US9845342B2 - Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria - Google Patents

Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria Download PDF

Info

Publication number
US9845342B2
US9845342B2 US14/857,606 US201514857606A US9845342B2 US 9845342 B2 US9845342 B2 US 9845342B2 US 201514857606 A US201514857606 A US 201514857606A US 9845342 B2 US9845342 B2 US 9845342B2
Authority
US
United States
Prior art keywords
seq
amino acids
targeting sequence
protein
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US14/857,606
Other languages
English (en)
Other versions
US20160108096A1 (en
Inventor
Brian Thompson
Ashley Siegel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Spogen Biotech Inc
Original Assignee
Spogen Biotech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US14/857,606 priority Critical patent/US9845342B2/en
Application filed by Spogen Biotech Inc filed Critical Spogen Biotech Inc
Publication of US20160108096A1 publication Critical patent/US20160108096A1/en
Assigned to SPOGEN BIOTECH INC. reassignment SPOGEN BIOTECH INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SIEGEL, Ashley, THOMPSON, BRIAN
Priority to US15/842,062 priority patent/US10407472B2/en
Publication of US9845342B2 publication Critical patent/US9845342B2/en
Application granted granted Critical
Priority to US16/563,086 priority patent/US10836800B2/en
Priority to US17/079,942 priority patent/US11905315B2/en
Assigned to GENISYS CREDIT UNION reassignment GENISYS CREDIT UNION SECURITY INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ELEMENTAL ENZYMES AG AND TURF, LLC, SPOGEN BIOTECH INC, THOMPSON, BRIAN M, THOMPSON, KATIE C
Assigned to GENISYS CREDIT UNION reassignment GENISYS CREDIT UNION SECURITY INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ELEMENTAL ENZYMES AG AND TURF, LLC, SPOGEN BIOTECH INC, THOMPSON, BRIAN M, THOMPSON, KATIE C
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H3/00—Processes for modifying phenotypes, e.g. symbiosis with bacteria
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A01N37/44—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a nitrogen atom attached to the same carbon skeleton by a single or double bond, this nitrogen atom not being a member of a derivative or of a thio analogue of a carboxylic group, e.g. amino-carboxylic acids
    • A01N63/02—
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/10—Animals; Substances produced thereby or obtained therefrom
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/50—Isolated enzymes; Isolated proteins
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A23K20/147—Polymeric derivatives, e.g. peptides or proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2/00—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor
    • A61L2/16—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor using chemical substances
    • A61L2/18—Liquid substances or solutions comprising solids or dissolved gases
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F3/00—Biological treatment of water, waste water, or sewage
    • C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
    • C02F3/342—Biological treatment of water, waste water, or sewage characterised by the microorganisms used characterised by the enzymes used
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F3/00—Biological treatment of water, waste water, or sewage
    • C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
    • C02F3/348—Biological treatment of water, waste water, or sewage characterised by the microorganisms used characterised by the way or the form in which the microorganisms are added or dosed
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K8/00—Compositions for drilling of boreholes or wells; Compositions for treating boreholes or wells, e.g. for completion or for remedial operations
    • C09K8/60—Compositions for stimulating production by acting on the underground formation
    • C09K8/62—Compositions for forming crevices or fractures
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N3/00—Spore forming or isolating processes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • E—FIXED CONSTRUCTIONS
    • E21—EARTH OR ROCK DRILLING; MINING
    • E21B—EARTH OR ROCK DRILLING; OBTAINING OIL, GAS, WATER, SOLUBLE OR MELTABLE MATERIALS OR A SLURRY OF MINERALS FROM WELLS
    • E21B43/00—Methods or apparatus for obtaining oil, gas, water, soluble or meltable materials or a slurry of minerals from wells
    • E21B43/16—Enhanced recovery methods for obtaining hydrocarbons
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A23K10/18—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions of live microorganisms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2101/00—Nature of the contaminant
    • C02F2101/10—Inorganic compounds
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2101/00—Nature of the contaminant
    • C02F2101/30—Organic compounds
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/002—Grey water, e.g. from clothes washers, showers or dishwashers
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/003—Wastewater from hospitals, laboratories and the like, heavily contaminated by pathogenic microorganisms
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/007—Contaminated open waterways, rivers, lakes or ponds
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/06—Contaminated groundwater or leachate
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/10—Nature of the water, waste water, sewage or sludge to be treated from quarries or from mining activities
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/14—Paint wastes
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/16—Nature of the water, waste water, sewage or sludge to be treated from metallurgical processes, i.e. from the production, refining or treatment of metals, e.g. galvanic wastes
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/26—Nature of the water, waste water, sewage or sludge to be treated from the processing of plants or parts thereof
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/26—Nature of the water, waste water, sewage or sludge to be treated from the processing of plants or parts thereof
    • C02F2103/28—Nature of the water, waste water, sewage or sludge to be treated from the processing of plants or parts thereof from the paper or cellulose industry
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035—Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2208/00—Aspects relating to compositions of drilling or well treatment fluids
    • C09K2208/24—Bacteria or enzyme containing gel breakers

