WO2005078074A2 - Protease variants - Google Patents

Protease variants Download PDF

Info

Publication number
WO2005078074A2
WO2005078074A2 PCT/DK2005/000097 DK2005000097W WO2005078074A2 WO 2005078074 A2 WO2005078074 A2 WO 2005078074A2 DK 2005000097 W DK2005000097 W DK 2005000097W WO 2005078074 A2 WO2005078074 A2 WO 2005078074A2
Authority
WO
WIPO (PCT)
Prior art keywords
atom
protease
positions
variant
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DK2005/000097
Other languages
English (en)
French (fr)
Other versions
WO2005078074A3 (en
Inventor
Allan Svendsen
Stefan Minning
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Original Assignee
Novozymes AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes AS filed Critical Novozymes AS
Priority to JP2006552463A priority Critical patent/JP2007521823A/ja
Priority to US10/588,555 priority patent/US20070281332A1/en
Priority to CN2005800109412A priority patent/CN1942584B/zh
Priority to EP05700647A priority patent/EP1713919A2/en
Publication of WO2005078074A2 publication Critical patent/WO2005078074A2/en
Publication of WO2005078074A3 publication Critical patent/WO2005078074A3/en
Anticipated expiration legal-status Critical
Priority to US12/758,943 priority patent/US8563289B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C12N9/54Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2299/00Coordinates from 3D structures of peptides, e.g. proteins or enzymes

