WO2006068802A2 - COMPOSITIONS OF AMINOACYL-tRNA SYNTHETASE AND USES THEREOF - Google Patents

COMPOSITIONS OF AMINOACYL-tRNA SYNTHETASE AND USES THEREOF Download PDF

Info

Publication number
WO2006068802A2
WO2006068802A2 PCT/US2005/043603 US2005043603W WO2006068802A2 WO 2006068802 A2 WO2006068802 A2 WO 2006068802A2 US 2005043603 W US2005043603 W US 2005043603W WO 2006068802 A2 WO2006068802 A2 WO 2006068802A2
Authority
WO
WIPO (PCT)
Prior art keywords
trna
cell
amino acid
protein
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/043603
Other languages
English (en)
French (fr)
Other versions
WO2006068802A3 (en
Inventor
Andrew Paulsel
Ho Sung Cho
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ambrx Inc
Original Assignee
Ambrx Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AT05852740T priority Critical patent/ATE541934T1/de
Priority to MX2007007581A priority patent/MX2007007581A/es
Priority to CA2590429A priority patent/CA2590429C/en
Priority to HK08102426.2A priority patent/HK1111722B/en
Priority to NZ555425A priority patent/NZ555425A/en
Priority to JP2007548250A priority patent/JP4990792B2/ja
Priority to CN2005800444340A priority patent/CN101087875B/zh
Priority to BRPI0519568-3 priority patent/BRPI0519568C8/pt
Priority to EP05852740A priority patent/EP1836298B1/en
Application filed by Ambrx Inc filed Critical Ambrx Inc
Priority to KR1020077016502A priority patent/KR101252835B1/ko
Priority to AU2005319518A priority patent/AU2005319518B2/en
Publication of WO2006068802A2 publication Critical patent/WO2006068802A2/en
Publication of WO2006068802A3 publication Critical patent/WO2006068802A3/en
Priority to IL183342A priority patent/IL183342A/en
Anticipated expiration legal-status Critical
Priority to GB0713653A priority patent/GB2436765A/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione

Definitions

  • the invention pertains to the field of translation biochemistry.
  • the invention relates to methods for producing and compositions of aminoacyl-tRNA synthetases and uses thereof.
  • the invention also relates to methods of producing proteins in cells using such aminoacyl-tRNA synthetases and related compositions.
  • Unnatural amino acids have been microinjected into cells. For example, unnatural amino acids were introduced into the nicotinic acetylcholine receptor in Xenopus oocytes (e.g., M. W.
  • a Xenopus oocyte was coinjected with two RNA species made in vitro: an mRNA encoding the target protein with a UAG stop codon at the amino acid position of interest and an amber suppressor tRNA aminoacylated with the desired unnatural amino acid.
  • a number of new amino acids with novel chemical, physical or biological properties including photoaffmity labels and photoisomerizable amino acids, photocrosslinking amino acids (see, e.g., Chin, J. W., et al. (2002) Proc. Natl. Acad. Sci. U. S. A. 99:11020-11024; and, Chin, J. W., et al., (2002) J. Am. Chem. Soc. 124:9026-9027), keto amino acids (see, e.g., Wang, L., et al., (2003) Proc. Natl. Acad. Sci. U. S. A. 100:56-61 and Zhang, Z. et al., Biochem.
  • the invention provides compositions of and methods of producing orthogonal aminoacyl-tRNA synthetases.
  • Aminoacyl-tRNA synthetases of the present invention aminoacylate tRNA with a non-naturally encoded amino acid.
  • These translational components can be used to incorporate a selected amino acid in a specific position in a growing polypeptide chain (during nucleic acid translation) in response to a selector codon that is recognized by the tRNA.
  • a method includes growing, in an appropriate medium, a cell, where the cell comprises a nucleic acid that comprises at least one selector codon and encodes a protein; and, providing the selected amino acid.
  • the cell further comprises: an orthogonal tRNA (O-tRNA) that functions in the cell and recognizes the selector codon; and, an orthogonal aminoacyl-tRNA synthetase (O-RS) that preferentially aminoacylates the O-tRNA with the selected amino acid.
  • O-tRNA orthogonal tRNA
  • O-RS orthogonal aminoacyl-tRNA synthetase
  • the O- tRNA comprises suppression activity in the presence of a cognate synthetase.
  • a protein produced by this method is also a feature of the present invention.
  • FIG. 1 The cloverleaf structure of J17 tRNA with T ⁇ C stem mutation sites is shown.
  • FIG. 13 Figure 2 - Supression of an amber mutation in human growth hormone is shown using J17 or J17 mutants (F12, F13, F14) and E9 RS. Total cell lysate for each sample was analyzed by SDS PAGE.
  • FIG. 14 Figure 3 - Supression of an amber mutation in human growth hormone is shown in different cell lines using Fl 3 and E9 RS.
  • nucleic acids and/or nucleic acid sequences are homologous when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence.
  • any naturally occurring nucleic acid can be modified by any available mutagenesis method to include one or more selector codon.
  • this mutagenized nucleic acid encodes a polypeptide comprising one or more selected amino acid, e.g. unnatural amino acid.
  • the mutation process can, of course, additionally alter one or more standard codon, thereby changing one or more standard amino acid in the resulting mutant protein as well.
  • the one or more standard amino acid may be changed to an unnatural amino acid or a natural amino acid.
  • Homology is generally inferred from sequence similarity between two or more nucleic acids or proteins (or sequences thereof).
  • the precise percentage of similarity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence similarity is routinely used to establish homology.
  • Higher levels of sequence similarity e.g., 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more, can also be used to establish homology.
  • Methods for determining sequence similarity percentages e.g., BLASTP and BLASTN using default parameters are described herein and are generally available.
  • Orthogonal refers to a molecule (e.g., an orthogonal tRNA (O-tRNA) and/or an orthogonal aminoacyl tRNA synthetase (0-RS)) that is used with reduced efficiency by a system of interest (e.g., a translational system, e.g., a cell).
  • Orthogonal refers to the inability or reduced efficiency, e.g., less than 20% efficient, less than 10% efficient, less than 5% efficient, or e.g., less than 1% efficient, of an orthogonal tRNA and/or orthogonal RS to function in the translation system of interest.
  • an orthogonal tRNA in a translation system of interest is aminoacylated by any endogenous RS of a translation system of interest with reduced or even zero efficiency, when compared to aminoacylation of an endogenous tRNA by an endogenous RS.
  • an orthogonal RS aminoacylates any endogenous tRNA in the translation system of interest with reduced or even zero efficiency, as compared to aminoacylation of the endogenous tRNA by an endogenous RS.
  • a second orthogonal molecule can be introduced into the cell that functions with the first orthogonal molecule.
  • an orthogonal tRNA/RS pair includes introduced complementary components that function together in the cell with an
  • Cognate refers to components that function together, e.g., a tRNA and an aminoacyl-tRNA synthetase.
  • the components can also be referred to as being complementary.
  • Preferentially aminoacylates refers to an efficiency, e.g., about 70% efficient, about 75% efficient, about 80% efficient, about 85% efficient, about 90% efficient, about 95% efficient, or about 99% or more efficient, at which an O-RS aminoacylates an OfRNA with a selected amino acid, e.g., an unnatural amino acid, compared to the O-RS aminoacylating a naturally occurring tRNA or a starting material used to generate the O-tRNA.
  • a selected amino acid e.g., an unnatural amino acid
  • the unnatural amino acid is then incorporated into a growing polypeptide chain with high fidelity, e.g., at greater than about 70% efficiency for a given selector codon, at greater than about 75% efficiency for a given selector codon, at greater than about 80% efficiency for a given selector codon, at greater than about 85% efficiency for a given selector codon, at greater than about 90% efficiency for a given selector codon, greater than about 95% efficiency for a given selector codon, or greater than about 99% efficiency for a given selector codon.
  • Selector codon refers to codons recognized by the O- tRNA in the translation process and not recognized by an endogenous tRNA.
  • the O-tRNA anticodon loop recognizes the selector codon on the mRNA and incorporates its amino acid, e.g., a selected amino acid, such as an unnatural amino acid, at this site in the polypeptide.
  • Selector codons can include but are not limited to, e.g., nonsense codons, such as, stop codons, including but not limited to, amber, ochre, and opal codons; four or more base codons; rare codons; codons derived from natural or unnatural base pairs and/or the like.
  • a selector codon can also include one of the natural three base codons, wherein the endogenous system does not use (or rarely uses) said natural three base codon. For example, this includes a system that is lacking a tRNA that recognizes the natural three base codon, and/or a system wherein the natural three base codon is a rare codon.
  • Suppressor tRNA is a tRNA that alters the reading of a messenger RNA (mRNA) in a given translation system, e.g., by providing a mechanism for incorporating an amino acid into a polypeptide chain in response to a selector codon.
  • a suppressor tRNA can read through a codon including but not limited to, a stop codon, a four base codon, or a rare codon.
  • Suppression activity refers to the ability of a tRNA, e.g., a suppressor tRNA, to read through a selector codon. Activity can be expressed as a percentage of activity observed as compared to a control (e.g., lacking a cognate synthetase).
  • Translation system refers to the components necessary to incorporate a naturally occurring amino acid into a growing polypeptide chain (protein).
  • Components of a translation system can include, e.g., ribosomes, tRNA's, synthetases, mRNA and the like.
  • the components of the present invention can be added to an in vitro or in vivo translation system.
  • Examples of translation systems include but are not limited to, a non-eukaryotic cell, e.g., a bacterium (such as E.
  • a eukaryotic cell e.g., a yeast cell, a mammalian cell, a plant cell, an algae cell, a fungus cell, an insect cell, a cell-free translational system e.g., a cell lysate, and/or the like.
  • a eukaryotic cell e.g., a yeast cell, a mammalian cell, a plant cell, an algae cell, a fungus cell, an insect cell, a cell-free translational system e.g., a cell lysate, and/or the like.
  • Translation systems may be cellular or cell-free, and may be prokaryotic or eukaryotic.
  • Cellular translation systems include, but are not limited to, whole cell preparations such as permeabilized cells or cell cultures wherein a desired nucleic acid sequence can be transcribed to mRNA and the mRNA translated.
  • Cell-free translation systems are commercially available and many different types and systems are well-known. Examples of cell- free systems include, but are not limited to, prokaryotic lysates such as Escherichia coli lysates, and eukaryotic lysates such as wheat germ extracts, insect cell lysates, rabbit reticulocyte lysates, rabbit oocyte lysates and human cell lysates.
  • Eukaryotic extracts or lysates may be preferred when the resulting protein is glycosylated, phosphorylated or otherwise modified because many such modifications are only possible in eukaryotic systems.
  • Some of these extracts and lysates are available commercially (Promega; Madison, Wis.; Stratagene; La Jolla, Calif; Amersham; Arlington Heights, 111.; GIBCO/BRL; Grand Island, N. Y.).
  • Membranous extracts such as the canine pancreatic extracts containing microsomal membranes, are also available which are useful for translating secretory proteins. [27] Reconstituted translation systems may also be used.
  • telomeres initiation factor-1
  • IF-2 IF-2
  • IF-3 a or ⁇
  • EF-Tu elongation factor T
  • Cell-free systems may also be coupled transcription/translation systems wherein DNA is introduced to the system, transcribed into mRNA and the mRNA translated as described in Current Protocols in Molecular Biology (F. M. Ausubel et al. editors, Wiley Interscience, 1993), which is hereby specifically incorporated by reference.
  • RNA transcribed in eukaryotic transcription system may be in the form of heteronuclear RNA (hnRNA) or 5 '- end caps (7-methyl guanosine) and 3 '-end poly A tailed mature mRNA, which can be an advantage in certain translation systems.
  • hnRNA heteronuclear RNA
  • 5 '- end caps (7-methyl guanosine) and 3 '-end poly A tailed mature mRNA which can be an advantage in certain translation systems.
  • capped mRNAs are translated with high efficiency in the reticulocyte lysate system.
  • Selected amino acid refers to any desired naturally occurring amino acid or unnatural amino acid.
  • unnatural amino acid or “non-naturally encoded amino acid” refers to any amino acid, modified amino acid, and/or amino acid analogue that is not one of the 20 common naturally occurring amino acids or selenocysteine or pyrrolysine.
  • Other terms that may be used synonymously with the term “non-naturally encoded amino acid” and “unnatural amino acid” are "non-natural amino acid,” “non-naturally-occurring amino acid,” and variously hyphenated and non-hyphenated versions thereof.
  • non-naturally encoded amino acid also includes, but is not limited to, amino acids that occur by modification (e.g. post-translational modifications) of a naturally encoded amino acid (including but not limited to, the 20 common amino acids or pyrrolysine and selenocysteine) but are not themselves naturally incorporated into a growing polypeptide chain by the translation complex.
  • non-naturally-occurring amino acids include, but are not limited to, iV-acetylglucosaminyl-L-serine, N- acetylglucosaminyl-L-threonine, and O-phosphotyrosine.
  • Positive selection or screening marker refers to a marker that when present, e.g., expressed, activated or the like, results in identification of a cell with the positive selection marker from those without the positive selection marker.
  • Negative selection or screening marker refers to a marker that when present, e.g., expressed, activated or the like, allows identification of a cell that does not possess the desired property (e.g., as compared to a cell that does possess the desired property).
  • reporter refers to a component that can be used to select target components of a system of interest.
  • a reporter can include a protein, e.g., an enzyme, that confers antibiotic resistance or sensitivity (including, but not limited to, ⁇ -lactamase, chloramphenicol acetyltransferase (CAT), and the like), a fluorescent screening marker (including but not limited to, green fluorescent protein (e.g.
  • GFP GFP
  • YFP YFP
  • EGFP GFP
  • RFP RFP
  • a luminescent marker including but not limited to, a firefly luciferase protein
  • an affinity based screening marker or positive or negative selectable marker genes such as lacZ, ⁇ -gal/lacZ ( ⁇ -galactosidase), ADH (alcohol dehydrogenase), his3, ura3, Ieu2, Iys2, or the like.
  • Eukarvote refers to organisms belonging to the phylogenetic domain Eucarya such as animals (including but not limited to, mammals, insects, reptiles, birds, etc.), ciliates, plants (including but not limited to, monocots, dicots, algae, etc.), fungi, yeasts, flagellates, microsporidia, protists, etc.
  • Non-eukarvote refers to non- eukaryotic organisms.
  • a non-eukaryotic organism can belong to the Eubacteria (including but not limited to, Escherichia coli, Thermus thermophilus, Bacillus stearothermophilus, Pseudomonas fluorescens, Pseudomonas aeruginosa, Pseudomonas putida, etc.) phylogenetic domain, or the Archaea (e.g., Methanococcus jannaschii, Methanobacterium thermoautotrophicum, Halobacterium such as Haloferax volcanii and Halobacterium species NRC-I, Archaeoglobus fulgidus, Pyrococcus furiosus, Pyrococcus horikoshii, Aeuropyrum pernix, etc.) phylogenetic domain.
  • Eubacteria including but not limited to, Escherichia coli, Ther
  • Conservative variant refers to a translation component, e.g., a conservative variant OtRNA or a conservative variant O-RS, that functionally performs like the component from which the conservative variant is based, e.g., an OtRNA or O-RS, but has variations in the sequence.
  • an O-RS will aminoacylate a complementary O-tRNA or a conservative variant O-tRNA with a selected amino acid, e.g., an unnatural amino acid, although the O-tRNA and the conservative variant O-tRNA do not have the same sequence.
  • a tRNA will be aminoacylated with a
  • the conservative variant can have, e.g., one variation, two variations, three variations, four variations, or five or more variations in sequence, as long as the conservative variant is complementary to the corresponding O-tRNA or O-RS.
  • Selection or screening agent refers to an agent that, when present, allows for a selection/screening of certain components from a population.
  • a selection or screening agent includes, but is not limited to, e.g., a nutrient, an antibiotic, a wavelength of light, an antibody, an expressed polynucleotide, or the like.
  • the selection agent can be varied, e.g., by concentration, intensity, etc.
  • Such translation systems generally comprise cells that include an orthogonal tRNA (O-tRNA), an orthogonal aminoacyl tRNA synthetase (O-RS), and a selected amino acid, e.g., an unnatural amino acid, where the O-RS aminoacylates the O-tRNA with the selected amino acid.
  • An orthogonal pair of the present invention is composed of an O-tRNA, e.g., a suppressor tRNA, a frameshift tRNA, or the like, and an O-RS.
  • the O-tRNA recognizes a first selector codon and has suppression activity in presence of a cognate synthetase in response to a selector codon.
  • the cell uses the components to incorporate the selected amino acid into a growing polypeptide chain.
  • a nucleic acid that comprises a polynucleotide that encodes a polypeptide of interest can also be present, where the polynucleotide comprises a selector codon that is recognized by the O-tRNA.
  • the translation system can also be an in vitro
  • RS molecules of the present invention are useful in any translational system, including systems that utilize ribosomes in translation.
  • the translation system may also be a cell-free (in- vitro) translational system.
  • these systems which can include either mRNA as a template (in- vitro translation) or DNA as a template (combined in- vitro transcription and translation), the in vitro synthesis is directed by the ribosomes.
  • Kim, D.M. and J.R. Swartz Biotechnology and Bioengineering, IA :309-316 (2001); Kim, D.M. and J.R. Swartz, Biotechnology Letters, 22, 1537-1542, (2000); Kim, D.M., and J.R.
  • an E. coli cell comprising the RS of the present invention includes such a translation system.
  • the E. coli cell of the present invention includes an orthogonal tRNA (O-tRNA), where the O-tRNA comprises suppression activity in presence of a cognate synthetase in response to a selector codon; an orthogonal aminoacyl-tRNA synthetase (O-RS); a selected amino acid; and, a nucleic acid that comprises a polynucleotide that encodes a polypeptide of interest, where the polynucleotide comprises a selector codon that is recognized by the O-tRNA.
  • O-tRNA orthogonal tRNA
  • O-RS orthogonal aminoacyl-tRNA synthetase
  • the invention also features multiple O-tRNA/O-RS pairs in a cell, which allows incorporation of more than one selected amino acid.
  • the cell can further include an additional different O-tRNA/O-RS pair and a second selected amino acid, where the O-tRNA recognizes a second selector codon and the O-RS preferentially aminoacylates the O-tRNA with the second selected amino acid.
  • a cell can further comprise, e.g., an amber suppressor tRNA-aminoacyl tRNA synthetase pair derived from the tyrosyl-tRNA synthetase of Methanococcus jannaschii.
  • the O-tRNA and/or the O-RS can be naturally occurring or can be derived by mutation of a naturally occurring tRNA and/or RS, e.g., which generates libraries of tRNA's and/or libraries of RSs, from a variety of organisms.
  • one strategy of producing an orthogonal tRNA/aminoacyl-tRNA synthetase pair involves importing a heterologous tRNA/synthetase pair from, e.g., a source other than the host cell, or multiple sources, into the host cell.
  • the properties of the heterologous synthetase candidate include, e.g., that it does not charge any host cell tRNA, and the properties of the heterologous tRNA candidate include, e.g., that it is not aminoacylated by any host cell synthetase.
  • the heterologous tRNA is orthogonal to all host cell synthetases.
  • a second strategy for generating an orthogonal pair involves generating mutant libraries from which to screen and/or select an O-tRNA or O-RS. These strategies can also be combined.
  • the O-tRNA and O-RS are derived from at least one organism.
  • the O-tRNA is derived from a naturally occurring or mutated naturally occurring tRNA from a first organism and the O-RS is derived from naturally occurring or mutated naturally occurring RS from a second organism.
  • the first and second organisms are different.
  • an orthogonal pair may include a tRNA synthetase derived from Methanobacterium thermoautotrophicum, and a tRNA derived from an archael tRNA (e.g., from Halobacterium sp. NRC-I).
  • the first and second organisms are the same. See the section entitled "Sources and Host Organisms" herein for additional information.
  • an O-RS of the present invention comprises or is encoded by a polynucleotide sequence as set forth in SEQ ID NO.: 4, or a complementary polynucleotide sequence thereof, or a conservative variation thereof.
  • an O-RS comprises an amino acid sequence as set forth in SEQ ID NO.: 4, or a complementary polynucleotide sequence thereof, or a conservative variation thereof.
  • an O-RS comprises an amino acid sequence as set forth in SEQ ID NO.
  • Orthogonal tRNA mediates incorporation of a selected amino acid into a protein that is encoded by a polynucleotide that comprises a selector codon that is recognized by the O-tRNA, e.g., in vivo or in vitro.
  • An O-tRNA may be aminoacylated with a desired amino acid by any method or technique, including but not limited to, chemical or enzymatic aminoacylation. The aminoacylated O-tRNA may be added directly to a translation system.
  • An O-tRNA may be aminoacylated by an RS of the present invention with a selected amino acid in vitro or in vivo, hi addition, the RS may be an O-RS.
  • An O-tRNA can be provided to the translation system (e.g., in vitro translation components, or a cell) directly, or by providing a polynucleotide that encodes an O-tRNA or a portion thereof.
  • an O-tRNA, or a portion thereof is encoded by a polynucleotide sequence as set forth in SEQ ID NO.: 1, 2, 3, or a complementary polynucleotide sequence thereof, or a conservative variation thereof.
  • An O-RS can be provided to the translation system (e.g., in vitro translation components, or a cell) directly (e.g. SEQ ID NO: 5 or 17) or a conservative variation thereof, or by providing a polynucleotide that encodes an O-RS or a portion thereof.
  • an O-RS, or a portion thereof is encoded by a polynucleotide sequence as set forth in SEQ ID NO.: 4, a polynucleotide sequence that encodes amino acid sequence SEQ ID NO: 17, or a complementary polynucleotide sequence thereof, or a conservative variation thereof.
  • An O-tRNA of the present invention comprises suppression activity in the presence of a cognate synthetase in response to a selector codon.
  • Suppression activity can be determined by any of a number of assays known in the art.
  • a /?-galactosidase reporter assay can be used.
  • a derivative of a plasmid that expresses lacZ gene under the control of promoter is used, e.g., where the Leu-25 of the peptide VVLQRRD WEN of lacZ is replaced by a selector codon, e.g., TAG, TGA, AGGA, etc.
  • lacZ plasmid is introduced into cells from an appropriate organism (e.g., an organism where the orthogonal components can be used) along with plasmid comprising an O-tRNA of the present invention.
  • a cognate synthetase can also be introduced (either as a polypeptide or a polynucleotide that encodes the cognate synthetase when expressed). The cells are grown in media to a desired density,
  • Percent suppression is calculated as the percentage of activity for a sample relative to a comparable control, e.g., the value observed from the derivatived lacZ construct, where the construct has a corresponding sense codon at desired position rather than a selector codon.
  • O-tRNA's suitable for use in the present invention are any one of the O-tRNA molecules disclosed in U.S. Patent Applications 10/126,931, 10/126,927, and 10/825,867. hi the tRNA molecule, Thymine (T) is replaced with Uracil (U). hi addition, additional modifications to the bases can be present.
  • the invention also includes conservative variations of O-tRNA. For example, conservative variations of O-tRNA include those molecules that function like the O-tRNA and maintain the tRNA L-shaped structure, but do not have the same sequence (and are other than wild type tRNA molecules). See also the section herein entitled "Nucleic Acid and Polypeptide Sequence and Variants.”
  • composition comprising an O-tRNA can further include an orthogonal aminoacyl-tRNA synthetase (O-RS), where the O-RS preferentially aminoacylates the O- tRNA with a selected amino acid (e.g., an unnatural amino acid).
  • O-RS orthogonal aminoacyl-tRNA synthetase
  • a composition including an O-tRNA can further include a translation system (e.g., an in vitro or an in vivo translation system).
  • a nucleic acid comprising a polynucleotide encoding a polypeptide of interest, wherein the polynucleotide comprises one or more selector codons recognized by the O-tRNA, or a combination of one or more of these, can also be present in the cell or other translation system. See also, the section herein entitled "Orthogonal Aminoacyl-tRNA Synthetases (O-RS)."
  • O-tRNA orthogonal tRNA
  • a tRNA, e.g., an O-tRNA, produced by the method is also a feature of the present invention.
  • Methods of producing an orthogonal tRNA include mutating the anticodon loop of each of a pool of tRNA's to allow recognition of a selector codon (e.g., an amber codon, an opal codon, a four base codon, etc.), thereby providing a plurality of potential O-tRNA's; and analyzing secondary structure of a member of the plurality potential O-tRNA to identify non-canonical base pairs in the secondary structure, and optionally mutating the non- canonical base pairs (e.g., the non-canonical base pairs are mutated to canonical base pairs).
  • the non-canonical base pairs can be located in the stem region of the secondary structure.
  • An O-tRNA may possess an improvement of one or more characteristics or activities, such as improvement in orthogonality for a desired organism compared to the starting material, e.g., the plurality of tRNA sequences, while preserving its affinity towards a desired RS.
  • O-tRNA' s may be developed by mutating a known tRNA to modulate its interaction with or binding affinity to one or more molecules that influence translation or are components of translation machinery.
  • Such components include, but are not limited to, elongation factors.
  • Bacterial elongation factor EF-Tu plays a key role in the elongation step in protein synthesis. Following aminoacylation of the tRNA by tRNA synthetase, EF-Tu binds the aminoacylated tRNA and brings it to the A site of the ribosome. The ester bond between the charged amino acid and the tRNA is protected from spontaneous hydrolysis due to the binding between EF-Tu and aminoacylated tRNA.
  • Stortchevoi et al. investigated mutants of the E. coli initiation tRNA 0 ⁇ ' U50:G64 wobble base pair in the T ⁇ C stem, since this base pair was found to be a secondary negative determinant blocking the tRNA's activity in elongation, presumably due to a weakened interaction between the EF- Tu.GTP and aminoacylated tRNA (JBC 2003 278(20):17672-17679). Also, LaRiviere et al. described in Science 2001 Oct 5;294(5540): 165-8 the thermodynamic contributions of the amino acid and the tRNA body to the overall binding affinity to EF-Tu.
  • the methods optionally include analyzing the homology of sequences of tRNA's and/or aminoacyl-tRNA synthetases to determine potential candidates for an O-tRNA, O-RS and/or pairs thereof, that appear to be orthogonal for a specific organism.
  • Computer programs known in the art and described herein can be used for the analysis, hi one example, to choose potential orthogonal translational components for use in a prokaryotic organism, a synthetase and/or a tRNA is chosen that does not display unusual homology to prokaryotic organisms.
  • a pool of fRNA's can also be produced by a consensus strategy.
  • the pool of tRNA's is produced by aligning a plurality of tRNA sequences; determining a consensus sequence; and generating a library of tRNA's using at least a portion, most of, or the entire consensus sequence.
  • a consensus sequence can be compiled with a computer program, e.g., the GCG program pileup.
  • degenerate positions determined by the program are changed to the most frequent base at those positions.
  • a library is synthesized by techniques known in the art using the consensus sequence.
  • overlap extension of oligonucleotides in which each site of the tRNA gene can be synthesized as a doped mixture of 90% the consensus sequence and 10% a mixture of the other 3 bases can be used to provide the library based on the consensus sequence.
  • Other mixtures can also be used, e.g., 75% the consensus sequence and 25% a mixture of the other 3 bases, 80% the consensus sequence and 20% a mixture of the other 3 bases, 95% the consensus sequence and 5% a mixture of the other 3 bases, etc.
  • mutant tRNA's can be generated using various mutagenesis techniques known in the art.
  • the mutant tRNA's can be generated by site- specific mutations, random point mutations, homologous recombination, DNA shuffling or other recursive mutagenesis methods, chimeric construction or any combination thereof.
  • Additional mutations can be introduced at a specific position(s), e.g., at a nonconservative position(s), or at a conservative position(s), at a randomized position(s), or a combination thereof in a desired loop or region of a tRNA, e.g., an anticodon loop, the acceptor stem, D arm or loop, variable loop, T ⁇ C arm or loop, other regions of the tRNA molecule, or a combination thereof. Mutations may include matched base pairs in the stem region.
  • an O-tRNA is obtained by subjecting to negative selection a population of cells of a first species, where the cells comprise a member of the plurality of potential O-tRNA's.
  • the negative selection eliminates cells that comprise a member of the plurality of potential O-tRNA's that is aminoacylated by an aminoacyl-tRNA synthetase (RS) that is endogenous to the cells.
  • RS aminoacyl-tRNA synthetase
  • a selector codon(s) is introduced into polynucleotide that encodes a negative selection marker, e.g., an enzyme that confers antibiotic resistance, e.g., ⁇ -lactamase, an enzyme that confers a detectable product,
  • Screening/selection can be done by growing the population of cells in the presence of a selection agent (e.g., an antibiotic, such as ampicillin). In one embodiment, the concentration of the selection agent is varied.
  • a selection agent e.g., an antibiotic, such as ampicillin.
  • a selection system is used that is based on the in vivo suppression of selector codon, e.g., nonsense or frameshift mutations introduced into a polynucleotide that encodes a negative selection marker, e.g., a gene for ⁇ -lactamase ⁇ bid).
  • selector codon e.g., nonsense or frameshift mutations introduced into a polynucleotide that encodes a negative selection marker, e.g., a gene for ⁇ -lactamase ⁇ bid.
  • polynucleotide variants e.g., bla variants, with, e.g., TAG, AGGA, and TGA, at position a certain position, are constructed.
  • Cells, e.g., bacteria, are transformed with these polynucleotides, hi the case of an orthogonal tRNA, which cannot be efficiently charged by endogenous E. coli synthetases, antibiotic resistance, e.g., ampicillin resistance, should be about or less than that for a bacteria transformed with no plasmid. If the tRN A is not orthogonal, or if a heterologous synthetase capable of charging the tRNA is co-expressed in the system, a higher level of antibiotic, e.g., ampicillin, resistance is be observed. Cells, e.g., bacteria, are chosen that are unable to grow on LB agar plates with antibiotic concentrations about equal to cells transformed with no plasmids.
  • a toxic product e.g., ribonuclease barnase
  • a member of the plurality of potential tRNA's is aminoacylated by endogenous host, e.g., Escherichia coli synthetases (i.e., it is not orthogonal to the host, e.g., Escherichia coli synthetases)
  • the selector codon is suppressed and the toxic polynucleotide product produced leads to cell death.
  • Cells harboring orthogonal tRNA or non-functional tRNA's survive.
  • the pool of tRNA's that are orthogonal to a desired organism are then subjected to a positive selection in which a selector codon is placed in a positive selection marker, e.g., encoded by a drug resistance gene, such a ⁇ -lactamase gene.
  • a positive selection marker e.g., encoded by a drug resistance gene, such a ⁇ -lactamase gene.
  • the positive selection is performed on cell comprising a polynucleotide encoding or comprising a member of the pool of tRNA's, a polynucleotide encoding a positive selection marker, and a polynucleotide encoding cognate RS.
  • a selection agent e.g., ampicillin.
  • tRNA's are then selected for their ability to be aminoacylated by the coexpressed cognate synthetase and to insert an amino acid in response to this selector codon.
  • these cells show an enhancement in suppression efficiency compared to cells harboring non-functional tRNA's, or tRNA's that cannot efficiently be recognized by the synthetase of interest.
  • tRNA's that are not efficiently recognized by the synthetase of interest are sensitive to the antibiotic. Therefore, tRNA's that: (i) are not substrates for endogenous host, e.g., Escherichia coli, synthetases; (ii) can be aminoacylated by the synthetase of interest; and (iii) are functional in translation survive both selections.
  • the stringency of the selection e.g., the positive selection, the negative selection or both the positive and negative selection, in the above described-methods, optionally may be varied.
  • the stringency of the negative selection can be controlled by introducing different numbers of selector codons into the barnase gene and/or by using an inducible promoter.
  • the concentration of the selection or screening agent is varied (e.g., ampicillin).
  • the stringency is varied because the desired activity can be low during early rounds. Thus, less stringent selection criteria are applied in early rounds and more stringent criteria are applied in later rounds of selection.
  • the negative selection, the positive selection, or both the negative and positive selection can be repeated multiple times. Multiple different negative selection markers, positive selection markers or both negative and positive selection markers can be used. In certain embodiments, the positive and negative selection marker can be the same.
  • the negative selection marker, the positive selection marker or both the positive and negative selection markers can include a marker that fluoresces or catalyzes a luminescent reaction in the presence of a suitable reactant.
  • a product of the marker is detected by fluorescence-activated cell sorting (FACS) or by luminescence.
  • FACS fluorescence-activated cell sorting
  • the marker includes an affinity based screening marker. See, Francisco, J. A., et al., (1993) Production and fluorescence-activated cell sorting of Escherichia coli expressing afunctional antibody fragment on the external surface. Proc Natl Acad Sci U S A. 90:10444- 8.
  • a tRNA may be aminoacylated with a desired amino acid by any method or technique, including but not limited to, chemical or enzymatic aminoacylation.
  • Aminoacylation may be accomplished by aminoacyl tRNA synthetases or by other enzymatic molecules, including but not limited to, ribozymes.
  • ribozyme is interchangeable with "catalytic RNA.”
  • Cech and coworkers Cech, 1987, Science, 236:1532- 1539; McCorkle et al., 1987, Concepts Biochem. 64:221-226
  • Cech and coworkers demonstrated the presence of naturally occurring RNAs that can act as catalysts (ribozymes).
  • these natural RNA catalysts have only been shown to act on ribonucleic acid substrates for cleavage and splicing, the recent development of artificial evolution of ribozymes has expanded the repertoire of catalysis to various chemical reactions.
  • RNA molecules that can catalyze aminoacyl-RNA bonds on their own (2 ')3 '-termini (Illangakekare et al., 1995 Science 267:643-647), and an RNA molecule which can transfer an amino acid from one RNA molecule to another (Lohse et al., 1996, Nature 381:442-444).
  • U.S. Patent Application Publication 2003/0228593 which is incorporated by reference herein, describes methods to construct ribozymes and their use in aminoacylation of tRNAs with naturally encoded and non-naturally encoded amino acids.
  • Substrate- immobilized forms of enzymatic molecules that can aminoacylate tRNAs may enable efficient affinity purification of the aminoacylated products.
  • suitable substrates include agarose, sepharose, and magnetic beads.
  • the production and use of a substrate-immobilized form of ribozyme for aminoacylation is described in Chemistry and Biology 2003, 10:1077-1084 and U.S. Patent Application Publication 2003/0228593, which is incorporated by reference herein.
  • Chemical aminoacylation methods include, but are not limited to, those introduced by Hecht and coworkers (Hecht, S. M. Ace. Chem. Res. 1992, 25, 545; Heckler, T. G.; Roesser, J. R.; Xu, C; Chang, P.; Hecht, S. M. Biochemistry 1988, 27, 7254; Hecht, S. M.; Alford, B. L.; Kuroda, Y.; Kitano, S. J. Biol. Chem. 1978, 253, 4517) and by Schultz, Chaniberlin, Dougherty and others (Cornish, V. W.; Mendel, D.; Schultz, P. G. Angew. Chem. Int. Ed. Engl.