Definitions

  • sequence listing is submitted electronically via EFS-Web as an ASCII-formatted sequence listing with a file named “3005.US Gene Sequence Listing.txt” created on Sep. 10, 2015, and having a size of 488 kilobytes, and is filed concurrently with the specification.
  • sequence listing contained in this ASCII-formatted document is part of the specification and is herein incorporated by reference in its entirety.
  • the present invention generally relates to fusion proteins containing a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of a Bacillus cereus family member.
  • the invention also relates to recombinant Bacillus cereus family members expressing such fusion proteins, formulations containing the recombinant Bacillus cereus family members, seeds coated with the recombinant Bacillus cereus family members, and methods for using the recombinant Bacillus cereus family members (e.g., for stimulating plant growth, protecting a plant from a pathogen, enhancing stress resistance in a plant, immobilizing a recombinant Bacillus cereus family member spore on a plant, stimulating germination of plant seeds, and delivering nucleic acids to plants).
  • the invention additionally relates to recombinant Bacillus cereus family members that overexpress a protease or a nuclease, wherein overexpression of the protease or nuclease partially or completely inactivates spores of the Bacillus cereus family member or renders the spores more susceptible to physical or chemical inactivation.
  • the present invention further relates to recombinant Bacillus cereus family members that overexpress exosporium proteins, seeds coated with such recombinant Bacillus cereus family members, and methods of using such recombinant Bacillus cereus family members (e.g., for stimulating plant growth, enhancing stress resistance in plants, and protecting plants from pathogens).
  • the invention further relates to various modifications of the recombinant Bacillus cereus family members that express the fusion proteins, including: (i) overexpression of modulator proteins that modulate the expression of the fusion protein in the recombinant Bacillus cereus members; (ii) genetic inactivation of the recombinant Bacillus cereus family members; and (iii) mutations or other genetic alterations of the recombinant Bacillus cereus family members that allow for the collection of exosporium fragments containing the fusion protein.
  • the invention also relates to various methods for using the exosporium fragments.
  • the invention further relates to fusion proteins comprising a spore coat protein and a protein or peptide of interest, recombinant bacteria that express such fusion proteins, seeds coated with such recombinant bacteria, and methods for using such recombinant bacteria (e.g., for stimulating plant growth, protecting a plant from a pathogen, enhancing stress resistance in a plant, immobilizing a recombinant bacterial spore on a plant, stimulating germination of plant seeds, and delivering nucleic acids to plants).
  • the present invention further relates to biologically pure bacterial cultures of novel strains of bacteria.
  • the present invention additionally relates to plant seeds coated with an enzyme that catalyzes the production of nitric oxide or a superoxide dismutase, or with a recombinant spore-forming bacterium that overexpresses an enzyme that catalyzes the production of nitric oxide or a superoxide dismutase.
  • the invention also relates to methods for delivering beneficial bacteria and enzymes or vaccines to animals, and other methods of use.
  • rhizosphere Within the zone surrounding a plant's roots is a region called the rhizosphere.
  • bacteria, fungi, and other organisms compete for nutrients and for binding to the root structures of the plant. Both detrimental and beneficial bacteria and fungi can occupy the rhizosphere.
  • the bacteria, fungi, and the root system of the plant can all be influenced by the actions of peptides, enzymes, and other proteins in the rhizosphere. Augmentation of soil or treatment of plants with certain of these peptides, enzymes, or other proteins would have beneficial effects on the overall populations of beneficial soil bacteria and fungi, create a healthier overall soil environment for plant growth, improve plant growth, and provide for the protection of plants against certain bacterial and fungal pathogens.
  • FIGS. 1A and 1B show alignments of the amino acid sequence of an amino-terminal portion of Bacillus anthracis Sterne strain BclA and with the corresponding region from various exosporium proteins from Bacillus cereus family members.
  • FIG. 2 shows exemplary fluorescent microscopy results for the expression of fusion proteins containing various exosporium proteins linked to an mCherry reporter on the exosporium of a recombinant Bacillus cereus family member.
  • FIG. 3 provides data showing to recombinant Bacillus thuringiensis BT013A spores expressing a fusion protein comprising a DNA binding protein.
  • FIG. 4 is a transmission electron micrograph showing exosporium fragments and a Bacillus cereus family member spore from which the exosporium has been lost, generated using a recombinant Bacillus cereus family member having a knock-out mutation of its CotE gene.
  • FIG. 5 is a photograph of an SDS-PAGE gel showing a protein marker standard (lane 1) and proteins from exosporium fragments generated using a recombinant Bacillus cereus family member having a knock-out mutation of its CotE gene (lane 2).
  • FIG. 6 provides data illustrating enzyme activity of an acid phosphatase in exosporium fragments derived from a Bacillus cereus family member having a knock-out mutation of its CotE gene.
  • FIG. 7 provides data illustrating that Bacillus cereus family member EE349 reduces the inhibitory effects of herbicide on root length in lentils.
  • FIG. 8 provides data illustrating increased phosphatase activity in a Bacillus cereus family member modified to overexpress acid phosphatase (AcpC).
  • FIG. 9 provides data showing the endoglucanase activity of recombinant Bacillus thuringiensis spores expressing a CotC-endoglucanase fusion protein.
  • FIG. 10 provides bright-field and fluorescence microscopy images showing detection of RNA on the surface of recombinant B. thuringiensis spores expressing a fusion protein comprising amino acids 20-35 of SEQ ID NO: 1 and SspC bound to either single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA).
  • ssRNA single-stranded RNA
  • dsRNA double-stranded RNA
  • FIG. 11 provides a photograph showing the effects of the microRNA MIR319 on soy height and root development, following delivery to soybean plants using recombinant B. thuringiensis spores expressing a fusion protein comprising amino acids 20-35 of SEQ ID NO: 1 and SspC bound to MIR319.
  • FIG. 12 provides bright-field and fluorescence microscopy images showing detection of GFP and mCherry in the gut of nematodes fed normal OP50 E. coli bacterial food (two right-hand panels) or nematodes fed B. thuringiensis spores expressing a fusion protein comprising amino acids 20-35 of SEQ ID NO: 1 and either GFP or mCherry (three left-hand panels).
  • FIG. 13 provides a fluorescence microscopy image showing detection of endophytic bacteria isolated from inside of corn plants treated with Bacillus thuringiensis EE-B00184 expressing a fusion protein comprising amino acids 20-35 of SEQ ID NO: 1 and GFP. Arrows denote single spores.
  • FIG. 14 provides a photograph showing fluorescence of bacterial colonies containing recombinant Bacillus cereus family members expressing a fusion protein comprising amino acids 20-35 of SEQ ID NO: 1 and GFP, isolated from inside of corn plants grown from seeds coated with the recombinant bacteria.
  • FIG. 15 provides a transmission electron micrographs showing: (A) intact spores of Bacillus thuringiensis BT013A surrounded by attached exosporium; (B) spores of CotE knockout strain of Bacillus thuringiensis BT013A, with detached exosporium; and (C) a purified exosporium fragment preparation of exosporium fragments derived from a CotE knockout strain of Bacillus thuringiensis BT013A.
  • animal encompasses any non-human animal as well as humans.
  • the animal can be a mammal (e.g., a human, a sheep, goat, cow, pig, deer, alpaca, bison, camel, donkey, horse, mule, llama, rabbit, dog, or cat), a bird (e.g., a chicken, turkey, duck, goose, quail, or pheasant), a fish (e.g., salmon, trout, tilapia, tuna, catfish, or a carp), or a crustacean (e.g., a shrimp, prawn, lobster, crab, or crayfish).
  • a mammal e.g., a human, a sheep, goat, cow, pig, deer, alpaca, bison, camel, donkey, horse, mule, llama, rabbit, dog, or cat
  • a bird e.g., a chicken, turkey, duck,
  • a “biologically pure bacterial culture” refers to a culture of bacteria containing no other bacterial species in quantities sufficient to interfere with the replication of the culture or be detected by normal bacteriological techniques. Stated another way, it is a culture wherein virtually all of the bacterial cells present are of the selected strain.
  • bioactive peptide refers to any peptide that exerts a biological activity. “Bioactive peptides” can be generated, for example, via the cleavage of a protein, peptide, proprotein, or preproprotein by a protease or peptidase.
  • the term “effective amount” refers to a quantity which is sufficient to result in a statistically significant increase of growth and/or of protein yield and/or of grain yield of a plant as compared to the growth, protein yield and grain yield of the control-treated plant.
  • An “enzyme involved in the production or activation of a plant growth stimulating compound” includes any enzyme that catalyzes any step in a biological synthesis pathway for a compound that stimulates plant growth or alters plant structure, or any enzyme that catalyzes the conversion of an inactive or less active derivative of a compound that stimulates plant growth or alters plant structure to an active or more active form of the compound.
  • Such compounds include, for example, but are not limited to, small molecule plant hormones such as auxins and cytokinins, bioactive peptides, and small plant growth stimulating molecules synthesized by bacteria or fungi in the rhizosphere (e.g., 2,3-butanediol).
  • fusion protein refers to a protein having a polypeptide sequence that comprises sequences derived from two or more separate proteins.
  • a fusion protein can be generated by joining together a nucleic acid molecule that encodes all or part of a first polypeptide with a nucleic acid molecule that encodes all or part of a second polypeptide to create a nucleic acid sequence which, when expressed, yields a single polypeptide having functional properties derived from each of the original proteins.
  • breeding rate refers to the number of seeds that germinate during a particular time period. For example, a germination rate of 85% indicates that 85 out of 100 seeds germinate during a given time period.
  • inactivate or “inactivation” as used herein in reference to the inactivation of spores of a recombinant Bacillus cereus family member or a recombinant spore-forming bacterium means that the spores are unable to germinate, or that the spores can germinate, but are damaged such that germination does not result in a living bacterium.
  • partially inactivate or “partial inactivation” mean that a percentage of the spores are inactivated, but that some spores retain the ability to germinate and return to a live, replicating state.
  • genetic inactivation refers to inactivation of spores a recombinant Bacillus cereus family member or recombinant spore-forming bacterium by a mutation of the spore's DNA that results in complete or partial inactivation of the spore.
  • physical inactivation and “chemical inactivation refer to inactivation of spores using any physical or chemical means, e.g., by heat treatment, gamma irradiation, x-ray irradiation, UV-A irradiation, UV-B irradiation, or treatment with a solvent such as gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, chloroform, or phenol, or any combination thereof.
  • a solvent such as gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, chloroform, or phenol, or any combination thereof.
  • immobilizing a recombinant Bacillus cereus family member spore on a plant and “immobilizing a spore of a recombinant spore-forming bacterium on a plant” refers to the binding of a recombinant Bacillus cereus family member spore or a spore of a recombinant spore-forming bacterium to plant, e.g., to a root of a plant or to an aerial portion of a plant such as a leaf, stem, flower, or fruit, such that the spore is maintained at the plant's root structure or aerial portion instead of dissipating into the plant growth medium or into the environment surrounding the aerial portions of the plant.
  • inoculant as described in this invention is defined in several Federal, or State regulations as (1) “soil or plant inoculants shall include any carrier or culture of a specific micro-organism or mixture of micro-organisms represented to improve the soil or the growth, quality, or yield of plants, and shall also include any seed or fertilizer represented to be inoculated with such a culture” (New York State 10-A Consolidated Law); (2) “substances other than fertilizers, manufactured, sold or represented for use in the improvement of the physical condition of the soil or to aid plant growth or crop yields” (Canada Fertilizers Act); (3) “a formulation containing pure or predetermined mixtures of living bacteria, fungi or virus particles for the treatment of seed, seedlings or other plant propagation material for the purpose of enhancing the growth capabilities or disease resistance or otherwise altering the properties of the eventual plants or crop” (Ad hoc European Working Group, 1997) or (4) “meaning any chemical or biological substance of mixture of substances or device distributed in this state to be applied to soil, plants or seeds
  • a “modulator protein” includes any protein that, when overexpressed in a Bacillus cereus family member expressing any of the fusion proteins described herein, modulates expression of the fusion protein, such that the expression of the fusion protein is increased or decreased as compared to expression of the fusion protein in a Bacillus cereus family member that does not overexpress the modulator protein.
  • a “plant growth medium” includes any material that is capable of supporting the growth of a plant.
  • plant immune system enhancer protein or peptide as used herein includes any protein or peptide that has a beneficial effect on the immune system of a plant.
  • plant growth stimulating protein or peptide includes any protein or peptide that increases plant growth in a plant exposed to the protein or peptide.
  • probiotic refers to microorganisms (e.g., bacteria) that provide health benefits when consumed by or administered to an animal.
  • promoting plant growth and “stimulating plant growth” are used interchangeably herein, and refer to the ability to enhance or increase at least one of the plant's height, weight, leaf size, root size, or stem size, to increase protein yield from the plant or to increase grain yield of the plant.
  • a “protein or peptide that protects a plant from a pathogen” as used herein includes any protein or peptide that makes a plant exposed to the protein or peptide less susceptible to infection with a pathogen.
  • a “protein or peptide that enhances stress resistance in a plant” as used herein includes any protein or peptide that makes a plant exposed to the protein or peptide more resistant to stress.
  • plant binding protein or peptide refers to any peptide or protein capable of specifically or non-specifically binding to any part of a plant (e.g., roots or aerial portions of a plant such as leaves foliage, stems, flowers, or fruits) or to plant matter.
  • pyrethrinase refers to any enzyme that degrades a pyrethrin or a pyrethroid.
  • Rhizosphere is used interchangeably with “root zone” to denote that segment of the soil that surrounds the roots of a plant and is influenced by them.
  • targeting sequence refers to a polypeptide sequence that, when present as part of a longer polypeptide or a protein, results in the localization of the longer polypeptide or the protein to a specific subcellular location.
  • the targeting sequences described herein result in localization of proteins to the exosporium of a Bacillus cereus family member.
  • the present invention relates to fusion proteins comprising a targeting sequence, an exosporium protein, or an exosporium protein fragment targets the fusion protein to the exosporium of a Bacillus cereus family member and at least one protein or peptide of interest.
  • these fusion proteins are targeted to the exosporium layer of the spore and are physically oriented such that the protein or peptide of interest is displayed on the outside of the spore.
  • This Bacillus exosporium display (BEMD) system can be used to deliver peptides, enzymes, and other proteins to plants (e.g., to plant foliage, fruits, flowers, stems, or roots) or to a plant growth medium such as soil. Peptides, enzymes, and proteins delivered to the soil or another plant growth medium in this manner persist and exhibit activity in the soil for extended periods of time.
  • Introduction of recombinant Bacillus cereus family member bacteria expressing the fusion proteins described herein into soil or the rhizosphere of a plant leads to a beneficial enhancement of plant growth in many different soil conditions.
  • the use of the BEMD to create these enzymes allows them to continue to exert their beneficial results to the plant and the rhizosphere over the first months of a plants life.
  • amino acid sequences for the targeting sequences, exosporium proteins, and exosporium protein fragments that can be used for targeting of proteins or peptides of interest to the exosporium of a Bacillus cereus family members, are provided in Table 1 together with their SEQ ID NOs.
  • weihenstephensis KBAB4 AA 1-39 of hypothetical protein bmyco0001_21660 ( B. mycoides 2048) 29 Full length hypothetical protein bmyco0001_21660 ( B. mycoides 2048) 30 AA 1-30 of hypothetical protein bmyc0001_22540 ( B. mycoides 2048) 31 Full length hypothetical protein bmyc0001_22540 ( B. mycoides 2048) 32 AA 1-21 of hypothetical protein bmyc0001_21510 ( B. mycoides 2048) 33 Full length hypothetical protein bmyc0001_21510 ( B. mycoides 2048) 34 AA 1-22 of collagen triple helix repeat protein ( B.
  • anthracis Sterne 95* Met + AA 20-35 of BclA ( B. anthracis Sterne) 96 Met + AA 12-27 of BetA/BAS3290 ( B. anthracis Sterne) 97 Met + AA 18-33 of gene 2280 ( B. weihenstephensis KBAB4) 98 Met + AA 18-33 of gene 3572 ( B. weihenstephensis KBAB4) 99 Met + AA 12-27 of Exosporium Leader Peptide ( B. cereus VD166) 100 Met + AA 18-33 of YVTN ⁇ -propeller protein 101 ( B.
  • SEQ ID NO: 96 also represents a methionine residue plus amino acids 20-35 of B. thuringiensis BclA.
  • ** B. mycoides hypothetical protein TIGR03720 has 100% sequence identity with B. mycoides hypothetical protein WP003189234.
  • SEQ ID NOs: 57 and 58 also represent amino acids 1-136 of B. mycoides hypothetical protein WP003189234 and full length B. mycoides hypothetical protein WP003189234, respectively.
  • Bacillus is a genus of rod-shaped bacteria.
  • the Bacillus cereus family of bacteria includes any Bacillus species that is capable of producing an exosporium.
  • the Bacillus cereus family of bacteria includes the species Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis , and Bacillus toyoiensis .
  • Bacillus cereus family bacteria undergo sporulation and form oval endospores that can stay dormant for extended periods of time.
  • the outermost layer of the endospores is known as the exosporium and comprises a basal layer surrounded by an external nap of hair-like projections. Filaments on the hair-like nap are predominantly formed by the collagen-like glycoprotein BclA, while the basal layer is comprised of a number of different proteins.
  • Another collagen-related protein, BclB is also present in the exosporium and exposed on endospores of Bacillus cereus family members. BclA, the major constituent of the surface nap, has been shown to be attached to the exosporium with its amino-terminus (N-terminus) positioned at the basal layer and its carboxy-terminus (C-terminus) extending outward from the spore.
  • amino acids 20-35 of BclA from Bacillus anthracis Sterne strain have been found to be sufficient for targeting to the exosporium.
  • a sequence alignment of amino acids 1-41 of BclA (SEQ ID NO: 1) with the corresponding N-terminal regions of several other Bacillus cereus family exosporium proteins and Bacillus cereus family proteins having related sequences is shown in FIGS. 1A and 1B .
  • FIGS. 1A and 1B there is a region of high-homology among all of the proteins in the region corresponding to amino acids 20-41 of BclA.
  • amino acids corresponding to amino acids 36-41 of BclA contain secondary structure and are not necessary for fusion protein localization to the exosporium.
  • the conserved targeting sequence region of BclA (amino acids 20-35 of SEQ ID NO: 1) is shown in bold in FIGS. 1A and 1B and corresponds to the minimal targeting sequence needed for localization to the exosporium.
  • a more highly conserved region spanning amino acids 25-35 of BclA within the targeting sequence is underlined in the sequences in FIGS. 1A and 1B , and is the recognition sequence for ExsFA/BxpB/ExsFB and homologs, which direct and assemble the described proteins on the surface of the exosporium.
  • amino acids 1-33 of Bacillus anthracis Sterne strain BetA/BAS3290 amino acids 1-33 of Bacillus anthracis Sterne strain BetA/BAS3290, a methionine followed by amino acids 2-43 of Bacillus anthracis Sterne strain BAS4623, and amino acids 1-34 of Bacillus anthracis Sterne strain BclB, respectively.
  • BAS4623 it was found that replacing the valine present at position 1 in the native protein with a methionine resulted in better expression.
  • each of these sequences contains a conserved region corresponding to amino acids 20-35 of BclA (SEQ ID NO: 1; shown in bold), and a more highly conserved region corresponding to amino acids 20-35 of BclA (underlined).
  • SEQ ID NO: 9 is amino acids 1-30 of Bacillus anthracis Sterne strain BAS1882
  • SEQ ID NO: 11 is amino acids 1-39 of the Bacillus weihenstephensis KBAB4 2280 gene product
  • SEQ ID NO: 13 is amino acids 1-39 of the Bacillus weihenstephensis KBAB4 3572 gene product
  • SEQ ID NO: 15 is amino acids 1-49 of Bacillus cereus VD200 exosporium leader peptide
  • SEQ ID NO: 17 is amino acids 1-33 of Bacillus cereus VD166 exosporium leader peptide
  • SEQ ID NO: 19 is amino acids 1-39 of Bacillus cereus VD200 hypothetical protein IKG_04663
  • SEQ ID NO: 21 is amino acids 1-39 of Bacillus weihenstephensis KBAB4 YVTN ⁇ -propeller protein
  • SEQ ID NO: 23 is amino acids 1
  • SEQ ID NO: 61 is amino acids 1-39 of B. cereus E33L collagen-like protein
  • SEQ ID NO: 63 is amino acids 1-41 of B. weihenstephanensis KBAB4 triple helix repeat-containing collagen
  • SEQ ID NO: 65 is amino acids 1-30 of B. thuringiensis str. Al Hakam hypothetical protein BALH_2230
  • SEQ ID NO: 67 is amino acids 1-33 of B. cereus ATCC 14579 triple helix repeat-containing collagen
  • SEQ ID NO: 69 is amino acids 1-44 of B. cereus collagen triple helix repeat
  • SEQ ID NO: 71 is amino acids 1-38 of B.
  • SEQ ID NO: 73 is amino acids 1-30 of B. cereus E33L hypothetical protein BCZK1835
  • SEQ ID NO: 75 is amino acids 1-48 of B. weihenstephanensis KBAB4 triple helix repeat-containing collagen
  • SEQ ID NO: 77 is amino acids 1-30 of B. cereus ATCC 14579 triple helix repeat-containing collagen
  • SEQ ID NO: 79 is amino acids 1-39 of B. cereus ATCC 14579 hypothetical protein BC4725
  • SEQ ID NO: 81 is amino acids 1-44 of B. cereus E33L hypothetical protein BCZK4476
  • SEQ ID NO: 83 is amino acids 1-40 of B. anthracis str.
  • SEQ ID NO: 85 is amino acids 1-34 of B. thuringiensis serovar konkukian str. 97-27 BclA protein
  • SEQ ID NO: 87 is amino acids 1-34 of B. cereus ATCC 10987 conserved hypothetical protein
  • SEQ ID NO: 89 is amino acids 1-34 of B. cereus ATCC 14579 triple helix repeat-containing collagen
  • SEQ ID NO: 91 is amino acids 1-99 of B. cereus exosporium leader peptide partial sequence
  • SEQ ID NO: 93 is amino acids 1-136 of B. weihenstephanensis hypothetical protein ER45_27600. As shown in FIGS.
  • each of the N-terminal regions of these proteins contains a region that is conserved with amino acids 20-35 of BclA (SEQ ID NO: 1), and a more highly conserved region corresponding to amino acids 25-35 of BclA.
  • BclA which includes amino acids 20-35 can be used as to target a fusion protein to the exosporium.
  • full-length exosporium proteins or exosporium protein fragments can be used for targeting the fusion proteins to the exosporium.
  • full-length BclA or a fragment of BclA that includes amino acids 20-35 can be used for targeting to the exosporium.
  • full length BclA SEQ ID NO: 2
  • a midsized fragment of BclA that lacks the carboxy-terminus such as SEQ ID NO: 95 (amino acids 1-196 of BclA) can be used to target the fusion proteins to the exosporium.
  • the targeting sequence can also comprise much shorter portions of BclA which include amino acids 20-35, such as SEQ ID NO: 1 (amino acids 1-41 of BclA), amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, or SEQ ID NO: 96 (a methionine residue linked to amino acids 20-35 of BclA). Even shorter fragments of BclA which include only some of amino acids 20-35 also exhibit the ability to target fusion proteins to the exosporium.
  • the targeting sequence can comprise amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1.
  • weihenstephensis KBAB4 triple helix repeat containing collagen B. mycoides 2048 hypothetical protein bmyco0001_21660 , B. mycoides 2048 hypothetical protein bmyc0001_22540, B. mycoides 2048 hypothetical protein bmyc0001_21510, B. thuringiensis 35646 collagen triple helix repeat protein, B. cereus hypothetical protein WP_69652, B. cereus exosporium leader WP016117717, B. cereus exosporium peptide WP002105192, B. cereus hypothetical protein WP87353, B. cereus exosporium peptide 02112369, B. cereus exosporium protein WP016099770, B.
  • B. cereus ATCC 14579 triple helix repeat-containing collagen B. cereus ATCC 14579 hypothetical protein BC4725, B. cereus E33L hypothetical protein BCZK4476, B. anthracis str. ‘Ames Ancestor’ triple helix repeat-containing collagen, B. thuringiensis serovar konkukian str. 97-27 BclA protein, B. cereus ATCC 10987 conserved hypothetical protein, B. cereus ATCC 14579 triple helix repeat-containing collagen, B. cereus exosporium leader peptide partial sequence, or B. weihenstephanensis hypothetical protein ER45_27600 which includes the amino acids corresponding to amino acids 20-35 of BclA can serve as the targeting sequence.
  • amino acids 12-27 of BetA/BAS3290 amino acids 23-38 of BAS4623, amino acids 13-28 of BclB, amino acids 9-24 of BAS1882, amino acids 18-33 of KBAB4 2280 gene product, amino acids 18-33 of KBAB4 3572 gene product, amino acids 28-43 of B. cereus VD200 exosporium leader peptide, amino acids 12-27 of B. cereus VD166 exosporium leader peptide, amino acids 18-33 of B. cereus VD200 hypothetical protein IKG_04663, amino acids 18-33 B. weihenstephensis KBAB4 YVTN ⁇ -propeller protein, amino acids 9-24 of B.
  • weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 amino acids 9-24 of B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, amino acids 15-30 of B. weihenstephensis KBAB4 triple helix repeat containing collagen, amino acids 18-33 of B. mycoides 2048 hypothetical protein bmyco0001_21660, amino acids 9-24 of B. mycoides 2048 hypothetical protein bmyc0001_22540, amino acids 1-15 of B. mycoides 2048 hypothetical protein bmyc0001_21510, amino acids 1-16 of B. thuringiensis 35646 collagen triple helix repeat protein, amino acids 14-29 of B.
  • cereus hypothetical protein WP_69652 amino acids 20-35 of B. cereus exosporium leader WP016117717, amino acids 28-43 of B. cereus exosporium peptide WP002105192, amino acids 17-32 of B. cereus hypothetical protein WP87353, amino acids 18-33 of B. cereus exosporium peptide 02112369, amino acids 18-33 of B. cereus exosporium protein WP016099770, amino acids 15-30 of B. thuringiensis hypothetical protein YP006612525, and amino acids 115-130 of B. mycoides hypothetical protein TIGR03720 correspond to amino acids 20-35 of BclA. As can be seen from FIG. 1B , amino acids 15-30 of B.
  • weihenstephanensis KBAB4 triple helix repeat-containing collagen amino acids 9-24 of B. cereus ATCC 14579 triple helix repeat-containing collagen, amino acids 18-33 of B. cereus ATCC 14579 hypothetical protein BC4725, amino acids 23-38 of B. cereus E33L hypothetical protein BCZK4476, amino acids 19-34 B. anthracis str.
  • any amino acid sequence comprising amino acids 20-35 of BclA, or any of the above-listed corresponding amino acids can serve as the targeting sequence.
  • the targeting sequence can comprise amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, SEQ ID NO: 96, amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1.
  • the targeting sequence consists of amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 96.
  • the targeting sequence can consist of amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1.
  • the exosporium protein can comprise full length BclA (SEQ ID NO: 2), or the exosporium protein fragment can comprise a midsized fragment of BclA that lacks the carboxy-terminus, such as SEQ ID NO: 59 (amino acids 1-196 of BclA).
  • the exosporium protein fragment can consist of SEQ ID NO: 59.
  • the targeting sequence can comprise amino acids 2-35 of SEQ ID NO: 1; amino acids 5-35 of SEQ ID NO: 1; amino acids 8-35 of SEQ ID NO: 1; amino acids 10-35 of SEQ ID NO: 1; or amino acids 15-35 of SEQ ID NO: 1.
  • the targeting sequence can also comprise amino acids 1-27 of SEQ ID NO: 3, amino acids 12-27 of SEQ ID NO: 3, or SEQ ID NO: 3, or the exosporium protein can comprise full length BetA/BAS3290 (SEQ ID NO: 4). It has also been found that a methionine residue linked to amino acids 12-27 of BetA/BAS3290 can be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 97.
  • the targeting sequence can also comprise amino acids 14-23 of SEQ ID NO: 3, amino acids 14-25 of SEQ ID NO: 3, or amino acids 12-23 of SEQ ID NO: 3.
  • the targeting sequence can comprise amino acids 2-27 of SEQ ID NO: 3; amino acids 5-27 of SEQ ID NO: 3; amino acids 8-27 of SEQ ID NO: 3; or amino acids 10-27 of SEQ ID NO: 3.
  • the targeting sequence can also comprise amino acids 1-38 of SEQ ID NO: 5, amino acids 23-38 of SEQ ID NO: 5, or SEQ ID NO: 5, or the exosporium protein can comprise full length BAS4623 (SEQ ID NO: 6).
  • the targeting sequence can comprise amino acids 2-38 of SEQ ID NO: 5; amino acids 5-38 of SEQ ID NO: 5; amino acids 8-38 of SEQ ID NO: 5; amino acids 10-38 of SEQ ID NO: 5; amino acids 15-38 of SEQ ID NO: 5; or amino acids 20-38 of SEQ ID NO: 5.
  • the targeting sequence can comprise amino acids 1-28 of SEQ ID NO: 7, amino acids 13-28 of SEQ ID NO: 7, or SEQ ID NO: 7, or the exosporium protein can comprise full length BclB (SEQ ID NO:8).
  • the targeting sequence can comprise amino acids 2-28 of SEQ ID NO: 7; amino acids 5-28 of SEQ ID NO: 7; amino acids 8-28 of SEQ ID NO: 7; or amino acids 10-28 of SEQ ID NO: 7.
  • the targeting sequence can also comprise amino acids 1-24 of SEQ ID NO: 9, amino acids 9-24 of SEQ ID NO: 9, or SEQ ID NO: 9, or the exosporium protein can comprise full length BAS1882 (SEQ ID NO: 10).
  • a methionine residue linked to amino acids 9-24 of BAS1882 can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 105.
  • the targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 9; amino acids 5-24 of SEQ ID NO: 9; or amino acids 8-24 of SEQ ID NO: 9.
  • the targeting sequence can also comprise amino acids 1-33 of SEQ ID NO:11, amino acids 18-33 of SEQ ID NO: 11, or SEQ ID NO: 11, or the exosporium protein can comprise the full length B. weihenstephensis KBAB4 2280 gene product (SEQ ID NO: 12).
  • a methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 2280 gene product can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 98.
  • the targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 11; amino acids 5-33 of SEQ ID NO: 11; amino acids 8-33 of SEQ ID NO: 11; amino acids 10-33 of SEQ ID NO: 11; or amino acids 15-33 of SEQ ID NO: 11.
  • the targeting sequence can also comprise amino acids 1-33 of SEQ ID NO: 13, amino acids 18-33 of SEQ ID NO: 13, or SEQ ID NO:13, or the exosporium protein can comprise the full length B. weihenstephensis KBAB4 3572 gene product (SEQ ID NO:14). A methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 3572 gene product can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 99.
  • the targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 13; amino acids 5-33 of SEQ ID NO: 13; amino acids 8-33 of SEQ ID NO: 13; amino acids 10-33 of SEQ ID NO: 13; or amino acids 15-33 of SEQ ID NO: 13;
  • the targeting sequence can comprise amino acids 1-43 of SEQ ID NO: 15, amino acids 28-43 of SEQ ID NO: 15, or SEQ ID NO:15, or the exosporium protein can comprise full length B. cereus VD200 exosporium leader peptide (SEQ ID NO:16).
  • the targeting sequence can comprise amino acids 2-43 of SEQ ID NO: 15; amino acids 5-43 of SEQ ID NO: 15; amino acids 8-43 of SEQ ID NO: 15; amino acids 10-43 of SEQ ID NO: 15; amino acids 15-43 of SEQ ID NO: 15; amino acids 20-43 of SEQ ID NO: 15; or amino acids 25-43 of SEQ ID NO: 15.
  • the targeting sequence can also comprise amino acids 1-27 of SEQ ID NO: 17, amino acids 12-27 of SEQ ID NO: 17, or SEQ ID NO: 17, or the exosporium protein can comprise full-length B. cereus VD166 exosporium leader peptide (SEQ ID NO:18).
  • a methionine residue linked to amino acids 12-27 of the B. cereus VD166 exosporium leader peptide can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 100.
  • the targeting sequence can comprise amino acids 2-27 of SEQ ID NO: 17; amino acids 5-27 of SEQ ID NO: 17; amino acids 8-27 of SEQ ID NO: 17; or amino acids 10-27 of SEQ ID NO: 17.
  • the targeting sequence can also comprise amino acids 1-33 of SEQ ID NO: 19, amino acids 18-33 of SEQ ID NO: 19, or SEQ ID NO:19, or the exosporium protein can comprise full length B. cereus VD200 hypothetical protein IKG_04663 (SEQ ID NO:20).
  • the targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 19; amino acids 5-33 of SEQ ID NO: 19; amino acids 8-33 of SEQ ID NO: 19; amino acids 10-33 of SEQ ID NO: 19; or amino acids 15-33 of SEQ ID NO: 19.
  • the targeting sequence comprises amino acids 1-33 of SEQ ID NO: 21, amino acids 18-33 of SEQ ID NO: 21, or SEQ ID NO:21, or the exosporium protein can comprise full length B. weihenstephensis KBAB4 YVTN ⁇ -propeller protein (SEQ ID NO:22).
  • a methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 YVTN ⁇ -propeller protein can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 101.
  • the targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 21; amino acids 5-33 of SEQ ID NO: 21; amino acids 8-33 of SEQ ID NO: 21; amino acids 10-33 of SEQ ID NO: 21; or amino acids 15-33 of SEQ ID NO: 21.
  • the targeting sequence can also comprise amino acids 1-24 of SEQ ID NO: 23, amino acids 9-24 of SEQ ID NO: 23, or SEQ ID NO:23, or the exosporium protein can comprise full length B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 (SEQ ID NO:24). A methionine residue linked to amino acids 9-24 of B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 102.
  • the targeting sequence can comprise amino acids 2-24 of SEQ ID NO:23; amino acids 5-24 of SEQ ID NO: 23; or amino acids 8-24 of SEQ ID NO: 23.
  • the targeting sequence comprise amino acids 1-24 of SEQ ID NO: 25, amino acids 9-24 of SEQ ID NO: 25, or SEQ ID NO: 25, or the exosporium protein can comprise full length B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131 (SEQ ID NO:26). A methionine residue linked to amino acids 9-24 of B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131 can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 103.
  • the targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 25; amino acids 5-24 of SEQ ID NO: 25; or amino acids 8-24 of SEQ ID NO: 25.
  • the targeting sequence comprises amino acids 1-30 of SEQ ID NO: 27, amino acids 15-30 of SEQ ID NO: 27, or SEQ ID NO:27, or the exosporium protein can comprise full length B. weihenstephensis KBAB4 triple helix repeat containing collagen (SEQ ID NO:28).
  • the targeting sequence can comprise amino acids 2-30 of SEQ ID NO: 27; amino acids 5-30 of SEQ ID NO: 27; amino acids 8-30 of SEQ ID NO: 27; or amino acids 10-30 of SEQ ID NO: 27.
  • the targeting sequence can also comprise amino acids 1-33 of SEQ ID NO: 29, amino acids 18-33 of SEQ ID NO: 29, or SEQ ID NO:29, or the exosporium protein can comprise full length B. mycoides 2048 hypothetical protein bmyco0001_21660 (SEQ ID NO:30).
  • the targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 29; amino acids 5-33 of SEQ ID NO: 29; amino acids 8-33 of SEQ ID NO: 29; amino acids 10-33 of SEQ ID NO: 29; or amino acids 15-33 of SEQ ID NO: 29.
  • the targeting sequence can also comprise amino acids 1-24 of SEQ ID NO: 31, amino acids 9-24 of SEQ ID NO: 31, or SEQ ID NO:31, or the exosporium protein can comprise full length B. mycoides 2048 hypothetical protein bmyc0001_22540 (SEQ ID NO:32). A methionine residue linked to amino acids 9-24 of B. mycoides 2048 hypothetical protein bmyc0001_22540 can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 104.
  • the targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 31; amino acids 5-24 of SEQ ID NO: 31; or amino acids 8-24 of SEQ ID NO: 31.
  • the targeting sequence comprises amino acids 1-15 of SEQ ID NO: 33, SEQ ID NO:33, or the exosporium protein comprises full length B. mycoides 2048 hypothetical protein bmyc0001_21510 (SEQ ID NO:34).
  • the targeting sequence can also comprise amino acids 1-16 of SEQ ID NO: 35, SEQ ID NO:35, or the exosporium protein can comprise full length B. thuringiensis 35646 collagen triple helix repeat protein (SEQ ID NO:36).
  • the targeting sequence can comprise amino acids 1-29 of SEQ ID NO:43, amino acids 14-29 of SEQ ID NO: 43, or SEQ ID NO: 43, or the exosporium protein can comprise full length B. cereus hypothetical protein WP_69652 (SEQ ID NO: 44).
  • the targeting sequence can comprise amino acids 2-29 of SEQ ID NO: 43; amino acids 5-29 of SEQ ID NO: 43; amino acids 8-29 of SEQ ID NO: 43; or amino acids 10-29 of SEQ ID NO: 43.
  • the targeting sequence can comprise amino acids 1-35 of SEQ ID NO: 45, amino acids 20-35 of SEQ ID NO: 45, or SEQ ID NO: 45, or the exosporium protein can comprise full length B. cereus exosporium leader WP016117717 (SEQ ID NO: 46).
  • a methionine residue linked to amino acids 20-35 of B. cereus exosporium leader WP016117717 can also be used as a targeting sequence.
  • the targeting sequence can comprise SEQ ID NO: 106.
  • the targeting sequence can comprise amino acids 2-35 of SEQ ID NO: 45; amino acids 5-35 of SEQ ID NO: 45; amino acids 8-35 of SEQ ID NO: 45; amino acids 10-35 of SEQ ID NO: 45; or amino acids 15-35 of SEQ ID NO: 45.
  • the targeting sequence can comprise amino acids 1-43 of SEQ ID NO: 47, amino acids 28-43 of SEQ ID NO: 47, or SEQ ID NO: 47, or the exosporium protein can comprise full length B. cereus exosporium peptide WP002105192 (SEQ ID NO: 48).
  • the targeting sequence can comprise amino acids 2-43 of SEQ ID NO: 47; amino acids 5-43 of SEQ ID NO: 47; amino acids 8-43 of SEQ ID NO: 47; amino acids 10-43 of SEQ ID NO: 47; amino acids 15-43 of SEQ ID NO: 47; amino acids 20-43 of SEQ ID NO: 47; or amino acids 25-43 of SEQ ID NO: 47.
  • the targeting sequence can comprise amino acids 1-32 of SEQ ID NO: 49, amino acids 17-32 of SEQ ID NO: 49, or SEQ ID NO: 49, or the exosporium protein can comprise full length B. cereus hypothetical protein WP87353 (SEQ ID NO: 50).
  • the targeting sequence can comprise amino acids 2-32 of SEQ ID NO: 49; amino acids 5-32 of SEQ ID NO: 49; amino acids 8-32 of SEQ ID NO: 49; amino acids 10-32 of SEQ ID NO: 49; or amino acids 15-32 of SEQ ID NO: 49.
  • the targeting sequence can comprise amino acids 1-33 of SEQ ID NO: 51, amino acids 18-33 of SEQ ID NO: 51, or SEQ ID NO: 51, or the exosporium protein can comprise full length B. cereus exosporium peptide 02112369 (SEQ ID NO: 52).
  • the targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 51; amino acids 5-33 of SEQ ID NO: 51; amino acids 8-33 of SEQ ID NO: 51; amino acids 10-33 of SEQ ID NO: 51; or amino acids 15-33 of SEQ ID NO: 51;
  • the targeting sequence can comprise amino acids 1-33 of SEQ ID NO: 53, amino acids 18-33 of SEQ ID NO: 53, or SEQ ID NO: 53, or the exosporium protein can comprise full length B. cereus exosporium protein WP016099770 (SEQ ID NO: 54).
  • the targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 53; amino acids 5-33 of SEQ ID NO: 53; amino acids 8-33 of SEQ ID NO: 53; amino acids 10-33 of SEQ ID NO: 53; or amino acids 15-33 of SEQ ID NO: 53.
  • the targeting sequence can comprise acids 1-30 of SEQ ID NO: 55, amino acids 15-30 of SEQ ID NO: 55, or SEQ ID NO: 55, or the exosporium protein can comprise full length B. thuringiensis hypothetical protein YP006612525 (SEQ ID NO: 56).
  • the targeting sequence can comprise amino acids 2-30 of SEQ ID NO: 55; amino acids 5-30 of SEQ ID NO: 55; amino acids 8-30 of SEQ ID NO: 55; or amino acids 10-30 of SEQ ID NO: 55.
  • the targeting sequence can also comprise amino acids 1-130 of SEQ ID NO: 57, amino acids 115-130 of SEQ ID NO: 57, or SEQ ID NO: 57, or the exosporium protein can comprise full length B. mycoides hypothetical protein TIGR03720 (SEQ ID NO: 58).
  • the targeting sequence can comprise amino acids 2-130 of SEQ ID NO: 57; amino acids 5-130 of SEQ ID NO: 57; amino acids 10-130 of SEQ ID NO: 57; amino acids 20-130 of SEQ ID NO: 57; amino acids 30-130 of SEQ ID NO: 57; amino acids 40-130 of SEQ ID NO: 57; amino acids 50-130 of SEQ ID NO: 57; amino acids 60-130 of SEQ ID NO: 57; amino acids 70-130 of SEQ ID NO: 57; amino acids 80-130 of SEQ ID NO: 57; amino acids 90-130 of SEQ ID NO: 57; amino acids 100-130 of SEQ ID NO: 57; or amino acids 110-130 of SEQ ID NO: 57.
  • the targeting sequence can comprise amino acids 1-30 of SEQ ID NO: 59; or SEQ ID NO: 59; or the exosporium protein can comprise full length B. cereus ATCC 10987 collagen triple helix repeat domain protein (SEQ ID NO: 60).
  • the targeting sequence can comprise amino acids 2-30 of SEQ ID NO: 59; amino acids 4-30 of SEQ ID NO: 59; or amino acids 6-30 of SEQ ID NO: 59.
  • the targeting sequence can comprise amino acids 1-33 of SEQ ID NO: 61; amino acids 18-33 of SEQ ID NO: 61; or SEQ ID NO: 61; or the exosporium protein can comprise full length B. cereus E33L collagen-like protein (SEQ ID NO: 62).
  • the targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 61; amino acids 5-33 of SEQ ID NO: 61; amino acids 10-33 of SEQ ID NO: 61; or amino acids 15-33 of SEQ ID NO: 61.
  • the targeting sequence can comprise amino acids 1-35 of SEQ ID NO: 63; or SEQ ID NO: 63; or the exosporium protein can comprise full length B. weihenstephanensis KBAB4 triple helix repeat-containing collagen (SEQ ID NO: 64).
  • the targeting sequence can comprise amino acids 2-35 of SEQ ID NO: 63; amino acids 5-35 of SEQ ID NO: 63; amino acids 8-35 of SEQ ID NO: 63; amino acids 10-35 of SEQ ID NO: 63; or amino acids 15-35 of SEQ ID NO: 63.
  • the targeting sequence can comprise amino acids 1-24 of SEQ ID NO: 65; acids 9-24 of SEQ ID NO: 65; SEQ ID NO: 65; or SEQ ID NO: 107; or the exosporium protein can comprise full length B. thuringiensis str. Al Hakam hypothetical protein BALH_2230 (SEQ ID NO: 66).
  • the targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 65; or amino acids 5-24 of SEQ ID NO: 65.
  • the targeting sequence can comprise acids 1-27 of SEQ ID NO: 67; amino acids 12-27 of SEQ ID NO: 67; or SEQ ID NO: 67; or the exosporium protein can comprise full length B. cereus ATCC 14579 triple helix repeat-containing collagen (SEQ ID NO: 68).
  • the targeting sequence can comprise amino acids 2-27 of SEQ ID NO: 67; amino acids 5-27 of SEQ ID NO: 67; or amino acids 10-27 of SEQ ID NO: 67.
  • the targeting sequence can comprise amino acids 1-38 of SEQ ID NO: 69; amino acids 23-38 of SEQ ID NO: 69; or SEQ ID NO: 69; or the exosporium protein can comprise full length B. cereus collagen triple helix repeat (SEQ ID NO: 70).
  • the targeting sequence can comprise amino acids 2-38 of SEQ ID NO: 69; amino acids 5-38 of SEQ ID NO: 69; amino acids 10-38 of SEQ ID NO: 69; or amino acids 15-38 of SEQ ID NO: 69.
  • the exosporium protein can comprise full length B. cereus ATCC 14579 triple helix repeat-containing collagen (SEQ ID NO: 72).
  • the targeting sequence can comprise SEQ ID NO: 73, or the exosporium protein can comprise full length B. cereus E33L hypothetical protein BCZK1835 (SEQ ID NO: 74).
  • the targeting sequence can comprise amino acids 1-42 of SEQ ID NO: 75; amino acids 27-42 of SEQ ID NO: 75; or SEQ ID NO: 75; or the exosporium protein can comprise full length B. weihenstephanensis KBAB4 triple helix repeat-containing collagen (SEQ ID NO: 76).
  • the targeting sequence can comprise amino acids 2-42 of SEQ ID NO: 75; amino acids 5-42 of SEQ ID NO: 75; amino acids 10-42 of SEQ ID NO: 75; amino acids 15-42 of SEQ ID NO: 75; amino acids 20-42 of SEQ ID NO: 75; or amino acids 25-42 of SEQ ID NO: 75.
  • the targeting sequence can comprise amino acids 1-24 of SEQ ID NO: 77; amino acids 9-24 of SEQ ID NO: 77; or SEQ ID NO: 77; or the exosporium protein can comprise full length B. cereus ATCC 14579 triple helix repeat-containing collagen (SEQ ID NO: 78).
  • the targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 77; or amino acids 5-24 of SEQ ID NO: 77;
  • the exosporium protein can comprise full length B. cereus ATCC 14579 hypothetical protein BC4725 (SEQ ID NO: 80).
  • the targeting sequence can comprise amino acids 1-38 of SEQ ID NO: 81; amino acids 23-38 of SEQ ID NO: 81; or SEQ ID NO: 81; or the exosporium protein can comprise full length B. cereus E33L hypothetical protein BCZK4476 (SEQ ID NO: 82).
  • the targeting sequence can comprise amino acids 2-38 of SEQ ID NO: 81; acids 5-38 of SEQ ID NO: 81; amino acids 10-38 of SEQ ID NO: 81; amino acids 15-38 of SEQ ID NO: 81; or amino acids 20-38 of SEQ ID NO: 81.
  • the targeting sequence can comprise amino acids 1-34 of SEQ ID NO: 83; or SEQ ID NO: 83; or the exosporium protein can comprise full length B. anthracis str. ‘Ames Ancestor’ triple helix repeat-containing collagen (SEQ ID NO: 84).
  • the exosporium protein can comprise full length B. thuringiensis serovar konkukian str. 97-27 BclA protein (SEQ ID NO: 86).
  • the targeting sequence can comprise amino acids 1-28 of SEQ ID NO: 87; amino acids 13-28 of SEQ ID NO: 87; or SEQ ID NO: 87; or the exosporium protein can comprise full length B. cereus ATCC 10987 conserved hypothetical protein (SEQ ID NO: 88).
  • the targeting sequence can comprise amino acids 2-28 of SEQ ID NO: 87; amino acids 5-28 of SEQ ID NO: 87; or amino acids 10-28 of SEQ ID NO: 87.
  • the targeting sequence can comprise amino acids 1-28 of SEQ ID NO: 89; or SEQ ID NO: 89; or the exosporium protein can comprise full length B. cereus ATCC 14579 triple helix repeat-containing collagen (SEQ ID NO: 90).
  • the targeting sequence can comprise amino acids 2-28 of SEQ ID NO: 89; amino acids 5-28 of SEQ ID NO: 89; or amino acids 10-28 of SEQ ID NO: 89
  • the targeting sequence can comprise amino acids 1-93 of SEQ ID NO: 91; or SEQ ID NO: 91; or the exosporium protein can comprise B. cereus exosporium leader peptide partial sequence (SEQ ID NO: 92).
  • the targeting sequence can comprise amino acids 2-93 of SEQ ID NO: 91; amino acids 10-93 of SEQ ID NO: 91; amino acids 20-93 of SEQ ID NO: 91; amino acids 30-93 of SEQ ID NO: 91; amino acids 40-93 of SEQ ID NO: 91; amino acids 50-93 of SEQ ID NO: 91; or amino acids 60-93 of SEQ ID NO: 91.
  • the targeting sequence can comprise amino acids 1-130 of SEQ ID NO: 93; or SEQ ID NO: 93; or the exosporium protein can comprise B. weihenstephanensis ) hypothetical protein ER45_27600, partial sequence (SEQ ID NO: 94).
  • the targeting sequence can comprise amino acids 2-130 of SEQ ID NO: 93; amino acids 10-130 of SEQ ID NO: 93; amino acids 20-130 of SEQ ID NO: 93; or amino acids 30-130 of SEQ ID NO: 93.
  • amino acids 20-35 of BclA can be used to target a fusion protein to the exosporium of a recombinant Bacillus cereus family member.
  • amino acids 20-33 of BclA, amino acids 20-31 of BclA, amino acids 21-33 of BclA, or amino acids 23-31 of BclA can be used to target a fusion protein to the exosporium of a recombinant Bacillus cereus family member.
  • the targeting sequence can consist of amino acids 20-33 of SEQ ID NO: 1, amino acids 20-31 of SEQ ID NO: 1, amino acids 21-33 of SEQ ID NO: 1, or amino acids 23-31 of SEQ ID NO: 1.
  • the corresponding regions of any of the SEQ ID NOs. shown in FIGS. 1A and 1B can also be used to target a fusion protein to the exosporium of a recombinant Bacillus cereus family member.
  • corresponding regions it is meant that when the sequences are aligned with SEQ ID NO: 1, as shown in FIGS. 1A and 1B , the regions of the other amino acid sequences that align with the amino acids of SEQ ID NO: are the “corresponding regions” of those sequences.
  • amino acids 12-25 of SEQ ID NO: 3, amino acids 23-36 of SEQ ID NO: 5, amino acids 13-26 of SEQ ID NO: 7, etc. can be used to target a fusion protein to the exosporium of a recombinant Bacillus cereus family member, since these regions align with amino acids 20-33 of SEQ ID NO: 1 as shown in FIG. 1A .
  • additional amino acids can be added to the amino-terminus, the carboxy terminus, or both the amino- and carboxy termini to create a targeting sequence that will be effective for targeting a fusion protein to the exosporium of a recombinant Bacillus cereus family member.
  • FIGS. 1A and 1B list the percent identity of each of corresponding amino acids of each sequence to amino acids 20-35 of BclA (“20-35% Identity”) and to amino acids 25-35 of BclA (“25-35% Identity”).
  • the corresponding amino acids of BetA/BAS3290 are about 81.3% identical
  • the corresponding amino acids of BAS4623 are about 50.0% identical
  • the corresponding amino acids of BclB are about 43.8% identical
  • the corresponding amino acids of BAS1882 are about 62.5% identical
  • the corresponding amino acids of the KBAB4 2280 gene product are about 81.3% identical
  • the corresponding amino acids of the KBAB4 3572 gene product are about 81.3% identical.
  • the sequence identities over this region for the remaining sequences are listed in FIGS. 1A and 1B .
  • the corresponding amino acids of BetA/BAS3290 are about 90.9% identical
  • the corresponding amino acids of BAS4623 are about 72.7% identical
  • the corresponding amino acids of BclB are about 54.5% identical
  • the corresponding amino acids of BAS1882 are about 72.7% identical
  • the corresponding amino acids of the KBAB4 2280 gene product are about 90.9% identical
  • the corresponding amino acids of the KBAB4 3572 gene product are about 81.8% identical.
  • the sequence identities over this region for the remaining sequences are listed in FIGS. 1A and 1B .
  • the targeting sequence can comprise an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%.
  • the targeting sequence can also comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.
  • the targeting sequence can also comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.
  • the targeting sequence can also comprise an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.
  • the targeting sequence can comprise an amino sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.
