WO1996001274A1 - NEUE hIL-4-MUTANTENPROTEINE ALS ANTAGONISTEN ODER PARTIELLE AGONISTEN DES HUMANEN INTERLEUKIN 4 - Google Patents

NEUE hIL-4-MUTANTENPROTEINE ALS ANTAGONISTEN ODER PARTIELLE AGONISTEN DES HUMANEN INTERLEUKIN 4 Download PDF

Info

Publication number
WO1996001274A1
WO1996001274A1 PCT/EP1995/002358 EP9502358W WO9601274A1 WO 1996001274 A1 WO1996001274 A1 WO 1996001274A1 EP 9502358 W EP9502358 W EP 9502358W WO 9601274 A1 WO9601274 A1 WO 9601274A1
Authority
WO
WIPO (PCT)
Prior art keywords
hil
asp
amino acid
mutant proteins
antagonists
Prior art date
Application number
PCT/EP1995/002358
Other languages
English (en)
French (fr)
Inventor
Hanno Wild
Rudolf Hanko
Michael Dörschug
Hans-Dietrich Hörlein
Jürgen Beunink
Heiner Apeler
Hermann Wehlmann
Walter Sebald
Original Assignee
Bayer Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to HU9603563A priority Critical patent/HU221416B1/hu
Priority to SK1692-96A priority patent/SK284391B6/sk
Priority to JP8503644A priority patent/JPH10502360A/ja
Priority to EP95924273A priority patent/EP0769020B1/de
Priority to DE59507920T priority patent/DE59507920D1/de
Priority to US08/765,012 priority patent/US6130318A/en
Priority to DK95924273T priority patent/DK0769020T3/da
Priority to AT95924273T priority patent/ATE190068T1/de
Application filed by Bayer Aktiengesellschaft filed Critical Bayer Aktiengesellschaft
Priority to CA002193993A priority patent/CA2193993C/en
Priority to AU28852/95A priority patent/AU705745B2/en
Priority to KR1019960703865A priority patent/KR100265219B1/ko
Publication of WO1996001274A1 publication Critical patent/WO1996001274A1/de
Priority to NO965621A priority patent/NO965621D0/no
Priority to GR20000401195T priority patent/GR3033498T3/el