  • Methods for generating catalytic RNA may involve generating separate pools of randomized ribozyme sequences, performing directed evolution on the pools, screening the pools for desirable aminoacylation activity, and selecting sequences of those ribozymes exhibiting desired aminoacylation activity.
  • Ribozymes can comprise motifs and/or regions that facilitate acylation activity, such as a GGU motif and a U-rich region.
  • a GGU motif can facilitate recognition of an amino acid substrate
  • a GGU-motif can form base pairs with the 3' termini of a tRNA.
  • the GGU and motif and U-rich region facilitate simultaneous recognition of both the amino acid and tRNA simultaneously, and thereby facilitate aminoacylation of the 3' terminus of the tRNA.
  • Ribozymes can be generated by in vitro selection using a partially randomized r24mini conjugated with tRNA Asn C cc G3 followed by systematic engineering of a consensus sequence found in the active clones.
  • An exemplary ribozyme obtained by this method is termed "Fx3 ribozyme" and is described in U.S. Pub. App. No. 2003/0228593, the contents of which is incorporated by reference herein, acts as a versatile catalyst for the synthesis of various aminoacyl-tRNAs charged with cognate non-natural amino acids.
  • Immobilization on a substrate may be used to enable efficient affinity purification of the aminoacylated tRNAs.
  • suitable substrates include, but are not limited to, agarose, sepharose, and magnetic beads.
  • Ribozymes can be immobilized on resins by taking advantage of the chemical structure of RNA, such as the 3'-cis-diol on the ribose of RNA can be oxidized with periodate to yield the corresponding dialdehyde to facilitate immobilization
  • RNA on the resin Various types of resins can be used including inexpensive hydrazide resins wherein reductive animation makes the interaction between the resin and the ribozyme an irreversible linkage. Synthesis of aminoacyl-tRNAs can be significantly facilitated by this on-column aminoacylation technique. Kourouklis et al. Methods 2005; 36:239-4 describe a column-based aminoacylation system.
  • One suitable method is to elute the aminoacylated tRNAs from a column with a buffer such as a sodium acetate solution with 10 niM EDTA, a buffer containing 50 mM N-(2- hydroxyethyl)pi ⁇ erazine-N'-(3- ⁇ ropanesulfonic acid), 12.5 mM KCl, pH 7.0, 10 mM EDTA, or simply an EDTA buffered water (pH 7.0).
  • a buffer such as a sodium acetate solution with 10 niM EDTA, a buffer containing 50 mM N-(2- hydroxyethyl)pi ⁇ erazine-N'-(3- ⁇ ropanesulfonic acid), 12.5 mM KCl, pH 7.0, 10 mM EDTA, or simply an EDTA buffered water (pH 7.0).
  • the aminoacylated tRNAs can be added to translation reactions in order to incorporate the amino acid with which the tRNA was aminoacylated in a position of choice in a polypeptide made by the translation reaction.
  • Examples of translation systems in which the aminoacylated tRNAs may be used include, but are not limited to cell lysates. Cell lysates provide reaction components necessary for in vitro translation of a polypeptide from an input mRNA. Examples of such reaction components include but are not limited to ribosomal proteins, rRNA, amino acids, tRNAs, GTP, ATP, translation initiation and elongation factors and additional factors associated with translation.
  • translation systems may be batch translations or compartmentalized translation. Batch translation systems combine reaction components in a single compartment while compartmentalized translation systems separate the translation reaction components from reaction products that can inhibit the translation efficiency. Such translation systems are available commercially.
  • Coupled transcription/translation systems allow for both transcription of an input DNA into a corresponding mRNA, which is in turn translated by the reaction components.
  • An example of a commercially available coupled transcription/translation is the Rapid Translation System (RTS, Roche Inc.).
  • the system includes a mixture containing E. coli lysate for providing translational components such as ribosomes and translation factors.
  • an RNA polymerase is included for the transcription of the input DNA into an mRNA template for use in translation.
  • RTS can use compartmentalization of the reaction components by way of a membrane interposed between reaction compartments, including a supply/waste compartment and a transcription/translation compartment.
  • Aminoacylation of tRNA may be performed by other agents, including but not limited to, transferases, polymerases, catalytic antibodies, multi-functional proteins, and the like.
  • An O-RS of the present invention preferentially aminoacylates an O-tRNA with a selected amino acid in vitro or in vivo.
  • An O-RS of the present invention can be provided to the translation system (e.g., in vitro translation components, or a cell) by a polypeptide that includes an O-RS and/or by a polynucleotide that encodes an O-RS or a portion thereof.
  • an O-RS, or a portion thereof is encoded by a polynucleotide sequence as set forth in SEQ ID NO.: 4 or a complementary polynucleotide sequence thereof, or a conservative variation thereof.
  • An O-RS of the present invention may aminoacylate a number of different O-tRNA molecules, including but not limited to, those disclosed herein.
  • O-RS orthogonal aminoacyl-tRNA synthetase
  • a method includes subjecting to positive selection a population of cells of a first species, where the cells each comprise: 1) a member of a plurality of aminoacyl-tRNA synthetases (RSs), where the plurality of RSs comprise mutant RSs, RSs derived from a species other than the first species or both mutant RSs and RSs derived from a species other than the first species; 2) the orthogonal tRNA (O-tRNA) from a second species; and 3) a polynucleotide that encodes a positive selection marker and comprises at least one selector codon.
  • Cells are selected or screened for those that show an enhancement in suppression efficiency compared to cells lacking or with a reduced amount of the member of the plurality of RSs.
  • Cells having an enhancement in suppression efficiency comprise an active RS that aminoacylates the O-tRNA.
  • a level of aminoacylation (in vitro or in vivo) by the active RS of a first set of tRNA's from the first species is compared to the level of aminoacylation (in vitro or in vivo) by the active RS of a second set of tRNA's from the second species.
  • the level of aminoacylation can be determined by a detectable substance (e.g., a labeled amino acid or unnatural amino acid).
  • the active RS that more efficiently aminoacylates the second set of tRNA's compared to the first set of tRNA's is selected, thereby providing the orthogonal aminoacyl-tRNA synthetase for use with the O-tRNA.
  • An O-RS, e.g., an O-RS, identified by the method is also a feature of the present invention.
  • any of a number of assays can be used to determine aminoacylation. These assays can be performed in vitro or in vivo. For example, in vitro aminoacylation assays are described in, e.g., Hoben, P., and Soil, D. (1985) Methods Enzvmol. 113:55-59 and in U.S. Patent Application Publication No. 2003/0228593. Aminoacylation can also be determined by using a reporter along with orthogonal translation components and detecting the reporter in a cell expressing a polynucleotide comprising at least one selector codon that encodes a protein. See also, U.S. patent application 10/126,927, entitled “IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS;" and, USSN 10/825,867 entitled “EXPANDING THE EUKARYOTIC GENETIC CODE.”
  • An identified O-RS can be further manipulated to alter the substrate specificity of the synthetase so that only a desired unnatural amino acid, but not any of the common 20 amino acids, are charged to the O-tRNA.
  • Methods to generate an orthogonal aminoacyl tRNA synthetases with a substrate specificity for an unnatural amino acid include mutating the synthetase, e.g., at the active site in the synthetase, at the editing mechanism site in the synthetase, at different sites by combining different domains of synthetases, or the like, and applying a selection process.
  • a strategy is used that is based on the combination of a positive selection followed by a negative selection.
  • suppression of the selector codon introduced at a non-essential position(s) of a positive marker allows cells to survive under positive selection pressure, hi the presence of both natural and unnatural amino acids, survivors thus encode active synthetases charging the orthogonal suppressor tRNA with either a natural or unnatural amino acid.
  • suppression of a selector codon introduced at a non-essential position(s) of a negative marker removes synthetases with natural amino acid specificities. Survivors of the negative and positive selection encode synthetases that aminoacylate (charge) the orthogonal suppressor tRNA with unnatural amino acids only. These synthetases can then be subjected to further mutagenesis, e.g., DNA shuffling or other recursive mutagenesis methods.
  • the library of mutant O-RSs can be generated using various mutagenesis techniques known in the art.
  • the mutant RSs can be generated by site-specific mutations, random point mutations, homologous recombination, DNA shuffling or other recursive mutagenesis methods, chimeric construction or any combination thereof.
  • a library of mutant RSs can be produced from two or more other, e.g., smaller, less diverse "sub-libraries.” Chimeric libraries of RSs are also included in the invention. It
  • libraries of tRNA synthetases from, various organisms e.g., microorganisms such as eubacteria or archaebacteria
  • libraries that comprise natural diversity see, e.g., U.S. Patent No. 6,238,884 to Short et al; U.S. Patent No. 5,756,316 to Schallenberger et al; U.S. Patent No. 5,783,431 to Petersen et al; U.S. Patent No. 5,824,485 to Thompson et al; U.S. Patent No. 5,958,672 to Short et al
  • synthetases are subject to the positive and negative selection/screening strategy, these synthetases can then be subjected to further mutagenesis.
  • a nucleic acid that encodes the O-RS can be isolated; a set of polynucleotides that encode mutated O-RSs (e.g., by random mutagenesis, site-specific mutagenesis, recombination or any combination thereof) can be generated from the nucleic acid; and, these individual steps or a combination of these steps can be repeated until a mutated O-RS is obtained that preferentially aminoacylates the O-tRNA with the unnatural amino acid.
  • the steps are performed multiple times, e.g., at least two times.
  • Additional levels of selection/screening stringency can also be used in the methods of the present invention, for producing O-tRNA, O-RS, or pairs thereof.
  • the selection or screening stringency can be varied on one or both steps of the method to produce an O-RS. This could include, e.g., varying the amount of selection/screening agent that is used, etc. Additional rounds of positive and/or negative selections can also be performed.
  • Selecting or screening can also comprise one or more positive or negative selection or screening that includes, e.g., a change in amino acid permeability, a change in translation efficiency, a change in translational fidelity, etc.
  • the one or more change is based upon a mutation in one or more gene in an organism in which an orthogonal tRNA-tRNA synthetase pair is used to produce protein.
  • the positive selection marker can be any of a variety of molecules including, but not limited to, a product that provides a nutritional supplement for growth and the selection is performed on a medium that lacks the nutritional supplement.
  • polynucleotides that encode positive selection markers include, but are not limited to, e.g., a reporter gene based on complementing the amino acid auxotrophy of a cell, a his3 gene (e.g., where the his3 gene encodes an imidazole glycerol phosphate dehydratase, detected by providing 3-aminotriazole (3-AT)), ura3 gene, Ieu2 gene, Iys2 gene, lacZ gene,
  • lacZ production is detected by ortho-nitrophenyl- ⁇ -D-galactopyranoside (ONPG) hydrolysis.
  • ONPG ortho-nitrophenyl- ⁇ -D-galactopyranoside
  • Additional positive selection markers include, e.g., luciferase, green fluorescent protein (GFP), YFP, EGFP, RFP, the product of an antibiotic resistant gene (e.g., chloramphenicol acetyltransferase (CAT)), a transcriptional modulator protein (e.g., GAL4), etc.
  • a polynucleotide that encodes a positive selection marker comprises a selector codon.
  • a polynucleotide that encodes the positive selection marker can be operably linked to a response element.
  • An additional polynucleotide that encodes a transcriptional modulator protein that modulates transcription from the response element, and comprises at least one selector codon can also be present.
  • the incorporation of the unnatural amino acid into the transcriptional modulator protein by the O-tRNA aminoacylated with the unnatural amino acid results in transcription of the polynucleotide (e.g., reporter gene) encoding the positive selection marker.
  • the selector codon is located in or substantially near a portion of the polynucleotide that encodes a DNA binding domain of the transcriptional modulator protein.
  • a polynucleotide that encodes the negative selection marker can also be operably linked to a response element from which transcription is mediated by the transcriptional modulator protein. See, e.g., A. J. DeMaggio, et al., (2000), The yeast split-hybrid system, Method Enzymol. 328:128-137; H. M. Shih, et al., (1996), A positive genetic selection for disrupting protein-protein interactions: identification of CREB mutations that prevent association with the coactivator CBP, Proc. Natl. Acad. Sci. U. S. A. 93:13896-13901; M.
  • the positive selection marker and/or negative selection marker of the invention can comprise at least two selector codons, which each or both can comprise at least two different selector codons or at least two of the same selector codons.
  • the transcriptional modulator protein is a molecule that binds (directly or indirectly) to a nucleic acid sequence (e.g., a response element) and modulates transcription of a sequence that is operably linked to the response element.
  • a transcriptional modulator protein can be a transcriptional activator protein (e.g., GAL4, nuclear hormone receptors, API, CREB, LEF/tcf family members, SMADs, VP 16, SPl, etc.), a transcriptional repressor protein (e.g., nuclear hormone receptors, Groucho/tle family, Engrailed family, etc), or a protein that can have both activities depending on the environment (e.g., LEF/tcf, homobox proteins, etc.).
  • a response element is typically a nucleic acid sequence that is recognized by the transcriptional modulator protein or an additional agent that acts in concert with the transcriptional modulator protein.
  • GAL4 transcriptional activator protein
  • the DBD is linked, by an intervening protein sequence, to a C-terminal 113 amino acid activation domain (AD) that can activate transcription when bound to DNA.
  • AD amino acid activation domain
  • amber suppression by the 0-tRNA/O-RS pair can be linked to
  • GAL4 activated reporter genes can be used to perform both positive and negative selections with the gene.
  • the medium used for negative selection can comprise a selecting or screening agent that is converted to a detectable substance by the negative selection marker.
  • the detectable substance is a toxic substance.
  • a polynucleotide that encodes a negative selection marker can be, e.g., an ura3 gene.
  • the URA3 reporter can be placed under control of a promoter that contains GAL4 DNA binding sites.
  • the negative selection is accomplished on a medium that comprises 5-flubroorotic acid (5-FOA), which is converted into a detectable substance (e.g., a toxic substance which kills the cell) by the gene product of the ura3 gene.
  • a detectable substance e.g., a toxic substance which kills the cell
  • the negative selection marker can also be any of a variety of molecules.
  • the positive selection marker and/or the negative selection marker may be a polypeptide that fluoresces or catalyzes a luminescent reaction in the presence of a suitable reactant.
  • negative selection markers include, but are not limited to, e.g., luciferase, green fluorescent protein (GFP), YFP, EGFP, RFP, the product of an antibiotic resistant gene (e.g., chloramphenicol acetyltransferase (CAT)), the product of a lacZ gene, transcriptional modulator protein, etc.
  • the positive selection marker and/or the negative selection marker may be detected by fluorescence-activated cell sorting (FACS) or by luminescence.
  • the positive selection marker and/or negative selection marker may comprise an affinity based screening marker.
  • the same polynucleotide can encode both the positive selection marker and the negative selection marker.
  • the positive selection step, the negative selection step or both the positive and negative selection steps and can include using a reporter, wherein the reporter is detected by fluorescence-activated cell sorting (FACS).
  • FACS fluorescence-activated cell sorting
  • a positive selection can be done first with a positive selection
  • CAT chloramphenicol acetyltransferase
  • the CAT gene comprises a selector codon, e.g., an amber stop codon, in the CAT gene, which followed by a negative selection screen, that is based on the inability to suppress a selector codon(s), e.g., two or more, at positions within a negative marker, e.g., T7 RNA polymerase gene.
  • the positive selection marker and the negative selection marker can be found on the same vector, e.g., plasmid. Expression of the negative marker drives expression of the reporter, e.g., green fluorescent protein (GFP).
  • GFP green fluorescent protein
  • the stringency of the selection and screen can be varied, e.g., the intensity of the light need to fluorescence the reporter can be varied.
  • a positive selection can be done with a reporter as a positive selection marker, which is screened by FACS, followed by a negative selection screen, that is based on the inability to suppress a selector codon(s), e.g., two or more, at positions within a negative marker, e.g., barnase gene.
  • the reporter is displayed on a cell surface, e.g., on a phage display or the like.
  • Cell-surface display e.g., the OmpA-based cell-surface display system, relies on the expression of a particular epitope, e.g., a poliovirus C3 peptide fused to an outer membrane porin OmpA, on the surface of the Escherichia coli cell.
  • the epitope is displayed on the cell surface only when a selector codon in the protein message is suppressed during translation.
  • the displayed peptide then contains the amino acid recognized by one of the mutant aminoacyl-tRNA synthetases in the library, and the cell containing the corresponding synthetase gene can be isolated with antibodies raised against peptides containing specific unnatural amino acids.
  • the OmpA-based cell-surface display system was developed and optimized by Georgiou et al. as an alternative to phage display. See, Francisco, J. A., Campbell, R., Iverson, B. L. & Georgoiu, G. Production and fluorescence-activated cell sorting of Escherichia coli expressing a functional antibody fragment on the external surface. Proc. Natl. Acad. Sci. U S A 90:10444-8 (1993).
  • inventions include carrying one or more of the selection steps in vitro.
  • the selected component e.g., synthetase and/or tRNA
  • the translational components of the present invention are typically derived from non-eukaryotic organisms.
  • the orthogonal O-tKNA can be derived from a non- eukaryotic organism, e.g., an archaebacterium, such as Methanococcus jannaschii, Methanobacterium thermoautotrophicum, Halobacterium such as Haloferax volcanii and Halobacterium species NRC-I, Archaeoglobus fulgidus, Pyrococcus furiosus, Pyrococcus horikoshii, Aeuropyrum pernix, or the like, or a eubacterium, such as Escherichia coli, Thermus thermophilics, Bacillus stearothermphilus, or the like, while the orthogonal O-RS can be derived from a non-eukaryotic organism, e.g., Methanobacterium thermoautotrophicum, Halobacterium such as Haloferax volcanii and Halo
  • the individual components of an 0-tRNA/O-RS pair can be derived from the same organism or different organisms.
  • the O-tRNA/O-RS pair is from the same organism.
  • the O-tRNA and the O-RS of the O-tRNA/O-RS pair are from different organisms.
  • the O-tRNA can be derived from, e.g., a Halobacterium sp NRC-I
  • the O-RS can be derived from, e.g., a Methanobacterium thermoautrophicum.
  • the O-tRNA, O-RS or O-tRNA/O-RS pair can be selected or screened in vivo or in vitro and/or used in a cell, e.g., a non-eukaryotic cells (such as E. coli cell), or a eukaryotic
  • a non-eukaryotic cell can be from a variety of sources, such as the Archaea phylogenetic domain, including but not limited to, Methanococcus jannaschii, Methanobacterium thermoautotrophicum, Halobacterium such as Haloferax volcanii and Halobacterium species NRC-I, Archaeoglobus fulgidus, Pyrococcus furiosus, Pyrococcus horikoshii, Aeuropyrum pernix, or the like, or can belong to the Eubacteria phylogenetic domain (including but not limited to, Escherichia coli, Thermus thermophilics, Bacillus stearothermophilus, Pseudomonas fluorescens, Pseudomonas aeruginosa, Pseudomonas putida, or the like.
  • the Archaea phylogenetic domain including but not limited to, Methanococcus jannaschii, Methano
  • a eukaryotic cell can be from a variety of sources, including but not limited to, a plant (e.g., complex plant such as monocots, or dicots), an algae, a protist, a fungus, a yeast (including but not limited to, Saccharomyces cerevisiae), an animal (including but not limited to, a mammal, an insect, an arthropod, etc.), or the like.
  • a plant e.g., complex plant such as monocots, or dicots
  • an algae e.g., complex plant such as monocots, or dicots
  • a protist e.g., a fungus
  • yeast including but not limited to, Saccharomyces cerevisiae
  • an animal including but not limited to, a mammal, an insect, an arthropod, etc.
  • Compositions of cells with translational components of the present invention are also a feature of the present invention. See also USSN 10/825,867 entitled
  • polypeptide of interest with a selected amino acid in a host cell
  • Suitable bacterial promoters are well known in the art and described, e.g., in Sambrook et al. and Ausubel et al.
  • Bacterial expression systems for expressing a polypeptide of interest are available in, including but not limited to, E. coli, Bacillus sp., Pseudomonas fluorescens, Pseudomonas aeruginosa, Pseudomonas putida, and Salmonella (Palva et al., Gene 22:229-235 (1983); Mosbach et al., Nature 302:543-545 (1983)). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
  • a tRNA and/or RS of the present invention and/or a polypeptide of interest may be utilized and/or expressed in any number of suitable expression systems including, for example, yeast, insect cells, mammalian cells, and bacteria.
  • suitable expression systems including, for example, yeast, insect cells, mammalian cells, and bacteria.
  • yeast includes any of the various yeasts capable of expressing a polypeptide of interest. Such yeasts include, but are not limited to, ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts and yeasts belonging to the Fungi imperfecti (Blastomycetes) group. The ascosporogenous yeasts are divided into two families, Spermophthoraceae and Saccharomycetaceae.
  • the latter is comprised of four subfamilies, Schizosaccharomycoideae (e.g., genus Schizosaccharomyces), Nadsonioideae, Lipomycoideae and Saccharomycoideae (e.g., genera Pichia, Kluyveromyces and Saccharomyces).
  • the basidiosporogenous yeasts include the genera Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium, and Filobasidiella.
  • Yeasts belonging to the Fungi Imperfecti ⁇ Blastomycetes) group are divided into two families, Sporobolomycetaceae (e.g., genera Sporobolomyces and Bullera) and Cryptococcaceae (e.g., genus Candida).
  • Sporobolomycetaceae e.g., genera Sporobolomyces and Bullera
  • Cryptococcaceae e.g., genus Candida
  • [104] Of particular interest for use with the present invention are species within the genera Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Hansenula, Torulopsis, and Candida, including, but not limited to, P. pastoris, P. guillerimondii, S. cerevisiae, S. carlsbergensis, S. diastaticus, S. douglasii, S. kluyveri, S, norbensis, S. oviformis, K. lactis, K. fragilis, C. albicans, C. maltosa, and H. polymorpha.
  • Yeast are generally available from a variety of sources including, but not limited to, the Yeast Genetic Stock Center, Department of Biophysics and Medical Physics, University of California (Berkeley, CA), and the American Type Culture Collection (“ATCC”) (Manassas, VA).
  • ATCC American Type Culture Collection
  • yeast host or “yeast host cell” includes yeast that can be, or has been, used as a recipient for recombinant vectors or other transfer DNA.
  • the term includes the progeny of the original yeast host cell that has received the recombinant vectors or other transfer DNA. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to accidental or deliberate mutation. Progeny of the parental cell that are sufficiently similar to the parent to be characterized by the relevant property, such as the presence of a nucleotide sequence encoding a polypeptide of interest, are included in the progeny intended by this definition.
  • Expression and transformation vectors including extrachromosomal replicons or integrating vectors, have been developed for transformation into many yeast hosts.
  • expression vectors have been developed for S. cerevisiae (Sikorski et al., GENETICS (1989) 122:19; Ito et al., J. BACTERIOL. (1983) 153:163; ⁇ innen et al., PROC. NATL. ACAD.
  • nidulans (Ballance et al., BlOCHEM. BlOPHYS. RES. COMMUN. (1983) 112:284-89; Tilburn et al., GENE (1983) 26:205-221; and Yelton et al., PROC. NATL. ACAD. SCI. USA (1984) 81:1470-74); A. niger (Kelly and Hynes, EMBO J. (1985) 4:475-479); T. reesia (EP 0 244 234); and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium (WO 91/00357), each incorporated by reference herein.
  • Control sequences for yeast vectors are known to those of ordinary skill in the art and include, but are not limited to, promoter regions from genes such as alcohol dehydrogenase (ADH) (EP 0 284 044); enolase; glucokinase; glucose-6-phosphate isomerase; glyceraldehyde-3-phosphate-dehydrogenase (GAP or GAPDH); hexokinase; phosphofructokinase; 3-phosphoglycerate mutase; and pyruvate kinase (PyK) (EP 0 329 203).
  • ADH alcohol dehydrogenase
  • GAP glyceraldehyde-3-phosphate-dehydrogenase
  • hexokinase phosphofructokinase
  • 3-phosphoglycerate mutase 3-phosphoglycerate mutase
  • pyruvate kinase PyK
  • the yeast PHO5 gene encoding acid phosphatase, also may provide useful promoter sequences (Miyanohara et al., PROC. NATL. ACAD. Sci. USA (1983) 80:1).
  • Other suitable promoter sequences for use with yeast hosts may include the promoters for 3- phosphoglycerate kinase (Hitzeman et al., J. BlOL. CHEM. (1980) 255:12073); and other glycolytic enzymes, such as pyruvate decarboxylase, triosephosphate isomerase, and phosphoglucose isomerase (Holland et al., BIOCHEMISTRY (1978) 17:4900; Hess et al., J.
  • yeast promoters having the additional advantage of transcription controlled by growth conditions may include the promoter regions for alcohol dehydrogenase 2; isocytochrome C; acid phosphatase; metallothionein; glyceraldehyde-3 -phosphate dehydrogenase; degradative enzymes associated with nitrogen metabolism; and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 0 073 657.
  • yeast enhancers also may be used with yeast promoters, hi addition, synthetic promoters may also function as yeast promoters. For example, the upstream activating
  • 35 sequences (UAS) of a yeast promoter may be joined with the transcription activation region of another yeast promoter, creating a synthetic hybrid promoter.
  • hybrid promoters include the ADH regulatory sequence linked to the GAP transcription activation region. See U.S. Patent Nos. 4,880,734 and 4,876,197, which are incorporated by reference herein.
  • Other examples of hybrid promoters include promoters that consist of the regulatory sequences of the ADH2, GAlA, GALlO, or PHO5 genes, combined with the transcriptional activation region of a glycolytic enzyme gene such as GAP or PyK. See EP 0 164 556.
  • a yeast promoter may include naturally occurring promoters of non-yeast origin that have the ability to bind yeast RNA polymerase and initiate transcription.
  • yeast expression vectors include terminators, for example, from GAPDH or the enolase genes (Holland et al., J. BlOL. CHEM. (1981) 256:1385).
  • origin of replication from the 2 ⁇ plasmid origin is suitable for yeast.
  • a suitable selection gene for use in yeast is the trpl gene present in the yeast plasmid. See Tschumper et al., GENE (1980) 10:157; Kingsman et al., GENE (1979) 7:141. The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan.
  • Leu2-deficient yeast strains (ATCC 20,622 or 38,626) are complemented by known plasmids bearing the Leu2 gene.
  • Methods of introducing exogenous DNA into yeast hosts are known to those of ordinary skill in the art, and typically include, but are not limited to, either the transformation of spheroplasts or of intact yeast host cells treated with alkali cations.
  • transformation of yeast can be carried out according to the method described in Hsiao et al., PROC. NATL. ACAD. SCI. USA (1979) 76:3829 and Van Solingen et al., J. BACT. (1977) 130:946.
  • other methods for introducing DNA into cells such as by nuclear injection, electroporation, or protoplast fusion may also be used as described generally in SAMBROOK ET AL., MOLECULAR CLONING: A LAB. MANUAL (2001).
  • Yeast host cells may then be cultured using standard techniques known to those of ordinary skill in the art.
  • the yeast host strains may be grown in fermentors during the amplification stage using standard feed batch fermentation methods known to those of ordinary skill in the art.
  • the fermentation methods may be adapted to account for differences in a particular yeast host's carbon utilization pathway or mode of expression control.
  • fermentation of a Saccharomyces yeast host may require a single glucose feed, complex nitrogen source (e.g., casein hydrolysates), and multiple vitamin supplementation.
  • the methylotrophic yeast P. pastoris may require glycerol, methanol, and trace mineral feeds, but only simple ammonium (nitrogen) salts for optimal growth and expression. See, e.g., U.S. Patent No. 5,324,639; Elliott et al., J. PROTEIN CHEM. (1990) 9:95; and Fieschko et al., BIOTECH. BIOENG. (1987) 29:1113, incorporated by reference herein.
  • Such fermentation methods may have certain common features independent of the yeast host strain employed.
  • a growth limiting nutrient typically carbon
  • fermentation methods generally employ a fermentation medium designed to contain adequate amounts of carbon, nitrogen, basal salts, phosphorus, and other minor nutrients (vitamins, trace minerals and salts, etc.). Examples of fermentation media suitable for use with Pichia are described in U.S. Patent Nos. 5,324,639 and 5,231,178, which are incorporated by reference herein.
  • insect host or “insect host cell” refers to a insect that can be, or has been, used as a recipient for recombinant vectors or other transfer DNA.
  • the term includes the progeny of the original insect host cell that has been transfected. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to accidental or deliberate mutation. Progeny of the parental cell that are sufficiently similar to the parent to be characterized by the relevant property, such as the presence of a nucleotide sequence encoding a polypeptide of interest, are included in the progeny intended by this definition.
  • suitable insect cells for expression of a polypeptide of interest is known to those of ordinary skill in the art.
  • Several insect species are well described in the art and are commercially available including Aedes aegypti, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni.
  • suitable hosts may include those shown to have, inter alia, good secretion capacity, low proteolytic activity, and overall robustness.
  • Insect are generally available from a variety of sources including, but not limited to, the Insect Genetic Stock Center, Department of Biophysics and Medical Physics, University of California (Berkeley, CA); and the American Type Culture Collection (“ATCC”) (Manassas, VA).
  • ATCC American Type Culture Collection
  • the components of a baculovirus-infected insect expression system include a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a convenient restriction site for insertion of the heterologous gene to be expressed; a wild type baculovirus with sequences homologous to the baculovirus-specific fragment in the transfer vector (this allows for the homologous recombination of the heterologous gene in to the baculovirus genome); and appropriate insect host cells and growth media.
  • the materials, methods and techniques used in constructing vectors, transfecting cells, picking plaques, growing cells in culture, and the like are known in the art and manuals are available describing these techniques.
  • the vector and the wild type viral genome are transfected into an insect host cell where the vector and viral genome recombine.
  • the packaged recombinant virus is expressed and recombinant plaques are identified and purified.
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, for example, Invitrogen Corp. (Carlsbad, CA). These techniques are generally known to those of ordinary skill in the art and fully described in SUMMERS AND SMITH, TEXAS AGRICULTURAL EXPERIMENT STATION BULLETIN NO. 1555 (1987), herein incorporated by reference.
  • Vectors that are useful in baculovirus/insect cell expression systems include, for example, insect expression and transfer vectors derived from the baculovirus Autographacalifornica nuclear polyhidrosis virus (AcNPV), which is a helper- independent, viral expression vector.
  • AdNPV baculovirus Autographacalifornica nuclear polyhidrosis virus
  • Viral expression vectors derived from this system usually use the strong viral polyhedrin gene promoter to drive expression of heterologous genes. See generally, O'Reilly ET AL., BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL (1992).
  • the above- described components comprising a promoter, leader (if desired), coding sequence of interest, and transcription termination sequence, are typically assembled into an intermediate transplacement construct (transfer vector).
  • Intermediate transplacement constructs are often maintained in a replicon, such as an extra chromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as bacteria.
  • the replicon will have a replication system, thus allowing it to be maintained in a suitable host for cloning and amplification.
  • the plasmid may contain the polyhedrin polyadenylation signal (Miller, ANN. REV. MICROBIOL. (1988) 42:177) and a prokaryotic ampicillin-resistance ⁇ amp) gene and origin of replication for selection and propagation in E. coli.
  • pAc373 One commonly used transfer vector for introducing foreign genes into AcNPV is pAc373. Many other vectors, known to those of skill in the art, have also been designed including, for example, pVL985, which alters the polyhedrin start codon from ATG to ATT, and which introduces a BamHI cloning site 32 base pairs downstream from the ATT. See Luckow and Summers, VIROLOGY 170:31 (1989). Other commercially available vectors
  • the transfer vector and wild type baculoviral genome are co-transfected into an insect cell host.
  • Methods for introducing heterologous DNA into the desired site in the baculovirus virus are known in the art. See SUMMERS AND SMITH, TEXAS AGRICULTURAL EXPERIMENT STATION BULLETIN NO. 1555 (1987); Smith et al., M ⁇ L. CELL. BlOL. (1983) 3:2156; Luckow and Summers, VIROLOGY (1989) 170:31.
  • the insertion can be into a gene such as the polyhedrin gene, by homologous double crossover recombination; insertion can also be into a restriction enzyme site engineered into the desired baculovirus gene. See Miller et al., BlOESSA YS (1989) 11(4):91.
  • Transfection may be accomplished by electroporation. See TROTTER AND WOOD,
