en) 2005-02-18 2011-03-23 Novartis Vaccines and Diagnostics, Inc. Immunogens from uropathogenic escherichia coli
US8642577B2 (en) 2005-04-08 2014-02-04 Chimerix, Inc. Compounds, compositions and methods for the treatment of poxvirus infections
WO2006110655A2 (en) 2005-04-08 2006-10-19 Chimerix, Inc. Compounds, compositions and methods for the treatment of poxvirus infections
EP2329843A2 (en) 2005-04-18 2011-06-08 Novartis Vaccines and Diagnostics, Inc. Expressing Hepatitis B Virus surface antigen for vaccine preparation
US8916161B2 (en) 2005-06-14 2014-12-23 Sophiris Bio Inc. Method of treating or preventing benign prostatic hyperplasia using modified pore-forming proteins
EP2614709A1 (en) 2005-07-18 2013-07-17 Novartis AG Small animal model for HCV replication
EP2450056A1 (en) 2005-07-19 2012-05-09 Elan Pharma International Limited Prevention and treatment of synucleinopathic and amyloidogenic disease
EP2357000A1 (en) 2005-10-18 2011-08-17 Novartis Vaccines and Diagnostics, Inc. Mucosal and systemic immunizations with alphavirus replicon particles
EP2377552A2 (en) 2005-11-04 2011-10-19 Novartis Vaccines and Diagnostics S.r.l. Influenza vaccines with reduced amount of emulsion adjuvant
US8697087B2 (en) 2005-11-04 2014-04-15 Novartis Ag Influenza vaccines including combinations of particulate adjuvants and immunopotentiators
EP2368573A2 (en) 2005-11-04 2011-09-28 Novartis Vaccines and Diagnostics S.r.l. Influenza vaccines including combinations of particulate adjuvants and immunopotentiators
EP2368572A2 (en) 2005-11-04 2011-09-28 Novartis Vaccines and Diagnostics S.r.l. Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture
WO2007052058A1 (en) * 2005-11-04 2007-05-10 Novartis Vaccines And Diagnostics Srl Influenza vaccines including combinations of particulate adjuvants and immunopotentiators
EP2377551A2 (en) 2005-11-04 2011-10-19 Novartis Vaccines and Diagnostics S.r.l. Adjuvanted influenza vaccines including cytokine-inducing agents
EP2360175A2 (en) 2005-11-22 2011-08-24 Novartis Vaccines and Diagnostics, Inc. Norovirus and Sapovirus virus-like particles (VLPs)
EP2385126A1 (en) 2005-11-25 2011-11-09 Novartis Vaccines and Diagnostics S.r.l. Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870
EP2385127A1 (en) 2005-11-25 2011-11-09 Novartis Vaccines and Diagnostics S.r.l. Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870
EP2478916A1 (en) 2006-01-27 2012-07-25 Novartis Vaccines and Diagnostics GmbH Influenza vaccines containing hemagglutinin and matrix proteins
US9200042B2 (en) 2006-03-07 2015-12-01 Vaxinnate Corporation Flagellin fusion proteins
EP2357184A1 (en) 2006-03-23 2011-08-17 Novartis AG Imidazoquinoxaline compounds as immunomodulators
EP2382987A1 (en) 2006-03-24 2011-11-02 Novartis Vaccines and Diagnostics GmbH Storage of influenza vaccines without refrigeration
EP2382988A1 (en) 2006-03-31 2011-11-02 Novartis AG Combined mucosal and parenteral immunization against HIV
WO2007119815A1 (en) 2006-04-14 2007-10-25 Kyowa Hakko Kirin Co., Ltd. Toll-like receptor 9 agonists
WO2008042024A2 (en) 2006-06-01 2008-04-10 Elan Pharmaceuticals, Inc. Neuroactive fragments of app
WO2008020335A2 (en) 2006-06-09 2008-02-21 Novartis Ag Immunogenic compositions for streptococcus agalactiae
EP2514437A1 (en) 2006-07-20 2012-10-24 Novartis AG Frozen stockpiling of influenza vaccines
EP2586790A2 (en) 2006-08-16 2013-05-01 Novartis AG Immunogens from uropathogenic Escherichia coli