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5406—IL-4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • New hIL-4 mutant proteins as antagonists or partial agonists of human interleukin 4
  • the present invention relates to new hIL-4 mutant proteins, processes for their preparation and their use as medicaments, in particular in the case of excessive misguided immune reactions and autoimmune diseases.
  • PCT WO 93/10235 already discloses therapeutic agents which are or contain antagonists or partial agonists of hIL-4, the antagonists or partial agonists being hIL-4 mutant proteins.
  • Human interleukin-4 (hIL-4) is one of the numerous cytokines that induce and coordinate the proliferation, maturation, survival and differentiation of lymphoid and myeloid cells.
  • hIL-4 is at the
  • IgE-mediated immune response directly involved and accelerated the proliferation of thymocytes and activated T cells.
  • a high affinity IL-4 receptor protein with Mr 140,000 was identified, which according to its cDNA sequence consists of 800 amino acid residues. This belongs to a recently described group of receptors called hematopoietin receptor
  • the amino acid sequence of the mature IL-4 consists of 129 residues, based on the cloned cDNA.
  • the cDNA has been expressed in E. coli and yeast. From these sources, recombinant IL-4 with high biological
  • a monoclonal antibody which has antagonistic properties against human interleukin-4 has recently become known. This antibody contains a Fab fragment and is produced by a human-human hybridoma cell line.
  • a hybridoma cell line from spleen cells of a rat immunized against (non-) glycosylated human IL-4 also produces monoclonal antibodies against hIL-4.
  • interleukin 4 The role of interleukin 4 in allergic processes suggests that substances that inhibit interleukin-4 mediated processes or compete with hIL-4 interrupt the disease-triggering reaction chain.
  • hIL-4 mutant proteins in which at one or more of the positions 120, 121, 122, 123, 124, 125, 126, 127 or 128 the amino acid (s) naturally occurring in the wild type ( n) is exchanged for one or more other of the ' possible natural amino acids.
  • These hIL-4 mutant proteins are antagonists or partial agonists of human LL-4.
  • the present invention now relates to new hIL-4 mutant proteins which are antagonists or partial agonists of human interleukin-4 in which, in addition to the exchange (s) at positions 121, 124 or 125, further modifications of the hIL-4 protein have been carried out. These modifications are made to increase the stability of the hIL-4 mutant protein, to extend the biological half-life or to facilitate the manufacturing and purification process.
  • amino acids that occur naturally in the wild-type are deleted or replaced by other amino acids at one or more positions, or additional amino acids - also at the C- or N-terminus - are inserted, or one or more of the amino acids are identified with different not Protein polymers, such as ' polyethylene glycol and its derivatives - or substituted by glycosyl radicals.
  • amino acids generally stand for
  • the configuration name can be omitted for simplification.
  • Non-protein polymers are e.g. Polyethylene glycol, polypropylene glycol or polyoxyalkylenes, as described in US Pat. Nos. 4,640,835, 4,496,689, 4,301,144, 4,670,417, 4,791,192 or 4,179,337.
  • Glycosylation is the linking of a carbohydrate structure to the side chain of an asparagine residue ("N-glycosylation") or the coupling of a sugar, preferably N-acetylgalactosamine, galactose or xylose to serine, threonine, 4-hydroxyproline or 5-hydroxylysine (O-glycosylation ).
  • hIL-4 mutant proteins in which the amino acid 124 (tyrosine), the amino acids 121 (arginine) and amino acid 125 (serine) are exchanged in any combination for one of the possible natural amino acids, and in which the N- and / or C-terminus of the molecule is additionally modified and / or one or more polyethylene glycol molecules are covalently bound to the molecule and / or glycosylation sites present in the molecule are partially or completely deleted.
  • Particularly preferred embodiments from this group are muteins in which the amino acid 124 (tyrosine), the amino acids 121 (arginine) and amino acid 125 (serine) are exchanged in any combination for aspartic acid or gutamic acid, and in which the N- and / or C-terminus of the molecule is modified and / or one or more polyethylene glycol molecules are covalently bonded to the molecule and / or glycosylation sites present in the molecule are partially or completely deleted.
  • a preferred embodiment is also the replacement of amino acid 121 (arginine) and 125 (serine) with a naturally occurring amino acid, preferably aspartic acid or glutamic acid, and in which the N- and / or C-terminus of the molecule is additionally modified and / or one or more polyethylene glycol molecules are covalently bound to the molecule and / or glycosylation sites present in the molecule are partially or completely deleted.
  • hIL-4 mutant proteins in which the amino acid 124 (tyrosine) is replaced by a naturally occurring amino acid and 0 to a further amino acid at positions 121 and / or 125 by another of the possible amino acids, and in which the N- and / or C-terminus of the molecule is modified and / or one or more polyethylene glycol molecules are covalently bound to the molecule and / or glycosylation sites present in the molecule are partially or completely deleted.
  • hIL-4 mutant proteins in which amino acid 124 (tyrosine) is replaced by aspartic acid or glutamic acid and position 121 by another of the possible amino acids, preferably aspartic acid or glutamic acid, and in which the N- and / / or C-terminus of the molecule is modified and / or one or more polyethylene glycol molecules are covalently bound to the molecule and / or glycosylation sites present in the molecule are partially or completely deleted.
  • N-terminal modification for the abovementioned examples is the insertion of an amino acid, preferably Ala, Gly, Pro, Ser, Thr, Val, particularly preferably Ala, between the N-terminal methionine and the natural N-terminus of the hIL-4 mutant protein.
  • a preferred embodiment of the deletion of glycosylation sites in the above-mentioned embodiments is the exchange of asparagine in position 38 for another naturally occurring amino acid, preferably aspartic acid and / or asparagine in position 105 for another naturally occurring amino acid, preferably aspartic acid.
  • hIL-4 can be genetically engineered as a recombinant protein (rhIL-4), for example in E. coli.
  • the protein formed can be solubilized, renatured and isolated.
  • the rhIL-4 then has a high specific biological activity, which can be determined, for example, by measuring the DNA synthesis / proliferation of activated T cells or the CD23 expression of activated B cells [cf. Kruse, N. et al. (1991) FEBS Lett. 286, 58-60; Kikutani, H. et al. (1986) Cell 47, 657-665].
  • Yokota, T., Otsuka, T., Mosmann, T. for obtaining cDNA which encompasses a DNA region which encodes the mature region of hIL-4, or which encodes the mature region of hIL-4.
  • Banchereau, J., DeFrance, T.
  • cDNA encoding the mature region of hIL-4 is also understood to mean cDNAs which, with approximately the same number of base pairs, are mutants of the cDNA specifically specified in the prior art mentioned, provided that the hIL-4 muteins to be provided therewith are also antagonists or partial agonists.
  • cDNA encoding the mature region of hIL-4 can be obtained by cutting out an EcoRV / BamHI fragment from a genetically engineered cDNA (e.g. from British Bio-Technology Ltd., Oxford, England). The DNA fragment is added with the addition of synthetic oligonucleotides, e.g. 5'-CATGCACAAGTGCGAT and 5'-ATCGCACTTGTG, which are the first 4
  • Amino acid sequence variants of IL-4 are generated by introducing suitable modified nucleotides into the IL-4 coding DNA or by in vitro synthesis of the desired IL-4 form.
  • Such variants include e.g. Deletions or insertions or substitutions of residues within the IL-4 amino acid sequence. Any combination of deletion, insertion and substitution is permissible to achieve the final construct, provided that
  • End construct has the desired features.
  • the amino acid changes can also change the post-translational processing of IL-4: for example, can by inserting, deleting or otherwise influencing the leader sequence of the native IL-4, the number or the positions of the glycosylation sites, the properties of the membrane anchoring and / or the intracellular localization of IL-4 are changed.
  • the mutation sites can be changed individually or in series, e.g. by (1) substitution first with conservatively selected amino acids and then with more radical options depending on the results achieved, (2) deletion of the target
  • a suitable method for identifying certain IL-4 residues or regions as preferred mutagenesis sites is the "alanine scanning mutagenesis" described by Cunningham and Wells (Science, 244: 1081-1085, 1989).
  • a residue or a group of target residues is identified (e.g. charged residues such as
  • Arg, Asp, His, Lys and Glu and replaced by a neutral or negatively charged amino acid (preferably alanine or polyalanine) so as to influence the interaction of the amino acids with the adjacent aqueous environment inside or outside the cell.
  • a neutral or negatively charged amino acid preferably alanine or polyalanine
  • Variants worked on or for the substitution sites. This means that although the location for introducing an amino acid sequence change is predetermined, the type of change per se need not be predetermined.
  • the size of the deletions in an amino acid sequence is generally about 1 to 30 residues, preferably about 1 to 10 residues, and are normally one behind the other.
  • the deletions normally concern amino acid residues lying directly next to one another.
  • IL-4 in the affected area, e.g. Cysteine crosslinking, beta sheet structure or alpha helix, is retained.
  • the insertions in an amino acid sequence include amino and / or carboxyl-terminal fusions with a length from a single residue to polypeptides with 100 or more residues as well as within a sequence
  • Insertions of single or multiple amino acid residues can generally about 1 to 10 residues, preferably 1 to 5 and optimally 1 to 3 residues.
  • Examples of terminal insertions are IL-4 with an N-terminal methionyl residue, an artifact of the direct expression of IL-4 in a recombinant bacterial cell culture, the insertion of one or more additional amino acids between methionine and the natural N-terminus for better elimination of the methionine, e.g. by bacterial proteases, and the fusion of a heterologous N-terminal signal sequence to the N-terminus of the IL-4 molecule to promote the secretion of mature IL-4 from the recombinant
  • Host cells or the fusion of polyamino acids for easier isolation of IL-4.
  • These signal sequences are usually selected from the intended host cell types and are therefore homologous to them. Suitable sequences are e.g. ompA, ompT, phoA, molE, amp or pelB for E. coli, the alpha factor, amylase, invertase, killer toxin and mellitin pre-pro peptide for E. coli, the alpha factor, amylase, invertase, killer toxin and mellitin pre-pro peptide for
  • Yeast and viral signals such as herpes gD for mammalian cells.
  • a further preferred signal sequence is the natural signal sequence of interleukin-4.
  • the signal sequences which are split off by the expression organism itself are particularly preferred, so that the interleukin-4 mutant protein has the natural N-terminus.
  • Preferred expression products after cleavage of the signal sequence are:
  • insertion variants of IL-4 include the fusion of immunogenic polypeptides to the N or C terminus of IL-4, e.g. bacterial polypeptides such as beta-lactamase or an enzyme encoded by the E. coli trp locus or a yeast protein, as well as C-terminal fusions with proteins with a long half-life such as e.g. immunoglobulin constant regions (or other immunoglobulin regions), albumin or ferritin - cf. Description in WO 89/02922 (published April 6, 1989).
  • variants are those with amino acid substitution.
  • at least one amino acid residue in the IL-4 molecule is replaced by another residue.
  • hydrophobic Met, Ala, Val, Leu, He
  • neutral hydrophilic Cys, Ser, Thr
  • Non-conservative substitutions involve the exchange of a representative of one of these classes for that of another.
  • Amino acid substitution is used, among other things, to change the native glycosylation pattern of the polypeptide.
  • “Change” means deletion of one or several of the carbohydrate scaffolds in the native IL-4 and / or addition of one or more glycosylation sites that are not present in the native IL-4.
  • glycosylation of the polypeptides is usually either N-linked or O-linked.
  • N-linked refers to the coupling of the carbohydrate structure to the side chain of an asparagine residue.
  • O-linked refers to the coupling of one of the sugars N-acetylgalactosamine, galactose or xylose to a hydroxyamino acid, generally. Serine or threonine, although 4-hydroxyproline or 5-hydroxylysine can also be used.
  • amino acid sequence such that it contains one or more of the tri-peptide sequences described above (for N-linked glycosylation sites).
  • the change can also be made by adding or substituting one or more serine or threonine residues to the native IL-4 sequence (for 0-linked glycosylation sites). In the sense of an easier one
  • the IL-4 amino acid sequence is preferably changed via changes at the level of the DNA, in particular via a mutation of the transcoding DNA at previously selected bases, so that codons are generated which are translated into the desired amino acids.
  • one or more of the tri-peptide sequences present is modified by substitution or deletion of all or part of the tri-peptide.
  • the carbohydrate skeleton can be deleted by substitution or deletion of the corresponding amino acid.
  • the sugar (s) can be (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups such as those of cysteine, (d) free hydroxyl groups such as those of serine, threonine or
  • chemical or enzymatic agents can also be used to remove the carbohydrate frameworks occurring in the native IL-4.
  • Chemical deglycosylation requires exposure of the polypeptide to the compound trifluoromethanesulfonic acid or an equivalent compound. This treatment leads to the elimination of most or all of the sugars with the exception of the linking sugar (N-
  • Glycosylation at the potential glycosylation sites can be accomplished using the compound tunicamycin - described by Duskin et al. (J. Biol. Chem., 257: 3105 [1982]) - can be prevented. Tunicamycin blocks the
  • IL-4 covalent modification of IL-4 involves linking IL-4 to various non-protein polymers, e.g. Polyethylene glycol, polypropylene glycol, or polyoxyalkylene, in the manner described in US Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or
  • the agent used for cross-linking, the degree of substitution and the reaction conditions are selected by experiments with bifunctional agents, preferably with a series of reagents, each of which reacts with a different side chain.
  • a preferred way of improving the half-life of proteins circulating in vivo is to conjugate it to a polymer which gives it a longer half-life.
  • PEG polyethylene glycol
  • Cl-NH the conjugation of polyethylene glycol
  • PEG is a non-immunogenic, linear, uncharged polymer with three water molecules per molecule of ethylene oxide so that the hydrodynamic properties of the conjugated molecules can change dramatically (Maxfield et al., Polymer, 16: 505-509 (1975); Bailey, FE , et al, in: Nonionic surfactants [Schick, MJ, ed.] pp. 794-821, 1967).
  • Several therapeutically used enzymes have been linked to PEG with the aim of effectively increasing the in vivo half-life (Abuchowski, A. et al., J. Biol.
  • LL-4 can also be enclosed in microcapsules made e.g. by coacervation techniques or by "interfacial polymerization” (e.g. hydroxymethyl cellulose or gelatin microcapsules and
  • IL-4 preparations are also used in antibody production as standards for IL-4 assays (eg by labeling IL-4 for use as a standard in a radioimmunoassay, an enzyme-linked immunoassay or in a Radioreceptor assay), in affinity purification techniques and in receptor binding assays (of the competitive type) when labeled with radioiodine, enzymes, fluorophores, "spin labeis", etc. are suitable.
  • a certain "screening" of the variant obtained is necessary in order to achieve the optimal variant.
  • a change in the immunological character of the IL-4 molecule e.g. the affinity for a particular antibody, measured by a competitive immunoassay.
  • the variant is based on changes in the decrease or increase in their activity - compared to that found in the same assay for the native IL-4
  • Activity checked.
  • Other potential changes in the protein or polypeptide properties - such as, for example, the redox or thermal stability, the hydrophobicity, the sensitivity to proteolytic degradation, the stability in the recombinant cell culture or in the plasma or also the tendency to use "carriers" or to Aggregating multimers - are determined by methods that are state of the art.
  • the compounds according to the invention either inhibit interleukin-4-mediated processes or compete with the hIL-4. They are therefore suitable for the treatment of excessive or incorrectly controlled immune reactions and
  • Autoimmune diseases This also includes immunodeficiencies of both primary and secondary types.
  • the antagonist can be used both in transplants and in the palliative therapy of tumor diseases. These include, for example: - Allergies
  • the IL-4 mutant protein can be systemic as well as local i.e. can be used topically, e.g. inhalatively as a spray.
  • a formulation as a depot preparation is also possible. With all forms of therapy, both short-term therapy and long-term therapy should be considered.
  • Therapeutic formulations of the IL-4 antagonist are prepared for storage in that the IL-4 antagonist after reaching the desired degree of purity with physiologically acceptable "carriers", auxiliaries or stabilizers (Remington's Pharmaceutical Sciences, loc. Cit.) In the form of a lyophilisate or aqueous Solutions is mixed. Acceptable "carriers",
  • buffers such as phosphate, citrate and other organic acids
  • Antioxidants such as Ascorbic acid
  • low molecular weight polypeptides less than about 10 residues
  • proteins such as serum albumin, gelatin or immunoglobulins
  • hydrophilic polymers such as
  • Polyvinyl pyrrolidone Polyvinyl pyrrolidone; Amino acids such as glycine, glutamine, asparagine, arginine or lysine; Monosaccharides, disaccharides and other carbohydrates, e.g. Glucose, mannose or dextrins; Chelating agents such as EDTA; Sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium and / or non-ionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG).
  • Amino acids such as glycine, glutamine, asparagine, arginine or lysine
  • Monosaccharides, disaccharides and other carbohydrates e.g. Glucose, mannose or dextrins
  • Chelating agents such as EDTA
  • Sugar alcohols such as mannitol or sorbitol
  • salt-forming counterions such as sodium and
  • An IL-4 antagonist for in vivo use must be sterile. This is easily accomplished by filtration through sterile membrane filters, either before or after lyophilization and reconstitution.
  • the IL-4 antagonist is usually gelled in lyophilized form or in solution.
  • sustained release preparations are e.g. semi-permeable matrices made of solid hydrophobic polymers containing the protein; these matrices are shaped articles, e.g. Film-coated tablets or microcapsules.
  • sustained release matrices are polyesters, hydrogels [e.g. Poly (2-hydroxyethyl methacrylate) - described by Langer et al., J. Biomed. Mater. Res., 15: 167-277
  • Lactic acid-glycolic acid copolymer and leuprolide acetate and poly-D - (-) - 3-hydroxybutyric acid (EP 133,988). While polymers such as ethylene vinyl acetate and lactic acid-glycolic acid allow the release of the molecules for more than 100 days, the release of the proteins occurs in some hydrogels shorter periods. If encapsulated proteins remain in the body for long periods of time, they can denature or aggregate through moisture at 37 C, which results in a loss of biological effectiveness and possible changes in immunogenicity. Depending on the mechanism in question, useful strategies can be developed to stabilize the proteins.
  • stabilization can be achieved by modifying the sulfhydryl residues, lyophilizing from acidic solutions, checking the liquid content, using suitable additives and developing more specifically Achieve polymer matrix compositions.
  • Delayed-release LL-4 antagonist formulations also include IL-4 antagonists encapsulated in liposomes.
  • Liposomes containing IL-4 antagonists are produced by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Be. USA, 82: 3688-
  • the liposomes are typically of the small (about 200-800 angstroms) unilamellar type with a lipid content of more than about 30 mol%
  • Another application of the invention relates to the incorporation of EL-4 antagonists into "molded articles". These can be used to modulate or prevent the
  • Shock can be used.
  • example 1 Shock Shock can be used.
  • hIL-4 amino acid sequence there are two asparagine-linked glycosylation sites in amino acid positions 38 and 105.
  • the corresponding codons in the structural gene can be exchanged for those for aspartic acid. This prevents N-glycosylation of the resulting hIL-4 mutant protein when the gene is expressed in yeast strains.
  • the codon exchange in the nucleotide sequence was confirmed by DNA sequencing.
  • the modified structural gene was inserted into yeast expression vectors and expressed in suitable strains.
  • This mutagenesis inserts the amino acid alanine (codon GCC) into position (+ 2) of the IL4Y124D gene.
  • an Ncol site CCATGG is introduced at the 5 'end of the gene in order to facilitate the subsequent screening and cloning in an expression vector. The 'screening' of
  • Plaques were carried out by a restriction analysis based on double-stranded Ml 3 RF DNA (replicative form). Positive clones could be identified by restriction digestion with the enzymes Ncol and BamHI. The correct sequence was also confirmed by sequencing.
  • the starting materials were prepared in demineralized water and the pH was adjusted to pH 5.5. The sterilization was carried out at 121 ° C. for 20 min. Glucose was dissolved in 1/5 of the required volume in demineralized water, sterilized separately and added to the remaining nutrient solution after cooling. Regular canned food:
  • Canned stocks of all yeast transformants were created by filling 2 ml aliquots of a preculture and storing in liquid nitrogen.
  • the preculture fermentations were in 1 liter shake flasks filled with 200 ml
  • SD2 nutrient solution performed.
  • the inoculation was carried out with a canned stock or with a single colony from an SD2 agar plate.
  • the cultures were incubated at 26-30 ° C for 2-3 days with constant shaking.
  • the main culture fermentations were carried out using 10 liter.
  • the feed solution had the following composition:
  • the components were separated, dissolved in demineralized water and sterilized at 121 ° C for 20 min. After cooling, both solutions were combined.
  • the induction was carried out by changing the carbohydrate in the feed solution from glucose (500 g / 1) to galactose (500 g / 1). The further control of the feeding rate was then not carried out via the RQ value.
  • the feeding rate was manually set to double the feeding rate at the time of
  • the GallO promoter was usually induced after about 48 hours of fermentation.
  • the fermenter content was cooled to 10-15 ° C and, in the case of intracellular expression, the yeast cells were harvested by standard centrifugation techniques (e.g. cup centrifuge). The cell mass obtained after centrifugation was cryopelletized by direct dropping in liquid nitrogen and stored at -80 ° C. The product was worked up from the biomass treated in this way. When the heterologous protein was secreted into the culture broth, the yeast cells were separated from the
  • Culture broth using standard centrifugation techniques (e.g. cup centrifuge) or using cross-flow microfiltration (e.g. Filtron-Minisette system). If necessary, the culture broth was sterile filtered. The product was further processed from the cell-free culture broth.
  • standard centrifugation techniques e.g. cup centrifuge
  • cross-flow microfiltration e.g. Filtron-Minisette system
  • the E. coli transformants expressing hIL4 mutant proteins were cultivated in LB nutrient solution of the following composition:
  • the ingredients were dissolved in deionized water and sterilized at 121 ° C for 20 min. Before the inoculation, the nutrient solution was used to select the
  • Antibiotics suitable for transformers e.g. 100 mg / 1 Na ampicillin or 50 mg / 1 Kanamycin sulfate depending on the selection marker used in the vector are added sterile.
  • the preculture fermentations were carried out in 1 liter shake flask filled with 200 ml LB nutrient solution.
  • the inoculation was carried out with a canned stock or with a single colony from an LB agar plate.
  • the cultures were incubated at 30 ° C. for 12-18 hours with constant shaking.
  • the main culture fermentations were carried out using 10 liters.
  • sterile samples were taken from the culture broth at intervals of approximately 1 hour and the optical density at 600 nm (OD600) was determined. When an OD600 of 0.8-1.2 was reached, the
  • IPTG induction Sterile addition of isopropyl-ß-D-thiogalactopyranoside (IPTG) ad 0.4 mM
  • the induction time was typically 4-8 hours.
  • Example 5 After the fermentation had ended (6-14 hours), the contents of the fermenter were cooled to 10-15 ° C. and the bacterial cells were harvested using standard centrifugation techniques (eg cup centrifuge). The cell mass obtained after centrifugation was optionally stored in the frozen state. The product was processed from the biomass obtained in this way.
  • standard centrifugation techniques eg cup centrifuge
  • Yeast transform anten with an expression vector containing a gene coding for an hIL-4 mutant protein and a constitutive promoter (e.g. alpha
  • Mating factor promoter, GAPDH promoter, TPI promoter were cultivated on a 10 liter scale at 28 ° C.
  • the qualitative test for expression of the hIL-4 mutant protein was carried out using SDS-PAGE.
  • the fermentation time was 96 hours.
  • the biomass concentration achieved at the end of the fermentation was 27 g / 1 TG.
  • Yeast transformers with an expression vector containing a gene coding for an hIL-4 mutanate protein and an inducible promoter were cultivated on a 10 liter scale at 28 ° C. After a fermentation period of 48 hours, the induction took place by changing the carbohydrate used in the feed solution from glucose to galactose. During the fermentation, the qualitative test for expression of the hIL-4 mutant protein was carried out using SDS-PAGE. The fermentation time was 96 hours. The biomass concentration reached at the end of the fermentation was 24 g / 1 TG. After separation of the cells and sterile filtration, the product was worked up from the cell-free culture broth.
  • an inducible promoter e.g. Gal 10 promoter or a derivative of the GallO promoter
  • E. coli transformants with an expression vector containing a gene coding for an hIL-4 mutant protein and a temperature-inducible promoter (e.g. ⁇ pL promoter or a derivative of the ⁇ pL promoter) were cultivated on a 10 liter scale in LB nutrient solution.
  • the main culture batches were inoculated with 5% by volume of a 14-hour-old preculture cultivated in LB + Amp nutrient solution.
  • Fermentation temperature at the start of the fermentation was 30 ° C and was increased from 0.8 - 1.2 to 42 ° C to induce the temperature-sensitive promoter after reaching an OD600.
  • the qualitative test for expression of the hIL-4 mutant protein was carried out using SDS-PAGE. After an induction period of 4-6 hours, the fermentation was terminated by
  • the biomass concentration achieved at the end of fermentation was approx. 5 g / 1 FG.
  • the E. coli cells were harvested by centrifugation in a beaker centrifuge (15 min., 6500 x g, 4 ° C.) and the cell mass was cryopelletized by direct dropping in liquid nitrogen. The further frozen biomass was stored at -80 ° C.
  • the product was processed from the biomass treated in this way.
  • E. coli wet weight from Example 7 25 g were taken up in 200 ml of buffer (0.1 M phosphate buffer, pH 7.3, 0.1% Triton, 1 mM EDTA, 1 ⁇ g / ml pepstatin) and disrupted by ultrasound (Branson Sonifier B 15).
  • the the inclusion bodies containing the product were obtained by centrifugation (35,000 ⁇ g, 20 min.) and washed in the digestion buffer, which additionally contained 4 M urea.
  • the washed inclusion bodies were solubilized in 125 ml of buffer (0.2 M Tris, pH 8.1, 8 M guanidine hydrochloride). 4 g of sodium sulfite and 2 g of potassium tetrathionate were added and the reaction mixture was stirred for 2 h. Undissolved constituents were removed by centrifugation after the reaction had ended (35,000 x g, 20 min.).
  • buffer 0.2 M Tris, pH 8.1, 8 M guanidine hydrochloride
  • the supernatant was applied to a gel filtration column (Sephacryl-S-300 HR, Pharmacia, 10 ⁇ 90 cm) and gel filtered in PBS buffer containing 6 M guanidine hydrochloride at a flow rate of 280 ml / h.
  • Product-containing fractions were identified by SDS-PAGE and pooled.
  • ß-mercaptoethanol final concentration 15 mM was added. After two hours of incubation at room temperature, the mixture was diluted 5-fold with water and dialyzed for 3-4 days against buffer (3 mM NaH, PO 4 , 7 mM Na 2 HPO 4 , 2 mM KC1, 120 mM NaCl).
  • the dialyzed material was adjusted to pH 5 with acetic acid and the conductivity was reduced to ⁇ 10 mS / cm by adding water.
  • CM-Sepharose was applied to a Vydac C-4 column (1 x 25 cm, 10 ⁇ m) equilibrated with 0.1% TFA and eluted with an increasing acetonitrile gradient. Fractions containing pure product were pooled and lyophilized.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pulmonology (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Obesity (AREA)
  • Transplantation (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Die vorliegende Erfindung betrifft neue hIL-4-Mutantenproteine, Verfahren zu ihrer Herstellung sowie ihre Verwendung als Arzneimittel, insbesondere bei überschießenden fehlgesteuerten Immunreactionen und Autoimmunerkrankungen.