  • liposomes may be used to transfect the insect cells with the recombinant expression vector and the baculovirus. See, e.g., Liebman et al., BiOTECHNiQUES (1999) 26(1):36; Graves et al., BIOCHEMISTRY (1998) 37:6050; Nomura et al., J. BIOL. CHEM.
  • liposomes include, for example, Cellfectin® and Lipofectin® (Invitrogen, Corp., Carlsbad, CA).
  • Baculovirus expression vectors usually contain a baculovirus promoter.
  • a baculovirus promoter is any DNA sequence capable of binding a baculovirus RNA polymerase and initiating the downstream (3') transcription of a coding sequence (e.g., structural gene) into mRNA.
  • a promoter will have a transcription initiation region which is
  • This transcription initiation region typically includes an RNA polymerase binding site and a transcription initiation site.
  • a baculovirus promoter may also have a second domain called an enhancer, which, if present, is usually distal to the structural gene. Moreover, expression may be either regulated or constitutive.
  • Structural genes abundantly transcribed at late times in the infection cycle, provide particularly useful promoter sequences. Examples include sequences derived from the gene encoding the viral polyhedron protein (FRIESEN EX AL., The Regulation of Baculovirus Gene Expression in THE MOLECULAR BIOLOGY OF BACULOVIRUSES (1986); EP 0 127 839 and 0 155 476) and the gene encoding the plO protein (Vlak et al., J. GEN. VlROL.
  • the newly formed baculovirus expression vector is packaged into an infectious recombinant baculovirus and subsequently grown plaques may be purified by techniques known to those of ordinary skill in the art. See Miller et al., BlOESSAYS (1989) 11(4):91; SUMMERS AND SMITH, TEXAS AGRICULTURAL EXPERIMENT STATION BULLETIN NO. 1555 (1987).
  • Recombinant baculovirus expression vectors have been developed for infection into several insect cells.
  • recombinant baculoviruses have been developed for, inter alia, Aedes aegypti (ATCC No. CCL-125), Bombyx mori (ATCC No. CRL-8910), Drosophila melanogaster (ATCC No. 1963), Spodoptera frugiperda, and Trichoplusia ni.
  • Aedes aegypti ATCC No. CCL-125
  • Bombyx mori ATCC No. CRL-8910
  • Drosophila melanogaster ATCC No. 1963
  • Spodoptera frugiperda Spodoptera frugiperda
  • Trichoplusia ni See Wright, NATURE (1986) 321:718; Carbonell et al., J. ViROL. (1985) 56:153; Smith et al., MOL. CELL. BIOL. (1983) 3
  • the cell lines used for baculovirus expression vector systems commonly include, but are not limited to, Sf9 ⁇ Spodoptera frugiperda) (ATCC No. CRL-1711), Sf21 ⁇ Spodoptera frugiperda) (Invitrogen Corp., Cat. No. 11497-013 (Carlsbad, CA)), Tri-368 ⁇ Trichopulsia ni), and High-FiveTM BTI-TN-5B1-4 ⁇ Trichopulsia ni).
  • the vectors may be single copy or low or high multicopy vectors. Vectors may serve for cloning and/or expression. In view of the ample literature concerning vectors, commercial availability of many vectors, and even manuals describing vectors and their restriction maps and characteristics, no extensive discussion is required here. As is well-known, the vectors normally involve markers allowing for selection, which markers may provide for cytotoxic agent resistance, prototrophy or immunity. Frequently, a plurality of markers is present, which provide for different characteristics.
  • a bacterial promoter is any DNA sequence capable of binding bacterial RNA polymerase and initiating the downstream (3') transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region typically includes an RNA polymerase binding site and a transcription initiation site.
  • a bacterial promoter may also have a second domain called an operator that may overlap an adjacent RNA polymerase binding site at which RNA synthesis begins. The operator permits negative regulated (inducible) transcription, as a gene repressor protein may bind the operator and thereby inhibit transcription of a specific gene.
  • Constitutive expression may occur in the absence of negative regulatory elements, such as the operator.
  • positive regulation may be achieved by a gene activator protein binding sequence, which, if present is usually proximal (5') to the RNA polymerase binding sequence.
  • An example of a gene activator protein is the catabolite activator protein (CAP), which helps initiate transcription of the lac operon in Escherichia coli (E. coli) [Raibaud et al, ANNU. REV. GENET. (1984) 18:173].
  • Regulated expression may therefore be either positive or negative, thereby either enhancing or reducing transcription.
  • Sequences encoding metabolic pathway enzymes provide particularly useful promoter sequences. Examples include promoter sequences derived from sugar metabolizing enzymes, such as galactose, lactose (lac) [Chang et al., NATURE (1977) 198:1056], and maltose. Additional examples include promoter sequences derived from biosynthetic enzymes such as tryptophan (trp) [Goeddel et al., Nuc. ACIDS RES. (1980) 8:4057; Yelverton et al., NUCL. ACIDS RES. (1981) 9:731; U.S. Pat. No. 4,738,921; EP Pub. Nos.
  • promoter systems also provide useful promoter sequences. Strong promoters, such as the T7 promoter may be used to induce the polypeptide of interest at high levels. Examples of such vectors are known to those of ordinary skill in the art and include the pET29 series from Novagen, and the pPOP vectors described in WO99/05297, which is incorporated by reference herein. Such expression systems produce high levels of polypeptide in the host without compromising host cell viability or growth parameters. pET19 (Novagen) is another vector known in the art.
  • synthetic promoters which do not occur in nature also function as bacterial promoters.
  • transcription activation sequences of one bacterial or bacteriophage promoter may be joined with the operon sequences of another bacterial or bacteriophage promoter, creating a synthetic hybrid promoter [U.S. Pat. No. 4,551,433, which is incorporated by reference herein].
  • the tac promoter is a hybrid trp-lac promoter comprised of both trp promoter and lac operon sequences that is regulated by the lac repressor [Amann et al., GENE (1983) 25:167; de Boer et al., PROC. NATL. ACAD. SCI. (1983) 80:21].
  • a bacterial promoter can include naturally occurring promoters of non-bacterial origin that have the ability to bind bacterial RNA polymerase and initiate transcription.
  • a naturally occurring promoter of non-bacterial origin can also be coupled with a compatible RNA polymerase to produce high levels of expression of some genes in prokaryotes.
  • the bacteriophage T7 RNA polymerase/promoter system is an example of a coupled promoter system [Studier et al., J. M ⁇ L. BlOL. (1986) 189:113; Tabor et al., Proc Natl. Acad. Sci. (1985) 82:1074].
  • a hybrid promoter can also be comprised of a bacteriophage promoter and an E. coli operator region (EP Pub. No. 267 851).
  • an efficient ribosome binding site is also useful for the expression of foreign genes in prokaryotes.
  • the ribosome binding site is called the Shine-Dalgarno (SD) sequence and includes an initiation codon (ATG) and a sequence 3-9 nucleotides in length located 3-11 nucleotides upstream of the initiation codon [Shine et al., NATURE (1975) 254:34].
  • SD sequence is thought to promote binding of mRNA to the ribosome by the pairing of bases between the SD sequence and the 3' and of E. coli 16S rRNA [Steitz et al. "Genetic signals and nucleotide sequences in messenger RNA", hi -Biological Regulation and Development: Gene Expression (Ed. R. F. Goldberger, 1979)].
  • bacterial host or "bacterial host cell” refers to a bacterial that can be, or has been, used as a recipient for recombinant vectors or other transfer DNA.
  • the term includes the progeny of the original bacterial host cell that has been transfected. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to accidental or deliberate mutation. Progeny of the parental cell that are sufficiently similar to the parent to be characterized by the relevant property, such as the presence of a nucleotide sequence encoding a polypeptide of interest, are included in the progeny intended by this definition.
  • suitable host bacteria for expression of polypeptides is known to those of ordinary skill in the art.
  • suitable hosts may include those shown to have, inter alia, good inclusion body formation capacity, low proteolytic activity, and overall robustness.
  • Bacterial hosts are generally available from a variety of sources including, but not limited to, the Bacterial Genetic Stock Center, Department of Biophysics and Medical Physics, University of California (Berkeley, CA); and the American Type Culture Collection ("ATCC”) (Manassas, VA).
  • Industrial/pharmaceutical fermentation generally use bacterial derived from K strains (e.g. W3110) or from bacteria derived from B strains (e.g. BL21).
  • E. coli hosts include, but are not limited to, strains of BL21, DHlOB, or derivatives thereof, hi another embodiment of the methods of the present invention, the E. coli host is a protease minus strain including, but not limited to, OMP- and LON-.
  • the host cell strain may be a species of Pseudomonas, including but not limited to, Pseudomonas fluorescens, Pseudomonas aeruginosa, and Pseudomonas putida.
  • Pseudomonas fluorescens biovar 1 designated strain MBlOl
  • strain MBlOl is known to be useful for recombinant production and is available for therapeutic protein production processes.
  • Examples of a Pseudomonas expression system include the system available from The Dow Chemical Company as a host strain (Midland, MI available on the World Wide Web at dow.com).
  • the recombinant host cell strain is cultured under conditions appropriate for production of the polypeptide of interest.
  • the method of culture of the recombinant host cell strain will be dependent on the nature of the expression construct utilized and the identity of the host cell. Recombinant host strains are normally cultured using methods that are well known to the art.
  • Recombinant host cells are typically cultured in liquid medium containing assimilatable sources of carbon, nitrogen, and inorganic salts and, optionally, containing vitamins, amino acids, growth factors, and other proteinaceous culture supplements known to those of ordinary skill in the art.
  • Liquid media for culture of host cells may optionally contain antibiotics or anti-fungals to prevent the growth of undesirable microorganisms and/or compounds including, but not limited to, antibiotics to select for host cells containing the expression vector.
  • Recombinant host cells may be cultured in batch or continuous formats, with either cell harvesting (in the case where the polypeptide of interest accumulates intracellularly) or harvesting of culture supernatant in either batch or continuous formats.
  • cell harvesting in the case where the polypeptide of interest accumulates intracellularly
  • harvesting of culture supernatant in either batch or continuous formats.
  • batch culture and cell harvest are preferred.
  • Selector codons of the present invention expand the genetic codon framework of protein biosynthetic machinery.
  • a selector codon includes, e.g., a unique three base codon, a nonsense codon, such as a stop codon, including but not limited to, an amber codon (UAG), an ochre codon, or an opal codon (UGA), an unnatural codon, a four base (or more) codon, a rare codon, or the like.
  • a number of selector codons can be introduced into a desired gene or polynucleotide, e.g., one or more, two or more, three or more, etc.
  • the methods involve the use of a selector codon that is a stop codon for the incorporation of a selected amino acid, e.g., an unnatural amino acid, in vivo.
  • a selector codon that is a stop codon for the incorporation of a selected amino acid, e.g., an unnatural amino acid, in vivo.
  • an O-tRNA is produced that recognizes the stop codon and is aminoacylated by an O-RS with a selected amino acid. This O-tRNA is not recognized by the naturally
  • a stop codon used as a selector codon is an amber codon, UAG, and/or an opal codon, UGA.
  • SEQ ID NO.: 6 for an example of an O-tRNA that recognizes an amber codon
  • SEQ ID NO.: 7 for an example of an O-tRNA that recognizes an opal codon.
  • a genetic code in which UAG and UGA are both used as a selector codon can encode 22 amino acids while preserving the ochre nonsense codon, UAA, which is the most abundant termination signal.
  • the incorporation of selected amino acids, e.g., unnatural amino acids, in vivo can be done without significant perturbation of the host cell.
  • the suppression efficiency for the UAG codon depends upon the competition between the O-tRNA, e.g., the amber suppressor tRNA, and the release factor 1 (RFl) (which binds to the UAG codon and initiates release of the growing peptide from the ribosome)
  • the suppression efficiency can be modulated by, e.g., either increasing the expression level of O-tRNA, e.g., the suppressor tRNA, or using an RFl deficient strain.
  • the suppression efficiency for the UAG codon depends upon the competition between the O-tRNA, e.g., the amber suppressor tRNA, and a eukaryotic release factor (e.g., eRF) (which binds to a stop codon and initiates release of the growing peptide from the ribosome), the suppression efficiency can be modulated by, e.g., increasing the expression level of O-tRNA, e.g., the suppressor tRNA.
  • O-tRNA e.g., the amber suppressor tRNA
  • a eukaryotic release factor e.g., eRF
  • Unnatural amino acids can also be encoded with rare codons.
  • the rare arginine codon, AGG has proven to be efficient for insertion of Ala by a synthetic tRNA acylated with alanine.
  • the synthetic tRNA competes with the naturally occurring tRNAArg, which exists as a minor species in Escherichia coli. Some organisms do not use all triplet codons.
  • An unassigned codon AGA in Micrococcus luteus has been utilized for insertion of amino acids in an in vitro
  • Selector codons also comprise extended codons, e.g., four or more base codons, such as, four, five, six or more base codons.
  • four base codons include but are not limited to, AGGA, CUAG, UAGA, CCCU, and the like.
  • five base codons include but are not limited to, AGGAC, CCCCU, CCCUC, CUAGA, CUACU, UAGGC and the like.
  • a feature may include using extended codons based on frameshift suppression.
  • Four or more base codons can insert, e.g., one or multiple selected amino acids, including but not limited to, unnatural amino acids, into the same protein.
  • the four or more base codon is read as single amino acid.
  • the anticodon loops can decode, e.g., at least a four-base codon, at least a five-base codon, or at least a six-base codon or more.
  • a selector codon can also include one of the natural three base codons, where the endogenous system does not use (or rarely uses) the natural base codon. For example, this includes a system that is lacking a tRNA that recognizes the natural three base codon, and/or a system where the three base codon is a rare codon.
  • Selector codons optionally include unnatural base pairs. These unnatural base pairs further expand the existing genetic alphabet. One extra base pair increases the number of triplet codons from 64 to 125.
  • Properties of third base pairs include stable and selective base pairing, efficient enzymatic incorporation into DNA with high fidelity by a polymerase, and the efficient continued primer extension after synthesis of the nascent unnatural base pair.
  • Descriptions of unnatural base pairs which can be adapted for methods and compositions include, e.g., Hirao, et al., (2002) An unnatural base pair for incorporating amino acid analogues into protein, Nature Biotechnology, 20:177-182. See, also, Wu, Y., et al., (2002) J. Am. Chem. Soc. 124:14626-14630. Other relevant publications are listed below.
  • the unnatural nucleoside is membrane permeable and is phosphorylated to form the corresponding triphosphate.
  • the increased genetic information is stable and not destroyed by cellular enzymes.
  • Previous efforts by Benner and others took advantage of hydrogen bonding patterns that are different from those in canonical Watson-Crick pairs, the most noteworthy example of which is the iso-C:iso-G pair. See, e.g., Switzer et al., (1989) J. Am. Chem. Soc, 111:8322; and Piccirilli et al., (1990) Nature, 343:33; Kool, (2000) Curr. Opin. Chem. Biol., 4:602.
  • a PICS:PICS self-pair is found to be more stable than natural base pairs, and can be efficiently incorporated into DNA by Klenow fragment of Escherichia coli DNA polymerase I (KF). See, e.g., McMinn et al., (1999) J. Am. Chem. Soc. 121:11585-6; and Ogawa et al., (2000) J. Am. Chem. Soc, 122:3274.
  • KF Escherichia coli DNA polymerase I
  • a translational bypassing system can also be used to incorporate a selected amino acid, e.g., an unnatural amino acid, in a desired polypeptide.
  • a translational bypassing system a large sequence is inserted into a gene but is not translated into protein. The sequence contains a structure that serves as a cue to induce the ribosome to hop over the sequence and resume translation downstream of the insertion.
  • a selected amino acid refers to any desired naturally occurring amino acid or unnatural amino acid.
  • a naturally occurring amino acid includes any one of the twenty genetically encoded alpha-amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine.
  • the selected amino acid is incorporated into a growing polypeptide chain with high fidelity, e.g., at greater than about 70% efficiency for given selector codon, at greater than 75% efficiency for a given selector codon, at greater than about 80% efficiency for a given selector codon, at greater than about 85% efficiency for a given selector codon, at greater than about 90% efficiency for a given selector codon, at greater than about 95% efficiency for a given selector codon, or at greater than about 99% or more efficiency for a given selector codon.
  • an unnatural amino acid refers to any amino acid, modified amino acid, or amino acid analogue other than selenocysteine and/or pyrrolysine and the following twenty genetically encoded alpha-amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine,
  • An unnatural amino acid is typically any structure having Formula I wherein the
  • R group is any substituent other than one used in the twenty natural amino acids. See, e.g., Biochemistry by L. Stryer, 3 rd ed. 1988, Freeman and Company, New York, for structures of the twenty natural amino acids. Note that, the unnatural amino acids of the present invention can be naturally occurring compounds other than the twenty alpha-amino acids above.
  • the unnatural amino acids of the present invention typically differ from the natural amino acids only in the structure of the side chain, the unnatural amino acids form amide bonds with other amino acids, including but not limited to, natural or unnatural, in the same manner in which they are formed in naturally occurring proteins. However, the unnatural amino acids have side chain groups that distinguish them from the natural amino acids.
  • R in Formula I may comprise an alkyl-, aryl-, acyl-, keto-, azido-, hydroxyl-, hydrazine, cyano-, halo-, hydrazide, alkenyl, alkynl, ether, thiol, seleno-, sulfonyl- , borate, boronate, phospho, phosphono, phosphine, heterocyclic, enone, imine, aldehyde, ester, thioacid, hydroxylamine, amine, and the like, or any combination thereof.
  • non-natural amino acids include, but are not limited to, amino acids comprising a photoactivatable cross-linker, spin-labeled amino acids, fluorescent amino acids, metal binding amino acids, metal-containing amino acids, radioactive amino acids, amino acids with novel functional groups, amino acids that covalently or noncovalently interact with other molecules, photocaged and/or photoisomerizable amino acids, amino acids comprising biotin or a biotin analogue, glycosylated amino acids such as a sugar substituted serine, other carbohydrate modified amino acids, keto-containing amino acids, amino acids comprising polyethylene glycol or polyether, heavy atom substituted amino acids, chemically cleavable and/or photocleavable amino acids, amino acids with an elongated side chains as compared to natural amino acids, including but not limited to, polyethers or long chain hydrocarbons, including but not limited to, greater than about 5 or greater than about 10 carbons, carbon- linked sugar-containing amino acids, redox-active amino acids, amino thioa
  • Unnatural amino acids may have a photo activatable cross-linker that is used, e.g., to link a protein to a solid support.
  • Unnatural amino acids may have a saccharide moiety attached to the amino acid side chain.
  • unnatural amino acids In addition to unnatural amino acids that contain novel side chains, unnatural amino acids also optionally comprise modified backbone structures, e.g., as illustrated by the structures of Formula II and III:
  • Z typically comprises OH, NH 2 , SH, NH-R', or S-R';
  • X and Y which can be the same or different, typically comprise S or O, and R and R', which are optionally the same or different, are typically selected from the same list of constituents for the R group described above for the unnatural amino acids having Formula I as well as hydrogen.
  • unnatural amino acids may comprise substitutions in the amino or carboxyl group as illustrated by Formulas II and III.
  • Unnatural amino acids of this type include, but are not limited to, ⁇ -hydroxy acids, ⁇ -thioacids, ⁇ -aminothiocarboxylates, e.g., with side chains corresponding to the common twenty natural amino acids or unnatural side chains.
  • substitutions at the ⁇ -carbon optionally include L, D, or ⁇ - ⁇ -disubstituted amino acids such as D-glutamate, D-alanine, D-methyl-0-tyrosine, aminobutyric acid, and the like.
  • Other structural alternatives include cyclic amino acids, such as proline analogues as well as
  • Tyrosine analogs include para-substituted tyrosines, ortho-substituted tyrosines, and meta substituted tyrosines, wherein the substituted tyrosine comprises a keto group (including but not limited to, an acetyl group), a benzoyl group, an amino group, a hydrazine, an hydroxyamine, a thiol group, a carboxy group, an isopropyl group, a methyl group, a C 6 - C 20 straight chain or branched hydrocarbon, a saturated or unsaturated hydrocarbon, an O-methyl group, a polyether group, a nitro group, or the like, m addition, multiply substituted aryl rings are also contemplated.
  • a keto group including but not limited to, an acetyl group
  • benzoyl group an amino group, a hydrazine, an hydroxyamine, a thiol group, a carboxy group
  • Glutamine analogs include, but are not limited to, ⁇ -hydroxy derivatives, ⁇ -substituted derivatives, cyclic derivatives, and amide substituted glutamine derivatives.
  • Example phenylalanine analogs include, but are not limited to, para-substituted phenylalanines, ortho-substituted phenyalanines, and meta- substituted phenylalanines, wherein the substituent comprises a hydroxy group, a methoxy group, a methyl group, an allyl group, an aldehyde, an azido, an iodo, a bromo, a keto group (including but not limited to, an acetyl group), or the like.
  • unnatural amino acids include, but are not limited to, a j ⁇ -acetyl-L- phenylalanine, a />-propargyl- phenylalanine, O-methyl-L-tyrosine, an L-3-(2-naphthyl)alanine, a 3-methyl-phenylalanine, an O-4-allyl-L-tyrosine, a 4-propyl-L-tyrosine, a tri-O-acetyl-GlcNAc ⁇ -serine, an L-Dopa, a fluorinated phenylalanine, an isopropyl-L-phenylalanine, ap-azido-L-phenylalanine, aj?-acyl- L-phenylalanine, a j9-benzoyl-L ⁇ phenylalanine, an L-phosphoserine, a phosphonoserine, a phosphonotyrosine,
  • a non-natural amino acid incorporated into a polypeptide at the amino terminus can be composed of an R group that is any substituent other than one used in the twenty natural amino acids and a 2 nd reactive group different from the NH 2 group normally present in ⁇ -amino acids (see Formula I).
  • a similar non-natural amino acid can be incorporated at
  • the unnatural amino acids of the invention may be selected or designed to provide additional characteristics unavailable in the twenty natural amino acids.
  • unnatural amino acid may be optionally designed or selected to modify the biological properties of a protein, e.g., into which they are incorporated.
  • the following properties may be optionally modified by inclusion of an unnatural amino acid into a protein: toxicity, biodistribution, solubility, stability, e.g., thermal, hydrolytic, oxidative, resistance to enzymatic degradation, and the like, facility of purification and processing, structural properties, spectroscopic properties, chemical and/or photochemical properties, catalytic activity, redox potential, half-life, ability to react with other molecules, e.g., covalently or noncovalently, and the like.
  • an unnatural amino acid presents additional chemical moieties that can be used to add additional molecules. These modifications can be made in vivo in a eukaryotic or non-eukaryotic cell, or in vitro. Thus, in certain embodiments, the post-translational modification is through the unnatural amino acid.
  • An unnatural amino acid in a polypeptide may be used to attach another molecule to the polypeptide, including but not limited to, a label, a dye, a polymer, a water-soluble polymer, a derivative of polyethylene glycol, a photocrosslinker, a radionuclide, a cytotoxic compound, a drug, an affinity label, a photoaffmity label, a reactive compound, a resin, a second protein or polypeptide or polypeptide analog, an antibody or antibody fragment, a metal chelator, a cofactor, a fatty acid, a carbohydrate, a polynucleotide, a DNA, a RNA, an antisense polynucleotide, a saccharide, a water-soluble ' dendrimer, a cyclodextrin, an inhibitory ribonucleic acid, a biomaterial, a nanoparticle, a spin label, a fluorophore, a metal-containing moiety,
  • a heavy atom a chemically cleavable group, a photocleavable group, an elongated side chain, a carbon-linked sugar, a redox-active agent, an amino thioacid, a toxic moiety, an isotopically labeled moiety, a biophysical probe, a phosphorescent group, a chemiluminescent group, an electron dense group, a magnetic group, an intercalating group, a chromophore, an energy transfer agent, a biologically active agent, a detectable label, a small molecule, a quantum dot, a nanotransmitter, or any combination of the above or any other desirable compound or substance, comprising a second reactive group to at least one unnatural amino acid comprising a first reactive group utilizing chemistry methodology that is known to one of ordinary skill in the art to be suitable for the particular reactive groups.
  • the post-translational modification can be through a nucleophilic- electrophilic reaction.
  • Most reactions currently used for the selective modification of proteins involve covalent bond formation between nucleophilic and electrophilic reaction partners, including but not limited to the reaction of ⁇ -haloketones with histidine or cysteine side chains. Selectivity in these cases is determined by the number and accessibility of the nucleophilic residues in the protein.
  • other more selective reactions can be used such as the reaction of an umiatural keto-amino acid with hydrazides or aminooxy compounds, in vitro and in vivo. See, e.g., Cornish, et al., (1996) J. Am. Chem.
  • Unnatural amino acid uptake by a cell is one issue that is typically considered when designing and selecting unnatural amino acids, e.g., for incorporation into a protein. For example, the high charge density of ⁇ -amino acids suggests that these compounds are unlikely to be cell permeable.
  • Natural amino acids are taken up into the cell via a collection of protein-based transport systems. A rapid screen can be done which assesses which unnatural amino acids, if any, are taken up by cells. See, e.g., the toxicity assays in, e.g., U.S. Patent Publication No. US 2004/0198637 entitled "Protein Arrays" which is incorporated by reference herein, and Liu, D.R.
  • Biosynthesis of Unnatural Amino Acids Many biosynthetic pathways already exist in cells for the production of amino acids and other compounds. While a biosynthetic method for a particular unnatural amino acid may not exist in nature, including but not limited to, in a cell, the invention provides such methods. For example, biosynthetic pathways for unnatural amino acids are optionally generated in host cell by adding new enzymes or modifying existing host cell pathways. Additional new enzymes are optionally naturally occurring enzymes or artificially evolved enzymes.
  • the biosynthesis of />-aminophenylalanine relies on the addition of a combination of known enzymes from other organisms.
  • the genes for these enzymes can be introduced into a cell by transforming the cell with a plasmid comprising the genes.
  • the genes, when expressed in the cell, provide an enzymatic pathway to synthesize the desired compound. Examples of the types of enzymes that are optionally added are provided in the examples below. Additional enzymes sequences are found, for example, in Genbank. Artificially evolved enzymes are also optionally added into a cell in the same manner. In this manner, the cellular machinery and resources of a cell are manipulated to produce unnatural amino acids.
  • 56 maxygen.com is optionally used to develop novel enzymes and pathways. See, e.g., Stemmer (1994), Rapid evolution of a protein in vitro by DNA shuffling, Nature 370(4):389- 391; and, Stemmer, (1994), DNA shuffling by random fragmentation and reassembly: In vitro recombination for molecular evolution, Proc. Natl. Acad. Sci. USA., 91:10747-10751. Similarly DesignPathTM, developed by Genencor (available on the World Wide Web at genencor.com) is optionally used for metabolic pathway engineering, e.g., to engineer a pathway to create O-methyl-L-tyrosine in a cell.
  • metabolic pathway engineering e.g., to engineer a pathway to create O-methyl-L-tyrosine in a cell.
  • This technology reconstructs existing pathways in host organisms using a combination of new genes, including but not limited to, those identified through functional genomics, and molecular evolution and design. Diversa Corporation (available on the World Wide Web at diversa.com) also provides technology for rapidly screening libraries of genes and gene pathways, including but not limited to, to create new pathways.
  • the unnatural amino acid produced with an engineered biosynthetic pathway of the present invention is produced in a concentration sufficient for efficient protein biosynthesis, e.g., a natural cellular amount, but not to such a degree as to affect the concentration of the other amino acids or exhaust cellular resources.
  • concentrations produced in vivo in this manner are about 10 mM to about 0.05 mM.
  • NUCLEIC ACID AND POLYPEPTIDE SEQUENCE AND VARIANTS [164] As described above and below, the invention provides for nucleic acid polynucleotide sequences and polypeptide amino acid sequences, e.g., tRNA's and RSs, and, e.g., compositions and methods comprising said sequences. Examples of said sequences, e.g., tRNA's and RSs are disclosed herein. However, one of skill in the art will appreciate that the invention is not limited to those sequences disclosed herein, e.g., the Examples. One of skill will appreciate that the invention also provides many related and unrelated sequences with the functions described herein, e.g., encoding an O-tRNA or an O-RS.
  • the invention provides polypeptides (O-RSs) and polynucleotides, e.g., O-tRNA, polynucleotides that encode O-RSs or portions thereof, oligonucleotides used to isolate
  • Polynucleotides of the present invention include those that encode proteins or polypeptides of interest of the present invention with one or more selector codon.
  • polynucleotides of the present invention include, e.g., a polynucleotide comprising a nucleotide sequence as set forth in SEQ ID NO.: 4; a polynucleotide that is complementary to or that encodes a polynucleotide sequence thereof, or a conservative variation thereof.
  • a polynucleotide of the present invention also includes a polynucleotide that encodes a polypeptide of the present invention.
  • a nucleic acid that hybridizes to a polynucleotide indicated above under highly stringent conditions over substantially the entire length of the nucleic acid is a polynucleotide of the present invention.
  • a composition includes a polypeptide of the present invention and an excipient (e.g., buffer, water, pharmaceutically acceptable excipient, etc.).
  • polypeptides of the present invention include, e.g., a polypeptide comprising a amino acid sequence as set forth in SEQ ID NO.: 5; a polypeptide that is complementary to or that encodes a polypeptide sequence thereof, or a conservative variation thereof.
  • the invention also provides an antibody or antisera specifically immunoreactive with a polypeptide of the present invention.
  • a vector (e.g., a plasmid, a cosmid, a phage, a bacterium, a virus, a naked polynucleotide, a conjugated polynucleotide, etc.) comprises a polynucleotide of the present invention, hi one embodiment, the vector is an expression vector.
  • the expression vector includes a promoter operably linked to one or more of the polynucleotides of the present invention.
  • a cell comprises a vector that includes a polynucleotide of the present invention.
  • variants of the disclosed sequences are included in the invention. For example, conservative variations of the disclosed sequences that yield a functionally identical sequence are included in the invention. Variants of the nucleic acid polynucleotide sequences, wherein the variants hybridize to at least one disclosed sequence, are considered to be included in the invention. Unique subsequences of the sequences disclosed herein, as determined by, e.g., standard sequence comparison techniques, are also included in the invention.
  • Constant variations of a particular nucleic acid sequence refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or, where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences.
  • One of ordinary skill in the art will recognize that individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids in an encoded sequence are "conservatively modified variations” or “conservatively modified variants” where the alterations result in the deletion of an amino acid, addition of an amino acid, or substitution of an amino acid with a chemically similar amino acid.
  • “conservative variations" of a listed polypeptide sequence of the present invention include substitutions of a small percentage, typically less than 5%, more typically less than 4%, 2% or 1%, of the amino acids of the polypeptide sequence, with a conservatively selected amino acid of the same conservative substitution group.
  • Comparative hybridization can be used to identify nucleic acids of the present invention, such as SEQ ID NO.: 4, including conservative variations of nucleic acids of the present invention, and this comparative hybridization method is a preferred method of distinguishing nucleic acids of the present invention.
  • target nucleic acids which hybridize to the nucleic acids represented by SEQ ID NO: 4 under high, ultra-high, and/or ultra-ultra high stringency conditions are a feature of the present invention. Examples of such nucleic acids include those with one or a few silent or conservative nucleic acid substitutions as compared to a given nucleic acid sequence.
  • a test nucleic acid is said to specifically hybridize to a probe nucleic acid when it hybridizes at least 1 A as well to the probe as to the perfectly matched complementary target, i.e., with a signal to noise ratio at least 1 A as high as hybridization of the probe to the target under conditions in which the perfectly matched probe binds to the perfectly matched complementary target with a signal to noise ratio that is at least about 5x-10x as high as that observed for hybridization to any of the unmatched target nucleic acids.
  • Nucleic acids "hybridize” when they associate, typically in solution. Nucleic acids hybridize due to a variety of well characterized physico-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like.
  • stringent hybridization conditions refers to conditions of low ionic strength and high temperature as is known in the art. Typically, under stringent conditions a probe will hybridize to its target subsequence in a complex mixture of nucleic acid (including but not limited to, total cellular or library DNA or RNA) but does not hybridize to other sequences in the complex mixture.
  • Higgins 2 provide details on the synthesis, labeling, detection and quantification of DNA and RNA, including oligonucleotides.