Definitions

  • the present invention relates to variants of proteases belonging to the RP-II or C-component type, and methods for the construction of such variants with altered properties, such as stability (e.g. thermostability or storage stability), Ca 2+ dependency, and pH dependent activity.
  • stability e.g. thermostability or storage stability
  • Ca 2+ dependency e.g. thermostability or storage stability
  • pH dependent activity e.g. thermostability or storage stability
  • proteases have been used within the detergent industry as part of washing formulations for more than 30 years. Proteases are from a commercial perspective the most relevant enzyme in such formulations, but other enzymes including lipases, amy- lases, cellulases, hemicellulases or mixtures of enzymes are also often used. Proteases are also used in other fields, such as production of diary products, processing of hides, feed processing, etc. To improve the cost and/or the performance of proteases there is an ongoing search for proteases with altered properties, such as increased activity at low temperatures, increased thermostability, increased specific activity at a given pH, altered Ca 2+ dependency, increased stability in the presence of other detergent ingredients (e.g.
  • proteases with altered properties includes both discovery of naturally occurring proteases, i.e. so called wild-type proteases but also alteration of well- known proteases by e.g. genetic manipulation of the nucleic acid sequence encoding said proteases. Knowledge of the relationship between the three-dimensional structure and the function of a protein has improved the ability to evaluate which areas of a protein to alter to affect a specific property of the protein.
  • proteases which has been indicated for use in detergents, food processing, feed processing is the RP-II proteases or C-component proteases belonging to the protease family S1 B, glutamic-acid-specific endopeptidases.
  • Bacillus proteases of the RP-II type are serine proteases that in primary structure are similar to chymotrypsin.
  • the first description of a protease of the RP-II family of Bacillus proteases was in US Patent No. 4,266,031 (Tang et al., Novo Industri A/S), where it was designated Component C and tentatively (and incorrectly) characterised as not being a serine protease or metallo protease.
  • Component C was considered a contaminant in the produc- tion of the Bacillus licheniformis alkaline protease, subtilisin Carlsberg.
  • EP 369 817 (Omnigene Bioproducts, Inc.) the B. subtilis member of the RP-II family was identified by its amino acid and DNA sequences. The enzyme was again stated n ot to be a s erine p rotease, and t he family n ame R P-II d esignated ( Residual Protease II). The enzyme was characterized further as a metallo protease by the inven- tors of EP 369 817 (Rufo et al., 1990, J. B actehol.
  • RP-II proteases were disclosed with DNA and amino acid sequences. These RP-II proteases were isolated from ⁇ . pumilus, B. halmapalus and ⁇ . licheniformis. WO 01/16285 also discloses a number of variants of RP-II proteases. These variants were based on various concepts relating to the primary structure of the RP-II proteases (amino acid sequences). The homology matrix in Table 1 below clearly indicates that the RP-II proteases
  • Bacillus sp. JA96 glutamic-acid-specific endopeptidase, JA96, WO 01/16285 2. 1 p3e ⁇ . Intermedius, glutamic-acid-specific endopeptidase, BIP, EMBL No. Y5136, Reb kov et al., Journal of Protein Chemistry, Vol. 18, No. 1 , 1999 3.
  • Bacillus sp. B032 glutamic-acid-specific endopeptidase, B032, WO 01/16285 4. Bacillus licheniformis, BLC, WO 01/16285 (cf. US Patent No. 4,266,031 ) 5. Bacillus sp.
  • CDJ31 glutamic-acid-specific endopeptidase, CDJ31 , WO 01/16285 6.
  • Bacillus sp. AC116 glutamic-acid-specific endopeptidase, AC116, WO 01/16285 7.
  • Bacillus sp. AA513 glutamic-acid-specific endopeptidase, AA513, WO 01/16285 9.
  • eta_staau Staphylococcus aureus exfoliative toxin A Lee et al.
  • the inventors of the present invention have elucidated the three-dimensional structure of the C-component protease from Bacillus licheniformis and found that there are several differences between this and the three-dimensional structure of Toxin A from Staphylococcus aureus also belonging to t he S 1 B s ubgroup of p roteases.
  • This surprising difference in structure makes it advantageous to use the BLC structure as basis for homology modelling of RP-II proteases, which, in turn, will improve the ability to obtain desired changes in functionality by protein engineering.
  • the object of the present invention is to provide a method for constructing RP-II proteases having altered properties, in particular to provide a method for constructing RP-II proteases having altered properties as described above.
  • the present invention relates to a method for con- structing a variant of a parent RP-II protease, wherein the variant has at least one altered property as compared to said parent RP-II protease, which method comprises: i) analyzing the three-dimensional structure of the RP-II protease to identify, on the basis of an evaluation of structural considerations, at least one amino acid residue or at least one structural region of the RP-II protease, which is of relevance for altering said property; ii) constructing a variant of the RP-II protease, which as compared to the parent RP-II protease, has been modified in the amino acid residue or structural part identified in i) so as to alter said property; and iii) testing the resulting RP-II protease variant for said property.
  • RP-II protease in certain regions and/or positions is expected to confer a particular effect to the thus produced RP-II protease variant, it should be noted that modification of the parent RP-II protease in any of such regions may also give rise to any other of the above-mentioned effects.
  • any of the regions and/or positions mentioned as being of particular interest with respect to, e.g., improved thermostability may also give rise to, e.g., higher activity at a lower pH, an altered pH optimum, or increased specific activity, such as increased peptidase activity.
  • variants of a RP-II protease relate to variants of a RP-II protease, the DNA encoding such variants and methods of preparing the variants. Still further as- pects of the present invention relates to the use of the variants for various industrial purposes, in particular as an additive in detergent compositions. Other aspects of the present invention will be apparent from the below description as well as from the appended claims.
  • Fig. 1 provides a schematic structure of the RP-II protease from Bacillus licheniformis, BLC.
  • Fig. 2 shows a 3D structure based alignment of the wild type RP-II proteases 1 to 8 of Table 1.
  • Fig. 3 shows the BLC protease ribbon structure in black, with indication of active site residues, the bound peptide and the ion-binding site. The calcium ion is the sphere at the bottom of the Figure, the active site residues are in light grey and shown in stick model, and the bound peptide DAFE is in medium grey and shown in stick model.
  • APPENDIX 1 provides the structural coordinates for the solved crystal 3D structure of the BLC RP-II protease, in the standard pdb format. The residues are numbered from 1-217, the calcium ion is numbered 301 , and the DAFE substrate is numbered 401-404.
  • RP-II proteases refers to a sub-group of serine protease, belonging to the protease family S1 B, glutamic-acid-specific endopeptidases.
  • Serine proteases or serine peptidases is a subgroup of proteases characterised by having a serine in the active site, which forms a covalent adduct with the substrate.
  • RP-II proteases and the serine proteases are characterised by having two active site amino acid residues apart from the serine, namely a histidine and an aspartic acid residue.
  • the RP-II proteases have a homology to the rest of the S1 B protease family of around 50% (using the UWGCG version 8 software GAP program), or more preferred a homology higher than 55%.
  • Table 1 demonstrate homologies between various S1 B proteases.
  • the RP-II proteases, nos. 1 to 8 are in Table 1 indicated in bold and the other S1 B proteases, nos. 9 to 13, in bold italics.
  • Table 1 shows that there is a clear distinction to the RP-II proteases from the other S1 B proteases, but it is also clear that among the RP-II proteases there are subgroups.
  • One subgroup comprises nos. 1 , 2, and 3; and another subgroup comprises nos. 4, 5, and 6.
  • the lengths of the listed RP-II proteases vary from 215 to 222 amino acid residues and experience within the subtil- isin subgroups of subtilases indicates that such a variation in length probably has only little effect on the 3-dimensional structures of these and other RP-II protease subgroups.
  • parent is in the context of the present invention to be understood as a protein, which is modified to create a protein variant.
  • the parent protein may be a naturally occurring (wild-type) polypeptide or it may be a variant thereof prepared by any suitable means.
  • the parent protein may be a variant of a naturally occurring protein which has been modified by substitution, chemical modification, deletion or truncation of o ne or more amino acid residues, o r by a ddition o r i nsertion of one o r more amino acid residues to the amino acid sequence, of a naturally-occurring polypeptide.
  • parent RP-II protease refers to a RP-II protease which is modified to create a RP-II protease variant.
  • variant is in the context of the present invention to be understood as a protein which has been modified as compared to a parent protein at one or more amino acid residues.
  • modification(s) or “modified” is in the context of the present invention to be understood as to include chemical modification of a protein as well as genetic manipulation of the DNA encoding a protein.
  • the modification(s) may be replacements) of the amino acid side chain(s), substitution(s), deletion(s) and/or insertions in or at the amino acid(s) of interest.
  • modified protein e.g. “modified RP-II protease”
  • modified protein is to be understood as a protein which contains modification(s) compared to a parent protein, e.g. RP-II protease.
  • HOMOLOGY "Homology" or “homologous to” is in the context of the present invention to be understood in its conventional meaning and the "homology" between two amino acid sequences should be determined by use of the "Similarity" parameter defined by the GAP program from the University of Wisconsin Genetics Computer Group (UWGCG) package using default settings for alignment parameters, comparison matrix, gap and gap extension penalties. Default values for GAP penalties, i.e. GAP creation penalty of 3.0 and GAP extension penalty of 0.1 (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wis- consin, USA 53711 ). The method is also described in S.B. Needleman and CD.
  • SEQ. ID. NO. 12 JA96 (AA)
  • SEQ. ID. NO. 13 BSMPR (DNA)
  • SEQ. ID. NO. 14 BSMPR (AA)
  • SEQ. ID. NO. 15 BIP (DNA)
  • SEQ. ID. NO. 16 BIP (AA)
  • position is in the context of the present invention to be understood as the number of an amino acid residue in a peptide, polypeptide or protein when counting from the N-terminal end of said peptide/polypeptide.
  • the position numbers used here normally refer directly to different RP-II proteases.
  • the RP-II proteases are numbered individually according to each of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, and 16.
  • the invention is not limited to variants of these particular RP-II proteases but extends to parent proteases containing amino acid residues at positions which are "equivalent" to the particular identified residues in Bacillus licheniformis RP-II protease.
  • P-II p rotease a nd the s ubstitutions are m ade at t he e quivalent a mino acid residue positions in JA96 or BIP corresponding to those listed above.
  • a residue (amino acid) position of a RP-II protease is equivalent to a residue (position) of the Bacillus licheniformis RP-II protease if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in Bacillus licheniformis RP-II protease (i.e., having the same or similar functional capacity to combine, react, or interact chemically).
  • the amino acid sequence of a precursor protease is directly compared to the Bacillus licheniformis RP-II protease, BLC, primary sequence by aligning the amino acid sequence of an isolated or parent wild type enzyme with a suitable well-known enzyme of the same group or class of enzymes defines a frame of reference. This type of numbering was used in WO 01/16285. If nothing else is indicated herein, in the present instance the Bacillus licheniformis RP- II protease, first designated component C and therefore here abbreviated BLC, has been chosen as standard.
  • the 3D structure based alignment in Fig. 2 has been provided.
  • the amino acid sequence of a precursor RP-II protease may be directly correlated to the Bacillus licheniformis RP-II protease, BLC, primary sequence.
  • BLC Bacillus licheniformis RP-II protease
  • the (3D based) position corresponding to a position in BLC is found by i) identifying the RP-II protease from the alignment of Fig. 2 that is most homologous to the novel sequence, ii) aligning the novel sequence with the sequence identified to find the corresponding position in the RP-II protease from Fig. 2, and iii) establishing from Fig. 2 the corresponding position in BLC.
  • the GAP program from GCG package as described below are used.
  • the alignment of Fig. 2 defines a number of deletions and insertions in relation to the sequence of BLC. In the alignment deletions are indicated by asterixes (*) in the referenced sequence, and the referenced enzyme will be considered to have a gap at the position in question.
  • Insertions are indicated by asterixes (*) in the BLC sequence, and the positions in the referenced enzyme are given as the position number of the last amino acid residue where a corresponding amino acid residue exists in the standard enzyme with a lower case letter appended in alphabetical order, e.g. 82a, 82b, 82c, 82d, see Fig. 2.
  • the referenced enzyme contains a N- or C-terminal extension in comparison to BLC; an N-terminal extension is given the position number 0a, 0b, etc.
  • RP-II proteases are numbered by reference to the positions of the BLC RP-II protease (SEQ ID NO: 2) as provided in Fig. 2. The position is then indicated as "corresponding to BLC".
  • the inventors of the present invention have elucidated the three-dimensional structure of BLC, SEQ ID NO:2 by X-ray crystallography and found that there are several interesting features in the structure of this protease in comparison with the known structures of other proteases, such as the RP-II proteases. These features include both similarities and differences.
  • a RP-II protease is in the context of the present invention to be understood as a protease which has at least 50% homology to BLC (SEQ ID NO:2).
  • said protease may have at least 55% homology to BLC, i.e. to SEQ ID NO:2.
  • the invention thus relates to variant RP-II proteases having at least 50% homology to BLC.
  • variants of the invention may comprise RP-II proteases comprising a number of modifications or modifications in a number of positions ranging from at least one and up to 50, or from 1 to 45, or from 1 to 40, or from 1 to 35, or from 1 to 30, or from 1 to 25, or from 1 to 20, or from 1 to 15, or from 1 to 14, or from 1 to 13, or from 1 to 12, or from 1 to 1 1 , or from 1 to 10, or from 1 to 9, or from 1 to 8, or from 1 to 7, or from 1 to 6, or from 1 to 5, or from 1 to 4, or from 1 to 3, or from 1 to 2 modifications or positions.
  • modifications comprising substitutions, deletions and insertions in the indicated number or number of positions.
  • a RP-II protease variant of the present invention is encoded by an isolated polynucleotide, which nucleic acid sequence has at least 50% homology with the nucleic acid sequence shown in SEQ ID NO: 1 , and where the polynucleotide encodes a variant RP-II protease in relation to a parent protease.
  • a RP-II protease suitable for the purpose described herein may be a RP-II protease homologous to the three- dimensional structure of BLC, i.e.
  • a set of structure coordinates for a protein or a portion thereof is a relative set of points that define a shape in three dimensions; it is possible that an entirely different set of coordinates defines an identical or a similar shape. Moreover, slight variations in the individual coordinates may have little or no effect on the overall shape. These variations in coordinates may be generated because of mathematical manipulations of the structure coordinates.
  • the structure coordinates of Appendix 1 ( BLC s gagture) m ay b e m anipulated by e rystallographic p ermutations o f the structure coordinates, fractionalization of the structure coordinates, integer addi- tions or subtractions to sets of the structure coordinates, inversion of the structure coordinates or any combination of the above.
  • said variations may be due to differences in the primary amino acid sequence.
  • variations are within an acceptable standard error as compared to the structure coordinates of Appendix 1 said three-dimensional structure is within the context of the present invention to be understood as being homologous to the structure of Appendix 1.
  • the standard error may typically be measured as the root mean square deviation of e.g.