Description

Neue hIL-4-Mutantenproteine als Antagonisten oder partielle Agonisten des humanen Interleukin 4
Die vorliegende Erfindung betrifft neue hIL-4-Mutantenproteine, Verfahren zu ihrer Herstellung, sowie ihre Verwendung als Arzneimittel, insbesondere bei überschießenden fehlgesteuerten Immunreaktionen und Autoimmunerkrankungen.
Aus der PCT WO 93/10235 sind bereits therapeutische Mittel, die Antagonisten oder partielle Agonisten des hIL-4 sind oder diese enthalten, wobei die Antagonisten oder partiellen Agonisten hIL-4-Mutantenproteine sind, bekannt.
Humanes Interleukin-4 (hIL-4) ist eines unter den zahlreichen Cytokinen, die die Proliferation, die Reifung, das Überleben und die Differenzierung lymphoider und myeloischer Zellen induzieren und koordinieren. Insbesondere ist hIL-4 an der
IgE-mediierten Immunreaktion beteiligt und beschleunigt direkt die Proliferation von Thymocyten und aktivierten T-Zellen. Man konnte ein hochaffines IL-4- Rezeptorprotein mit Mr 140 000 identifizieren, welches gemäß seiner cDNA- Sequenz aus 800 Aminosäureresten besteht. Dieses gehört zu einer kürzlich beschriebenen Gruppe von Rezeptoren, die man als Hämatopoietin-Rezeptor-
Superfamilie bezeichnet.
Die Aminosäuresequenz des reifen IL-4 besteht aus 129 Resten, wenn man die klonierte cDNA zugrundelegt. Die cDNA ist in E.coli und Hefe exprimiert worden. Aus diesen Quellen kann rekombinantes IL-4 mit hoher biologischer
Aktivität gewonnen werden. In jüngster Zeit ist bereits ein monoclonaler Antikörper bekannt geworden, der gegenüber dem menschlichen Interleukin-4 antagonistische Eigenschaften aufweist. Dieser Antikörper enthält ein Fab-Fragment und wird von einer Mensch-Mensch- Hybridomazellinie produziert. Auch eine Hybridomazellinie aus Milzzellen einer gegen (nicht-)glycosyliertes menschliches IL-4 immunisierten Ratte produziert monoclonale Antikörper gegen hIL-4.
Die Rolle des Interleukin 4 bei allergischen Prozessen läßt hoffen, daß Substanzen, die Interleukin-4 vermittelte Prozesse inhibieren oder mit dem hIL-4 konkurrieren, die krankheitsauslösende Reaktionskette unterbrechen.
In DE 41 37 333 AI sind hIL-4-Mutantenproteine beschrieben, bei denen an einer oder mehreren der Positionen 120, 121, 122, 123, 124, 125, 126, 127 oder 128 die dort natürlicherweise im Wildtyp auftretende(n) Aminosäure(n) gegen eine bzw. mehrere andere der ' möglichen natürlichen Aminosäuren ausgetauscht ist. Diese hIL-4-Mutantenproteine sind Antagonisten oder partielle Agonisten des humanen LL-4.
Die vorliegende Erfindung betrifft nun neue hIL-4-Mutantenproteine, die Antagonisten oder partielle Agonisten des humanen Interleukin-4 sind, in welchen zusätzlich zu dem/den Austausch/en an den Positionen 121, 124 oder 125 weitere Modifikationen des hIL-4-Proteins durchgeführt worden sind . Diese Modifikationen werden durchgeführt, um die Stabilität des hIL-4-Mutantenproteins zu erhöhen, um die biologische Halbwertszeit zu verlängern oder um das Herstellungs- und Reiningungsverfahren zu erleichtern.
Dazu werden an einer oder mehreren Positionen, die dort natürlicherweise im Wildtyp auftretenden Aminosäuren deletiert bzw. durch andere Aminosäuren ersetzt, oder es werden zusätzliche Aminosäuren - auch an C- oder N-Terminus - eingefügt, oder eine oder mehrere der Aminosäuren werden mit verschiedenen Nicht-Protein-Polymeren, wie z.B.' Polyethylenglykol und dessen Derivaten- oder durch Glycosylreste substituiert. Aminosäuren stehen im Rahmen der Erfindung im allgemeinen für
Ala L-Alanin
Arg L-Arginin
Asn L-Asparagin
Asp L-Asparaginsäure
Cys L-Cystein
Gin L-Glutamin
Glu L-Glutaminsäure
Gly L-Glycin
His L-Histidin
He L-Isoleucin
Leu L-Leucin
Lys L-Lysin
Met L-Methionin
Pro L-Prolin
Phe L-Phenylalanin
Ser L- Serin
Thr L-Threonin
Trp L-Tryptophan
Tyr L-Tyrosin
Val L-Valin,
wobei zur Vereinfachung die Konfigurationsbezeichnung unterbleiben kann.
Unter Nicht-Protein-Polymere versteht man z.B. Polyethylenglycol, Poly- propylenglycol oder Polyoxyalkylene, wie sie in den US-Patenten Nr. 4.640.835, 4.496.689, 4.301.144, 4.670.417, 4.791.192 oder 4.179.337 beschrieben sind.
Unter Glycosylierung versteht man die Verknüpfung eines Kohlenhydratgerüstes an die Seitenkette eines Asparaginrestes ("N-Glycosylierung") oder die Kopplung eines Zuckers, bevorzugt N-Acetylgalaktosamin, Galaktose oder Xylose an Serin, Threonin, 4-Hydroxyprolin oder 5-Hydroxylysin (O-Glycosylierung).
Bevorzugt sind hIL-4 Mutantenproteine, bei denen die Aminosäure 124 (Tyrosin), die Aminosäuren 121 (Arginin) und Aminosäure 125 (Serin) in beliebiger Kombi¬ nation gegen eine der möglichen natürlichen Aminosäuren ausgetauscht sind, und bei welchen zusätzlich der N- und/oder C-terminus des Moleküls modifiziert ist und/oder ein oder mehrere Polyethylenglycol-Moleküle kovalent an das Molekül gebunden sind und/oder im Molekül vorhandene Glycosylierungsstellen teilweise oder vollständig deletiert sind.
Besonders bevorzugte Ausführungen aus dieser Gruppe sind Muteine, bei denen die Aminosäure 124 (Tyrosin), die Aminosäuren 121 (Arginin) und Aminosäure 125 (Serin) in beliebiger Kombination gegen Asparaginsäure oder Gutaminsäure ausgetauscht sind, und bei welchen zusätzlich der N- und/oder C-terminus des Moleküls modifiziert ist und/oder ein oder mehrere Polyethylenglycol-Moleküle kovalent an das Molekül gebunden sind und/oder im Molekül vorhandene Glyco¬ sylierungsstellen teilweise oder vollständig deletiert sind.
Bevorzugte Ausführungsform ist ebenfalls der Austausch der Aminosäure 121 (Arginin) und 125 (Serin) gegen eine natürlich vorkommende Aminosäure, bevor¬ zugt Asparaginsäure oder Glutaminsäure, und bei welchen zusätzlich der N- und/oder C-terminus des Moleküls modifiziert ist und/oder ein oder mehrere Poly¬ ethylenglycol-Moleküle kovalent an das Molekül gebunden sind und/oder im Molekül vorhandene Glycosylierungsstellen teilweise oder vollständig deletiert sind.
Besonders bevorzugt sind weiterhin hIL-4 Mutantenproteine, in welchen die Aminosäure 124 (Tyrosin) gegen eine natürlich vokommende Aminosäure und 0 bis eine weitere Aminosäure an den Positionen 121 und/oder 125 gegen eine andere der möglichen Aminosäuren ausgetauscht sind, und bei welchen zusätzlich der N- und/oder C-terminus des Moleküls modifiziert ist und/oder ein oder mehrere Polyethylenglycol-Moleküle kovalent an das Molekül gebunden sind und/oder im Molekül vorhandene Glycosylierungsstellen teilweise oder vollständig deletiert sind.
Aus dieser Gruppe besonders bevorzugt sind hIL-4 Mutantenproteine, in welchen die Aminosäure 124 (Tyrosin) gegen Asparaginsäure oder Glutaminsäure und die Position 121 gegen eine andere der möglichen Aminosäuren, bevorzugt Asparaginsäure oder Glutaminsäure ausgetauscht sind, und bei welchen zusätzlich der N- und/oder C-terminus des Moleküls modifiziert ist und/oder ein oder mehrere Polyethylenglycol-Moleküle kovalent an das Molekül gebunden sind und/oder im Molekül vorhandene Glycosylierungsstellen teilweise oder vollständig deletiert sind.
Bevorzugte Ausführungen der N-terminalen Modifikation für oben genannte Bei¬ spiele ist die Insertion einer Aminosäure, bevorzugt Ala, Gly, Pro, Ser, Thr, Val, besonders bevorzugt Ala, zwischen dem N-terminalen Methionin und dem natür¬ lichen N-terminus des hIL-4 Mutantenproteins.
Beispiele für ein derartig exprimiertes Produkt sind:
Ala(-l)-Tyr(124)Asp AI a(- 1 )- Arg( 121 ) Asp-Ty r( 124) Asp Ala(- 1 )- Arg( 121 )Asp-Tyr( 124)Asp-Ser( 125) Asp
Ala(-l)-Tyr(124)Asp-Ser(125)Asp Ala(- 1 )-Arg( 121 )Asp-Ser( 125)Asp
Bevorzugte Ausführung der Deletierung von Glycosylierungsstellen in den oben genannten Ausführungen sind die Austausche von Asparagin in Position 38 gegen eine andere natürlich vorkommende Aminosäure, bevorzugt Asparaginsäure und/ oder Asparagin in Position 105 gegen eine andere natürlich vorkommende Amino¬ säure, bevorzugt Asparaginsäure.
Beispiele für derartig exprimierte Produkte sind:
Asn(38) Asp-Asn( 105)Asp-Tyr( 124)Asp Asn(38)Asp-Asn(105)Asp-Arg(121)Asp-Tyr(124)Asp
Asn(38)Asp-Asn(l 05) Asp-Arg( 121 ) Asp-Tyr( 124) Asp-Ser( 125) Asp Asn(38) Asp- Asn(l 05)Asp-Tyr( 124)Asp-Ser( 125)Asp Asn(38) Asp-Asn( 105) Asp-Arg( 121 ) Asp-Ser( 125) Asp
hIL-4 läßt sich als rekombinantes Protein (rhIL-4) gentechnisch, z.B. in E.coli, erzeugen. Das dabei gebildete Protein läßt sich solubilisieren, renaturieren und isolieren. Das rhIL-4 besitzt dann eine hohe spezifische biologische Aktivität, die z.B. durch Messung der DNA-Synthese/Proliferation von aktivierten T-Zellen oder der CD23 Expression von aktivierten B-Zellen bestimmt werden kann [vgl. Kruse, N. et al. (1991) FEBS Lett. 286, 58-60; Kikutani, H. et al. (1986) Cell 47, 657-665].
Zur Beschaffung von cDNA, die einen DNA-Bereich umfaßt, der den maturen Bereich von hIL-4 kodiert, oder die den maturen Bereich von hIL-4 kodiert, wird auf Yokota, T., Otsuka, T., Mosmann, T., Banchereau, J., DeFrance, T.,
Blanchard, D., De Vries, J.E., Lee, F. and Arai, K.I. (1986) Proc. Natl. Acad. Sei, USA 83, 5894-5898 und die dort angeführte Literatur verwiesen. Im vorliegenden Zusammenhang werden unter "cDNA, die den maturen Bereich von hIL-4 kodiert" auch cDNA's verstanden, die bei etwa gleicher Anzahl von Basenpaaren Mutanten der konkret im genannten Stand der Technik angegebenen cDNA darstellen, sofern die damit vorzusehenden hIL-4-Muteine ebenfalls Antagonisten oder partielle Agonisten sind.
Hinsichtlich der Durchnumerierung des den maturen Bereich von hIL-4 kodierenden DNA-Bereiches wird hier Garr. C. et al., Biochemistry 1991, 30, 1515-1523 gefolgt.
cDNA, die den maturen Bereich von hIL-4 kodiert, kann durch das Ausschneiden eines EcoRV/BamHI-Fragment aus einer gentechnologisch hergestellten cDNA (z.B. von Britisch Bio-Technology Ltd., Oxford, England) gewonnen werden. Das DNA-Fragment wird unter Zusatz von synthetischen Oligonucleotiden, z.B. 5'- CATGCACAAGTGCGAT und 5'-ATCGCACTTGTG, welche die ersten 4
Aminosäure-Codons von Interleukin-4 und zusätzlich das Codon für das Start- Methionin enthalten, in einen Expressionsvektor integriert, beispielsweise zwischen die Ncol- und BamHI-Schnittstellen des Expressionsvektors pRτspRC 109 [vgl. Weigel, U, Meyer, M. und Sebald W. (1989) Eur. J. Biochem. 180, 295-300].
Aminosäuresequenz- Varianten von IL-4 werden durch Einführung geeigneter veränderter Nukleotide in die IL-4-kodierende DNA oder durch In-vitro-Synthese der gewünschten IL-4-Form erzeugt. Zu solchen Varianten gehören z.B. Deletionen oder Insertionen oder Substitutionen von Resten innerhalb der IL-4- Aminosäuresequenz. Dabei ist zur Erzielung des Endkonstrukts jede Kombination aus Deletion, Insertion und Substitution zulässig, vorausgesetzt daß das
Endkonstrukt die gewünschten Merkmale aufweist. Die Aminosäureveränderungen können auch die post-translationale Prozessierung von IL-4 verändern: z.B. können durch Insertion, Deletion oder anderweitige Beeinflussung der Leader-Sequenz des nativen IL-4 die Anzahl oder die Positionen der Glycosylierungsstellen, die Eigenschaften der Membranverankerung und/oder die intrazelluläre Lokalisation von IL-4 verändert werden.
Bei der Konstruktion von Aminosäuresequenz-Varianten von IL-4 hängen die
Lokalisation der Mutationsstelle und die Art der Mutation von der (den) zu verändernden Eigenschaft(en) von IL-4 ab. Die Mutationsstellen können einzeln oder in Reihe verändert werden, so z.B. durch (1) Substitution zunächst mit konservativ ausgewählten Aminosäuren und danach mit radikaleren Wahlmöglich- keiten in Abhängigkeit von den erzielten Ergebnissen, (2) Deletion des Target-
Rests oder (3) Insertion von Resten in der Nähe der lokalisierten Stelle.
Eine geeignete Methode zur Identifizierung bestimmter IL-4-Reste oder -Regionen als bevorzugte Mutagenesestellen ist die von Cunningham und Wells (Science, 244: 1081-1085, 1989) beschriebene "Alanin-Scanning-Mutagenese". Dabei wird ein Rest oder eine Gruppe von Target-Resten identifiziert (z.B. geladene Reste wie
Arg, Asp, His, Lys und Glu) und durch eine neutrale oder negativ geladene Aminosäure (am besten Alanin oder Polyalanin) ersetzt, um so die Interaktion der Aminosäuren mit dem benachbarten wässrigen Umfeld innerhalb oder außerhalb der Zelle zu beeinflussen. Die Bereiche, die auf die Substitutionen funktionell empfindlich reagieren, werden danach durch die Einführung weiterer oder anderer