  • stringent conditions are selected to be about 5-10° C lower than the thermal melting point (T 111 ) for the specific sequence at a defined ionic strength pH.
  • T 111 thermal melting point
  • the T m is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T m , 50% of the probes are occupied at equilibrium).
  • Stringent conditions may be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 3O 0 C for short probes (including but not limited to, 10 to 50 nucleotides) and at least about 6O 0 C for long probes (including but not limited to, greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal may be at least two times background, optionally 10 times background hybridization.
  • Exemplary stringent hybridization conditions can be as following: 50% formamide, 5X SSC, and 1% SDS, incubating at 42 0 C, or 5X SSC, 1% SDS, incubating at 65 0 C, with wash in 0.2X SSC, and 0.1% SDS at 65 0 C. Such washes can be performed for 5, 15, 30, 60, 120, or more minutes.
  • An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formalin with 1 mg of heparin at 42°C, with the hybridization being carried out overnight.
  • An example of stringent wash conditions is a 0.2x SSC wash at 65°C for 15 minutes ⁇ see, Sambrook, et ah, Molecular Cloning, A Laboratory Manual (3rd ed. 2001) for a description of SSC buffer). Often the high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example low stringency wash is 2x SSC at 40°C for 15 minutes, hi general, a signal to noise ratio of 5x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
  • hybridization and wash conditions can easily be determined empirically for any test nucleic acid. For example, in determining highly stringent hybridization and wash conditions, the hybridization and wash conditions are gradually increased (e.g., by increasing temperature, decreasing salt concentration, increasing detergent concentration and/or increasing the concentration of organic solvents such as formalin in the hybridization or wash), until a selected set of criteria are met. For example, the hybridization and wash conditions are gradually increased until a probe binds to a perfectly matched complementary target with a signal to noise ratio that is at least 5x as high as that observed for hybridization of the probe to an unmatched target.
  • the hybridization and wash conditions are gradually increased until a probe binds to a perfectly matched complementary target with a signal to noise ratio that is at least 5x as high as that observed for hybridization of the probe to an unmatched target.
  • T m is the temperature (under defined ionic strength and pH) at which 50% of the test sequence hybridizes to a perfectly matched probe.
  • "highly stringent" hybridization and wash conditions are selected to be about 5°C lower than the T m for the specific sequence at a defined ionic strength and pH.
  • Ultra high-stringency hybridization and wash conditions are those in which the stringency of hybridization and wash conditions are increased until the signal to noise ratio for binding of the probe to the perfectly matched complementary target nucleic acid is at least 10x as high as that observed for hybridization to any of the unmatched target nucleic acids.
  • a target nucleic acid which hybridizes to a probe under such conditions, with a signal to noise ratio of at least 1 A that of the perfectly matched complementary target nucleic acid is said to bind to the probe under ultra-high stringency conditions.
  • even higher levels of stringency can be determined by gradually increasing the hybridization and/or wash conditions of the relevant hybridization assay. For example, those in which the stringency of hybridization and wash conditions are increased until the signal to noise ratio for binding of the probe to the perfectly matched complementary target nucleic acid is at least 10X, 2OX, 50X, 10OX, or 500X or more as high as that observed for hybridization to any of the unmatched target nucleic acids.
  • a target nucleic acid which hybridizes to a probe under such conditions, with a signal to noise ratio of at least 1 A that of the perfectly matched complementary target nucleic acid is said to bind to the probe under ultra-ultra-high stringency conditions.
  • nucleic acids which do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codoii degeneracy permitted by the genetic code.
  • the invention provides a nucleic acid that comprises a unique subsequence in a nucleic acid selected from the sequences of O-tRNA's and O-RSs disclosed herein.
  • the unique subsequence is unique as compared to a nucleic acid corresponding to any known O-tRNA or O-RS nucleic acid sequence. Alignment can be performed using, e.g., BLAST set to default parameters. Any unique subsequence is useful, e.g., as a probe to identify the nucleic acids of the present invention.
  • the invention includes a polypeptide which comprises a unique subsequence in a polypeptide selected from the sequences of O-RSs disclosed herein.
  • the unique subsequence is unique as compared to a polypeptide corresponding to any of known polypeptide sequence.
  • the invention also provides for target nucleic acids which hybridizes under stringent conditions to a unique coding oligonucleotide which encodes a unique subsequence in a polypeptide selected from the sequences of O-RSs wherein the unique subsequence is unique as compared to a polypeptide corresponding to any of the control polypeptides (e.g., parental sequences from which synthetases of the present invention were derived, e.g., by mutation). Unique sequences are determined as noted above.
  • nucleic acid or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, or designated region,, as measured using one of the sequence comparison algorithms described below (or other algorithms available to persons of ordinary skill in the art) or by manual alignment and visual inspection.
  • nucleic acids or polypeptides e.g., DNAs encoding an O-tRNA or O-RS, or the amino acid sequence of an O- RS
  • phrase “substantially identical,” in the context of two nucleic acids or polypeptides refers to two or more sequences or subsequences that have at least about 60%, about
  • nucleotide or amino acid residue identity when compared and aligned for maximum correspondence over a comparison window, or designated region, as measured using a sequence comparison algorithm (or other algorithms available to persons of ordinary skill in the art) or by manual alignment and visual inspection.
  • sequence comparison algorithm or other algorithms available to persons of ordinary skill in the art
  • Such “substantially identical” sequences are typically considered to be “homologous,” without reference to actual ancestry.
  • Substantial identity may exist over a region of the sequences that is at least about 50 residues in length, a region of at least about 100 residues, or a region of at least about 150 residues, or over the full length of the two sequences to be compared.
  • sequence comparison and homology determination typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm and BLAST 2.0 algorithms, which are described in Altschul et al, (1997) Nuc. Acids Res. 25:3389-3402, and Altschul et al, L MoI. Biol. 215:403-410 (1990).
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information available at the World Wide Web at ncbi.nhn.nih.gov. This algorithm involves first identifying high scoring
  • HSPs 64 sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence.
  • T is referred to as the neighborhood word score threshold (Altschul et al, supra).
  • M forward score for a pair of matching residues; always > 0
  • N penalty score for mismatching residues; always ⁇ 0).
  • a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • W wordlength
  • E expectation
  • the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences ⁇ see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid may be considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, less than about 0.01, or less than about 0.001.
  • nucleotide sequence may be conveniently modified by site-directed mutagenesis in accordance with conventional methods.
  • nucleotide sequence may be prepared by chemical synthesis, including but not limited to, by using an oligonucleotide synthesizer, wherein oligonucleotides are designed based on the amino acid sequence of the desired polypeptide, and preferably selecting those codons that are favored in the host cell in which the recombinant polypeptide will be produced.
  • oligonucleotides coding for portions of the desired polypeptide may be synthesized and assembled by PCR, ligation or ligation chain reaction. See, e.g., Barany, et ah, Proc. Natl. Acad. ScL 88: 189-193 (1991); U.S. Patent 6,521,427 which are incorporated by reference herein. [190] This invention utilizes routine techniques in the field of recombinant genetics.
  • mutagenesis Various types are used in the invention for a variety of purposes, including but not limited to, to produce novel synthetases or tRNAs, to mutate tRNA molecules, to produce libraries of tRNAs, to mutate RS molecules, to produce libraries of synthetases, to produce selector codons, to insert selector codons that encode a selected amino acid in a protein or polypeptide of interest.
  • novel synthetases or tRNAs to mutate tRNA molecules
  • libraries of tRNAs to mutate RS molecules
  • selector codons to insert selector codons that encode a selected amino acid in a protein or polypeptide of interest.
  • selector codons to insert selector codons that encode a selected amino acid in a protein or polypeptide of interest.
  • 66 directed, random point mutagenesis, homologous recombination, DNA shuffling or other recursive mutagenesis methods, chimeric construction, mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA or the like, or any combination thereof.
  • Additional suitable methods include point mismatch repair, mutagenesis using repair- deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, double-strand break repair, and the like. Mutagenesis, including but not limited to, involving chimeric constructs, is also included in the present invention.
  • mutagenesis can be guided by known information of the naturally occurring molecule or altered or mutated naturally occurring molecule, including but not limited to, sequence, sequence comparisons, physical properties, secondary, tertiary, or quaternary structure, crystal structure or the like.
  • Oligonucleotides for use in mutagenesis of the present invention, e.g., mutating libraries of tRNAs or synthetases, or altering tRNAs or RSs, are typically synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers, Tetrahedron Letts. 22(20):1859-1862, (1981) e.g., using an automated synthesizer, as described in Needham-VanDevanter et al., Nucleic Acids Res., 12:6159-6168 (1984).
  • nucleic acid can be custom or standard ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company (mcrc@oligos.com), The Great American Gene Company (www.genco.com), ExpressGen Inc. (www.expressgen.com), Operon Technologies hie. (Alameda, Calif.) and many others.
  • the invention also relates to eukaryotic host cells, non-eukaryotic host cells, and organisms for the in vivo incorporation of an unnatural amino acid via orthogonal tRNA/RS pairs.
  • Host cells are genetically engineered (including but not limited to, transformed, transduced or transfected) with the polynucleotides of the present invention or constructs which include a polynucleotide of the present invention, including but not limited to, a vector of the present invention, which can be, for example, a cloning vector or an expression vector.
  • the coding regions for the orthogonal tRNA, the orthogonal tRNA synthetase, and the protein to be derivatized are operably linked to gene expression control elements that are functional in the desired host cell.
  • the vector can be, for example, in the form of a plasmid, a cosmid, a phage, a bacterium, a virus, a naked polynucleotide, or a conjugated polynucleotide.
  • the vectors are introduced into cells and/or microorganisms by standard methods including electroporation (Fromm et al., Proc. Natl. Acad. Sci.
  • Bacterial cells can be used to amplify the number of plasmids containing DNA constructs of this invention.
  • the bacteria are grown to log phase and the plasmids within the bacteria can be isolated by a variety of methods known in the art (see, for instance, Sambrook).
  • kits are commercially available for the purification of plasmids from bacteria, (see, e.g., EasyPrepTM, FlexiPrepTM, both from Pharmacia Biotech; StrataCleanTM from Stratagene; and, QIAprepTM from Qiagen).
  • the isolated and purified plasmids are then further manipulated to produce other plasmids, used to transfect cells or incorporated into related vectors to infect organisms.
  • Typical vectors contain transcription and translation terminators, transcription and translation initiation sequences, and promoters useful for regulation of the expression of the particular target nucleic acid.
  • the vectors optionally comprise generic expression cassettes containing at least one independent terminator sequence, sequences permitting replication of the cassette in eukaryotes, or prokaryotes, or both (including but not limited to, shuttle vectors) and selection markers for both prokaryotic and eukaryotic systems.
  • Vectors are suitable for replication and/or integration in prokaryotes, eukaryotes, or both.
  • nucleic acid and virtually any labeled nucleic acid, whether standard or non-standard
  • any nucleic acid can be custom or standard ordered from any of a variety of commercial sources, such as the Midland Certified Reagent Company (Midland, TX available on the World Wide Web at mcrc.com), The Great American Gene Company (Ramona, CA available on the World Wide Web at genco.com), ExpressGen Inc. (Chicago, IL available on the World Wide Web at expressgen.com), Operon Technologies Inc. (Alameda, CA) and many others.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for such activities as, for example, screening steps, activating promoters or selecting transformants. These cells can optionally be cultured into transgenic organisms.
  • Other useful references, e.g. for cell isolation and culture (e.g., for subsequent nucleic acid isolation) include Freshney (1994) Culture of Animal Cells, a Manual of Basic
  • an unnatural amino acid can be done for a variety of purposes, including but not limited to, tailoring changes in protein structure and/or function, changing size, acidity, nucleophilicity, hydrogen bonding, hydrophobicity, accessibility of protease target sites, targeting to a moiety (including but not limited to, for a protein array), adding a biologically active molecule, attaching a polymer, attaching a radionuclide, modulating serum half-life, modulating tissue penetration (e.g. tumors), modulating active transport, modulating tissue, cell or organ specificity or distribution, modulating immunogenicity, modulating protease resistance, etc. Proteins that include an unnatural amino acid can have enhanced or even entirely new catalytic or biophysical properties.
  • compositions including proteins that include at least one unnatural amino acid are useful for, including but not limited to, novel therapeutics, diagnostics, catalytic enzymes, industrial enzymes, binding proteins (including but not limited to, antibodies), and including but not limited to, the study of protein structure
  • a protein may have at least one, including but not limited to, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten or more unnatural amino acids.
  • the unnatural amino acids can be the same or different, including but not limited to, there can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more different sites in the protein that comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more different unnatural amino acids.
  • a protein may have at least one, but fewer than all, of a particular amino acid present in the protein is substituted with the unnatural amino acid.
  • the unnatural amino acids can be identical or different (including but not limited to, the protein can include two or more different types of unnatural amino acids, or can include two of the same unnatural amino acid).
  • the unnatural amino acids can be the same, different or a combination of a multiple unnatural amino acid of the same kind with at least one different unnatural amino acid.
  • proteins or polypeptides of interest By producing proteins or polypeptides of interest with at least one unnatural amino acid in eukaryotic cells, proteins or polypeptides will typically include eukaryotic post-translational modifications, hi certain embodiments, a protein includes at least one unnatural amino acid and at least one post-translational modification that is made in vivo by a eukaryotic cell, where the post-translational modification is not made by a prokaryotic cell.
  • the post-translation modification includes, including but not limited to, acetylation, acylation, lipid-modification, palmitoylation, palmitate addition, phosphorylation, glycolipid-linkage modification, glycosylation, and the like
  • the post-translation modification includes proteolytic processing of precursors (including but not limited to, calcitonin precursor, calcitonin gene-related peptide precursor, preproparathyroid hormone, preproinsulin, proinsulin, prepro-opiomelanocortin, proopiomelanocortin and the like), assembly into a multisubunit protein or macromolecular assembly, translation to another site in the cell (including but not limited to, to organelles, such as the endoplasmic reticulum, the Golgi apparatus, the nucleus, lysosomes, peroxisomes, mitochondria, chloroplasts, vacuoles, etc., or through the secretory pathway).
  • the protein comprises a secretion or
  • a method includes growing, in an appropriate medium, the cell, where the cell comprises a nucleic acid that comprises at least one selector codon and encodes a protein; and, providing the selected amino acid; where the cell further comprises: an orthogonal tRNA (O-tRNA) that functions in the cell and recognizes the selector codon; and, an orthogonal aminoacyl-fRNA synthetase (O-RS) that preferentially aminoacylates the O-tRNA with the selected amino acid.
  • O-tRNA orthogonal tRNA
  • O-RS orthogonal aminoacyl-fRNA synthetase
  • the O- tRNA comprises suppression activity in presence of a cognate synthetase in response to a selector codon.
  • a protein produced by this method is also a feature of the present invention.
  • compositions of the present invention and compositions made by the methods of the present invention optionally are in a cell.
  • the O-tRNA/O-RS pairs or individual components of the present invention can then be used in a host system's translation machinery, which results in a selected amino acid, e.g., unnatural amino acid, being incorporated into a protein.
  • compositions of the present invention can be in an in vitro translation system, or in an in vivo system(s).
  • Any protein (or portion thereof) that includes a selected amino acid, e.g., an unnatural amino acid, (and any corresponding coding nucleic acid, e.g., which includes one or more selector codons) can be produced using the compositions and methods herein. Any polypeptide is suitable for incorporation of one or more selected amino acids. No attempt is made to identify the hundreds of thousands of known proteins, any of which can be modified to include one or more unnatural amino acid, e.g., by tailoring any available mutation methods to include one or more appropriate selector codon in a relevant translation system. Common sequence repositories for known proteins include GenBank EMBL, DDBJ and the NCBI. Other repositories can easily be identified by searching the internet.
  • the proteins are, e.g., at least 60%, at least 70%, at least 75%, at least
  • any available protein e.g., a therapeutic protein, a diagnostic protein, an industrial enzyme, or portion thereof, and the like
  • they comprise one or more selected amino acid.
  • therapeutic, diagnostic, and other proteins that can be modified to comprise one or more selected amino acid, e.g., an unnatural amino acid, can be found, but not limited to, those in USSN 10/825,867 entitled “Expanding the Eukaryotic Genetic Code;” and, U. S. Patent Application Serial Number 10/126,927, entitled “IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS.”
  • the protein or polypeptide of interest (or portion thereof) in the methods and/or compositions of the present invention is encoded by a nucleic acid.
  • the nucleic acid comprises at least one selector codon, at least two selector codons, at least three selector codons, at least four selector codons, at least five selector codons, at least six selector codons, at least seven selector codons, at least eight selector codons, at least nine selector codons, ten or more selector codons.
  • Genes coding for proteins or polypeptides of interest can be mutagenized using methods well-known to one of skill in the art and described herein under "Mutagenesis and Other Molecular Biology Techniques" to include, e.g., one or more selector codon for the incorporation of a selected amino acid, e.g., an unnatural amino acid.
  • a nucleic acid for a protein of interest is mutagenized to include one or more selector codon, providing for the insertion of the one or more selected amino acids, e.g., unnatural amino acid.
  • the invention includes any such variant, e.g., mutant, versions of any protein, e.g., including at least one selected amino acid.
  • the invention also includes corresponding nucleic acids, i.e., any nucleic acid with one or more selector codon that encodes one or more selected amino acid.
  • Host cells are genetically engineered (e.g., transformed, transduced or transfected) with one or more vectors that express the orthogonal tRNA, the orthogonal tRNA synthetase, and a vector that encodes the protein to be derivatized.
  • Each of these components can be on the same vector, or each can be on a separate vector, two components can be on one vector and the third component on a second vector.
  • the vector can be
  • 74 be, for example, in the form of a plasmid, a cosmid, a phage, a bacterium, a virus, a naked polynucleotide, or a conjugated polynucleotide.
  • VaIRS valyl-tRNA synthetase
  • VaIRS can misaminoacylate tRNAVal with Cys, Thr, or aminobutyrate (Abu); these noncognate amino acids are subsequently hydrolyzed by the editing domain.
  • a mutant Escherichia coli strain was selected that has a mutation in the editing site of VaIRS. This edit-defective VaIRS incorrectly charges tRNAVal with Cys.
  • the mutant VaIRS also incorporates Abu into proteins when this mutant Escherichia coli strain is grown in the presence of Abu. Mass spectrometric analysis shows that about 24% of valines are replaced by Abu at each valine position in the native protein.
  • polypeptides of the present invention provide a variety of new polypeptide sequences (e.g., comprising selected amino acids (e.g., unnatural amino acids) in the case of proteins synthesized in the translation systems herein, or, e.g., in the case of the novel synthetases, novel sequences of standard amino acids), the polypeptides also provide new structural features which can be recognized, e.g., in immunological assays.
  • the generation of antisera, which specifically bind the polypeptides of the present invention, as well as the polypeptides which are bound by such antisera, are a feature of the present invention.
  • antibody includes, but is not limited to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof which specifically bind and recognize an analyte (antigen). Examples include polyclonal, monoclonal, chimeric, and single chain antibodies, and the like. Fragments of immunoglobulins, including Fab fragments and fragments produced by an expression library,
  • antibody 78 including phage display are also included in the term "antibody” as used herein. See, e.g., Paul, Fundamental Immunology, 4th Ed., 1999, Raven Press, New York, for antibody structure and terminology.
  • the invention includes RSs and proteins made utilizing tRNAs and/or RSs of the present invention that specifically bind to or that are specifically immunoreactive with an antibody or antisera generated against an immunogen comprising an amino acid sequence.
  • the antibody or antisera is subtracted with available protein, such as the wild-type polypeptide, e.g., the "control" polypeptides.
  • the wild-type protein corresponds to a nucleic acid
  • a polypeptide encoded by the nucleic acid is generated and used for antibody/antisera subtraction purposes.
  • the immunoassay uses a polyclonal antiserum which was raised against one or more polypeptide or a substantial subsequence thereof (i.e., at least about 30% of the full length sequence provided).
  • the set of potential polypeptide immunogens derived from the protein are collectively referred to below as "the immunogenic polypeptides.”
  • the resulting antisera is optionally selected to have low cross-reactivity against the control synthetase homologues and any such cross-reactivity is removed, e.g., by immunoabsorbtion, with one or more of the control homologues, prior to use of the polyclonal antiserum in the immunoassay.
  • one or more of the immunogenic polypeptides is produced and purified as described herein.
  • recombinant protein can be produced in a recombinant cell.
  • An inbred strain of mice (used in this assay because results are more reproducible due to the virtual genetic identity of the mice) is immunized with the immunogenic protein(s) in combination with a standard adjuvant, such as Freund's adjuvant, and a standard mouse immunization protocol ⁇ see, e.g., Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a standard description of antibody generation, immunoassay formats and conditions that can be used to determine specific immunoreactivity.
  • Polyclonal sera are collected and titered against the immunogenic polypeptide in an immunoassay, for example, a solid phase immunoassay with one or more of the immunogenic proteins immobilized on a solid support.
  • Polyclonal antisera with a titer of 10 6 or greater are selected, pooled and subtracted with the control synthetase polypeptides to produce subtracted pooled titered polyclonal antisera.
  • the subtracted pooled titered polyclonal antisera are tested for cross reactivity against the control homologues in a comparative immunoassay.
  • discriminatory binding conditions are determined for the subtracted titered polyclonal antisera which result in at least about a 5-10 fold higher signal to noise ratio for binding of the titered polyclonal antisera to the immunogenic protein as compared to binding to the control synthetase homologues. That is, the stringency of the binding reaction is adjusted by the addition of non-specific competitors such as albumin or non-fat dry milk, and/or by adjusting salt conditions, temperature, and/or the like.
  • binding conditions are used in subsequent assays for determining whether a test polypeptide (a polypeptide being compared to the immunogenic polypeptides and/or the control polypeptides) is specifically bound by the pooled subtracted polyclonal antisera.
  • immunoassays in the competitive binding format are used for detection of a test polypeptide.
  • cross-reacting antibodies are removed from the pooled antisera mixture by immunoabsorbtion with the control polypeptides.
  • the immunogenic polypeptide(s) are then immobilized to a solid support which is exposed to the subtracted pooled antisera.
  • Test proteins are added to the assay to compete for binding to the pooled subtracted antisera.
  • test protein(s) The ability of the test protein(s) to compete for binding to the pooled subtracted antisera as compared to the immobilized protein(s) is compared to the ability of the immunogenic polypeptide(s) added to the assay to compete for binding (the immunogenic polypeptides compete effectively with the immobilized immunogenic polypeptides for binding to the pooled antisera).
  • the percent cross-reactivity for the test proteins is calculated, using standard calculations.
  • control proteins In a parallel assay, the ability of the control proteins to compete for binding to the pooled subtracted antisera is optionally determined as compared to the ability of the immunogenic polypeptide(s) to compete for binding to the antisera. Again, the percent cross- reactivity for the control polypeptides is calculated, using standard calculations. Where the percent cross-reactivity is at least 5-1 Ox as high for the test polypeptides as compared to the
  • test polypeptides are said to specifically bind the pooled subtracted antisera.
  • the immunoabsorbed and pooled antisera can be used in a competitive binding immunoassay as described herein to compare any test polypeptide to the immunogenic and/or control polypeptide(s).
  • the immunogenic, test and control polypeptides are each assayed at a wide range of concentrations and the amount of each polypeptide required to inhibit 50% of the binding of the subtracted antisera to, e.g., an immobilized control, test or immunogenic protein is determined using standard techniques.
  • test polypeptide required for binding in the competitive assay is less than twice the amount of the immunogenic polypeptide that is required, then the test polypeptide is said to specifically bind to an antibody generated to the immunogenic protein, provided the amount is at least about 5-1Ox as high as for the control polypeptide.
  • the pooled antisera is optionally fully immunosorbed with the immunogenic polypeptide(s) (rather than the control polypeptides) until little or no binding of the resulting immunogenic polypeptide subtracted pooled antisera to the immunogenic polypeptide(s) used in the immunosorbtion is detectable.
  • This fully immunosorbed antisera is then tested for reactivity with the test polypeptide. If little or no reactivity is observed (i.e., no more than 2x the signal to noise ratio observed for binding of the fully immunosorbed antisera to the immunogenic polypeptide), then the test polypeptide is specifically bound by the antisera elicited by the immunogenic protein.
  • Kits are also a feature of the present invention.
  • a kit for producing a protein that comprises at least one selected amino acid, e.g., an unnatural amino acid, in a cell is provided, where the kit includes a container containing a polynucleotide sequence
  • kits further includes at least selected amino acid.
  • the kit includes an aminoacylated tRNA of the invention, hi another embodiment, the kit further comprises instructional materials for producing the protein.
  • kits for producing a protein that comprises at least one selected amino acid, e.g., an unnatural amino acid, in a cell-free translation system, where the kit includes a container containing a polynucleotide sequence encoding an O-tRNA, and/or an O-tRNA, and/or a polynucleotide sequence encoding an O-RS, and/or an O-RS.
  • the kit further includes a selected amino acid
  • the kit includes an aminoacylated tRNA of the invention
  • the kit further comprises instructional materials for producing the protein.
  • the selection procedure was preformed which consisted of five alternating rounds of selection, three positive, two negative.
  • the libraries were combined in a 1:1 ratio and electroporated into the positive selection cell line (GeneHog with positive selection plasmid, pREP) and plated on minimal media plates (GMML) with appropriate antibiotics and the non-naturally encoded amino acid para-acetyl phenylalanine (pAF).
  • the plates were incubated at 37 0 C for about 40 hours at which point the cells were harvested by scraping.
  • the DNA was extracted using a Qiagen Mini-Prep procedure, and then was agarose gel purified to isolate the library plasmid DNA.
  • This DNA was then electroporated into the negative selection cell line (GeneHog with negative selection plasmid pBAD derivative). These transformants were plated on LB
  • J17 is shown as SEQ ID NO: 8 and in U.S. Patent Publication Nos. 2003/0108885 as SEQ ID NO: 8.
  • Jl 7 tRNA has a U51 :G63 wobble pair in the T ⁇ C stem as shown in Figure 1.
  • E9 (SEQ ID NO: 4) and the polynucleotide sequence encoding human growth hormone
  • hGH hGH with an amber codon substitution (SEQ ID NO: 16).
  • SEQ ID NO: 16 The expression of hGH was under the control of the T7 promoter.
  • TCCGCCGTTCTGC (FTaml2; SEQ ID NO: 10).
  • CCGCCGTTCTGC (FTaml3; SEQ ID NO: 11).
  • CCGCCGTTCTGC (FTaml4; SEQ ID NO: 12).
  • plasmid pET19 Jl 7 E9 hGH comprising the polynucleotide sequence for Jl 7 tRNA (SEQ ID NO: 8), the polynucleotide sequence encoding the tRNA synthetase E9 (SEQ ID NO: 4) and the polynucleotide sequence encoding human growth hormone with an amber codon substitution (SEQ ID NO: 16) was used as a template for amplification with the following set of primers:
  • CGCCGGACCACTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTTAAGC forward primer; FTaml5; SEQ ID NO: 13
  • CAAATTCGTCCATATGGGATTCC FTam 16;
  • the forward primer was used to extend the sequence from the 3' end of tRNA to the Nde I site of the plasmid.
  • the resulting product was gel purified.
  • SEQ ID NO: 2 (F13), and SEQ ID NO: 3 (F14).
  • the tRNAs were named after their corresponding reverse primers.
  • the cells were harvested by centrifugation at 5000 x g for 5 minutes.
  • the cells were lysed with B-PER Reagent (Pierce, Rockford, IL) supplemented with 5 ug/ml DNAse I.
  • the total cell lysate was analyzed by 4- 12% SDS PAGE.
  • Figure 2 shows an analysis of E. coli strain 1 total cell lysates by SDS PAGE.
  • the suppressed hGH yield of the J17 mutants was approximately 1.5-2 fold higher than that of J17 in E. coli strain 1.
  • One J17 mutant, F13 was further tested in E. coli strain 2 bacterial cell line for amber suppression as shown in Figure 3.
  • E. coli strain 2 the expression as well as amber suppression yields were reduced relative to that in E. coli strain 1.
  • hi the absence of para- acetylphenylalanine no full length hGH product was observed by SDS-PAGE.
  • hi the presence 4 mM ⁇ r ⁇ -acetylphenylalanine full length hGH was observed for both tRNAs.
  • the suppressed hGH yield of F13 was about three fold higher than that ofJ17.
  • a fermentation run comparing J17 and F13 was performed with a final volume of approximately 1.5 L.
  • the plasmid encoding the J17 tRNA and the plasmid encoding F13 tRNA were each transformed into E. coli strain 1.
  • the final cell density for each was approximately 19O g wet cells/1.
  • the hGH titer was 347 mg/L for the Jl 7 clone and 542 mg/L for the Fl 3 clone.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Cosmetics (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2005/043603 2004-12-22 2005-12-01 COMPOSITIONS OF AMINOACYL-tRNA SYNTHETASE AND USES THEREOF Ceased WO2006068802A2 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
EP05852740A EP1836298B1 (en) 2004-12-22 2005-12-01 COMPOSITIONS OF AMINOACYL-tRNA SYNTHETASE AND USES THEREOF
CA2590429A CA2590429C (en) 2004-12-22 2005-12-01 Compositions of aminoacyl-trna synthetase and uses thereof
HK08102426.2A HK1111722B (en) 2004-12-22 2005-12-01 Compositions of aminoacyl-trna synthetase and uses thereof
NZ555425A NZ555425A (en) 2004-12-22 2005-12-01 Compositions of aminoacyl-tRNA synthetase and uses thereof
JP2007548250A JP4990792B2 (ja) 2004-12-22 2005-12-01 アミノアシル−tRNAシンテターゼの組成物およびこの使用
CN2005800444340A CN101087875B (zh) 2004-12-22 2005-12-01 氨酰基-tRNA合成酶的组合物及其用途
BRPI0519568-3 BRPI0519568C8 (pt) 2004-12-22 2005-12-01 Aminoacil-trna sintetase (rs), composições que compreendem a dita aminoacil-trna sintetase, célula de levedura, célula fúngica, célula não eucariótica, vetor que codifica uma rs, polinucleotídeo e ainda método para produzir um polipeptídeo em uma célula com um aminoácido selecionado em uma posição especificada
AT05852740T ATE541934T1 (de) 2004-12-22 2005-12-01 Zusammensetzungen von aminoacyl-trna-synthetase und verwendungen davon
KR1020077016502A KR101252835B1 (ko) 2004-12-22 2005-12-01 아미노아실-tRNA 합성효소의 조성물 및 그것의 용도
MX2007007581A MX2007007581A (es) 2004-12-22 2005-12-01 Composiciones de amino acil-arnt sintetasa y sus usos.
AU2005319518A AU2005319518B2 (en) 2004-12-22 2005-12-01 Compositions of aminoacyl-tRNA synthetase and uses thereof
IL183342A IL183342A (en) 2004-12-22 2007-05-21 Aminoacyl compounds - tRNA synthetase and their use
GB0713653A GB2436765A (en) 2004-12-22 2007-07-13 Compositions of aminoacyl-trna synthetase and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US63914604P 2004-12-22 2004-12-22
US60/639,146 2004-12-22