EP2497495A2 (en) 2006-09-11 2012-09-12 Novartis AG Making influenza virus vaccines without using eggs
EP2532362A1 (en) 2006-12-06 2012-12-12 Novartis AG Vaccines including antigen from four strains of influenza virus
EP2679240A1 (en) 2006-12-06 2014-01-01 Novartis AG Vaccines including antigen from four strains of influenza virus
EP2548895A1 (en) 2007-01-11 2013-01-23 Novartis AG Modified saccharides
EP3067066A1 (en) 2007-02-23 2016-09-14 Prothena Biosciences Limited Prevention and treatment of synucleinopathic and amyloidogenic disease
EP2583978A2 (en) 2007-02-23 2013-04-24 The Regents of the University of California Prevention and treatment of synucleinopathic and amyloidogenic disease
EP2484377A1 (en) 2007-06-27 2012-08-08 Novartis AG Low-additive influenza vaccines
US9463250B2 (en) 2007-07-17 2016-10-11 Glaxosmithkline Biologicals Sa Conjugate purification
EP2659912A2 (en) 2007-07-17 2013-11-06 Novartis AG Conjugate purification
EP2572726A1 (en) 2007-08-01 2013-03-27 Novartis AG Compositions comprising pneumococcal antigens
WO2009034473A2 (en) 2007-09-12 2009-03-19 Novartis Ag Gas57 mutant antigens and gas57 antibodies
EP2952524A1 (en) 2007-10-17 2015-12-09 Janssen Sciences Ireland UC Immunotherapy regimes dependent on apoe status
EP2614835A1 (en) 2007-11-26 2013-07-17 Novartis AG Vaccination with multiple clades of H5 influenza A virus
EP3067048A1 (en) 2007-12-07 2016-09-14 Novartis Ag Compositions for inducing immune responses
EP2891498A1 (en) 2007-12-20 2015-07-08 Novartis AG Fermentation processes for cultivating streptococci and purification processes for obtaining CPS therefrom
EP2537857A2 (en) 2007-12-21 2012-12-26 Novartis AG Mutant forms of streptolysin O
WO2009086539A2 (en) 2007-12-28 2009-07-09 Elan Pharmaceuticals, Inc. Treatment and prophylaxis of amyloidosis
EP2730659A2 (en) 2007-12-28 2014-05-14 Elan Pharmaceuticals Inc. Treatment and Prophylaxis of Amyloidosis
EP2886551A2 (en) 2008-02-21 2015-06-24 Novartis AG Meningococcal fhbp polypeptides
EP2631245A1 (en) 2008-03-10 2013-08-28 Children's Hospital & Research Center at Oakland Chimeric factor H binding proteins (fHBP) containing a heterologous B domain and methods of use
EP2889042A2 (en) 2008-03-18 2015-07-01 Novartis AG Improvements in preparation of influenza virus vaccine antigens
US9205138B2 (en) 2008-04-18 2015-12-08 Vaxinnate Corporation Deletion mutants of flagellin and methods of use
US9211320B2 (en) 2008-04-18 2015-12-15 Vaxinnate Corporation Deletion mutants of flagellin and methods of use
US8932605B2 (en) 2008-04-18 2015-01-13 Vaxinnate Corporation Deletion mutants of flagellin and methods of use
US8222225B2 (en) 2008-05-21 2012-07-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating pneumoconiosis with oligodeoxynucleotides
WO2010032138A2 (en) 2008-09-18 2010-03-25 Novartis Ag Vaccine adjuvant combinations
US8475801B2 (en) 2008-12-09 2013-07-02 Pfizer Vaccines, LCC IgE CH3 peptide vaccine
US8298547B2 (en) 2008-12-09 2012-10-30 Pfizer Vaccines, LLC IgE CH3 peptide vaccine
US9216229B2 (en) 2008-12-09 2015-12-22 Pfizer Vaccines Llc IgE CH3 peptide vaccine
EP2865389A1 (en) 2008-12-09 2015-04-29 Pfizer Vaccines LLC IgE CH3 peptide vaccine
WO2010067286A2 (en) 2008-12-09 2010-06-17 Pfizer Vaccines Llc IgE CH3 PEPTIDE VACCINE
WO2010079464A1 (en) 2009-01-12 2010-07-15 Novartis Ag Cna_b domain antigens in vaccines against gram positive bacteria
WO2010100632A2 (en) 2009-03-06 2010-09-10 Novartis Ag Chlamydia antigens