Varianten an den oder für die Substitionsstellen aufgearbeitet. Dies bedeutet, daß zwar die Stelle für die Einführung einer Aminosäuresequenz-Veränderung vorbestimmt ist, aber die Art der Veränderung per se nicht vorbestimmt sein muß.
Um also die Ausführung einer Mutation an einer bestimmten Stelle zu optimieren, kann am Target-Codon oder an der Target-Region das Verfahren des "Ala-
Scanning" oder der Zufall s-Mutagenese durchgeführt werden, wobei die exprimier- ten IL-4- Varianten auf die optimale Kombination im Interesse der gewünschten Eigenschaft überprüft werden.
Bei der Konstruktion der Aminosäuresequenz- Varianten gibt es also zwei Hauptvariable: die Stelle der Mutation und die Art der Mutation. Die Größe der Deletionen in einer Aminosäuresequenz beträgt in der Regel etwa 1 bis 30 Reste, bevorzugt etwa 1 bis 10 Reste, und sind im Normalfall hinterein- anderliegend. Im Normalfall betreffen die Deletionen unmittelbar nebeneinander liegende Aminosäurereste.
Die Zahl der aufeinanderfolgenden Deletionen wird so gewählt, daß die
Tertiärstruktur von IL-4 im betroffenen Bereich, z.B. Cystein-Crosslinking, Beta- Faltblatt-Struktur oder Alpha-Helix, erhalten bleibt.
Zu den Insertionen in einer Aminosäuresequenz gehören amino- und/oder carboxyl-terminale Fusionen mit einer Länge von einem einzigen Rest bis zu Polypeptiden mit 100 oder mehr Resten sowie innerhalb einer Sequenz liegende
Insertionen von einzelnen oder mehreren Aminosäure-Resten. Innerhalb einer Sequenz liegende Insertionen (d.h. Insertionen innerhalb der IL-4-Sequenz) können i.a. etwa 1 bis 10 Reste, vorzugsweise 1 bis 5 und optimal erweise 1 bis 3 Reste, umfassen. Beispiele für terminale Insertionen sind IL-4 mit einem N-terminalen Methionylrest, ein Artefakt der direkten Expression von IL-4 in einer rekombinanten Bakterienzellkultur, die Insertion einer oder mehrerer zusätzlicher Aminosäuren zwischen Methionin und dem natürlichen N-Terminus zur besseren Abspaltung des Methionins, z.B. durch bakterieneigene Proteasen, und die Fusion einer heterologen N-terminalen Signalsequenz an den N-Terminus des IL-4- Moleküls zur Förderung der Sekretion von reifem IL-4 aus den rekombinanten
Wirtszellen bzw. die Fusion von Polyaminosäuren, z.B. Polyhistidin, zur leichteren Isolierung von IL-4. Diese Signalsequenzen werden in der Regel aus den vorgesehenen Wirtszellarten ausgewählt und sind diesen daher homolog. Geeignete Sequenzen sind z.B ompA, ompT, phoA, molE, amp oder pelB für E. coli-, der Alpha-Faktor, Amylase, Invertase, Killer-Toxin sowie Mellitin-Pre-Pro-Peptid für
Hefe- und virale Signale wie Herpes gD für Säugerzellen.
Eine weiter bevorzugte Signalsequenz ist die natürliche Signalsequenz des Inter- leukin-4.
Besonders bevorzugt sind die Signal Sequenzen, die vom Expressionsorganismus selber abgespalten werden, so daß das Interleukin-4 Mutantenprotein den natür¬ lichen N-terminus aufweist. Bevorzugte Expressionsprodukte nach Abspaltung der Signalsequenz sind:
Tyr(124)Asp
Arg( 121 ) Asp-Tyr( 124) Asp Arg( 121 ) Asp-Tyr( 124) Asp-Ser(l 25) Asp Tyr(124)Asp-Ser(125)Asp
Arg(121)Asp-Ser(125)Asp
Zu den weiteren Insertions- Varianten von IL-4 gehören die Fusion immunogener Polypeptide an den N- oder C-Terminus von IL-4, z.B. bakterielle Polypeptide wie Beta-Lactamase oder ein durch den E. coli-trp-Locus kodiertes Enzym oder ein Hefeprotein, sowie C-terminale Fusionen mit Proteinen mit langer Halbwertzeit wie z.B. immunglobulinkonstante Regionen (oder andere Immunglobulin- Regionen), Albumin oder Ferritin - vgl. Beschreibung in WO 89/02922 (veröffentlicht am 6. April 1989).
Eine weitere Gruppe von Varianten sind diejenigen mit Aminosäuresubstitution. Bei diesen Varianten ist mindestens ein Aminosäurerest im IL-4-Molekül durch einen anderen Rest ersetzt.
Die natürlich vorkommenden Reste werden auf der Grundlage gemeinsamer Seitenketten-Charakteristika in Klassen gegliedert:
1) hydrophob: Met, Ala, Val, Leu, He; 2) neutral hydrophil: Cys, Ser, Thr;
3) sauer: Asp, Glu;
4) basisch: Asn, Gin, His, Lys, Arg;
5) Reste mit Einfluß auf die Kettenorientierung: Gly, Pro; und 6) aromatisch: Trp, Tyr, Phe.
Nichtkonservative Substitutionen beinhalten den Austausch eines Vertreters einer dieser Klassen gegen den einer anderen.
Die Aminosäuresubstitution findet u.a. Anwendung bei der Änderung des nativen Glycosylierungsmusters des Polypeptids. "Änderung" heißt Deletion eines oder mehrerer der Kohlenhydratgerüste im nativen IL-4 und/oder Hinzufügung einer oder mehrerer Glycosylierungsstellen, die im nativen IL-4 nicht vorhanden sind.
Die Glycosylierung der Polypetide ist normalerweise entweder N-verknüpft oder O-verknüpft. "N-verknüpft" bezieht sich auf die Kopplung des Kohlenhydrat- gerüsts an die Seitenkette eines Asparaginrestes. Die tri-Peptid-Sequenzen
Asparagin-X-Serin und Asparagin-X-Threonin, wobei X jede Aminosäure mit Ausnahme von Prolin sein kann, sind die Erkennungssequenzen für die enzymatische Kopplung des Kohlenhydratgerüsts an die Asparagin-Seitenkette. Die Anwesenheit einer dieser tri-Peptid-Sequenzen in einem Polypeptid schafft demzufolge eine potentielle Glykosylierungsstelle.
" O-verknüpft" b ezi eht si ch auf di e Kopplung eines der Zucker N- Acetylgalactosamin, Galaktose oder Xylose an eine Hydroxyaminosäure, i.a. Serin oder Threonin, obwohl auch 4-Hydroxyprolin oder 5-Hydroxylysin verwendet werden können.
Die Hinzufügung von Glykosylierungsstellen an IL-4 erfolgt problemlos durch
Änderung der Aminosäuresequenz derart, daß diese eine oder mehrere der oben beschriebenen tri-Peptid-Sequenzen (für N-verknüpfte Glykosylierungsstellen) enthält. Die Änderung kann ebenso durch Addition oder Substitution von einem oder mehreren Serin- oder Threoninresten an die native IL-4-Sequenz (für 0- verknüpfte Glykosylierungsstellen) erfolgen. Im Sinne eines einfacheren
Vorgehens wird die IL-4-Aminosäuresequenz vorzugsweise über Änderungen auf der Ebene der DNA geändert, insbesondere über eine Mutation der Um¬ kodierenden DNA an vorher ausgewählten Basen, so daß Codons erzeugt werden, die in die gewünschten Aminosäuren translatiert werden. Analog wird bei der gewünschten Deletion des Kohlenhydratgerüstes eine oder mehrere der vorhande¬ nen tri-Peptid-Sequenzen (für N-verknüpfte Glycosylierungen) durch Substitution oder Deletion des ganzen oder Teilen des tri-Peptids modifiziert. Im Falle von O-Glycosylierungsstellen kann das Kohlenhydratgerüst durch Substitution oder Deletion der entsprechenden Aminosäure deletiert werden.
Eine weitere Möglichkeit zur Erhöhung der Anzahl der Kohlenhydratgerüste in IL-
4 liegt in der chemischen oder enzymatischen Ankopplung von Glykosiden an das Polypeptid. Diese Verfahren sind insofern von Vorteil, als daß sie die Herstellung des Polypeptids nicht in einer Wirtszelle mit Glykosylierungsmöglichkeiten für die N- und O-verknüpfte Glykosylierung erfordern. Je nach dem verwendeten Kopplungsmechanismus kann (können) der (die) Zucker mit (a) Arginin und Histidin, (b) freien Carboxylgruppen, (c) freien Sulfhydrylgruppen wie denen von Cystein, (d) freien Hydroxylgruppen wie denen von Serin, Threonin oder
Hydroxyprolin, (e) aromatischen Resten wie denen von Phenylalanin, Tyrosin oder Tryptophan oder (f) der Amidogruppe von Glutamin verknüpft werden. Diese Methoden werden in WO 87/05330, veröffentlicht am 11. September 1987, und bei Aplin und Wriston (CRC Crit. Rev. Biochem, S. 259-306 [1981]) beschrieben.
Zur Entfernung der im nativen IL-4 vorkommenden Kohlenhydratgerüste können neben der oben erwähnten Methode auch chemische oder enzymatische Mittel angewandt werden. Bei der chemischen Deglykosylierung ist die Exposition des Polypeptids gegenüber der Verbindung Trifluormethansulfonsäure oder einer äquivalenten Verbindung erforderlich. Diese Behandlung führt zur Abspaltung der meisten oder aller Zucker mit Ausnahme des verknüpfenden Zuckers (N-
Acetylglucosamin oder N-Acetylgalaktosamin), läßt aber das Polypeptid intakt. Die chemische Deglykosylierung wird von Hakkimuddin et al., Arch. Biochem. Biophys., 259:52 (1987) und von Edge et al., Anal. Biochem., 1 18: 131 (1981) beschrieben. Die enzymatische Abspaltung von Kohlenhydratgerüsten in den Polypeptiden i st durch di e Verwendung einer Reihe von Endo- und
Exoglykosidasen - beschrieben von Thotakura et al. (Meth. Enzymol., 138:350 [1987]) - zu erreichen.
Die Glykosylierung an den potentiellen Glykosylierungsstellen kann durch Verwendung der Verbindung Tunicamycin - beschrieben von Duskin et al. (J. Biol. Chem., 257:3105 [1982]) - verhindert werden. Tunicamycin blockiert die
Bildung von Protein-N-Glykosid-Verknüpfungen.
Ein weiterer Typ einer kovalenten Modifikation von IL-4 schließt die Verknüpfung von IL-4 an verschiedene Nicht-Protein-Polymere, z.B. Polyethylenglykol, Poly- propylenglykol oder Polyoxyalkylene, in der Art und Weise ein, wie sie in den US-Patenten Nr. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 oder
4,179,337 beschrieben wird. Das zur Quervernetzung verwendete Agens, der Substitutionsgrad und die Reaktionsbedingungen wird durch Experimente mit bifunktionellen Agentien ausgewählt, vorzugsweise mit einer Reihe von Reagenzien, von denen jedes mit einer anderen Seitenkette reagiert.
Eine bevorzugt genutzte Möglichkeit zur Verbesserung der Halbwertzeit von in vivo zirkulierenden Proteinen ist dessen Konjugation an ein Polymer, das ihm eine längere Halbwertzeit verleiht. So hat sich z.B . die Konjugation von Polyethylenglykol (PEG) an Cl-NH als eine ausgezeichnete Möglichkeit zur Verlängerung der Halbwertzeit erwiesen. PEG ist ein nicht immunogenes, lineares, ungeladenes Polymer mit drei Wassermolekülen pro Molekül Äthylenoxid, so' daß sich die hydrodynamischen Eigenschaften der konjugierten Moleküle dramatisch ändern können (Maxfield et al., Polymer, 16:505-509 (1975); Bailey, F.E., et al, in: Nonionic surfactants [Schick, M.J., Hrsg.] S. 794-821, 1967). Mehrere therapeutisch verwendete Enzyme wurden mit dem Ziel einer wirksamen Erhöhung der In-vivo-Halbwertzeit mit PEG verknüpft (Abuchowski, A. et al., J. Biol.
Chem. 252:3582-3586, 1977; Abuchowski, A. et al., Cancer Biochem. Biophys., 7: 175-186, 1984). Die PEG- Verknüpfung von IL-2 (Interleukin-2) soll nicht nur dessen Zirkulations-Überlebensdauer verlängern, sondern auch dessen Potenz erhöhen (Katre, N.V. et al., Proc. Natl. Acad. Sei., 84: 1487-1491 (1987); Goodson, R. et al., Bio/Technology, 8:343-346, 1990). Für die PEG-Verknüpfung anderer
Moleküle ist eine Verminderung der Immunogenität und der Toxizität mitgeteilt worden (Abuchowski, A. et al., J. Biol. Chem., 252:3578-3581, 1977).
LL-4 kann auch in Mikrokapseln eingeschlossen werden, hergestellt z.B. durch Coacervationstechniken oder durch "Grenzschicht-Polymerisierung" ("interfacial polymerization") (z.B. Hydroxymethylcellulose- oder Gelatine-Mikrokapseln und
Poly-[Methylmethacylat]-Mikrokapseln) in kolloidalen Arzneistoff-Freigabe¬ systemen (z.B. Liposome, Albumin-Mikrosphären, Mikroemulsionen, Nano- Partikel und Nanokapseln) oder in Makroemulsionen. Solche Techniken werden in Remington's Pharmaceutical Sciences, 16. Auflage, Osol, A., Hrsg. (1980), genannt.
IL-4-Präparate sind auch bei der Antikörpergewinnung als Standards für IL-4- Assays (z.B. durch Markierung von IL-4 zur Verwendung als Standard in einem Radioimmunassay, einem enzymgekoppelten Immunassay oder in einem Radiorezeptorassay), in Affinitäts-Reinigungstechniken und in Rezeptorbindungs- Assays (vom kompetitiven Typ) bei Markierung mit Radioiod, Enzymen, Fluorophoren, "spin labeis" usw. geeignet.
Da die Voraussage der Eigenschaften einer IL-4-Variante schwierig ist, ist es verständlich, daß ein gewisses "Screening" der erhaltenen Variante notwendig ist, um die optimale Variante zu erreichen. So wird z.B. eine Änderung im immunologischen Charakter des IL-4-Moleküls, z.B. die Affinität für einen bestimmten Antikörper, durch einen kompetitiven Immunassay gemessen. Die Variante wird auf Veränderungen bei der Verminderung oder Verstärkung ihrer Aktivität - verglichen mit der im gleichen Assay für das nativen IL-4 festgestellten