Publications (2)

Publication Number Publication Date
WO2006068802A2 true WO2006068802A2 (en) 2006-06-29
WO2006068802A3 WO2006068802A3 (en) 2007-03-08

Family

ID=36602203

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/043603 Ceased WO2006068802A2 (en) 2004-12-22 2005-12-01 COMPOSITIONS OF AMINOACYL-tRNA SYNTHETASE AND USES THEREOF

Country Status (15)

Country Link
US (6) US7736872B2 (https=)
EP (1) EP1836298B1 (https=)
JP (1) JP4990792B2 (https=)
KR (1) KR101252835B1 (https=)
CN (3) CN102732588B (https=)
AT (1) ATE541934T1 (https=)
AU (1) AU2005319518B2 (https=)
BR (1) BRPI0519568C8 (https=)
CA (1) CA2590429C (https=)
GB (1) GB2436765A (https=)
IL (1) IL183342A (https=)
MX (1) MX2007007581A (https=)
NZ (1) NZ555425A (https=)
WO (1) WO2006068802A2 (https=)
ZA (1) ZA200704927B (https=)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009067636A2 (en) 2007-11-20 2009-05-28 Ambrx, Inc. Modified insulin polypeptides and their uses
EP1937824A4 (en) * 2005-08-18 2009-06-17 Ambrx Inc TRNA COMPOSITIONS AND ITS USES
WO2009075847A2 (en) 2007-12-11 2009-06-18 The Scripps Research Institute In vivo unnatural amino acid expression in the methylotrophic yeast pichia pastoris
EP2064316A4 (en) * 2006-09-08 2009-09-30 Ambrx Inc LOCAL SPECIFIC INKORPORATION OF NON-NATURAL AMINO ACIDS IN SWIVELING CELLS
WO2010011735A2 (en) 2008-07-23 2010-01-28 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
US8114630B2 (en) 2007-05-02 2012-02-14 Ambrx, Inc. Modified interferon beta polypeptides and their uses
WO2012024452A2 (en) 2010-08-17 2012-02-23 Ambrx, Inc. Modified relaxin polypeptides and their uses
JP2012511326A (ja) * 2008-12-10 2012-05-24 ザ スクリプス リサーチ インスティチュート 化学的に反応性の非天然アミノ酸を使用するキャリア−ペプチド接合体の製造
US8518666B2 (en) 2006-03-03 2013-08-27 California Institute Of Technology Site-specific incorporation of amino acids into molecules
WO2014146575A1 (en) 2013-03-19 2014-09-25 Beijing Shenogen Pharma Group Ltd. Antibodies and methods for treating estrogen receptor-associated diseases
EP2805965A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified porcine somatotropin polypeptides and their uses
EP2805964A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified bovine somatotropin polypeptides and their uses
US9133457B2 (en) 2004-05-17 2015-09-15 California Institute Of Technology Methods of incorporating amino acid analogs into proteins
WO2016065326A2 (en) 2014-10-24 2016-04-28 Bristol-Myers Squibb Company Modified fgf-21 polypeptides and uses thereof
US9879249B2 (en) 2009-02-17 2018-01-30 Redwood Bioscience, Inc. Aldehyde-tagged protein-based drug carriers and methods of use
US9975936B2 (en) 2007-03-30 2018-05-22 Ambrx, Inc. Nucleic acids encoding modified FGF-21 polypeptides comprising non-naturally occurring amino acids
WO2018148419A1 (en) 2017-02-08 2018-08-16 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof
WO2018223108A1 (en) 2017-06-02 2018-12-06 Ambrx, Inc. Methods and compositions for promoting non-natural amino acid-containing protein production
US10183998B2 (en) 2011-01-14 2019-01-22 Redwood Bioscience, Inc. Aldehyde-tagged immunoglobulin polypeptides and methods of use thereof
US10253083B2 (en) 2010-08-17 2019-04-09 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
WO2020056066A1 (en) 2018-09-11 2020-03-19 Ambrx, Inc. Interleukin-2 polypeptide conjugates and their uses
WO2020082057A1 (en) 2018-10-19 2020-04-23 Ambrx, Inc. Interleukin-10 polypeptide conjugates, dimers thereof, and their uses
WO2021183832A1 (en) 2020-03-11 2021-09-16 Ambrx, Inc. Interleukin-2 polypeptide conjugates and methods of use thereof
US11208632B2 (en) 2016-04-26 2021-12-28 R.P. Scherer Technologies, Llc Antibody conjugates and methods of making and using the same
US11273202B2 (en) 2010-09-23 2022-03-15 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
WO2024077277A1 (en) 2022-10-07 2024-04-11 Ambrx, Inc. Drug linkers and antibody conjugates thereof
WO2024155627A1 (en) 2023-01-16 2024-07-25 Ambrx, Inc. Anti-cd70 antibody-drug conjugates
WO2024178310A1 (en) 2023-02-23 2024-08-29 Ambrx, Inc. Trop2-directed antibody-drug conjugates and uses thereof
WO2024241086A1 (en) 2023-05-24 2024-11-28 Ambrx, Inc. Pegylated bovine interferon lambda and methods of use thereof
WO2025041055A1 (en) 2023-08-22 2025-02-27 Ambrx, Inc. Anti-psma adc conjugate compositions and methods of use thereof

Families Citing this family (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008541766A (ja) * 2005-06-03 2008-11-27 アンブレツクス・インコーポレイテツド タンパク質中への天然にコードされないアミノ酸の取り込み
WO2010099477A2 (en) 2009-02-27 2010-09-02 Atyr Pharma, Inc. Polypeptide structural motifs associated with cell signaling activity
US8980253B2 (en) 2010-04-26 2015-03-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of cysteinyl-tRNA synthetase
CA2797362C (en) 2010-04-27 2020-12-08 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of isoleucyl trna synthetases
EP2563382B1 (en) 2010-04-27 2017-06-07 aTyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of threonyl trna synthetases
WO2011139853A2 (en) * 2010-04-28 2011-11-10 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of alanyl trna synthetases
CA2797393C (en) 2010-04-29 2020-03-10 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of valyl trna synthetases
CA2797374C (en) 2010-04-29 2021-02-16 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of asparaginyl trna synthetases
CA2797799C (en) 2010-05-03 2020-12-08 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of seryl-trna synthetases
CN103140233B (zh) 2010-05-03 2017-04-05 Atyr 医药公司 与甲硫氨酰‑tRNA合成酶的蛋白片段相关的治疗、诊断和抗体组合物的发现
CN103096912A (zh) 2010-05-03 2013-05-08 Atyr医药公司 与苯丙氨酰-α-tRNA合成酶的蛋白片段相关的治疗、诊断和抗体组合物的创新发现
US8961961B2 (en) 2010-05-03 2015-02-24 a Tyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of arginyl-tRNA synthetases
US9062301B2 (en) 2010-05-04 2015-06-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutamyl-prolyl-tRNA synthetases
JP6008844B2 (ja) 2010-05-04 2016-10-19 エータイアー ファーマ, インコーポレイテッド p38MULTI−tRNA合成酵素複合体のタンパク質フラグメントに関連した治療用、診断用および抗体組成物の革新的発見
EP2568996B1 (en) 2010-05-14 2017-10-04 aTyr Pharma, Inc. Therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-beta-trna synthetases
CN103096914B (zh) 2010-05-17 2015-08-12 Atyr医药公司 与亮氨酰-tRNA合成酶的蛋白片段相关的治疗、诊断和抗体组合物的创新发现
CA2800375C (en) 2010-05-27 2021-03-09 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutaminyl-trna synthetases
EP2575857B1 (en) 2010-06-01 2018-01-24 aTyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of lysyl-trna synthetases
US8999321B2 (en) 2010-07-12 2015-04-07 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-tRNA synthetases
WO2012009289A2 (en) 2010-07-12 2012-01-19 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of aspartyl-trna synthetases
EP2593125B1 (en) 2010-07-12 2017-11-01 aTyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-trna synthetases
US20130202576A1 (en) 2010-07-12 2013-08-08 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-trna synthetases
AU2011293294B2 (en) 2010-08-25 2016-03-24 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Tyrosyl-tRNA synthetases
CA2812795C (en) 2010-10-06 2021-08-31 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of tryptophanyl trna synthetases
US8658394B2 (en) * 2011-02-02 2014-02-25 Waterstone Pharmaceuticals Methods, cells and systems for incorporating non-canonical amino acids into proteins
US9714419B2 (en) 2011-08-09 2017-07-25 Atyr Pharma, Inc. PEGylated tyrosyl-tRNA synthetase polypeptides
US9816084B2 (en) 2011-12-06 2017-11-14 Atyr Pharma, Inc. Aspartyl-tRNA synthetases
US9822353B2 (en) 2011-12-06 2017-11-21 Atyr Pharma, Inc. PEGylated aspartyl-tRNA synthetase polypeptides
WO2013115926A2 (en) 2011-12-29 2013-08-08 Atyr Pharma, Inc. Aspartyl-trna synthetase-fc conjugates
MX356107B (es) 2012-02-16 2018-05-15 Atyr Pharma Inc Histidil-arnt sintetasas para tratar enfermedades autoinmunes e inflamatorias.
HK1211208A1 (zh) 2012-08-22 2016-05-20 Immunogen, Inc. 細胞毒性苯並二氮呯衍生物
CN105378075B (zh) 2013-03-15 2022-04-05 Atyr 医药公司 组氨酰-trna合成酶-fc缀合物
KR101646728B1 (ko) * 2014-08-27 2016-08-09 동국대학교 산학협력단 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법
EP3259354A4 (en) * 2015-02-17 2018-07-25 California Institute of Technology Cell-free biomolecular breadboards and related methods and arrangements
US10676723B2 (en) 2015-05-11 2020-06-09 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US11129906B1 (en) 2016-12-07 2021-09-28 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
TWI911136B (zh) 2017-03-29 2026-01-11 開曼群島商北極星藥業集團股份有限公司 蛋白質結合物
CN110536694A (zh) 2017-04-20 2019-12-03 Atyr 医药公司 用于治疗肺部炎症的组合物和方法
EP4126058A1 (en) 2020-03-31 2023-02-08 Protomer Technologies Inc. Conjugates for selective responsiveness to vicinal diols
AR121891A1 (es) 2020-04-22 2022-07-20 Merck Sharp & Dohme CONJUGADOS DE INTERLEUCINA 2 HUMANA SESGADOS AL DÍMERO DEL RECEPTOR DE INTERLEUCINA 2 bgᶜ Y CONJUGADOS CON UN POLÍMERO HIDROSOLUBLE NO PEPTÍDICO
CN112062820B (zh) * 2020-08-24 2023-05-26 黑龙江八一农垦大学 大肠杆菌重组外膜蛋白a包涵体蛋白的复性纯化方法
JP2024500284A (ja) 2020-11-19 2024-01-09 プロトマー・テクノロジーズ・インコーポレイテッド 芳香族ホウ素含有化合物及びインスリン類似体
WO2023196596A2 (en) * 2022-04-08 2023-10-12 Absci Corporation Trna synthetases and methods of use thereof
WO2023225534A1 (en) 2022-05-18 2023-11-23 Protomer Technologies Inc. Aromatic boron-containing compounds and related insulin analogs

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0073657A1 (en) 1981-08-31 1983-03-09 Genentech, Inc. Preparation of hepatitis B surface antigen in yeast
EP0284044A1 (en) 1987-03-23 1988-09-28 Zymogenetics, Inc. High level expression in yeast
EP0329203A1 (en) 1983-02-22 1989-08-23 Chiron Corporation Yeast expression systems with vectors having PyK promoters, and synthesis of foreign protein
WO2002085923A2 (en) 2001-04-19 2002-10-31 The Scripps Research Institute In vivo incorporation of unnatural amino acids