  • RMS root mean square deviation
  • AA513 RP-II protease from Bacillus halmapalus AA513 (NP000368)
  • AC116 RP-II protease from Bacillus licheniformis AC116 (NP000364)
  • B032 RP-II protease from Bacillus pumilus B032 (NP000366)
  • CDJ31 RP-II protease from Bacillus licheniformis CDJ31 (NP000365)
  • JA96 RP-II protease from Bacillus pumilus JA96 (NP000367)
  • MPR RP-II protease from Bacillus subtilis IS75 (cf.
  • a preferred embodiment of the present invention is a variant of a parent RP-II protease or a RP-II protease variant which is at least 50% homologous to the sequence of SEQ ID NO 2 preferably at least 55%, preferably at least 65%, at least 70%, at least 74%, at least 80%, at least 83%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homologous to the sequence of SEQ ID NO:2, 4, 6, 8, 10, 12, 14 or 16.
  • a further embodiment of the invention is a RP-II protease variant comprising the following structural characteristics: a) two beta-barrel domains each comprising six long strands in antiparallel organisation, b) three alpha helices, c) at least one ion-binding site, d) an active site comprising the amino acid residues His, Asp and Ser.
  • the potential ion binding site is defined as similar coordination or arrangement of the coordinates as in the 3D structure of BLC having one calcium ion coordinated by the lie 3 carbonyl atom O, the Ser 5 carbonyl atom O and bidendate by the Asp 161 Carboxyl acid group and the further coordination made by waters.
  • the calcium may be substituted in the structure by water but then having the same coordination.
  • the RP-II protease variants of the present invention are encoded by isolated polynucleotides, which nucleic acid sequence has at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the nucleic acid sequence shown in SEQ ID NO:1 , 3, 5, 7 ,9, 11 , 13, or 15, and where the polynucleotide encodes a variant RP-II protease in relation to a parent protease.
  • the isolated nucleic acid sequence encoding a RP-II protease variant of the invention hybridizes with a complementary strand of the nucleic acid sequence shown in SEQ ID NO: 1 preferably under low stringency conditions, at least under medium stringency conditions, at least under medium/high stringency conditions, at least under high stringency conditions, at least under very high stringency conditions.
  • Suitable experimental conditions for determining hybridization at low, medium, or high stringency between a nucleotide probe and a homologous DNA or RNA sequence involves presoaking of the filter containing the DNA fragments or RNA to hybridize in 5 x SSC (Sodium chloride/Sodium citrate, Sambrook et al.
  • the filter is then washed twice for 30 minutes in 2 x SSC, 0.5 % SDS at least 55°C (low stringency), more preferably at least 60°C (medium stringency), still more preferably at least 65°C (medium/high stringency), even more preferably at least 70°C (high stringency), and even more preferably at least 75°C (very high stringency).
  • the BLC RP-II protease was used to elucidate the three-dimensional structure forming the basis for the present invention.
  • the structure of BLC was solved in accordance with the principle for x-ray crys- tallographic methods, for example, as given in X-Ray Structure Determination, Stout, G.K. and Jensen, L.H., John Wiley & Sons, Inc. NY, 1989.
  • the structural coordinates for the solved crystal structure of BLC are given in standard PDB format (Protein Data Bank, Brookhaven National Laboratory, Brook- haven, CT) as set forth in Appendix 1. It is to be understood that Appendix 1 forms part of the present application.
  • CA refers to c-alpha (carbon atoms) or to calcium ions, (however to avoid misunderstandings we normally use the full names "c-alpha atoms", “calcium” "Ca” or “ion” in the present specification). Amino acid residues are given in their standard three-letter code or the standard one-letter code.
  • the protease coordinates has a chain identification called A, whereas the peptide is called B, the calcium ion is called C, and the water is W.
  • the positions of the mentioned residues refer to the sequence of BLC as disclosed in SEQ ID NO: 2.
  • the overall structure of BLC falls into the S1 group of the proteases (MEROPS; http://merops.sanger.ac.uk/).
  • the structure is a trypsin type of fold with two beta-barrel domains.
  • the beta-barrel's each consists of six antiparallel beta-sheets folded into a beta-barrel.
  • the topology can be described as S1-S2-S3-S6-S5-S4 for the strands in both beta-barrels. It is assumed that all the RP-II proteases fall within the same gen- eral overall structure.
  • the 3D structure of C-component serine protease from Bacillus licheniformis has 16 strands of which the 12 bigger strands compose the two beta-barrels; and 3 helixes.
  • the four very short strands are number 1 , 5, 6 and 10 counting from the N-terminal and are composed of residue numbers 9-10, 50-51 , 56-57 and 114-115.
  • the other strands are residue numbers 22-26, 31-36, 41-44, 62-65, 77-83, 99-102, 126-131 , 142-151 , 156-159, 171-177, 182-192 and 201-205.
  • Two very small helices are composed of residues 86-90 and 106-110.
  • the active site consists of a triad involving the Ser in position 167, the His in position 47, and the Asp in position 96.
  • the 3D structure of BLC has one calcium ion coordinated by the carbonyl oxygen atom of lie in position 3, the carbonyl oxygen atom of Ser in position 5, and biden- date by the Carboxylic acid group of Asp in position 161. Further coordinations are made by water molecules.
  • the calcium ion is placed in a distance from the CA atoms of the active site and Gly in position 168 as provided below: Ser 167 CA atom to Ca ion: 16.07A His 47 CA atom to Ca ion: 24.27A Asp 96 CA atom to Ca ion: 23.72A Gly 168 CA atom to Ca ion: 19.20A
  • the position of an ion-binding site can be defined by the distance to four specific atoms in the core structure.
  • the distance from the ion-binding site to the c-alpha atoms of the three active site residues has been chosen.
  • the residues Ser, His and Asp in the active site are highly conserved. In BLC they are Asp96, His47 and Ser167.
  • the fourth distance chosen is the distance to the c-alpha atom of the amino acid residue coming first after the active site serine residue in the sequence (herein after called "next to Ser"); in the 3D structure of BLC it is Gly168.
  • the distance between the ion-binding site and i) Asp c-alpha atom is 22.50-24.00 A, ii) His c-alpha atom is 23.25- 25.25 A, iii) Ser c-alpha atom is 15.00-17.00A, iv) next to Ser c-alpha atom is 18.20- 20.20 A,
  • these distances may vary from one RP-II protease to the other, and as described above, the ion binding site may also bind to a sodium ion.
  • the present distances are given with a calcium ion in the structure. If a sodium ion was bound instead the distances would be shifted a little bit.
  • the distances can vary ⁇ O. ⁇ A, preferably ⁇ 0.7A, ⁇ 0.6A, ⁇ O. ⁇ A, ⁇ 0.4A, or most preferably ⁇ 0.3A.
  • the peptide structure circumscribing the ion- binding site is composed of the amino acid residues placed in positions 1-7, 159-162 and 143-145 with the coordinating atoms being the backbone carbonyl oxygen atom of residues 13, S5, D161 and water molecules.
  • 3D structures of RP-II proteases can be modelled using the known structure of a related protease and general modelling tools as shown in Example 1.
  • a prerequisite for obtaining a realistic 3D model structure is that the model is based on an adequate sequence homology higher than 50%, preferably higher than 55%, and even more pre- ferred higher than 60% to the sequence of the protease for which the structure is known.
  • RP-II Protease models can be constructed based on the 3D guided sequence alignments to BLC in Figure 2. Therefore 3D structure models of RP-II proteases could in principle be made by using the modelling tools and the known 3D structure of the toxin A protease from Staphylococcus a ureus from t he E xf family of p roteases ( Cavarelli e t a I. ( 1997) The
  • the common protease region has an RMS lower than 1.2. Outside the common protease region the structure of the RP-II protease BLC differs from the Toxin A structure to a greater extent.
  • the intermediate region consists of residues 14-28, 29-51 , 94-104, 155-175.
  • the intermediate region has an RMS bigger than 1.2 and less than 1.8. Any relationships between the three-dimensional structure and functionality based on modelling from the S. aureus 3D structure are potentially difficult to predict in this region of the RP-II proteases.
  • the common region and the intermediate region consist of the majority of the two central beta-barrels, especially the strands of the beta-barrels.
  • the nonhomologous region consists of residues 1-6, 7-13, 52-57, 59-69, 84-88,
  • the nonhomologous region has a RMS higher than 1.5. Any relation- ships between the three-dimensional structure and functionality based on modelling from the S. aureus 3D structure are very difficult to predict in this region of the RP-II proteases. Inferred structure-function relationships based on model building of a RP-II protease 3D structure on the 3D structure of S. aureus Toxin A would thus be very uncer- tain and speculative.
  • a model structure of a RP-II protease can be built using the BLC structure in Appendix 1 , or a structure similar to the BLC structure comprising the structural elements (a) two beta-barrel domains each comprising six long strands in antiparallel organisation, (b) three alpha helices, (c) at least one low affinity ion-binding site, and (d) an active site comprising the amino acid residues His, Asp and Ser, or other 3D RP-II protease structures, e.g.
  • the principle is to align the amino acid sequence of a protein for which the 3D structure is known with the amino acid sequence of a protein for which a model 3D structure has to be constructed.
  • the structurally conserved regions can then be built on the basis of consensus sequences. In areas lacking homology, loop structures can be inserted, or sequences can be deleted with subsequent bonding of the necessary residues using, e.g., the program Homology.
  • the present i nvention comprises a method of p roducing a variant of a parent
  • BLC like RP-II protease the variant having at least one altered property as compared to the parent BLC like RP-II protease
  • the method comprising: a) producing a model structure of the parent BLC like RP-II protease on the three-dimensional structure of BLC, b) comparing the model three-dimensional structure of the parent BLC like RP-II protease to the BLC structure by superimposing the structures through matching the active residues CA, CB, C, O, and N atoms, c) identifying on the basis of the comparison in step a) at least one structural part of the parent BLC like RP-II protease, wherein an alteration in said struc- tural part is predicted to result in an altered property; d) modifying the nucleic acid sequence encoding the parent BLC like RP-II protease to produce a nucleic acid sequence encoding deletion or substitution of one or more amino acids at a position corresponding to said structural
  • An ion-binding site is a significant feature of an enzyme. Therefore alterations of the amino acid residues close to the ion-binding site are likely to result in alterations of the stability of the enzyme. Especially modifications affecting the charge distribution and/or the electrostatic field strength at or in the vicinity of the site are important.
  • Improved stability Stabilisation of the ion-binding site of RP-II proteases may be obtained by modifications in positions close to the ion binding site.
  • Such modifications may comprise the substitution of a positively charged amino acid residue with a neutral or negatively charged residue, or the substitution of a neu- tral residue with a negatively charged residue or the deletion of a positively charged or neutral residue in positions close to the ion binding site.
  • Positions located at a distance of 1 ⁇ A or less to the ion-binding site of BLC are: 1 , 2, 3, 4, 5, 6, 7, 8, 143, 144, 145, 146, 158, 159, 160, 161 , 162, 194, 199, 200, and 201.
  • positions 2, 3, 4, 5, 6, 7, 144, 159, 160, 161 located at a distance of 6 A or less from the ion binding site are important.
  • Corresponding positions in other RP-II proteases may be identified using Fig. 2 herein.
  • the modifications D7E and D7Q in BLC are examples of suitable modifications in one of these positions.
  • a variant with improved stability may be ob- tained by modification of the mobility of identified regions, such as by introduction of di- sulfide bond(s), substitution with proline, alteration of hydrogen bond contact(s), altering charge distribution, introduction of salt bridge(s), filling in internal structural cavities with one or more amino acids with bulkier side groups (in e.g. regions which are structurally mobile), substitution of histidine residues with other amino acids, removal of a deamidation sites, or by helix capping.
  • thermosta- bilisation may be obtained by altering the highly mobile regions. Generally, thermostability may be improved by making these regions less mobile. Improvements of the en- zyme may be obtained by making modifications in the regions and positions identified below. Introducing e.g.
  • the regions can be found by analysing the B-factors taken from the coordinate file in Appendix 1 , and/or from molecular dynamics calculations of the isotropic fluctuations. These can be obtained by using the program CHARMm from MSI (Molecular Simulations Inc.).
  • Modifications are preferably made in the regions 26-31 (26, 27, 28, 29, 30, 31 ); 89-91 (89, 90, 91 ); 216-221 (216, 217, 218, 219, 220, 221 ), and es- pecially in BLC the substitutions G30A and G91A. Similar modifications may be made in structurally corresponding residues in other RP-II proteases. Also B-factors (see “in X-Ray Structure Determination, Stout, G.K. and Jensen, L.H., John Wiley & Sons, Inc. NY, 1989") from crystallographic data indicate the following more mobile regions in the BLC (RP-II protease) structure: 51 -56, (i.e.
  • a RP-II protease variant of the present invention with improved stability, e.g. thermostability, as compared to the parent RP-II protease may be obtained by introducing new inter-domain or intra-domain bonds to provide a more rigid and stable structure, such as by establishing inter- or intra-domain disulfide bridges. This is done by introducing cysteines in appropriate positions in the RP-II molecule by substitution(s) or insertion(s). According to the guidelines mentioned above the below mentioned amino acid residues identified in the amino acid sequence of SEQ ID NO: 2 are contemplated as being suitable for cysteine replacement. With one or more of these substitutions with cysteine, disulfide bridges may form in a variant of BLC.
  • a stabilising disulfide bridge may be constructed through the substitutions: S145C and T128C
  • a variant with improved stability as compared to the parent RP-II protease may be obtained by changing the surface charge distribution of the RP-II protease. For example, when the pH is lowered to about 5 or below, histidine residues typically become positively charged and, consequently, unfavorable electrostatic interactions on the protein surface may occur. By engineering the surface charge of the RP-II protease one may avoid such unfavorable electrostatic interactions that in turn may lead to a higher stability of the RP-II protease.
  • Charged amino acid residues are (a) positively charged: Lys, Arg, His (pH ⁇ 5),
  • the surface charge distribution may be modified by (a) removing charged residues from the surface through deletion of a charged residue or substituting an uncharged residue for a charged residue, (b) adding charged residues to the surface through insertion of a charged residue or substituting a charged residue for an uncharged residue, or (c) by reverting the charge at a residue through substituting a positively charged residue for a negatively charged residue or substituting a negatively charged residue for a positively charged residue.
  • a further aspect of the present invention relates to a method for con- structing a variant of a parent RP-II protease having a modified surface charge distribution, the method comprising: a) identifying, on the surface of the parent RP-II protease, at least one charged amino acid residue; b) modifying the charged residue identified in step (a) through deletion or substitu- tion with an uncharged amino acid residue; c) optionally repeating steps a) and b) recursively; d) preparing the variant resulting from steps a) - c); e) testing the stability of said variant; and f) optionally repeating steps a) - e) recursively; and g) selecting a RP-II protease variant having increased stability as compared to the parent RP-II protease.
  • the above method may be employed. Again, compared to the above method, the only difference being steps a) and b) which, in this case, read: a) identifying, on the surface of the parent RP-II protease, at least one charged amino acid residue; b) substituting the charged amino acid residue identified in step (a) with an amino acid residue having an opposite charge.
  • the surface accessible area are measured using the DSSP program (Kabsch and Sander, Biopolymers (1983), 22, 2577-2637). All residues having a surface accessibility higher than 0, 0.10, 0.20, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55 or 0.60 are regarded a surface residue.