WO2010109323A1 (en) 2009-03-24 2010-09-30 Novartis Ag Adjuvanting meningococcal factor h binding protein
WO2010115118A2 (en) 2009-04-03 2010-10-07 Antigenics, Inc. Methods for preparing and using multichaperone-antigen complexes
EP2510947A1 (en) 2009-04-14 2012-10-17 Novartis AG Compositions for immunising against Staphylococcus aureus
WO2010138193A2 (en) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Targeted synthetic nanocarriers with ph sensitive release of immunomodulatory agents
EP2944320A1 (en) 2009-06-15 2015-11-18 National University of Singapore Influenza vaccine, composition, and methods of use
WO2010146414A1 (en) 2009-06-15 2010-12-23 National University Of Singapore Influenza vaccine, composition, and methods of use
EP3178490A2 (en) 2009-07-15 2017-06-14 GlaxoSmithKline Biologicals S.A. Rsv f protein compositions and methods for making same
WO2011008974A2 (en) 2009-07-15 2011-01-20 Novartis Ag Rsv f protein compositions and methods for making same
WO2011007257A1 (en) 2009-07-16 2011-01-20 Novartis Ag Detoxified escherichia coli immunogens
EP2837386A1 (en) 2009-07-16 2015-02-18 Novartis AG Detoxified Escherichia coli immunogens
WO2011013034A1 (en) 2009-07-30 2011-02-03 Pfizer Vaccines Llc Antigenic tau peptides and uses thereof
WO2011024071A1 (en) 2009-08-27 2011-03-03 Novartis Ag Adjuvant comprising aluminium, oligonucleotide and polycation
EP3017828A1 (en) 2009-08-27 2016-05-11 GlaxoSmithKline Biologicals SA Hybrid polypeptides including meningococcal fhbp sequences
WO2011024072A2 (en) 2009-08-27 2011-03-03 Novartis Ag Hybrid polypeptides including meningococcal fhbp sequences
EP2865752A1 (en) 2009-09-03 2015-04-29 Pfizer Vaccines LLC PCSK9 vaccine
WO2011027257A2 (en) 2009-09-03 2011-03-10 Pfizer Vaccines Llc Pcsk9 vaccine
WO2011030218A1 (en) 2009-09-10 2011-03-17 Novartis Ag Combination vaccines against respiratory tract diseases
WO2011036564A2 (en) 2009-09-28 2011-03-31 Novartis Vaccines Institute For Global Health Srl Hyperblebbing shigella strains
WO2011036562A1 (en) 2009-09-28 2011-03-31 Novartis Vaccines Institute For Global Health Srl Purification of bacterial vesicles
WO2011039631A2 (en) 2009-09-30 2011-04-07 Novartis Ag Expression of meningococcal fhbp polypeptides
WO2011138636A1 (en) 2009-09-30 2011-11-10 Novartis Ag Conjugation of staphylococcus aureus type 5 and type 8 capsular polysaccharides
WO2011048561A1 (en) 2009-10-20 2011-04-28 Novartis Ag Diagnostic and therapeutic methods for rheumatic heart disease based upon group a streptococcus markers
WO2011051893A1 (en) 2009-10-27 2011-05-05 Novartis Ag Modified meningococcal fhbp polypeptides
WO2011058302A1 (en) 2009-11-10 2011-05-19 Guy's And St Thomas's Nhs Foundation Trust Bacteremia-associated antigen from staphylococcus aureus
WO2011077309A2 (en) 2009-12-22 2011-06-30 Pfizer Vaccines Llc Vaccine compositions
US9765100B2 (en) 2010-02-12 2017-09-19 Chimerix, Inc. Nucleoside phosphonate salts
US9006218B2 (en) 2010-02-12 2015-04-14 Chimerix Inc. Nucleoside phosphonate salts
WO2011104632A1 (en) 2010-02-26 2011-09-01 Novartis Ag Immunogenic proteins and compositions
WO2012020326A1 (en) 2010-03-18 2012-02-16 Novartis Ag Adjuvanted vaccines for serogroup b meningococcus
WO2011121576A2 (en) 2010-04-01 2011-10-06 Novartis Ag Immunogenic proteins and compositions
WO2011127316A1 (en) 2010-04-07 2011-10-13 Novartis Ag Method for generating a parvovirus b19 virus-like particle
WO2011130379A1 (en) 2010-04-13 2011-10-20 Novartis Ag Benzonapthyridine compositions and uses thereof