Aktivität - überprüft. Andere potentielle Veränderungen der Protein- oder Polypeptid-Eigenschaften - wie z.B. der Redox- oder der thermischen Stabilität, der Hydrophobizität, der Empfindlichkeit gegenüber proteolytischem Abbau, der Stabilität in der rekombinanten Zellkultur oder im Plasma oder auch der Tendenz, mit "Carriern" oder zu Multimeren zu aggregieren - werden durch Methoden bestimmt, die Stand der Technik sind.
THERAPEUTISCHE FORMULIERUNGEN UND VERABREICHUNG VON E -4
Die erfindungsgemäßen Verbindungen inhibieren entweder Interleukin-4-ver- mittelte Prozesse oder konkurrieren mit dem hIL-4. Sie eignen sich deshalb zur Behandlung von überschießenden bzw. fehlgesteuerten Immunreaktionen und
Autoimmunerkrankungen. Dazu zählen auch Immundefizienzen sowohl primärer als auch sekundärer Art. Darüber hinaus kann der Antagonist sowohl bei Transplantationen als auch bei der pallitaüven Therapie von Tumorerkrankungen eingesetzt werden. Dazu gehören beispielsweise: - Allergien
(Blockierung der Primär- und der IgE vermittelten
Antwort; Desensibilisierung bei bekannter Allergie; Atopische
Erkrankungen; Linderung bei Asthma Anfällen; Hyper IgE Syndrom).
Transplantationen (Reduktion der HLA-DR Expression bei
Organtransplantation, Suppression der GVHD, Einsatz beim Purgen von
Knochenmark)
Leukämien und solide IL-4 Rezeptor exprimierende
Tumoren (Reduktion einer überschießenden autokrinen IL-4
Produktion; Hemmung des Tumorwachstums)
Gegenregulation bei Überproduktion von Thrombozyten
Therapie von Gerinnungsstörungen
(via Monozytenblock) - Verwendung bei Störungen des Lipidstoffwechsels
Korrektur bei Störungen des Kohlehydrathaushalts
Verbesserung des Immunstatus bei Infektionen
(Sepsis).
Aufgrund seiner guten Wasserlöslichkeit kann das IL-4-Mutantenprotein sowohl systemisch als auch lokal d.h. topisch eingesetzt werden, u.a. inhalativ als Spray.
Auch eine Formulierung als Depotpräparat ist möglich. Bei allen Therapieformen ist sowohl an eine Kurzzeittherapie als auch an eine Dauertherapie zu denken. Therapeutische Formulierungen des IL-4-Antagonisten werden zur Lagerung dadurch zubereitet, daß der IL-4-Antagonist nach Erreichen des gewünschten Reinheitsgrades mit physiologisch akzeptablen "Carriern", Hilfsstoffen oder Stabilisatoren (Remington's Pharmaceutical Sciences, a.a.O.) in Form eines Lyophilisats oder von wässrigen Lösungen gemischt wird. Akzeptable "Carrier",
Hilfsstoffe oder Stabilisatoren sind für die Empfänger bei den angewendeten Dosierungen und Konzentrationen nicht toxisch; dazu gehören Puffer wie Phosphat, Zitrat und andere organische Säuren; Antioxidantien wie z.B. Ascorbinsäure; niedermolekulare Polypeptide (weniger als etwa 10 Reste), Proteine wie Serumalbumin, Gelatin oder Immunglobuline; hydrophile Polymere wie
Polyvinylpyrrolidon; Aminosäuren wie Glycin, Glutamin, Asparagin, Arginin oder Lysin; Monosaccharide, Disaccharide und andere Kohlenhydrate, z.B. Glukose, Mannose oder Dextrine; Chelatbildner wie EDTA; Zuckeralkohole wie Mannitol oder Sorbitol; salzbildende Gegenionen wie Natrium und/oder nicht-ionische oberflächenaktive Stoffe wie Tween, Pluronics oder Polyethylenglykol (PEG).
Ein IL-4-Antagonist zur in-vivo-Anwendung muß steril sein. Dies wird leicht erreicht durch Filtration über sterile Membranfilter, entweder vor oder nach der Lyophilisierung und Rekonstitution. Gel agert wird der IL-4-Antagonist normalerweise in lyophilisierter Form oder in Lösung.
Geeignete Beispiele für Zubereitungen mit verzögerter Freisetzung sind z.B. semipermeable Matrizen aus festen hydrophoben Polymeren, die das Protein enthalten; bei diesen Matrizen handelt es sich um geformte Artikel ("shaped articles"), z.B. Filmtabletten oder Mikrokapseln. Beispiele für Matrizen mit verzögerter Freisetzung sind Polyester, Hydrogele [z.B. Poly(2-hydroxyethyl- methacrylat) - beschrieben von Langer et al., J. Biomed. Mater. Res., 15: 167-277
[1981] und Langer, Chem. Tech., 12:98-105 [1982] -oder Poly(vinylalkohol)], Polyactide (US-Pat. Nr. 3,773,919, EP 58,481), Copolymere aus L-Glutaminsäure und Gamma-ethyl-L-glutamat (Sidman et al., Biopolymers, 22:547-556 [1983]), nicht abbaubares Ethylen-vinyl-acetat (Langer et al., a.a.O.), abbaubare Milchsäure- Glykolsäure-Copolymere wie Lupron DepotTM (injizierbare Mikrosphären aus
Milchsäure-Glykolsäure-Copolymer und Leuprolidazetat) und Poly-D-(-)-3- hydroxybuttersäure (EP 133,988). Während Polymere wie Ethylenvinylacetat und Milchsäure-Glykolsäure die Freisetzung der Moleküle über mehr als 100 Tage ermöglichen, erfolgt die Freisetzung der Proteine bei einigen Hydrogelen über kürzere Zeiträume. Verweilen gekapselte Proteine über längere Zeiträume im Körper, so können sie durch Feuchtigkeit bei 37 C denaturieren oder aggregieren, woraus sich ein Verlust an biologischer Wirksamkeit und mögliche Veränderungen in der Immunogenität ergeben. Zur Stabilisierung der Proteine lassen sich je nach dem in Frage kommenden Mechanismus sinnvolle Strategien entwickeln. Stellt sich z.B. heraus, daß der Mechanismus, der zur Aggregation führt, auf einer intermolekularen S-S-Brückenbildung durch Thiodisulfid-Austausch beruht, läßt sich die Stabilisierung durch Modifizierung der Sulfhydrylreste, Lyophilisierung aus sauren Lösungen, Kontrolle des Flüssigkeitsgehaltes, Verwendung geeigneter Zusatzstoffe und Entwicklung spezieller Polymer-Matrix-Zusammensetzungen erreichen.
Zu den Formulierungen eines LL-4- Antagonisten mit verzögerter Freisetzung gehören ebenso in Liposomen eingeschlossene IL-4-Antagonisten. IL-4- Antagonisten enthaltende Liposome werden mit per se bekannten Methoden hergestellt: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sei. USA, 82:3688-
3692 (1985); Hwang et al., Proc. Natl. Acad. Sei. USA, 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143 ,949; EP 142,641 ; j apani sche Patentanmeldung 83-1 18008; US-Pat. Nr. 4,485,045 und 4,544,545; sowie EP 102,324. Die Liposome sind in der Regel vom kleinen (etwa 200-800 Angström) unilamellaren Typ mit einem Lipidgehalt von mehr als etwa 30 Mol-%
Cholesterol, wobei der Anteil für die optimale IL-4- Antagonisten jeweils angepaßt wird. Liposome mit einer verlängerten Zirkulationszeit werden im US-Pat. Nr. 5,013,556 offengelegt.
Eine weitere Anwendung der Erfindung betrifft den Einbau von EL-4- Antagonisten in "geformte Artikel". Diese können zur Modulierung oder Verhinderung des
Auftretens eines Schocks eingesetzt werden. Beispiel 1
Entfernung potentieller N-Glykosilierungsstellen in hLL-4-Mutantenproteinen
In der natürlichen hIL-4-Aminosäuresequenz sind zwei Asparagin-gekoppelte Glykosylierungsstellen in den Aminosäure-Positionen 38 und 105 vorhanden. Die entsprechenden Codons im Strukturgen können gegen solche für Asparaginsäure ausgetauscht werden. Dadurch unterbleibt bei Expression des Gens in Hefestämmen eine N-Glykosylierung des resultierenden hIL-4-Mutantenproteins.
Die Durchführung der beiden Codon-Austausche ("site-directed mutagenesis") im Strukturgen für hIL-4-Mutantenproteine erfolgte nach der Methode von Deng und Nickoloff [Anal. Biochem. 200:81 (1992)] unter Verwendung des Klonierungs-
Vektors pUC18. Die synthetischen Oligonucleotide, die für die Änderung des Strukturgens erforderlich waren, hatten folgende Sequenzen:
a) für den Austausch Asparagin gegen Asparaginsäure in Position 38: 51 - GCC TCC AAG GAC ACA ACT GAG -3'
b) für den Austausch Asparagin gegen Asparaginsäure in Position 105:
5' - GTG AAG GAA GCC GAC CAG AGT ACG -3'.
Die in den angegebenen Nukleotidsequenzen unterstrichenen Positionen markieren die Codons für Asparaginsäure.
Durch DNA- Sequenzierung wurde der Codon-Austausch in der Nukleotidsequenz bestätigt. Das geänderte Strukturgen wurde in Hefe-Expressionsvektoren inseriert und in geeigneten Stämmen zur Expression gebracht. Beispiel 2
Insertion einer Aminosäure in der Position (+ 2) zur Herstellung eines IL-4 Muteins ohne N-terminalem Methionin in E. coli
Zur Herstellung eines D -4-Muteins, dem das N-terminale Methionin fehlt, wurde in der Position (+ 2) eine Aminosäure eingeführt, die zur Abspaltung des N- terminalen Methionins in E. coli durch eine spezifische Methionin Aminopeptidase führt (Flinta et al., Eur. J. Biochem. 154, 193 - 196, 1986). Zu diesem Zweck wurde der Vektor RPR9-LL4-Y 124D (Anlage 1) mit den Restriktionsendo- nucleasen Xhol und BamHI geschnitten. Das hierbei entstehende ca. 450 Bp lange DNA Fragment, das die Sequenzinformationen für das IL4Y124D Gen und ein kurzes (ca. 50 Bp langes) Fragment aus der atpE Region des Vektors trägt, wurde über Agarosegelektrophorese gereinigt und in den mit Sall und BamHI geschnittenen Vektor M13mpl 8 umkloniert. Einzelsträngige DNA wurde hergestellt und einer 'in vitro Mutagenese Reaktion' mit folgendem Oligonukleotid unterzo -Όge-n:
5' CTGGAGACTGCCATGGCCCACAAGTGCGATATCACC 3'.
Durch diese Mutagenese wird in der Position (+ 2) des IL4Y124D Gens die Aminosäure Alanin (Codon GCC) eingefügt. Außerdem wird am 5'-Ende des Gens eine Ncol Schnittstelle (CCATGG) eingeführt, um das anschließende Screening und die Klonierung in einem Expressionsvektor zu erleichtern. Das 'Screening' der
Plaques erfolgte durch eine Restiktionsanalyse ausgehend von doppel strängiger Ml 3 RF DNA (Replikative Form). Positive Klone konnten durch einen Restritionsverdau mit den Enzymen Ncol und BamHI identifiziert werden. Die korrekte Sequenz wurde zusätzlich durch eine Sequenzierung bestätigt.
Ein ca. 400 Bp langes DNA Fragment wurde mit Ncol und BamHI aus einem ausgewählten M13mpl8 Klon herausgeschnitten, über Agarosegelelektrophorese gereinigt und in den ebenfalls mit Ncol und BamHI geschnittenen Vektor pTrc99A (kommerziell erhältlich von Pharmacia P-L Biochemicals) kloniert. Mit dem aus dieser Klonierung resultierenden Vektor pAPHlOO (IL4Y125D) wurden E. coli Zellen (TG1) transformiert und auf Ampicillin-haltigem Nährboden selektioniert. Die Expression und Reinigung des Proteins führte zu einem IL-4 Mutein, dem das N-terminale Methionin fehlt.
Beispiel 3:
Fermentation der Hefezellen
Nährlösungen:
Zur Kultivierung der hIL4-Mutantenproteine exprimierenden Hefezellen wurden die folgenden Nährlösungen verwendet:
Nährlösung
Einsatzstoff SD2 Sc6
Bacto Yeast Nitrogen Base 6,7 g/1 -
Difco Hefeextrakt - 20,0 g/1
Glucose 20,0 g/1 5,0 g/1
KH2P04 6,7 g/1 1,4 g/1
(NH4)2S04 - 2,0 g/1
MgS04 x 7 H20 - 0,5 g/1
Anti schaummittel PPG 2000 - 0,1 g/1
Die Einsatzstoffe wurden in demineralisiertem Wasser angesetzt und der pH-Wert auf pH 5,5 eingestellt. Die Sterilisation erfolgte für 20 min bei 121°C. Glucose wurde in 1/5 des erforderlichen Volumens in demineralisiertem Wasser gelöst, getrennt sterilisiert und nach dem Abkühlen zur übrigen Nährlösung gegeben. Stammkonserven:
Stammkonserven aller Hefetransformanten wurden durch Abfüllung von 2-ml- Aliquots einer Vorkultur und Lagerung in flüssigem Stickstoff angelegt.
Vorkulturen:
Die Vorkulturfermentationen wurden in l-Ltr.-Schüttelkolben, gefüllt mit 200 ml
SD2-Nährlösung durchgeführt. Die Beimpfung erfolgte mit einer Stammkonserve oder mit einer Einzelkolonie von einer SD2-Agarplatte. Die Kulturen wurden unter ständigem Schütteln für 2-3 Tage bei 26-30°C inkubiert.
Hauptkulturfermentationen:
Die Hauptkulturfermentationen wurden unter Verwendung von 10-Ltr.-
Rührkesselfermentern in Sc6-Nährlösung durchgeführt. Die Beimpfung erfolgte mit 3-5 Vol% einer Vorkultur, wobei vor der Beimpfung die Biomasse aus der Vorkultur abzentrifugiert und in Sc6-Medium resuspendiert wurde. Die Fermentationsbedingungen für die lO-Ltr.-Hauptkultur waren wie folgt:
Temperatur 26-30°C
Rührerdrehzahl 600 rpm
Belüfungsrate 0,5 vvm pH-Sollwert 5,5 (Korrektur mit 5 N NaOH und 5 N H2S04)
Ab einer Fermentationszeit von 5 Std. wurden die Kulturen kontinuierlich mit Glucose und Hefeextrakt gefüttert. Die Fütterungsrate wurde über den
Respiratorischen Quotienten (RQ-Wert) der Kultur geregelt. Der RQ-Sollwert betrug 1,0. Die Fütterlösung hatte folgende Zusammensetzung:
Glucose 500 g/1
Difco-Hefeextrakt 75 g/1