Family Cites Families (189)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
US4289872A (en) 1979-04-06 1981-09-15 Allied Corporation Macromolecular highly branched homogeneous compound based on lysine units
FR2504010B1 (fr) 1981-04-15 1985-10-25 Sanofi Sa Medicaments anticancereux contenant la chaine a de la ricine associee a un anticorps antimelanome et procede pour leur preparation
US4551433A (en) 1981-05-18 1985-11-05 Genentech, Inc. Microbial hybrid promoters
JPS57206622A (en) 1981-06-10 1982-12-18 Ajinomoto Co Inc Blood substitute
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
DE3374837D1 (en) 1982-02-17 1988-01-21 Ciba Geigy Ag Lipids in the aqueous phase
US4671958A (en) 1982-03-09 1987-06-09 Cytogen Corporation Antibody conjugates for the delivery of compounds to target sites
DE3218121A1 (de) 1982-05-14 1983-11-17 Leskovar, Peter, Dr.-Ing., 8000 München Arzneimittel zur tumorbehandlung
US4511503A (en) 1982-12-22 1985-04-16 Genentech, Inc. Purification and activity assurance of precipitated heterologous proteins
US4511502A (en) 1982-12-22 1985-04-16 Genentech, Inc. Purification and activity assurance of precipitated heterologous proteins
US4512922A (en) 1982-12-22 1985-04-23 Genentech, Inc. Purification and activity assurance of precipitated heterologous proteins
US4876197A (en) 1983-02-22 1989-10-24 Chiron Corporation Eukaryotic regulatable transcription
US5089398A (en) 1983-02-22 1992-02-18 Chiron Corporation Enhanced yeast transcription employing hybrid GAPDH promoter region constructs
US4755465A (en) 1983-04-25 1988-07-05 Genentech, Inc. Secretion of correctly processed human growth hormone in E. coli and Pseudomonas
US4859600A (en) 1983-04-25 1989-08-22 Genentech, Inc. Recombinant procaryotic cell containing correctly processed human growth hormone
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
US4689406A (en) 1983-08-10 1987-08-25 Amgen Enhancement of microbial expression of polypeptides
DE3483949D1 (de) 1983-09-26 1991-02-21 Udo Dr Med Ehrenfeld Mittel und erzeugnis fuer die diagnose und therapie von tumoren sowie zur behandlung von schwaechen der zelligen und humoralen immunabwehr.
US4880734A (en) 1984-05-11 1989-11-14 Chiron Corporation Eukaryotic regulatable transcription
US4542225A (en) 1984-08-29 1985-09-17 Dana-Farber Cancer Institute, Inc. Acid-cleavable compound
US4738921A (en) 1984-09-27 1988-04-19 Eli Lilly And Company Derivative of the tryptophan operon for expression of fused gene products
US4659839A (en) 1984-10-10 1987-04-21 Mallinckrodt, Inc. Coupling agents for radiolabeled antibody fragments
US4837148A (en) 1984-10-30 1989-06-06 Phillips Petroleum Company Autonomous replication sequences for yeast strains of the genus pichia
DE3675588D1 (de) 1985-06-19 1990-12-20 Ajinomoto Kk Haemoglobin, das an ein poly(alkenylenoxid) gebunden ist.
US4680338A (en) 1985-10-17 1987-07-14 Immunomedics, Inc. Bifunctional linker
US4699784A (en) 1986-02-25 1987-10-13 Center For Molecular Medicine & Immunology Tumoricidal methotrexate-antibody conjugate
US5186933A (en) 1986-12-30 1993-02-16 Baylor College Of Medicine Synthesis and immunogenicity of rotavirus genes using a baculovirus expression system
WO1988007082A1 (en) 1987-03-16 1988-09-22 American Biogenetic Sciences, Inc. Recombinant baculovirus occlusion bodies in vaccines and biological insecticides
US5229490A (en) 1987-05-06 1993-07-20 The Rockefeller University Multiple antigen peptide system
WO1989001037A1 (en) 1987-07-24 1989-02-09 Cetus Corporation Production of ricin toxins in a baculovirus-insect cell expression system
AU2251488A (en) 1987-07-24 1989-03-01 Cetus Corporation Production of biologically active forms of csf using a baculovirus (acnpv)-insect cell expression system
US5080891A (en) 1987-08-03 1992-01-14 Ddi Pharmaceuticals, Inc. Conjugates of superoxide dismutase coupled to high molecular weight polyalkylene glycols
US4929555A (en) 1987-10-19 1990-05-29 Phillips Petroleum Company Pichia transformation
US4904584A (en) 1987-12-23 1990-02-27 Genetics Institute, Inc. Site-specific homogeneous modification of polypeptides
CA1340772C (en) 1987-12-30 1999-09-28 Patricia Tekamp-Olson Expression and secretion of heterologous protiens in yeast employing truncated alpha-factor leader sequences
US5674706A (en) 1988-05-06 1997-10-07 Chiron Corporation High level expression of proteins in yeast
CA1324969C (en) 1988-05-06 1993-12-07 Jeffrey R. Shuster High level expression of proteins in yeast
FR2631974B1 (fr) 1988-05-31 1992-12-11 Agronomique Inst Nat Rech Baculovirus modifie, son procede de preparation et son application en tant que vecteur d'expression de genes
WO1990001556A1 (en) 1988-08-05 1990-02-22 Mount Sinai School Of Medicine Of The City University Of New York In vivo infection of live insects with a recombinant baculovirus
GB8819453D0 (en) 1988-08-16 1988-09-21 Roy P Production of bluetongue virus non-structural proteins using baculovirus expression vector
NZ230425A (en) 1988-09-02 1992-07-28 Molecular Eng Ass Production of paramyxovirus fusion (f) protein using recombinant baculovirus expression vector
EP0397834B1 (en) 1988-10-28 2000-02-02 Genentech, Inc. Method for identifying active domains and amino acid residues in polypeptides and hormone variants
US6780613B1 (en) 1988-10-28 2004-08-24 Genentech, Inc. Growth hormone variants
AU649217B2 (en) 1988-11-18 1994-05-19 Regents Of The University Of California, The Method for site-specifically incorporating unnatural amino acids into proteins
EP0401384B1 (en) 1988-12-22 1996-03-13 Kirin-Amgen, Inc. Chemically modified granulocyte colony stimulating factor
US4902502A (en) 1989-01-23 1990-02-20 Cetus Corporation Preparation of a polymer/interleukin-2 conjugate
WO1990010078A1 (en) 1989-02-23 1990-09-07 University Of Ottawa Improved baculovirus expression system capable of producing foreign gene proteins at high levels
EP0460071A4 (en) 1989-02-24 1993-02-03 Cell Analysis Systems, Inc. Method and apparatus for determining a proliferation index of a cell sample
US5324844A (en) 1989-04-19 1994-06-28 Enzon, Inc. Active carbonates of polyalkylene oxides for modification of polypeptides
EP0470128B2 (en) 1989-04-19 2003-08-13 Enzon, Inc. Active carbonates of polyalkylene oxides for modification of polypeptides
US5122614A (en) 1989-04-19 1992-06-16 Enzon, Inc. Active carbonates of polyalkylene oxides for modification of polypeptides
WO1990014428A1 (en) 1989-05-17 1990-11-29 University Of Georgia Research Foundation, Inc. Improved baculovirus expression vectors
FR2649120B1 (fr) 1989-06-30 1994-01-28 Cayla Nouvelle souche et ses mutants de champignons filamenteux, procede de production de proteines recombinantes a l'aide de ladite souche et souches et proteines obtenues selon ce procede
US5162601A (en) 1989-11-22 1992-11-10 The Upjohn Company Plant potyvirus expression vector with a gene for protease
US5312808A (en) 1989-11-22 1994-05-17 Enzon, Inc. Fractionation of polyalkylene oxide-conjugated hemoglobin solutions
US5219564A (en) 1990-07-06 1993-06-15 Enzon, Inc. Poly(alkylene oxide) amino acid copolymers and drug carriers and charged copolymers based thereon
FR2664905B1 (fr) 1990-07-18 1994-08-12 Agronomique Inst Nat Rech Baculovirus modifie, son procede d'obtention, et vecteurs d'expression obtenus a partir dudit baculovirus.
WO1992001800A1 (en) 1990-07-20 1992-02-06 Chiron Corporation Method for integrative transformation of yeast using dispersed repetitive elements
EP0541721A4 (en) 1990-08-02 1993-12-29 Chiron Corporation Expression of human cmv glycoprotein-h using the baculovirus-insect cell expression system
EP0548267A4 (en) 1990-09-04 1994-11-23 Salk Inst Biotech Ind Production of insulin-like growth factor-1 in methylotrophic yeast cells
US5492821A (en) 1990-11-14 1996-02-20 Cargill, Inc. Stabilized polyacrylic saccharide protein conjugates
US5252714A (en) 1990-11-28 1993-10-12 The University Of Alabama In Huntsville Preparation and use of polyethylene glycol propionaldehyde
CA2405246A1 (en) 1990-12-03 1992-06-11 Genentech, Inc. Enrichment method for variant proteins with alterred binding properties
US5231178A (en) 1991-01-16 1993-07-27 The Salk Institute Biotechnology/Industrial Associates, Inc. Method for the purification of intact, correctly-folded insulin-like growth factor-1
WO1992016555A1 (en) 1991-03-18 1992-10-01 Enzon, Inc. Hydrazine containing conjugates of polypeptides and glycopolypeptides with polymers
WO1992016619A1 (en) 1991-03-19 1992-10-01 Us Army Expression of influenza nucleoprotein antigens in baculovirus
US5595732A (en) 1991-03-25 1997-01-21 Hoffmann-La Roche Inc. Polyethylene-protein conjugates
US6013433A (en) 1991-04-26 2000-01-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Baculovirus expression vectors and recombinant antigens for detecting type-specific antibodies to herpes simplex virus
US5281698A (en) 1991-07-23 1994-01-25 Cetus Oncology Corporation Preparation of an activated polymer ester for protein conjugation
US5290686A (en) 1991-07-31 1994-03-01 The United States Of America As Represented By The Department Of Health And Human Services Expression of influenza a M2 protein in baculovirus
IT1260468B (it) 1992-01-29 1996-04-09 Metodo per mantenere l'attivita' di enzimi proteolitici modificati con polietilenglicole
CA2118130A1 (en) 1992-04-14 1993-10-28 Jean M. J. Frechet Dendritic based macromolecules and method of production
US5516657A (en) 1992-05-11 1996-05-14 Cambridge Biotech Corporation Baculovirus vectors for expression of secretory and membrane-bound proteins
ZA933926B (en) 1992-06-17 1994-01-03 Amgen Inc Polyoxymethylene-oxyethylene copolymers in conjuction with blomolecules
AU5006993A (en) 1992-08-21 1994-03-15 Enzon, Inc. Novel attachment of polyalkylene oxides to bio-effecting substances
US5382657A (en) 1992-08-26 1995-01-17 Hoffmann-La Roche Inc. Peg-interferon conjugates
US5298643A (en) 1992-12-22 1994-03-29 Enzon, Inc. Aryl imidate activated polyalkylene oxides
AU6029594A (en) 1993-01-15 1994-08-15 Enzon, Inc. Factor viii - polymeric conjugates
US5349001A (en) 1993-01-19 1994-09-20 Enzon, Inc. Cyclic imide thione activated polyalkylene oxides
US5321095A (en) 1993-02-02 1994-06-14 Enzon, Inc. Azlactone activated polyalkylene oxides
US5532142A (en) 1993-02-12 1996-07-02 Board Of Regents, The University Of Texas System Method of isolation and purification of fusion polypeptides
IL104734A0 (en) 1993-02-15 1993-06-10 Univ Bar Ilan Bioactive conjugates of cellulose with amino compounds
WO1994028024A1 (en) 1993-06-01 1994-12-08 Enzon, Inc. Carbohydrate-modified polymer conjugates with erythropoietic activity
WO1995000162A1 (en) 1993-06-21 1995-01-05 Enzon, Inc. Site specific synthesis of conjugated peptides
GB9317618D0 (en) 1993-08-24 1993-10-06 Royal Free Hosp School Med Polymer modifications
US5762939A (en) 1993-09-13 1998-06-09 Mg-Pmc, Llc Method for producing influenza hemagglutinin multivalent vaccines using baculovirus
US5919455A (en) 1993-10-27 1999-07-06 Enzon, Inc. Non-antigenic branched polymer conjugates
US5643575A (en) 1993-10-27 1997-07-01 Enzon, Inc. Non-antigenic branched polymer conjugates
US5491076A (en) 1993-11-01 1996-02-13 The Texas A&M University System Expression of foreign genes using a replicating polyprotein producing virus vector
US5605792A (en) 1993-11-04 1997-02-25 The Ohio State University Research Foundation Infectious bursal disease virus VP2 fusion protein expressed by baculovirus, use as diagnostic
US5951974A (en) 1993-11-10 1999-09-14 Enzon, Inc. Interferon polymer conjugates
KR960705579A (ko) 1993-11-10 1996-11-08 에릭에스. 딕커 개선된 인터페론 중합체 결합체(Improved interferon polymer conjugates)
US5446090A (en) 1993-11-12 1995-08-29 Shearwater Polymers, Inc. Isolatable, water soluble, and hydrolytically stable active sulfones of poly(ethylene glycol) and related polymers for modification of surfaces and molecules
FR2715664B1 (fr) 1994-01-31 1996-04-12 Proteine Performance Sa Baculovirus recombinant et son utilisation pour la production d'anticorps monoclonaux.
JP3090586B2 (ja) 1994-03-15 2000-09-25 片倉工業株式会社 システインプロテアーゼ遺伝子欠損バキュロウイルスおよびその製造法並びにこれを利用する有用タンパク質の製造法
US5473034A (en) 1994-03-18 1995-12-05 Hyogo Prefectural Government Method for producing protein-synthetic polymer conjugate and said conjugate produced thereby
US5629384A (en) 1994-05-17 1997-05-13 Consiglio Nazionale Delle Ricerche Polymers of N-acryloylmorpholine activated at one end and conjugates with bioactive materials and surfaces
WO1995033490A1 (en) 1994-06-02 1995-12-14 Enzon, Inc. Method of solubilizing substantially water insoluble materials
US5730990A (en) 1994-06-24 1998-03-24 Enzon, Inc. Non-antigenic amine derived polymers and polymer conjugates
US6403375B1 (en) 1994-08-24 2002-06-11 Boyce Thompson Institute For Plant Research, Inc. Establishment of Trichoplusia ni cell lines in serum-free medium for recombinant protein and baculovirus production
US5650234A (en) 1994-09-09 1997-07-22 Surface Engineering Technologies, Division Of Innerdyne, Inc. Electrophilic polyethylene oxides for the modification of polysaccharides, polypeptides (proteins) and surfaces
US5871986A (en) 1994-09-23 1999-02-16 The General Hospital Corporation Use of a baculovirus to express and exogenous gene in a mammalian cell
US5824784A (en) 1994-10-12 1998-10-20 Amgen Inc. N-terminally chemically modified protein compositions and methods
WO1996041813A2 (en) 1994-11-09 1996-12-27 Offord Robin E Functionalized polymers for site-specific attachment
US5738846A (en) 1994-11-10 1998-04-14 Enzon, Inc. Interferon polymer conjugates and process for preparing the same
US5932462A (en) 1995-01-10 1999-08-03 Shearwater Polymers, Inc. Multiarmed, monofunctional, polymer for coupling to molecules and surfaces
WO1996025496A1 (en) 1995-02-17 1996-08-22 Instituut Voor Dierhouderij En Diergezondheid (Id-Dlo) PRODUCTION OF BIOLOGICALLY ACTIVE RECOMBINANT BOVINE FOLLICLE STIMULATING HORMONE (REC bFSH) IN THE BACULOVIRUS EXPRESSION SYSTEM
FR2732035B1 (fr) 1995-03-23 1997-05-30 Agronomique Inst Nat Rech Procede de regulation de l'expression d'un gene dans un baculovirus, par un site de fixation d'un recepteur de l'acide retinoique, et vecteur pour la mise en oeuvre du dit procede
NZ308772A (en) 1995-05-17 1999-04-29 Du Pont Recombinant baculovirus insecticides
AU5893696A (en) 1995-06-07 1996-12-30 Novo Nordisk A/S Modification of polypeptides
US5672662A (en) 1995-07-07 1997-09-30 Shearwater Polymers, Inc. Poly(ethylene glycol) and related polymers monosubstituted with propionic or butanoic acids and functional derivatives thereof for biotechnical applications
WO1997026332A1 (en) 1996-01-17 1997-07-24 Schering Corporation Baculovirus expression system for human interleukin 5 receptor and method of screening for interleukin 5 antagonists
US5861279A (en) 1996-01-17 1999-01-19 Schering Corporation Baculovirus expression system for human interleukin 5 receptor and method of screening for interleukin 5 antagonists
US5747639A (en) 1996-03-06 1998-05-05 Amgen Boulder Inc. Use of hydrophobic interaction chromatography to purify polyethylene glycols
EP1731174A3 (en) 1996-08-02 2007-01-17 Ortho-McNeil Pharmaceutical, Inc. Polypeptides having a covalently bound N-terminal polyethylene glycol via hydrazone or oxime bond
US5980948A (en) 1996-08-16 1999-11-09 Osteotech, Inc. Polyetherester copolymers as drug delivery matrices
US6214966B1 (en) 1996-09-26 2001-04-10 Shearwater Corporation Soluble, degradable poly(ethylene glycol) derivatives for controllable release of bound molecules into solution
DE69725881T2 (de) 1996-12-13 2004-09-09 Chiron Corp. (N.D.Ges.D. Staates Delaware), Emeryville Verfahren zur expression von heterologen proteinen in hefe
DE69800640T2 (de) 1997-01-29 2001-07-05 Polymasc Pharmaceuticals Plc, London Pegylationsverfahren
GB9703406D0 (en) 1997-02-19 1997-04-09 Chiron Spa Expression of heterologous proteins
EP0981548A4 (en) 1997-04-30 2005-11-23 Enzon Inc GLYCOSYLATABLE SINGLE CHAIN ANTIGEN-BINDING PROTEINS, MANUFACTURE AND USE THEREOF
US5990237A (en) 1997-05-21 1999-11-23 Shearwater Polymers, Inc. Poly(ethylene glycol) aldehyde hydrates and related polymers and applications in modifying amines
US5965393A (en) 1997-07-01 1999-10-12 National Institute Of Immunology Method for enhancing foreign gene expression in baculovirus expression vector system
ATE375363T1 (de) 1997-07-14 2007-10-15 Bolder Biotechnology Inc Derivate des wachstumshormons und verwandte proteine
GB9715660D0 (en) 1997-07-25 1997-10-01 Zeneca Ltd Proteins
EP1003889A1 (en) 1997-08-05 2000-05-31 Chiron Corporation NOVEL $i(PICHIA PASTORIS) GENE SEQUENCES AND METHODS FOR THEIR USE
DE19735593C2 (de) 1997-08-15 1999-08-26 Hepavec Ag Fuer Gentherapie Hüllprotein-modifizierter Baculovirus-Vektor für die Gentherapie
US6090584A (en) 1997-08-21 2000-07-18 University Technologies International Inc. Baculovirus artificial chromosomes and methods of use
US5989868A (en) 1997-09-12 1999-11-23 The Board Of Regents Of The University Of Oklahoma Fusion protein systems designed to increase soluble cytoplasmic expression of heterologous proteins in esherichia coli
PT1538206E (pt) 1997-09-16 2010-04-12 Centocor Ortho Biotech Inc Método para a síntese química e construção completa de genes e genomas
US6129912A (en) 1997-09-26 2000-10-10 Uab Research Foundation Polyethylene glycol-protein compositions which reduce the antigenic display of red blood cells
US6201072B1 (en) 1997-10-03 2001-03-13 Macromed, Inc. Biodegradable low molecular weight triblock poly(lactide-co- glycolide) polyethylene glycol copolymers having reverse thermal gelation properties
US6004573A (en) 1997-10-03 1999-12-21 Macromed, Inc. Biodegradable low molecular weight triblock poly(lactide-co-glycolide) polyethylene glycol copolymers having reverse thermal gelation properties
DE19748489A1 (de) 1997-11-03 1999-05-06 Roche Diagnostics Gmbh Polyethylenglykol-derivatisierte Biomoleküle und deren Verwendung in heterogenen Nachweisverfahren
US6448369B1 (en) 1997-11-06 2002-09-10 Shearwater Corporation Heterobifunctional poly(ethylene glycol) derivatives and methods for their preparation
EP0924298A1 (en) 1997-12-18 1999-06-23 Stichting Instituut voor Dierhouderij en Diergezondheid (ID-DLO) Protein expression in baculovirus vector expression systems
US5985263A (en) 1997-12-19 1999-11-16 Enzon, Inc. Substantially pure histidine-linked protein polymer conjugates
US5981709A (en) 1997-12-19 1999-11-09 Enzon, Inc. α-interferon-polymer-conjugates having enhanced biological activity and methods of preparing the same
CA2321261A1 (en) 1998-03-04 1999-09-10 Onyx Pharmaceuticals, Inc. Baculovirus expression system and method for high throughput expression of genetic material
JP2002505338A (ja) 1998-03-05 2002-02-19 カイロン コーポレイション 生物学的に活性な分子の血清半減期を増加するための方法
DK1411075T3 (da) 1998-03-12 2008-10-27 Nektar Therapeutics Al Corp Fremgangsmåde til fremstilling af polymerkonjugater
KR100264953B1 (ko) 1998-04-03 2001-03-02 박현우 재조합 베큘로바이러스, 이의 제조방법 및 이를 포함하는 미생물 살충제
US6451986B1 (en) 1998-06-22 2002-09-17 Immunex Corporation Site specific protein modification
US6168932B1 (en) 1998-07-13 2001-01-02 Parker Hughes Institute Recombinant DTctGMCSF fusion toxin in a baculovirus expression vector system
US6245528B1 (en) 1998-07-28 2001-06-12 Academia Sinica Latent baculovirus expression system
US6368825B1 (en) 1998-08-10 2002-04-09 Academia Sinica Baculovirus containing minimal CMV promoter
US6552167B1 (en) 1998-08-28 2003-04-22 Gryphon Therapeutics, Inc. Polyamide chains of precise length
US6214499B1 (en) * 1998-09-11 2001-04-10 Eastman Kodak Company Liquid crystalline filter dyes for imaging elements
WO2000020032A1 (en) 1998-10-06 2000-04-13 Trustees Of Dartmouth College RECOMBINANT CAT ALLERGEN, Fel dI, EXPRESSED IN BACULOVIRUS FOR DIAGNOSIS AND TREATMENT OF CAT ALLERGY
US6420339B1 (en) 1998-10-14 2002-07-16 Amgen Inc. Site-directed dual pegylation of proteins for improved bioactivity and biocompatibility
DE69936351T2 (de) 1998-10-30 2008-02-21 Novozymes A/S Glykosylierte proteine mit reduzierter allergenität
US6451346B1 (en) 1998-12-23 2002-09-17 Amgen Inc Biodegradable pH/thermosensitive hydrogels for sustained delivery of biologically active agents
US6281211B1 (en) 1999-02-04 2001-08-28 Euro-Celtique S.A. Substituted semicarbazides and the use thereof
US6342216B1 (en) 1999-03-17 2002-01-29 The Board Of Regents, The University Of Texas System Therapy of cancer by insect cells containing recombinant baculovirus encoding genes
US6994986B2 (en) 1999-03-17 2006-02-07 The Board Of Trustees Of The Leland Stanford University In vitro synthesis of polypeptides by optimizing amino acid metabolism
JP4707237B2 (ja) 1999-03-17 2011-06-22 ザ ボード オブ トラスティーズ オブ ザ リーランド スタンフォード ジュニア ユニバーシティ 外因性アミノ酸および新規atp再生システムを用いたインビトロ高分子生合成の方法
US6337191B1 (en) 1999-03-22 2002-01-08 The Board Of Trustees Of The Leland Stanford Junior University Vitro protein synthesis using glycolytic intermediates as an energy source
JP2002542349A (ja) 1999-04-16 2002-12-10 ダブリューエム・マーシュ・ライス・ユニバーシティー ポリ(プロピレンフマラート)−ジアクリレートマクロマーで交差結合された生体分解性のポリ(プロピレンフマラート)ネットワーク
US6261805B1 (en) 1999-07-15 2001-07-17 Boyce Thompson Institute For Plant Research, Inc. Sialyiation of N-linked glycoproteins in the baculovirus expression vector system
US6485937B1 (en) 1999-10-15 2002-11-26 The Rockefeller University System for rapid generation of recombinant baculovirus-based expression vectors for silkworm larvae
CN1298000A (zh) * 1999-11-30 2001-06-06 上海博容基因开发有限公司 一种新的多肽——人Ⅱ类氨酰基-tRN A合成酶9和编码这种多肽的多核苷酸
US6348558B1 (en) 1999-12-10 2002-02-19 Shearwater Corporation Hydrolytically degradable polymers and hydrogels made therefrom
AU781839B2 (en) 1999-12-22 2005-06-16 Nektar Therapeutics Sterically hindered derivatives of water soluble polymers
DK1259563T4 (en) 1999-12-22 2016-11-21 Nektar Therapeutics PROCEDURE FOR PREPARING 1-BENZOTRIAZOLYL CARBONATE ESTERS OF WATER SOLUBLE POLYMERS
US6413507B1 (en) 1999-12-23 2002-07-02 Shearwater Corporation Hydrolytically degradable carbamate derivatives of poly (ethylene glycol)
US6646110B2 (en) 2000-01-10 2003-11-11 Maxygen Holdings Ltd. G-CSF polypeptides and conjugates
WO2001062827A2 (en) 2000-02-22 2001-08-30 Shearwater Corporation N-maleimidyl polymer derivatives
AU2001257577A1 (en) 2000-02-28 2001-09-03 Shearwater Corporation Water-soluble polymer conjugates of artelinic acid
GB0012997D0 (en) 2000-05-26 2000-07-19 Eurogene Limited Gene delivery
US6586207B2 (en) 2000-05-26 2003-07-01 California Institute Of Technology Overexpression of aminoacyl-tRNA synthetases for efficient production of engineered proteins containing amino acid analogues
JP2002030098A (ja) 2000-07-17 2002-01-29 Institute Of Immunology Co Ltd バキュロウィルスの発芽ウイルスからウイルスエンベロープを回収する方法
US6436386B1 (en) 2000-11-14 2002-08-20 Shearwater Corporation Hydroxyapatite-targeting poly (ethylene glycol) and related polymers
TW593427B (en) 2000-12-18 2004-06-21 Nektar Therapeutics Al Corp Synthesis of high molecular weight non-peptidic polymer derivatives
TWI246524B (en) 2001-01-19 2006-01-01 Shearwater Corp Multi-arm block copolymers as drug delivery vehicles
US6908963B2 (en) 2001-10-09 2005-06-21 Nektar Therapeutics Al, Corporation Thioester polymer derivatives and method of modifying the N-terminus of a polypeptide therewith
AU2002352524B2 (en) 2001-11-07 2007-10-04 Nektar Therapeutics Branched polymers and their conjugates
US6716821B2 (en) 2001-12-21 2004-04-06 Immunogen Inc. Cytotoxic agents bearing a reactive polyethylene glycol moiety, cytotoxic conjugates comprising polyethylene glycol linking groups, and methods of making and using the same
AU2003240482B2 (en) 2002-05-30 2009-03-12 The Scripps Research Institute Copper-catalysed ligation of azides and acetylenes
MXPA05003978A (es) * 2002-10-16 2005-06-22 Scripps Research Inst Sintesis de glicoproteinas.
ES2324608T3 (es) 2002-10-16 2009-08-11 The Scripps Research Institute Incorporacion especifica de sitio de cetoaminoacidos en proteinas.
WO2004058946A2 (en) 2002-12-22 2004-07-15 The Scripps Research Institute Protein arrays
WO2004094593A2 (en) 2003-04-17 2004-11-04 The Scripps Research Institute Expanding the eukaryotic genetic code
US20060160175A1 (en) 2003-07-07 2006-07-20 The Scripps Research Institute Compositions of orthogonal leucyl-trna and aminoacyl-trna synthetase pairs and uses thereof
WO2005019415A2 (en) 2003-07-07 2005-03-03 The Scripps Research Institute Compositions of orthogonal lysyl-trna and aminoacyl-trna synthetase pairs and uses thereof
WO2005007624A2 (en) 2003-07-07 2005-01-27 The Scripps Research Institute Compositions of orthogonal glutamyl-trna and aminoacyl trna synthetase pairs and uses thereof
US6972042B2 (en) * 2003-08-28 2005-12-06 Ampu-Clamp Llc Quick-release tube clamp for modular lower limb prosthetic systems and method thereof
EP1675620B1 (en) 2003-10-09 2019-05-08 Ambrx, Inc. Polymer derivatives
EP2327724A3 (en) 2004-02-02 2011-07-27 Ambrx, Inc. Modified human growth hormone polypeptides and their uses