US9764031B2 (en) 2010-05-26 2017-09-19 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
WO2011149564A1 (en) 2010-05-28 2011-12-01 Tetris Online, Inc. Interactive hybrid asynchronous computer game infrastructure
EP2942061A2 (en) 2010-06-07 2015-11-11 Pfizer Vaccines LLC Ige ch3 peptide vaccine
US9249233B2 (en) 2010-06-07 2016-02-02 Pfizer Vaccines Llc IgE CH3 peptide vaccine
WO2011154863A1 (en) 2010-06-07 2011-12-15 Pfizer Inc. Her-2 peptides and vaccines
WO2011154878A1 (en) 2010-06-07 2011-12-15 Pfizer Vaccines Llc Ige ch3 peptide vaccine
US8722053B2 (en) 2010-06-07 2014-05-13 Pfizer Vaccines Llc IgE CH3 peptide vaccine
WO2011161551A2 (en) 2010-06-11 2011-12-29 Novartis Ag Omv vaccines
WO2011161653A1 (en) 2010-06-25 2011-12-29 Novartis Ag Combinations of meningococcal factor h binding proteins
EP3153578A1 (en) 2010-07-06 2017-04-12 Novartis Ag Norovirus derived immunogenic compositions and methods
WO2012006293A1 (en) 2010-07-06 2012-01-12 Novartis Ag Norovirus derived immunogenic compositions and methods
WO2012006359A1 (en) 2010-07-06 2012-01-12 Novartis Ag Delivery of self-replicating rna using biodegradable polymer particles
WO2012009442A2 (en) 2010-07-14 2012-01-19 Merck Sharp & Dohme Corp. Anti-addl monoclonal antibody and uses thereof
WO2012035519A1 (en) 2010-09-16 2012-03-22 Novartis Ag Immunogenic compositions
WO2012049662A1 (en) 2010-10-15 2012-04-19 Novartis Vaccines Institute For Global Health Srl Hyperblebbing salmonella strains
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
WO2012085668A2 (en) 2010-12-24 2012-06-28 Novartis Ag Compounds
WO2012103361A1 (en) 2011-01-26 2012-08-02 Novartis Ag Rsv immunization regimen
WO2012131504A1 (en) 2011-03-02 2012-10-04 Pfizer Inc. Pcsk9 vaccine
US9745354B2 (en) 2011-04-22 2017-08-29 Wyeth Llc Compositions relating to a mutant Clostridium difficile toxin and methods thereof
USRE46376E1 (en) 2011-04-22 2017-04-25 Wyeth Llc Compositions relating to a mutant Clostridium difficile toxin and methods thereof
US9187536B1 (en) 2011-04-22 2015-11-17 Wyeth Llc Compositions relating to a mutant Clostridium difficile toxin and methods thereof
WO2012143902A1 (en) 2011-04-22 2012-10-26 Wyeth Llc Compositions relating to a mutant clostridium difficile toxin and methods thereof
WO2012158613A1 (en) 2011-05-13 2012-11-22 Novartis Ag Pre-fusion rsv f antigens
US9126996B2 (en) 2011-06-01 2015-09-08 Janus Biotherapeutics, Inc. Immune system modulators
US9359361B2 (en) 2011-06-01 2016-06-07 Janus Biotherapeutics, Inc. Immune system modulators
US9353115B2 (en) 2011-06-01 2016-05-31 Janus Biotherapeutics, Inc. Immune system modulators
US9637489B2 (en) 2011-06-01 2017-05-02 Janus Biotherapeutics, Inc. Immune system modulators
WO2013006838A1 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic combination compositions and uses thereof
WO2013006842A2 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic compositions and uses thereof
WO2013009564A1 (en) 2011-07-08 2013-01-17 Novartis Ag Tyrosine ligation process
WO2013016460A1 (en) 2011-07-25 2013-01-31 Novartis Ag Compositions and methods for assessing functional immunogenicity of parvovirus vaccines
WO2013030783A1 (en) 2011-08-30 2013-03-07 Novartis Ag Immunogenic proteins and compositions
US9511130B2 (en) 2011-09-14 2016-12-06 Glaxosmithkline Biologicals Sa Escherichia coli vaccine combination
WO2013038375A2 (en) 2011-09-14 2013-03-21 Novartis Ag Methods for making saccharide-protein glycoconjugates