  • the targeting sequence can also consist of an amino acid sequence consisting of 16 amino acids and having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO:1 is at least about 72%.
  • the targeting sequence can comprise an amino acid sequence having at least 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.
  • the targeting sequence can also comprises an amino sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO:1 is at least about 72%.
  • the targeting sequence can also comprise an amino sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO:1 is at least about 81%.
  • the targeting sequence can also comprise an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO:1, wherein the identity with amino acids 25-35 is at least about 81%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 81% identity with amino acids 20-35 of SEQ ID NO:1, wherein the identity with amino acids 25-35 is at least about 81%.
  • the targeting sequence can comprise an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.
  • the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.
  • targeting sequences can also be used as targeting sequences, so long as the targeting sequence comprises amino acids 20-35 of BclA, the corresponding amino acids of BetA/BAS3290, BAS4263, BclB, BAS1882, the KBAB4 2280 gene product, or the KBAB 3572 gene product, or a sequence comprising any of the above noted sequence identities to amino acids 20-35 and 25-35 of BclA is present.
  • Certain Bacillus cereus family exosporium proteins which lack regions having homology to amino acids 25-35 of BclA can also be used to target a peptide or protein to the exosporium of a Bacillus cereus family member.
  • the fusion proteins can comprise an exosporium protein comprising SEQ ID NO: 108 ( B. mycoides InhA), an exosporium protein comprising SEQ ID NO: 109 ( B. anthracis Sterne BAS1141 (ExsY)), an exosporium protein comprising SEQ ID NO: 110 ( B. anthracis Sterne BAS1144 (BxpB/ExsFA)), an exosporium protein comprising SEQ ID NO: 111 ( B.
  • anthracis Sterne BAS1145 (CotY)), an exosporium protein comprising SEQ ID NO: 112 ( B. anthracis Sterne BAS1140), an exosporium protein comprising SEQ ID NO: 113 ( B. anthracis H9401 ExsFB), an exosporium protein comprising SEQ ID NO: 114 ( B. thuringiensis HD74 InhA1), an exosporium protein comprising SEQ ID NO: 115 ( B. cereus ATCC 10876 ExsJ), an exosporium protein comprising SEQ ID NO: 116 ( B. cereus ExsH), an exosporium protein comprising SEQ ID NO: 117 ( B.
  • anthracis Ames YjcA
  • an exosporium protein comprising SEQ ID NO: 118 B. anthracis YjcB
  • an exosporium protein comprising SEQ ID NO: 119 B. anthracis Sterne BclC
  • an exosporium protein comprising SEQ ID NO: 120 Bacillus thuringiensis serovar konkukian str. 97-27 acid phosphatase
  • an exosporium protein comprising SEQ ID NO: 121 B. thuringiensis HD74 InhA2
  • an exosporium protein comprising SEQ ID NO: 122 B. mycoides InhA3
  • Inclusion of an exosporium protein comprising any of SEQ ID NOs: 108-122 in the fusion proteins described herein will result in targeting to the exosporium of a B. cereus family member.
  • exosporium proteins having a high degree of sequence identity with any of the full-length exosporium proteins or the exosporium protein fragments described above can also be used to target a peptide or protein to the exosporium of a Bacillus cereus family member.
  • the fusion protein can comprise an exosporium protein or exosporium protein fragment comprising an amino acid sequence having at least 85% identity with any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.
  • the fusion protein can comprise an exosporium protein having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.
  • the targeting motif, exosporium protein, or exosporium protein fragment is recognized by the spore exosporium assembly machinery and directed to the exosporium, resulting in display of the protein or peptide of interest portion of the fusion protein on the outside of the spore.
  • the use of different targeting sequences allows for control of the expression level of the fusion protein on the surface of the Bacillus cereus family member spore.
  • Use of certain of the targeting sequences described herein will result in a higher level of expression of the fusion protein, whereas use of others of the targeting sequences will result in lower levels of expression of the fusion protein on the surface of the spore.
  • the targeting sequence, exosporium protein, or exosporium protein fragment can comprise the amino acid sequence GXT at its carboxy terminus, wherein X is any amino acid.
  • the targeting sequence, exosporium protein, or exosporium protein fragment can comprise an alanine residue at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.
  • the targeting sequence, exosporium protein, or exosporium protein fragment can further comprise a methionine, serine, or threonine residue at the amino acid position immediately preceding the first amino acid of the targeting sequence, exosporium protein, or exosporium protein fragment or at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.
  • the present invention relates to fusion proteins comprising at least one protein or peptide of interest and a targeting sequence or exosporium protein.
  • the fusion protein can comprise: (1) a targeting sequence comprising amino acids 1-30 of SEQ ID NO: 59; (2) a targeting sequence comprising SEQ ID NO: 59; (3) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 60; (4) a targeting sequence comprising amino acids 2-30 of SEQ ID NO: 59; (5) a targeting sequence comprising amino acids 4-30 of SEQ ID NO: 59; (6) a targeting sequence comprising amino acids 6-30 of SEQ ID NO: 59; (7) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 61; (8) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 61; (9) a targeting sequence comprising SEQ ID NO: 61; (10) an exosporium protein comprising an amino acids 1-30 of SEQ ID NO: 59; (2) a targeting
  • the fusion protein can comprise: (1) a targeting sequence comprising amino acids 2-30 of SEQ ID NO: 59; (2) a targeting sequence comprising amino acids 4-30 of SEQ ID NO: 59; (3) a targeting sequence comprising amino acids 6-30 of SEQ ID NO: 59; (4) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 61; (5) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 61; (6) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 61; (7) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 61; (8) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 63; (9) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 63; (10) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 63; (11) a targeting sequence comprising amino acids 10-35 of SEQ ID NO:
  • the fusion protein can comprise: (1) a targeting sequence consisting of amino acids 20-33 of SEQ ID NO: 1; (2) a targeting sequence consisting of amino acids 21-33 of SEQ ID NO: 1; (3) a targeting sequence consisting of amino acids 23-31 of SEQ ID NO: 1; (4) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 96; (5) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 96; (6) a targeting sequence consisting of amino acids 12-25 of SEQ ID NO: 3; (7) a targeting sequence consisting of amino acids 13-25 of SEQ ID NO: 3; (8) a targeting sequence consisting of amino acids 15-23 of SEQ ID NO: 3; (9) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 97; (10) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 98; (11) a targeting sequence consisting of amino acids 20-33 of SEQ ID NO: 1; (2) a targeting sequence consisting of amino acids
  • the present invention relates to fusion proteins comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment.
  • the protein or peptide of interest can be an enzyme that catalyzes the production of nitric oxide or a nucleic acid binding protein or peptide.
  • the targeting sequence, exosporium protein, or exosporium protein fragment can be any targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member.
  • the targeting sequence exosporium protein or exosporium protein fragment can be any of the targeting sequences, exosporium proteins, or exosporium protein fragments listed above in paragraphs [00166]-[00168] for use with any protein or peptide of interest or: (1) a targeting sequence comprising an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%; (2) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; (3) a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; (4) a targeting sequence comprising SEQ ID NO: 1; (5) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 2; (6) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 1; (7) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 1; (8) a targeting sequence comprising amino acids 8-35 of SEQ ID NO:
  • the targeting sequence, exosporium protein, or exosporium protein fragment can be: (1) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 1; (2) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 1; (3) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 1; (4) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 1; (5) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 1; (6) a targeting sequence comprising amino acids 2-27 of SEQ ID NO: 3; (7) a targeting sequence comprising amino acids 5-27 of SEQ ID NO: 3; (8) a targeting sequence comprising amino acids 8-27 of SEQ ID NO: 3; (9) a targeting sequence comprising amino acids 10-27 of SEQ ID NO: 3; (10) a targeting sequence comprising amino acids 2-38
  • a fusion protein which comprises an antigen or a remediation enzyme and a targeting sequence or exosporium protein.
  • the targeting sequence or exosporium protein can comprise any of the targeting sequences or exosporium proteins listed above in paragraphs [00166]-[00168] for use with any protein or peptide of interest or: (1) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 1; (2) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 1; (3) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 1; (4) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 1; (5) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 1; (6) a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; (7) a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; (8) a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; (9) a targeting sequence comprising amino acids 2-27 of
  • a fusion protein which comprises an enzyme suitable for breaking an emulsion or gel in a hydraulic fracturing fluid or an antibacterial protein or peptide and a targeting sequence, exosporium protein, or exosporium protein fragment.
  • the targeting sequence, exosporium protein, or exosporium protein fragment can comprise any of the targeting sequences or exosporium proteins listed above in paragraphs [00166]-[00168] for use with any protein or peptide of interest or: (1) a targeting sequence comprising an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%; (2) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; (3) a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; (4) a targeting sequence comprising SEQ ID NO: 1; (5) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 2; (6) a targeting sequence comprising
  • the targeting sequence or exosporium protein comprises any of the targeting sequences or exosporium proteins listed above in paragraph [00167] for use with any protein or peptide of interest or: (1) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 1; (2) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 1; (3) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 1; (4) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 1; (5) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 1; (6) a targeting sequence comprising amino acids 2-27 of SEQ ID NO: 3; (7) a targeting sequence comprising amino acids 5-27 of SEQ ID NO: 3; (8) a targeting sequence comprising amino acids 8-27 of SEQ ID NO:
  • the targeting sequence or exosporium protein comprises any of the targeting sequences or exosporium proteins listed above in paragraph [00167] for use with any protein or peptide of interest or: (1) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 9; (2) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 9; (3) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 9; (4) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 11; (5) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 11; (6) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 11; (7) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 11; (8) a targeting sequence comprising amino acids 15-33 of SEQ ID NO:
  • the targeting sequence or exosporium protein comprises: (1) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 9; (2) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 9; (3) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 11; (4) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 11; (5) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 11; (6) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 11; (7) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 13; (8) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 13; (9) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 13; (10) a targeting sequence comprising
  • the protein or peptide of interest of the fusion protein described above can comprise an antigen.
  • the protein or peptide of interest of the fusion protein described above can comprise a remediation enzyme.
  • the protein or peptide of interest of the fusion protein described above can comprise an enzyme suitable for breaking an emulsion or gel in a hydraulic fracturing fluid.
  • the protein or peptide of interest of the fusion protein described above can comprise an antibacterial protein or peptide.
  • the present invention further relates to recombinant Bacillus cereus family members that express a fusion protein.
  • the fusion protein can be any of the fusion proteins described above in Section I.B.
  • Recombinant Bacillus cereus family members that express the fusion proteins described herein display the protein or peptide of interest portion of the fusion protein on the outside of their spores. It has been found that overexpression of certain exosporium proteins (referred to herein as “modulator proteins”) in a recombinant Bacillus cereus family member that also expresses a fusion protein allows for modulation (i.e., increasing or decreasing) the expression level of the fusion protein, thereby increasing or decreasing the amount of the protein or peptide of interest that is displayed on the outside of the spore.
  • modulator proteins certain exosporium proteins
  • the ability to the control the amount of the protein or peptide of interest that is displayed on the outside of the spore is beneficial, since in some cases, it will be desirable to increase the amount of the protein or peptide of interest that is displayed.
  • the protein of interest is an enzyme that degrades a plant nutrient source
  • it will be desirable to decrease the amount of the protein or peptide of interest that is displayed it will be desirable to decrease the amount of the protein or peptide of interest that is displayed.
  • the protein or peptide of interest comprises a plant immune system enhancer protein or peptide
  • the recombinant Bacillus cereus family members that express a modulator protein can be used in any of the various fields and methods described herein, and for any of the uses described herein.
  • the recombinant Bacillus cereus family members that express a modulator protein can be used in methods for stimulating plant growth; methods for protecting a plant from a pathogen; methods for enhancing stress resistance in plants; methods for immobilizing recombinant Bacillus cereus family member spores on plants; methods for stimulating germination of a plant seed; methods for delivering nucleic acids to a plant; methods for delivering nucleic acids to animals, insects, worms (e.g., nematodes), fungi, or protozoans; methods for delivering enzymes to a plant; methods for altering a property of a plant; methods for delivering proteins or peptides to an animal; vaccines and methods of producing an immunogenic response in a subject; methods for reducing contaminants in an environment
  • proteins e.g., enzymes
  • a biological response curve wherein an optimal concentration of a protein or enzyme leads to the desired effect, and an excess of the protein or too small of an amount of the protein leads to undesirable or diminished effects.
  • a biological drug such as the protein drug insulin for diabetes treatment
  • the protein or peptide of interest comprises a protein or peptide involved in direct signaling in plants, such as the flagellin peptide flg22, and the recombinant Bacillus cereus family member expressing the fusion protein is to be applied to a plant to provide a beneficial effect to the plant.
  • Such modulation would be beneficial to avoid a signaling response that is great enough that it would lead to detrimental responses to the plant (e.g., too great of a response to flg22 can result in necrosis), or a signaling response that is low enough that it would yield a poor or insufficient response to the peptide.
  • a biological response curve would also be relevant for recombinant Bacillus cereus family members expressing a fusion protein wherein the protein or peptide of interest comprises an antigen. In such cases, it would be desirable to modulate the expression level of the fusion protein comprising the antigen to achieve an optimal range for generating a proper immune response in an animal. Too large of a dose could lead to injection site edema and unwanted inflammation, whereas too small of a dose could lead to insufficient vaccination or immune response.
  • Modulation of the expression level of a fusion protein on the exosporium of a recombinant Bacillus cereus family member also provides benefits, for example, when the recombinant Bacillus cereus family member is used for breaking an emulsion or gel in a hydraulic fracturing fluid.
  • Polysaccharide gels are frequently used in the hydraulic fracturing processing gels. These gels require breaking.
  • the operator will desire that the break, which is an enzymatic reaction, happen at a particular optimized rate. Breaking the gel too quickly can lead to undesired side effects such as pooling of undigested gel fragments. On the other hand, breaking the gel too slowly leads to long wait times and increased expense.
  • the enzyme levels on the exosporium of a recombinant Bacillus cereus family member expressing a fusion protein comprising an enzyme suitable for breaking an emulsion or gel in a hydraulic fracturing fluid can be modulated to ensure that an optimized level of enzyme is present for breaking gels, leading to preferred results when used in the field.
  • a recombinant Bacillus cereus family member that expresses: (i) a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member; and (ii) a modulator protein, wherein the expression of the modulator protein is increased as compared to expression of the modulator protein in a wild-type Bacillus cereus family member under the same conditions.
  • the modulator protein when co-expressed with the fusion protein in the recombinant Bacillus cereus family member, results in increased or decreased expression of the fusion protein as compared to the expression level of the fusion protein in a recombinant Bacillus cereus family member that does not express the modulator protein at an increased level under the same conditions as compared to the expression of the modulator protein in a wild-type Bacillus cereus family member.
  • the modulator protein can comprise an ExsY protein, an ExsFA/BxpB protein, a CotY protein, a CotO protein, an ExsFB protein, an InhA1 protein, an InhA2 protein, an ExsJ protein, an ExsH protein, a YjcA protein, a YjcB protein, a BclC protein, an AcpC protein, an InhA3 protein, an alanine racemase 1, an alanine racemase 2, a BclA protein, a BclB protein, a BxpA protein, a BclE protein, a BetA/BAS3290 protein, a CotE protein, an ExsA protein, an ExsK protein, an ExsB protein, a YabG protein, a Tgl protein, a SODA1 protein, a SODA2 protein, a variant of any thereof, or a combination of any thereof.
  • the modulator protein when co-expressed in the recombinant Bacillus cereus family member with the fusion protein, results in increased expression of the fusion protein as compared to the expression level of the fusion protein in a recombinant Bacillus cereus family member that does not express the modulator protein at an increased level under the same conditions as compared to the expression of the modulator protein in a wild-type Bacillus cereus family member.
  • the modulator protein when co-expressed in the recombinant Bacillus cereus family member with the fusion protein, results in such increased expression of the fusion protein, the modulator protein can comprise a BclB protein, a CotE protein, a BxpB protein, a CotO protein, a BclA protein, a variant of any thereof, or a combination of any thereof
  • the modulator protein when co-expressed in the recombinant Bacillus cereus family member with the fusion protein, results in decreased expression of the fusion protein as compared to the expression level of the fusion protein in a recombinant Bacillus cereus family member that does not express the modulator protein at an increased level under the same conditions as compared to the expression of the modulator protein in a wild-type Bacillus cereus family member.
  • the modulator protein when co-expressed in the recombinant Bacillus cereus family member with the fusion protein, results in such decreased expression of the fusion protein, the modulator protein can comprise a BclC protein, an ApcC protein, a YjcB protein, a variant of any thereof, or a combination of any thereof.
  • the modulator protein can comprise a CotO protein, a BclB protein, an ExsFA/BxpB protein, a YjcB protein, a variant of any thereof, or a combination of any thereof.
  • modulator proteins have homologs, paralogs, or genetic rearrangements. Thus, many proteins that have at least 70% homology to any of the modulator sequences listed above in Table 2 will retain the ability to act as modulator proteins when overexpressed in a recombinant Bacillus cereus family member that also expresses any of the fusion proteins described herein. In addition, many of the modulator proteins (e.g., BclA, BclB, and BclE) have internal repeat regions that can differ significantly between strains.
  • the modulator protein can comprise an amino acid sequence having at least 70% sequence identity with any of SEQ ID NOs: 123-156.
  • the modulator protein can comprise an amino acid sequence having at least 75% sequence identity with any of SEQ ID NOs: 123-156.
  • the modulator protein can comprise an amino acid sequence having at least 85% sequence identity with any of SEQ ID NOs: 123-156.
  • the modulator protein can comprise an amino acid sequence having at least 90% sequence identity with any of SEQ ID NOs: 123-156.
  • the modulator protein can comprise an amino acid sequence having at least 95% sequence identity with any of SEQ ID NOs: 123-156.
  • the modulator protein can comprise an amino acid sequence having at least 98% sequence identity with any of SEQ ID NOs: 123-156.
  • the modulator protein can comprise an amino acid sequence having at least 99% sequence identity with any of SEQ ID NOs: 123-156.
  • the modulator protein can comprise an amino acid sequence having 100% sequence identity with any of SEQ ID NOs: 123-156.
  • the modulator protein can comprise SEQ ID NO: 124, 126, 134, 135, 143, or 144.
  • the recombinant Bacillus cereus family members that express a modulator protein can comprise a vector encoding the modulator protein.
  • the vector can comprise a multicopy plasmid. Multicopy plasmids allow for high expression levels of the modulator protein.
  • the DNA encoding the fusion protein is suitably under the control of a sporulation promoter which will cause expression of the fusion protein on the exosporium of a B. cereus family member endospore (e.g., a native bclA promoter from a B. cereus family member).
  • a sporulation promoter which will cause expression of the fusion protein on the exosporium of a B. cereus family member endospore (e.g., a native bclA promoter from a B. cereus family member).
  • any of the fusion proteins described above in Section 1.B can be expressed in the recombinant Bacillus cereus family member under the control of a sporulation promoter that is native to the targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein, or a portion of such a promoter.
  • any of the modulator proteins described above in Section II can be expressed under the control of its native promoter or a portion thereof.
  • any of the fusion proteins or modulator proteins can be expressed under the control of a high-expression sporulation promoter.
  • the high-expression sporulation promoter comprises a sigma-K sporulation-specific polymerase promoter sequence.
  • exemplary nucleotide sequences for promoters that can be used to express any of the fusion proteins or any of the modulator proteins in a recombinant Bacillus cereus family member are provided in Table 3 below, together with their SEQ ID NOs.
  • Table 3 also provides exemplary minimal promoter sequences for many of the promoters.
  • sigma-K sporulation-specific polymerase promoter sequences in the promoters are indicated by bold and underlined text.
  • Several of the sequences have multiple sigma K sequences that overlap with one another. The overlaps are indicated by double underlining in the table.
  • the promoter sequences are immediately upstream of the start codon for each of the indicated genes. In other words, in the sequences shown in Table 3 below, the last nucleotide of the promoter sequence immediately precedes the first nucleotide of the start codon for the coding region of the gene encoding the indicated protein.
  • anthracis AAAGGAGTGAAAAAC Sterne) (SEQ ID NO: 160) CotY/CotZ promoter TAGAAGAAGAACGCCGACTACTTTATGTCGCAATTACACGGGC ( B. anthracis Sterne) GAAAGAAGAACTTTACATTTCCTCTCCGCAATTTTTTAGAGGA (SEQ ID NO: 161) AAAAAATTAGATATATCTCGTTTTTTATACACTGTGCGAAAAG ATTTACCTGAAAAGACATCCACTAAATAAGGATGTCTTTTTTTA TATTGTATTATGTACATCCCTACTATATAAATTCCCTGCTTTTAT CGTAAGAATTAACGTAATATCAACCATATCCCGTT CATATTGT A GTAGTGTATGTCAGAACTCACGAGAAGGAGTGAACATA CotY/CotZ minimal TCAACCATATCCCGTT CATATTGTA GTAGTGTATGTCAGAACT promoter CACGAGAAGGAGTGAACATA ( B.
  • anthracis Sterne CotO promoter TAACTCAATCTTAAGAGAAATTGAGGAGCGCACCACTTCGT ( B. cereus ) CGTACAACAACGCAAGAAGAAGTTGGGGATACAGCAGTATTCT (SEQ ID NO: 163) TATTCAGTGATTTAGCACGCGGCGTAACAGGAGAAAACATTCA CGTTGATTCAGGGTAT CATATCTTA GGATA AATATAATA TTAA TTTTAAAGGACAATCTCTACATGTTGAGATTGTCCTTTTTATTT GTTCTTAGAAAGAACGATTTTTAACGAAAGTTCTTACCACGTTA TGAATATAAGTATAATAGTACACGATTTATTCAGCTACGT CotO minimal promoter ACGTTGATTCAGGGTAT CATATCTTA GGATA AATATAATA TTA ( B.
  • GCTCTTTTTATTTGGTTTTCTTTCATTTCTAAATAACATTTTCAA (SEQ ID NO: 165) CTCTATTCATACTATTCTTTCAACTTTAGGTTACAAACTATTTCT GTAAGCGTAGTGTTTCTTTTGTACTATAGGCAGTTAGTTTTATC CATAACAGTACACCTCTGCACTATTCACTATAAATTTT CATATA TT A TATTGTGCTTGTCCAAAACATGTGGTTATTACTCACGCGAT CTAAATGAAAGAAAGGAGTGAAAAT ExsFB minimal promoter ACTATTCACTATAAATTTT CATATATTA TATTGTGCTTGTCCAA ( B.
  • AAACACTCAACTATAAGAAAAGTAAGGAGGAAATAA serovar kurstaki (SEQ ID NO: 172) ExsH promoter ATATGCTAATGCTTAGTTTTTATACTCAAGTTAAAATGTGCTTT ( B.
  • AATTATCGTTCATGTTTCCTATTTTAAGCAGAACAAATAACTCA (SEQ ID NO: 174) ATTACTTTTTTCGATTGGATCTTTTTTAACTCTTATAATAGGAA AACACTCAACTATAAAAATAAGTAAGGAGGAAATAA YjcA promoter TATAAAATAAAAGGGCGTGTATTTGCTACTGATGCAGTATTGT ( B. thuringiensis serovar GTGCGCCTAAAAATGGAATTTCACAACCAGATCCACATGTTGT kurstaki str.
  • GTTAGTGCTTTTTTATTAGTTTTATATAATTGGATTCCGATCGTT (SEQ ID NO: 177) GCAGAGCCGTTACTTGCATTATTAGCTATTGCAGGAGCAGCAG CAATCATTGAAACGATTACAG GATATTTTA TGGGAG AATAAT ATA TTTTCATAATACGAGAAAAAGCGGAGTTTAAAAGAATGAG GGAACGGAAATAAAGAGTTGTT CATATAGTA AATAGACAGAA YjcB minimal promoter ACGGAAATAAAGAGTTGTT CATATAGTA AATAGACAGAA ( B. thuringiensis serovar kurstaki str.
  • CATTCTCATTAGAAAGGAGAGATTTA (SEQ ID NO: 180) AcpC promoter GACTATGTTTATTCAG GATAAAATA TAGCACTACACTCTCTCCT ( B. cereus F837/76) CTTATTATGTAGCATCTCTCTAATCCATCATTTGTTTCATTTAGT (SEQ ID NO: 181) TAAAATTGTAAATAAAATCACATGATTTGTCAATTATAATTGTC ATTTCGACAATTAAACTTGTCAAAATAATTCTCATCATTTTTTC TCATCTTTCTAATATAGGACATACTACTATATATACAAAAGAC AATATGCAAATGTT CATACAAAA AATATTATTTTTCGA TATAT AATA TTAACTGATTTTCTAACATCAAGGAGGGTACAT AcpC minimal promoter AGACAATATGCAAATGTT CATACAAAA AATATTATTTTTCGA T ( B.
  • AAATTGTTCAAGTAGTTTAAGATTTCTTTTCAATAATTCAAATG (SEQ ID NO: 190) TCCGTGTCATTTTCTTTCGGTTTTG CATCTACTA TATAATGAAC GCTTTATGGAGGTGAATTT BclB promoter ( B. GACCTGTAAGTCTGTAGGGAAGAATAATTTCAAGAGCCAGTGA thuringiensis serovar TAATAGATTTTTTTGTTTTTTCATTCTTATCTTGAATATAAATCA konkukian str.
  • TTTAA 97-27 (SEQ ID NO: 192) BxpA promoter TTTT CATCTGCTA CATCGTGAAGTAATGCTGCCATTTCAATTAT ( B. anthracis AAAACGATTTCCTCCTTCTTGCTCGGATAAAGAAATCGCCAGTT str.
  • GGTGACGACAA CATATACAA GAGGCACTCCTGCTGGTACTGTA anthracis ⁇ Sterne) ACAGGAACAAATATGGGGCAAAGTGTAAATA CATCGGGTA TA (SEQ ID NO: 195) GCACAAGCTGTCCCGAATACA GATAATATG GATTCAACGGCG GGACTCCCTTAAGAAATTAGGGGAGTCTTTATTTGGAAAAAGA GCTTATGTTACATAAAAACAGGAGTAATTGTTTTAAAAGTAGT ATTGGTGACGTTGTTAGAAAATACAATTTAAGTAGAAGGTGCG TTTTTATATGA AATATATTT TATAGCTGTACTTTACCTTTCAAG BclE minimal promoter ACAAGCTGTCCCGAATACA GATAATATG GATTCAACGGCGGG ( B .anthracis ⁇ Sterne) ACTCCCTTAAGAAATTAGGGGAGTCTTTATTTGGAAAAAGAGC (SEQ ID NO: 196) TTATGTTACATAAAAACAGGAGTAATTGTTTTA
  • AAAAAGCACCTCTCATTAATTTATATTATAGTCATTGAAATCTA (SEQ ID NO: 197) ATTTAATGAAATCAT CATACTATA TGTTTTATAAGAAGTAAAG GTAC CATACTTA A TTAATACATATCTATACACTTCAATATCAC AGCATGCAGTTGAATTATATCCAACTTTCATTTCAAATTAAATA AGTGCCTCCGCTATTGTGAATGTCATTTACTCTCCCTACTA CAT TTAATA ATTATGACAAGCAATCATAGGAGGTTACTAC BetA minimal promoter TAAGAAGTAAAGGTAC CATACTTA A TTAATACATATCTATACA ( B.
  • AGAGTATAAGAAAGATATTGATATTTACCATTTAGCATCAGAG (SEQ ID NO: 203) ATGGTCATTGATGGTATTGTTCATCCAAACAATTTAAGAGAAG AGTTAAAAGGACGATTCGAAATGTATATGAGTAAATATCAAGT ATTTACGGATCGTAAA CATCCTGTT TATCCAGTTTAAAAGCCC TATTTAGGGCTTTCTTGCTCAAAAAGTTAAGGAGGGGAAAACA ExsK minimal promoter ( B. TCAAGTATTTACGGATCGTAAA CATCCTGTT TATCCAGTTTAA thuringiensis serovar AAGCCCTATTTAGGGCTTTCTTGCTCAAAAAGTTAAGGAGGGG konkukian str.
  • AAAACA (SEQ ID NO: 204) ExsB promoter AGGATTTCAGTGGGACGCCTCCTCTCTTCTTACATTAAATTAAT ( B. cereus F837/76) CATACTATA AAATGAAAGAAATGAAATGAAAAATAGCGGAAA (SEQ ID NO: 205) AATCAGAAATTTTTTCTGGTAG TATACAATATGTTA CAATAAG CTTTGTCAATGAAAGAAGGAATTCCGTGCAATGCACGGGAGAG GTTCGCGAACTCCCTCTATAAAAAACTATGGAAACAAC AATAT CTTT AGGTATTGTTTTGTTTTTTTATTGTGACAGTTCAAGAACG TTCTTTCTTCTTATTCGTAGTAGAGAAGGAGAATGAGTGAA ExsB minimal promoter ACTATGGAAACAAC AATATCTTT AGGTATTGTTTTGTTTTTA ( B.
  • AACTTTCCATTTTTTTAAATTGTTCAAGTAGTTTAAGATTTCTT (SEQ ID NO: 215) TTCAATAATTCAAATGTCCGTGTCATTTTCTTTCGGTTTTG CAT CTACTA TATAATGAACGCTTTATGGAGGTGAATTT BAS1882 promoter ( B.
  • AAAGCTAACTGCTTTTTTATTAAATAACTATTTTATTAAATTTC (SEQ ID NO: 216) ATATATACAATCGCTTGTCCATTTCATTTGGCTCTACCCACG CA TTTACTA TTAGTAATATGAATTTTTCAGAGGTGGATTTTATT Gene 3572 promoter CTATGATTTAAGATACACAATAGCAAAAGAGAAA CATATTAT ( B.
  • ATGTAAATACAAACAAGAAGATAAGGA (SEQ ID NO: 220) CotY promoter AGGATGTCTTTTTTTATATTGTATTATGTACATCCCTACTATATA ( B. thuringiensis AATTCCCTGCTTTTATCGTAAGAATTAACGTAATATCAACCATA Al Hakam) TCCCGTT CATATTGTA GTAGTGTATGTCAGAACTCACGAGAAG (SEQ ID NO: 221) GAGTGAACATAA YjcA promoter TTAATGTCACTCCTTATCTTCTTGTTTGTATTTACATT AATAAG ( B.
  • the sigma-K sporulation-specific polymerase promoter sequences in the promoter sequences shown in Table 3 result in high expression levels of the fusion protein or modulator protein during late sporulation.
  • the consensus sequence for the sigma-K sporulation-specific polymerase promoter sequence is CATANNNTN; however, this sequence can comprise up to two mutations and still be functional.
  • the sigma-K sporulation-specific polymerase promoter sequence is generally found upstream of the ribosome binding site (RBS).
  • Promoters having a high degree of sequence identity to any of the sequences shown above in Table 3 can also be used to express the fusion proteins or the modulator proteins.
  • the fusion protein or modulator protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 80% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157-231.
  • the fusion protein or modulator protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 90% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157-231.
  • the fusion protein or modulator protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 95% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157-231.
  • the fusion protein or modulator protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 98% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157-231.
  • the fusion protein or modulator protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 99% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157-231.
  • the fusion protein or modulator protein can be expressed under the control of a promoter comprising a nucleic acid sequence having 100% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157-231.
  • the modulator protein or fusion protein can be expressed under the control of a BclA promoter (e.g., SEQ ID NO: 189, 190, 215, 229 or 230), a CotY promoter (e.g., SEQ ID NO: 161, 162 or 221), an ExsY promoter (e.g., SEQ ID NO: 157, 158 or 220), or a rhamnose promoter (e.g., SEQ ID NO: 225).
  • a BclA promoter e.g., SEQ ID NO: 189, 190, 215, 229 or 230
  • CotY promoter e.g., SEQ ID NO: 161, 162 or 221
  • an ExsY promoter e.g., SEQ ID NO: 157, 158 or 220
  • a rhamnose promoter e.g., SEQ ID NO: 225.
  • the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 80% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157, 158, 161, 162, 189, 190, 215, 220, 221, 225, 229, or 230.
  • the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 85% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157, 158, 161, 162, 189, 190, 215, 220, 221, 225, 229, or 230.
  • the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 90% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157, 158, 161, 162, 189, 190, 215, 220, 221, 225, 229, or 230.
  • the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 95% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157, 158, 161, 162, 189, 190, 215, 220, 221, 225, 229, or 230.
  • the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 98% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157, 158, 161, 162, 189, 190, 215, 220, 221, 225, 229, or 230.
  • the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 99% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157, 158, 161, 162, 189, 190, 215, 220, 221, 225, 229, or 230.
  • the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having 100% identity with a nucleic acid sequence of any one of SEQ ID NOs: 157, 158, 161, 162, 189, 190, 215, 220, 221, 225, 229, or 230.
  • the fusion protein or modulator protein can be expressed under the control of a promoter comprising a sigma-K sporulation specific polymerase promoter sequence, wherein the sigma-K sporulation-specific polymerase promoter sequence or sequences have 100% identity with the corresponding nucleotides of any of SEQ ID NOs: 157-231.
  • the fusion proteins can be expressed under the control of a promoter that is native to the targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein.
  • a promoter that is native to the targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein.
  • the fusion protein can be expressed under the control of a native BclA promoter (e.g., SEQ ID NO: 189, 190, 215, 229 or 230).
  • the modulator proteins can be expressed under the control of their native promoters.
  • the modulator protein comprises CotO
  • the CotO can be expressed under the control of a native CotO promoter (e.g., SEQ ID NO: 163 or 226).
  • Native promoter sequences for each of the modulator proteins are provided above in Table 3.
  • Table 3 also provides exemplary minimal promoter sequences for each modulator protein.
  • the modulator proteins and fusion proteins can be expressed under any of these minimal promoter sequences.
  • the modulator protein can be expressed under a minimal promoter that comprises a portion of the native promoter sequence.
  • the modulator protein comprises CotO
  • the CotO can be expressed under the minimal CotO promoter (SEQ ID NO: 164).
  • the modulator proteins can be expressed under the control of any promoter comprising a sigma-K sporulation-specific polymerase promoter sequence, regardless of whether the promoter is the native promoter for the modulator protein.
  • each of the native promoters and the minimal promoters for the modulator proteins contains at least one sigma-K sporulation-specific polymerase promoter sequence.
  • the modulator protein is BxpB
  • the BxpB can be expressed under the control of a BclA promoter (e.g., SEQ ID NO: 189, 190, 215, 229 or 230) or any of the other promoters listed in Table 3.
  • the modulator protein or the fusion protein can be expressed under a portion of any of the promoters listed above in Table 3, so long as the portion of the promoter includes a sigma-K sporulation-specific polymerase promoter sequence.
  • the modulator protein can be expressed under a promoter region that comprises the first 25, 50, 100, 150, 200, 250, or 300 nucleotides upstream of the start codon, so long as that region comprises a sigma-K sporulation-specific polymerase promoter sequence.
  • the recombinant Bacillus cereus family members that express fusion proteins comprising a protein or peptide of interest and a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member can be used to deliver proteins or peptides of interest to plants, seeds, a plant growth medium, or an area surrounding a seed or a plant (e.g., via soil drench, foliar application, or as a seed treatment).
  • the recombinant Bacillus cereus family members can be used to deliver nucleic acid molecules to animals, insects, worms (e.g., nematodes), fungi, and protozoans; to deliver proteins or peptides to an animal; in vaccines and for producing an immunogenic response; for remediation; for treating a hydraulic fracturing fluid to break an emulsion or gel within the fluid; for disinfection; and for various other uses described hereinbelow.
  • the presence of the living microorganisms may not be desirable, and instead, it would be desirable to separate the living spore from the fusion proteins in the exosporium on the outside surface of the spore.
  • Mutations or other genetic alterations can be introduced into the recombinant Bacillus cereus family members that allow free exosporium to be separated from spores of the recombinant Bacillus cereus family member. This separation process yields exosporium fragments that contain the fusion proteins but that are substantially free of the spores themselves.
  • substantially free of spores it is meant that once the free exosporium is separated from the spores, a preparation is obtained that contains less than 5% by volume of spores, preferably less than 3% by volume of spores, even more preferably less than 1% by volume of spores, and most preferably contains no spores or if spores are present, they are undetectable.
  • exosporium fragments can be used in place of the recombinant Bacillus cereus family members themselves and can be used to deliver proteins or peptides of interest to plants, seeds, a plant growth medium, or an area surrounding a seed or a plant, or for any of the other purposes described herein.
  • a recombinant Bacillus cereus family member that expresses a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.
  • the recombinant Bacillus cereus family member comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions.
  • the mutation or the increased expression of the protein results in Bacillus cereus spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore.
  • a further recombinant Bacillus cereus family member that expresses a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.
  • the recombinant Bacillus cereus family member comprises a mutation in a CotE gene; (ii) expresses an ExsY protein, wherein the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the ExsY protein comprises a carboxy-terminal tag comprising a globular protein; (iii) expresses a BclB protein, wherein the expression of the BclB protein is increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions; (iv) expresses a YjcB protein, wherein the expression of the YjcB protein is increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions; (v) comprises a mutation in an ExsY gene; (vi) comprises a mutation in a mutation in
  • the recombinant Bacillus cereus family member can comprise a mutation in the CotE gene, such as a knock-out of the CotE gene or a dominant negative form of the CotE gene.
  • the mutation in the CotE gene can partially or completely inhibit the ability of CotE to attach the exosporium to the spore.
  • the recombinant Bacillus cereus family member can express an ExsY protein.
  • the ExsY protein comprises a carboxy-terminal tag comprising a globular protein (e.g., a green fluorescent protein (GFP) or a variant thereof), and the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions.
  • the globular protein can have a molecular weight of between 25 kDa and 100 kDa. Expression of the ExsY protein comprising the carboxy-terminal tag comprising a globular protein can also inhibit binding of the ExsY protein to its targets in the exosporium.
  • the recombinant Bacillus cereus family member can express a BclB protein, which may result in the formation of a fragile exosporium.
  • the expression of the BclB protein can be increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions.
  • the recombinant Bacillus cereus family member can express a YjcB protein, which may cause the exosporium to form in pieces rather than in a complete structure.
  • the expression of the YjcB protein can be increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions.
  • the recombinant Bacillus cereus family member can comprise a mutation an ExsY gene, such as a knock-out of the ExsY gene.
  • the mutation in the ExsY gene can partially or completely inhibit the ability of ExsY to complete the formation of the exosporium or attach the exosporium to the spore.
  • the recombinant Bacillus cereus family member can comprise a mutation a CotY gene, such as a knock-out of the CotY gene.
  • the mutation in the CotY gene can result in the formation of a fragile exosporium.
  • the recombinant Bacillus cereus family member can comprise a mutation an ExsA gene, such as a knock-out of the ExsA gene.
  • the mutation in the ExsA gene can result in the formation of a fragile exosporium.
  • the recombinant Bacillus cereus family member can comprise a mutation a CotO gene, such as a knock-out of the CotO gene or a dominant negative form of the CotO gene.
  • the mutation in the CotO gene can cause the exosporium to form in strips.
  • Exosporium fragments can be prepared from any of these recombinant Bacillus cereus family members and used for various purposes as described further hereinbelow.
  • the exosporium fragments comprise the fusion proteins.
  • a cell-free protein preparation is obtained in which the fusion proteins are stabilized and supported through covalent bonds to the exosporium fragments.
  • the fusion proteins Due to the strong covalent bonds between the fusion proteins and the exosporium fragments, the fusion proteins become resistant to heat.
  • the heat resistance of the fusion proteins bound to the exosporium fragments allows them to be used for applications that require heat-resistant proteins or enzymes (e.g., in feed additives).
  • Spores of bacteria of the genus Bacillus can be genetically inactivated. Genetic inactivation of the spores can be advantageous, for example because it allows for delivery of spores to a plant or a plant growth medium while eliminating any detrimental effects that the live bacteria might have on a plant. In addition, use of inactivated spores can provide many of the same benefits (e.g., prevention of bacterial growth in a product) as discussed above in Section IV with respect to the use of exosporium fragments.
  • a recombinant bacterium of the genus Bacillus that expresses a protease or a nuclease is provided.
  • the expression of the protease or nuclease is increased as compared to the expression of the protease or the nuclease in a wild-type bacterium of the genus Bacillus under the same conditions.
  • the increased expression of the protease or the nuclease partially or completely inactivates spores of the recombinant bacterium of the genus Bacillus or renders spores of the recombinant bacterium of the genus Bacillus more susceptible to physical or chemical inactivation.
  • the recombinant bacterium of the genus Bacillus is preferably a recombinant Bacillus cereus family member.
  • the recombinant Bacillus cereus family member can also express a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.
  • the recombinant bacterium of the genus Bacillus can express both a protease and a nuclease, wherein the expression of the protease is increased as compared to the expression of the protease in a wild-type bacterium of the genus Bacillus under the same conditions and the expression of the nuclease is increased as compared to the expression of the nuclease in a wild-type bacterium of the genus Bacillus under the same conditions.
  • the protease of the recombinant bacterium can comprise a non-specific protease.
  • the protease of the recombinant bacterium can comprise a serine protease, a threonine protease, a cysteine protease, an aspartate protease, a glutamic acid protease, an alkaline protease, a subtilisin, a histidine protease, or a metalloprotease.
  • the protease of the recombinant bacterium can comprise a germination spore protease, such as a Bacillus subtilis germination spore protease, a Bacillus mycoides germination spore protease, or a Bacillus thuringiensis germination spore protease.
  • a germination spore protease such as a Bacillus subtilis germination spore protease, a Bacillus mycoides germination spore protease, or a Bacillus thuringiensis germination spore protease.
  • the germination spore protease can comprise an active form of the germination spore protease. This protease is naturally inactive in the spore. Upon germination, the protease becomes active due to cleavage of the protease into a proprotein active form. Thus, the recombinant bacterium can comprise an active protease rather than the naturally inactive form. The active protease can digest the protective SASP proteins in the spore prior to germination.
  • the nuclease of the recombinant bacterium can comprise an endonuclease or an exonuclease.
  • the nuclease can comprise a non-specific endonuclease, such as Bacillus subtilis endonuclease 1.
  • Bacillus subtilis endonuclease 1 can have the amino acid sequences listed below in Table 4.
  • a protease or a nuclease having a high degree of amino acid identity to the sequences listed above in Table 4 can also be used.
  • the germination spore protease can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 233 or 234.
  • the germination spore protease can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 233 or 234.
  • the germination spore protease can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 233 or 234.
  • the germination spore protease can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 233 or 234.
  • the germination spore protease can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 233 or 234.
  • the germination spore protease can comprise an amino acid sequence having 100% identity with SEQ ID NO: 233 or 234.
  • non-specific endonuclease can comprise an amino acid having at least 85% identity with SEQ ID NO: 232.
  • the non-specific endonuclease can comprise an amino acid having at least 90% identity with SEQ ID NO: 232.
  • the non-specific endonuclease can comprise an amino acid having at least 95% identity with SEQ ID NO: 232.
  • the non-specific endonuclease can comprise an amino acid having at least 98% identity with SEQ ID NO: 232.
  • the non-specific endonuclease can comprise an amino acid having at least 99% identity with SEQ ID NO: 232.
  • the non-specific endonuclease can comprise an amino acid having 100% identity with SEQ ID NO: 232.
  • the protease or nuclease can be expressed under the control of a promoter comprising a sigma G promoter sequence.
  • the promoter can have one of the sequences shown in Table 5 below.
  • the consensus sequence for binding of the sigma G transcription factor is CATNNTA, where N is any nucleotide.
  • the sigma G promoter sequences in the promoters in Table 5 are indicated by bold and underlined text.
  • G sequences Promoter Nucleic Acid Sequence
  • GPR Protease, B. GTAACTAAAGCTTCTACAGTTTTAACAGCTGAACGCATGTCAGACTT subtilis 168 GATAGAAGCGTTATGTGCACGACGCTCTTCGCTAAGTTTAGCGCGTT (SEQ ID NO: 235) TGATAGCAGATTTAATGTTTGC CATACTT TTCACCTCCCTGGTGCGA TCGAGTGACTCGATACTTA CATAGAA CAAGTGATATTCTATCAAACG GAGAAGAGAATTGCAATAGCGAGATCAATGAAATTT CATGTAA AGG AAAGAATGACCTTATATATTTTTGGGGAATCTAACTATATTTACTAT GAATTGCGGAGGAGATACG GPR Protease GCAATAGCGAGATCAATGAAATTT CATGTAA AGGAAAGAATGACCT minimal promoter, TATATATTTTTGGGGAATCTAACTATATTTACTATGAATTGCGGAGG B.
  • subtilis 168 AGATACG SEQ ID NO: 236)
  • GPR Protease, B. TTTCACCTCCTAAGATACAACCTGTAGCACAGTGTCTTAAGGTTAAA subtilis 168 TCTTCTTCACAATAGAACAAATTGTATTCTATCAAACACACCTTTAG (SEQ ID NO: 237) ATTGCAATATAAATGTAAAGTATTTTT CATTGAA GGTTCTCTTTTTAG CATGATT TATTCAGCAAATGGCAACAATATAGGTACTTAATGTGAA GGAGGCCCCTGT GPR Protease GAAGGTTCTCTTTTTAG CATGATT TATTCAGCAAATGGCAACAATAT minimal promoter, AGGTACTTAATGTGAAGGAGGCCCCTGT B.
  • subtilis 168 SASP ⁇ , GCTTTGTTGATTTCGAGCCGTATATTCAAGAAGCGGTAGATAACATT B. subtilis 168 GAGACAATGACCCTTTATAGCGAACAAGAAGCTAACGATAAATTCG (SEQ ID NO: 239) CTGAACTCTTTTAAATCAATTTTCAGCTCCTGTATACAATTACCAAAG TTTTTCTGAATGAAGCCATGTGTTTTGACA CATTCTA TACTCACAAG GAGGTGAGACAC SASP ⁇ minimal GAATGAAGCCATGTGTTTTGACA CATTCTA TACTCACAAGGAGGTG promoter, B. AGACAC subtilis 168 (SEQ ID NO: 240) SASP ⁇ , B.
  • AAACGGCTAAGCTTTTTTTATTTCTCAAGATTTACCACACAATTCTCC subtilis 168 GCATGATTTTCCGGCCATTTTAACATAATACGTAGTAACAAGCCGGC (SEQ ID NO: 241)
  • subtilis 168 SASP ⁇ , B.
  • TTCGCTTCTCCCACTTAATCTGATTTACATTCCAAGGAATCCAATGAT subtilis 168 TTATATGGAGATCTGAAACATAATCAATTTTCATTTTGTCTCCACCTT (SEQ ID NO: 243) TCTTAATGAAAAATTTATTTCTTTGGCGTGTATAAATTAAAATAATCT CTC CATAATA TGATTCAAACAAGCTTGTTTTCATTACACTTTAGGAG ATGAATAAG SASP ⁇ minimal GTATAAATTAAAATAATCTC CATAATA TGATTCAAACAAGCTTGT promoter, TTTCATTACACTTTAGGAGATGAATAAG B. subtilis 168 (SEQ ID NO: 244) SASP ⁇ , B.
  • nuclease or protease under a sigma G promoter allows for site-specific expression of the nuclease or protease in the forespore, where the enzyme's activity is directed towards the forespore and, the region where the bacterial target DNA is located. Extensive cleavage of the forespore DNA is lethal to the bacterial spore when it begins to germinate.
  • GPR germination spore protease
  • overexpression of germination spore protease (GPR) in its active form in the forespore of a Bacillus cereus family member during sporulation results in proteolytic cleavage of proteins in the forespore and inactivation of the spore and/or renders the spore more sensitive to inactivation by ultraviolet or gamma irradiation.
  • GPR germination spore protease
  • overexpression of a non-specific endonuclease in the forespore during sporulation destroys the DNA in the spore, leading to a high number of inactivated spore particle.
  • SASPs small acid soluble proteins
  • the GPR By expressing a GPR under the control of a sigma G promoter, the GPR is expressed in the forespore and the protective SASP proteins are degraded as sporulation commences, leaving the bacterial DNA more susceptible to degradation.
  • expression of a non-specific nuclease under the control of a sigma G promoter leads to digestion of the host DNA. Since the spore is unable to repair the large scale damage to its DNA, this ultimately leads to killing of the spore.