Die Bestandteile wurden getrennt, in demineralisiertem Wasser gelöst und für 20 min bei 121°C sterilisiert. Nach dem Abkühlen wurden beide Lösungen vereinigt. Bei Verwendung des induzierten GallO-Promotors oder eines Derivats des GallO- Promotors erfolgte die Induktion durch Wechsel des Kohlenhydrats in der Futterlösung von Glucose (500 g/1) zu Galaktose (500 g/1). Die weitere Kontrolle der Fütterungsrate erfolgte dann nicht über den RQ-Wert. Die Fütterungsrate wurde manuell auf den doppelten Wert der Fütterungsrate zum Zeitpunkt der
Induktion eingestellt. Die Induktion des GallO-Promotors erfolgte üblicherweise nach etwa 48 Std. Fermentationsdauer.
Zellernte:
Nach Beendigung der Fermentation (80-120 Std.) wurde der Fermenterinhalt auf 10-15°C abgekühlt und im Falle der intrazellulären Expression die Hefezellen durch Standard-Zentrifugationstechniken (z.B. Becherzentrifuge) geerntet. Die nach der Zentrifugati on erhaltene Zellmasse wurde durch direktes Eintropfen in flüssigen Stickstoff cryopelletisiert und bei -80°C gelagert. Die Produktauf¬ arbeitung erfolgte aus der so behandelten Biomasse. Bei Sekretion des heterologen Proteins in die Kulturbrühe erfolgte eine Abtrennung der Hefezellen aus der
Kulturbrühe durch Standard-Zentrifugati onstechniken (z.B. Becherzentrifuge) oder mittels Querstrom-Mikrofiltration (z.B. Filtron-Minisette-System). Falls erforder¬ lich wurde die Kulturbrühe sterilfiltriert. Die weitere Produktaufarbeitung erfolgte aus der zelllfreien Kulturbrühe.
Beispiel 4
Fermentation von E. coli
Nährlösungen:
Die Kultivierung der hIL4-Mutantenproteine exprimierenden E.coli-Transformanten erfolgte in LB-Nährlösung folgender Zusammensetzung:
Bacto Tryton 10 g/1
Bacto Hefeextrakt 5 g/1
NaCl 10 g/1
Die Bestandteile wurden in deionisiertem Wasser gelöst und für 20 min bei 121°C sterilisiert. Vor der Beimpfung wurde der Nährlösung ein zur Selektion der
Transform anten geeignetes Antibiotikum (z.B. 100 mg/1 Na-Ampicillin oder 50 mg/1 Kanamycinsulfat in Abhängigkeit von dem im Vektor verwendeten Selektionsmarker) steril zugefügt.
Stammkonserven:
Stammkonserven aller E. coli-Transformanten wurden durch Abfüllung von 2 ml-
Aliquots einer Vorkultur und Lagerung in flüssigem Stickstoff angelegt.
Vorkulturen:
Die Vorkulturfermentationen wurden in 1 Ltr-Schüttelkolben, gefüllt mit 200 ml LB-Nährlösung durchgeführt. Die Beimpfung erfolgte mit einer Stammkonserve oder mit einer Einzelkolonie von einer LB-Agarplatte. Die Kulturen wurden unter ständigem Schütteln für 12 - 18 Std. bei 30°C inkubiert.
Hauptkulturfermentationen:
Die Hauptkulturfermentationen wurden unter Verwendung von 10 Ltr.-
Rührkesselferm entern in LB-Nährlösung durchgeführt. Die Beimpfung erfolgte mit 1-5 Vol% einer Vorkultur, wobei vor der Beimpfung die Biomasse aus der Vorkultur abzentrifugiert und in frischem LB-Medium resuspendiert wurde. Die Fermentationsbedingungen für die 10 Ltr.-Hauptkultur waren wie folgt:
Start-Temperatur 30°C (bei Verwendung temperaturinduzi erbarer Promotoren) 37°C (bei Verwendung IPTG-induzierbarer Vektoren)
Rührerdrehzahl 500 rpm
Belüftungsrate 0,5 vvm
Zur Verfolgung des Biomassenwachstums wurden im Abstand von ca. 1 Std. aus der Kulturbrühe sterile Proben entnommen und die optische Dichte bei 600 nm (OD600) bestimmt. Bei Erreichen einer OD600 von 0,8 - 1,2 erfolgte die
Induktion der Kulturen. In Abhängigkeit vom gewählten Promotor wurde wie folgt induziert:
Temperaturinduktion: Erhöhung der Fermentationstemperatur von
30°C auf 42°C IPTG-Induktion: Sterile Zugabe von Isopropyl-ß-D-thiogalacto- pyranosid (IPTG) ad 0,4 mM
Die Induktionszeit betrug typischerweise 4 - 8 Std.
Zeil ernte:
Nach Beendigung der Fermentation (6 - 14 Std.) wurde der Fermenterinhalt auf 10-15°C abgekühlt und die Bakterienzellen durch Standard-Zentrifugations- techniken (z.B. Becherzentrifuge) geerntet. Die nach der Zentrifugation erhaltene Zellmasse wurde gegebenenfalls im eingefrorenen Zustand zwischengelagert. Die Produktaufarbeitung erfolgte aus der so gewonnenen Biomasse. Beispiel 5
Expression von Interleukin -4-Mutantenproteinen in Hefezellen unter
Verwendung konstitutiver Promotoren
Hefetransform anten mit einem Expressionsvektor enthaltend ein für ein hIL-4- Mutantenprotein kodierendes Gen und einen konstitutiven Promotor (z.B. Alpha-
Mating-Faktor-Promotor, GAPDH-Promotor, TPI-Promotor) wurden im 10 Ltr.- Maßstab bei 28°C kultiviert. Während der Fermentation erfolgte die qualitative Prüfung auf Expression des hIL-4-Mutantenproteins mittels SDS-PAGE. Die Fermentationsdauer betrug 96 Std. Die bei Fermentationsende erzielte Biomasse- konzentration lag ei 27 g/1 TG. Nach Abtrennung der Zellen durch Zentrifugati on
(15 min, 6.500 x g, 4°C) und Sterilfiltration erfolgte die Produktaufarbeitung aus der zellfreien Kulturbrühe.
Beispiel 6
Expression von Interleukin-4-Mutantenproteinen in Hefezellen unter Verwendung induzierbarer Promotoren
Hefetransform anten mit einem Expressionsvektor enthaltend ein für ein hIL-4- Mutanatenprotein kodierendes Gen und einen induzierbaren Promotor (z.B. Gal lO- Promotor oder ein Derivat des GallO-Promotors) wurden im 10 Ltr. Maßstab bei 28°C kultiviert. Nach einer Fermentationsdauer von 48 Std. erfolgte die Induktion durch Wechsel des in der Futterlösung verwendeten Kohlenhydrats von Glucose nach Galaktose. Während der Fermentation erfolgte die qualitative Prüfung auf Expression des hIL-4-Mutantenproteins mittels SDS-PAGE. Die Fermentations¬ dauer betrug 96 Std. Die bei Fermentationsende erzielte Biomassekonzentration betrug 24 g/1 TG. Nach Abtrennung der Zellen und Sterilfiltration erfolgte die Produktaufarbeitung aus der zellfreien Kulturbrühe.
Analog zu diesem Verfahren können auch andere induzierbare Promotoren zur Expression von hIL-4-Mutantenprόteinen eingesetzt werden. In Abhängigkeit von der Art des gewählten Promotors muß eine geeignete Induktionstechnik eingesetzt werden. Beispiel 7
Expression von Interleukin-4-Mutantenproteinen in E. coli unter Verwendung induzierbarer Promotoren
E.coli-Transformanten mit einem Expressionsvektor enthaltend ein für ein hIL-4- Mutantenprotein kodierendes Gen und einen temperaturinduzierbaren Promotor (z.B. λpL-Promotor oder ein Derivat des λpL-Promotors) wurden im 10 Ltr. Maßstab in LB-Nährlösung kultiviert. Die Selektion der vektorhaltigen Zellen erfolgte durch Zuabe von 100 mg/1 Na-Ampicillin zur LB-Nährlösung ( = LB+ Amp-Nährlösung). Die Beimpfung der Hauptkulturansätze erfolgte mit 5 Vol% einer 14 Std. alten in LB+Amp-Nährlösung kultivierten Vorkultur. Die
Fermentationstemperatur betrug bei Beginn der Fermentation 30°C und wurde zur Induktion des temperatursensitiven Promotors nach Erreichen einer OD600 von 0,8 - 1,2 auf 42°C erhöht. Während der Fermentation erfolgte die qualitative Prüfung auf Expression des hIL-4-Mutantenproteins mittels SDS-PAGE. Nach einer Induktionsdauer von 4 - 6 Std. erfolgte die Beendigung der Fermentation durch
Kühlung der Kulturbrühe auf 10-15°C. Die bei Fermentationsende erzielte Biomassekonzentration betrug ca. 5 g/1 FG. Die E. coli-Zellen wurden durch Zentrifugati on in der Becherzentrifuge geerntet (15 min., 6500 x g, 4°C) und die Zellmasse durch direktes Eintropfen in flüssigen Stickstoff cryopelletisiert. Die weitere Lagerung der so tiefgefrorenen Biomasse erfolgte bei -80°C. Die
Produktaufarbeitung erfolgte aus der so behandelten Biomasse.
Analog zu diesem Verfahren können auch andere induzierbare Promotoren zur Expression von hIL-4-Mutantenproteinen in E. coli eingesetzt werden. In Abhängigkeit von der Art des gewählten Promotors muß eine geeignete Induktionstechnik verwendet werden.
Beispiel 8
Aufarbeitung eines EL-4-Mutantenproteins
Zellaufschluß und Isolierung der "inclusion bodies"
25 g E. coli Feuchtmasse aus Beispiel 7 wurden in 200 ml Puffer (0.1 M Phosphatpuffer, pH 7,3, 0.1% Triton, 1 mM EDTA, 1 μg/ml Pepstatin) aufgenommen und durch Ultraschall (Branson Sonifier B 15) aufgeschlossen. Die das Produkt enthaltenden "inclusion bodies" wurden mittels Zentrifugation (35.000 x g, 20 min.) gewonnen und im Aufschlußpuffer,der zusätzlich 4 M Harnstoff enthielt, gewaschen.
Solubilisierung und Sulfitolyse des Produkts
Die gewaschenen "inclusion bodies" wurden in 125 ml Puffer (0,2 M Tris, pH 8,1, 8 M Guanidinhydrochlorid) solubilisiert. 4 g Natriumsulfit und 2 g Kaliumtetra- thionat wurden zugegeben, und die Reaktionsmischung 2 h gerührt. Ungelöste Bestandteile wurden nach Beendigung der Reaktion durch Zentrifugation entfernt (35.000 x g, 20 min.).
Gelfiltration
Der Überstand wurde auf eine Gelfiltrationssäule (Sephacryl-S-300 HR, Pharmacia, 10 x 90 cm) aufgetragen und in PBS-Puffer, der 6 M Guanidinhydro¬ chlorid enthielt, mit einer Flußrate von 280 ml/h gelfiltriert. Produkthaltige Fraktionen wurden mittels SDS-PAGE identifiziert und vereinigt.
Renaturierung
Zur Reduktion der Moleküle wurde ß-Mercaptoethanol (Endkonzentration 15 mM) hinzugegeben. Nach zwei Stunden Inkubation bei Raumtemperatur wurde der Ansatz 5fach mit Wasser verdünnt und 3-4 Tage gegen Puffer (3 mM NaH,P04, 7 mM Na2HP04, 2 mM KC1, 120 mM NaCl) dialysiert.
Konzentrierung
Das dialysierte Material wurde mit Essigsäure auf pH 5 eingestellt und die Leitfähigkeit durch Zugabe von Wasser auf < 10 mS/cm verringert. 50 ml CM- Sepharose-FF (Pharmacia), equilibriert mit 25 mM Ammonium acetat, pH 5,0, wurden unter Rühren zum Ansatz gegeben. Ungebundenes Material wurde abfiltriert, und das Gel in eine Säule gefüllt. Das Produkt wurde mit einem linearen Gradienten von 0-1 M NaCl in 25 mM Ammoniumacetat, pH 5,0, mit einer Flußrate von 300 ml/h eluiert. Produkthaltige Fraktionen wurden mittels SDS-PAGE oder analytischer RP-Chromatographie identifiziert. Endreinigung
Der Pool der CM-Sepharose wurde auf eine mit 0,1% TFA equilibrierten Vydac C-4 Säule (1 x 25 cm, 10 μm) aufgetragen und mit einem steigenden Acetonitrilgradienten eluiert. Fraktionen, die Reinprodukt enthielten, wurden vereinigt und lyophilisiert.
SEQUENZPROTOKOLL
(1) ALGEMEINE INFORMATION:
(i) ANMELDER:
(A) NAME: Bayer AG
(B) STRASSE: Bayerwerk
(C) ORT: Leverkusen
(E) LAND: Deutschland
(F) POSTLEITZAHL: D-51368
(G) TELEPHON: 0214/3061455 (H) TELEFAX: 0214/303482
(ii) ANMELDETITEL: Neue hIL4-Mutantenproteine als Antagonisten oder partielle Agonisten des humanen Interleukin 4
(iii) ANZAHL DER SEQUENZEN: 5
(iv) COMPUTER-LESBARE FORM:
(A) DATENTRÄGER: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) BETRIEBSSYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.25 (EPA)
(2) INFORMATION ZU SEQ ID NO: 1 :
(i) SEQUENZ CHARAKTERISTIKA:
(A) LÄNGE: 16 Basenpaare
(B) ART: Nukleinsäure
(C) STRANGFORM: Einzel
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: cDNS
(iii) HYPOTHETISCH: NEIN
(iii) ANTISENSE: NEIN
(vi) URSPRÜNLICHE HERKUNFT:
(C) INDIVIDUUM ISOLAT: synthetisch
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 1 : CATGCACAAG TGCGAT 16
(2) INFORMATION ZU SEQ LD NO: 2:
(i) SEQUENZ CHARAKTERISTIK:
(A) LÄNGE: 12 Basenpaare
(B) ART: Nukleinsäure
(C) STRANGFORM: Einzel
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: cDNS
(iii) HYPOTHETISCH: NEIN
(iii) ANTISENSE: NEIN
(vi) URSPRÜNLICHE HERKUNFT:
(C) INDIVIDUUM ISOLAT: synthetisch
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 2: ATCGCACTTG TG 12
(2) INFORMATION ZU SEQ ID NO: 3 :
(i) SEQUENZ CHARAKTERISTIKA:
(A) LÄNGE: 21 Basenpaare
(B) ART: Nukleinsäure
(C) STRANGFORM: Einzel
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: cDNS
(iii) HYPOTHETISCH: NEIN
(iii) ANTISENSE: NEIN
(vi) URSPRÜNLICHE HERKUNFT:
(C) INDIVIDUUM ISOLAT: synthetisch
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 3: GCCTCCAAGG ACACAACTGA G 21 (2) INFORMATION ZU SEQ ID NO: 4:
(i) SEQUENZ CHARAKTERISTIKA:
(A) LÄNGE: 24 Basenpaare
(B) ART: Nukleinsäure
(C) STRANGFORM: Einzel
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: cDNS
(iii) HYPOTHETISCH: NEIN
(iii) ANTISENSE: NEIN
(vi) URSPRÜNLICHE HERKUNFT:
(C) INDIVIDUUM ISOLAT: synthetisch
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 4: GTGAAGGAAG CCGACCAGAG TACG 24
(2) INFORMATION ZU SEQ ID NO: 5:
(i) SEQUENZ CHARAKTERISTIKA:
(A) LÄNGE: 36 Basenpaare
(B) ART: Nukleinsäure
(C) STRANGFORM: Einzel
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: cDNS
(iii) HYPOTHETISCH: NEIN
(iii) ANTISENSE: NEIN
(vi) URSPRÜNLICHE HERKUNFT:
(C) INDIVIDUUM ISOLAT: synthetisch
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 5: CTGGAGACTG CCATGGCCCA CAAGTGCGAT ATCACC 36