WO2013038385A2 (en) 2011-09-14 2013-03-21 Novartis Ag Escherichia coli vaccine combination
WO2013068949A1 (en) 2011-11-07 2013-05-16 Novartis Ag Carrier molecule comprising a spr0096 and a spr2021 antigen
WO2013084071A2 (en) 2011-12-08 2013-06-13 Novartis Ag Clostridium difficile toxin-based vaccine
WO2013108272A2 (en) 2012-01-20 2013-07-25 International Centre For Genetic Engineering And Biotechnology Blood stage malaria vaccine
WO2013124473A1 (en) 2012-02-24 2013-08-29 Novartis Ag Pilus proteins and compositions
US9597385B2 (en) 2012-04-23 2017-03-21 Allertein Therapeutics, Llc Nanoparticles for treatment of allergy
WO2013160335A2 (en) 2012-04-26 2013-10-31 Novartis Ag Antigens and antigen combinations
WO2013164754A2 (en) 2012-05-04 2013-11-07 Pfizer Inc. Prostate-associated antigens and vaccine-based immunotherapy regimens
WO2013174832A1 (en) 2012-05-22 2013-11-28 Novartis Ag Meningococcus serogroup x conjugate
WO2014005958A1 (en) 2012-07-06 2014-01-09 Novartis Ag Immunogenic compositions and uses thereof
US9764027B2 (en) 2012-09-18 2017-09-19 Glaxosmithkline Biologicals Sa Outer membrane vesicles
US9873694B2 (en) 2012-10-03 2018-01-23 Janus Biotherapeutics, Inc. Imidazole quinoline-based immune system modulators
WO2014053607A1 (en) 2012-10-03 2014-04-10 Novartis Ag Immunogenic compositions
WO2014053612A1 (en) 2012-10-03 2014-04-10 Novartis Ag Immunogenic composition
WO2014060898A2 (en) 2012-10-21 2014-04-24 Pfizer Inc. Compositions and methods relating to a mutant clostridium difficile toxin
US9539217B2 (en) 2013-04-03 2017-01-10 Allertein Therapeutics, Llc Nanoparticle compositions
WO2015022401A1 (en) * 2013-08-14 2015-02-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Immunoadjuvant compositions and uses thereof
WO2015063647A1 (en) 2013-11-01 2015-05-07 Pfizer Inc. Vectors for expression of prostate-associated antigens
WO2015068129A1 (en) 2013-11-08 2015-05-14 Novartis Ag Salmonella conjugate vaccines
WO2015075635A2 (en) 2013-11-19 2015-05-28 Prothena Biosciences Limited Monitoring immunotherapy of lewy body disease from constipation symptoms
WO2015123291A1 (en) 2014-02-11 2015-08-20 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Pcsk9 vaccine and methods of using the same
WO2015136470A1 (en) 2014-03-12 2015-09-17 Prothena Biosciences Limited Anti-mcam antibodies and associated methods of use
WO2015136469A1 (en) 2014-03-12 2015-09-17 Prothena Biosciences Limited Anti-mcam antibodies and associated methods of use
WO2016183486A1 (en) 2015-05-13 2016-11-17 Agenus Inc. Vaccines for treatment and prevention of cancer
WO2016207853A2 (en) 2015-06-26 2016-12-29 Seqirus UK Limited Antigenically matched influenza vaccines
WO2017046776A2 (en) 2015-09-16 2017-03-23 Prothena Biosciences Limited Use of anti-mcam antibodies for treatment or prophylaxis of giant cell arteritis, polymyalgia rheumatica or takayasu's arteritis
WO2017046774A2 (en) 2015-09-16 2017-03-23 Prothena Biosciences Limited Use of anti-mcam antibodies for treatment or prophylaxis of giant cell arteritis, polymyalgia rheumatica or takayasu's arteritis
WO2017125844A1 (en) 2016-01-19 2017-07-27 Pfizer Inc. Cancer vaccines
WO2017153955A1 (en) 2016-03-09 2017-09-14 Prothena Biosciences Limited Use of anti-mcam antibodies for treatment or prophylaxis of granulomatous lung diseases
WO2017153953A1 (en) 2016-03-09 2017-09-14 Prothena Biosciences Limited Use of anti-mcam antibodies for treatment or prophylaxis of granulomatous lung diseases