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0073657A1 (en) 1981-08-31 1983-03-09 Genentech, Inc. Preparation of hepatitis B surface antigen in yeast
EP0329203A1 (en) 1983-02-22 1989-08-23 Chiron Corporation Yeast expression systems with vectors having PyK promoters, and synthesis of foreign protein
EP0284044A1 (en) 1987-03-23 1988-09-28 Zymogenetics, Inc. High level expression in yeast
WO2002085923A2 (en) 2001-04-19 2002-10-31 The Scripps Research Institute In vivo incorporation of unnatural amino acids

Non-Patent Citations (45)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology", 1994
"Current Protocols", 1999, GREENE PUBLISHING ASSOCIATES, INC. AND JOHN WILEY & SONS, INC., article "Current Protocols in Molecular Biology"
"Programming peptidomimetic synthetases by translating genetic codes designed de novo", PNAS, vol. 100, no. 11, pages 6353 - 6357
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1995
BERGER; KIMMEL: "Guide to Molecular Cloning Techniques, Methods in Enzymology", vol. 152, ACADEMIC PRESS, INC.
CECH, SCIENCE, vol. 236, 1987, pages 1532 - 1539
CHEMBIOCHEM, vol. 3, no. 11, 2002, pages 1135 - 1137
CORNISH, V. W.; MENDEL, D.; SCHULTZ, P. G., ANGEW. CHEM. INT. ED. ENGL., vol. 34, 1995, pages 621
EDWARDS, H.; SCHIMMEL, P., MOL. CELL. BIOL., vol. 10, 1990, pages 1633 - 1641
ELLMAN, J.A.; MENDEL, D.; SCHULTZ, P.G.: "Site-specific incorporation of novel backbone structures into proteins", SCIENCE, vol. 255, no. 5041, 1992, pages 197 - 200
FENG ET AL.: "Expanding tRNA recognition of a tRNA synthetase by a single amino acid change", PNAS, vol. 100, no. 10, 2003, pages 5676 - 5681
FRANCISCO, J. A. ET AL.: "Production and fluorescence-activated cell sorting of Escherichia coli expressing a functional antibody fragment on the external surface", PROC. NATL. ACAD. SCI. U S A, vol. 90, 1993, pages 10444 - 8
HAMES; HIGGINS: "Gene Probes", 1995, IRL PRESS AT OXFORD UNIVERSITY PRESS, pages: 1
HAMES; HIGGINS: "Gene", 1995, IRL PRESS AT OXFORD UNIVERSITY PRESS
HECHT, S. M. ET AL., J. BIOL. CHEM., vol. 253, 1978, pages 4517
HECHT, S. M., ACC. CHEM. RES., vol. 25, 1992, pages 545
HECKLER, T. G. ET AL., BIOCHEMISTRY, vol. 27, 1988, pages 7254
HESS ET AL., J. ADV. ENZYME REG., vol. 7, 1969, pages 149
HITZEMAN ET AL., J. BIOL. CHEM., vol. 255, 1980, pages 12073
HOLLAND ET AL., BIOCHEMISTRY, vol. 17, 1978, pages 4900
KOBAYASHI ET AL., NATURE STRUCTURAL BIOLOGY, vol. 10, no. 6, 2003, pages 425 - 432
KOWAL, A. K. ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 98, 2001, pages 2268 - 2273
KRIEGLER, GENE TRANSFER AND EXPRESSION: A LABORATORY MANUAL, 1990
L. WANG; P. G. SCHULTZ, CHEM. COMM., vol. 1, 2002, pages 1 - 11
LIU, D. R.; SCHULTZ, P. G., PROC. NATL. ACAD. SCI. U. S. A., vol. 96, 1999, pages 4780 - 4785
LOHSE ET AL., NATURE, vol. 381, 1996, pages 442 - 444
LUCKOW; SUMMERS, VIROLOGY
M. IBBA; H. HENNECKE, FEBS LETT., vol. 364, 1995, pages 272
M. IBBA; P. KAST; H. HENNECKE, BIOCHEMISTRY, vol. 33, 1994, pages 7107
MCCORKLE ET AL., CONCEPTS BIOCHEM., vol. 64, 1987, pages 221 - 226
MILLER, ANN. REV. MICROBIOL., vol. 42, 1988, pages 177
MIYANOHARA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 1
N. BUDISA ET AL., FASEB J., vol. 13, 1999, pages 41
NOREN, C. J. ET AL., PROTEIN GENE
OHNO, S. ET AL., J. BIOCHEM., vol. 124, 1998, pages 1065 - 1068
O'REILLY ET AL., BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL, 1992
PASTMAK, M ET AL., HELV. CHIM. ACTA, vol. 83, 2000, pages 2277 - 2286
RAIBAUD ET AL., ANNU. REV. GENET., vol. 18, 1984, pages 173
ROBERTSON, S. A.; ELLMAN, J. A.; SCHULTZ, P. G., J. AM. CHEM. SOC., vol. 113, 1991, pages 2722
SAKAMOTO, K. ET AL., NUCLEIC ACIDS RES., vol. 30, 2002, pages 4692 - 4699
SAMBROOK ET AL.: "Molecular Cloning - A Laboratory Manual", vol. 1-3, 1989, COLD SPRING HARBOR LABORATORY, COLD SPRING HARBOR
SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 2001
SAYERS, J.R.; SCHMIDT, W. ECKSTEIN, F.: "Exonucleases in phosphorothioate-based olignoucleotide-directed mutagensis", NUCLEIC ACIDS RES, vol. 16, no. 3, 1988, pages 791 - 802
TIJSSEN: "Overview of principles of hybridization and the strategy of nucleic acid probe assays", vol. I, 1993, ELSEVIER, article "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes"
TLLANGAKEKARE ET AL., SCIENCE, vol. 267, 1995, pages 643 - 647

Cited By (78)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9133457B2 (en) 2004-05-17 2015-09-15 California Institute Of Technology Methods of incorporating amino acid analogs into proteins
AU2005335491B2 (en) * 2005-08-18 2010-11-25 Ambrx, Inc. Compositions of tRNA and uses thereof
EP1937824A4 (en) * 2005-08-18 2009-06-17 Ambrx Inc TRNA COMPOSITIONS AND ITS USES
US7632823B2 (en) * 2005-08-18 2009-12-15 Ambrx, Inc. Compositions of tRNA and uses thereof
US8518666B2 (en) 2006-03-03 2013-08-27 California Institute Of Technology Site-specific incorporation of amino acids into molecules
US8980581B2 (en) 2006-03-03 2015-03-17 California Institute Of Technology Site-specific incorporation of amino acids into molecules
AU2007292891B2 (en) * 2006-09-08 2012-04-12 Ambrx, Inc. Site specific incorporation of non-natural amino acids by vertebrate cells
JP2010502221A (ja) * 2006-09-08 2010-01-28 アンブルックス,インコーポレイテッド 脊椎動物細胞による非天然アミノ酸の部位特異的組み込み
EP2064316A4 (en) * 2006-09-08 2009-09-30 Ambrx Inc LOCAL SPECIFIC INKORPORATION OF NON-NATURAL AMINO ACIDS IN SWIVELING CELLS
US9975936B2 (en) 2007-03-30 2018-05-22 Ambrx, Inc. Nucleic acids encoding modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US10377805B2 (en) 2007-03-30 2019-08-13 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally encoding amino acids and their uses
US11993637B2 (en) 2007-03-30 2024-05-28 Ambrx, Inc. Modified FGF-21 polypeptides with non-naturally encoded amino acids
US10961291B2 (en) 2007-03-30 2021-03-30 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US8114630B2 (en) 2007-05-02 2012-02-14 Ambrx, Inc. Modified interferon beta polypeptides and their uses
WO2009067636A2 (en) 2007-11-20 2009-05-28 Ambrx, Inc. Modified insulin polypeptides and their uses
EP2930182A1 (en) 2007-11-20 2015-10-14 Ambrx, Inc. Modified insulin polypeptides and their uses
EP2231856A4 (en) * 2007-12-11 2011-05-18 Scripps Research Inst IN VIVO EXPRESSION OF NON-NATURAL AMINO ACIDS IN THE METHYLOTROPHIC YEAST PICHIA PASTORIS
WO2009075847A2 (en) 2007-12-11 2009-06-18 The Scripps Research Institute In vivo unnatural amino acid expression in the methylotrophic yeast pichia pastoris
US8647840B2 (en) 2007-12-11 2014-02-11 The Scripps Research Institute In vivo unnatural amino acid expression in the methylotrophic yeast Pichia pastoris
JP2014039554A (ja) * 2007-12-11 2014-03-06 Scripps Research Inst メタノール資化性酵母ピキア・パストリスにおけるインビボ非天然アミノ酸発現
AU2008335778B2 (en) * 2007-12-11 2014-04-10 The Scripps Research Institute In vivo unnatural amino acid expression in the methylotrophic yeast Pichia pastoris
US9732349B2 (en) 2007-12-11 2017-08-15 The Scripps Research Institute In vivo unnatural amino acid expression in the methylotrophic yeast Pichia pastoris
JP2016144469A (ja) * 2007-12-11 2016-08-12 ザ スクリプス リサーチ インスティテュート メタノール資化性酵母ピキア・パストリスにおけるインビボ非天然アミノ酸発現
CN105647824A (zh) * 2007-12-11 2016-06-08 斯克利普斯研究院 甲基营养酵母菌巴斯德毕赤酵母中的体内非天然氨基酸表达
JP2011527886A (ja) * 2007-12-11 2011-11-10 ザ スクリプス リサーチ インスティチュート メタノール資化性酵母ピキア・パストリスにおけるインビボ非天然アミノ酸発現
EP2889370A1 (en) * 2007-12-11 2015-07-01 The Scripps Research Institute In vivo unnatural amino acid expression in the methylotrophic yeast Pichia pastoris
US10138283B2 (en) 2008-07-23 2018-11-27 Ambrx, Inc. Modified bovine G-CSF polypeptides and their uses
WO2010011735A2 (en) 2008-07-23 2010-01-28 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
EP3225248A1 (en) 2008-07-23 2017-10-04 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
US9109022B2 (en) 2008-12-10 2015-08-18 The Scripps Research Institute Production of carrier-peptide conjugates using chemically reactive unnatural amino acids
US8637306B2 (en) 2008-12-10 2014-01-28 The Scripps Research Institute Production of carrier-peptide conjugates using chemically reactive unnatural amino acids
JP2012511326A (ja) * 2008-12-10 2012-05-24 ザ スクリプス リサーチ インスティチュート 化学的に反応性の非天然アミノ酸を使用するキャリア−ペプチド接合体の製造
EP2370473A4 (en) * 2008-12-10 2013-03-06 Scripps Research Inst PREPARATION OF CARRIER PEPTIDE CONJUGATES DUE TO CHEMICALLY REACTIVE UNNATURATED AMINO ACIDS
US8609383B2 (en) 2008-12-10 2013-12-17 The Scripps Research Institute Production of carrier-peptide conjugates using chemically reactive unnatural amino acids
US9879249B2 (en) 2009-02-17 2018-01-30 Redwood Bioscience, Inc. Aldehyde-tagged protein-based drug carriers and methods of use
EP2805965A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified porcine somatotropin polypeptides and their uses
EP2805964A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified bovine somatotropin polypeptides and their uses
US9962450B2 (en) 2010-08-17 2018-05-08 Ambrx, Inc. Method of treating heart failure with modified relaxin polypeptides
US11786578B2 (en) 2010-08-17 2023-10-17 Ambrx, Inc. Modified relaxin polypeptides and their uses
EP4302783A2 (en) 2010-08-17 2024-01-10 Ambrx, Inc. Modified relaxin polypeptides and their uses
US11439710B2 (en) 2010-08-17 2022-09-13 Ambrx, Inc. Nucleic acids encoding modified relaxin polypeptides
US11311605B2 (en) 2010-08-17 2022-04-26 Ambrx, Inc. Methods of treating heart failure and fibrotic disorders using modified relaxin polypeptides
US10702588B2 (en) 2010-08-17 2020-07-07 Ambrx, Inc. Modified relaxin polypeptides comprising a non-naturally encoded amino acid in the A chain
US10253083B2 (en) 2010-08-17 2019-04-09 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
US10751391B2 (en) 2010-08-17 2020-08-25 Ambrx, Inc. Methods of treatment using modified relaxin polypeptides comprising a non-naturally encoded amino acid
WO2012024452A2 (en) 2010-08-17 2012-02-23 Ambrx, Inc. Modified relaxin polypeptides and their uses
US11273202B2 (en) 2010-09-23 2022-03-15 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
US12138296B2 (en) 2010-09-23 2024-11-12 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
US10183998B2 (en) 2011-01-14 2019-01-22 Redwood Bioscience, Inc. Aldehyde-tagged immunoglobulin polypeptides and methods of use thereof
WO2014146575A1 (en) 2013-03-19 2014-09-25 Beijing Shenogen Pharma Group Ltd. Antibodies and methods for treating estrogen receptor-associated diseases
US12247058B2 (en) 2014-10-24 2025-03-11 Bristol-Myers Squibb Company Nucleic acids encoding modified FGF-21 polypeptides, vectors and cells containing, and use thereof
US10377806B2 (en) 2014-10-24 2019-08-13 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides and uses thereof
US10189883B2 (en) 2014-10-24 2019-01-29 Bristol-Myers Squibb Company Therapeutic uses of modified FGF-21 polypeptides
EP3909596A1 (en) 2014-10-24 2021-11-17 Bristol-Myers Squibb Company Modified fgf-21 polypeptides and uses thereof
WO2016065326A2 (en) 2014-10-24 2016-04-28 Bristol-Myers Squibb Company Modified fgf-21 polypeptides and uses thereof
US11248031B2 (en) 2014-10-24 2022-02-15 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides
EP3412302A1 (en) 2014-10-24 2018-12-12 Bristol-Myers Squibb Company Modified fgf-21 polypeptides and uses thereof
US11788066B2 (en) 2016-04-26 2023-10-17 R.P. Scherer Technologies, Llc Antibody conjugates and methods of making and using the same
US11208632B2 (en) 2016-04-26 2021-12-28 R.P. Scherer Technologies, Llc Antibody conjugates and methods of making and using the same
US11185570B2 (en) 2017-02-08 2021-11-30 Bristol-Myers Squibb Company Method of treating cardiovascular disease and heart failure with modified relaxin polypeptides
US12097242B2 (en) 2017-02-08 2024-09-24 Bristol-Myers Squibb Company Treatment of fibrosis, cardiovascular disease and heart failure with modified relaxin polypeptides
US11364281B2 (en) 2017-02-08 2022-06-21 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and pharmaceutical compositions thereof
WO2018148419A1 (en) 2017-02-08 2018-08-16 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof
US10266578B2 (en) 2017-02-08 2019-04-23 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof
US12097241B2 (en) 2017-02-08 2024-09-24 Bristol-Myers Squibb Company Methods of treating kidney failure, and/or improving or stablizing renal function using modified relaxin polypeptides
US11851662B2 (en) 2017-06-02 2023-12-26 Ambrx, Inc. Methods and compositions for promoting non-natural amino acid-containing protein production
WO2018223108A1 (en) 2017-06-02 2018-12-06 Ambrx, Inc. Methods and compositions for promoting non-natural amino acid-containing protein production
US12577575B2 (en) 2017-06-02 2026-03-17 Ambrx, Inc. Methods and compositions for promoting non-natural amino acid-containing protein production
EP4382124A2 (en) 2017-06-02 2024-06-12 Ambrx, Inc. Methods and compositions for promoting non-natural amino acid-containing protein production
WO2020056066A1 (en) 2018-09-11 2020-03-19 Ambrx, Inc. Interleukin-2 polypeptide conjugates and their uses
EP4389145A2 (en) 2018-09-11 2024-06-26 Ambrx, Inc. Interleukin-2 polypeptide conjugates and their uses
WO2020082057A1 (en) 2018-10-19 2020-04-23 Ambrx, Inc. Interleukin-10 polypeptide conjugates, dimers thereof, and their uses
WO2021183832A1 (en) 2020-03-11 2021-09-16 Ambrx, Inc. Interleukin-2 polypeptide conjugates and methods of use thereof
WO2024077277A1 (en) 2022-10-07 2024-04-11 Ambrx, Inc. Drug linkers and antibody conjugates thereof
WO2024155627A1 (en) 2023-01-16 2024-07-25 Ambrx, Inc. Anti-cd70 antibody-drug conjugates
WO2024178310A1 (en) 2023-02-23 2024-08-29 Ambrx, Inc. Trop2-directed antibody-drug conjugates and uses thereof
WO2024241086A1 (en) 2023-05-24 2024-11-28 Ambrx, Inc. Pegylated bovine interferon lambda and methods of use thereof
WO2025041055A1 (en) 2023-08-22 2025-02-27 Ambrx, Inc. Anti-psma adc conjugate compositions and methods of use thereof

Also Published As

Publication number Publication date
US7838265B2 (en) 2010-11-23
US7846689B2 (en) 2010-12-07
EP1836298B1 (en) 2012-01-18
US7883866B2 (en) 2011-02-08
US20100174054A1 (en) 2010-07-08
HK1111722A1 (en) 2008-08-15
CN102732588B (zh) 2015-01-07
WO2006068802A3 (en) 2007-03-08
CN101087875A (zh) 2007-12-12
NZ555425A (en) 2010-04-30
JP2008525024A (ja) 2008-07-17
AU2005319518A1 (en) 2006-06-29
BRPI0519568A2 (pt) 2009-01-27
US7736872B2 (en) 2010-06-15
US7858344B2 (en) 2010-12-28
MX2007007581A (es) 2007-07-24
GB0713653D0 (en) 2007-08-22
US20090123971A1 (en) 2009-05-14
CN102732588A (zh) 2012-10-17
CA2590429C (en) 2014-10-07
US20100173380A1 (en) 2010-07-08
JP4990792B2 (ja) 2012-08-01
KR20070092287A (ko) 2007-09-12
ATE541934T1 (de) 2012-02-15
IL183342A (en) 2012-03-29
CN101087875B (zh) 2012-08-22
AU2005319518B2 (en) 2010-09-09
US20100184140A1 (en) 2010-07-22
US7829310B2 (en) 2010-11-09
EP1836298A2 (en) 2007-09-26
BRPI0519568C8 (pt) 2022-06-14
CN102719366A (zh) 2012-10-10
CA2590429A1 (en) 2006-06-29
US20100173379A1 (en) 2010-07-08
BRPI0519568B8 (pt) 2021-05-25
IL183342A0 (en) 2007-09-20
ZA200704927B (en) 2009-09-30
CN102719366B (zh) 2014-07-16
BRPI0519568B1 (pt) 2020-09-24
EP1836298A4 (en) 2008-07-09
KR101252835B1 (ko) 2013-04-10
GB2436765A (en) 2007-10-03
US20100167347A1 (en) 2010-07-01

Similar Documents

Publication Publication Date Title
EP1836298B1 (en) COMPOSITIONS OF AMINOACYL-tRNA SYNTHETASE AND USES THEREOF
EP1937824B1 (en) COMPOSITIONS OF tRNA AND USES THEREOF
HK1122843B (en) Compositions of trna and uses thereof
HK1111722B (en) Compositions of aminoacyl-trna synthetase and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 183342

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2590429

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 555425

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2005319518

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2005319518

Country of ref document: AU

Date of ref document: 20051201

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/a/2007/007581

Country of ref document: MX

Ref document number: 2007548250

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2005319518

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 200580044434.0

Country of ref document: CN

Ref document number: 2739/CHENP/2007

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 0713653

Country of ref document: GB

Kind code of ref document: A

Free format text: PCT FILING DATE = 20051201

WWE Wipo information: entry into national phase

Ref document number: 2005852740

Country of ref document: EP

Ref document number: 0713653.4

Country of ref document: GB

WWE Wipo information: entry into national phase

Ref document number: 1020077016502

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2005852740

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0519568

Country of ref document: BR