  • An amino acid residue found on the surface of BLC using the above method is T109 and it is contemplated that the substitutions T109R, K, H are of particular interest. Similar substitutions may be introduced in equivalent positions of other RP-II proteases.
  • thermostability of a RP-II protease can be obtained by subjecting the RP-II protease in question to analysis for secondary structure, identifying residues in the RP-II protease having dihedral angles ⁇ (phi) and ⁇ (psi) confined to the intervals [- 90° ⁇ -40° and -180° ⁇ 180°], preferably the intervals [-90° ⁇ -40° and 120° ⁇ 180°] or [-90° ⁇ -40° and -50° ⁇ 10°] and excluding residues located in regions in which the RP-II protease is characterized by possessing ⁇ -helical or ⁇ -sheet structure.
  • proline residues are generally not compatible with ⁇ - helical and ⁇ -sheet secondary conformations. If a proline residue is not already at the identified position(s), the naturally occurring amino acid residue is substituted with a proline residue, preferably by site directed mutagenesis applied on a gene encoding the RP-II protease in question.
  • proline residues can be introduced at positions 18, 115, 185, 269 and 293. Accordingly, a preferred BLC variant has one or more of the substitutions: T60P, S221 P, G193P, and V194P.
  • Amino acid residues at a distance of less than 1 ⁇ A from the active site residues are most likely to influence the specificity and activity of the RP-II proteases, therefore variants comprising modifications in positions 1 , 8, 22-35 (22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35), 42-58 (42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58), 82-100 (82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100), 129-135 (1129, 130, 131 ,132, 133, 134, 135), 141 -142, 153-156 (153, 154, 155, 156), 158, 161-171 (161 , 162, 163, 164, 165, 166, 167, 168,
  • the substrate binding site is identified by the residues in contact with a substrate model, such as the DAFE.
  • a substrate model such as the DAFE.
  • DAFE bound in the active site can be found in Appendix 1. Without being limited to any theory, it is presently believed that binding between a substrate and an enzyme is supported by favorable interactions found within a sphere 10 A from the substrate molecule, in particular within a sphere of 6 A from the substrate molecule. Examples of such favorable bonds are hydrogen bonds, strong electrostatic interaction and/or hydropho- bic interactions.
  • the following residues of the BLC protease are within a distance of 1 ⁇ A from the peptide DAFE and thus believed to be involved in interactions with said substrate: 1 , 2, 3, 8, 25, 29, 30, 31 , 32, 33, 34, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 90, 91 , 92, 93, 94, 95, 96, 97, 129, 131 , 132, 133, 134, 135, 155, 157, 158, 159, 160, 161 , 162, 163, 164, 165, 166, 167, 168, 169, 171 , 189, 190, 191 , 192, 193, 194, 195, 196, 197, 198, 200 and 204.
  • the following residues of the BLC protease (SEQ ID NO: 1 ), are within a dis- tance of 6A from the peptide DAFE and thus believed to be involved in interactions with said substrate: 1 , 2, 31 , 32, 47, 48, 88, 91 , 93, 96, 162, 163, 164, 165, 166, 167, 168, 190, 191 , 192, 193, 194, 195, and 201.
  • Helix capping For the RP-II proteases helix capping may be obtained by modifying the position structurally corresponding to position 221 in BLC, and specifically in BLC by the modification A221 N.T
  • removal of deamidation sites may be obtained by modifying the positions structurally corresponding to positions 213, 216, and 222 of BLC, and specifically in BLC by the modifications.
  • the present invention also encompasses any of the above mentioned RP-II protease variants in combination with any other modification to the amino acid sequence thereof. Especially combinations with other modifications known in the art to provide improved properties to the enzyme are envisaged. Such modifications to be combined with any of the above indicated modifications are exemplified in the following.
  • the present invention relates to an RP-II protease variant, in which one or more amino acid residues susceptible to oxidation, especially methionine residues exposed to the surface of the molecule, is/are deleted or replaced with another amino acid residue less susceptible to oxidation.
  • the amino acid residue less susceptible to oxidation may for instance be selected from the group consisting of A, E, N, Q, I, L, S and K.
  • variants comprises at least one of the deletions or substitutions M36 ⁇ * ,S,A,N,Q,K ⁇ ; M160 ⁇ * ,S,A,N,Q,K ⁇ of the BLC protease; M144 ⁇ * ,S,A,N,Q,K ⁇ of the AC116 and CDJ31 proteases; M67 ⁇ *,S ⁇ N,Q,K ⁇ , M79 ⁇ *,S,A,N,Q,K ⁇ , M137f,S,A,N,Q,K ⁇ , M144 ⁇ *,S,A,N,Q,K ⁇ , and M171 ⁇ *,S,A,N,Q,K ⁇ of the B032, BIP and JA96 proteases; M159 ⁇ * ,S,A,N,Q,K ⁇ of the B032 protease; M81 ⁇ * ,S,A,N,Q,K ⁇ , and M141 ⁇ *,S,A,N,Q,K ⁇ in the MPR protease; and M17 ⁇ *,S,A,
  • the invention consequently further relates to an RP-II protease variant, in which either or both residues of any of the Asn-Gly sequence appearing in the amino acid sequence of the parent RP-II protease is/are deleted or substituted with a residue of a different amino acid.
  • the Asn and/or Gly residue may, for instance, be substituted with a residue of an amino acid selected from the group consisting of A, Q, S, P, T and Y.
  • any of the Asn or Gly residues of the Asn-Gly occupying positions 68-69, 182-183 and/or 192-193 of the BLC protease; positions 68-69 and/or
  • positions 45-46, 74-75, 196-197, and/or 201-202 of the B032 may be deleted or substituted with a residue of an amino acid selected from the group consisting of A, Q, S, P, T and Y. (positions are indicated in relation to the BLC protease as indicated in Fig. 2)
  • AC116 and CDJ-31 proteases are:
  • autoproteolysis sites may be removed by changing the amino acids at an autoproteolysis site. Since the RP-II proteases cleaves at Glu and Asp residues it is preferred to modify such residues of a parent RP-II protease having the same or a similar specificity, preferably by substituting with any other amino acid except Glu.
  • the parent RP-II proteases are mostly specific towards Glu and to a minor extent towards Asp residues. Therefore the modification of the parent (trypsin-like) RP-II protease may preferably be made by changing Glu to another amino acid residue (including Asp). Experiments have indicated that the substitution of Ala for Glu or Asp provides good results.
  • Glu and Asp residue are in the BLC, CDJ31 and AC116 proteases found in positions E101 , ,E152, E173, E209, D6, D51 , D96, D135, D161 , and D212.
  • BLC has a further Glu in position E104 and Asp in D7.
  • Specific BLC, CDJ31 and AC116 variants are thus E101A, E152A, E173A, E209A,
  • Further specific BLC variants are E104A and D7A.
  • MPR Glu and Asp are found at positions E7, E89a, E152, D6, D54, D92, D96, D135, D144, D161 , D177 and D209 Specific MPR variants are thus E7A, E89aA, E152A, D6A, D54A, D92A, D96A,
  • Glu and Asp are found at positions E26, E55, E94, E117, E123, E137b, E199, D40, D96, D103b, D103d, D135, D149, D154, D161 , D184 and D209
  • Specific AA513 variants are thus E26A, E55A, E94A, E117A, E123A, E137bA,
  • autoproteolysis can be prevented by changing the amino acid residue occupying the 1 st and/or 2nd position following the Glu or Asp residue in question to Pro. For instance, this may in BLC, CDJ31 and AC116 be done in the positions 174 and/or 175 as follows:
  • the invention relates to an RP-II variant comprising one or more of the following substitutions:
  • CDJ31
  • a A513 variants comprises o ne o r m ore of the following substitutions:
  • Examples of specific MPR variants comprises one or more of the following sub- stitutions:
  • Examples of specific BLC variants comprises one or more of the following substitutions:
  • the RP-II protease variants of the present invention may be produced by any known method within the art.
  • the invention also relates to polynucleotides encoding the RP-II protease variants of the present invention, DNA constructs comprising such polynucleotides and host cells comprising such constructs or polynucleotides.
  • natural occurring proteins may be produced by culturing the organism expressing the protein and subsequently purifying the protein, or recombinantly by cloning a polynucleotide, e.g. genomic DNA or cDNA, encoding the protein into an expression vector, introducing said expression vector into a host cell, culturing the host cell and purifying the expressed protein.
  • protein variants may be produced by site-directed mutagenesis of the gene encoding a parent protein, introduction of the mutated gene into an expression vector, host cell etc.
  • the gene encoding the parent protein may be cloned from a strain producing the polypeptide or from an expression library, i.e. it may be isolated from ge- nomic DNA or prepared from cDNA, or a combination thereof.
  • the gene may even be a fully synthetically produced gene.
  • a nd/or introducing mutations (random and/or site directed) into said genes may be used in order to obtain a parent RP-II protease, or RP-II protease variant of the invention.
  • Random mutagenesis is suitably performed either as localized or region-specific random mutagenesis in at least three parts of the gene translating to the amino acid sequence shown in question, or within the whole gene.
  • the random mutagenesis of a DNA sequence encoding a parent RP-II protease may be conveniently performed by use of any method known in the art.
  • a further aspect of the present invention relates to a method for generating a variant of a parent RP-II protease wherein the variant exhibits an altered property, such as increased thermostability, increased stability at low pH and at low calcium concentration, relative to the parent RP-II protease, the method comprising: a) subjecting a DNA sequence encoding the parent protease to localized or region- specific random mutagenesis, b) expressing the mutated DNA sequence obtained in step (a) in a host cell, and c) screening for host cells expressing a RP-II protease variant which has an altered property relative to the parent RP-II protease.
  • Step (a) of the above method of the invention is preferably performed using doped primers.
  • the oligonucleotide may be doped or spiked with the three non-parent nucleotides during the synthesis of the oligonucleotide at the positions that are to be changed. The doping or spiking may be done so that codons for unwanted amino acids are avoided.
  • the doped or spiked oligonucleotide can be incorporated into the DNA encoding the RP-II protease by any published technique, using, e.g., PCR, LCR or any DNA polymerase and ligase as deemed appropriate.
  • the doping is carried out using "constant random doping", in which the p ercentage of wild-type a nd modification i n each position i s p redefined.
  • the doping may be directed toward a preference for the introduction of certain nucleotides, and thereby a preference for the introduction of one or more specific amino acid residues.
  • the doping may be made, e.g., so as to allow for the introduction of 90% wild type and 10% modifications in each position.
  • An additional consideration in the choice of a doping scheme is based on genetic as well as protein-structural con- straints.
  • the doping scheme may be made by using the DOPE program which, inter alia, ensures that introduction of stop codons is avoided (L.J. Jensen et al. Nucleic Acid Research, 26, 697-702 (1998).
  • the D NA sequence to be mutagenized may conveniently b e present i n a g e- nomic or cDNA library prepared from an organism expressing the parent RP-II prote- ase.
  • the DNA sequence may be present on a suitable vector such as a plasmid or a b acteriophage, which as such may be incubated with or otherwise exposed to the mutagenizing agent.
  • the DNA to be mutagenized may also be present in a host cell either by being integrated in the genome of said cell or by being present on a vector harboured in the cell. Finally, the DNA to be mutagenized may be in isolated form. It will be understood that the DNA sequence to be subjected to random mutagenesis is preferably a cDNA or a genomic DNA sequence. In some cases it may be convenient to amplify the mutated DNA sequence prior to performing the expression step b) or the screening step c). Such amplification may be performed in accordance with methods known in the art, the presently preferred method being PCR-generated amplification using oligonucleotide primers prepared on the basis of the DNA or amino acid sequence of the parent enzyme.
  • the mutated DNA is expressed by culturing a suitable host cell carrying the DNA sequence under conditions allowing expression to take place.
  • the host cell used for this purpose may be one which has been transformed with the mutated DNA sequence, optionally present on a vector, or one which was carried the DNA sequence encoding the parent enzyme during the mutagenesis treatment.
  • suitable host cells are the following: gram positive bacteria such as Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amy- loliquefaciens, Bacillus coagulants, Bacillus circulans, Bacillus lautus, Bacillus megaterium, Bacillus thu ngiensis, Streptomyces lividans or Streptomyces murinus; and gram negative bacteria such as E. coli.
  • the mutated DNA sequence may further comprise a DNA sequence encoding functions permitting expression of the mutated DNA sequence.
  • the random mutagenesis may be advantageously localised to a part of the parent RP-II protease in question. This may, e.g., be advantageous when certain regions of the enzyme have been identified to be of particular importance for a given property of the enzyme, and when modified are expected to result in a variant having improved properties. Such regions may normally be identified when the tertiary structure of the parent enzyme has been elucidated and related to the function of the enzyme.
  • the localised or region-specific, random mutagenesis is conveniently performed by u se of PCR g enerated mutagenesis techniques as d escribed above o r any other suitable technique known in the art.
  • the DNA sequence encoding the part of the DNA sequence to be modified may be isolated, e.g., by insertion into a suitable vector, and said part may be subsequently subjected to mutagenesis by use of any of the mutagenesis methods discussed above.
  • the localised random mutagenesis may be carried out by the following steps: 1. Select regions of interest for modification in the parent enzyme 2. Decide on mutation sites and non-mutated sites in the selected region 3. Decide on which kind of mutations should be carried out, e.g. with re- spect to the desired stability and/or performance of the variant to be constructed 4. Select structurally based mutations 5. Adjust the residues selected in step 3 with regard to step 4. 6. Analyse by use of a suitable dope algorithm the nucleotide distribu- tion. 7. If necessary, adjust the wanted residues to genetic code realism, e.g. taking into account constraints resulting from the genetic code, e.g.
  • Suitable dope algorithms for use in step 6 are well known in the art.
  • One such algorithm is described by Tomandl, D. et al., 1997, Journal of Computer-Aided Molecular Design 11 :29-38.
  • Another algorithm is DOPE (Jensen, LJ, Andersen, KV, Svend- sen, A, and Kretzschmar, T (1998) Nucleic Acids Research 26:697-702).
  • a recombinant expression vector comprising a nucleic acid sequence encoding a RP-II protease variant of the invention may be any vector that may conveniently be subjected to recombinant DNA procedures and which may bring about the expression of the nucleic acid sequence.
  • the choice of vector will often depend on the host cell into which it is to be introduced. Examples of a suitable vector include a linear or closed circular plasmid or a virus.
  • the vector may be an autonomously replicating vector, i.e., a vector which exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extra-chromosomal element, a mini chromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self- replication. Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, pACYC184, pUB110, pE194, pTA1060, and pAM ⁇ l .
  • origin of replications for use in a yeast host cell are the 2 micron origin of replication, the combination of CEN6 and ARS4, and the combination of CEN3 and ARS1.
  • the origin of replication may be one having a mutation which makes it function as temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75:1433).
  • the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • Vectors which are integrated into the genome of the host cell may contain any nucleic acid sequence enabling integration into the genome; in par- ticular it may contain nucleic acid sequences facilitating integration into the genome by homologous or non-homologous recombination.
  • the vector system may be a single vector, e.g. plasmid or virus, or two or more vectors, e.g. plasmids or virus', which together contain the total DNA to be introduced into the genome of the host cell, or a transposon.
  • the vector may in particular be an expression vector in which the DNA sequence encoding the RP-II protease variant of the invention is operably linked to additional segments or control sequences required for transcription of the DNA.