Also Published As

Publication number Publication date Type
CA2283557A1 (en) 1998-09-17 application
ES2333069T3 (en) 2010-02-16 grant
JP2002511841A (en) 2002-04-16 application
EP1005368B1 (en) 2009-09-02 grant
EP1005368A1 (en) 2000-06-07 application
DK1005368T3 (en) 2010-01-04 grant
EP1005368A4 (en) 2004-09-29 application
EP2172216A3 (en) 2010-11-24 application
JP5087758B2 (en) 2012-12-05 grant
DE69841122D1 (en) 2009-10-15 grant
EP2172216A2 (en) 2010-04-07 application
JP2009280606A (en) 2009-12-03 application

Similar Documents

Publication Publication Date Title
Staats et al. Mucosal immunity to infection with implications for vaccine development
Bode et al. CpG DNA as a vaccine adjuvant
Krieg Immune effects and mechanisms of action of CpG motifs
Ellis New technologies for making vaccines
Krieg Mechanisms and applications of immune stimulatory CpG oligodeoxynucleotides
Donnelly et al. DNA vaccines
Klinman et al. CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases
US6610661B1 (en) Immunostimulatory polynucleotide/immunomodulatory molecule conjugates
Gramzinski et al. Immune response to a hepatitis B DNA vaccine in Aotus monkeys: a comparison of vaccine formulation, route, and method of administration.
Chow et al. Improvement of hepatitis B virus DNA vaccines by plasmids coexpressing hepatitis B surface antigen and interleukin-2.
Davis et al. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen
US7255868B2 (en) Chimeric immunomodulatory compounds and methods of using the same—I
US20020028784A1 (en) Methods of preventing and treating viral infections using immunomodulatory polynucleotide sequences
Vollmer et al. Immunotherapeutic applications of CpG oligodeoxynucleotide TLR9 agonists
Klinman et al. CpG motifs as immune adjuvants
US20090155307A1 (en) Immunostimulatory nucleic acid oil-in-water formulations and related methods of use
US6610308B1 (en) Immunostimulant emulsion
US20050238660A1 (en) Cpg formulations and related methods
US20060094681A1 (en) Immunostimulatory oligonucleotide multimers
US7615227B2 (en) Use of CpG oligodeoxynucleotides to induce angiogenesis
US6815429B2 (en) Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
Robinson et al. DNA vaccines for viral infections: basic studies and applications
US20020098199A1 (en) Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
Dunham The application of nucleic acid vaccines in veterinary medicine
Tighe et al. Gene vaccination: plasmid DNA is more than just a blueprint

Legal Events

Date Code Title Description
ENP Entry into the national phase in:

Ref country code: US

Ref document number: 1998 153730

Date of ref document: 19980915

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09154614

Country of ref document: US

AL Designated countries for regional patents

Kind code of ref document: A1


AK Designated states

Kind code of ref document: A1


121 Ep: the epo has been informed by wipo that ep was designated in this application
COP Corrected version of pamphlet


DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 67595/98

Country of ref document: AU

ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2283557

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2283557

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1998912919

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1998912919

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 67595/98

Country of ref document: AU