  • Overexpression of a GPR and a non-specific endonuclease can be used together to both degrade the protective SASP proteins and the host DNA.
  • protease or the nuclease can be expressed under the control of any promoter comprising a sigma G promoter sequence.
  • protease or nuclease can be expressed under the control of any of the promoters listed in Table 5 above.
  • the protease or nuclease can be expressed under the control of a promoter having a high degree of sequence identity with any of the promoter sequences listed above in Table 5.
  • the promoter can comprise a nucleic acid sequence having at least 95% identity with a nucleic acid sequence of any of SEQ ID NOs: 235-246.
  • the promoter can comprise a nucleic acid sequence having at least 98% identity with a nucleic acid sequence of any of SEQ ID NOs: 235-246.
  • the promoter can comprise a nucleic acid sequence having at least 99% identity with a nucleic acid sequence of any of SEQ ID NOs: 235-246.
  • the promoter can comprise a nucleic acid sequence having 100% identity with a nucleic acid sequence of any of SEQ ID NOs: 235-246.
  • spores of the recombinant bacterium of the genus Bacillus can be more susceptible to inactivation, for example, by ultraviolet irradiation, gamma irradiation, or by treatment with bleach, hydrogen peroxide, chloroform, phenol, or acetic acid, as compared to the same spores that do not expresses the protease or the nuclease at an increased level as compared to expression of the protease or the nuclease in a wild-type bacterium of the genus Bacillus , treated under the same conditions.
  • Spores of any of the recombinant Bacillus cereus family member spores that express a fusion protein comprising a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member can also be genetically inactivated or rendered more susceptible to physical or chemical inactivation by modification of the Bacillus cereus family member to comprise a mutation.
  • Such mutations include knock-out or other inactivating mutations in one or more genes encoding a germination receptor.
  • the germination receptor genes include, for example, GerA, GerB, GerK, GerH, GerI, GerG, GerL, GerQ, GerR, GerS, GerN, GerU, or GerX.
  • Such mutations also include knock-out or other inactivating mutations in spore cortex lytic enzymes.
  • the spore cortex lytic enzymes SleB and CwJ can be mutated to inactivate spores. Such mutations prevent outgrowth of the spore upon germination and effectively inactivate the spores.
  • Such mutations further include knock-out or other inactivating mutations of SASP genes (e.g., SASP ⁇ , SASP ⁇ , or SASP ⁇ ). Such mutations eliminate the UV protection of the spores and render them more susceptible to inactivation by ultraviolet irradiation and other methods.
  • Such methods also include making knock-out or other inactivating mutations in genes encoding spore coat or cortex proteins (e.g., CotA, CotB, or CotC). Such mutations render the spores more susceptible to inactivation by physical or chemical methods such as exposure to ultraviolet irradiation, gamma irradiation, or treatment with solvents such as bleach, hydrogen peroxide, chloroform, phenol, or acetic acid.
  • the present invention relates to a recombinant Bacillus cereus family member that expresses a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.
  • the recombinant Bacillus cereus family member comprises a mutation that partially or completely inactivates spores of the recombinant Bacillus cereus family member or renders spores of the recombinant Bacillus cereus family more susceptible to physical or chemical inactivation as compared to the same spores that do not comprise the mutation.
  • the mutation comprises a mutation in a gene encoding a germination receptor, a mutation in a gene encoding a spore cortex lytic enzyme, a mutation in a gene encoding a small acid-soluble spore protein (SASP), or a mutation in a gene encoding a spore coat or cortex protein.
  • SASP small acid-soluble spore protein
  • the present invention further relates to a recombinant Bacillus cereus family member that expresses a fusion protein as described in Section I above.
  • the recombinant Bacillus cereus family member comprises a mutation that partially or completely inactivates spores of the recombinant Bacillus cereus family member or renders spores of the recombinant Bacillus cereus family more susceptible to physical or chemical inactivation as compared to the same spores that do not comprise the mutation.
  • any of the recombinant Bacillus cereus family members described above in Section V.A that express a protease or a nuclease can also comprise a mutation that partially or completely inactivates spores of the recombinant Bacillus cereus family member or renders spores of the recombinant Bacillus cereus family more susceptible to physical or chemical inactivation as compared to the same spores that do not comprise the mutation.
  • the mutation can comprise a mutation in a gene encoding a germination receptor, a mutation in a gene encoding a spore cortex lytic enzyme, a mutation in a gene encoding a small acid-soluble spore protein (SASP), or a mutation in a gene encoding a spore coat or cortex protein.
  • SASP small acid-soluble spore protein
  • the mutation can comprise a mutation in a gene encoding a germination receptor, such as a knock-out mutation of the gene encoding the germination receptor.
  • the germination receptor can comprise GerA, GerB, GerK, GerH, GerI, GerG, GerL, GerQ, GerR, GerS, GerN, GerU, or GerX.
  • the mutation can comprise a mutation in a gene encoding a spore cortex lytic enzyme, such as a knock-out mutation of the gene encoding the spore cortex lytic enzyme.
  • the spore cortex lytic enzyme can comprise SleB or CwlJ.
  • the mutation can comprise a mutation in a gene encoding a SASP, such as a mutation in a SspA gene, a mutation in a SspB gene, a mutation in a SspC gene, a mutation in a SspD gene, a mutation in a SspE gene, a mutation in a SspF gene, a mutation in a SspG gene, a mutation in a SspH gene, a mutation in a SspI gene, a mutation in a SspJ gene, a mutation in a SspK gene, a mutation in a SspL gene, a mutation in a SspM gene, a mutation in a SspN gene, a mutation in a SspO gene, a mutation in a SspP gene, or a combination thereof.
  • a SASP such as a mutation in a SspA gene, a mutation in a SspB gene, a mutation
  • the SASP can comprise SASP ⁇ , SASP ⁇ , or SASP ⁇ .
  • the spores of the recombinant Bacillus cereus family member may be more susceptible to inactivation by ultraviolet irradiation or gamma irradiation as compared to the same spores that do not comprise the mutation in the gene encoding the SASP.
  • the mutation can comprise a mutation in a gene encoding a spore coat or cortex protein, such as a knock-out mutation of the gene encoding the spore coat or cortex protein.
  • the spore coat or cortex protein can comprise CotA, CotB, or CotC.
  • the spores of the recombinant Bacillus cereus family member may be more susceptible to inactivation by ultraviolet irradiation, gamma irradiation or by treatment with bleach, hydrogen peroxide, chloroform, phenol, or acetic acid, as compared to the same spores that do not comprise the mutation in the spore coat or cortex protein, treated under the same conditions.
  • a recombinant Bacillus cereus family member that expresses an exosporium protein is provided, wherein the expression of the exosporium protein is increased as compared to the expression of the exosporium protein in a wild-type Bacillus cereus family member under the same conditions.
  • the exosporium protein can comprise an exosporium enzyme, wherein the exosporium enzyme comprises an enzyme involved in nutrient solubilization, an inosine-uridine hydrolase, a protease, an enzyme that catalyzes the degradation of a free radical, an arginase, or an alanine racemase.
  • the exosporium protein can comprise a BclA protein, a BclB protein, a CotE protein a CotO protein, an ExsY protein, an ExsFA/BxpB protein, a CotY protein, an ExsFB protein, an ExsJ protein, an ExsH protein, a YjcA protein, a YjcB protein, a BclC protein, a BxpA protein, a BclE protein, a BetA/BAS3290 protein, an ExsA protein, an ExsK protein, an ExsB protein, a YabG protein, or a Tgl protein.
  • the exosporium protein is preferably not part of a fusion protein.
  • Exemplary amino acid sequences for AcpC, InhA1, InhA2, InhA3, SODA1, and SODA2 are provided above in Tables 1 and 2.
  • Exemplary sequences for alanine racemase 1, alanine racemase 2, arginase, IunH1, and IunH2 are provided by the SEQ ID NOs. referenced in Table 6 below.
  • the SODA enzymes and arginase degrade free radicals. Spores that overexpress these enzymes have increased resistance to stress caused by free radicals.
  • the exosporium protein comprises an exosporium enzyme
  • the exosporium enzyme comprises an enzyme involved in nutrient solubilization
  • the enzyme involved in nutrient solubilization can comprise an enzyme involved in phosphate solubilization, such as an acid phosphatase (e.g., AcpC).
  • the acid phosphatase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 137.
  • the acid phosphatase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 137.
  • the acid phosphatase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 137.
  • the acid phosphatase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 137.
  • the acid phosphatase can comprise an amino acid sequence having 100% identity with SEQ ID NO: 137.
  • the exosporium protein comprises an exosporium enzyme
  • the exosporium enzyme comprises an inosine-uridine hydrolase
  • the inosine-uridine hydrolase can comprise IunH1 or IunH2.
  • the inosine-uridine hydrolase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 250 or 251.
  • the inosine-uridine hydrolase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 250 or 251.
  • the inosine-uridine hydrolase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 250 or 251.
  • the inosine-uridine hydrolase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 250 or 251.
  • the inosine-uridine hydrolase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 250 or 251.
  • the inosine-uridine hydrolase can comprise an amino acid sequence having 100% identity with SEQ ID NO: 250 or 251.
  • the exosporium protein comprises an exosporium enzyme
  • the exosporium enzyme comprises a protease
  • the protease can be a metalloprotease (e g, InhA1, InhA2, or InhA3).
  • the metalloprotease can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 114, 121, 122, 129, 130, or 138.
  • the metalloprotease can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 114, 121, 122, 129, 130, or 138.
  • the metalloprotease can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 114, 121, 122, 129, 130, or 138.
  • the metalloprotease can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 114, 121, 122, 129, 130, or 138.
  • the metalloprotease can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 114, 121, 122, 129, 130, or 138.
  • the metalloprotease can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 114, 121, 122, 129, 130, or 138.
  • the metalloprotease can comprise an amino acid sequence having 100% identity with SEQ ID NO: 114, 121, 122, 129, 130, or 138.
  • the exosporium protein comprises an exosporium enzyme
  • the exosporium enzyme comprises an enzyme that catalyzes the degradation of a free radical
  • the enzyme that catalyzes the degradation of a free radical can comprise a superoxide dismutase (e.g., superoxide dismutase 1 (SODA1) or superoxide dismutase 2 (SODA2)).
  • SODA1 superoxide dismutase 1
  • SODA2 superoxide dismutase 2
  • the superoxide dismutase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having 100% identity with SEQ ID NO: 155 or 156.
  • the exosporium protein comprises an exosporium enzyme
  • the exosporium enzyme comprises an arginase
  • the arginase can comprise a Bacillus thuringiensis arginase.
  • the arginase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 249.
  • the arginase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 249.
  • the arginase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 249.
  • the arginase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 249.
  • the arginase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 249.
  • the arginase can comprise an amino acid sequence having 100% identity with SEQ ID NO: 249.
  • the exosporium protein comprises an exosporium enzyme
  • the exosporium enzyme comprises an alanine racemase
  • the alanine racemase can comprise alanine racemase 1 (ALR1) or alanine racemase 2 (ALR2).
  • the alanine racemase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 247 or 248.
  • the alanine racemase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 247 or 248.
  • the alanine racemase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 247 or 248.
  • the alanine racemase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 247 or 248.
  • the alanine racemase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 247 or 248.
  • the alanine racemase can comprise an amino acid sequence having 100% identity with SEQ ID NO: 247 or 248.
  • the exosporium protein can comprise a BclA protein, a BclB protein, a CotE protein a CotO protein, an ExsY protein, an ExsFA/BxpB protein, a CotY protein, an ExsFB protein, an ExsJ protein, an ExsH protein, a YjcA protein, a YjcB protein, a BclC protein, a BxpA protein, a BclE protein, a BetA/BAS3290 protein, an ExsA protein, an ExsK protein, an ExsB protein, a YabG protein, or a Tgl protein.
  • the exosporium protein preferably comprises a BclA protein, a BclB protein, a CotE protein, or a CotO protein. Exemplary amino acid sequences for these exosporium proteins can be found in Table 2 above.
  • the exosporium protein can comprise a BclA protein.
  • the BclA protein can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 141 or 142.
  • the BclA protein can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 141 or 142.
  • the BclA protein can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 141 or 142.
  • the BclA protein can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 141 or 142.
  • the BclA protein can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 141 or 142.
  • the BclA protein can comprise an amino acid sequence having 100% identity with SEQ ID NO: 141 or 142.
  • the exosporium protein can comprise a BclB protein.
  • the BclB protein can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 143 or 144.
  • the BclB protein can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 143 or 144.
  • the BclB protein can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 143 or 144.
  • the BclB protein can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 143 or 144.
  • the BclB protein can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 143 or 144.
  • the BclB protein can comprise an amino acid sequence having 100% identity with SEQ ID NO: 143 or 144.
  • the exosporium protein can comprise a CotE protein.
  • the CotE protein can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 149.
  • the CotE protein can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 149.
  • the CotE protein can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 149.
  • the CotE protein can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 149.
  • the CotE protein can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 149.
  • the CotE protein can comprise an amino acid sequence having 100% identity with SEQ ID NO: 149.
  • the exosporium protein can comprise a CotO protein.
  • the CotO protein can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 126.
  • the CotO protein can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 126.
  • the CotO protein can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 126.
  • the CotO protein can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 126.
  • the CotO protein can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 126.
  • the CotO protein can comprise an amino acid sequence having at least 100% identity with SEQ ID NO: 126.
  • the exosporium protein can comprise an ExsY protein.
  • the ExsY protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 123.
  • the exosporium protein can comprise an ExsFA/BxpB protein.
  • the ExsFA/BxpB protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO:124.
  • the exosporium protein can comprise a CotY protein.
  • the CotY protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 125.
  • the exosporium protein can comprise an ExsFB protein.
  • the ExsFB protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 127 or 128.
  • the exosporium protein can comprise an ExsJ protein.
  • the ExJ protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 131.
  • the exosporium protein can comprise an ExsH protein.
  • the ExsH protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 132.
  • the exosporium protein can comprise a YjcA protein.
  • the YjcA protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 133.
  • the exosporium protein can comprise a YjcB protein.
  • the YjcB protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 134 or 135.
  • the exosporium protein can comprise a BclC protein.
  • the BclC protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% with SEQ ID NO: 136.
  • the exosporium protein can comprise a BxpA protein.
  • the BxpA protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% with SEQ ID NO: 145.
  • the exosporium protein can comprise a BclE protein.
  • the BclE protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 146 or 147.
  • the exosporium protein can comprise a BetA/BAS3290 protein.
  • the BetA/BAS3290 protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 148.
  • the exosporium protein can comprise an ExsA protein.
  • the ExsA protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 150.
  • the exosporium protein can comprise an ExsK protein.
  • the ExsK protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 151.
  • the exosporium protein can comprise an ExsB protein.
  • the ExsB protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 152.
  • the exosporium protein can comprise a YabG protein.
  • the YabG protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 153.
  • the exosporium protein can comprise a Tgl protein.
  • the Tjl protein can comprise an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 156.
  • the recombinant Bacillus cereus family member can also express a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.
  • any of the fusion proteins comprising a protein or peptide of interest and a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member, can be expressed an endophytic Bacillus cereus family member, a strain of bacteria that is capable of degrading an herbicide or a pesticide, or a probiotic strain of bacteria.
  • the expression of the fusion proteins in an endophytic strain of bacteria provides the ability to deliver the protein or peptide of interest into the plant itself.
  • the endophytic strains can be delivered to plants using various methods, e.g., the endophytic strains can be delivered via seed treatment, treatment of the plant growth medium (e.g., soil), irrigation, application to the plant itself (e.g., foliar application to the aerial portions of a plant). Once inside the plant, the bacteria multiply and colonize the internal tissues of the plant.
  • probiotic strains of bacteria that express of the fusion proteins are useful in methods for delivering the proteins or peptides of interest (e.g., enzymes) to animals.
  • fusion proteins comprising a protein or peptide of interest and a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member
  • Bacillus cereus family member strain that is capable of degrading an herbicide or a pesticide, as explained further hereinbelow, these strains are particularly useful in methods for decontamination of an environment contaminated with an herbicide and/or a pesticide.
  • the present invention therefore relates to a recombinant Bacillus cereus family member that expresses a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member, wherein the recombinant Bacillus cereus family member comprises an endophytic strain of bacteria, a strain of bacteria that is capable of degrading an herbicide or a pesticide, or a probiotic strain of bacteria.
  • the endophytic strain of bacteria can comprise Bacillus cereus family member EE349, Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, or Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, or Bacillus mycoides EE-B00363.
  • the endophytic strain of bacteria can comprise Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, or Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, or Bacillus mycoides EE-B00363.
  • the strain of bacteria that is capable of degrading an herbicide or a pesticide can comprise Bacillus cereus family member EE349, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, or Bacillus mycoides EE-B00363.
  • the probiotic strain of bacteria can comprise Bacillus cereus family member EE349, Bacillus cereus family member EE439, Bacillus thuringiensis EE417, or Bacillus cereus EE444.
  • the present invention further relates to a recombinant Bacillus cereus family member that expresses a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member, wherein the recombinant Bacillus cereus family member comprises an endophytic strain of bacteria, and the fusion protein comprises any of the fusion proteins described in Section I above.
  • any of the targeting sequences, exosporium proteins, or exosporium proteins described in this section can be in any of the fusion proteins in:
  • the targeting sequence, exosporium protein, or exosporium protein fragment can comprise: (1) a targeting sequence comprising an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%; (2) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; (3) a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; (4) a targeting sequence comprising SEQ ID NO: 1; (5) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 2; (6) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 1; (7) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 1; (8) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 1; (9) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 1; (10)
  • the targeting sequence can comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.
  • the targeting sequence can comprise an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.
  • the targeting sequence can comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.
  • the targeting sequence can comprise an amino acid sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.
  • the targeting sequence can comprise an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.
  • the targeting sequence can comprise an amino acid sequence having at least about 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.
  • the targeting sequence can comprise an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.
  • the targeting sequence can comprise an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.
  • the targeting sequence can comprise an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.
  • the targeting sequence can consist of: (a) an amino acid sequence consisting of 16 amino acids and having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%; (b) amino acids 1-35 of SEQ ID NO: 1; (c) amino acids 20-35 of SEQ ID NO: 1; (d) SEQ ID NO: 1; (e) SEQ ID NO: 96; or (f) SEQ ID NO: 120.
  • the targeting sequence can consist of the amino acid sequence as described in these examples.
  • the fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.
  • the fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 95% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.
  • the fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 98% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.
  • the fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 99% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.
  • the fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having 100% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.
  • the fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.
  • the fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 95% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.
  • the fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 98% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.
  • the fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 99% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.
  • the fusion protein can comprise an exosporium protein comprising an amino acid sequence having 100% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.
  • the targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein can comprise the amino acid sequence GXT at its carboxy terminus, wherein X is any amino acid.
  • the targeting sequence, exosporium protein, or exosporium protein fragment can comprise an alanine residue at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.
  • the targeting sequence, exosporium protein, or exosporium protein fragment can further comprise a methionine, serine, or threonine residue at the amino acid position immediately preceding the first amino acid of the targeting sequence, exosporium protein, or exosporium protein fragment or at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.
  • Fusion Proteins Comprising a Protein or Peptide of Interest and a Spore Coat Protein, Recombinant Spore-Coat Forming Bacteria, and Seeds Coated with Recombinant Spore-Coat Forming Bacteria
  • a number of spore coat proteins can be used to display proteins or peptides of interest on a surface of a spore of a recombinant spore-forming bacterium.
  • Such bacteria include any spore-forming bacteria, and in particular include spore-forming bacteria of the genuses Bacillus, Lysinibacillus, Virginibacillus, Clostridia , and Paenibacillus .
  • Spore-forming bacteria of the genus Bacillus include Bacillus cereus family members as well as other Bacillus species that are not Bacillus cereus family members (e.g., Bacillus species bacteria that lack an exosporium).
  • spore coat proteins include CotB, CotC, CgeA, CotB/H, CotG, spore coat protein X, and CotY.
  • amino acid sequences for exemplary spore coat proteins that can be used for targeting of proteins or peptides of interest to a spore surface of a recombinant spore-forming bacterium are provided in Table 7 below, together with their SEQ ID NOs.
  • the present invention also relates to fusion proteins comprising at least one protein or peptide of interest and a spore coat protein, wherein the spore coat protein comprises a CotB/H protein, a spore protein X protein, or a CotY protein, wherein the CotY protein comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 258 or 259.
  • the spore coat protein can comprise a CotB/H protein.
  • the spore coat protein can comprise a spore protein X protein.
  • the spore coat protein can comprise a CotY protein, wherein the CotY protein comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 258 or 259.
  • the spore coat protein can comprises an amino acid sequence having at least 85% identity with SEQ ID NO: 255, 257, 258, or 259.
  • the spore coat protein can comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 255, 257, 258, or 259.
  • the spore coat protein can comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 255, 257, 258, or 259.
  • the spore coat protein can comprises an amino acid sequence having at least 98% identity with SEQ ID NO: 255, 257, 258, or 259.
  • the spore coat protein can comprises an amino acid sequence having at least 99% identity with SEQ ID NO: 255, 257, 258, or 259.
  • the spore coat protein can comprises an amino acid sequence having at least 100% identity with SEQ ID NO: 255, 257, 258, or 259.
  • Recombinant spore-forming bacteria that expresses any of the fusion proteins described in Section IX.B are provided.
  • the recombinant spore-forming bacteria can comprise an endophytic strain of bacteria, a plant growth-promoting strain of bacteria, or a strain of bacteria that is both endophytic and plant growth-promoting.
  • the present invention further relates to a recombinant spore-forming bacterium that expresses a fusion protein comprising at least one protein or peptide of interest and a spore coat protein that targets the fusion protein to the surface of a spore of the bacterium, wherein the spore coat protein comprises a CotB protein, a CotC protein, a CgeA protein, a CotB/H protein, a CotG protein, a spore coat protein X protein, or a CotY protein; and wherein the recombinant spore-forming bacterium comprises an endophytic strain of bacteria, a plant growth-promoting strain of bacteria, or a strain of bacteria that is both endophytic and plant growth-promoting.
  • the endophytic strains can be delivered to plants using various methods, e.g., the endophytic strains can be delivered via seed treatment, treatment of the plant growth medium (e.g., soil), irrigation, application to the plant itself (e.g., foliar application to the aerial portions of a plant). Once inside the plant, the bacteria multiply and colonize the internal tissues of the plant.
  • the plant growth medium e.g., soil
  • irrigation e.g., foliar application to the aerial portions of a plant.
  • the present invention also relates to plant seeds coated with a recombinant spore-forming bacterium, wherein the recombinant spore-forming bacterium expresses a fusion protein comprising at least one protein or peptide of interest and a spore coat protein that targets the fusion protein to the surface of a spore of the bacterium, wherein the spore coat protein comprises a cotB protein, a CotC protein, a CgeA protein, a CotB/H protein, a Cot G protein, a spore protein X protein, or a cotY protein.
  • the recombinant spore-coat forming bacterium can comprise a bacterium of the genus Bacillus or Lysinibacillus.
  • the present invention further relates to a recombinant bacterium of the genus Bacillus , wherein the recombinant bacterium comprises a recombinant spore-forming bacterium and wherein the recombinant spore-forming bacterium expresses a fusion protein comprising at least one protein or peptide of interest and a spore coat protein that targets the fusion protein to the surface of a spore of the bacterium, wherein the spore coat protein comprises a CotB protein, a CotC protein, a CgeA protein, a CotB/H protein, a Cot G protein, a spore coat protein X protein, or a CotY protein.
  • the recombinant spore-coat forming bacterium expresses a protease or a nuclease, wherein the expression of the protease or nuclease is increased as compared to the expression of the protease or the nuclease in a wild-type bacterium of the genus Bacillus under the same conditions, and wherein the increased expression of the protease or the nuclease partially or completely inactivates spores of the recombinant bacterium of the genus Bacillus or renders spores of the recombinant bacterium of the genus Bacillus more susceptible to physical or chemical inactivation.
  • the protease or nuclease can be any of the proteases or nucleases described above in Section V.A, and can be expressed under the control of any of the promoters described above in Section V.A.
  • the invention further relates to plant seeds coated with such spore-forming bacteria.
  • the recombinant bacterium can comprise an endophytic strain of bacteria, a plant growth-promoting strain of bacteria, or a strain of bacteria that is both endophytic and plant growth-promoting.
  • the recombinant spore-forming bacterium can comprise an endophytic strain of bacteria, a plant growth-promoting strain of bacteria, or a strain of bacteria that is both endophytic and plant growth-promoting.
  • the endophytic strain of bacteria, the plant growth-promoting strain of bacteria, or the strain of bacteria that is both endophytic and plant growth-promoting can comprise Bacillus megaterium EE385, Bacillus sp. EE387, Bacillus circulans EE388, Bacillus subtilis EE405, Lysinibacillus fusiformis EE442, or Lysinibacillus sphaericus EE443, Bacillus pumilus EE-B00143, Bacillus subtilis EE148 , Bacillus subtilis EE218, or Bacillus megaterium EE281.
  • the endophytic strain of bacteria can comprise Bacillus subtilis EE405 or Bacillus megaterium EE385.
  • the endophytic strain, the plant growth-promoting strain of bacteria, or the strain of bacteria that is both endophytic and plant growth-promoting of bacteria can comprise Bacillus cereus family member EE349, Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, or Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, Bacillus mycoides EE-B00363, Bacillus mycoides BT155, Bacillus mycoides EE118, Bacillus mycoides EE141, Bacillus mycoides BT46-3, Bacillus cereus family member EE128, Bacillus thuringiensis BT013A, or Bacillus cereus family member EE349.
  • the spore coat protein can comprise an amino acid sequence having at least 85% identity with any of SEQ ID NOs: 252-259.
  • the spore coat protein can comprise an amino acid sequence having at least 90% identity with any of SEQ ID NOs: 252-259.
  • the spore coat protein can comprise an amino acid sequence having at least 95% identity with any of SEQ ID NOs: 252-259.
  • the spore coat protein can comprise an amino acid sequence having at least 98% identity with any of SEQ ID NOs: 252-259.
  • the spore coat protein can comprise an amino acid sequence having at least 99% identity with any of SEQ ID NOs: 252-259.
  • the spore coat protein can comprise an amino acid sequence having 100% identity with any of SEQ ID NOs: 252-259.
  • a recombinant spore-forming bacterium that expresses a fusion protein comprising at least one protein or peptide of interest and a protein that targets the fusion protein to the surface of a spore of the bacterium is also provided.
  • the recombinant spore-forming bacterium is not a recombinant Bacillus cereus family member.
  • the protein that targets the fusion protein to the surface of a spore of the bacterium comprises amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 96, or an amino acid sequence having at least 85% identity with SEQ ID NO: 108, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 120, or SEQ ID NO: 121.
  • the protein that targets the fusion protein of the surface of a spore of the bacterium can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 108, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 120, or SEQ ID NO: 121.
  • the protein that targets the fusion protein of the surface of a spore of the bacterium can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 108, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 120, or SEQ ID NO: 121.
  • the protein that targets the fusion protein of the surface of a spore of the bacterium can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 108, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 120, or SEQ ID NO: 121.
  • the protein that targets the fusion protein of the surface of a spore of the bacterium can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 108, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 120, or SEQ ID NO: 121.
  • the protein that targets the fusion protein of the surface of a spore of the bacterium can comprise an amino acid sequence having at least 100% identity with SEQ ID NO: 108, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 120, or SEQ ID NO: 121.
  • the protein that targets the fusion protein to a surface of a spore of the bacterium can comprise amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 96, SEQ ID NO: 108, SEQ ID NO: 120, or SEQ ID NO: 121.
  • the recombinant-spore forming bacterium comprises an endophytic strain of bacteria, a plant growth-promoting strain of bacteria, or a strain of bacteria that is both endophytic and plant growth-promoting.
  • the endophytic strain of bacteria, the plant growth-promoting strain of bacteria, or the strain of bacteria that is both endophytic and plant growth-promoting comprises Bacillus megaterium EE385, Bacillus sp.
  • the endophytic strain of bacteria preferably comprises Bacillus sp. EE387.
  • any of the fusion proteins described herein can be made using standard cloning and molecular biology methods known in the art.
  • a gene encoding a protein or peptide of interest e.g., a gene encoding a plant growth stimulating protein or peptide
  • PCR polymerase chain reaction
  • DNA molecule that encodes the fusion protein can be cloned into any suitable vector, for example a plasmid vector.
  • the vector suitably comprises a multiple cloning site into which the DNA molecule encoding the fusion protein can be easily inserted.
  • the vector also suitably contains a selectable marker, such as an antibiotic resistance gene, such that bacteria transformed, transfected, or mated with the vector can be readily identified and isolated.
  • the vector is a plasmid
  • the plasmid suitably also comprises an origin of replication.
  • DNA coding for the fusion protein can be integrated into the chromosomal DNA of the B. cereus family member or spore-forming bacterium host.
  • any of the fusion proteins described herein can also comprise additional polypeptide sequences that are not part of the targeting sequence, exosporium protein, exosporium protein fragment, or the plant growth stimulating protein or peptide, the protein or peptide that protects a plant from a pathogen, the protein or peptide that enhances stress resistance in a plant, or the plant binding protein or peptide.
  • the fusion protein can include tags or markers to facilitate purification or visualization of the fusion protein (e.g., a polyhistidine tag or a fluorescent protein such as GFP or YFP) or visualization of recombinant Bacillus cereus family member spores expressing the fusion protein.
  • Fusion proteins on the exosporium of a Bacillus cereus family member or on a surface of a spore of a spore-forming bacterium using the targeting sequences, exosporium proteins, exosporium protein fragments, and spore coat proteins described herein is enhanced due to a lack of secondary structure in the amino-termini of these sequences, which allows for native folding of the fused proteins and retention of activity. Proper folding can be further enhanced by the inclusion of a short amino acid linker between the targeting sequence, exosporium protein, exosporium protein fragment, spore coat protein, and the protein or peptide of interest.
  • any of the fusion proteins described herein can comprise an amino acid linker between the targeting sequence, the exosporium protein, the exosporium protein fragment, or the spore coat protein and the protein or peptide of interest.
  • the linker can comprise a polyalanine linker or a polyglycine linker.
  • a linker comprising a mixture of both alanine and glycine residues can also be used.
  • a fusion protein in a fusion protein where the targeting sequence comprises SEQ ID NO: 1, can have one of the following structures:
  • Glycine Linker SEQ ID NO: 1-G n -POI
  • a n , G n , and (A/G) n are any number of alanines, any number of glycines, or any number of a mixture of alanines and glycines, respectively.
  • n can be 1 to 25, and is preferably 6 to 10.
  • the linker comprises a mixture of alanine and glycine residues
  • any combination of glycine and alanine residues can be used.
  • “POI” represents the protein or peptide of interest.
  • the linker can comprise a protease recognition site.
  • a protease recognition site allows for targeted removal, upon exposure to a protease that recognizes the protease recognition site, of the protein or peptide of interest.
  • the protein or peptide of interest can comprise any protein or peptide.
  • the protein or peptide of interest in the fusion proteins described herein can comprise, for example: (a) a plant growth stimulating protein or peptide; (b) a protein or peptide that protects a plant from a pathogen; (c) a protein or peptide that enhances stress resistance of a plant; (d) a plant binding protein or peptide; (e) an enzyme that catalyzes the production of nitric oxide; (f) a nucleic acid binding protein or peptide; or (g) a plant signaling molecule or a protein or peptide that alters the composition of a plant; (h) an antigen; (i) a remediation enzyme; (j) an enzyme suitable for breaking an emulsion or gel in a hydraulic fracturing fluid; or (k) an antibacterial protein or peptide.
  • the protein or peptide of interest can comprise a plant growth stimulating protein or peptide.
  • the plant growth stimulating protein or peptide can comprise a peptide hormone, a non-hormone peptide, an enzyme involved in the production or activation of a plant growth stimulating compound, or an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source.
  • the plant growth stimulating protein or peptide can comprise a peptide hormone.
  • the peptide hormone can comprise a phytosulfokine (e.g., phytosulfokine- ⁇ ), clavata 3 (CLV3), systemin, ZmlGF, or a SCR/SP11.
  • a phytosulfokine e.g., phytosulfokine- ⁇
  • CLV3 clavata 3
  • systemin e.g., ZmlGF
  • SCR/SP11 a SCR/SP11
  • the plant growth stimulating protein or peptide can comprise a non-hormone peptide.
  • the non-hormone peptide can comprise a RKN 16D10, Hg-Syv46, an eNOD40 peptide, melittin, mastoparan, Mas7, RHPP, POLARIS, or kunitz trypsin inhibitor (KTI).
  • KTI kunitz trypsin inhibitor
  • the plant growth stimulating protein or peptide can comprise an enzyme involved in the production or activation of a plant growth stimulating compound.
  • the enzyme involved in the production or activation of a plant growth stimulating compound can be any enzyme that catalyzes any step in a biological synthesis pathway for a compound that stimulates plant growth or alters plant structure, or any enzyme that catalyzes the conversion of an inactive or less active derivative of a compound that stimulates plant growth or alters plant structure into an active or more active form of the compound.
  • the plant growth stimulating compound can comprise a compound produced by bacteria or fungi in the rhizosphere, e.g., 2,3-butanediol.
  • the plant growth stimulating compound can comprise a plant growth hormone.
  • the plant growth hormone can comprise a cytokinin or a cytokinin derivative, ethylene, an auxin or an auxin derivative, a gibberellic acid or a gibberellic acid derivative, abscisic acid or an abscisic acid derivative, or a jasmonic acid or a jasmonic acid derivative.
  • the cytokinin or the cytokinin derivative can comprise kinetin, cis-zeatin, trans-zeatin, 6-benzylaminopurine, dihydroxyzeatin, N6-(D2-isopentenyl) adenine, ribosylzeatin, N6-(D2-isopentenyl) adenosine, 2-methylthio-cis-ribosylzeatin, cis-ribosylzeatin, trans-ribosylzeatin, 2-methylthio-trans-ribosylzeatin, ribosylzeatin-5-monosphosphate, N6-methylaminopurine, N6-dimethylaminopurine, 2′-deoxyzeatin riboside, 4-hydroxy-3-methyl-trans-2-butenylaminopurine, ortho-topolin, meta-topolin, benzylaminopurine, ortho-topolin, meta-topolin, benzyla
  • the auxin or the auxin derivative can comprise an active auxin, an inactive auxin, a conjugated auxin, a naturally occurring auxin, or a synthetic auxin, or a combination thereof.
  • the auxin or auxin derivative can comprise indole-3-acetic acid, indole-3-pyruvic acid, indole-3-acetaldoxime, indole-3-acetamide, indole-3-acetonitrile, indole-3-ethanol, indole-3-pyruvate, indole-3-acetaldoxime, indole-3-butyric acid, a phenylacetic acid, 4-chloroindole-3-acetic acid, a glucose-conjugated auxin, or a combination thereof.
  • the enzyme involved in the production or activation of a plant growth stimulating compound can comprise an acetoin reductase, an indole-3-acetamide hydrolase, a tryptophan monooxygenase, an acetolactate synthetase, an ⁇ -acetolactate decarboxylase, a pyruvate decarboxylase, a diacetyl reductase, a butanediol dehydrogenase, an aminotransferase (e.g., tryptophan aminotransferase), a tryptophan decarboxylase, an amine oxidase, an indole-3-pyruvate decarboxylase, an indole-3-acetaldehyde dehydrogenase, a tryptophan side chain oxidase, a nitrile hydrolase, a nitrilase, a peptidase, a protease, an
  • the protease or peptidase can be a protease or peptidase that cleaves proteins, peptides, proproteins, or preproproteins to create a bioactive peptide.
  • the bioactive peptide can be any peptide that exerts a biological activity.
  • bioactive peptides examples include RKN 16D10 and RHPP.
  • the protease or peptidase that cleaves proteins, peptides, proproteins, or preproproteins to create a bioactive peptide can comprise subtilisin, an acid protease, an alkaline protease, a proteinase, an endopeptidase, an exopeptidase, thermolysin, papain, pepsin, trypsin, pronase, a carboxylase, a serine protease, a glutamic protease, an aspartate protease, a cysteine protease, a threonine protease, or a metalloprotease.
  • protease or peptidase can cleave proteins in a protein-rich meal (e.g., soybean meal or yeast extract).
  • a protein-rich meal e.g., soybean meal or yeast extract.
  • the enzyme comprises a chitosanase
  • the chitosanase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 100% identity with SEQ ID NO: 313.
  • the fusion protein can comprise amino acids 20-35 of BclA (amino acids 20-35 of SEQ ID NO: 1) as the targeting sequence and an amino acid sequence comprising SEQ ID NO: 313 as the enzyme that is specific for a cellular component of a bacterium or fungus.
  • the fusion protein can further comprise a linker (e.g., a polyalanine linker) between the targeting sequence and the enzyme.
  • the plant growth stimulating protein or peptide can comprise an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source.
  • the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source can comprise a cellulase, a lipase, a lignin oxidase, a protease, a glycoside hydrolase, a phosphatase, a nitrogenase, a nuclease, an amidase, a nitrate reductase, a nitrite reductase, an amylase, an ammonia oxidase, a ligninase, a glucosidase, a phospholipase, a phytase, a pectinase, a glucanase, a sulfatase, a urease, a xylanase, or a siderophore.
  • fusion proteins comprising enzymes that degrade or modify a bacterial, fungal, or plant nutrient source can aid in the processing of nutrients in the vicinity of the plant and result in enhanced uptake of nutrients by the plant or by beneficial bacteria or fungi in the vicinity of the plant.
  • the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source can comprise a cellulase.
  • the cellulase can comprise an endocellulase (e.g., an endoglucanase such as a Bacillus subtilis endoglucanase, a Bacillus thuringiensis endoglucanase, a Bacillus cereus endoglucanase, or a Bacillus clausii endoglucanase), an exocellulase (e.g., a Trichoderma reesei exocellulase), or a ⁇ -glucosidase (e.g., a Bacillus subtilis ⁇ -glucosidase, a Bacillus thuringiensis ⁇ -glucosidase, a Bacillus cereus ⁇ -glucosidase, or a Bacillus clausii ⁇ -glucosidase).
  • the cellulase preferably comprises a Bacillus subtilis endoglucanase.
  • the endoglucanase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 311.
  • the endoglucanase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 311.
  • the endoglucanase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 311.
  • the endoglucanase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 311.
  • the endoglucanase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 311.
  • the endoglucanase can comprise an amino acid sequence having 100% identity with SEQ ID NO: 311.
  • the fusion protein can comprise amino acids 20-35 of BclA (amino acids 20-35 of SEQ ID NO: 1) as the targeting sequence and an amino acid sequence comprising SEQ ID NO: 311 as the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source.
  • the fusion protein can further comprise a linker (e.g., a polyalanine linker) between the targeting sequence and the enzyme.
  • the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source can comprise a lipase (e.g., a Bacillus subtilis lipase, a Bacillus thuringiensis lipase, a Bacillus cereus lipase, or a Bacillus clausii lipase).
  • a lipase e.g., a Bacillus subtilis lipase, a Bacillus thuringiensis lipase, a Bacillus cereus lipase, or a Bacillus clausii lipase.
  • the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source can comprise a lignin oxidase.
  • the lignin oxidase can comprise a lignin peroxidase, a laccase, a glyoxal oxidase, a ligninase, or a manganese peroxidase.
  • the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source can comprise a protease.
  • the protease can comprise a subtilisin, an acid protease, an alkaline protease, a proteinase, a peptidase, an endopeptidase, an exopeptidase, a thermolysin, a papain, a pepsin, a trypsin, a pronase, a carboxylase, a serine protease, a glutamic protease, an aspartate protease, a cysteine protease, a threonine protease, or a metalloprotease.
  • the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source can comprise a phosphatase.
  • the phosphatase can comprise a phosphoric monoester hydrolase, a phosphomonoesterase (e.g., PhoA4), a phosphoric diester hydrolase, a phosphodiesterase, a triphosphoric monoester hydrolase, a phosphoryl anhydride hydrolase, a pyrophosphatase, a phytase (e.g., a Bacillus subtilis EE148 phytase or a Bacillus thuringiensis BT013A phytase), a trimetaphosphatase, or a triphosphatase.
  • a phosphoric monoester hydrolase e.g., PhoA4
  • a phosphoric diester hydrolase e.g., PhoA4
  • a phosphodiesterase e.g.,
  • the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source can comprise a nitrogenase.
  • the nitrogenase can comprise a Nif family nitrogenase (e.g., Paenibacillus massiliensis NifBDEHKNXV).
  • the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source can comprise a phospholipase.
  • the phospholipase can comprise a phospholipase A1, a phospholipase A2, a phospholipase C, a phospholipase D, or a lysophospholipase.
  • the phospholipase preferably comprises a phospholipase C.
  • the phospholipase C can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 312.
  • the phospholipase C can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 312.
  • the phospholipase C can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 312.
  • the phospholipase C can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 312.
  • the phospholipase C can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 312.
  • the phospholipase C can comprise an amino acid sequence having 100% identity with SEQ ID NO: 312.
  • the fusion protein can comprise amino acids 20-35 of BclA (amino acids 20-35 of SEQ ID NO: 1) as the targeting sequence and an amino acid sequence comprising SEQ ID NO: 312 as the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source.
  • the fusion protein can further comprise a linker (e.g., a polyalanine linker) between the targeting sequence and the enzyme.
  • the protein or peptide of interest can comprise a protein or peptide that protects a plant from a pathogen.
  • the protein or peptide that protects a plant from a pathogen can comprise a plant immune system enhancer protein or peptide.
  • the plant immune system enhancer protein or peptide can comprise a harpin, a harpin-like protein, an ⁇ -elastin, a ⁇ -elastin, a systemin, a phenylalanine ammonia-lyase, an elicitin, a defensin, a cryptogein, a flagellin protein, or a flagellin peptide (e.g., flg22).
  • the protein or peptide that protects a plant from a pathogen can be a protein or peptide that has antibacterial activity, antifungal activity, or both antibacterial and antifungal activity.
  • proteins and peptides include bacteriocins, lysozymes, lysozyme peptides (e.g., LysM), siderophores, avidins, streptavidins, non-ribosomal active peptides, conalbumins, albumins, lactoferrins, lactoferrin peptides (e.g., LfcinB), and TasA.