  • operably linked indicates that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in a promoter and proceeds through the DNA sequence encoding the RP-II protease variant.
  • Additional segments or control sequences include a promoter, a polyadenylation sequence, a propeptide sequence, a signal sequence and a transcription terminator. At a minimum the control sequences include a promoter and transcriptional and translational stop signals.
  • the promoter may be any DNA sequence that shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
  • suitable promoters for use in bacterial host cells include the promoter of the Bacillus subtilis levansucrase gene (sacB), the Bacillus stearothermophilus maltogenic amylase gene (amyM), the Bacillus licheniformis alpha-amylase gene (amyL), the Bacillus amyloliquefaciens alpha-amylase gene (amyQ), the Bacillus subtilis alkaline protease gene, or the Bacillus pumilus xylosidase gene, the Bacillus amyloliquefaciens BAN amylase gene, the Bacillus licheniformis penicillinase gene (penP), the Bacillus subtilis xylA and xylB genes, and the prokaryotic beta-lactamase gene (Villa-Kamaroff et a l., 1 978, P roceedings of the N ational Academy of S ciences U SA 75:
  • phage Lambda P R or PL promoters examples include the phage Lambda P R or PL promoters or the E. coli lac, trp or tac promoters or the Streptomyces coelicolor agarase gene (dagA). Further promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; and in Sambrook et al., 1989, supra.
  • promoters for use in a filamentous fungal host cell are promoters obtained from the genes encoding Aspergillus oryzae TAKA amylase, Rhi- zomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoa- mylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae those phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium oxysporum trypsin-like protease (as described in U.S.
  • Patent No. 4,288,627 which is incorporated herein by reference
  • Particularly preferred promoters for use in filamentous fungal host cells are the TAKA amylase, NA2-tpi (a hybrid of the promoters from the genes encoding Aspergillus niger neutral (-amylase and Aspergillus oryzae those phosphate isomerase), and glaA promoters.
  • Further suitable promoters for use in filamentous fungus host cells are the ADH3 promoter (McKnight et al., The EMBO J. 4 (1985), 2093 - 2099) or the tpiA promoter.
  • promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255 (1980), 12073 - 12080; Alber and Kawasaki, J. Mol. Appl. Gen. 1 (1982), 419 - 434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaen- der et al, eds.), Plenum Press, New York, 1982), or the TPI1 (US 4,599,311 ) or ADH2- 4c (Russell et al., Nature 304 (1983), 652 - 654) promoters.
  • yeast host cells are described by Romanos et al., 1992, Yeast 8:423-488.
  • useful promoters include viral promoters such as those from Simian Virus 40 (SV40), Rous sarcoma virus (RSV), adenovirus, and bovine papilloma virus (BPV).
  • viral promoters such as those from Simian Virus 40 (SV40), Rous sarcoma virus (RSV), adenovirus, and bovine papilloma virus (BPV).
  • suitable promoters for use in mammalian cells are the SV40 promoter (Subramani et al., Mol. Cell Biol. 1 (1981 ), 854 -864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222 (1983), 809 - 814) or the adenovirus 2 major late promoter.
  • a suitable promoter for use in insect cells is the polyhedrin promoter (US 4,745,051 ; Vasuvedan et al., FEBS Lett. 311 , (1992) 7 - 11 ), the P10 promoter (J.M. Vlak et al., J. Gen. Virology 69, 1988, pp. 765-776), the Autographa califor- nica polyhedrosis virus basic protein promoter (EP 397 485), the baculovirus immediate early gene 1 promoter (US 5,155,037; US 5,162,222), or the baculovirus 39K delayed- early gene promoter (US 5,155,037; US 5,162,222).
  • the polyhedrin promoter US 4,745,051 ; Vasuvedan et al., FEBS Lett. 311 , (1992) 7 - 11
  • the P10 promoter J.M. Vlak et al., J. Gen. Virology 69, 1988, pp.
  • the DNA sequence encoding a RP-II protease variant of the invention may also, if necessary, be operably connected to a suitable terminator.
  • the recombinant vector of the invention may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
  • the vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, or a gene encoding resistance to e.g.
  • antibiotics like ampicillin, kanamycin, chloramphenicol, erythromycin, tetracycline, spectinomycine, neomycin, hygromycin, methotrexate, or resistance to heavy metals, virus or herbicides, or which provides for prototrophy or auxotrophs.
  • bac- terial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, resistance.
  • a frequently used mammalian marker is the dihydrofolate reductase gene ( DHFR). S Amble m arkers for yeast host cells a re A DE2, H IS3, L EU2, LYS2, MET3, TRP1 , and URA3.
  • a selectable marker for use in a filamentous fungal host cell may be selected from the group including, but not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin p hosphotransferase), niaD ( nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), and glu- fosinate resistance markers, as well as equivalents from other species.
  • amdS acetamidase
  • argB ornithine carbamoyltransferase
  • bar phosphinothricin acetyltransferase
  • hygB hygromycin p
  • amdS and pyrG markers of Aspergillus nidulans or Aspergillus oryzae are the amdS and pyrG markers of Aspergillus nidulans or Aspergillus oryzae and the bar marker of Streptomyces hygroscopicus.
  • selection may be accomplished by co-transformation, e.g., as described in WO 91/17243, where the selectable marker is on a separate vector.
  • a s ecretory s ignal s equence (also k nown a s a I eader s e- quence, prepro sequence or pre sequence) may be provided in the recombinant vector.
  • the secretory signal sequence is joined to the DNA sequence encoding the enzyme in the correct reading frame. Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the enzyme.
  • the secretory signal sequence may be that normally associated with the enzyme or may be from a gene encoding another se- creted protein.
  • the nucleic acid constructs of the present invention may also comprise one or more nucleic acid sequences which encode one or more factors that are advantageous in the expression of the polypeptide, e.g., an activator (e.g., a trans-acting factor), a chaperone, and a processing protease. Any factor that is functional in the host cell of choice may be used in the present invention.
  • an activator e.g., a trans-acting factor
  • a chaperone e.g., a chaperone
  • processing protease e.g., a factor that is functional in the host cell of choice.
  • the nucleic acids encoding one or more of these factors are not necessarily in tandem with the nucleic acid sequence encoding the polypeptide.
  • the DNA sequence encoding a RP-II protease variant of the present invention may be either homologous or heterologous to the host cell into which it is introduced. If homologous to the host cell, i.e. produced by the host cell in nature, it will typically be operably connected to another promoter sequence or, if applicable, another secretory signal sequence and/or terminator sequence than in its natural environment.
  • the term "homologous” is intended to include a DNA sequence encoding an enzyme native to the host organism in question.
  • heterologous is intended to include a DNA sequence not expressed by the host cell in nature. Thus, the DNA sequence may be from another organism, or it may be a synthetic sequence.
  • the host cell into which the DNA construct or the recombinant vector of the invention is introduced may be any cell that is capable of producing the present RP-II protease variants, such as prokaryotes, e.g. bacteria or eukaryotes, such as fungal cells, e.g. yeasts or filamentous fungi, insect cells, plant cells or mammalian cells.
  • prokaryotes e.g. bacteria or eukaryotes
  • fungal cells e.g. yeasts or filamentous fungi
  • insect cells e.g. yeasts or filamentous fungi
  • plant cells or mammalian cells e.g.
  • Examples of bacterial host cells which, on cultivation, are capable of producing the RP-II protease variants of the invention are gram-positive bacteria such as strains of Bacillus, e.g. strains of ⁇ . subtilis, B. licheniformis, B. lentus, B. brevis, B. stear
  • the enzyme may be retained in the cytoplasm, typically as insoluble granules (known as inclusion bodies), or it may be directed to the periplasmic space by a bacterial secretion sequence.
  • the cells are lysed and the granules are recovered and denatured after which the enzyme is refolded by diluting the denaturing agent.
  • the enzyme may be recovered from the periplasmic space by disrupting the cells, e.g. by sonication or osmotic shock, to release the contents of the periplasmic space and recovering the enzyme.
  • the enzyme When expressing the RP-II protease variant in gram-positive bacteria such as Bacillus or Streptomyces strains, the enzyme may be retained in the cytoplasm, or it may be directed to the extracellular medium by a bacterial secretion sequence. In the latter case, the enzyme may be recovered from the medium as described below.
  • host yeast cells include cells of a species of Candida, Kluyveromy- ces, Saccharomyces, Schizosaccharomyces, Pichia, Hansehula, or Yarrowia.
  • the yeast host cell is a Saccharomyces carlsbergensis, Saccharo- myces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell.
  • Other useful yeast host cells are a Kluyveromyces lactis, Kluyveromyces fragilis, Hansehula polymorpha, Pichia pastoris, Yarrowia lipolytica, Schizosaccharomyces pombe, Ustilgo maylis, Candida maltose, Pichia guillermondii and Pichia methanolio cell (cf.
  • yeast Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M., and Davenport, R.R., eds, Soc. App. Bacteriol. Symposium Series N o. 9 , 1 980.
  • Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153:163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75:1920.
  • filamentous fungal cells include filamentous forms of the subdivi- sion Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra), in particular it may of the a cell of a species of Acremonium, such as A.
  • chrysogenum Aspergillus, such as A. awamori, A. foetidus, A. japonicus, A. niger, A. nidulans or A. oryzae, Fusarium, such as F. bactridioides, F. cerealis, F. crookwellense, F. culmorum, F. graminearum, F. graminum, F. heterosporum, F. negundi, F. reticulatum, F. roseum, F. sambucinum, F. sarcochroum, F. sulphureum, F. trichothecioides or F. oxysporum, Humicola, such as H.
  • insect cells include a Lepidoptera cell line, such as Spodoptera frugiperda cells or Trichoplusia ni cells (cf. US 5,077,214). Culture conditions may suitably be as d escribed in WO 89/01029 or WO 89/01028.Transformation of insect cells and production of heterologous polypeptides therein may be performed as described in US 4,745,051 ; US 4, 775, 624; US 4,879,236; US 5,155,037; US 5,162,222; EP 397,485).
  • mammalian cells examples include Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, COS cells, or any number of other immortalized cell lines available, e.g., from the American Type Culture Collection. Methods of trans- fecting m ammalian c ells a nd e xpressing DNA s equences i ntroduced i n t he c ells a re described in e.g. Kaufman and Sharp, J. Mol. Biol. 159 (1982), 601 - 621 ; Southern and Berg, J. Mol. Appl. Genet.
  • Mammalian cells may be trans- fected by direct uptake using the calcium phosphate precipitation method of Graham and Van der Eb (1978, Virology 52:546). Methods for expression and isolation of proteins
  • the above mentioned host cells transformed or transfected with a vector comprising a nucleic acid sequence encoding an enzyme of the present invention are typically cultured in a suitable nutrient medium under conditions permitting the production of the desired molecules, after which these are recovered from the cells, or the culture broth.
  • the medium used to culture the host cells m ay be any conventional m edium suitable for growing the host cells, such as minimal or complex media containing ap- muscularte supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection). T he media may be prepared using procedures known in the art (see, e.g., references for bacteria and yeast; Bennett, J.W.
  • the enzymes of the present invention are secreted into the nutrient medium, they may be recovered directly from the medium. If they are not secreted, they may be recovered from cell lysates.
  • the enzymes of the present invention may be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous compo- nents of the supernatant or filtrate by means of a salt, e.g. ammonium sulphate, purification by a variety of chromatographic procedures, e.g.
  • the enzymes of the invention may be detected using methods known in the art that are specific for these proteins. These detection methods include use of specific antibodies, formation of a product, or disappearance of a substrate. For example, an enzyme assay may be used to determine the activity of the molecule. Procedures for determining various kinds of activity are known in the art.
  • the enzymes of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing (IEF), differential solubility (e.g., ammonium sul- fate p recipitation), o r extraction (see, e .g., P rotein P urification, J -C J anson a nd L ars Ryden, editors, VCH Publishers, New York, 1989).
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing (IEF)
  • differential solubility e.g., ammonium sul- fate p recipitation
  • o r extraction see, e .g., P
  • heterologous host cell When an expression vector comprising a DNA sequence encoding an enzyme of the present invention is transformed/transfected into a heterologous host cell it is possible to enable heterologous recombinant production of the enzyme.
  • An advantage of using a heterologous host cell is that it is possible to make a highly purified enzyme composition, characterized in being free from homologous impurities, which are often present when a protein or peptide is expressed in a homologous host cell.
  • homologous impurities mean any impurity (e.g. other polypeptides than the enzyme of the invention) which originates from the homologous cell where the enzyme of the invention is originally obtained from.
  • the enzyme of the invention may be added to and thus become a component of a detergent composition.
  • the detergent composition of the invention may for example be formulated as a hand or machine laundry detergent composition including a laundry additive composition suitable for pre-treatment of stained fabrics and a rinse added fabric softener composition, or be formulated as a detergent composition for use in general household hard surface cleaning operations, or be formulated for hand or machine dishwashing operations.
  • the invention provides a detergent additive comprising the enzyme of the invention.
  • the detergent additive as well as the detergent composition may comprise one or more other enzymes such as a protease, a lipase, a cutinase, an amylase, a carbohydrase, a cellulase, a pectinase, a mannanase, an arabinase, a ga- lactanase, a xylanase, an oxidase, e.g., a laccase, and/or a peroxidase.
  • the properties of the chosen enzyme(s) should be compatible with the selected detergent, (i.e. pH-optimum, compatibility with other enzymatic and non- enzymatic ingredients, etc.), and the enzyme(s) should be present in effective amounts.
  • proteases include those of animal, vegetable or microbial origin. Microbial origin is preferred. Chemically modified or protein engineered mutants are included.
  • the protease may be a serine protease or a metallo protease, preferably an alkaline microbial protease or a trypsin-like protease.
  • alkaline proteases are subtilisins, especially those derived from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06279).
  • trypsin-like proteases are trypsin (e.g.
  • proteases are the variants described in WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially the variants with substitutions in one or more of the following positions: 27, 36, 57, 68, 76, 87, 97, 101 , 104, 106, 120, 123, 167, 170, 194, 206, 218, 222, 224, 235, 245, 252 and 274.
  • Preferred commercially available protease enzymes include AlcalaseTM, Savi- naseTM, PrimaseTM, DuralaseTM, EsperaseTM, CoronaseTM and KannaseTM (Novozymes A/S), M axataseTM, M axacalTM, M axapemTM, ProperaseTM, P urafectTM, Purafect OxPTM, FN2TM, and FN3TM (Genencor International Inc.).
  • Lipases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful lipases include lipases from Humicola (synonym Thermomyces), e.g. from H. lanuginosa (T. lanuginosus) as described in EP 258 068 a nd EP 305 216 or f rom H. insolens a s described in WO 96/13580, a Pseudomonas lipase, e.g. from P. alcaligenes or P. pseudoalcaligenes (EP 2 18 272), P. cepacia ( EP 331 376), P.
  • lipase variants such as those described in WO 92/05249, WO 94/01541 , EP 407 225, EP 260 105, WO 95/35381 , WO 96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO 97/04079 and WO 97/07202.
  • Preferred commecially available lipase enzymes include LipolaseTM, Lipolase UltraTM and LipexTM (Novozymes A/S).
  • Amylases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Amylases include, for example, ⁇ -amylases obtained from Bacillus, e.g. a special strain of ⁇ . licheniformis, described in more detail in GB 1 ,296,839.
  • amylases examples include the variants described in WO 94/02597, WO 94/18314, WO 96/23873, and WO 97/43424, especially the variants with substitutions in one or more of the following positions: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181 , 188, 190, 197, 202, 208, 209, 243, 264, 304, 305, 391 , 408, and 444.