Claims

Patentansprüche
Humane Interleukin-4-Mutantenproteine als Antagonisten oder partielle Agonisten des humanen Interleukin 4, dadurch gekennzeichnet, daß neben Austauschen in den Positionen 121, 124 oder 125 zusätzliche Modifika¬ tionen am N- und/oder C-Terminus vorhanden sind, und/oder daß poten¬ tielle Glycosylierungsstellen im Molekül deletiert sind und/oder daß das Mutantenprotein mit einem Nicht-Protein-Polymer gekoppelt ist.
Arzneimittel, die Substanzen nach Anspruch 1 enthalten.
PCT/EP1995/002358 1994-07-01 1995-06-19 NEUE hIL-4-MUTANTENPROTEINE ALS ANTAGONISTEN ODER PARTIELLE AGONISTEN DES HUMANEN INTERLEUKIN 4 WO1996001274A1 (de)

Priority Applications (13)

Application Number Priority Date Filing Date Title
DK95924273T DK0769020T3 (da) 1994-07-01 1995-06-19 Nye hIL-4-mutantproteiner som antagonister eller delvise agonister for det humane interleukin-4
JP8503644A JPH10502360A (ja) 1994-07-01 1995-06-19 ヒトインターロイキン４のアンタゴニストもしくは部分的アゴニストとして用いられる新規ｈＩＬ−４突然変異蛋白質
EP95924273A EP0769020B1 (de) 1994-07-01 1995-06-19 NEUE hIL-4-MUTANTENPROTEINE ALS ANTAGONISTEN ODER PARTIELLE AGONISTEN DES HUMANEN INTERLEUKIN 4
DE59507920T DE59507920D1 (de) 1994-07-01 1995-06-19 NEUE hIL-4-MUTANTENPROTEINE ALS ANTAGONISTEN ODER PARTIELLE AGONISTEN DES HUMANEN INTERLEUKIN 4
US08/765,012 US6130318A (en) 1994-07-01 1995-06-19 hIL-4 mutant proteins used as antagonists or partial agonists of human interleukin 4
HU9603563A HU221416B1 (en) 1994-07-01 1995-06-19 Hil-4mutant proteins used as antagonists or partial agonists of human interleukin 4
AT95924273T ATE190068T1 (de) 1994-07-01 1995-06-19 Neue hil-4-mutantenproteine als antagonisten oder partielle agonisten des humanen interleukin 4
SK1692-96A SK284391B6 (sk) 1994-07-01 1995-06-19 Mutantné proteíny ľudského interleukínu-4 ako antagonisty alebo parciálne agonisty ľudského interleukínu-4, liečivá, ktoré ich obsahujú, a použitie
CA002193993A CA2193993C (en) 1994-07-01 1995-06-19 New hil-4 mutant proteins used as antagonists or partial agonists of human interleukin 4
AU28852/95A AU705745B2 (en) 1994-07-01 1995-06-19 Novel hIL-4 mutant proteins as antagonists or partial agonists of human interleukin 4
KR1019960703865A KR100265219B1 (ko) 1994-11-18 1995-11-17 누벅조 직물 및 그 제조방법
NO965621A NO965621D0 (no) 1994-07-01 1996-12-30 Nye hIL-4-mutantproteiner som antagonister eller partielle agonister for det humane interleukin 4
GR20000401195T GR3033498T3 (en) 1994-07-01 2000-05-24 NEW hIL-4 MUTANT PROTEINS USED AS ANTAGONISTS OR PARTIAL AGONISTS OF HUMAN INTERLEUKIN 4

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE4423131A DE4423131A1 (de) 1994-07-01 1994-07-01 Neue hIL-4-Mutantenproteine als Antagonisten oder partielle Agonisten des humanen Interleukin 4
DEP4423131.8 1994-07-01

Publications (1)

Publication Number Publication Date
WO1996001274A1 true WO1996001274A1 (de) 1996-01-18

Family

ID=6522032

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1995/002358 WO1996001274A1 (de) 1994-07-01 1995-06-19 NEUE hIL-4-MUTANTENPROTEINE ALS ANTAGONISTEN ODER PARTIELLE AGONISTEN DES HUMANEN INTERLEUKIN 4

Country Status (18)

Country Link
US (1) US6130318A (de)
EP (1) EP0769020B1 (de)
JP (3) JPH10502360A (de)
KR (1) KR100393508B1 (de)
AT (1) ATE190068T1 (de)
AU (1) AU705745B2 (de)
CA (1) CA2193993C (de)
CZ (1) CZ292703B6 (de)
DE (2) DE4423131A1 (de)
DK (1) DK0769020T3 (de)
ES (1) ES2145280T3 (de)
GR (1) GR3033498T3 (de)
HU (1) HU221416B1 (de)
NO (1) NO965621D0 (de)
SK (1) SK284391B6 (de)
TW (1) TW458984B (de)
WO (1) WO1996001274A1 (de)
ZA (1) ZA955443B (de)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9017980B2 (en) 2005-04-11 2015-04-28 Crealta Pharmaceuticals Llc Variant forms of urate oxidase and use thereof
US9028835B2 (en) 2001-10-03 2015-05-12 President And Fellows Of Harvard College Copolymers for suppression of autoimmune diseases, and methods of use
US9885024B2 (en) 1998-08-06 2018-02-06 Duke University PEG-urate oxidase conjugates and use thereof
US10139399B2 (en) 2009-06-25 2018-11-27 Horizon Pharma Rheumatology Llc Methods and kits for predicting infusion reaction risk and antibody-mediated loss of response by monitoring serum uric acid during PEGylated uricase therapy