  • the protein or peptide that protects a plant from a pathogen can be a protein or a peptide that has insecticidal activity, helminthicidal activity, suppresses insect or worm predation, or a combination thereof.
  • the protein or peptide that protects a plant from a pathogen can comprise an insecticidal bacterial toxin (e.g., a VIP insecticidal protein), an endotoxin, a Cry toxin (e.g., a Cry toxin from Bacillus thuringiensis ), a protease inhibitor protein or peptide (e.g., a trypsin inhibitor or an arrowhead protease inhibitor), a cysteine protease, or a chitinase.
  • insecticidal bacterial toxin e.g., a VIP insecticidal protein
  • an endotoxin e.g., a Cry toxin (e.g.,
  • the Cry toxin comprises a Cry toxin from Bacillus thuringiensis
  • the Cry toxin can be a Cry5B protein or a Cry2A protein.
  • Cry5B and Cry2A have both insecticidal and nematocidal activity.
  • the protein that protects a plant from a pathogen can comprise an enzyme.
  • the enzyme can comprise a protease or a lactonase.
  • the proteases and lactonases can be specific for a bacterial signaling molecule (e.g., a bacterial lactone homoserine signaling molecule).
  • the lactonase can comprise 1,4-lactonase, 2-pyrone-4,6-dicarboxylate lactonase, 3-oxoadipate enol-lactonase, actinomycin lactonase, deoxylimonate A-ring-lactonase, gluconolactonase L-rhamnono-1,4-lactonase, limonin-D-ring-lactonase, steroid-lactonase, triacetate-lactonase, or xylono-1,4-lactonase.
  • the enzyme can comprise an enzyme that is specific for a cellular component of a bacterium or fungus.
  • the enzyme can comprise a ⁇ -1,3-glucanase, a ⁇ -1,4-glucanase, a ⁇ -1,6-glucanase, a chitosanase, a chitinase, a chitosanase-like enzyme, a lyticase, a peptidase, a proteinase, a protease (e.g., an alkaline protease, an acid protease, or a neutral protease), a mutanolysin, a stapholysin, or a lysozyme.
  • a protease e.g., an alkaline protease, an acid protease, or a neutral protease
  • mutanolysin a stapholysin, or
  • the enzyme comprises a chitosanase
  • the chitosanase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 313.
  • the chitosanase can comprise an amino acid sequence having at least 100% identity with SEQ ID NO: 313.
  • the fusion protein can comprise amino acids 20-35 of BclA (amino acids 20-35 of SEQ ID NO: 1) as the targeting sequence and an amino acid sequence comprising SEQ ID NO: 313 as the enzyme that is specific for a cellular component of a bacterium or fungus.
  • the fusion protein can further comprise a linker (e.g., a polyalanine linker) between the targeting sequence and the enzyme.
  • the pathogen can comprise a protein or a peptide of interest that protects a plant from a bacterial pathogen, a fungal pathogen, a worm pathogen, or an insect pathogen.
  • the bacterial pathogen can comprise an ⁇ -class Proteobacterium, a ⁇ -class Proteobacterium, a ⁇ -class Proteobacterium, or a combination thereof; or wherein the bacterial pathogen comprises Agrobacterium tumefaciens, Pantoea stewartii, Erwinia carotovora, Ralstonia solanacearum, Pseudomonas syringae, Pseudomonas aeruginosa, Xanthomonas campestris , or a combination thereof.
  • the protein or peptide that protects a plant from a pathogen can comprise a protein or peptide protects the plant from predation by a worm or an insect pathogen.
  • the worm or insect pathogen can comprise an army worm, a black cutworm, a European corn borer, a fall armyworm, a cutworm, a Japanese beetle, a lesser cornstalk borer, a maize billbug, a seed corn maggot, a webworm, a southern cornstalk borer, a southern corn rootworm, a southern potato wireworm, a stalk borer, a sugarcane beetle, a white grub, a cabbage looper, a boll weevil, a yellow striped armyworm, a cereal leaf beetle, a chinch bug, an aphid, a beet armyworm, a Mexican bean beetle, a soybean looper, soybean stem borer, or a combination thereof.
  • the protein or peptide of interest can comprise a protein or peptide that enhances stress resistance in a plant.
  • the protein or peptide that enhances stress resistance in a plant can comprise an enzyme that degrades a stress-related compound.
  • Stress-related compounds include, but are not limited to, aminocyclopropane-1-carboxylic acid (ACC), reactive oxygen species, nitric oxide, oxylipins, and phenolics. Specific reactive oxygen species include hydroxyl, hydrogen peroxide, oxygen, and superoxide.
  • ACC aminocyclopropane-1-carboxylic acid
  • reactive oxygen species include hydroxyl, hydrogen peroxide, oxygen, and superoxide.
  • the enzyme that degrades a stress-related compound can comprise a superoxide dismutase, an oxidase, a catalase, an aminocyclopropane-1-carboxylic acid deaminase, a peroxidase, an antioxidant enzyme, or an antioxidant peptide.
  • the superoxide dismutase can comprise superoxide dismutase 1 (SODA1) or superoxide dismutase 2 (SODA2).
  • the superoxide dismutase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having 100% identity with SEQ ID NO: 155 or 156.
  • the protein or peptide that enhances stress resistance in a plant can comprise a protein or peptide that protects a plant from an environmental stress.
  • the environmental stress can comprise, for example, drought, flood, heat, freezing, salt, heavy metals, low pH, high pH, or a combination thereof.
  • the protein or peptide that protects a plant from an environmental stress can comprises an ice nucleation protein, a prolinase, a phenylalanine ammonia lyase, an isochorismate synthase, an isochorismate pyruvate lyase, or a choline dehydrogenase.
  • the protein or peptide of interest can comprise a plant binding protein or peptide.
  • the plant binding protein or peptide can be any protein or peptide that is capable of specifically or non-specifically binding to any part of a plant (e.g., a plant root or an aerial portion of a plant such as a leaf, stem, flower, or fruit) or to plant matter.
  • the plant binding protein or peptide can be a root binding protein or peptide, or a leaf binding protein or peptide.
  • Suitable plant binding proteins and peptides include adhesins (e.g., rhicadhesin), flagellins, omptins, lectins, expansins, biofilm structural proteins (e.g., TasA or YuaB) pilus proteins, curlus proteins, intimins, invasins, agglutinins, and afimbrial proteins.
  • adhesins e.g., rhicadhesin
  • flagellins e.g., rhicadhesin
  • lectins e.g., lectins
  • expansins e.g., expansins
  • biofilm structural proteins e.g., TasA or YuaB pilus proteins
  • curlus proteins e.g., intimins, invasins, agglutinins, and afimbrial proteins.
  • Nitric oxide is a powerful germinant that when present in proximity to a plant seed, increases germination.
  • the present invention relates to fusion proteins comprising any of the targeting sequences, exosporium proteins, exosporium protein fragments, or spore coat proteins described herein and an enzyme that catalyzes the production of nitric oxide synthase.
  • the protein or peptide of interest can comprise an enzyme that catalyzes the production of nitric oxide.
  • Fusion proteins comprising an enzyme that catalyzes the production of nitric oxide can be expressed in recombinant Bacillus cereus family members or recombinant spore-forming bacteria for the purpose of delivering the enzyme that catalyzes the production of nitric oxide to a plant seed, a plant, a plant growth medium, or an area surrounding a plant or a plant seed, and thereby stimulating germination.
  • the enzyme that catalyzes the production of nitric oxide can comprise a nitric oxide synthase (e.g., a Bacillus thuringiensis nitric oxide synthase or a Bacillus subtilis nitric oxide synthase, for example a nitric oxide synthase from Bacillus thuringiensis BT013A or Bacillus subtilis 168) or an arginase.
  • a nitric oxide synthase e.g., a Bacillus thuringiensis nitric oxide synthase or a Bacillus subtilis nitric oxide synthase, for example a nitric oxide synthase from Bacillus thuringiensis BT013A or Bacillus subtilis 168
  • an arginase e.g., a Bacillus thuringiensis nitric oxide synthase or a Bacillus subtilis nitric oxide synthase
  • the nitric oxide synthase can comprise one of the amino acid sequences described below in Table 8.
  • the nitric oxide synthase can also comprise a sequence having a high degree of sequence identity with the nitric oxide synthase sequences shown in Table 8 above.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 85% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 98% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 99% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 100% sequence identity with SEQ ID NO: 260 or 261.
  • the fusion protein can comprise one of the amino acid sequences shown in Table 9 below.
  • the targeting sequence is shown in boldface text, a six amino acid alanine linker is indicated by underlining, and the sequence of the nitric oxide synthase is shown in plain text.
  • the fusion protein can comprise SEQ ID NO: 262 or 263.
  • fusion proteins comprising a nitric oxide synthase Fusion protein (SEQ ID NO) Amino Acid Sequence Met + Amino acids MAFDPNLVGPTLPPIPP AAAAAA MEEKE 20-35 of BclA, ILWNEAKAFIAACYQELGKEEEVKDRLA alanine linker, DIKSEIDLTGSYVHTKEELEHGAKMAWR and Bacillus NSNRCIGRLFWNSLNVIDRRDVRTKEEV subtilis Nitric RDALFHHIETATNNGKIRPTITIFPPEE Oxide Synthatase KGEKQVEIWNHQLIRYAGYESDGERIGD (SEQ ID NO: 262) PASCSLTAACEELGWRGERTDFDLLPLI FRMKGDEQPVWYELPRSLVIEVPITHPD IEAFSDLELKWYGVPIISDMKLEVGGIH YNAAPFNGWYMGTEIGARNLADEKRYDK LKKVASVIGIAADYNTDLWKDQALVEL
  • Nitric oxide synthases from a number species including Bacillus thuringiensis, Bacillus cereus, Bacillus subtilis and Bacillus mycoides can be used as the protein or peptide of interest in the fusion proteins.
  • nucleic acids delivered to plants in the field would be desirable, but has been hampered by the instability of nucleic acids, which degrade rapidly when introduced the environment (e.g., into a plant growth medium such as soil).
  • the present invention relates to fusion proteins comprising any of the targeting sequences, exosporium proteins, exosporium protein fragments, or spore coat proteins described herein and a nucleic acid binding protein or peptide.
  • fusion proteins stabilize nucleic acids and can be used to deliver nucleic acids to soil and/or to plants.
  • the protein or peptide of interest can comprise a nucleic acid binding protein or peptide.
  • the nucleic acid binding protein or peptide can comprise an RNA binding protein or peptide or a DNA binding protein or peptide.
  • RNA binding protein or peptide can comprise a non-specific RNA binding protein or peptide or a specific RNA binding protein or peptide.
  • the RNA binding peptide can comprise an Hfq protein (e.g., a Bacillus thuringiensis Hqf protein).
  • Hfq protein e.g., a Bacillus thuringiensis Hqf protein
  • the DNA binding protein or peptide can comprise a small acid-soluble spore protein (SASP).
  • SASP small acid-soluble spore protein
  • the SASP can comprise a SASP encoded by an SspA gene, an SspB gene, an SspC gene, an SspD gene, an SspE gene, an SspF gene, an SspG gene, an SspH gene, an SspI gene, an SspJ gene, an SspK gene, an SspL gene, an SspM gene, an SspN gene, an SspO gene, or an SspP gene.
  • the SASP can comprise a SASP ⁇ , a SASP ⁇ , or a SASP ⁇ .
  • the SASP can comprise a Bacillus thuringiensis SASP.
  • the nucleic acid binding protein can comprise one of the amino acid sequences described below in Table 10.
  • the nucleic acid binding protein can also comprise a sequence having a high degree of sequence identity with any of the sequences shown above in Table 10.
  • the nucleic acid binding protein can comprise a nucleic acid sequence having at least 85% identity with any of SEQ ID NOs: 264-266.
  • the nucleic acid binding protein can comprise a nucleic acid sequence having at least 90% identity with any of SEQ ID NOs: 264-266.
  • the nucleic acid binding protein can comprise a nucleic acid sequence having at least 95% identity with any of SEQ ID NOs: 264-266.
  • the nucleic acid binding protein can comprise a nucleic acid sequence having at least 98% identity with any of SEQ ID NOs: 264-266.
  • the nucleic acid binding protein can comprise a nucleic acid sequence having at least 99% identity with any of SEQ ID NOs: 264-266.
  • the nucleic acid binding protein can comprise a nucleic acid sequence having at least 100% identity with any of SEQ ID NOs: 264-266.
  • the fusion protein can comprise one of the amino acid sequences shown in Table 11 below.
  • the targeting sequence is shown in boldface text, a six amino acid alanine linker is indicated by underlining, and the sequence of the nucleic acid binding protein or peptide (SASP ⁇ , SASP ⁇ , or Hfq) is shown in plain text.
  • the fusion protein can comprise SEQ ID NO: 267, 268, or 269.
  • fusion proteins comprising a nucleic acid binding protein Fusion protein (SEQ ID NO) Amino Acid Sequence Met + Amino acids MAFDPNLVGPTLPPIPP AAAAAAAA MA 20-35 of BclA, alanine QQSRSRSNNNNDLLIPQAASAIEQMKL linker, and SASP ⁇ EIASEFGVQLGAETTSRANGSVGGEIT (SEQ ID NO: 267) KRLVRLAQQNMGGQFH Met + Amino acids MAFDPNLVGPTLPPIPP AAAAAAAA MA 20-35 of BclA, alanine NNNSGNSNNLLVPGAAQAIDQMKLEIA linker, and SASP ⁇ KSEFGVNLGADTTSRANGSVGGEITRL (SEQ ID NO: 268) VSFAQQNMGGGQF Met + Amino acids MAFDPNLVGPTLPPIPP AAAAAAAA MK 20-35 of BclA, alanine PINIQDQFLNQIRKENTY
  • Nucleases can also be used to both bind to and cleave nucleic acid molecules. Nucleases have high affinity for RNA and DNA molecules, and exert their enzymatic activity by cleaving RNA and/or DNA molecules into smaller RNA and/or DNA fragments. Nucleases can be specific, recognizing and cleaving specific DNA or RNA sequences, or non-specific, cleaving any DNA and/or RNA that they come in contact with.
  • Nucleases can be categorized into exonucleases (nucleases that cleave nucleotides off of the ends of RNA and/or DNA molecules), or endonucleases (nucleases that cleave a phosphodiester bond within a polynucleotide chain).
  • Each nuclease enzyme has an active site that comprises particular amino acids that act to catalyze the cleavage of the nucleic acid molecule. Mutation of these active sites can inactivate the active site and allow for high affinity binding of the nuclease to its nucleic acid substrate, without cleavage of the substrate. Thus, such mutants can bind to and stabilize the nucleic acid molecule without cleaving the nucleic acid molecule.
  • the nucleic acid binding protein can comprise a nuclease (e.g., a nuclease having an inactivated active site).
  • a nucleic acid molecule can be bound to the nucleic acid binding protein or peptide.
  • the nucleic acid can comprise, for example, a modulating RNA molecule; an RNAi molecule; a microRNA; an aptamer; or a DNA molecule that encodes a modulating RNA molecule, an RNAi molecule, a microRNA, or an aptamer.
  • a Bacillus cereus family member can serve as a host for expression of fusion proteins comprising a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of the Bacillus cereus family member; serve as a host for expression of modulator proteins that modulate the expression of a fusion protein; can serve as a host for overexpression of an exosporium enzyme; can be genetically inactivated; or can comprise a mutation or other genetic alteration that allows for collection of free exosporium.
  • the recombinant Bacillus cereus family member can coexpress two or more of any of the fusion proteins discussed above.
  • the recombinant Bacillus cereus family member can coexpress at least one fusion protein that comprises a plant binding protein or peptide, together with a fusion protein comprising a plant growth stimulating protein or peptide, a fusion protein comprising a protein or peptide that protects a plant from a pathogen, a fusion protein comprising protein or peptide that enhances stress resistance in a plant, a fusion protein comprising an enzyme that catalyzes the production of nitric oxide, or a fusion protein comprising a nucleic acid binding protein or peptide.
  • the recombinant Bacillus cereus family member can comprise any Bacillus species that is capable of producing an exosporium.
  • the recombinant Bacillus cereus family member can comprise Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis , or a combination thereof.
  • the recombinant Bacillus cereus family member can comprise Bacillus thuringiensis or Bacillus mycoides.
  • any Bacillus cereus family member can be conjugated, transduced, or transformed with a vector encoding the fusion protein using standard methods known in the art (e.g., by electroporation).
  • the bacteria can then be screened to identify transformants by any method known in the art. For example, where the vector includes an antibiotic resistance gene, the bacteria can be screened for antibiotic resistance.
  • DNA encoding the fusion protein can be integrated into the chromosomal DNA of a B. cereus family member host.
  • the recombinant Bacillus cereus family member can then exposed to conditions which will induce sporulation. Suitable conditions for inducing sporulation are known in the art.
  • the recombinant Bacillus cereus family member can be plated onto agar plates, and incubated at a temperature of about 30° C. for several days (e.g., 3 days).
  • Inactivated strains non-toxic strains, or genetically manipulated strains of any of the above species can also suitably be used.
  • a Bacillus thuringiensis that lacks the Cry toxin can be used.
  • the recombinant B. cereus family member spores expressing the fusion protein have been generated, they can be inactivated to prevent further germination once in use. Any method for inactivating bacterial spores that is known in the art can be used.
  • Suitable methods include, without limitation, heat treatment, gamma irradiation, x-ray irradiation, UV-A irradiation, UV-B irradiation, chemical treatment (e.g., treatment with gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, or any combination thereof), or a combination thereof.
  • chemical treatment e.g., treatment with gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, or any combination thereof
  • spores derived from nontoxigenic strains, or genetically or physically inactivated strains can be used.
  • Bacillus cereus family member strains have inherent beneficial attributes. For example, some strains have plant-growth promoting effects. Any of the recombinant Bacillus cereus family members described herein can comprise a plant-growth promoting strain of bacteria.
  • the plant-growth promoting strain of bacteria can comprise a strain of bacteria that produces an insecticidal toxin (e.g., a Cry toxin), produces a fungicidal compound (e.g., a ⁇ -1,3-glucanase, a chitosanase, a lyticase, or a combination thereof), produces a nematocidal compound (e.g., a Cry toxin), produces a bacteriocidal compound, is resistant to one or more antibiotics, comprises one or more freely replicating plasmids, binds to plant roots, colonizes plant roots, forms biofilms, solubilizes nutrients, secretes organic acids, or any combination thereof.
  • an insecticidal toxin e.g., a Cry toxin
  • produces a fungicidal compound e.g., a ⁇ -1,3-glucanase, a chitosanase, a
  • the plant growth-promoting strain of bacteria can comprise (a) Bacillus mycoides BT155 (NRRL No. B-50921), (b) Bacillus mycoides EE118 (NRRL No. B-50918), (c) Bacillus mycoides EE141 (NRRL No. B-50916), (d) Bacillus mycoides BT46-3 (NRRL No. B-50922), (e) Bacillus cereus family member EE128 (NRRL No. B-50917), (f) Bacillus thuringiensis BT013A (NRRL No.
  • Bacillus thuringiensis BT013A is also known as Bacillus thuringiensis 4Q7.
  • Each of the strains (h) through (j) were deposited with the USDA ARS on Aug. 19, 2015, and is identified by the NRRL deposit number provided in parentheses.
  • the recombinant Bacillus cereus family member comprising a plant-growth promoting strain of bacteria can comprise Bacillus mycoides BT155, Bacillus mycoides EE141, or Bacillus thuringiensis BT013A.
  • the recombinant Bacillus cereus family member can comprises an endophytic strain of bacteria.
  • the endophytic strain of bacteria can comprise Bacillus cereus family member EE349, Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, or Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377; Bacillus pseudomycoides EE-B00366; or Bacillus mycoides EE-B00363.
  • Bacillus cereus family member EE349 is also a plant growth promoting strain of bacteria and is described above. As discussed further in the Examples below, Bacillus cereus family member EE349 has also been found to be endophytic.
  • Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377; Bacillus pseudomycoides EE-B00366; or Bacillus mycoides EE-B00363 are described further below in Section XIV.
  • the endophytic strain of bacteria can comprise Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377; Bacillus pseudomycoides EE-B00366; or Bacillus mycoides EE-B00363.
  • the recombinant Bacillus cereus family member can comprise a strain of bacteria that is capable of degrading an herbicide or a pesticide.
  • Bacillus cereus family member EE349, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, and Bacillus mycoides EE-B00363 have been found to be capable of degrading herbicides and/or pesticides.
  • the strain of bacteria that is capable of degrading an herbicide can comprise Bacillus cereus family member EE349, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, or Bacillus mycoides EE-B00363.
  • the strain of bacteria that is capable of degrading an herbicide or a pesticide can degrade a sulfonylurea herbicide (e.g., sulfentrazone), an aryl triazine herbicide, dicamba, 2,4-D, a phenoxy herbicide, a pyrethrin, a pyrethroid, or a combination thereof.
  • a sulfonylurea herbicide e.g., sulfentrazone
  • an aryl triazine herbicide e.g., sulfentrazone
  • dicamba e.g., 2,4-D
  • a phenoxy herbicide e.g., pyrethrin, a pyrethroid, or a combination thereof.
  • the strain of bacteria that is capable of degrading a pesticide can be a strain of bacteria that is capable of degrading a pyrethrin.
  • the recombinant Bacillus cereus family member can comprise a probiotic strain of bacteria.
  • the probiotic strain of bacteria can comprise Bacillus cereus family member EE349, Bacillus cereus family member EE439, Bacillus thuringiensis EE417, or Bacillus cereus EE444.
  • the recombinant Bacillus cereus family member can comprise an inactivating mutation in its BclA gene, its CotE gene, or its CotO gene (e.g., a knock-out of the BclA gene, CotE gene, or CotO gene).
  • the recombinant Bacillus cereus family member can comprise an inactivating mutation in its BclA gene (e.g., a knock-out of the BclA gene). It has been found that expression of fusion proteins in a recombinant Bacillus cereus family member having such a mutation results in increased expression levels of the fusion protein.
  • the present invention further relates to endophytic bacterial strains. While many bacteria of the rhizosphere have a symbiotic relationship with the plant, only a small subset of these bacteria are capable of being internalized into the plant and growing endophytically. As described further in the Examples hereinbelow, several Bacillus cereus family member strains and several non- Bacillus cereus family member bacterial strains were isolated from corn seedlings and found to have the ability to grow endophytically in plants.
  • the present invention relates to biologically pure bacterial cultures of bacteria that have the ability to grow endophytically.
  • the bacterial strain in each of these bacterial cultures can be: (a) Bacillus cereus family member EE439 (NRRL B-50979); (b) Bacillus thuringiensis EE417 (NRRL B-50974); (c) Bacillus cereus EE444 (NRRL B-50977); (d) Bacillus thuringiensis EE319 (NRRL B-50983), (e) Bacillus thuringiensis EE-B00184 (NRRL B-67122); (f) Bacillus cereus family member EE-B00377 (NRRL B-67119); (g) Bacillus pseudomycoides EE-B00366 (NRRL B-67120); or (h) Bacillus mycoides EE-B00363 (NRRL B-67121).
  • strains (a) through (c) were deposited with the United States Department of Agriculture (USDA) Agricultural Research Service (ARS), having the address 1815 North University Street, Peoria, Ill. 61604 U.S.A., on Sep. 10, 2014, and are identified by the NRRL numbers provided in parentheses following the names of each strain.
  • Strain (d) was deposited with the USDA ARS on Sep. 17, 2014 and is identified by the NRRL number provided in parentheses following the name of the strain.
  • strains (e) through (h) was deposited with the USDA ARS on Aug. 19, 2015 and are identified by the NRRL numbers provided in parentheses following the names of each strain.
  • Bacillus cereus family member EE439 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 277.
  • Bacillus thuringiensis EE417 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 278.
  • Bacillus cereus EE444 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 279.
  • Bacillus thuringiensis EE319 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 280.
  • Bacillus thuringiensis EE-B00184 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 301.
  • Bacillus cereus family member EE-B00377 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 304.
  • Bacillus pseudomycoides EE-B00366 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 303.
  • Bacillus mycoides EE-B00363 (NRRL B-67121) and the bacteria has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 302.
  • the 16S rRNA sequences are listed below in Table 13.
  • the present invention further relates to a biologically pure bacterial culture wherein the bacteria in the bacterial culture are mutants of Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, or Bacillus mycoides EE-B00363 comprising one or more mutations, wherein the bacteria are endophytic.
  • the present invention also relates to other biologically pure bacterial cultures of bacteria (non- Bacillus cereus family members) that have the ability to grow endophytically. These strains were isolated from corn seedlings, as described in detail below in the Examples.
  • the bacterial strain in each of these bacterial cultures can be (a) Bacillus megaterium EE385 (NRRL B-50980), (b) Bacillus sp. EE387 (NRRL B-50981), (c) Bacillus circulans EE388 (NRRL B-50982), (d) Bacillus subtilis EE405 (NRRL B-50978), (e) Lysinibacillus fusiformis EE442 (NRRL B-50975), (f) Lysinibcaillus sphaericus EE443 (NRRL B-50976), or (g) Bacillus pumilus EE-B00143 (NRRL B-67123).
  • strains (a) through (f) were deposited with the United States Department of Agriculture (USDA) Agricultural Research Service (ARS), having the address 1815 North University Street, Peoria, Ill. 61604 U.S.A., on Sep. 10, 2014, and are identified by the NRRL numbers provided in parentheses following the names of each strain. Following deposit, Bacillus sp. EE387 was determined to be a Bacillus pumilus -like strain. Strain (g) was deposited with the USDA ARS on Aug. 19, 2015 and is identified by the NRRL number provided in parentheses following its name.
  • USDA United States Department of Agriculture
  • ARS Agricultural Research Service
  • Bacillus megaterium EE385 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 281.
  • Bacillus sp. EE387 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 282.
  • Bacillus circulans EE388 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 283.
  • Bacillus subtilis EE405 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 284 .
  • Lysinibacillus fusiformis EE442 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 285 .
  • Lysinibcaillus sphaericus EE443 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 286.
  • Bacillus pumilus EE-B00143 has a 16S ribosomal RNA sequence having at least 98%, at least 99%, or 100% sequence identity with the sequence of SEQ ID NO: 305.
  • the 16s rRNA sequences are listed below in Table 14.
  • the present invention further relates to a biologically pure bacterial culture wherein the bacteria in the bacterial culture are mutants of Bacillus megaterium EE385, Bacillus sp. EE387, Bacillus circulans EE388, Bacillus subtilis EE405 , Lysinibacillus fusiformis EE442, or Lysinibcaillus sphaericus EE443, comprising one or more mutations, wherein the bacteria are endophytic.
  • the present invention also relates to a biologically pure bacterial culture wherein the bacteria in the bacterial culture are mutants of Bacillus megaterium EE385, Bacillus sp. EE387, Bacillus circulans EE388, Bacillus subtilis EE405, Lysinibacillus fusiformis EE442, or Lysinibcaillus sphaericus EE443, comprising one or more mutations, wherein the bacteria are probiotic.
  • the invention further relates to inoculums of any of the biologically pure bacterial strains described above in the preceding section.
  • the inoculums are for application to plants, plant seeds, a plant growth medium, or an area surrounding a plant or a plant seed, wherein the inoculum comprises an effective amount of any one of the biologically pure bacterial cultures and an agriculturally acceptable carrier.
  • the inoculum can comprise an effective amount of a mixture comprising at least two of the biologically pure bacterial cultures described above in the immediately preceding section.
  • the inoculum can further comprise an effective amount of a rhizobacteria.
  • the rhizobacteria can be a biologically pure bacterial culture of a rhizobacteria strain.
  • the rhizobacteria can comprise Bradyrhizobium genus bacteria (e.g., Bradyrhizobium japonicum ), Rhizobium genus bacteria (e.g., Rhizobium phaseoli, Rhizobium leguminosarum , or a combination thereof), or a combination thereof.
  • a plant seed is also provided which is coated with: (i) an enzyme that catalyzes the production of nitric oxide; (ii) a superoxide dismutase or (iii) a recombinant microorganism that expresses an enzyme that catalyzes the production of nitric oxide or a superoxide dismutase, wherein the expression of the enzyme that catalyzes the production of nitric oxide or the superoxide dismutase is increased as compared to the expression of the enzyme that catalyzes the production of nitric oxide or the superoxide dismutase in a wild-type microorganism under the same conditions.
  • the enzyme that catalyzes the production of nitric oxide can comprise a nitric oxide synthase or an arginase.
  • the enzyme that catalyzes the production of nitric oxide can comprise a nitric oxide synthase, such as a nitric oxide synthase from Bacillus thuringiensis BT013A or Bacillus subtilis 168.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 85% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 98% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having at least 99% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can comprise an amino acid sequence having 100% sequence identity with SEQ ID NO: 260 or 261.
  • the superoxide dismutase can comprise superoxide dismutase 1 (SODA1) or superoxide dismutase 2 (SODA2).
  • the superoxide dismutase comprises an amino acid sequence having at least 85% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase comprises an amino acid sequence having at least 98% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase comprises an amino acid sequence having at least 99% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase comprises an amino acid sequence having at least 100% identity with SEQ ID NO: 155 or 156.
  • the recombinant microorganism can comprise a Bacillus species, Escherechia coli , an Aspergillus species such as Aspergillus niger , or a Saccharomyces species such as Saccharomyces cerevisiae.
  • the recombinant microorganism can comprise a Bacillus cereus family member, Bacillus subtilis, Bacillus licheniformis , or Bacillus megaterium.
  • Amino acid sequences for exemplary nitric oxide synthetase enzymes are provided above in Table 8.
  • Amino acid sequences for exemplary superoxide dismutases are provided above in Table 2.
  • Formulations comprise a recombinant Bacillus cereus family member as described herein, exosporium fragments derived from spores of a recombinant Bacillus cereus family member as described herein or a recombinant spore-forming bacterium as described herein, and an agriculturally acceptable carrier.
  • the agriculturally acceptable carrier can comprise an additive, such as an oil, a gum, a resin, a clay, a polyoxyethylene glycol, a terpene, a viscid organic, a fatty acid ester, a sulfated alcohol, an alkyl sulfonate, a petroleum sulfonate, an alcohol sulfate, a sodium alkyl butane diamate, a polyester of sodium thiobutane dioate, a benzene acetonitrile derivative, a proteinaceous material, or a combination thereof.
  • an additive such as an oil, a gum, a resin, a clay, a polyoxyethylene glycol, a terpene, a viscid organic, a fatty acid ester, a sulfated alcohol, an alkyl sulfonate, a petroleum sulfonate, an alcohol sulfate, a sodium alkyl butane diamate, a polyester of
  • the agriculturally acceptable carrier can comprise a thickener, such as a long chain alkylsulfonate of polyethylene glycol, a polyoxyethylene oleate, or a combination thereof; a surfactant such as a heavy petroleum oil, a heavy petroleum distillate, a polyol fatty acid ester, a polyethoxylated fatty acid ester, an aryl alkyl polyoxyethylene glycol, an alkyl amine acetate, an alkyl aryl sulfonate, a polyhydric alcohol, an alkyl phosphate, or a combination thereof; or an anti-caking agent such as a sodium salt (e.g., a sodium salt of monomethyl naphthalene sulfonate, a sodium salt of dimethyl naphthalene sulfonate, a sodium sulfite, a sodium sulfate, or a combination thereof), a calcium carbonate, diatomaceous earth, or a combination thereof.
  • the additive can comprise a proteinaceous material such as a milk product, wheat flour, soybean meal, blood, albumin, gelatin, alfalfa meal, yeast extract, or a combination thereof;
  • a proteinaceous material such as a milk product, wheat flour, soybean meal, blood, albumin, gelatin, alfalfa meal, yeast extract, or a combination thereof;
  • the agriculturally acceptable carrier can comprise vermiculite, charcoal, sugar factory carbonation press mud, rice husk, carboxymethyl cellulose, peat, perlite, fine sand, calcium carbonate, flour, alum, a starch, talc, polyvinyl pyrrolidone, or a combination thereof.
  • the formulation can comprise a seed coating formulation, a liquid formulation for application to plants or to a plant growth medium, or a solid formulation for application to plants or to a plant growth medium.
  • the seed coating formulation can comprise an aqueous or oil-based solution for application to seeds or a powder or granular formulation for application to seeds.
  • the liquid formulation for application to plants or to a plant growth medium can comprise a concentrated formulation or a ready-to-use formulation.
  • the solid formulation for application to plants or to a plant growth medium can comprise a granular formulation or a powder agent.
  • the formulation further can comprise a fertilizer, a micronutrient fertilizer material, an insecticide, an herbicide, a plant growth amendment, a fungicide, an insecticide, a molluscicide, an algicide, a bacterial inoculant, a fungal inoculant, or a combination thereof.
  • the bacterial inoculant can comprise a bacterial inoculant of the genus Rhizobium , a bacterial inoculant of the genus Bradyrhizobium , a bacterial inoculant of the genus Mesorhizobium , a bacterial inoculant of the genus Azorhizobium , a bacterial inoculant of the genus Allorhizobium , a bacterial inoculant of the genus Sinorhizobium , a bacterial inoculant of the genus Kluyvera , a bacterial inoculant of the genus Azotobacter , a bacterial inoculant of the genus Pseudomonas , a bacterial inoculant of the genus Azospirillium , a bacterial inoculant of the genus Bacillus , a bacterial inoculant of the genus Streptomyces ,
  • the bacterial inoculant can comprise a plant-growth promoting strain of bacteria.
  • the plant-growth promoting strain of bacteria can produce an insecticidal toxin, produce a fungicidal compound, produce a nematocidal compound, produce a bacteriocidal compound, can be resistant to one or more antibiotics, can comprise one or more freely replicating plasmids, bind to plant roots, colonize plant roots, form biofilms, solubilize nutrients, secrete organic acids, or combinations thereof.
  • the bacterial inoculant can comprise Bacillus aryabhattai CAP53 (NRRL No. B-50819), Bacillus aryabhattai CAP56 (NRRL No. B-50817), Bacillus flexus BT054 (NRRL No. B-50816), Paracoccus kondratievae NC35 (NRRL No. B-50820), Bacillus mycoides BT155 (NRRL No. B-50921), Enterobacter cloacae CAP12 (NRRL No. B-50822), Bacillus nealsonii BOBA57 (NRRL No. NRRL B-50821), Bacillus mycoides EE118 (NRRL No.
  • Bacillus subtilis EE148 (NRRL No. B-50927), Alcaligenes faecalis EE107 (NRRL No. B-50920), Bacillus mycoides EE141 (NRRL NO. B-50916), Bacillus mycoides BT46-3 (NRRL No. B-50922), Bacillus cereus family member EE128 (NRRL No. B-50917), Bacillus thuringiensis BT013A (NRRL No. B-50924), Paenibacillus massiliensis BT23 (NRRL No. B-50923), Bacillus cereus family member EE349 (NRRL No. B-50928), Bacillus subtilis EE218 (NRRL No.
  • Bacillus megaterium EE281 (NRRL No. B-50925), Bacillus cereus family member EE-B00377 (NRRL B-67119); Bacillus pseudomycoides EE-B00366 (NRRL B-67120), Bacillus mycoides EE-B00363 (NRRL B-67121), Bacillus pumilus EE-B00143 (NRRL B-67123), or Bacillus thuringiensis EE-B00184 (NRRL B-67122) or a combination thereof.
  • USDA United States Department of Agriculture
  • ARS Agricultural Research Service
  • the biochemical assays for confirmed Gram-positive strains such as Bacillus and Paenibacillus included growth on PEA medium and nutrient agar, microscopic examination, growth on 5% and 7.5% NaCl medium, growth at pH 5 and pH 9, growth at 42° C.
  • Partial 16S rRNA sequences for the strains Bacillus mycoides BT155, Bacillus mycoides EE118, Bacillus mycoides EE141, Bacillus mycoides BT46-3, Bacillus cereus family member EE128, Bacillus thuringiensis BT013A, and Bacillus cereus family member EE349 are provided in Table 12 above.
  • the formulation can comprise a plant-growth promoting strain of bacteria comprising Paracoccus kondratievae NC35, Bacillus aryabhattai CAP53, or Bacillus megaterium EE281, wherein the formulation further comprises any of the recombinant Bacillus cereus family members described herein, including any of the recombinant plant-growth promoting Bacillus cereus family member strains herein (e.g., recombinant Bacillus mycoides BT155, Bacillus mycoides EE141, or Bacillus thuringiensis BT013A).
  • a plant-growth promoting strain of bacteria comprising Paracoccus kondratievae NC35, Bacillus aryabhattai CAP53, or Bacillus megaterium EE281, wherein the formulation further comprises any of the recombinant Bacillus cereus family members described herein, including any of the recombinant plant-growth promoting Bacillus cereus family member strains herein (e
  • the fungal inoculant can comprise a fungal inoculant of the family Glomeraceae, a fungal inoculant of the family Claroidoglomeraceae, a fungal inoculant of the family Gigasporaceae, a fungal inoculant of the family Acaulosporaceae, a fungal inoculant of the family Sacculosporaceae, a fungal inoculant of the family Entrophosporaceae, a fungal inoculant of the family Pacidsporaceae, a fungal inoculant of the family Diversisporaceae, a fungal inoculant of the family Paraglomeraceae, a fungal inoculant of the family Archaeosporaceae, a fungal inoculant of the family Geosiphonaceae, a fungal inoculant of the family Ambisporaceae, a fungal inoculant of the family Scutellosporaceae, a fun
  • the spore-forming bacterium alone or in combination with the insecticide, can further comprise an effective amount of at least one fungicide.
  • Typical fungicidal ingredients also include Captan (N-trichloromethyl)thio-4-cyclohexane-1,2-dicarboximide), Fludioxoni 1 (4-(2,2-difluoro-1,3-benzodioxol-4-yl)-1-H-pyrrol-3-carbonitril; carbendazim iprodione (commercially available under the tradename Rovral®), tebuconazole, thiabendazole, azoxystrobin, prochloraz, and Oxadixyl (N-(2,6-dimethylphenyl)-2-methoxy-N-(2-oxo-3-oxazolidinyl) acetamide).
  • a formulation, plant seed, or inoculum comprises a fungicide
  • the fungicide can comprise aldimorph, ampropylfos, ampropylfos potassium, andoprim, anilazine, azaconazole, azoxystrobin, benalaxyl, benodanil, benomyl, benzamacril, benzamacryl-isobutyl, bialaphos, binapacryl, biphenyl, bitertanol, blasticidin-S, boscalid, bromuconazole, bupirimate, buthiobate, calcium polysulphide, capsimycin, captafol, captan, carbendazim, carvon, quinomethionate, chlobenthiazone, chlorfenazole, chloroneb, chloropicrin, chlorothalonil, chlozolinate, clozylacon, cufraneb, cymoxanil,
  • suitable fungicides include the following: (1) a compound capable to inhibit the nucleic acid synthesis like benalaxyl, benalaxyl-M, bupirimate, chiralaxyl, clozylacon, dimethirimol, ethirimol, furalaxyl, hymexazol, metalaxyl, metalaxyl-M, ofurace, oxadixyl, oxolinic acid; (2) a compound capable to inhibit the mitosis and cell division like benomyl, carbendazim, diethofencarb, ethaboxam, fuberidazole, pencycuron, thiabendazole thiophanate-methyl, zoxamide; (3) a compound capable to inhibit the respiration for example as CI-respiration inhibitor like diflumetorim; as CII-respiration inhibitor like boscalid, fenfuram, flutolanil, furametpyr, fur
  • the fungicide can comprise a substituted benzene, a thiocarbamate, an ethylene bis dithiocarbamate, a thiophthalidamide, a copper compound, an organomercury compound, an organotin compound, a cadmium compound, anilazine, benomyl, cyclohexamide, dodine, etridiazole, iprodione, metlaxyl, thiamimefon, triforine, or a combination thereof.
  • fungicide can be a foliar fungicide.
  • Foliar fungicides include copper, mancozeb, penthiopyrad, triazoles, cyproconazole, metconazole, propiconazole, prothioconazole, tebuconazole, azoxystrobin, pyraclastobin, fluoxastrobin, picoxystrobin, trifloxystrobin, sulfur, boscalid, thiophanate methyl, chlorothanonil, penthiopyrad, difenconazole, flutriafol, cyprodinil, fluzinam, iprodione, penflufen, cyazofamid, flutolanil, cymoxanil, dimethomorph, pyrimethanil, zoxamide, mandipropamid, metrinam, propamocarb, fen
  • a formulation, plant seed, or inoculum comprises a bacterial inoculant of the genus Bacillus
  • the bacterial inoculant can comprise Bacillus argri, Bacillus aizawai, Bacillus albolactis, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus coagulans, Bacillus endoparasiticus, Bacillus endorhythmos, Bacillus kurstaki, Bacillus lacticola, Bacillus lactimorbus, Bacillus lactis, Bacillus laterosporus, Bacillus lentimorbus, Bacillus licheniformis, Bacillus megaterium, Bacillus medusa, Bacillus metiens, Bacillus natto, Bacillus nigrificans, Bacillus popillae, Bacillus pumilus, Bacillus siamensis, Bacillus sphearicus, Bacillus spp., Bacillus subtilis,
  • a formulation, plant seed, or inoculum comprises an insecticide
  • the insecticide can be a nematicide.
  • Suitable nematicides include antibiotic nematicides such as abamectin; carbamate nematicides such as acetoprole, Bacillus chitonosporus , chloropicrin, benclothiaz, benomyl, Burholderia cepacia , carbofuran, carbosulfan, and cleothocard; dazomet, DBCP, DCIP, alanycarb, aldicarb, aldoxycarb, oxamyl, diamidafos, fenamiphos, fosthietan, phosphamidon, cadusafos, chlorpyrifos, dichlofenthion, dimethoate, ethoprophos, fensulfothion, fostiazate, harpins, heterophos, imicya
  • the nematicide and insecticide can be provided in the form of the commercial product Avicta Duo, which is a mixture of abamectin and thiamethoxam commercially available from Syngenta.
  • a formulation, plant seed, or inoculum comprises a bactericide, it may include streptomycin, penicillins, tetracyclines, ampicillin, and oxolinic acid.
  • the fertilizer can comprise a liquid fertilizer.
  • the micronutrient fertilizer material can comprise boric acid, a borate, a boron frit, copper sulfate, a copper frit, a copper chelate, a sodium tetraborate decahydrate, an iron sulfate, an iron oxide, iron ammonium sulfate, an iron frit, an iron chelate, a manganese sulfate, a manganese oxide, a manganese chelate, a manganese chloride, a manganese frit, a sodium molybdate, molybdic acid, a zinc sulfate, a zinc oxide, a zinc carbonate, a zinc frit, zinc phosphate, a zinc chelate, or a combination thereof.
  • the fertilizer can comprise ammonium sulfate, ammonium nitrate, ammonium sulfate nitrate, ammonium chloride, ammonium bisulfate, ammonium polysulfide, ammonium thiosulfate, aqueous ammonia, anhydrous ammonia, ammonium polyphosphate, aluminum sulfate, calcium nitrate, calcium ammonium nitrate, calcium sulfate, calcined magnesite, calcitic limestone, calcium oxide, calcium nitrate, dolomitic limestone, hydrated lime, calcium carbonate, diammonium phosphate, monoammonium phosphate, magnesium nitrate, magnesium sulfate, potassium nitrate, potassium chloride, potassium magnesium sulfate, potassium sulfate, sodium nitrates, magnesian limestone, magnesia, urea, urea-formaldehydes, urea ammonium nitrate
  • a formulation, plant seed, or inoculum can also include at least one biological control agent selected from (1) bacteria, in particular spore-forming bacteria, (2) fungi or yeasts, and (3) isoflavones.
  • a biological control agent selected from (1) bacteria, in particular spore-forming bacteria, (2) fungi or yeasts, and (3) isoflavones.
  • subtilis var. amyloliquefaciens Bacillus thuringiensis , in particular B. thuringiensis var. israelensis (products known as VectoBac®) or B. thuringiensis subsp. aizawai strain ABTS-1857 (products known as XenTari), or B. thuringiensis subsp.
  • israeltaki strain HD-1 products known as Dipel ES
  • Bacillus uniflagellatus , (1.29) Delftia acidovorans , in particular strain RAY209 (products known as BioBoost), (1.30) Lysobacter antibioticus , in particular strain 13-1 (Biological Control 2008, 45, 288-296), (1.31) Lysobacter enzymogenes , in particular strain 3.1T8, (1.32) Pseudomonas chlororaphis , in particular strain MA 342 (products known as Cedomon), (1.33) Pseudomonas proradix (products known as Proradix®), (1.34) Streptomyces galbus , in particular strain K61 (products known as Mycostop®, cf. Crop Protection 2006, 25, 468-475), (1.35) Streptomyces griseoviridis (products known as Mycostop®).
  • fungus or a yeast selected from the group consisting of [Group (2)]: (2.1) Ampelomyces quisqualis , in particular strain AQ 10 (product known as AQ 10®), (2.2) Aureobasidium pullulans , in particular blastospores of strain DSM14940 or blastospores of strain DSM 14941 or mixtures thereof (product known as Blossom Protect®), (2.3) Beauveria bassiana , in particular strain ATCC 74040 (products known as Naturalis®), (2.4) Candida oleophila , in particular strain O (products known as Nexy), (2.5) Cladosporium cladosporioides H39 (cf.
  • an isoflavone selected from the group consisting of [Group (3)]: (3.1) genistein, (3.2) biochanin A10, (3.3) formononetin, (3.4) daidzein. (3.5) glycitein, (3.6) hesperetin, (3.7) naringenin, (3.8) chalcone, (3.9) coumarin, (3.10) Ambiol (2-methyl-4-dimethylaminomethyl-5-hydroxybenzimidazol dihydrochoride) (3.11) ascorbate and (3.12) pratensein and the salts and esters thereof.
  • an isoflavone selected from the group consisting of [Group (3)]: (3.1) genistein, (3.2) biochanin A10, (3.3) formononetin, (3.4) daidzein. (3.5) glycitein, (3.6) hesperetin, (3.7) naringenin, (3.8) chalcone, (3.9) coumarin, (3
  • a formulation, plant seed, or inoculum comprises an insecticide
  • the insecticide can include pyrethroids, organophosphates, caramoyloximes, pyrazoles, amidines, halogenated hydrocarbons, neonicotinoids, and carbamates and derivatives thereof.
  • Particularly suitable classes of insecticides include organophosphates, phenylpyrazoles and pyrethoids.
  • Preferred insecticides are those known as terbufos, chlorpyrifos, chlorethoxyfos, tefluthrin, carbofuran, and tebupirimfos.
  • Commercially available insecticides include thiomethoxam (commercially available from Syngenta under the tradename Cruiser.
  • the insecticide can comprise an organophosphate, a carbamate, a pyrethroid, an acaricide, an alkyl phthalate, boric acid, a borate, a fluoride, sulfur, a haloaromatic substituted urea, a hydrocarbon ester, a biologically-based insecticide, or a combination thereof.
  • Suitable insecticides for use herein also include the following: (1) acetylcholine receptor agonists/antagonists such as chloronicotinyls/nconicotinoids, nicotine, bensultap or cartap. Suitable examples of chloronicotinyls/neonicotinoids include acetamiprid, dinotefuran, nitenpyram, nithiazine, thiacloprid, thiamethoxam, imidaclothiz and (2E)-1-[(2-chloro-1,3-thiazol-5-yl)methyl]-3,5-dimethyl-N-nitro-1,3,5-tri-azinan-2-imine; (2) acetylcholinesterase (ACNE) inhibitors such as carbamates and organophosphates.
  • acetylcholinesterase (ACNE) inhibitors such as carbamates and organophosphates.
  • carbamates include alanycarb, aldicarb, aldoxycarb, allyxycarb, aminocarb, bendiocarb, benfuracarb, bufencarb, butacarb, butocarboxim, butoxycarboxim, carbaryl, carbofuran, carbosulfan, chloethocarb, dimetilan, ethiofencarb, fenobucarb, fenothiocarb, formetanate, furathiocarb, isoprocarb, metam-sodium, methomyl, metolcarb, oxamyl, phosphocarb, pirimicarb, promecarb, propoxur, thiofanox, triazamate, trimethacarb, XMC and xylylcarb.
  • organophosphates include acephate, azamethiphos, azinphos (-methyl, -ethyl), bromophos-ethyl, bromfenvinfos (-methyl), butathiofos, cadusafos, carbophenothion, chlorethoxyfos, chlorfenvinphos, chlormephos, chlorpyrifos (-methyl/-ethyl), coumaphos, cyanofenphos, cyanophos, demeton-S-methyl, demeton-S-methylsulphon, dialifos, diazinon, dichlofenthion, dichlorvos/DDVP, dicrotophos, dimethoate, dimethylvinphos, dioxabenzofos, disulfoton, EPN, ethion, ethoprophos, etrimfos, famphur, fenamiphos, fenitrothion, fens
  • pyrethroids include acrinathrin, allethrin (d-cis-trans, d-trans), beta-cyfluthrin, bifenthrin, bioallethrin, bioallethrin-S-cyclopentyl-isomer, bioethanomethrin, biopermethrin, bioresmethrin, chlovaporthrin, cis-resmethrin, cis-permethrin, clocythrin, cycloprothrin, cyfluthrin, cyhalothrin, cyphenothrin, DDT, deltamethrin, empenthrin (1R-isomer), esfenvalerate, etofenprox, fenfluthrin, fenpropathrin, fenpyrithrin, fenvalerate, flubrocythrinate, flucythr
  • Suitable example of oxadiazines includes indoxacarb; (4) acetylcholine receptor modulators such as spinosyns. Suitable example of spinosyns includes spinosad; (5) GABA-gated chloride channel antagonists such as cyclodiene organochlorines and fiproles. Suitable examples of cyclodiene organochlorines include camphechlor, chlordane, endosulfan, gamma-HCH, HCH, heptachlor, lindane and methoxychlor. Suitable examples of fiproles include acetoprole, and vaniliprole; (6) chloride channel activators such as mectins.
  • mectins include abamectin, avermectin, emamectin, emamectin-benzoate, ivermectin, lepimectin, milbemectin and milbemycin; (7) juvenile hormone mimetics such as diofenolan, epofenonane, fenoxycarb, hydroprene, kinoprene, methoprene, pyriproxifen, triprene; (8) ecdysone agonists/disruptors such as diacylhydrazines.
  • diacylhydrazines include chromafenozide, halofenozide, methoxyfenozide and tebufenozide; (9) inhibitors of chitinbiosynthesis such as benzoylureas, buprofezin and cyromazine.
  • benzoylureas include bistrifluron, chlofluazuron, diflubenzuron, fluazuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, novaluron, noviflumuron, penfluron, teflubenzuron and triflumuron; (10) inhibitors of oxidative phosphorylation, ATP disruptors such as organotins and diafenthiuron.
  • organotins include azocyclotin, cyhexatin and fenbutatin oxide; (11) decouplers of oxidative phosphorylation by disruption of the H proton gradient such as pyrroles and dinitrophenols.
  • pyrroles includes chlorfenapyr.
  • dinitrophenols include binapacyrl, dinobuton, dinocap and DNOC; (12) site I electron transport inhibitors such as METIs, hydramethylnone and dicofol.