  • Commercially available amylases are DuramylTM, TermamylTM, StainzymeTM ,
  • Suitable cellulases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Suitable cellulases include cellulases from the genera Bacillus, Pseudomonas, Humicola, Fusarium, Thielavia, Acremonium, e.g. the fungal cellulases produced from Humicola insolens, Myceliophthora thermo- phila and Fusarium oxysporum disclosed in US 4,435,307, US 5,648,263, US 5,691 ,178, US 5,776,757 and WO 89/09259. Especially suitable cellulases are the alkaline or neutral cellulases having colour care benefits.
  • cellulases examples include cellulases described in EP 0 495 257, EP 0 531 372, WO 96/11262, WO 96/29397, WO 98/08940.
  • Other examples are cellu- lase variants such as those described in WO 94/07998, EP 0 531 315, US 5,457,046, US 5,686,593, US 5,763,254, WO 95/24471 , WO 98/12307 and PCT/DK98/00299.
  • RenozymeTM RenozymeTM
  • CelluzymeTM CelluzymeTM
  • CarezymeTM Novozymes A/S
  • ClazinaseTM ClazinaseTM
  • Puradax HATM Puradax HATM
  • KAC-500(B)TM Kao Corporation
  • Peroxidases/Oxidases include those of plant, bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful peroxidases include peroxidases from Coprinus, e.g. from C. cinereus, and variants thereof as those described in WO 93/24618, WO 95/10602, and WO 98/15257. Commercially available peroxidases include GuardzymeTM (Novozymes A/S).
  • the detergent enzyme(s) may be included in a detergent composition by adding separate additives containing one or more enzymes, or by adding a combined additive comprising all of these enzymes.
  • a detergent additive of the invention i.e. a separate additive or a combined additive, can be formulated e.g. as a granulate, a liquid, a slurry, etc.
  • Preferred detergent additive formulations are granulates, in particular non- dusting granulates, liquids, in particular stabilized liquids, or slurries.
  • Non-dusting g ranulates m ay b e p roduced, e .g., a s d isclosed i n U S 4 ,106,991 and 4,661 ,452 and may optionally be coated by methods known in the art.
  • waxy coating m aterials a re poly(ethylene oxide) p roducts ( polyethylene g lycol, P EG) with mean molar weights of 1000 to 20000; ethoxylated nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids.
  • film-forming coating materials suitable for application by fluid bed techniques are given in GB 1483591.
  • Liquid enzyme preparations may, for instance, be stabilized by adding a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid according to established methods.
  • Protected enzymes may be prepared according to the method disclosed in EP 238,216.
  • the detergent composition of the invention may be in any convenient form, e.g., a bar, a tablet, a powder, a granule, a paste or a liquid.
  • a liquid detergent m ay be aqueous, typically containing up to 70 % water and 0-30 % organic solvent, or non- aqueous.
  • the detergent composition comprises one or more surfactants, which may be non-ionic including semi-polar and/or anionic and/or cationic a nd/or zwitterionic.
  • the surfactants are typically present at a level of from 0.1 % to 60% by weight.
  • the detergent will usually contain from about 1% to about 40% of an anionic surfactant such as linear alkylbenzenesulfonate, alpha- olefinsulfonate, alkyl sulfate (fatty alcohol sulfate), alcohol ethoxysulfate, secondary al- kanesulfonate, alpha-sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid or soap.
  • an anionic surfactant such as linear alkylbenzenesulfonate, alpha- olefinsulfonate, alkyl sulfate (fatty alcohol sulfate), alcohol ethoxysulfate, secondary al-
  • the detergent When included therein the detergent will usually contain from about 0.2% to about 40% of a non-ionic surfactant such as alcohol ethoxylate, nonylphenol ethoxy- late, alkylpolyglycoside, alkyldimethylamineoxide, ethoxylated fatty acid monoethanol- amide, fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or N-acyl N- alkyl derivatives of glucosamine (“glucamides”).
  • a non-ionic surfactant such as alcohol ethoxylate, nonylphenol ethoxy- late, alkylpolyglycoside, alkyldimethylamineoxide, ethoxylated fatty acid monoethanol- amide, fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or N-acyl N- alkyl derivatives of glucosamine (“glucamides”).
  • a non-ionic surfactant such as alcohol ethoxylate, non
  • the detergent may contain 0-65 % of a detergent builder or complexing agent such a s zeolite, d iphosphate, triphosphate, phosphonate, carbonate, c itrate, n itrilotri- acetic acid, ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic acid, alkyl- or alkenylsuccinic acid, soluble silicates or layered silicates (e.g. SKS-6 from Hoechst).
  • the detergent may comprise one or more polymers.
  • Examples are carboxy- methylcellulose, poly(vinylpyrrolidone), poly (ethylene glycol), poly(vinyl alcohol), poly(vinylpyridine-N-oxide), poly(vinylimidazole), polycarboxylates such as polyacry- lates, maleic/acrylic acid copolymers and lauryl methacrylate/acrylic acid copolymers.
  • the detergent may contain a bleaching system which may comprise a H 2 0 2 source such as perborate or percarbonate which may be combined with a peracid- forming bleach activator such as tetraacetylethylenediamine or nonanoyloxyben- zenesulfonate.
  • the bleaching system may comprise peroxyacids of e.g. the amide, imide, or sulfone type.
  • the enzyme(s) of the detergent composition of the invention may be stabilized using conventional stabilizing agents, e.g., a polyol such as propylene glycol or glyc- erol, a sugar or sugar alcohol, lactic acid, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formylphenyl bo- ronic acid, and the composition may be formulated as described in e.g. WO 92/19709 and WO 92/19708.
  • the detergent may also contain other conventional detergent ingredients such as e.g. fabric conditioners including clays, foam boosters, suds suppressors, anti- corrosion agents, soil-suspending agents, anti-soil redeposition agents, dyes, bacteri- cides, optical brighteners, hydrotropes, tarnish inhibitors, or perfumes.
  • fabric conditioners including clays, foam boosters, suds suppressors, anti- corrosion agents, soil-suspending agents, anti-soil redeposition agents, dyes, bacteri- cides, optical brighteners, hydrotropes, tarnish inhibitors, or perfumes.
  • any enzyme in particular the enzyme of the invention, may be added in an amount corresponding to 0.01-100 mg of enzyme protein per litre of wash liquor, preferably 0.05-5 mg of enzyme protein per litre of wash liquor, in particular 0.1-1 mg of enzyme protein per litre of wash liquor.
  • the enzyme of the invention may additionally be incorporated in the detergent formulations disclosed in WO 97/07202
  • the RP-II protease variants of the present invention may also be used in the processing of food, especially in the field of diary products, such as milk, cream and cheese, but also in the processing of meat and vegetables.
  • the RP-II protease variants of the present invention may also be used in the processing of feed for cattle, poultry, and pigs and especially for pet food. TREATMENT OF HIDES
  • the RP-II protease variants of the invention may also be used for the treatment of hides.
  • the RP-II protease variants of the invention may also be used in processes for decontaminating instruments, surfaces, and other materials in hospitals, clinics, and meat processing plants, etc. in order to decompose prions or other infectious agents.
  • pNM1003 Disclosed in WO 01/16285 pSX222: Disclosed in WO 96/34946 pNM1008: See Example 2
  • the present invention provides a method of producing an isolated enzyme according to the invention, wherein a suitable host cell, which has been transformed with a DNA sequence encoding the enzyme, is cultured under conditions permitting the production of the enzyme, and the resulting enzyme is recovered from the culture.
  • a suitable host cell which has been transformed with a DNA sequence encoding the enzyme
  • the resulting enzyme is recovered from the culture.
  • an expression vector comprising a DNA sequence encoding the enzyme is transformed into a heterologous host cell it is possible to enable heterologous recombinant production of the enzyme of the invention.
  • the medium used to culture the transformed host cells may be any conventional medium suitable for growing the host cells in question.
  • the expressed RP-II protease may conveniently be secreted into the culture medium and may be recovered therefrom by well-known procedures including separating the cells from the medium by cen- trifugation or filtration, precipitating proteinaceous components of the medium by means of a salt such as ammonium sulfate, followed by chromatographic procedures such as ion exchange chromatography, affinity chromatography, or the like.
  • Enzyme activity can be measured using the PNA assay using succinyl-alanine- alanine-proline-glutamicacid-paranitroaniline as a substrate.
  • Standard textile pieces are obtained from EMPA St. Gallen, Lerchfeldstrasse 5, CH-9014 St. Gallen, Switzerland.
  • EMPA 116 cotton textile stained with blood, m ilk a nd i nk
  • a nd E MPA 117 polyester/cotton textile stained w ith b lood, milk and ink.
  • the textile can be cut into a smaller textile piece of 5x3 cm or 13x3 cm
  • protease stain may be used as well, e.g. C-03, C-05, C-10 from CFT, Center For Testmaterials, Vlaardingen, Netherlands
  • the enzymes of the invention may be tested in the detergent formulations disclosed in WO 97/07202 or in detergents formulations purchased from wfk testgewebe GmbH or similar supplier
  • one of the following commercial detergents may be used in the wash assay, e.g. Omo Multi Acao HDP, Unilever, Brazil Tide HDL, P&G, US Wisk HDL, Unilever, US TOP HDP, Lion, Japan Attack HDP, Kao, Japan Ariel Regular HDP, P&G, Europe Ariel Compact HDPC, P&G, Europe Persil Megaperls, Henkel, Germany Persil, Unilever, UK
  • the detergent should be in-activated before use in order to eliminate the enzyme activity already present in the detergent. This is done by heating a detergent stock solution to 85°C in 5 minutes in a micro wave oven. The concentration of the detergent stock solution in the micro wave oven is between 4 - 20 g/l
  • the first rough model provides a close structural homology between the model of JA96 protease and the 3D structure of the BCL as there are no overlapping side chains in the model structure.
  • the protein can in silico be soaked in a box of water and subjected to energy minimization and further molecular dynamics simulations using e.g. the CHARMmTM software from Accelrys.
  • the in silico soaking in water can conveniently be done by adding water in the Insight II program
  • the energy minimization can be done using settings of 300 Steepest descent (SD) and further 600 Conjugated gradients (CJ).
  • SD Steepest descent
  • CJ Conjugated gradients
  • the molecular dynamics simulations can conveniently be done using 1.2 ns run using the Veriet algorithm at 300K and standard parameters (see CHARMm manual).
  • Other RP-II protease 3D models may be built in an analogous way.
  • BLC site-directed variants of the invention comprising specific substitutions, insertions or deletions in the molecule are made by traditional cloning of PCR fragments (Sambrook et. al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Har- bor) produced by oligonucleotides containing the desired modification.
  • As template pNM1008 is used.
  • a mutational primer anti-sense
  • a suitable opposite sense primer e. g.. 5 ' -CTGTGCCCTTTAACCGCACAGC (SEQ ID No. 17)
  • the resulting DNA fragment is used as a sense primer in a second PCR together with a suitable anti-sense primer (e. g. 5 ' - GCATAAGCTTTTACAGGTACCGGC (SEQ ID No. 18)) upstream from the Kpnl digestion site.
  • a suitable anti-sense primer e. g. 5 ' - GCATAAGCTTTTACAGGTACCGGC (SEQ ID No. 18)
  • This resulting PCR product is digested with Kpnl and Mlul and ligated in pNM1008 digested with the respective enzymes.
  • the ligation reaction is transformed into E. coli by well-known techniques and 5 randomly chosen colonies are sequenced to confirm the designed mutations.
  • the pNM1008 derived plasmid comprising the variant is digested with Hindlll, ligated and transformed into a competent B. subtilis strain, selecting for protease activity.
  • This procedure relates to purification of 2 liter scale fermentation for the production of the RP-II proteases of the invention in a Bacillus host cell.
  • Approximately 1.6 liters of fermentation broth are centrifuged at 5000 rpm for 35 minutes in 1 liter beakers.
  • the supematants are adjusted to pH 7 using 10% acetic acid and filtered through a Seitz Supra S100 filter plate.
  • the filtrate is applied to a 100 ml Bacitracin affinity column equilibrated with 0.01 M d imethylglutaric a cid, 0.1 M b oric a cid a nd 0.002 M calcium chloride adjusted to pH 7 with sodium hydroxide (Buffer A). After washing the column with B uffer A to remove u nbound p rotein, the p rotease i s e luted from the B acitracin column using Buffer A supplemented with 25% 2-propanol and 1 M sodium chloride.
  • fractions with protease activity from the Bacitracin purification step are combined and applied to a 750 ml Sephadex G25 column (5 cm dia.) equilibrated with Buffer A.
  • the protease is eluted using a linear gradient of 0-0.2 M sodium chloride in 2 liters of the same buffer.
  • protease containing fractions from the CM Sepharose column are combined and filtered through a 0.2 ⁇ filter.
  • AMSA Automatic Mechanical Stress Assay
  • the performance of the enzyme variant is measured as the brightness of the colour of the textile samples washed with that specific enzyme variant. Brightness can also be expressed as the intensity of the light reflected from the textile sample when luminated with white light. When the textile is stained the intensity of the reflected light is lower, than that of a clean textile. Therefore the intensity of the reflected light can be used to measure wash performance of an enzyme variant.
  • Colour measurements are made with a professional flatbed scanner (PFU DL2400pro), which is used to capture an image of the washed textile samples.
  • the scans are made with a resolution of 200 dpi and with an output colour dept of 24 bits.
  • the scanner is frequently calibrated with a Kodak reflective IT8 target.
  • a special designed software a pplication i s used ( Novozymes Color Vector Analyzer).
  • the p rogram retrieves the 24 bit pixel values from the image and converts them into values for red, green and blue (RGB).
  • the intensity value (Int) is calculated by adding the RGB values together as vectors and then taking the length of the resulting vector:
  • the wash performance (P) of the variants is calculated in accordance with the below formula: P lnt(v) - lnt(r) where lnt(v) is the light intensity value of textile surface washed with enzyme variant and lnt(r) is the light intensity value of textile surface washed with the reference enzyme
  • Performance Scores are summing up the performances (P) of the tested enzyme variants as:
  • a variant is considered to exhibit improved wash performance, if it performs better than the reference in at least one detergent composition.
  • a Performance Score higher than 1 indicates better wash performance.
  • a variant is considered to exhibit improved wash performance, if it performs better than the reference in at least one detergent composition.
  • the following RP-II variants were constructed as indicated in Example 2 to be purified in accordance with Example 3 and tested as indicated above: Ion-binding modification: D7E; D7Q; H144R; D161 R; D161 K; H144Q+D161 R
  • the storage stability of the variants of the invention is determined by measuring the "residual activity" of the parent and the variants at regular time intervals.
  • the stor- age stability is often expressed as the half-life, ly 2 , the time lapsed till the activity is half the initial value.
  • the Proteolytic activity is measured as described above(PNA assay).
  • thermostability of the protease variant s of the invention is determine by Dif- ferential Scanning Calorimetry (DSC) typically with a heating rate of 0.5°C per minute in a solution containg about 2mg/ml variant.
  • DSC Dif- ferential Scanning Calorimetry
  • RP-II variants of the invention are in a fermentation experiment compared to the parent RP-II protease.
  • Both the variants and the parent are cloned in a pNM1008 expression vector background and fermented in a suitable medium.
  • variants providing an increased proteolytic activity in comparison to the activity of the parent are considered to posses an improved autoproteolytic stability relative to the parent.
  • the variants are tested for their oxidation stability in 0.01 M peracetic acid after 20 minutes at 50°C and pH 7.
  • the parent protease is used as reference.
  • ATOM 3846 SG ACYS B 32 -1. .274 1. ,895 25. ,659 0. 65 7. ,95 s
  • ATOM 4036 O ALA B 45 -6 .370 0. .833 28 .543 1, .00 8 .36 O
  • ATOM 4404 CA PRO B 73 13 .605 7 .254 39 .425 1 .00 10 .57 C
  • ATOM 4434 CD2 TYR B 74 9. ,752 7. ,632 42. .700 1. ,00 11. ,52 c
  • ATOM 4440 CA GLY B 75 11. ,872 1. ,851 39. .479 1. .00 10. ,79 C
  • ATOM 4536 CA ARG B 81 -4 .210 -7. .752 37 .427 1 .00 10 .96 C
  • ATOM 4560 CA TYR B 82 -6. .392 -5. .564 35. .243 1. .00 8. .45 C