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9415379D0 (en) * 1994-07-29 1994-09-21 Smithkline Beecham Plc Novel compounds
WO1999025732A2 (en) * 1997-11-13 1999-05-27 Europäisches Laboratorium für Molekularbiologie (EMBL) Design of coiled-coil dimer derived antagonists of 4-helix bundle cytokine specific receptors
AU2003294369B2 (en) * 2003-01-17 2008-08-14 Cornell Research Foundation, Inc. Injectable hydrogel microspheres from aqueous two-phase system
US7785580B2 (en) * 2003-08-29 2010-08-31 Aerovance, Inc. Modified IL-4 mutein receptor antagonists
US7404957B2 (en) * 2003-08-29 2008-07-29 Aerovance, Inc. Modified IL-4 mutein receptor antagonists
US7635754B2 (en) * 2004-09-22 2009-12-22 Aerovance, Inc. Interleukin-9 and interleukin-4 chimeric antagonist muteins and methods of using same
JP2008527981A (ja) * 2005-01-25 2008-07-31 アポロ ライフ サイエンシズ リミテッド 治療目的および診断目的のためにパラメーターにより選択されたｇｍ−ｃｓｆ、ｉｌ−３、ｉｌ−４、ｉｌ−５、ならびにそのキメラ
WO2006110761A2 (en) * 2005-04-11 2006-10-19 Savient Pharmaceuticals, Inc. A variant form of urate oxidase and use thereof
US20070009479A1 (en) * 2005-06-17 2007-01-11 Aerovance, Inc. Methods for treating dermatitis using mutant human IL-4 compositions
WO2007082068A2 (en) * 2006-01-11 2007-07-19 Aerovance, Inc. Methods and compositions for treating asthma in human and non human primates
BRPI0713484A2 (pt) * 2006-06-21 2012-11-06 Apogenix Gmbh expressão diferencial de citocina em cáncer humano
AU2007271349A1 (en) * 2006-07-06 2008-01-10 Apogenix Gmbh Human IL-4 muteins in combination with chemotherapeutics or pro-apoptotic agents in cancer therapy
WO2008101671A2 (en) * 2007-02-19 2008-08-28 Apogenix Gmbh Il-4 fc fusion proteins
WO2009009775A1 (en) * 2007-07-11 2009-01-15 Aerovance, Inc. Pharmaceutical polypeptide dry powder aerosol formulation and method of preparation
JP2009217498A (ja) * 2008-03-10 2009-09-24 Sato Knowledge & Intellectual Property Institute 印字試験システム
US8182626B2 (en) 2008-10-30 2012-05-22 Continental Ag Tire composition with improved vulcanizing agent
US9512194B2 (en) 2012-01-27 2016-12-06 The Board Of Trustees Of The Leland Stanford Junior University Modified IL-13 polypeptides
CN110615835A (zh) * 2012-08-09 2019-12-27 利兰斯坦福初级大学董事会 选择性地操纵靶细胞中对两个或更多个共有受体多肽识别的配体的细胞反应的方法
EP2813242A1 (de) * 2013-06-13 2014-12-17 PLS-Design GmbH Niedermolekulare Immunmodulatoren als Unterstützung für eine spezifische Immuntherapie
JP6936934B2 (ja) 2013-09-24 2021-09-22 メディシナ セラピューティクス インコーポレイテッド インターロイキン−４受容体結合融合タンパク質及びその使用
CN112538108B (zh) * 2020-12-24 2022-06-28 郑州大学 高亲和pvr突变体

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988004667A1 (en) * 1986-12-19 1988-06-30 Immunex Corporation Human interleukin-4 muteins
WO1993010235A1 (de) * 1991-11-13 1993-05-27 Bayer Aktiengesellschaft Menschliche il-4 mutantenproteine
US5298410A (en) * 1993-02-25 1994-03-29 Sterling Winthrop Inc. Lyophilized formulation of polyethylene oxide modified proteins with increased shelf-life

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) * 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
US4179337A (en) * 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4263428A (en) * 1978-03-24 1981-04-21 The Regents Of The University Of California Bis-anthracycline nucleic acid function inhibitors and improved method for administering the same
JPS6023084B2 (ja) * 1979-07-11 1985-06-05 味の素株式会社 代用血液
EP0052322B1 (de) * 1980-11-10 1985-03-27 Gersonde, Klaus, Prof. Dr. Verfahren zur Herstellung von Lipid-Vesikeln durch Ultraschallbehandlung, Anwendung des Verfahrens und Vorrichtung zur Durchführung des Verfahrens
US4485045A (en) * 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
US4640835A (en) * 1981-10-30 1987-02-03 Nippon Chemiphar Company, Ltd. Plasminogen activator derivatives
EP0088046B1 (de) * 1982-02-17 1987-12-09 Ciba-Geigy Ag Lipide in wässriger Phase
DE3218121A1 (de) * 1982-05-14 1983-11-17 Leskovar, Peter, Dr.-Ing., 8000 München Arzneimittel zur tumorbehandlung
EP0102324A3 (de) * 1982-07-29 1984-11-07 Ciba-Geigy Ag Lipide und Tenside in wässriger Phase
US4544545A (en) * 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
HUT35524A (en) * 1983-08-02 1985-07-29 Hoechst Ag Process for preparing pharmaceutical compositions containing regulatory /regulative/ peptides providing for the retarded release of the active substance
DE3336583A1 (de) * 1983-09-26 1985-04-25 Udo Dr. 8400 Regensburg Ehrenfeld Erzeugnis zur diagnose und therapie von malignen tumoren
US4615885A (en) * 1983-11-01 1986-10-07 Terumo Kabushiki Kaisha Pharmaceutical composition containing urokinase
US4496689A (en) * 1983-12-27 1985-01-29 Miles Laboratories, Inc. Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer
EP0206448B1 (de) * 1985-06-19 1990-11-14 Ajinomoto Co., Inc. Hämoglobin, das an ein Poly(alkenylenoxid) gebunden ist
WO1987005330A1 (en) * 1986-03-07 1987-09-11 Michel Louis Eugene Bergh Method for enhancing glycoprotein stability
US4791192A (en) * 1986-06-26 1988-12-13 Takeda Chemical Industries, Ltd. Chemically modified protein with polyethyleneglycol
JPH02501827A (ja) * 1986-12-19 1990-06-21 イミュネックス・コーポレーション ヒト・インターロイキン‐４　ミューテイン
PT88641B (pt) * 1987-10-02 1993-04-30 Genentech Inc Metodo para a preparacao de uma variante de adesao
US5013556A (en) * 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
JPH06506831A (ja) * 1991-05-02 1994-08-04 ノボザイムス アクティーゼルスカブ ラムノガラクツロナーゼ、対応するｄｎａ配列、ラムノガラクツロナーゼ含有酵素調製物および該酵素調製物の用途

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988004667A1 (en) * 1986-12-19 1988-06-30 Immunex Corporation Human interleukin-4 muteins
WO1993010235A1 (de) * 1991-11-13 1993-05-27 Bayer Aktiengesellschaft Menschliche il-4 mutantenproteine
US5298410A (en) * 1993-02-25 1994-03-29 Sterling Winthrop Inc. Lyophilized formulation of polyethylene oxide modified proteins with increased shelf-life

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
N. KRUSE ET AL: "Conversion of human interleukin-4 into a high affinity antagonist by a single amino acid replacement", EMBO JOURNAL, vol. 11, no. 9, EYNSHAM, OXFORD GB, pages 3237 - 3244 *
N. KRUSE ET AL: "Mutational analysis of human interleukin-4: identification of crucial amino acids for receptor binding and generation of a high affinity antagonist", BIOLOGICAL CHEMISTRY HOPPE-SEYLER, vol. 373, no. 9, pages 789 - 790 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9885024B2 (en) 1998-08-06 2018-02-06 Duke University PEG-urate oxidase conjugates and use thereof
US9028835B2 (en) 2001-10-03 2015-05-12 President And Fellows Of Harvard College Copolymers for suppression of autoimmune diseases, and methods of use
US11345899B2 (en) 2005-04-11 2022-05-31 Horizon Therapeutics Usa, Inc. Variant forms of urate oxidase and use thereof
US9670467B2 (en) 2005-04-11 2017-06-06 Horizon Pharma Rheumatology Llc Variant forms of urate oxidase and use thereof
US9926537B2 (en) 2005-04-11 2018-03-27 Horizon Pharma Rheumatology Llc Variant forms of urate oxidase and use thereof
US9926538B2 (en) 2005-04-11 2018-03-27 Horizon Pharma Rheumatology Llc Variant forms of urate oxidase and use thereof
US9017980B2 (en) 2005-04-11 2015-04-28 Crealta Pharmaceuticals Llc Variant forms of urate oxidase and use thereof
US10160958B2 (en) 2005-04-11 2018-12-25 Horizon Pharma Rheumatology Llc Variant forms of urate oxidase and use thereof
US10731139B2 (en) 2005-04-11 2020-08-04 Horizon Pharma Rheumatology Llc Variant forms of urate oxidase and use thereof
US11781119B2 (en) 2005-04-11 2023-10-10 Horizon Therapeutics Usa, Inc. Variant forms of urate oxidase and use thereof
US10139399B2 (en) 2009-06-25 2018-11-27 Horizon Pharma Rheumatology Llc Methods and kits for predicting infusion reaction risk and antibody-mediated loss of response by monitoring serum uric acid during PEGylated uricase therapy
US11598767B2 (en) 2009-06-25 2023-03-07 Horizon Therapeutics Usa, Inc. Methods and kits for predicting infusion reaction risk and antibody-mediated loss of response by monitoring serum uric acid during pegylated uricase therapy
US11639927B2 (en) 2009-06-25 2023-05-02 Horizon Therapeutics Usa, Inc. Methods and kits for predicting infusion reaction risk and antibody-mediated loss of response by monitoring serum uric acid during PEGylated uricase therapy
US10823727B2 (en) 2009-06-25 2020-11-03 Horizon Pharma Rheumatology Llc Methods and kits for predicting infusion reaction risk and antibody-mediated loss of response by monitoring serum uric acid during pegylated uricase therapy
US11982670B2 (en) 2009-06-25 2024-05-14 Horizon Therapeutics Usa, Inc. Methods and kits for predicting infusion reaction risk and antibody-mediated loss of response by monitoring serum uric acid during pegylated uricase therapy

Also Published As

Publication number Publication date
US6130318A (en) 2000-10-10
HU9603563D0 (en) 1997-02-28
EP0769020A1 (de) 1997-04-23
HU221416B1 (en) 2002-09-28
DK0769020T3 (da) 2000-07-31
DE59507920D1 (de) 2000-04-06
NO965621L (no) 1996-12-30
NO965621D0 (no) 1996-12-30
JPH10502360A (ja) 1998-03-03
ATE190068T1 (de) 2000-03-15
EP0769020B1 (de) 2000-03-01
HUT77577A (hu) 1998-06-29
CA2193993A1 (en) 1996-01-18
JP2011102302A (ja) 2011-05-26
SK284391B6 (sk) 2005-03-04
TW458984B (en) 2001-10-11
CZ384896A3 (en) 1997-06-11
AU705745B2 (en) 1999-06-03
DE4423131A1 (de) 1996-01-04
CA2193993C (en) 2008-11-18
GR3033498T3 (en) 2000-09-29
ZA955443B (en) 1996-02-13
CZ292703B6 (cs) 2003-11-12
KR100393508B1 (ko) 2003-10-23
AU2885295A (en) 1996-01-25
SK169296A3 (en) 1997-08-06
ES2145280T3 (es) 2000-07-01
JP2007051161A (ja) 2007-03-01

Similar Documents

Publication Publication Date Title
EP0769020B1 (de) NEUE hIL-4-MUTANTENPROTEINE ALS ANTAGONISTEN ODER PARTIELLE AGONISTEN DES HUMANEN INTERLEUKIN 4
DE69007975T2 (de) Fusionsprotein bestehend aus gm-csf und il-3.
DE3785864T2 (de) Verfahren zur Herstellung von menschlichem Epidermalwachstumsfaktor und dessen Analogen.
DE69031997T2 (de) TNF(Tumor Necrosis Factor)-Inhibitor und Verfahren zur Herstellung
DE69233008T2 (de) Fusionierung von Peptiden und Proteinen mit Thioredoxin und thioredoxin-ähnlichen Molekülen
DE3650267T3 (de) Die alpha- oder beta-Ketten von Inhibin codierende Nukleinsäure und Verfahren zur Synthese von Polypeptiden unter Verwendung einer solchen Nukleinsäure.
DE69133354T2 (de) Interleukin 1-beta protease und ihre inhibitoren
DE69033301T2 (de) Erythropoietin- Analoge
DE68916537T2 (de) Herstellung eines insulinähnlichen, wachstümsfaktor bindenden proteins.
CH681080A5 (de)
JPH07138292A (ja) マウス白血病抑制因子
DE3851035T2 (de) Interleukin-7.
DE69712036T2 (de) Neue verabreichung von thrombopoietin
DE69937570T2 (de) Transformierender wachstumsfaktor beta-9 (ztgfss9) aus säugetieren
DE69012377T2 (de) Polypeptid und dessen Herstellung.
DE69010096T2 (de) Expression und Sekretion von reifem menschlichem beta-Interleukin-1 in Bacillus subtilis und Mittel und Verfahren zu deren Ausführung.
DE69636052T2 (de) Mpl-liganden analoga
DE3687948T2 (de) Verfahren und nukleinsaeure zur herstellung von lecithin: cholestrinacyltransferase.
DE69837507T2 (de) Humanes Hedgehog-Protein
DE69233155T2 (de) Insulinartigen wachstumsfaktor bindendes protein
AT400444B (de) Verfahren zur herstellung von oncostatin m
CA2064738A1 (en) Megakaryocytopoietic factor
DE68927009T2 (de) EXPRESSION UND PROZESSIERUNG VON ACETYLIERTEN FGFs IN HEFEN
DE69427403T2 (de) Peptide-familie, genannt xenoxine
DE69330809T2 (de) Therapeutisches Agens für Neutropenie

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR BY CA CN CZ EE FI HU JP KP KR KZ LK LT LV MG MN MW MX NO NZ PL RO RU SD SI SK UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1995924273

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 08765012

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2193993

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: PV1996-3848

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 169296

Country of ref document: SK

Ref document number: 1019960707590

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 1995924273

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: PV1996-3848

Country of ref document: CZ

WWG Wipo information: grant in national office

Ref document number: 1995924273

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: PV1996-3848

Country of ref document: CZ