  • METIs include fenazaquin, fenpyroximate, pyrimidifen, pyridaben, tebufenpyrad, tolfenpyrad; (13) site II electron transport inhibitors such as rotenone; (14) site III electron transport inhibitors such as acequinocyl and fluacrypyrim; (15) microbial disrupters of the intestinal membrane of insects such as Bacillus thuringiensis strains; (16) inhibitors of lipid synthesis such as tetronic acids and tetramic acids. Suitable examples of tetronic acids include spirodiclofen, spiromesifen and spirotetramat.
  • Suitable example of tetramic acids includes cis-3-(2,5-dimethylphenyl)-8-methoxy-2-oxo-1-azaspiro[4.5]dec-3-en-4-yl ethyl carbonate (alias: carbonic acid, 3-(2,5-dimethylphenyl)-8-methoxy-2-oxo-1-azaspiro[4.5]dec-3-en-4-yl ethyl ester (CAS Reg.
  • Suitable example of phthalamides includes N.sup.2-[1,1-dimethyl-2-(methylsulphonyl)ethyl]-3-iodo-N.sup.1-[2-methyl-4-[1,2,2,2-tetrafluoro-1-(trifluoromethyl)ethyl]phenyl]-1,2-benzenedicarbo-xamide (i.e.
  • flubendiamide CAS reg. No.: 272451-65-7
  • nereistoxin analogues such as thiocyclam hydrogen oxalate and thiosultap-sodium
  • biologics, hormones or pheromones such as azadirachtin, Bacillus spec., Beauveria spec., codlemone, Metarrhizium spec., Paecilomyces spec., thuringiensis and Verticillium spec
  • active compounds having unknown or non-specified mechanisms of action such as fumigants, selective feeding inhibitors, mite growth inhibitors, amidoflumet; benclothiaz, benzoximate, bifenazate, bromopropylate, buprofezin, chinomethioat, chlordimeform, chlorobenzilate, chloropicrin, clothiazoben, cycloprene, cyflumetofen, dicyclanil, fe
  • nematicidal ingredients include abamectin (commercially available from Syngenta under the tradename Avicta).
  • a formulation, plant seed, or inoculum comprises an herbicide
  • the herbicide can comprise 2,4-D, 2,4-DB, acetochlor, acifluorfen, alachlor, ametryn, atrazine, aminopyralid, benefin, bensulfuron, bensulide, bentazon, bromacil, bromoxynil, butylate, carfentrazone, chlorimuron, chlorsulfuron, clethodim, clomazone, clopyralid, cloransulam, cycloate, DCPA, desmedipham, dicamba, dichlobenil, diclofop, diclosulam, diflufenzopyr, dimethenamid, diquat, diuron, DSMA, endothall, EPTC, ethalfluralin, ethofumesate, fenoxaprop, fluazifop-P, flucarbazone, flufenacet, flu
  • the herbicide can comprise a chlorophenoxy compound, a nitrophenolic compound, a nitrocresolic compound, a dipyridyl compound, an acetamide, an aliphatic acid, an anilide, a benzamide, a benzoic acid, a benzoic acid derivative, anisic acid, an anisic acid derivative, a benzonitrile, benzothiadiazinone dioxide, a thiocarbamate, a carbamate, a carbanilate, chloropyridinyl, a cyclohexenone derivative, a dinitroaminobenzene derivative, a fluorodinitrotoluidine compound, isoxazolidinone, nicotinic acid, isopropylamine, an isopropylamine derivative, oxadiazolinone, a phosphate, a phthalate, a picolinic acid compound, a triazine, a triazole, a uracil, a
  • the formulation can comprise an herbicide and a strain of bacteria that is capable of degrading the herbicide.
  • the strain of bacteria that is capable of degrading an herbicide can comprise Bacillus cereus family member EE349 (NRRL No. B-50928), Bacillus cereus family member EE-B00377 (NRRL B-67119), Bacillus pseudomycoides EE-B00366 (NRRL B-67120), or Bacillus mycoides EE-B00363 (NRRL B-67121), or a combination thereof.
  • the herbicide to be degraded can comprise a sulfonylurea such as sulfentrazone, an aryl triazine, dicamba, a phenoxy herbicide, 2,4-D, a pyrethrin, a pyrethroid, or a combination thereof
  • Binders can be included in the formulations, such as carboxymethylcellulose and natural and synthetic polymers in the form of powders, granules, or latexes, such as gum Arabic, chitin, polyvinyl alcohol and polyvinyl acetate, as well as natural phospholipids, such as cephalins and lecithins, and synthetic phospholipids. Binders include those composed preferably of an adhesive polymer that can be natural or synthetic without phytotoxic effect on the seed to be coated.
  • binders that can be included, either alone or in combination, include, for example, polyesters, polyether esters, polyanhydrides, polyester urethanes, polyester amides; polyvinyl acetates; polyvinyl acetate copolymers; polyvinyl alcohols and tylose; polyvinyl alcohol copolymers; polyvinylpyrolidones; polysaccharides, including starches, modified starches and starch derivatives, dextrins, maltodextrins, alginates, chitosanes and celluloses, cellulose esters, cellulose ethers and cellulose ether esters including ethylcelluloses, methylcelluloses, hydroxymethylcelluloses, hydroxypropylcelluloses and carboxymethylcellulose; fats; oils; proteins, including casein, gelatin and zeins; gum arabics; shellacs; vinylidene chloride and vinylidene chloride copolymers; lignosulfonates, in particular calcium
  • colorants including organic chromophores classified nitroso, nitro, azo, including monoazo, bisazo, and polyazo, diphenylmethane, triarylmethane, xanthene, methane, acridine, thiazole, thiazine, indamine, indophenol, azine, oxazine, anthraquinone, and phthalocyanine.
  • additives that can be added include trace nutrients such as salts of iron, manganese, boron, copper, cobalt, molybdenum, and zinc.
  • One or more preservatives may also be included for preservation and stabilization of the formulation.
  • suitable bactericides include those based on dichlorophene and benzylalcohol hemi formal (Proxel® from ICI or Acticide® RS from Thor Chemie and Kathon® MK from Dow Chemical) and isothiazolinone derivatives such as alkylisothiazolinones and benzisothiazolinones (Acticide® MBS from Thor Chemie).
  • suitable preservatives include MIT (2-methyl-4-isothiazolin-3-one), BIT (1,2-benzisothiazolin-3-one, which can be obtained from Avecia, Inc. as Proxel GXL as a solution in sodium hydroxide and dipropylene glycol), 5-chloro-2-(4-chlorobenzyl)-3(2H)-isothiazolone, 5-chloro-2-methyl-2H-isothiazol-3-one, 5-chloro-2-methyl-2H-isothiazol-3-one, 5-chloro-2-methyl-2H-isothiazol-3-one, 5-chloro-2-methyl-2H-isothiazol-3-one-hydrochloride, 4,5-dichloro-2-cyclohexyl-4-isothiazolin-3-one, 4,5-dichloro-2-octyl-2H-isothiazol-3-one, 2-methyl-2H-isothiazol-3-one, 2-methyl-2
  • suitable thickeners for the formulations include polysaccharides, organic clays, or a water-soluble polymer that exhibits pseudoplastic properties in an aqueous medium, such as, for example, gum arabic, gum karaya, gum tragacanth, guar gum, locust bean gum, xanthan gum, carrageenan, alginate salt, casein, dextran, pectin, agar, 2-hydroxyethyl starch, 2-aminoethyl starch, 2-hydroxy ethyl cellulose, methyl cellulose, carboxymethyl cellulose salt, cellulose sulfate salt, polyacrylamide, alkali metal salts of the maleic anhydride copolymers, alkali metal salts of poly(meth)acrylate.
  • Suitable antifreeze ingredients for the formulation include, for example and without limitation, ethylene glycol, 1,2-propylene glycol, 1,3-propylene glycol, 1,2-butanediol, 1,3-butanediol, 1,4-butanediol, 1,4-pentanediol, 3-methyl-1,5-pentanediol, dimethyl-2,3-butanediol, trimethylol propane, mannitol, sorbitol, glycerol, pentaerythritol, 1,4-cyclohexanedimethanol, xylenol, bisphenols such as bisphenol A or the like.
  • ether alcohols such as diethylene glycol, triethylene glycol, tetraethylene glycol, polyoxyethylene or polyoxypropylene glycols of molecular weight up to about 4000, diethylene glycol monomethylether, diethylene glycol monoethylether, triethylene glycol monomethylether, butoxyethanol, butylene glycol monobutylether, dipentaerythritol, tripentaerythritol, tetrapentaerythritol, diglycerol, triglycerol, tetraglycerol, pentaglycerol, hexaglycerol, heptaglycerol, octaglycerol and combinations thereof.
  • the present invention further relates to plant seeds coated with any of the recombinant Bacillus cereus family members described herein, with any of the recombinant spore-forming bacteria described herein, with any of the biologically pure bacterial cultures described herein, with any of the inoculums described herein, with any enzyme that catalyzes the production of nitric oxide, with any recombinant microorganism that expresses an enzyme that catalyzes the production of nitric oxide, or with any of the formulations other than vaccines as described herein.
  • the present invention further relates to methods for stimulating plant growth, methods for protecting a plant from a pathogen or enhancing stress resistance in a plant, methods for immobilizing recombinant Bacillus cereus family member spores or recombinant spore forming bacteria on a plant, methods for stimulating germination of a plant seed, methods for delivering nucleic acids to plants, methods for delaying germination of a spore of a recombinant Bacillus cereus family member, methods for making and using exosporium fragments, and methods for delivering beneficial bacteria to animals.
  • the present invention relates to methods for stimulating plant growth.
  • One method for stimulating plant growth of the present invention comprises introducing into a plant growth medium any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above.
  • any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant Bacillus cereus family member expresses a fusion protein comprising a plant growth stimulating protein or peptide.
  • the plant growth stimulating protein or peptide can be physically attached to the exosporium of the recombinant Bacillus cereus family member.
  • Another method for stimulating plant growth comprises introducing into a plant growth medium any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above.
  • any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant spore-forming bacterium expresses a fusion protein comprising a plant growth stimulating protein or peptide.
  • the plant growth stimulating protein or peptide can be physically attached to the spore coat of the recombinant spore-forming bacterium.
  • Yet another method for stimulating plant growth comprises introducing into a plant growth medium a recombinant Bacillus cereus family member or a formulation comprising a recombinant Bacillus cereus family member.
  • the recombinant Bacillus cereus family member or the formulation can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant Bacillus cereus family member expresses an enzyme involved in nutrient solubilization, a protease, a BclA protein, a BclB protein, a CotE protein a CotO protein, an ExsY protein, an ExsFA/BxpB protein, a CotY protein, an ExsFB protein, an ExsJ protein, an ExsH protein, a YjcA protein, a YjcB protein, a BclC protein, a BxpA protein, a BclE protein, a BetA/BAS3290 protein, an ExsA protein, an ExsK protein, an ExsB protein, a YabG protein, or a Tgl protein, wherein the expression of the enzyme involved in nutrient solubilization, the protease, a BclA protein, a BclB protein, a CotE protein a CotO protein, an ExsY protein, an ExsFA
  • the present invention also relates to methods for protecting a plant from a pathogen or enhancing stress resistance in a plant.
  • One method for protecting a plant from a pathogen or enhancing stress resistance in a plant comprises introducing into a plant growth medium any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above.
  • any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant Bacillus cereus family member expresses a fusion protein comprising a protein or peptide that protects a plant from a pathogen or a protein or peptide that enhances stress resistance in a plant.
  • the protein or peptide that protects a plant from a pathogen or the protein or peptide that enhances stress resistance in a plant can be physically attached to the exosporium of the recombinant Bacillus cereus family member.
  • Another method for protecting a plant from a pathogen or enhancing stress resistance in a plant comprises introducing into a plant growth medium any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above.
  • any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant spore-forming bacterium expresses a fusion protein comprising a protein or peptide that protects a plant from a pathogen or a protein or peptide that enhances stress resistance in a plant.
  • the protein or peptide that protects a plant from a pathogen or the protein or peptide that enhances stress resistance in a plant can be physically attached to the spore coat of the recombinant spore-forming bacterium.
  • plants grown in the plant growth medium comprising the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium are preferably less susceptible to infection with the pathogen as compared to plants grown under the same conditions in the identical plant growth medium that does not contain the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium.
  • any of the methods for enhancing stress resistance in a plant plants grown in the plant growth medium comprising the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium are preferably less susceptible to stress as compared to plants grown under the same conditions in the identical plant growth medium that does not contain the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium.
  • Another method for enhancing stress resistance in a plant comprises introducing into a plant growth medium a recombinant Bacillus cereus family member or a formulation comprising the recombinant Bacillus cereus family member.
  • the recombinant Bacillus cereus or the formulation can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant Bacillus cereus family member expresses a superoxide dismutase or an arginase, wherein the expression of the superoxide dismutase or the arginase is increased as compared to the expression of the superoxide dismutase or the arginase in a wild-type Bacillus cereus family member under the same conditions.
  • Another method for protecting a plant from a pathogen comprises introducing into a plant growth medium a recombinant Bacillus cereus family member or a formulation comprising the recombinant Bacillus cereus family member.
  • the recombinant Bacillus cereus or the formulation can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant Bacillus cereus family member expresses a protease, wherein the expression of the protease is increased as compared to the expression of the protease in a wild-type Bacillus cereus family member under the same conditions.
  • the present invention further relates to methods for immobilizing recombinant Bacillus cereus family member spores or recombinant spore forming bacteria on a plant.
  • One method for immobilizing a recombinant Bacillus cereus family member spore on a plant comprises introducing into a plant growth medium any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above.
  • any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant Bacillus cereus family member expresses a fusion protein comprising a plant binding protein or peptide.
  • the plant binding protein or peptide can be physically attached to the exosporium of the recombinant Bacillus cereus family member.
  • Another method for immobilizing a spore of a recombinant spore-forming bacterium on a plant comprises introducing into a plant growth medium any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above.
  • any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant spore-forming bacterium expresses a fusion protein comprising a plant binding peptide and the plant binding protein or peptide can be physically attached to the spore coat of the recombinant spore-forming bacterium.
  • the plant binding protein or peptide preferably selectively targets and maintains the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium on a plant.
  • the plant binding protein or peptide can selectively target and maintain the recombinant Bacillus cereus family member on at plant roots, substructures of roots, an aerial portion of a plant, or a substructure of an aerial portion of a plant.
  • the present invention also provides methods for stimulating germination of a plant seed.
  • One method for stimulating germination of a plant seed comprises introducing into a plant growth medium any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above.
  • any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant Bacillus cereus family member expresses a fusion protein comprising an enzyme that catalyzes the production of nitric oxide.
  • the enzyme that catalyzes the production of nitric oxide can be physically attached to the exosporium of the recombinant Bacillus cereus family member.
  • Another method for stimulating germination of a plant seed comprises introducing into a plant growth medium any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above.
  • any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant spore-forming bacterium expresses a fusion protein comprising an enzyme that catalyzes the production of nitric oxide, and the enzyme that catalyzes the production of nitric oxide can be physically attached to the spore coat of the recombinant spore-forming bacterium.
  • the above methods for stimulating germination of a plant seed preferably comprise applying the recombinant Bacillus cereus family member, the recombinant spore-forming bacterium, or the formulation to a plant seed.
  • any of the above methods for stimulating germination of a plant seed can further comprise applying a substrate for the enzyme that catalyzes production of nitric oxide to the plant growth medium, the plant seed, the plant, or the area surrounding the plant or the plant seed.
  • the method suitably further comprises adding L-arginine to the plant growth medium, the plant seed, the plant, or the area surrounding the plant or the plant seed.
  • the L-arginine can be applied to an aerial portion of the plant.
  • the L-arginine is preferably applied to the plant seed.
  • L-arginine enhances the reaction and leads to a more pronounced output of NO by the nitric oxide synthase. Furthermore, L-arginine on a plant seed, a plant growth medium, or an area surrounding a plant can serve as a substrate for the production of nitric oxide by native bacterial enzymes.
  • seeds in the plant growth medium comprising the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium or seeds to which the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium has been applied preferably have an increased germination rate as compared to seeds grown under the same conditions in the identical plant growth medium that does not contain the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium or seeds to which the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium has not been applied, grown under the same conditions.
  • seeds in the plant growth medium comprising the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium or seeds to which the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium has been applied preferably have a longer taproot after germination as compared to seeds grown under the same conditions in the identical plant growth medium that does not contain the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium or seeds to which the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium has not been applied under the same conditions.
  • Yet another method for stimulating germination of a plant seed comprises introducing into a plant growth medium, or applying to a plant, a plant seed, or an area surrounding a plant or a plant seed: (i) an enzyme that catalyzes the production of nitric oxide; (ii) a superoxide dismutase; or (iii) a recombinant microorganism that expresses an enzyme that catalyzes the production of nitric oxide or a superoxide dismutase, wherein the expression of the enzyme that catalyzes the production of nitric oxide or the superoxide dismutase is increased as compared to the expression of the enzyme that catalyzes the production of nitric oxide or the superoxide dismutase in a wild type microorganism under the same conditions.
  • the method preferably comprises applying the enzyme or the microorganism to a plant seed.
  • the method can further comprise applying a substrate for the enzyme that catalyzes production of nitric oxide to the plant growth medium, the plant seed, the plant, or the area surrounding the plant or the plant seed.
  • the method suitably further comprises adding L-arginine to the plant growth medium, the plant seed, the plant, or the area surrounding the plant or the plant seed.
  • the L-arginine can be applied to an aerial portion of the plant. The L-arginine is preferably applied to the plant seed.
  • Seeds in the plant growth medium comprising the enzyme or the microorganism or seeds to which the enzyme or the microorganism has been applied preferably have an increased germination rate as compared to seeds grown under the same conditions in the identical plant growth medium that does not contain enzyme or the microorganism or seeds to which the enzyme or the microorganism has not been applied, grown under the same conditions.
  • Seeds in the plant growth medium comprising the enzyme or the microorganism or seeds to which the enzyme or the microorganism has been applied preferably have a longer taproot after germination as compared to seeds grown under the same conditions in the identical plant growth medium that does not contain the enzyme or the microorganism or seeds to which the enzyme or the microorganism has not been applied under the same conditions.
  • the enzyme that catalyzes the production of nitric oxide synthase can comprise a nitric oxide synthase or an arginase.
  • the enzyme that catalyzes the production of nitric oxide comprises a nitric oxide synthase
  • the nitric oxide synthase can comprise, for example, a nitric oxide synthase from Bacillus thuringiensis BT013A or Bacillus subtilis 168.
  • the nitric oxide synthase can have at least 85% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can have at least 90% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can have at least 95% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can have at least 98% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can have at least 99% sequence identity with SEQ ID NO: 260 or 261.
  • the nitric oxide synthase can have 100% sequence identity with SEQ ID NO: 260 or 261.
  • the superoxide dismutase can comprise a superoxide dismutase 1 (SODA1) or a superoxide dismutase 2 (SODA2).
  • SODA1 superoxide dismutase 1
  • SODA2 superoxide dismutase 2
  • the superoxide dismutase can comprise an amino acid sequence having at least 85% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 155 or 156.
  • the superoxide dismutase can comprise an amino acid sequence having at least 100% identity with SEQ ID NO: 155 or 156.
  • the recombinant microorganism that expresses an enzyme that catalyzes the production of nitric oxide can comprise a Bacillus species (e.g., a Bacillus cereus family member, Bacillus subtilis, Bacillus licheniformis , or Bacillus megaterium ), Escherechia coli , an Aspergillus species (e.g., Aspergillus niger ), or a Saccharomyces species (e.g., Saccharomyces cerevisiae ).
  • Bacillus species e.g., a Bacillus cereus family member, Bacillus subtilis, Bacillus licheniformis , or Bacillus megaterium
  • Escherechia coli e.g., an Aspergillus species (e.g., Aspergillus niger )
  • Saccharomyces species e.g., Saccharomyces cerevisiae
  • the enzyme or the recombinant microorganism can be introduced into the plant growth medium, or applied to a plant, a plant seed, or an area surrounding a plant or a plant seed in a formulation comprising the enzyme or the recombinant microorganism and an agriculturally acceptable carrier.
  • the formulation can comprise any of the agriculturally acceptable carriers and other components discussed herein.
  • the enzyme that catalyzes the production of nitric oxide can be delivered purified or unpurified, and can be delivered alone or in combination with other beneficial proteins, inoculants, or chemicals to the plant seed, the plant growth medium, or an area surrounding the plant or the plant seed.
  • Methods for delivering nucleic acids to plants are also provided by the present invention.
  • One method for delivering nucleic acids to a plant comprises introducing into a plant growth medium any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above.
  • any of the recombinant Bacillus cereus family members described above or any of the formulations comprising a recombinant Bacillus cereus family member described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant Bacillus cereus family member expresses a fusion protein comprising a nucleic acid binding protein.
  • the nucleic acid binding protein or peptide is bound to a nucleic acid molecule.
  • the nucleic acid binding protein or peptide can be physically attached to the exosporium of the recombinant Bacillus cereus family member.
  • the recombinant Bacillus cereus family member can comprise an endophytic strain of bacteria.
  • the endophytic strain of bacteria can comprise Bacillus cereus family member EE349, Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, or Bacillus mycoides EE-B00363.
  • the endophytic strain of bacteria can comprise Bacillus cereus family member EE439, Bacillus thuringiensis EE417, Bacillus cereus EE444, Bacillus thuringiensis EE319, Bacillus thuringiensis EE-B00184, Bacillus cereus family member EE-B00377, Bacillus pseudomycoides EE-B00366, or Bacillus mycoides EE-B00363.
  • Another method for delivering nucleic acids to a plant comprises introducing into a plant growth medium any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above.
  • any of the recombinant spore-forming bacteria described above or any of the formulations comprising a recombinant spore-forming bacterium described above can be applied to a plant, a plant seed, or to an area surrounding a plant or a plant seed.
  • the recombinant spore-forming bacterium expresses a fusion protein comprising a nucleic acid binding protein.
  • the nucleic acid binding protein or peptide is bound to a nucleic acid molecule.
  • the nucleic acid binding protein or peptide can be physically attached to the spore coat of the recombinant spore-forming bacterium.
  • the recombinant spore-forming bacterium can comprise an endophytic strain of bacteria.
  • the endophytic strain of bacteria can comprise Bacillus megaterium EE385, Bacillus sp. EE387, Bacillus circulans EE388, Bacillus subtilis EE405 , Lysinibacillus fusiformis EE442 , Lysinibacillus sphericus EE443, or Bacillus pumilus EE-B00143.
  • the nucleic acid molecule can comprise a modulating RNA molecule; an RNAi molecule; a microRNA; an aptamer; or a DNA molecule that encodes a modulating RNA molecule, an RNAi molecule, a microRNA, or an aptamer.
  • the nucleic acid molecules to be delivered to the plant can be produced by any means known the art (e.g., chemical synthesis, recombinant production by a microorganism, etc.).
  • the nucleic acid molecules can then be bound to the nucleic acid binding protein or peptide portion of the fusion proteins described herein in preparation for delivery of such nucleic acids to a plant or plants.
  • the nucleic acid binding proteins and peptides immobilize and stabilize the nucleic acids and allow them to be delivered to the plant intact.
  • the nucleic acid molecules to be delivered to the plant can be in an active form, or in an inactive form that can be processed into an active form by the plant.
  • the nucleic acids molecules can be incubated with the any of the recombinant Bacillus cereus members or recombinant spore-forming bacteria described herein that express a fusion protein comprising a nucleic acid binding protein or peptide.
  • the present invention further relates to a method for delaying germination of a spore of a Bacillus cereus family member.
  • the method comprises modifying the Bacillus cereus family member to express an inosine-uridine hydrolase or an alanine racemase, wherein the expression of the inosine-uridine hydrolase or the alanine racemase is increased as compared to the expression of the inosine-uridine hydrolase or the alanine racemase in a wild-type Bacillus cereus family member under the same conditions.
  • the method can further comprise inactivating the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium prior to introduction into the plant growth medium or application to a plant, a plant seed, or an area surrounding a plant or a plant seed.
  • the inactivating can comprise subjecting the recombinant Bacillus cereus family member or the recombinant spore-forming bacterium to heat treatment; gamma irradiation; x-ray irradiation; UV-A irradiation; UV-B irradiation; treatment with gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, chloroform, or phenol, or a combination thereof.
  • the inactivating can comprise modifying the recombinant Bacillus cereus family member recombinant or spore-forming bacterium to express a germination spore protease or a non-specific endonuclease, wherein the expression of the germination spore protease or the non-specific endonuclease is increased as compared to the expression of the germination spore protease or the non-specific endonuclease in a wild-type Bacillus cereus family member under the same conditions, and wherein the recombinant spore-forming bacterium comprises a recombinant bacterium of the genus Bacillus.
  • the present invention further relates to methods for making and using exosporium fragments. These methods relate to the recombinant Bacillus cereus family members described in Section IV hereinabove, i.e., recombinant Bacillus cereus family members that comprise a mutation or another genetic alteration that allows for the collection of free exosporium.
  • the present invention relates to a method for removing exosporium from spores of a recombinant Bacillus cereus family member.
  • the method comprises subjecting a suspension comprising any of the recombinant Bacillus cereus family members described in Section IV hereinabove to centrifugation or filtration to produce fragments of exosporium that are separated from the spores.
  • the exosporium fragments comprise the fusion protein.
  • the method for removing exosporium from spores of a recombinant Bacillus cereus family member can comprise subjecting the suspension comprising the spores to centrifugation and collecting the supernatant, wherein the supernatant comprises the fragments of the exosporium and is substantially free of spores.
  • the method for removing exosporium from spores of a recombinant Bacillus cereus family member can comprise subjecting the suspension comprising the spores to filtration and collecting the filtrate, wherein the filtrate comprises the fragments of the exosporium and is substantially free of spores.
  • the suspension of spores can be agitated or mechanically disrupted prior to centrifugation or filtration.
  • the exosporium fragments can also be separated from the spores by gradient centrifugation, affinity purification, or by allowing the spores to settle out of the suspension.
  • the present invention further relates to methods for using the exosporium fragments.
  • a method for stimulating plant growth comprises introducing exosporium fragments or a formulation of comprising the exosporium fragments and an agriculturally acceptable carrier into a plant growth medium.
  • the exosporium fragments or the formulation can be applied to a plant, a plant seed, or an area surrounding a plant or a plant seed.
  • the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member described in Section IV hereinabove and comprise the fusion protein.
  • the fusion protein comprises a plant growth stimulating protein or peptide.
  • a method for protecting a plant from a pathogen or enhancing stress resistance in a plant comprises introducing exosporium fragments or a formulation of comprising the exosporium fragments and an agriculturally acceptable carrier into a plant growth medium.
  • the exosporium fragments or the formulation can be applied to a plant, a plant seed, or an area surrounding a plant or a plant seed.
  • the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member described in Section IV hereinabove and comprise the fusion protein.
  • the fusion protein comprises a protein or peptide that protects a plant from a pathogen or a protein or peptide that enhances stress resistance in a plant.
  • the fusion protein comprises protein or peptide that protects a plant from a pathogen.
  • plants grown in the plant growth medium comprising the exosporium fragments are preferably less susceptible to infection with the pathogen as compared to plants grown under the same conditions in the identical plant growth medium that does not contain the exosporium fragments.
  • the fusion protein comprises a protein or peptide that enhances stress resistance in a plant.
  • plants grown in the plant growth medium comprising the exosporium fragments are preferably less susceptible to stress as compared to plants grown under the same conditions in the identical plant growth medium that does not contain the exosporium fragments.
  • a method for immobilizing exosporium fragments on a plant comprises introducing exosporium fragments or a formulation of comprising the exosporium fragments and an agriculturally acceptable carrier into a plant growth medium.
  • the exosporium fragments or the formulation can be applied to a plant, a plant seed, or an area surrounding a plant or a plant seed.
  • the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member described in Section IV hereinabove and comprise the fusion protein.
  • the fusion protein comprises a plant binding protein or peptide.
  • the plant binding protein or peptide preferably selectively targets and maintains the exosporium fragments on a plant.
  • the plant binding protein or peptide can selectively target and maintain the exosporium fragments on at plant roots, substructures of roots, an aerial portion of a plant, or a substructure of an aerial portion of a plant.
  • a method for stimulating germination of a plant seed comprises introducing exosporium fragments or a formulation of comprising the exosporium fragments and an agriculturally acceptable carrier into a plant growth medium.
  • the exosporium fragments or the formulation can be applied to a plant, a plant seed, or an area surrounding a plant or a plant seed.
  • the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member described in Section IV hereinabove and comprise the fusion protein.
  • the fusion protein comprises a superoxide dismutase or an enzyme that catalyzes the production of nitric oxide.
  • the method preferably comprises applying the exosporium fragments to a plant seed.
  • the methods for stimulating germination can further comprise applying a substrate for the enzyme that catalyzes production of nitric oxide to the plant growth medium, the plant seed, the plant, or the area surrounding the plant or the plant seed.
  • the method suitably further comprises adding L-arginine to the plant growth medium, the plant seed, the plant, or the area surrounding the plant or the plant seed.
  • the L-arginine can be applied to an aerial portion of the plant. The L-arginine is preferably applied to the plant seed.
  • L-arginine enhances the reaction and leads to a more pronounced output of NO by the nitric oxide synthase. Furthermore, L-arginine on a plant seed, a plant growth medium, or an area surrounding a plant can serve as a substrate for the production of nitric oxide by native bacterial enzymes.
  • seeds in the plant growth medium comprising the exosporium fragments or seeds to which the exosporium fragments have been applied preferably have an increased germination rate as compared to the same seeds grown under the same conditions in the identical plant growth medium that does not contain the exosporium fragments or the same seeds grown under the same conditions to which the exosporium fragments have not been applied.
  • seeds in the plant growth medium comprising the exosporium fragments or seeds to which the exosporium fragments have been applied preferably have a longer taproot after germination as compared to the same seeds grown under the same conditions in the identical plant growth medium that does not contain the exosporium fragments or the same seeds grown under the same conditions to which the exosporium fragments have not been applied.
  • a method for delivering nucleic acids to a plant comprises introducing exosporium fragments or a formulation of comprising the exosporium fragments and an agriculturally acceptable carrier into a plant growth medium.
  • the exosporium fragments or the formulation can be applied to a plant, a plant seed, or an area surrounding a plant or a plant seed.
  • the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member described in Section IV hereinabove and comprise the fusion protein.
  • the fusion protein comprises a nucleic acid binding protein or peptide.
  • the nucleic acid binding protein or peptide is bound to a nucleic acid molecule.
  • the nucleic acid molecule can comprise a modulating RNA molecule; an RNAi molecule; a microRNA; an aptamer; or a DNA molecule that encodes a modulating RNA molecule, an RNAi molecule, a microRNA, or an aptamer.
  • the nucleic acid molecules to be delivered to the plant can be produced by any means known the art (e.g., chemical synthesis, recombinant production by a microorganism, etc.).
  • the nucleic acid molecules can then be bound to the nucleic acid binding protein or peptide portion of the fusion proteins described herein in preparation for delivery of such nucleic acids to a plant or plants.
  • the nucleic acid binding proteins and peptides immobilize and stabilize the nucleic acids and allow them to be delivered to the plant intact.
  • the nucleic acid molecules to be delivered to the plant can be in an active form, or in an inactive form that can be processed into an active form by the plant.
  • the nucleic acids molecules can be incubated with the exosporium fragments containing a fusion protein comprising a nucleic acid binding protein or peptide.
  • the plant growth medium can comprise soil, water, an aqueous solution, sand, gravel, a polysaccharide, mulch, compost, peat moss, straw, logs, clay, soybean meal, yeast extract, or a combination thereof.
  • the plant growth medium can be supplemented with a substrate or a cofactor for an enzyme.
  • the substrate or the cofactor can comprise tryptophan, an adenosine monophosphate, an adenosine diphosphate, an adenosine triphosphate (e.g., adenosine-3-triphosphate), indole, a trimetaphosphate, ferrodoxin, acetoin, diacetyl, pyruvate, acetolactate, pectin, cellulose, methylcellulose, starch, chitin, pectin, a protein meal, a cellulose derivative, a phosphate, acetoin, chitosan, an inactive derivative of indole-3-acetic acid, an inactive derivative of gibberellic acid, a xylan, an arabinoxylan, a fat, a wax, an oil, a phytic acid, a lignin, a humic acid
  • the methods described herein can comprise coating seeds with the recombinant Bacillus cereus family member, the recombinant spore-forming bacterium, or the exosporium fragments or a formulation containing the recombinant Bacillus cereus family member, the recombinant spore-forming bacterium, or the or exosporium fragments prior to planting.
  • the methods described herein can comprise applying the recombinant Bacillus cereus family member, the recombinant spore-forming bacterium, or the exosporium fragments, or a formulation containing the recombinant Bacillus cereus family member, the recombinant spore-forming bacterium, or the exosporium fragments to an aerial portion of a plant.
  • introducing the recombinant Bacillus cereus family member, the recombinant spore-forming bacterium, or the exosporium fragments into the plant growth medium can comprise applying a liquid or solid formulation containing the recombinant Bacillus cereus family member, the recombinant spore-forming bacterium, or the exosporium fragments to the medium.
  • the plant growth medium can comprise soil (e.g., potting soil), compost, peat moss, sand, seed starter mix, or a combination thereof.
  • the method can comprise applying the formulation to the plant growth medium prior to, concurrently with, or after planting of seeds, seedlings, cuttings, bulbs, or plants in the plant growth medium.
  • the method can further comprise introducing at least one agrochemical into the plant growth medium or applying at least one agrochemical to plants or seeds.
  • the agrochemical can comprise a fertilizer (e.g., a liquid fertilizer), a micronutrient fertilizer material (e.g., boric acid, a borate, a boron frit, copper sulfate, a copper frit, a copper chelate, a sodium tetraborate decahydrate, an iron sulfate, an iron oxide, iron ammonium sulfate, an iron frit, an iron chelate, a manganese sulfate, a manganese oxide, a manganese chelate, a manganese chloride, a manganese frit, a sodium molybdate, molybdic acid, a zinc sulfate, a zinc oxide, a zinc carbonate, a zinc frit, zinc phosphate, a zinc chelate, or a combination thereof), an insecticide (e.g., an organophosphate, a carbamate, a pyrethroid, an acar
  • the fertilizer can comprise ammonium sulfate, ammonium nitrate, ammonium sulfate nitrate, ammonium chloride, ammonium bisulfate, ammonium polysulfide, ammonium thiosulfate, aqueous ammonia, anhydrous ammonia, ammonium polyphosphate, aluminum sulfate, calcium nitrate, calcium ammonium nitrate, calcium sulfate, calcined magnesite, calcitic limestone, calcium oxide, calcium nitrate, dolomitic limestone, hydrated lime, calcium carbonate, diammonium phosphate, monoammonium phosphate, magnesium nitrate, magnesium sulfate, potassium nitrate, potassium chloride, potassium magnesium sulfate, potassium sulfate, sodium nitrates, magnesian limestone, magnesia, urea, urea-formaldehydes, urea ammonium nitrate
  • the agrochemical can comprise any of the fungicides, bacterial inoculants, or herbicides, described above in section XVII.
  • the plant can be a dicotyledon, a monocotyledon, or a gymnosperm.
  • the dicotyledon can be selected from the group consisting of bean, pea, tomato, pepper, squash, alfalfa, almond, aniseseed, apple, apricot, arracha, artichoke, avocado, bambara groundnut, beet, bergamot, black pepper, black wattle, blackberry, blueberry, bitter orange, bok-choi, Brazil nut, breadfruit, broccoli, broad bean, Brussels sprouts, buckwheat, cabbage, camelina, Chinese cabbage, cacao, cantaloupe, caraway seeds, cardoon, carob, carrot, cashew nuts, cassava, castor bean, cauliflower, celeriac, celery, cherry, chestnut, chickpea, chicory, chili pepper, chrysanthemum , cinnamon, citron, clementine, clove, clover, coffee, cola nut, colza, corn, cotton, cottonseed, cowpea, crambe , cran
  • the monocotyledon can be selected from the group consisting of corn, wheat, oat, rice, barley, millet, banana, onion, garlic, asparagus, ryegrass, millet, fonio, raishan, nipa grass, turmeric, saffron, galangal, chive, cardamom, date palm, pineapple, shallot, leek, scallion, water chestnut, ramp, Job's tears, bamboo, ragi, spotless watermeal, arrowleaf elephant ear, Tahitian spinach, abaca, areca , bajra, betel nut, broom millet, broom sorghum, citronella, coconut, cocoyam, maize, dasheen, durra, durum wheat, edo, fique, formio, ginger, orchard grass, esparto grass, Sudan grass, guinea corn, Manila hemp, hen
  • the gymnosperm can be from a family selected from the group consisting of Araucariaceae, Boweniaceae, Cephalotaxaceae, Cupressaceae, Cycadaceae, Ephedraceae, Ginkgoaceae, Gnetaceae, Pinaceae, Podocarpaceae, Taxaceae, Taxodiaceae, Welwitschiaceae, and Zamiaceae.
  • the plants and plant seeds described herein may include transgenic plants or plant seeds, such as transgenic cereals (wheat, rice), maize, soybean, potato, cotton, tobacco, oilseed rape and fruit plants (fruit of apples, pears, citrus fruits and grapes.
  • transgenic plants include corn, soybeans, potatoes, cotton, tobacco and oilseed rape.
  • Suitable transgenic plants and seeds can be characterized by the plant's formation of toxins, especially from the Bacillus thuringiensis genetic material by gene CryIA (a), CryIA (b), CryIA (c), CryIIA, CryIIIA, CryIIIB2, Cry9c, Cry2Ab, Cry3Bb, CryIF or a combination thereof).
  • the formation of toxins in plants increases the plant's resistance to insects, arachnids, nematodes and slugs and snails (hereinafter referred to as “Bt plants”).
  • Bt plants for example, are commercially available under the tradename YIELD GARD® (for example maize, cotton, soybeans), KnockOut® (for example maize), StarLink® (for example maize), Bollgard®(cotton), Nucotn® (cotton) and NewLeaf® (potato) maize varieties, cotton varieties, soybean varieties and potato varieties.
  • YIELD GARD® for example maize, cotton, soybeans
  • KnockOut® for example maize
  • StarLink® for example maize
  • Nucotn® cotton
  • NewLeaf® potato
  • Herbicide tolerance plants include plants under the trade names Roundup Ready® (a glyphosate tolerance, such as corn, cotton, soybeans), Clearfield (for example maize), Liberty Link®(tolerance with glufosinate, for example oilseed rape), IMI® (with imidazolinone tolerance) and STS® (tolerance to a sulfonylurea, such as maize).
  • Roundup Ready® a glyphosate tolerance, such as corn, cotton, soybeans
  • Clearfield for example maize
  • Liberty Link® tolerance with glufosinate, for example oilseed rape
  • IMI® with imidazolinone tolerance
  • STS® tolerance to a sulfonylurea
  • Plant seeds as described herein can be genetically modified (e.g., any seed that results in a genetically modified plant or plant part that expresses herbicide tolerance, tolerance to environmental factors such as water stress, drought, viruses, and nitrogen production, or resistance to bacterial, fungi or insect toxins).
  • Suitable genetically modified seeds include those of cole crops, vegetables, fruits, trees, fiber crops, oil crops, tuber crops, coffee, flowers, legume, cereals, as well as other plants of the monocotyledonous and dicotyledonous species.
  • the genetically modified seeds include peanut, tobacco, grasses, wheat, barley, rye, sorghum, rice, rapeseed, sugarbeet, sunflower, tomato, pepper, bean, lettuce, potato, and carrot.
  • the genetically modified seeds include cotton, soybean, and corn (sweet, field, seed, or popcorn).
  • transgenic plants which may be treated according to the invention are plants containing transformation events, or a combination of transformation events, that are listed for example in the databases from various national or regional regulatory agencies (see for example http://gmoinfo.jrc.it/gmp_browse.aspx and http://www.agbios.com/dbase.php).
  • the present invention further relates to methods for delivering beneficial bacteria and/or proteins or peptides to animals.
  • the administration of bacterial strains that are both probiotic and are also endophytic to a plant allows for entry of the bacteria into the plant where they divide and multiply.
  • the endophytic and probiotic strains can be delivered to plants using various methods, e.g., the endophytic and probiotic strains can be delivered via seed treatment, treatment of the plant growth medium (e.g., soil), irrigation, application to the plant itself (e.g., foliar application to the aerial portions of a plant). Once inside the plant, the bacteria multiply and colonize the internal tissues of the plant. The plant can then be fed to an animal, which allows for delivery of the probiotic bacteria to the animal.
  • the plant growth medium e.g., soil
  • irrigation e.g., irrigation
  • application to the plant itself e.g., foliar application to the aerial portions of a plant.
  • Costs are decreased as to traditional methods for delivering probiotic bacteria to animals, since the endophytic nature of the bacteria allows them to divide and multiply within the plant.
  • the dose increases.
  • the probiotic and endophytic strain can spread across a target crop prior to harvest and digestion.
  • Bacterial strains that are capable of colonizing the phylloplane of a plant and are also probiotic can also be used for these purposes. Strains that are capable of colonizing the phylloplane of a plant can be initially delivered to plants in small doses, and will then divide and colonize the external surfaces of the plants.
  • Suitable bacterial strains that are both endophytic or phylloplane-colonizing and probiotic include those strains that can both replicate in the field in or on a plant and that provide benefits to animals upon ingestion.
  • Benefits of probiotic bacteria in animals include but are not limited to regulation of the microbiome of the digestive tract of the animal, secretion of enzymes that aid in digestion of plant material, and stimulation of the animals immune system.
  • digestion-enhancing enzymes examples include, but are not limited to cellulases, endoglucanases, exoglucanases, ⁇ -glucosidases, amylases, proteases, pectinases, xylanases, xylosidases, lipases, phospholipases, and lignases.
  • Bacillus and Lysinibacillus genera are unique in that they contain a large number of species that are both endophytic and thus colonize plants, but that can also act as probiotics in vertebrates. Thus, Bacillus and Lysinibacillus species are highly suitable for delivery of probiotics to animals through passaging and growth in plants.
  • Common Bacillus species that can be both endophytic and probiotic include Bacillus subtilis, Bacillus firmus, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus toyocerin, Bacillus megaterium, Bacillus pumilus , and Bacillus licheniformis. Lysinibacillus species that are both endophytic and probiotic can also be used.
  • a method for delivering beneficial bacteria to an animal comprises feeding to an animal a plant modified to comprise a level of an endophytic and probiotic strain of bacteria that is greater than the level of the endophytic and probiotic strain of bacteria in the same plant that has not been modified grown under the same conditions.
  • the plant fed to the animal can comprise a plant grown in a plant growth medium containing the endophytic and probiotic strain of bacteria or a formulation comprising the endophytic and probiotic strain of bacteria, a plant to which the endophytic and probiotic strain of bacteria was applied, a plant grown from a plant seed to which the endophytic and probiotic strain of bacteria was applied, a plant grown in an area to which the endophytic and probiotic strain of bacteria was applied, or a seed grown in the area to which the endophytic and probiotic strain of bacteria was applied.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Polymers & Plastics (AREA)
  • Biophysics (AREA)
  • Environmental Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Virology (AREA)
  • Environmental & Geological Engineering (AREA)
  • Medicinal Chemistry (AREA)
  • General Life Sciences & Earth Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Hydrology & Water Resources (AREA)
  • Water Supply & Treatment (AREA)
  • Food Science & Technology (AREA)
  • Animal Husbandry (AREA)
  • Geology (AREA)
  • Mining & Mineral Resources (AREA)
  • Materials Engineering (AREA)
  • Gastroenterology & Hepatology (AREA)
US14/857,606 2014-09-17 2015-09-17 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria Active US9845342B2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US14/857,606 US9845342B2 (en) 2014-09-17 2015-09-17 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US15/842,062 US10407472B2 (en) 2014-09-17 2017-12-14 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US16/563,086 US10836800B2 (en) 2014-09-17 2019-09-06 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US17/079,942 US11905315B2 (en) 2014-09-17 2020-10-26 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462051885P 2014-09-17 2014-09-17
US14/857,606 US9845342B2 (en) 2014-09-17 2015-09-17 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/842,062 Continuation US10407472B2 (en) 2014-09-17 2017-12-14 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria

Publications (2)

Publication Number Publication Date
US20160108096A1 US20160108096A1 (en) 2016-04-21
US9845342B2 true US9845342B2 (en) 2017-12-19

Family

ID=54238608

Family Applications (4)

Application Number Title Priority Date Filing Date
US14/857,606 Active US9845342B2 (en) 2014-09-17 2015-09-17 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US15/842,062 Active 2035-10-08 US10407472B2 (en) 2014-09-17 2017-12-14 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US16/563,086 Active US10836800B2 (en) 2014-09-17 2019-09-06 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US17/079,942 Active 2036-05-20 US11905315B2 (en) 2014-09-17 2020-10-26 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria

Family Applications After (3)

Application Number Title Priority Date Filing Date
US15/842,062 Active 2035-10-08 US10407472B2 (en) 2014-09-17 2017-12-14 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US16/563,086 Active US10836800B2 (en) 2014-09-17 2019-09-06 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US17/079,942 Active 2036-05-20 US11905315B2 (en) 2014-09-17 2020-10-26 Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria

Country Status (16)

Country Link
US (4) US9845342B2 (es)
EP (1) EP3194425A1 (es)
CN (1) CN107208042A (es)
AR (2) AR101953A1 (es)
AU (3) AU2015317521B2 (es)
BR (30) BR112017005326A2 (es)
CA (1) CA2961641A1 (es)
CL (4) CL2017000647A1 (es)
CR (1) CR20170139A (es)
IL (3) IL295968A (es)
MX (2) MX2017003465A (es)
NZ (2) NZ767896A (es)
PH (1) PH12017500519A1 (es)
UA (1) UA126325C2 (es)
UY (1) UY36304A (es)
WO (2) WO2016044655A2 (es)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170290339A1 (en) * 2014-09-17 2017-10-12 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and an insecticide
US20170295797A1 (en) * 2014-09-17 2017-10-19 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and a fungicide
CN109138946A (zh) * 2018-07-16 2019-01-04 西南石油大学 一种10MPa监测水驱油过程三维渗流实验系统
US10349660B2 (en) 2013-03-15 2019-07-16 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants, and immobilizing bacillus spores on plants
US10555532B2 (en) 2013-03-15 2020-02-11 Spogen Biotech Inc. Plant growth-promoting bacteria and methods of use
US10836800B2 (en) 2014-09-17 2020-11-17 Spogen Biotech Inc. Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US10973908B1 (en) 2020-05-14 2021-04-13 David Gordon Bermudes Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated salmonella as a vaccine
US11124460B2 (en) 2016-03-16 2021-09-21 Spogen Biotech Inc. Methods for promoting plant health using free enzymes and microorganisms that overexpress enzymes
US11154064B2 (en) 2014-09-17 2021-10-26 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and another biological control agent
WO2022187961A1 (en) 2021-03-11 2022-09-15 Les Biotechnologies Ulysse Inc. Microorganism displaying antigenic protein of the sars-cov2 coronavirus
US11541105B2 (en) 2018-06-01 2023-01-03 The Research Foundation For The State University Of New York Compositions and methods for disrupting biofilm formation and maintenance
EP3969464A4 (en) * 2019-05-15 2023-02-08 Bayer CropScience LP TARGETING SEQUENCES FOR A PAENIBACILLUS BASED ENDOSPORES DISPLAY PLATFORM
US11793196B2 (en) 2019-03-19 2023-10-24 Bayer Cropscience Lp Fusion proteins, recombinant bacteria, and exosporium fragments for pest control and plant health

Families Citing this family (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9517257B2 (en) 2010-08-10 2016-12-13 Ecole Polytechnique Federale De Lausanne (Epfl) Erythrocyte-binding therapeutics
US9850296B2 (en) 2010-08-10 2017-12-26 Ecole Polytechnique Federale De Lausanne (Epfl) Erythrocyte-binding therapeutics
JP6017422B2 (ja) 2010-08-10 2016-11-02 エコール・ポリテクニーク・フェデラル・ドゥ・ローザンヌ（ウペエフエル）Ｅｃｏｌｅ Ｐｏｌｙｔｅｃｈｎｉｑｕｅ Ｆｅｄｅｒａｌｅ ｄｅ Ｌａｕｓａｎｎｅ （ＥＰＦＬ） 赤血球結合療法
NZ723879A (en) 2014-02-21 2018-03-23 Ecole Polytechnique Fed Lausanne Epfl Glycotargeting therapeutics
US10046056B2 (en) 2014-02-21 2018-08-14 École Polytechnique Fédérale De Lausanne (Epfl) Glycotargeting therapeutics
US10946079B2 (en) 2014-02-21 2021-03-16 Ecole Polytechnique Federale De Lausanne Glycotargeting therapeutics
US10953101B2 (en) 2014-02-21 2021-03-23 École Polytechnique Fédérale De Lausanne (Epfl) Glycotargeting therapeutics
US10766799B2 (en) 2014-05-23 2020-09-08 Nch Corporation Method for improving quality of aquaculture pond water using a nutrient germinant composition and spore incubation method
RU2736562C2 (ru) 2014-09-17 2020-11-18 Байер Кропсайенс Лп Композиции, содержащие рекомбинантные клетки bacillus и инсектицид
WO2016044529A1 (en) 2014-09-17 2016-03-24 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and another biological control agent
US10273193B1 (en) * 2015-09-29 2019-04-30 Evan James Schick Horticulture growth media
PL3430117T3 (pl) * 2016-03-14 2020-11-16 Henkel Ag & Co. Kgaa Sposób opanowywania nieprzyjemnych zapachów z zastosowaniem unieczynnionych przetrwalników bakterii zdolnych do hamowania lub zapobiegania powstawania nieprzyjemnego zapachu
US10897922B2 (en) 2016-04-05 2021-01-26 Nch Corporation Composition and method for germinative compounds in probiotic food and beverage products for human consumption
MY190858A (en) 2016-04-05 2022-05-12 Nch Corp Nutrient rich germinant composition and spore incubation method
BR112018069945A2 (pt) 2016-04-06 2019-02-05 Plant Health Care Inc micróbios benéficos para distribuição de peptídeos ou proteínas efetoras e uso dos mesmos
CN106282067B (zh) * 2016-08-24 2019-10-11 李丽丽 多功能农用复合微生物菌剂及微生态制剂与应用
CN106635942B (zh) * 2016-12-05 2020-05-29 齐鲁工业大学 一种芽孢表面稳定展示海藻糖合酶的工程菌及其构建方法
US20200071713A1 (en) * 2016-12-06 2020-03-05 Pebble Labs Usa Inc. System and methods for the biocontrol of plant pathogens
CN107223663B (zh) * 2017-04-24 2019-10-29 大连理工大学 春雷霉素及其衍生物为几丁质酶抑制剂的应用
WO2018232176A1 (en) 2017-06-16 2018-12-20 The University Of Chicago Compositions and methods for inducing immune tolerance
US20200170258A1 (en) 2017-07-20 2020-06-04 Spogen Biotech Inc. Bioactive polypeptides for improvements in plant protection, growth and productivity
MX2020003039A (es) * 2017-09-20 2020-09-28 Spogen Biotech Inc Proteinas de fusion, bacterias recombinantes y fragmentos del exosporio para promover la salud de las plantas.
US10988769B2 (en) 2017-11-16 2021-04-27 Bayer Cropscience Lp Paenibacillus-based endospore display platform, products and methods
CN108018233B (zh) * 2017-12-12 2021-09-21 广州融新科技发展有限公司 一株暹罗芽孢杆菌及其微生物菌剂的制备与应用
CN109988806B (zh) * 2017-12-29 2023-02-28 弈柯莱生物科技(上海)股份有限公司 一种n-乙酰-草铵膦盐的消旋方法
CN108018245A (zh) * 2018-01-12 2018-05-11 中国科学院成都生物研究所 一株产壳聚糖酶的枯草芽孢杆菌及其应用
US20190276834A1 (en) * 2018-03-07 2019-09-12 R.J. Reynolds Tobacco Company Methods and compositions for reducing bacterial load in tobacco
US11401500B2 (en) 2018-08-29 2022-08-02 Nch Corporation System, method, and composition for incubating spores for use in aquaculture, agriculture, wastewater, and environmental remediation applications
CN109576233A (zh) * 2018-12-03 2019-04-05 中国农业科学院兰州兽医研究所 一种蜱源性基因工程疫苗
EP3914068A4 (en) * 2019-01-23 2023-04-19 Spogen Biotech Inc. COMPOSITIONS FOR TREATING CITRUS DISEASES AND PROMOTING YIELD INCREASE IN ROW CROPS
CN109777755A (zh) * 2019-01-31 2019-05-21 自然资源部第三海洋研究所 一株暹罗芽孢杆菌dh35及其发酵上清液的应用
CN109730136A (zh) * 2019-02-26 2019-05-10 湖州周生记餐饮管理有限公司 一种卤肉熟食的储存方法
MX2021011361A (es) * 2019-03-19 2021-10-13 Bayer Cropscience Lp Proteinas de fusion, bacterias recombinantes y fragmentos de exosporios para la salud de las plantas.
CN110862951B (zh) * 2019-09-06 2021-09-21 海南大学 一种维氏气单胞菌减毒菌株的构建方法、菌株及其应用
EP4061925A1 (en) 2019-11-22 2022-09-28 Bayer CropScience LP Methods of fermentation of recombinant bacillus spores
WO2021159068A1 (en) 2020-02-06 2021-08-12 Nch Corportion Composition and method of using germinative compounds in probiotics for inflammation reduction in humans
CN111748497B (zh) * 2020-07-07 2022-02-08 山东农业大学 一株大山芽孢杆菌及其在快速降解亚硝酸盐中的应用
CN111662856B (zh) * 2020-07-31 2022-05-06 河北省农林科学院生物技术与食品科学研究所 一种包含木醋液的复合微生物制剂及其制备方法与应用
WO2022061210A1 (en) 2020-09-21 2022-03-24 Bayer Cropscience Lp Novel serine proteases
CN112175921B (zh) * 2020-10-23 2022-06-07 中国科学院成都生物研究所 一种壳聚糖酶突变体g21r及其应用
CN114437954A (zh) * 2020-11-03 2022-05-06 中国石油天然气集团有限公司 一种降解磺化钻井液的弯曲芽孢杆菌、混合菌及其应用
CN112553230B (zh) * 2020-12-21 2021-08-24 山东省科学院生物研究所 高产iaa绿色木霉工程菌株及其构建方法与应用
CN112707953B (zh) * 2021-01-22 2023-05-30 南昌师范学院 Ev71病毒样颗粒产品、其制备方法及其应用
CN112795519B (zh) * 2021-03-01 2023-01-10 千禾味业食品股份有限公司 一种暹罗芽孢杆菌及其在富含乙偶姻食醋中的应用
CN113046328B (zh) * 2021-04-13 2023-07-25 吉林大学 一株化脓隐秘杆菌噬菌体及其医用用途
CN113151123B (zh) * 2021-06-17 2022-07-08 吉林农业大学 一种低温产纤维素酶和木聚糖酶的蜡样芽孢杆菌
CN115363058B (zh) * 2021-07-18 2024-03-22 杭州绿键生物科技有限公司 一种有效灭活新型冠状病毒的消毒剂
CN114903824B (zh) * 2021-07-21 2023-12-29 广州梵之容化妆品有限公司 一种舒缓保湿面膜
CN113549626B (zh) * 2021-07-27 2022-08-09 昆明理工大学 与腐霉利特异性结合的核酸适配体Pr-A08及其应用
CN113403209B (zh) * 2021-07-30 2022-08-26 西南大学 天冬氨酸蛋白酶基因在改良球孢白僵菌菌株中的应用
CN113913431B (zh) * 2021-09-09 2023-10-24 湖南工业大学 一种辛硫磷核酸适配体、核酸适配体衍生物及其应用
WO2023092050A1 (en) 2021-11-20 2023-05-25 Bayer Cropscience Lp Beneficial combinations with recombinant bacillus cells expressing a serine protease
CN114158508B (zh) * 2021-11-30 2023-07-25 海南归耘田农业科技有限公司 一种有效预防小龙虾受寄生虫感染的方法
CN114410481B (zh) * 2021-12-30 2023-09-15 广州市土根旺生物科技有限公司 一株棘孢木霉及其应用
WO2023137458A1 (en) * 2022-01-14 2023-07-20 Syngenta Crop Protection Ag Compositions and methods for screening insecticidal proteins
CN114908030B (zh) * 2022-05-11 2023-11-14 南京工业大学 一种在枯草芽孢杆菌表面展示β-环糊精葡萄糖基转移酶的重组菌及其应用
WO2023245018A2 (en) * 2022-06-13 2023-12-21 Trustees Of Tufts College Methods for spore display
FR3138265A1 (fr) * 2022-07-29 2024-02-02 Biointrant composition antigerminative
CN116102640A (zh) * 2022-10-13 2023-05-12 浙江双糖生物科技有限公司 重组乳铁蛋白衍生肽及其在提高免疫力方面的应用

Citations (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5290914A (en) 1988-04-28 1994-03-01 Mycogen Corporation Hybrid diphtheria-B.t. pesticidal toxins
CA2146822A1 (en) 1994-04-14 1995-10-15 Hans-Jurgen Schnorbach Insecticidal mixtures
US5503652A (en) 1986-12-17 1996-04-02 Cominco Fertilizers Bacterial cultures for root-colonizing plants
WO1996023063A1 (en) 1995-01-26 1996-08-01 Michigan State University Method of producing and purifying enzymes
US5776448A (en) 1984-03-26 1998-07-07 Dna Plant Technology Corporation Chitinase-producing bacteria
US6110372A (en) 1996-12-17 2000-08-29 Perriello; Felix Anthony Bioremediation of petroleum pollutants with alkane-utilizing bacteria
US6184440B1 (en) 1997-07-27 2001-02-06 Yissum Research Development Company Of The Hebrew University Of Jerusalem Transgenic plants of altered morphology
US6232270B1 (en) 1995-05-30 2001-05-15 Micro Flo Company Agricultural compositions containing bacteria
US6309440B1 (en) 1998-08-25 2001-10-30 Thomas T. Yamashita Method and composition for promoting and controlling growth of plants
US6333302B1 (en) 1997-09-03 2001-12-25 Cornell Research Foundation, Inc. Use of hypersensitive response elicitor protein or polypeptide from Clavibacter michiganensis for disease resistance, growth enhancement and insect control
WO2002000232A2 (en) 2000-06-26 2002-01-03 Maxygen, Inc. Methods and compositions for developing spore display systems for medicinal and industrial applications
WO2002045513A2 (en) 2000-12-04 2002-06-13 Wisconsin Alumni Research Foundation Bacterial inoculants for enhancing plant growth
WO2002046388A1 (en) 2000-12-08 2002-06-13 Genofocus Co., Ltd. Method for expression of proteins on spore surface
WO2003011487A1 (en) 2001-07-27 2003-02-13 Global Biosciences, Inc. Remediation of metal contaminants with hydrocarbon-utilizing bacteria
US6548743B1 (en) 1998-08-10 2003-04-15 The General Hospital Corporation Transgenic plants expressing a dual-specificity MAPK phosphatase and uses thereof
WO2003066846A1 (en) 2002-02-05 2003-08-14 National Research Council Of Canada Methods for modifying plant responses to stress and correspondingly derived plants
US20030228679A1 (en) 2002-03-27 2003-12-11 Smith Donald L. Compositions and methods for increasing plant growth by inoculation with bacillus strains
EP0792363B1 (en) 1994-09-28 2003-12-17 Syngenta Participations AG Novel pesticidal proteins and strains
US20040077090A1 (en) 1999-09-29 2004-04-22 Short Jay M. Whole cell engineering by mutagenizing a substantial portion of a starting genome, combining mutations, and optionally repeating
WO2005028654A1 (en) 2003-09-19 2005-03-31 Korea Advanced Institute Of Science And Technology Method for whole surrounding surface display of target proteins using bacterial exosporium
US20050232947A1 (en) 2002-03-07 2005-10-20 Cutting Simon M Bacterial spores
WO2006012366A2 (en) 2004-07-20 2006-02-02 Phyllom Llc Methods for making and using recombinant bacillus thuringiensis spores
WO2007078127A1 (en) 2006-01-02 2007-07-12 Korea Advanced Institute Of Science And Technology Method for cell surface displaying of target proteins using bacillus anthracis exosporium
WO2007086898A2 (en) 2005-03-31 2007-08-02 University Of South Carolina Methods and compositions related to anthrax spore glycoproteins
WO2008017483A2 (en) 2006-08-09 2008-02-14 Dsm Ip Assets B.V. Spore surface displays of bioactive molecules
US20080248953A1 (en) 2005-11-17 2008-10-09 Mcgill University Use of Bacteriocins For Promoting Plant Growth and Disease Resistance
WO2009037329A2 (en) 2007-09-21 2009-03-26 Basf Plant Science Gmbh Plants with increased yield
WO2009056494A2 (en) 2007-10-30 2009-05-07 Basf Se Use of glycerol, method of crop treatment, composition for tank mixing and a method of preparation of a composition for tank mixing
US20090192040A1 (en) 2006-02-27 2009-07-30 North-West University Plant support formulation, vehicle for the delivery and translocation of phytologically benefical substances and compositions containing same
WO2010046221A1 (en) 2008-10-23 2010-04-29 Basf Plant Science Gmbh Plants with increased yield (nue)
EP1465980B1 (en) 2002-01-07 2010-08-25 BrettYoung Seeds Limited Sulfur-oxidizing bacteria for promoting plant growth
US20100233124A1 (en) 2008-02-22 2010-09-16 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
EP1590466B1 (en) 2003-02-06 2010-09-22 CropDesign N.V. Method for modifying plant growth characteristics
US20100291100A1 (en) 2009-03-27 2010-11-18 Gojo Industries, Inc. Compositions And Methods For Screening And Using Compounds Antagonizing Spore-Surface Interactions
CN102031231A (zh) 2010-11-03 2011-04-27 甘肃农业大学 一种植物促生菌及其菌剂与其制备方法和应用
WO2011106794A1 (en) 2010-02-28 2011-09-01 Los Alamos National Security, Llc Increasing plant growth by modulating omega-amidase expression in plants
WO2011121408A1 (en) 2010-03-31 2011-10-06 Probelte, Sa Bacterial strains and a bionematicide and plant growth stimulator containing them
US8080404B1 (en) 2005-04-05 2011-12-20 The United States Of America As Represented By The Secretary Of The Army Enzymatic decontamination
US8105613B2 (en) 2005-03-10 2012-01-31 The Secretary Of State For Defence Vaccine formulation
US8114659B2 (en) 2008-01-14 2012-02-14 Robert William Rawson Apparatus and method for catalytic treatment of a media
US20120227134A1 (en) 2009-11-17 2012-09-06 Basf Plant Science Company Gmbh Plants with Increased Yield
US20120259101A1 (en) 2011-04-11 2012-10-11 Li Tan Isopeptide Bond Formation in Bacillus Species and Uses Thereof
US20120266327A1 (en) 2009-10-22 2012-10-18 Crop Functional Genomics Center Plants Having Enhanced Yield-Related Traits and a Method for Making the Same
US8383366B2 (en) 2002-03-29 2013-02-26 Danisco Us Inc. Enhanced protein expression in Bacillus
WO2013090628A1 (en) 2011-12-13 2013-06-20 Synthetic Genomics, Inc. Plant growth-promoting microbes and uses therefor
US20130216653A1 (en) 2010-06-30 2013-08-22 Dsm Ip Assets B.V. Spore surface display of bioactive molecules
WO2013178658A1 (en) 2012-05-30 2013-12-05 Bayer Cropscience Ag Compositions comprising a biological control agent and an insecticide
WO2013178649A1 (en) 2012-05-30 2013-12-05 Bayer Cropscience Ag Compositions comprising a biological control agent and a fungicide from the group consisting of inhibitors of the respiratory chain at complex i or ii.
US8614078B2 (en) 2011-04-15 2013-12-24 The Curators Of The University Of Missouri Contaminant reducing amide functionalized ordered mesoporous carbon composition
WO2014004487A1 (en) 2012-06-29 2014-01-03 Pioneer Hi-Bred International, Inc. Manipulation of serine/threonine protein phosphatases for crop improvement
US8673311B2 (en) 2009-09-21 2014-03-18 Royal Holloway And Bedford New College Bacterial spore having therapeutic agent adsorbed on its surface
WO2014079814A1 (en) 2012-11-22 2014-05-30 Basf Se Pesticidal mixtures
WO2014079773A1 (en) 2012-11-22 2014-05-30 Basf Se Pesticidal mixtures
US20140274707A1 (en) 2013-03-15 2014-09-18 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants from pathogens, and immobilizing bacillus spores on plant roots
US20140274691A1 (en) 2013-03-15 2014-09-18 Spogen Biotech Inc. Plant growth-promoting bacteria and methods of use
EP2069504B1 (en) 2006-12-15 2015-06-03 CropDesign N.V. Plants having enhanced seed yield-related traits and a method for making the same
WO2015118516A1 (en) 2014-02-10 2015-08-13 Biofil Mikrobiológiai, Géntechnológiai És Biokémiai Kft. Soil bacteria for inoculating stress soils

Family Cites Families (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5858962A (en) 1987-05-11 1999-01-12 Ambi Inc. Composition for treating mastitis and other staphylococcal infections
US5200182A (en) 1988-05-26 1993-04-06 Nika Health Products, Ltd. Antiviral or antibacterial composition and method of use
PH30997A (en) 1990-03-12 1997-12-23 Ciba Geigy Antipathologenically effective compositions comprising lytic peptides and hydrolytic enzymes.
GB9510459D0 (en) 1995-05-24 1995-07-19 Zeneca Ltd Bicyclic amines
GB9624611D0 (en) 1996-11-26 1997-01-15 Zeneca Ltd Bicyclic amine compounds
JPH10203917A (ja) 1997-01-28 1998-08-04 Idemitsu Kosan Co Ltd 微生物種子粉衣組成物
US7432097B2 (en) 1997-08-13 2008-10-07 Verenium Corporation Phytases, nucleic acids encoding them and methods of making and using them
US5958104A (en) 1997-09-11 1999-09-28 Nonomura; Arthur M. Methods and compositions for enhancing plant growth
US6323023B1 (en) 1998-01-13 2001-11-27 Yissum Research Development Co., Ltd. Vectors containing nucleic acids coding for Arabidopsis thaliana endo-1,4-β-glucanase secretion signal peptide
JP3140430B2 (ja) 1999-03-09 2001-03-05 株式会社 バイテク バチルス属微生物とその用途
RU2160778C1 (ru) 1999-11-10 2000-12-20 Федеральное государственное унитарное предприятие "Пермский завод им. С.М. Кирова" Штамм бактерий bacillus сereus-продуцент нитрилгидратазы
US6630340B2 (en) 2000-03-01 2003-10-07 Novozymes A/S Family 5 xyloglucanases
US20030167506A1 (en) 2001-03-22 2003-09-04 Pioneer Hi-Bred International, Inc. Expansin protein and polynucleotides and methods of use
KR20030015943A (ko) 2001-08-18 2003-02-26 한국바이오비료 주식회사 섬유질 분해 효소를 분비하는 유전자, 유전자로부터분비된 효소, 유전자를 포함하는 미생물, 미생물을 이용한유기질 비료
ES2193892B1 (es) 2002-04-29 2005-05-16 Biotecnologicos Y Mercados, S.L. Fertilizante nitrogenado y procedimiento de obtencion del mismo.
AU2003251549B2 (en) 2002-06-14 2008-03-13 Bp Corporation North America Inc. Xylanases, nucleic acids encoding them and methods for making and using them
AU2004254640B2 (en) 2003-07-02 2010-08-26 Bp Corporation North America Inc. Glucanases, nucleic acids encoding them and methods for making and using them
JP2005298409A (ja) 2004-04-12 2005-10-27 Yukijirushi Shubyo Kk 植物発根促進剤
RU2006139953A (ru) 2004-04-13 2008-05-20 Е.И. Дюпон Де Немур Энд Компани (Us) Антраниламидные инсектициды
GB0416629D0 (en) 2004-07-27 2004-08-25 Univ Sheffield Crop spray
US7417181B2 (en) 2005-04-07 2008-08-26 The Samuel Roberts Noble Foundation Plants with increased phosphorous uptake
ES2437577T3 (es) 2005-07-18 2014-01-13 Basf Plant Science Gmbh Aumento del rendimiento en plantas que sobreexpresan los genes de ACCDP
JP2007117066A (ja) 2005-09-30 2007-05-17 Techno Giken Kk 植物種子の物理処理方法と育種、育苗方法
RU2313941C2 (ru) 2005-10-05 2008-01-10 ООО "БИО Агат Групп" Препарат для защиты растений от возбудителей болезней сельскохозяйственных культур и винограда с ростстимулирующим эффектом, способ получения этого препарата и штаммы для его осуществления
CN101362799A (zh) 2007-08-10 2009-02-11 中国科学院上海生命科学研究院 调控植物株高的基因及其应用
EP2197893B1 (en) 2007-09-07 2013-07-24 Dyadic International, Inc. Novel fungal enzymes
GB0717911D0 (en) 2007-09-14 2007-10-24 Univ Stirling Vaccine
CN101481666B (zh) 2008-11-19 2011-08-24 黄晓东 植物促生菌、含有植物促生菌的微生物制剂及其制备方法
CN102257146B (zh) 2008-12-18 2017-11-28 港大科桥有限公司 通过在转基因植物中引入磷酸酶来加速植物生长和改进产量的方法
KR101086367B1 (ko) 2010-03-11 2011-11-23 강원대학교산학협력단 식물생장 촉진 활성을 갖는 신균주 바실러스 아리아바타이 ｌｓ9 및 이의 용도
RU2439148C1 (ru) 2010-05-21 2012-01-10 Российская Федерация, От Имени Которой Выступает Министерство Промышленности И Торговли Российской Федерации ШТАММ ГИБРИДНЫХ КУЛЬТИВИРУЕМЫХ КЛЕТОК ЖИВОТНЫХ Mus musculus 1E6 - ПРОДУЦЕНТ МОНОКЛОНАЛЬНЫХ АНТИТЕЛ, СПЕЦИФИЧНЫХ К СПОРАМ Bacillus anthracis
CN101919407A (zh) 2010-07-21 2010-12-22 合肥工业大学 阿维菌素与苏云金芽孢杆菌复配的生物悬浮杀虫剂
CN103443278B (zh) 2011-03-23 2017-07-04 诺维信公司 生产分泌型多肽的方法
JP5747625B2 (ja) 2011-04-12 2015-07-15 住友化学株式会社 マンデロニトリル化合物の製造方法
AU2012247609B2 (en) 2011-04-27 2017-02-16 Aarhus Universitet High expression cereal phytase gene
CN103086784B (zh) 2011-10-27 2014-06-25 胡茂森 一种氨基酸加酶生物肥及其制备方法
RU2615834C2 (ru) * 2012-01-25 2017-04-11 Байер Интеллектуэль Проперти Гмбх Комбинация активных соединений, а также содержащая комбинацию композиция и их применение, семя, обработанное комбинацией или композицией, и способ борьбы для защиты сельскохозяйственных культур
TR201816257T4 (tr) 2012-05-30 2018-11-21 Bayer Cropscience Ag Bir biyolojik kontrol ajanı ve trifloksistrobin içeren bileşim.
JP2014001179A (ja) 2012-06-20 2014-01-09 Sumitomo Chemical Co Ltd 有害生物の防除方法
US9125419B2 (en) 2012-08-14 2015-09-08 Marrone Bio Innovations, Inc. Bacillus sp. strain with antifungal, antibacterial and growth promotion activity
GB2507760B (en) 2012-11-08 2015-07-08 Inst Of Food Res Methods
CN104918493B (zh) 2012-11-30 2018-02-06 拜尔农作物科学股份公司 三元杀真菌和杀虫混合物
US20160236996A1 (en) 2013-10-11 2016-08-18 Suunil Sudhakar CHANDHRY A Process for Producing Highly Nutritious and Bioavailable Organic Nitrogen Fertilizer from Non GMA Organisms
CL2013003780A1 (es) 2013-12-30 2014-06-20 Univ Concepcion Biofertilizante y su proceso de elaboración.
EP3102682A1 (en) 2014-02-04 2016-12-14 University of Florida Research Foundation, Inc. Pteris vittata phytase nucleotide and amino acid sequences and methods of use
EP3193619A1 (en) 2014-09-17 2017-07-26 Bayer Cropscience LP Compositions comprising recombinant bacillus cells and another biological control agent
WO2016044529A1 (en) 2014-09-17 2016-03-24 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and another biological control agent
WO2016044655A2 (en) 2014-09-17 2016-03-24 Spogen Biotech Inc. Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
MX2017003610A (es) 2014-09-17 2017-07-13 Bayer Cropscience Lp Composiciones que comprenden celulas recombinantes de bacillus y un fungicida.
BR112017005504A2 (pt) 2014-09-17 2018-08-14 Bayer Cropscience Lp composições que compreendem células recombinantes de bacillus e um inseticida.
BR112017005379A2 (pt) 2014-09-17 2018-08-14 Bayer Cropscience Lp composições que compreendem células recombinantes de bacillus e um fungicida.
RU2736562C2 (ru) 2014-09-17 2020-11-18 Байер Кропсайенс Лп Композиции, содержащие рекомбинантные клетки bacillus и инсектицид
PT3209319T (pt) 2014-10-21 2021-09-24 Hexima Ltd Um método de tratamento
US10851027B2 (en) 2014-12-22 2020-12-01 Biomineral Systems LLc Phosphorus fertilizer bio-catalyst for sustainable crop production
CN104945164A (zh) 2015-07-07 2015-09-30 卞佳林 一种种植红薯用的肥料及其制备方法
CA3221966A1 (en) 2016-03-16 2017-09-21 Spogen Biotech Inc. Methods for promoting plant health using free enzymes and microorganisms that overexpress enzymes
BR112018068719A2 (pt) 2016-03-16 2019-01-22 Spogen Biotech Inc métodos para produzir uma resposta imunogênica em um animal aquático e composição farmacêutica
WO2018152411A1 (en) 2017-02-17 2018-08-23 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and an insecticide
MX2020003039A (es) 2017-09-20 2020-09-28 Spogen Biotech Inc Proteinas de fusion, bacterias recombinantes y fragmentos del exosporio para promover la salud de las plantas.