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Detergent Compositions (AREA)
  • General Preparation And Processing Of Foods (AREA)
  • Treatment And Processing Of Natural Fur Or Leather (AREA)
PCT/DK2005/000097 2004-02-13 2005-02-14 Protease variants Ceased WO2005078074A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2006552463A JP2007521823A (ja) 2004-02-13 2005-02-14 プロテアーゼ変異型
US10/588,555 US20070281332A1 (en) 2004-02-13 2005-02-14 Protease Variants
CN2005800109412A CN1942584B (zh) 2004-02-13 2005-02-14 蛋白酶变体
EP05700647A EP1713919A2 (en) 2004-02-13 2005-02-14 Protease variants
US12/758,943 US8563289B2 (en) 2004-02-13 2010-04-13 Protease variants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DKPA200400226 2004-02-13
DKPA200400226 2004-02-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US10/588,555 A-371-Of-International US20070281332A1 (en) 2004-02-13 2005-02-14 Protease Variants
US12/758,943 Continuation US8563289B2 (en) 2004-02-13 2010-04-13 Protease variants

Publications (2)

Publication Number Publication Date
WO2005078074A2 true WO2005078074A2 (en) 2005-08-25
WO2005078074A3 WO2005078074A3 (en) 2005-11-03

Family

ID=34854485

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2005/000097 Ceased WO2005078074A2 (en) 2004-02-13 2005-02-14 Protease variants

Country Status (5)

Country Link
US (2) US20070281332A1 (https=)
EP (3) EP2325318A1 (https=)
JP (1) JP2007521823A (https=)
CN (2) CN102250861A (https=)
WO (1) WO2005078074A2 (https=)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009539351A (ja) * 2006-06-02 2009-11-19 プレジデント アンド フェロウズ オブ ハーバード カレッジ タンパク質表面のリモデリング
WO2010124146A3 (en) * 2009-04-23 2011-02-24 Danisco Us Inc. Three-dimensional structure of isoprene synthase and its use thereof for generating variants
US8173410B2 (en) 2008-04-23 2012-05-08 Danisco Us Inc. Isoprene synthase variants for improved microbial production of isoprene
EP2492684A1 (en) * 2006-06-02 2012-08-29 President and Fellows of Harvard College Protein surface remodeling
US8709785B2 (en) 2007-12-13 2014-04-29 Danisco Us Inc. Compositions and methods for producing isoprene
US9163263B2 (en) 2012-05-02 2015-10-20 The Goodyear Tire & Rubber Company Identification of isoprene synthase variants with improved properties for the production of isoprene
US9221886B2 (en) 2009-04-28 2015-12-29 President And Fellows Of Harvard College Supercharged proteins for cell penetration
US9273298B2 (en) 2010-10-27 2016-03-01 Danisco Us Inc. Isoprene synthase variants for improved production of isoprene
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001016285A2 (en) * 1999-08-31 2001-03-08 Novozymes A/S Novel proteases and variants thereof
NZ577510A (en) * 2006-12-20 2012-06-29 Danisco Milk protein hydrolyzates with reduced immunogenic potential
US11306328B2 (en) 2013-07-26 2022-04-19 President And Fellows Of Harvard College Genome engineering
CN105358686A (zh) * 2013-07-29 2016-02-24 诺维信公司 蛋白酶变体以及对其进行编码的多核苷酸
WO2015014804A1 (en) * 2013-07-29 2015-02-05 Novozymes A/S Protease variants and polynucleotides encoding same
US10402358B2 (en) * 2014-09-30 2019-09-03 Honeywell International Inc. Module auto addressing in platform bus
CN104561075A (zh) * 2014-11-13 2015-04-29 广东省微生物研究所 一种重组表达谷氨酸特异性内肽酶的地衣芽孢杆菌及其构建方法
CA3088793A1 (en) 2018-02-06 2019-08-15 Novozymes Bioag A/S Methods of protecting a plant from fungal pests
CN121420051A (zh) * 2023-07-07 2026-01-27 诺维信公司 用于去除蛋白质污渍的洗涤方法
WO2026017381A1 (en) 2024-07-17 2026-01-22 Novozymes A/S Optimized bacillus host cells

Family Cites Families (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US53711A (en) 1866-04-03 Improvement in the construction of pulleys
GB1296839A (https=) 1969-05-29 1972-11-22
GB1372034A (en) 1970-12-31 1974-10-30 Unilever Ltd Detergent compositions
GB1483591A (en) 1973-07-23 1977-08-24 Novo Industri As Process for coating water soluble or water dispersible particles by means of the fluid bed technique
GB1590432A (en) 1976-07-07 1981-06-03 Novo Industri As Process for the production of an enzyme granulate and the enzyme granuate thus produced
FR2430453B1 (fr) 1978-07-04 1986-04-18 Novo Industri As Produit proteasique a pouvoir allergisant reduit
US4288627A (en) 1980-02-12 1981-09-08 Phillips Petroleum Company Oxidation of thiols employing cobalt molybdate/triethylamine catalyst
DK187280A (da) 1980-04-30 1981-10-31 Novo Industri As Ruhedsreducerende middel til et fuldvaskemiddel fuldvaskemiddel og fuldvaskemetode
US4599311A (en) 1982-08-13 1986-07-08 Kawasaki Glenn H Glycolytic promotersfor regulated protein expression: protease inhibitor
US4745051A (en) 1983-05-27 1988-05-17 The Texas A&M University System Method for producing a recombinant baculovirus expression vector
US4879236A (en) 1984-05-16 1989-11-07 The Texas A&M University System Method for producing a recombinant baculovirus expression vector
DK263584D0 (da) 1984-05-29 1984-05-29 Novo Industri As Enzymholdige granulater anvendt som detergentadditiver
US4879231A (en) 1984-10-30 1989-11-07 Phillips Petroleum Company Transformation of yeasts of the genus pichia
US4775624A (en) 1985-02-08 1988-10-04 Eli Lilly And Company Vectors and compounds for expression of human protein C
JPH0697997B2 (ja) 1985-08-09 1994-12-07 ギスト ブロカデス ナ−ムロ−ゼ フエンノ−トチヤツプ 新規の酵素的洗浄剤添加物
US4882279A (en) 1985-10-25 1989-11-21 Phillips Petroleum Company Site selective genomic modification of yeast of the genus pichia
AU607690B2 (en) 1985-12-24 1991-03-14 Marion Laboratories, Inc. Use of synthetic sulfated saccharides to enhance wound healing
US4935349A (en) 1986-01-17 1990-06-19 Zymogenetics, Inc. Expression of higher eucaryotic genes in aspergillus
EG18543A (en) 1986-02-20 1993-07-30 Albright & Wilson Protected enzyme systems
DE3750450T2 (de) 1986-08-29 1995-01-05 Novo Industri As Enzymhaltiger Reinigungsmittelzusatz.
NZ221627A (en) 1986-09-09 1993-04-28 Genencor Inc Preparation of enzymes, modifications, catalytic triads to alter ratios or transesterification/hydrolysis ratios
DE3856593D1 (de) * 1987-04-06 2007-10-04 Novozymes As Regelung von elektrostatischen interaktionen an metallionen-Bindungsstellen zur Stabilisierung von Proteinen
US4914031A (en) * 1987-04-10 1990-04-03 Amgen, Inc. Subtilisin analogs
CA1309680C (en) 1987-07-24 1992-11-03 David Harano Airlift insect cell culture
US5024947A (en) 1987-07-24 1991-06-18 Cetus Corporation Serum free media for the growth on insect cells and expression of products thereby
EP0305216B1 (en) 1987-08-28 1995-08-02 Novo Nordisk A/S Recombinant Humicola lipase and process for the production of recombinant humicola lipases
JPS6474992A (en) 1987-09-16 1989-03-20 Fuji Oil Co Ltd Dna sequence, plasmid and production of lipase
DK6488D0 (da) 1988-01-07 1988-01-07 Novo Industri As Enzymer
DE68924654T2 (de) 1988-01-07 1996-04-04 Novonordisk As Spezifische Protease.
JP3079276B2 (ja) 1988-02-28 2000-08-21 天野製薬株式会社 組換え体dna、それを含むシュードモナス属菌及びそれを用いたリパーゼの製造法
JP2728531B2 (ja) 1988-03-24 1998-03-18 ノボ ノルディスク アクティーゼルスカブ セルラーゼ調製品
US5648263A (en) 1988-03-24 1997-07-15 Novo Nordisk A/S Methods for reducing the harshness of a cotton-containing fabric
US5118623A (en) 1988-05-27 1992-06-02 Solvay Enzymes, Inc. Bleach stable enzymes
CA2003078A1 (en) 1988-11-18 1990-05-18 Biotechnica International, Inc. Protease deletion
GB8910962D0 (en) 1989-05-12 1989-06-28 Natural Environment Res Novel baculovirus expression vectors and use thereof in the expression of foreign proteins in insects or insect cells
DK316989D0 (da) 1989-06-26 1989-06-26 Novo Nordisk As Enzymer
US5162222A (en) 1989-07-07 1992-11-10 Guarino Linda A Use of baculovirus early promoters for expression of foreign genes in stably transformed insect cells or recombinant baculoviruses
GB8915658D0 (en) 1989-07-07 1989-08-23 Unilever Plc Enzymes,their production and use
US5077214A (en) 1989-07-07 1991-12-31 The Texas A&M University System Use of baculovirus early promoters for expression of foreign genes in stably transformed insect cells
US5155037A (en) 1989-08-04 1992-10-13 The Texas A&M University System Insect signal sequences useful to improve the efficiency of processing and secretion of foreign genes in insect systems
DK63490D0 (da) 1990-03-09 1990-03-09 Novo Nordisk As Fremgangsmaade til fremstilling af ost
KR100236540B1 (ko) 1990-04-14 2000-01-15 레클로우크스 라우에르 알카리성 바실러스-리파제, 이를 코-딩하는 dna 서열 및 리파제를 생산하는 바실러스 균주
DK0531372T4 (da) 1990-05-09 2004-08-09 Novozymes As Cellulasepræparat omfattende et endoglucanaseenzym
DK115890D0 (da) 1990-05-09 1990-05-09 Novo Nordisk As Enzym
AU657278B2 (en) 1990-09-13 1995-03-09 Novo Nordisk A/S Lipase variants
JP3046344B2 (ja) * 1990-10-24 2000-05-29 塩野義製薬株式会社 新規プロテアーゼ
ES2174820T3 (es) 1991-01-16 2002-11-16 Procter & Gamble Composiciones detergentes compactas con celulasa de alta actividad.
CZ285148B6 (cs) 1991-04-30 1999-05-12 The Procter And Gamble Company Kapalné detergentní směsi s borito-polyolovým komplexem k inhibici proteolytického enzymu
EP0511456A1 (en) 1991-04-30 1992-11-04 The Procter & Gamble Company Liquid detergents with aromatic borate ester to inhibit proteolytic enzyme
ES2121014T3 (es) 1991-05-01 1998-11-16 Novo Nordisk As Enzimas estabilizadas y composiciones detergentes.
DK72992D0 (da) 1992-06-01 1992-06-01 Novo Nordisk As Enzym
DK88892D0 (da) 1992-07-06 1992-07-06 Novo Nordisk As Forbindelse
WO1994002597A1 (en) 1992-07-23 1994-02-03 Novo Nordisk A/S MUTANT α-AMYLASE, DETERGENT, DISH WASHING AGENT, AND LIQUEFACTION AGENT
ATE262035T1 (de) 1992-10-06 2004-04-15 Novozymes As Zellulosevarianten
PT867504E (pt) 1993-02-11 2003-08-29 Genencor Int Alfa-amilase estavel a oxidacao
KR950702240A (ko) 1993-04-27 1995-06-19 한스 발터 라벤 세제로의 이용을 위한 새로운 리파제 변형체
DK52393D0 (https=) 1993-05-05 1993-05-05 Novo Nordisk As
JP2859520B2 (ja) 1993-08-30 1999-02-17 ノボ ノルディスク アクティーゼルスカブ リパーゼ及びそれを生産する微生物及びリパーゼ製造方法及びリパーゼ含有洗剤組成物
US5817495A (en) 1993-10-13 1998-10-06 Novo Nordisk A/S H2 O2 -stable peroxidase variants
JPH07143883A (ja) 1993-11-24 1995-06-06 Showa Denko Kk リパーゼ遺伝子及び変異体リパーゼ
DE69527835T2 (de) 1994-02-22 2003-04-10 Novozymes A/S, Bagsvaerd Methode zur herstellung einer variante eines lipolytischen enzymes
DE69536145D1 (de) 1994-03-08 2011-04-07 Novozymes As Neuartige alkalische Zellulasen
WO1995030744A2 (en) 1994-05-04 1995-11-16 Genencor International Inc. Lipases with improved surfactant resistance
WO1995035381A1 (en) 1994-06-20 1995-12-28 Unilever N.V. Modified pseudomonas lipases and their use
AU2884695A (en) 1994-06-23 1996-01-19 Unilever Plc Modified pseudomonas lipases and their use
DE69535733T2 (de) 1994-10-06 2009-04-23 Novozymes A/S Ein enzympräparat mit endoglucanase aktivität
BE1008998A3 (fr) 1994-10-14 1996-10-01 Solvay Lipase, microorganisme la produisant, procede de preparation de cette lipase et utilisations de celle-ci.
US5827719A (en) 1994-10-26 1998-10-27 Novo Nordisk A/S Enzyme with lipolytic activity
AR000862A1 (es) 1995-02-03 1997-08-06 Novozymes As Variantes de una ó-amilasa madre, un metodo para producir la misma, una estructura de adn y un vector de expresion, una celula transformada por dichaestructura de adn y vector, un aditivo para detergente, composicion detergente, una composicion para lavado de ropa y una composicion para la eliminacion del
JPH08228778A (ja) 1995-02-27 1996-09-10 Showa Denko Kk 新規なリパーゼ遺伝子及びそれを用いたリパーゼの製造方法
CN102080070B (zh) 1995-03-17 2016-01-20 诺沃奇梅兹有限公司 新的内切葡聚糖酶
US6682924B1 (en) * 1995-05-05 2004-01-27 Novozymes A/S Protease variants and compositions
ATE429490T1 (de) 1995-05-05 2009-05-15 Novozymes As Protease-varianten und verbindungen
EP0839186B1 (en) 1995-07-14 2004-11-10 Novozymes A/S A modified enzyme with lipolytic activity
AU6655196A (en) 1995-08-11 1997-03-12 Novo Nordisk A/S Novel lipolytic enzymes
US5763385A (en) 1996-05-14 1998-06-09 Genencor International, Inc. Modified α-amylases having altered calcium binding properties
AU3938997A (en) 1996-08-26 1998-03-19 Novo Nordisk A/S A novel endoglucanase
EP1726644A1 (en) * 1996-09-17 2006-11-29 Novozymes A/S Cellulase variants
WO1998015257A1 (en) 1996-10-08 1998-04-16 Novo Nordisk A/S Diaminobenzoic acid derivatives as dye precursors
EP0932667B1 (en) 1996-11-04 2008-10-01 Novozymes A/S Subtilase variants and compositions
JP4044143B2 (ja) 1996-11-04 2008-02-06 ノボザイムス アクティーゼルスカブ ズブチラーゼ変異体及び組成物
WO1998034946A1 (en) 1997-02-12 1998-08-13 Massachusetts Institute Of Technology Daxx, a novel fas-binding protein that activates jnk and apoptosis
AR015977A1 (es) 1997-10-23 2001-05-30 Genencor Int Variantes de proteasa multiplemente substituida con carga neta alterada para su empleo en detergentes
WO2001016285A2 (en) * 1999-08-31 2001-03-08 Novozymes A/S Novel proteases and variants thereof
US6558939B1 (en) * 1999-08-31 2003-05-06 Novozymes, A/S Proteases and variants thereof
US6350599B1 (en) 2000-01-12 2002-02-26 Novozymes A/S Pullulanase variants and methods for preparing such variants with predetermined properties
AU2002223020B2 (en) 2000-11-27 2006-07-06 Novozymes A/S Automated mechanical stress assay for screening cleaning ingredients
EP1995319B1 (en) * 2002-04-10 2011-08-31 Novozymes A/S Bacillus licheniformis mutant host cell

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9150626B2 (en) 2006-06-02 2015-10-06 President And Fellows Of Harvard College Protein surface remodeling
US9434774B2 (en) 2006-06-02 2016-09-06 President And Fellows Of Harvard College Protein surface remodeling
EP3045532A1 (en) * 2006-06-02 2016-07-20 President and Fellows of Harvard College Protein surface remodeling
EP2492684A1 (en) * 2006-06-02 2012-08-29 President and Fellows of Harvard College Protein surface remodeling
JP2009539351A (ja) * 2006-06-02 2009-11-19 プレジデント アンド フェロウズ オブ ハーバード カレッジ タンパク質表面のリモデリング
US10407474B2 (en) 2006-06-02 2019-09-10 President And Fellows Of Harvard College Protein surface remodeling
US10626420B2 (en) 2007-12-13 2020-04-21 Danisco Us Inc. Compositions and methods for producing isoprene
US8709785B2 (en) 2007-12-13 2014-04-29 Danisco Us Inc. Compositions and methods for producing isoprene
US9260727B2 (en) 2007-12-13 2016-02-16 Danisco Us Inc. Compositions and methods for producing isoprene
US9909144B2 (en) 2007-12-13 2018-03-06 Danisco Us Inc. Compositions and methods for producing isoprene
US8916370B2 (en) 2008-04-23 2014-12-23 Danisco Us Inc. Isoprene synthase variants for improved microbial production of isoprene
US8173410B2 (en) 2008-04-23 2012-05-08 Danisco Us Inc. Isoprene synthase variants for improved microbial production of isoprene
US9175313B2 (en) 2009-04-23 2015-11-03 Danisco Us Inc. Three-dimensional structure of isoprene synthase and its use thereof for generating variants
US8518686B2 (en) 2009-04-23 2013-08-27 Danisco Us Inc. Three-dimensional structure of isoprene synthase and its use thereof for generating variants
WO2010124146A3 (en) * 2009-04-23 2011-02-24 Danisco Us Inc. Three-dimensional structure of isoprene synthase and its use thereof for generating variants
US9221886B2 (en) 2009-04-28 2015-12-29 President And Fellows Of Harvard College Supercharged proteins for cell penetration
US9273298B2 (en) 2010-10-27 2016-03-01 Danisco Us Inc. Isoprene synthase variants for improved production of isoprene
US9163263B2 (en) 2012-05-02 2015-10-20 The Goodyear Tire & Rubber Company Identification of isoprene synthase variants with improved properties for the production of isoprene
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Also Published As

Publication number Publication date
EP2305821A2 (en) 2011-04-06
US20100196990A1 (en) 2010-08-05
EP1713919A2 (en) 2006-10-25
EP2305821A3 (en) 2011-04-13
CN102250861A (zh) 2011-11-23
US8563289B2 (en) 2013-10-22
EP2325318A1 (en) 2011-05-25
CN1942584A (zh) 2007-04-04
US20070281332A1 (en) 2007-12-06
JP2007521823A (ja) 2007-08-09
WO2005078074A3 (en) 2005-11-03
CN1942584B (zh) 2011-07-27

Similar Documents

Publication Publication Date Title
US8563289B2 (en) Protease variants
US10144922B2 (en) Subtilase variants and compositions comprising the same
US8008057B2 (en) Subtilases
EP1590454A2 (en) Subtilases
WO2014194117A2 (en) Novel metalloproteases
JP2012045000A (ja) サブチラーゼ
CN1768137A (zh) 枯草杆菌酶
Pulido et al. Requirement of left-handed glycine residue for high stability of the Tk-subtilisin propeptide as revealed by mutational and crystallographic analyses
CN113166231A (zh) 胰凝乳蛋白酶抑制剂变体及其用途
EP1914307A2 (en) Subtilases
US20040096950A1 (en) Crystal structure of beta site APP cleaving enzyme (BACE) and methods of use thereof
WO2005010176A1 (en) Method for making polypeptide variants by combinatorial fragment exchange

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2005700647

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2006552463

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

WWE Wipo information: entry into national phase

Ref document number: 200580010941.2

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005700647

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10588555

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10588555

Country of ref document: US