Patent Citations (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5776448A (en) 1984-03-26 1998-07-07 Dna Plant Technology Corporation Chitinase-producing bacteria
US5503652A (en) 1986-12-17 1996-04-02 Cominco Fertilizers Bacterial cultures for root-colonizing plants
US5290914A (en) 1988-04-28 1994-03-01 Mycogen Corporation Hybrid diphtheria-B.t. pesticidal toxins
CA2146822A1 (en) 1994-04-14 1995-10-15 Hans-Jurgen Schnorbach Insecticidal mixtures
EP0792363B1 (en) 1994-09-28 2003-12-17 Syngenta Participations AG Novel pesticidal proteins and strains
WO1996023063A1 (en) 1995-01-26 1996-08-01 Michigan State University Method of producing and purifying enzymes
US5766914A (en) 1995-01-26 1998-06-16 Michigan State University Method of producing and purifying enzymes
US6232270B1 (en) 1995-05-30 2001-05-15 Micro Flo Company Agricultural compositions containing bacteria
US6110372A (en) 1996-12-17 2000-08-29 Perriello; Felix Anthony Bioremediation of petroleum pollutants with alkane-utilizing bacteria
US6184440B1 (en) 1997-07-27 2001-02-06 Yissum Research Development Company Of The Hebrew University Of Jerusalem Transgenic plants of altered morphology
US6333302B1 (en) 1997-09-03 2001-12-25 Cornell Research Foundation, Inc. Use of hypersensitive response elicitor protein or polypeptide from Clavibacter michiganensis for disease resistance, growth enhancement and insect control
US6548743B1 (en) 1998-08-10 2003-04-15 The General Hospital Corporation Transgenic plants expressing a dual-specificity MAPK phosphatase and uses thereof
US6309440B1 (en) 1998-08-25 2001-10-30 Thomas T. Yamashita Method and composition for promoting and controlling growth of plants
US20040077090A1 (en) 1999-09-29 2004-04-22 Short Jay M. Whole cell engineering by mutagenizing a substantial portion of a starting genome, combining mutations, and optionally repeating
WO2002000232A2 (en) 2000-06-26 2002-01-03 Maxygen, Inc. Methods and compositions for developing spore display systems for medicinal and industrial applications
WO2002045513A2 (en) 2000-12-04 2002-06-13 Wisconsin Alumni Research Foundation Bacterial inoculants for enhancing plant growth
US7393678B2 (en) 2000-12-04 2008-07-01 Wisconsin Alumni Research Foundation Klebsiella pneumoniae inoculants for enhancing plant growth
WO2002046388A1 (en) 2000-12-08 2002-06-13 Genofocus Co., Ltd. Method for expression of proteins on spore surface
WO2003011487A1 (en) 2001-07-27 2003-02-13 Global Biosciences, Inc. Remediation of metal contaminants with hydrocarbon-utilizing bacteria
EP1465980B1 (en) 2002-01-07 2010-08-25 BrettYoung Seeds Limited Sulfur-oxidizing bacteria for promoting plant growth
US7615681B2 (en) 2002-02-05 2009-11-10 National Research Council Of Canada Methods for modifying plant responses to stress and correspondingly derived plants
WO2003066846A1 (en) 2002-02-05 2003-08-14 National Research Council Of Canada Methods for modifying plant responses to stress and correspondingly derived plants
US20050232947A1 (en) 2002-03-07 2005-10-20 Cutting Simon M Bacterial spores
US20030228679A1 (en) 2002-03-27 2003-12-11 Smith Donald L. Compositions and methods for increasing plant growth by inoculation with bacillus strains
US8383366B2 (en) 2002-03-29 2013-02-26 Danisco Us Inc. Enhanced protein expression in Bacillus
EP1590466B1 (en) 2003-02-06 2010-09-22 CropDesign N.V. Method for modifying plant growth characteristics
US7919678B2 (en) 2003-02-06 2011-04-05 Cropdesign N.V. Method for modifying plant growth characteristics
WO2005028654A1 (en) 2003-09-19 2005-03-31 Korea Advanced Institute Of Science And Technology Method for whole surrounding surface display of target proteins using bacterial exosporium
US8030064B2 (en) 2003-09-19 2011-10-04 Korea Advanced Institute Of Science And Technology Method for whole surrounding surface display of target proteins using bacterial exosporium
WO2006012366A2 (en) 2004-07-20 2006-02-02 Phyllom Llc Methods for making and using recombinant bacillus thuringiensis spores
US8105613B2 (en) 2005-03-10 2012-01-31 The Secretary Of State For Defence Vaccine formulation
WO2007086898A2 (en) 2005-03-31 2007-08-02 University Of South Carolina Methods and compositions related to anthrax spore glycoproteins
US8080404B1 (en) 2005-04-05 2011-12-20 The United States Of America As Represented By The Secretary Of The Army Enzymatic decontamination
US20080248953A1 (en) 2005-11-17 2008-10-09 Mcgill University Use of Bacteriocins For Promoting Plant Growth and Disease Resistance
WO2007078127A1 (en) 2006-01-02 2007-07-12 Korea Advanced Institute Of Science And Technology Method for cell surface displaying of target proteins using bacillus anthracis exosporium
US20090192040A1 (en) 2006-02-27 2009-07-30 North-West University Plant support formulation, vehicle for the delivery and translocation of phytologically benefical substances and compositions containing same
WO2008017483A2 (en) 2006-08-09 2008-02-14 Dsm Ip Assets B.V. Spore surface displays of bioactive molecules
EP2069504B1 (en) 2006-12-15 2015-06-03 CropDesign N.V. Plants having enhanced seed yield-related traits and a method for making the same
US20100205690A1 (en) 2007-09-21 2010-08-12 Basf Plant Science Gmbh Plants With Increased Yield
WO2009037329A2 (en) 2007-09-21 2009-03-26 Basf Plant Science Gmbh Plants with increased yield
WO2009056494A2 (en) 2007-10-30 2009-05-07 Basf Se Use of glycerol, method of crop treatment, composition for tank mixing and a method of preparation of a composition for tank mixing
US8114659B2 (en) 2008-01-14 2012-02-14 Robert William Rawson Apparatus and method for catalytic treatment of a media
US20100233124A1 (en) 2008-02-22 2010-09-16 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
US20110281316A1 (en) 2008-02-22 2011-11-17 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
US9132175B2 (en) 2008-02-22 2015-09-15 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
US9133251B2 (en) 2008-02-22 2015-09-15 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
US20160051656A1 (en) 2008-02-22 2016-02-25 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
US20160053222A1 (en) 2008-02-22 2016-02-25 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
WO2010046221A1 (en) 2008-10-23 2010-04-29 Basf Plant Science Gmbh Plants with increased yield (nue)
US20110321197A1 (en) 2008-10-23 2011-12-29 Basf Plant Science Gmbh Plants with Increased Yield (NUE)
US20100291100A1 (en) 2009-03-27 2010-11-18 Gojo Industries, Inc. Compositions And Methods For Screening And Using Compounds Antagonizing Spore-Surface Interactions
US8673311B2 (en) 2009-09-21 2014-03-18 Royal Holloway And Bedford New College Bacterial spore having therapeutic agent adsorbed on its surface
US20120266327A1 (en) 2009-10-22 2012-10-18 Crop Functional Genomics Center Plants Having Enhanced Yield-Related Traits and a Method for Making the Same
US20120227134A1 (en) 2009-11-17 2012-09-06 Basf Plant Science Company Gmbh Plants with Increased Yield
WO2011106794A1 (en) 2010-02-28 2011-09-01 Los Alamos National Security, Llc Increasing plant growth by modulating omega-amidase expression in plants
US9068194B2 (en) 2010-02-28 2015-06-30 Los Alamos National Security, Llc Increasing plant growth by modulating omega-amidase expression in plants
WO2011121408A1 (en) 2010-03-31 2011-10-06 Probelte, Sa Bacterial strains and a bionematicide and plant growth stimulator containing them
US20130216653A1 (en) 2010-06-30 2013-08-22 Dsm Ip Assets B.V. Spore surface display of bioactive molecules
CN102031231A (zh) 2010-11-03 2011-04-27 甘肃农业大学 一种植物促生菌及其菌剂与其制备方法和应用
US20120259101A1 (en) 2011-04-11 2012-10-11 Li Tan Isopeptide Bond Formation in Bacillus Species and Uses Thereof
US8614078B2 (en) 2011-04-15 2013-12-24 The Curators Of The University Of Missouri Contaminant reducing amide functionalized ordered mesoporous carbon composition
US20140342905A1 (en) 2011-12-13 2014-11-20 Monsanto Technology Llc Plant growth-promoting microbes and uses therefor
WO2013090628A1 (en) 2011-12-13 2013-06-20 Synthetic Genomics, Inc. Plant growth-promoting microbes and uses therefor
WO2013178649A1 (en) 2012-05-30 2013-12-05 Bayer Cropscience Ag Compositions comprising a biological control agent and a fungicide from the group consisting of inhibitors of the respiratory chain at complex i or ii.
WO2013178658A1 (en) 2012-05-30 2013-12-05 Bayer Cropscience Ag Compositions comprising a biological control agent and an insecticide
US20140259225A1 (en) 2012-06-29 2014-09-11 Pioneer Hi Bred International Inc Manipulation of serine/threonine protein phosphatases for crop improvement
WO2014004487A1 (en) 2012-06-29 2014-01-03 Pioneer Hi-Bred International, Inc. Manipulation of serine/threonine protein phosphatases for crop improvement
WO2014079773A1 (en) 2012-11-22 2014-05-30 Basf Se Pesticidal mixtures
WO2014079814A1 (en) 2012-11-22 2014-05-30 Basf Se Pesticidal mixtures
US20140274707A1 (en) 2013-03-15 2014-09-18 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants from pathogens, and immobilizing bacillus spores on plant roots
US20140274691A1 (en) 2013-03-15 2014-09-18 Spogen Biotech Inc. Plant growth-promoting bacteria and methods of use
US20160031948A1 (en) 2013-03-15 2016-02-04 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants, and immobilizing bacillus spores on plants
US9573980B2 (en) * 2013-03-15 2017-02-21 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants from pathogens, and immobilizing Bacillus spores on plant roots
WO2015118516A1 (en) 2014-02-10 2015-08-13 Biofil Mikrobiológiai, Géntechnológiai És Biokémiai Kft. Soil bacteria for inoculating stress soils

Non-Patent Citations (150)

* Cited by examiner, † Cited by third party
Title
Ahemad, M., et al., "Mechanisms and Applications of Plant Growth Promoting Rhizobacteria: Current Perspective," Journal of King Saud University-Science, 2014, pp. 1-20, vol. 26.
Ahemad, M., et al., "Mechanisms and Applications of Plant Growth Promoting Rhizobacteria: Current Perspective," Journal of King Saud University—Science, 2014, pp. 1-20, vol. 26.
Anand, R., et al., "N2-Fixation and Seedling Growth Promotion of Lodgepole Pine by Endophytic Paenibacillus polymyxa", Microbial Ecology, 2013, pp. 369-374, vol. 66, No. 2.
Bae et al., Multiple Classes of Immune Related Ptoteases Associated with the Cell Death Response in Pepper Plants, PLOS ONE, 2013, 8: 63533.
Bent, E., et al., "Alterations in plant growth and in root hormone levels of lodgepole pines inoculated with rhizobacteria", Canadian Journal of Microbiology, Sep. 2001, pp. 793-800, vol. 47, No. 9.
Berlemont, R., et al., "Phylogenetic Distribution of Potential Cellulases in Bacteria," Applied and Environmental Microbiology, Mar. 2013, pp. 1545-1554, vol. 79, No. 5.
Boydston et al. 2010; The ExsY protein is required for complete formation of the exosporium of Bacillus anthracis. (J. Bacteriology. 188(21):7440-7448. *
Chakraborty, U., et al., "Plant growth promotion and induction of resistance in Camellia sinensis by Bacillus megaterium", Journal of Basic Microbiology, 2006, pp. 186-195, vol. 46, No. 3.
Chapman, K. D., "Phospholipase activity during plant growth and development and in response to environmental stress", Trends in Plant Sciences, 1998, 3: 419-426.
Choudhary, D. K., et al., "Interactions of Bacillus spp. and Plants-With Special Reference to Induced Systemic Resistance (ISR)", Microbiological Research, 2009, pp. 493-513, vol. 164.
Choudhary, D. K., et al., "Interactions of Bacillus spp. and Plants—With Special Reference to Induced Systemic Resistance (ISR)", Microbiological Research, 2009, pp. 493-513, vol. 164.
Ciabattini, A., et al., "Oral Priming of Mice by Recombinant Spores of Bacillus subtilis", Vaccine, Oct. 2004, pp. 4139-4143, vol. 22, Nos. 31-32.
Corbineau, F. and Côme, D., "Improvement of Germination of Terminalia Ivorensis Seeds", Forest Genetic Resources Information No. 21, http://www.faa.org/docrep/006/v3030e/V3030E10.htm, 7 pages.
Da Mota, F. F., et al., "Auxin Production and Detection of the Gene Coding for the Auxin Efflux Carrier (AEC) Protein in Paenibacillus polymyxa", Journal of Microbiology, Jun. 2008, pp. 257-264, vol. 46, No. 3.
De Freitas, J. R., et al., "Phosphate-solubilizing Rhizobacteria Enhance the Growth and Yield but not Phosphorus Uptake of Canola (Brassica napus L.)," Biology and Fertility of Soils, May 1997, pp. 358-364, vol. 24, Issue 4.
Ding, Y., et al., "Isolation and identification of nitrogen-fixing bacilli from plant rhizospheres in Beijing region", Journal of Applied Microbiology, 2005, pp. 1271-1281, vol. 99, No. 5.
Dong et al., "Identification of quorum-quenching N-acyl homoserine lactonases from Bacillus species", Appl. Environ. Microbial., 2002, 68: 1754-1759.
Doronina, N. V., et al., "Emended description of Paracoccus kondratievae", International Journal of Systematic and Evolutionary Microbiology, Mar. 2002, pp. 679-682, vol. 52, Part 2.
Dourado, M., et al., "Biotechnological and Agronomic Potential of Endophytic Pink-Pigmented Methylotrophic Methylobacterium spp.", BioMed Research International, vol. 2015, Article ID 909016, 19 pages.
Dowd, P.E., et al., "The Emerging Roles of Phospholipase C in Plant Growth and Development," Lipid Signaling in Plants, 2010, pp. 23-37, vol. 16.
Duc Le H., et al., "Bacterial Spores as Vaccine Vehicles", Infection and Immunity, May 2003, pp. 2810-2818, vol. 71, No. 5.
Duc, Le H., et al., "Immunization against anthrax using Bacillus subtilis spores expressing the anthrax protective antigen", Vaccine, Jan. 2007, pp. 346-355, vol. 25, No. 2.
English, M. M., et al., "Overexpression of has in the plant growth-promoting bacterium Enterobacter cloacae UW5 increases root colonization", Journal of Applied Microbiology, 2009, pp. 2180-2190, vol. 108, No. 6.
Erturk Y. et al., "Effects of plant growth promoting rhizobacteria (PGPR) on rooting and root growth of kiwifruit (Actinidia deliciosa) stem cuttings", Biological Research, 2010, pp. 91-98, vol. 43, No. 1.
Faria, D. C., et al., "Endophytic bacteria isolated from orchid and their potential to promote plant growth", World Journal of Microbiology & Biotechnology, 2013, pp. 217-221, vol. 29, No. 2.
Feng, F. et al., "Display of Human Proinsulin on the Bacillus subtilis Spore Surface for Oral Administration", Current Microbiology, Jul. 2013, 67(1):1-8.
Forage, R. G., et al., "Glycerol Fermentation in Klebsiella pneumoniae: Functions of the Coenzyme B12-Dependent Gycerol and Diol Dehydratases", Journal of Bacteriology, Feb. 1982, pp. 413-419, vol. 149, No. 2.
Gamalero, E., et al., "Bacterial Modulation of Plant Ethylene Levels", Plant Physiology , Sep. 2015, vol. 169, pp. 13-22.
Glick, B.R., "Modulation of plant ethylene levels by the bacterial enzyme ACC deaminase", FEMS Microbiology Letters, 2005, 251: 1-7.
Gnanaraj, M., et al."Isolation and gene expression analysis of Phospholipase C in response to abiotic stresses from Vigna radiata (L.) Wilczek", Indian Journal of Experimental Biology, vol. 53, Jun. 2015, pp. 335-341.
Goldberg, L. J., et al., "A Bacterial Spore Demonstrating Rapid Larvicidal Activity Against Anopheles Sergentii, Uranotaenia Unguiculata, Culex Univitattus, Aedes Aegypti and Culex Pipiens", Mosquito News, Sep. 1977, pp. 355-358, vol. 37, No. 3.
Guerchicoff, A., et al., "Identification and Characterization of a Previously Undescribed cyt Gene in Bacillus thuringiensis subsp. israelensis", Applied and Environmental Microbiology, Jul. 1997, pp. 2716-2721, vol. 63, No. 7.
Gujar et al., "Effect of phytase from Aspergillus niger on plant growth and mineral assimilation in wheat (Triticum aestivum Linn.) and its potential for use as a soil amendment", J Sci Food Agric., 2013, 93: 2242-2247.
Hafeez et al., "PGPR: Versatile tool to combat soil borne pathogens and improve plant health", Aspects of Applied Biology, 2011, 106: 241-245.
Haggag, W. M., et al., "Colonization of peanut roots by biofilm-forming Paenibacillus polymyxa initiates biocontrol against crown rot disease", Journal of Applied Microbiology, 2008, pp. 961-969, vol. 104, No. 4.
Han, W. and He, M., "The application of exogenous cellulose to improve soil fertility and plant growth due to acceleration of straw decomposition", Bioresource Technol, 2010, 101: 3724-3731.
Hartati et al., "Overexpression of Poplar Cellulase Accelerates Growth and Disturbs The Closing Movements of Leaves in Sengon", Plant Physiology, 2008, 147: 552-561.
Hinton, D. M., et al., "Enterobacter cloacae is an endophytic symbiont of corn", Mycopathologia, 1995, pp. 117-125, vol. 129, No. 2.
Hoelscher, B., et al., "Removal of Toxic Contaminants from Polluted Soil and Water via Enzyme-Linked Bacillus Spores", Poster presented at Missouri Life Sciences Week Research Poster Session, Apr. 14, 2010.
Hong, Y. and Lu, S., "Phospholipases in Plant Response to Nitrogen and Phosphorus Availability", Springer, Phospholipases in Plant Signaling and Communication in Plants, 2013, 20: 159-180.
Hontzeas, N., et al., "Changes in Gene Expression in Canola Roots Induced by ACC-Deaminase-Containing Plant-Growth-Promoting Bacteria", Molecular Plant-Microbe Interactions, Aug. 2004, pp. 865-871, vol. 17, No. 8.
Howard, G. and Elliott, L., "Effects of Cellulolytic Ruminol Bacteria and of Cell Extracts on Germination of Euonymus americanus L. Seeds", Applied and Environmental Microbiology, Jan. 1988. p. 218-224.
Idriss et al., "Extraccellular phytase activity of Bacillus amyloliquefaciens FZB45 contributes to its plant-growth-promoting effect", Microbiology, 2002, 148: 2097-2109.
Iniguez, A. L., et al., "Nitrogen Fixation in Wheat Provided by Klebsiella pneumoniae 342", Molecular Plant-Microbe Interactions, Oct. 2004, pp. 1078-1085, vol. 17, No. 10.
International Search Report and Written Opinion issued for PCT/US2015/050795, dated Mar. 31, 2016, 17 pages.
International Search Report and Written Opinion issued for PCT/US2015/050807, dated Dec. 10, 2015, 12 pages.
Invitation to Pay Additional Fees and, Where Applicable, Protest Fees, issued for PCT/US2015/050795, dated Jan. 14, 2016, 8 pages.
Islam, M. R., et al., "Characterization of Plant Growth-Promoting Traits of Free-Living Diazotrophic Bacteria and Their Inoculation Effects on Growth and Nitrogen Uptake of Crop Plants", Journal of Microbiology and Biotechnology, Oct. 2009, pp. 1213-1222, vol. 19, No. 10.
Isticato, R., et al., "Surface Display of Recombinant Proteins on Bacillus subtilis Spores", Journal of Bacteriology, Nov. 2001, pp. 6294-6301, vol. 183, No. 21.
Iwanicki, A., et al., "A system of vectors for Bacillus subtilis spore surface display", Microbial Cell Factories, 2014, 13:30, pp. 1-9.
Jackson, W.T., "Effect of Pectinase and Cellulase Preparations on the Growth and Development of Root Hairs", hysiologia Plantarum, 2006 (first published in 1959), 12: 502-510.
Jeong, H., et al., "Draft Genome Sequence of the Paenibacillus polymyxa Type Strain (ATCC 842T), A Plant Growth-Promoting Bacterium", Journal of Bacteriology, 2011, pp. 5026-5027, vol. 193, No. 18.
Johnson M. J., et al., "ExsY and CotY are Required for the Correct Assembly of the Exosporium and Spore Coat of Bacillus cereus", Journal of Bacteriology, 2006, pp. 7905-7913, vol. 188, No. 22.
Karakurt, H., et al., "Effects of indol-3-butyric acid (IBA), plant growth promoting rhizobacteria (PGPR) and carbohydrates on rooting of hardwood cutting of MM106 Apple rootstock", African Journal of Agricultural Research, Feb. 2009, pp. 060-064, vol. 4, No. 2.
Karigar, C., et al., "Role of Microbial Enzymes in the Bioremediation of Pollutants: A Review", SAGE-Hindawi Access to Research Enzyme Research, vol. 2011, Article ID 805187, 11 pages.
Khan, Z., et al., "A plant growth promoting rhizobacterium, Paenibacillus polymyxa strain GBR-1, suppresses root-knot nematode", Bioresource Technology, May 2008, pp. 3016-3023, vol. 99, No. 8.
Kim, J. F., et al., "Genome Sequence of the Polymyxin-Producing Plant-Probiotic Rhizobacterium Paenibacillus polymyxa E681", Journal of Bacteriology, 2010, pp. 6103-6104, vol. 192, No. 22.
Kim, J. H., et al., "Bacterial Surface Display of GFP(uv) on Bacillus subtilis Spores", Journal of Microbiology and Biotechnology, Apr. 2007, pp. 677-680, vol. 17, No. 4.
Kim, J. H., et al., "Spore-Displayed Streptavidin: A live Diagnostic tool in biotechnology", Biochemical and Biophysical Research Communications, May 2005, pp. 210-214, vol. 331, No. 1.
Kishore, G. K., et al., "Phylloplane bacteria increase seedling emergence, growth and yield of field-grown groundnut (Arachis hypogaea L.)", Letters in Applied Microbiology, 2005, pp. 260-268, vol. 40, No. 4.
Kong, Z., et al., "Effects of 1-aminocyclopropane-1-carboxylate (ACC) deaminase-overproducing Sinorhizobium meliloti on plant growth and copper tolerance of Medicago lupulina", Plant and Soil, Jun. 2015, vol. 391, Issue 1, pp. 383-398.
Lamsal, K., et al., "Application of Rhizobacteria for Plant Growth Promotion Effect and Biocontrol of Anthracnose Caused by Colletotrichum acutatum on Pepper", Mycobiology, Dec. 2012, pp. 244-251, vol. 40, No. 4.
Lee, S., et al., "Growth Promotion of Xanthium italicum by Application of Rhizobacterial Isolates of Bacillus aryabhaffai in Microcosm Soil", Journal of Microbiology, Feb. 2012, pp. 45-49, vol. 50, No. 1.
Leite, H. A., et al., "Bacillus subtilis and Enterobacter cloacae endophytes from healthy Theobroma cacao L. Trees can systemically colonize seedlings and promote growth", Applied Microbiology and Biotechnology, Dec. 2012, pp. 2639-2651, vol. 97, No. 6.
Leski, T. A., et al., "Identification and Classification of bcl Genes and Proteins of Bacillus cereus Group Organisms and Their Application in Bacillus anthracis Detection and Fingerprinting", Applied and Environmental Microbiology, Nov. 2009, pp. 7163-7172, vol. 75, No. 22.
Leveau, Johan H., et al., "Utilization of the Plant Hormone Indole-3-Acetic Acid for Growth by Pseydomonas putida Strain 1290", Applied and Environmental Microbiology, May 2005, p. 2365-2371.
Li, et al., "Cloning of the Thermostable Cellulose Gene from the Newly Isolated Bacillus subtillus and its Expression in Excherichia coli", Molecular Biotechnology, 2008, pp. 195-201, vol. 40, No. 2.
Li, J. et al. "An ACC Deaminase Minus Mutant of Enterobacter cloacae UW4 No Longer Promotes Root Elongation", Current Microbiology, Aug. 2000, pp. 101-105, vol. 41, No. 2.
Liu, J.L., et al., "Effects of two plant growth-promoting rhizobacteria containing 1-aminocyclopropane-1-carboxylate deaminase on oat growth in petroleum contaminated soil", International Journal of Environmental Science and Technology, Dec. 2015, vol. 12, Issue 12, pp. 3887-3894.
Liu, X., et al., "Colonization of Maize and Rice Plants by Strain Bacillus megaterium C4", Current Microbiology, 2006, pp. 186-190, vol. 52, No. 3.
Liu, Y., et al., "Study on Mechanisms of Colonization of Nitrogen-Fixing PGPB, Klebsiella pneumoniae NG14 on the Root Surface of Rice and the Formation of Biofilm", Current Microbiology, 2011, pp. 1113-1122, vol. 62, No. 4.
Lopez-Bucio, J., et al., "Bacillus megaterium Rhizobacteria Promote Growth and Alter Root-System Architecture Through an Auxin- and Ethylene-Independent Signaling Mechanism in Arabidopsis thaliana", Molecular Plant-Microbe Interactions, Feb. 2007, pp. 207-217, vol. 20, No. 2.
Lopez-Bucio, J., et al., "Bacillus megaterium Rhizobacteria Promote Growth and Alter Root-System Architecture Through an Auxin- and Ethylene-Independent Signaling Mechanism in Arabidopsis thaliana," Molecular Plant-Microbe Interactions, 2007, pp. 207-217, vol. 20, No. 2.
Luiz, W. B., et al., "Boosting systemic and secreted antibody responses in mice orally immunized with recombinant Bacillus subtilis strains following parenteral priming with a DNA vaccine encoding the enterotoxigenic Escherichia coli (ETEC) CFA/I fimbriae B subunit", Vaccine, 2008, pp. 3998-4005, vol. 26, No. 32.
Madmony, A. et al., "Enterobacter cloacae, an Obligatory Endophyte of Pollen Grains of Mediterranean Pines", Folia Microbiologica (Praha), 2005, pp. 209-216, vol. 50, No. 3.
Maes, M., et al., "Experiences and Perspectives for the Use of a Paenibacillus Strain As A Plant Protectant", Communications in Agricultural and Applied Biological Sciences, 2003, pp. 457-462, vol. 68, No. 4, Part B.
Marulanda, A., et al., "Regulation of plasma membrane aquaporins by inoculation with a Bacillus megaterium strain in maize (Zea mays L.) plants under unstressed and salt-stressed conditions", Planta, 2010, pp. 533-543, vol. 232, No. 2.
Mauriello, E. M., et al., "Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner", Vaccine, Mar. 2004, pp. 1177-1187, vol. 22, Nos. 9-10.
Medie, F. M., "Genome Analyses Highlight the Different Biological Roles of Cellulases," Nature Reviews Microbiology, Mar. 2012, pp. 227-234, vol. 10.
Meldau, D. G., et al., "A native plant growth promoting bacterium, Bacillus sp.B55, rescues growth performance of an ethylene-insensitive plant genotype in nature", Frontiers in Plant Science, Jun. 2012, pp. 1-13, vol. 3, Article 112.
Mercado, J., et al., "Expression of the b-1,3-glucanase gene bgn13.1 from Trichoderma harzianum in strawberry increases tolerance to crown rot diseases but interferes with plant growth", Transgenic Res 24:979-89, 2015.
Negri, A., et al., "Expression and display of Clostridium difficile protein FIiD on the surface of Bacillus subtilis spores", Journal of Medical Microbiology (2013), 62, 1379-1385.
Ngamau, C., "Endophytic bacteria associated with bananas (Musi spp.) in Kenya and their potential as biological fertilizers", A thesis submitted in fulfillment for the degree of Doctor of Philosophy in Plant Science in the Jomo Kenyatta University of Agriculture and Technology, 2013, 191 pages.
Oh, T., et al., "Expression of Aspergillus nidulans phy Gene in Nicotiana benthamiana Produces Active Phytase with Broad Specificities", Int J Mol Sci. 15: 15571-15591, 2014.
Ortiz-Castro, R., et al., "Plant growth promotion by Bacillus megaterium Involves Cytokinin signaling", Plant Signaling & Behavior 3:4, 263-265; Apr. 2008.
Paccez, J. D., et al., "Evaluation of different promoter sequences and antigen sorting signals on the immunogenicity of Bacillus subtilis vaccine vehicles", Vaccine, 2007, pp. 4671-4680, vol. 25, No. 24.
Paccez, J. D., et al., "Stable episomal expression system under control of a stress inducible promoter enhances the immunogenicity of Bacillus subtilis as a vector for antigen delivery", Vaccine, 2006, pp. 2935-2943, vol. 24, No. 15.
Park, T. J. et al., "Spore Display Using Bacillus thuringiensis Exosporium Protein InhA", Journal of Microbiology and Biotechnology, May 2009, pp. 495-501, vol. 19, No. 5.
Park, T. J., "Surface-Display of Recombinant Proteins on Bacterial Exosporium and its Biotechnological Applications", Doctoral Thesis presented to the Department of Chemical and Biomolecular Engineering, Korea Advanced Institute of Science and Technology, 2004, 104 pages.
Peixoto, R.S., et al., "Petroleum-Degrading Enzymes: Bioremediation and New Prospects", SAGE-Hindawi Access to Research Enzyme Research, vol. 2011, Article ID 475193, 7 pages.
Penrose, D. M., et al., "Levels of ACC and related compounds in exudate and extracts of canola seeds treated with ACC deaminase-containing plant growth-promoting bacteria", Canadian Journal of Microbiology, Apr. 2001, pp. 368-372, vol. 47, No. 4.
Pereira, Carlos Eduardo et al., "Compatibility among fungicide treatments on soybean seeds through film coating and inoculation with Bradyrhizobium strains", Acta Scientiarum. Agronomy, Maringa, v. 32, n. 4, p. 585-589, 2010.
Petrov, K et al. "High production of 2,3-butanediol from glycerol by Klebsiella pneumoniae G31", Applied Microbiology and Biotechnology, 2009, pp. 659-665, vol. 84, No. 4.
Phi, Q. T., et al., "Assessment of Root-Associated Paenibacillus polymyxa Groups on Growth Promotion and Induced Systemic Resistance in Pepper", Journal of Microbiology and Biotechnology, Dec. 2010, pp. 1605-1613, vol. 20, No. 12.
Phitsuwan, P., et al., "Present and Potential Applications of Cellulases in Agriculture, Biotechnology, and Bioenergy," Folia Microbiologica, 2013, pp. 163-176, vol. 58, No. 2.
Pilar-Izquierdo et al., "Barley seed coating with free and immobilized alkaline phosphatase to improve P uptake and plant growth", Journal of Agricultural Science, 2012, 150: 691-701.
Ping, R., et al., Journal of Northwest Forestry College [2005, 20(1): 78-79, Abstract, 1 page.
Prusty, R., et al., "The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae", PNAS, Mar. 23, 2004, vol. 101, No. 12, 4153-4157.
Raddadi, N., et al., "Screening of Plant Growth Promoting Traits of Bacillus thuringiensis," Annals of Microbiology, 2008, pp. 47-52, vol. 58, No. 1.
Rajendran, G., et al., "Enhanced growth and nodulation of pigeon pea by co-inoculation of Bacillus strains with Rhizobium spp", Bioresource Technology, 2007, pp. 4544-4550, vol. 99, No. 11.
Rajkumar, M., et al., "Effects of inoculation of plant-growth promoting bacteria on Ni uptake by Indian mustard", Bioresource Technology, 2008, pp. 3491-3498, vol. 99, No. 9.
Rao, M.A., et al., "Role of Enzymes in the Remediation of Polluted Environments", J. soil. sci. plant nutr. 10(3): 333-353 (2010), 21 pages.
Rasco, et al., UniProt KB database entry Q738B1-Q7381-BACC1, Jul. 5, 2004, 6 pages (referencing Rasco, et al., "The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pX01.", Nucleic Acids Res. 32:977-988 (2004)).
Rasco, et al., UniProt KB database entry Q738B1-Q7381—BACC1, Jul. 5, 2004, 6 pages (referencing Rasco, et al., "The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pX01.", Nucleic Acids Res. 32:977-988 (2004)).
Reetha, S., et al., "Screening of cellulase and pectinase by using Pseudomonas fluorescence and Bacillus subtilis", International Letters of Natural Sciences, 8(2) (2014) 75-80.
Ryu, C. M., et al., "Bacterial volatiles promote growth in Arabidopsis", Proceedings of the National Academy of Sciences of the United States of America, Apr. 2003, pp. 4927-4932, vol. 100, No. 8.
Sachdev, D. P., et al., "Isolation and characterization of indole acetic acid (IAA) producing Klebsiella pneumoniae strains from rhizosphere of wheat (Triticum aestivum) and their effect on plant growth", Indian Journal of Experimental Biology, Dec. 2009, pp. 993-1000, vol. 47, No. 12.
Saleh, S., et al., "Involvement of gacS and rpoS in enhancement of the plant growth-promoting capabilities of enterobacter cloacae CAL2 and UW4", Canadian Journal of Microbiology, Aug. 2001, pp. 698-705, vol. 47, No. 8.
Sales, J., et al. "Coffee (coffea arabica L.) seeds germination after treatment with different concentrations and ambebding times in celluslase", Cienc. agrotec. [online]. 2003, vol. 27, n.3, pp. 557-564 ISSN 1413-7054. http://dx.doi.org/10.1590/s1413-70542003000300009, Abstract Only, 1 page.
Selvakumar, G., et al., "Isolation and Characterization of Nonrhizobial Plant Growth Promoting Bacteria from Nodules of Kudzu (Pueraria thunbergiana) and Their Effect on Wheat Seedling Growth," Current Microbiology, Feb. 2008, pp. 134-139, vol. 56, Issue 2.
Sequence Listing filed in WO 2007/078127 A1 published Jul. 12, 2007, downloaded from <http://patentscope.wipo.int/search/en/detail.jsf?docId=WO2007078127&recNum=1&tab=PCTDocuments&maxRec=&office=&prevFilter=&sortOption=&queryString=>, 5 pages.
Shahid, M., et al., "Root colonization and growth promotion of sunflower (Helianthus annuus L.) by phosphate solubilizing Enterobacter sp. Fs-11", World Journal of Microbiology & Biotechnology, 2012, pp. 2749-2758, vol. 28, No. 8.
Shani et al., "Expression of endo-1,4-β-glucanase (cel1) in Arabidopsis thaliana is associated with plant growth, xylem development and cell wall thickening", Plant Cell Rep., 2006, 10: 1067-1074.
Shankar, M., et al., "Root colonization of a rice growth promoting strain of Enterobacter cloacae", Journal of Basic Microbiology, 2011, pp. 523-530, vol. 51, No. 5.
Shao, J., et al., "Contribution of indole-3-acetic acid in the plant growth promotion by the rhizospheric strain Bacillus amyloliquefaciens SQR9", Biol Fertil Soils (2015) 51:321-330.
Shen et al., "Effect of Plant Growth-promoting Rhizobacteria (PGPRs) on plant growth, yield, and quality of tomato (Lycopersicon esculentum Mill.) under simulated seawater irrigation", J Gen Appl Microbiol. 2012, 58: 253-262.
Shen, M., et al., "Effect of Plant Growth-Promoting Rhizobacteria (PGPRs) on Plant Growth, Yield, and Quality of Tomato (Lycopersicon esculentum Mill.) Under Simulated Seawater Irrigation," The Journal of General and Applied Microbiology, 2012, pp. 253-262, vol. 58, No. 4.
Siddikee, Md. A., et al., "Halotolerant bacteria with ACC deaminase activity alleviate salt stress effect in canola seed germination", J Korean Soc Appl Biol Chem (2015) 58(2):237-241.
Singh B. and Stayanarayana T., "Microbial phytases in phosphorous acquisition and plant growth promotion," Physiol. Mol. Biol. Plants, 2011, 17: 93-103.
Singh B. and Stayanarayana T., "Plant Growth Promotion by an Extracellular HAP-pPhytase of a Thermophilic Mold Sporotrichum thermophile", Appl. Biochem. Biotechnol, 2010, 160: 1267-1276.
Smirnova, I., and Saybenova, M., "The effect of inoculation by cellulolytic bacteria Bacillus cytaseus on wheat productivity", Institute of Microbiology and Virology Ministry of Education and Science, Kazakhstan, Almaty, p. 185-191.
Stearns et al.,"Effects of Bacterial ACC Deaminase on Brassica napus Gene Expression", MPMI vol. 25, No. 5, 2012, pp. 668-676.
Steichen, C. T., et al., "Non-uniform assembly of the Bacillus anthracis exosporium and a bottle cap model for spore germination and outgrowth", Molecular Microbiology, Apr. 2007, pp. 359-367, vol. 64, No. 2.
Tan, L., et al., "An Unusual Mechanism of Isopeptide Bond Formation Attaches the Collagenlike Glycoprotein BcIA to the Exosporium of Bacillus anthracis," May-Jun. 2011, 20 pages, vol. 2, No. 3 (RETRACTION).
Tan, L., et al., "An Unusual Mechanism of Isopeptide Bond Formation Attaches the Collagenlike Glycoprotein BcIA to the Exosporium of Bacillus anthracis," May-Jun. 2011, 20 pages, vol. 2, No. 3.
Tan, L., et al., "Sequence Motifs and Proteolytic Cleavage of the Collagen-Like Glycoprotein BcIA Required for Its Attachment to the Exosporium of Bacillus anthracis", Journal of Bacteriology, Mar. 2010, pp. 1259-1268, vol. 192, No. 5.
Thomas, P., et al., "Endophytic Bacteria Associated with Growing Shoot Tips of Banana (Musa sp.) cv. Grand Naine and the Affinity of Endophytes to the Host", Microbial Ecology, 2009, pp. 952-964, vol. 58, No. 4.
Thompson et al. 2008; Amino-terminal sequences of the Bacillus anthracis exosporium proteins BcIA and BcIB important for localization and attachment to the spore surface. At mospace/umsystem.edu/xmliu/bitstream/handle/10355/5700/research.pdf?sequence=3. *
Thompson, B. M. et al., "A System of Efficient, Cost-Effective, and Customizable Vaccines for Use with Multiple Vaccine Candidates," Oct. 2010 poster presentation, 1 page.
Thompson, B. M., "The Role of the Glycoprotein BcIB in the Exosporium in the Exosporium of Bacillus Anthracis," Doctoral Dissertation presented to the Department of Diagnostic Medicine/Pathobiology, College of Veterinary Medicine, Kansas State University, 2002, 178 pages.
Thompson, B. M., et al., "Assembly of the BcIB Glycoprotein into the Exosporium and Evidence for its Role in the Formation of the Exosporium 'cap' Structure in Bacillus anthracis," Molecular Microbiology, Dec. 2012, pp. 1073-1084, vol. 86, No. 5.
Thompson, B. M., et al., "Localization and Assembly of the Novel Exosporium Protein BetA of Bacillus anthracis," Journal of Bacteriology, 2011, pp. 5098-5104, vol. 193, No. 19.
Thompson, B. M., et al., "Targeting of the BcIA and BcIB Proteins to the Bacillus anthracis Spore Surface," Molecular Microbiology, 2008, pp. 421-434, vol. 70, No. 2.
Thompson, B. M., et al., "The BcIB Glycoprotein of Bacillus anthracis is Involved in Exosporium Integrity," Journal of Bacteriology, 2007, pp. 6704-6713, vol. 189, No. 18.
Thompson, B. M., et al., "The Co-Dependence of BxpB/ExsFA and BcIA for Proper Incorporation into the Exosporium of Bacillus anthracis," Molecular Microbiology, 2011, pp. 799-813, vol. 79, No. 3.
Thompson, B. M., et al., "Assembly of the BcIB Glycoprotein into the Exosporium and Evidence for its Role in the Formation of the Exosporium ‘cap’ Structure in Bacillus anthracis," Molecular Microbiology, Dec. 2012, pp. 1073-1084, vol. 86, No. 5.
Timmusk, S. et al., "Paenibacillus polymyxa Invades Plant Roots and Forms Biofilms", Applied and Environmental Microbiology, Nov. 2005, pp. 7292-7300, vol. 71, No. 11.
Timmusk, S., et al., "The Plant-Growth-Promoting Rhizobacterium Paenibacillus polymyxa Induces Changes in Arabidopsis thaliana Gene Expression: A Possible Connection Between Biotic and Abiotic Stress Responses", Molecular Plant-Microbe Interactions, Nov. 1999, pp. 951-959, vol. 12, No. 11.
Trivedi, P., et al., "Plant growth promotion abilities and formulation of Bacillus megaterium strain B 388 (MTCC6521) Isolated from a temperate Himalayan location", Indian Journal of Microbiology, 2008, pp. 342-347, vol. 48, No. 3.
Vendan, R. T., et al., "Diversity of Endophytic Bacteria in Ginseng and Their Potential for Plant Growth Promotion", Journal of Microbiology, 2010, pp. 559-565, vol. 48, No. 5.
Von Der Weid, I., et al., "Diversity of Paenibacillus polymyxa strains isolated from the rhizosphere of maize planted in Cerrado Soil," Research in Microbiology, Jun. 2000, pp. 369-381, vol. 151, No. 5.
Walker, R., et al., "Colonization of the developing rhizosphere of sugar beet seedlings by potential biocontrol agents applied as seed treatments", Journal of Applied Microbiology, 2002, pp. 228-237, vol. 92, No. 2.
Waller, L.N., et al., "Identification of a Second Collagen-Like Glycoprotein Produced by Bacillus anthracis and Demonstration of Associated Spore-Specific Sugars", Journal of Bacteriology, Jul. 2005, p. 4592-4597, vol. 187, No. 13.
Wang, X., et al., "PLD: Phospholipase Ds in Plant Signaling", Springer, Phospholipases in Plant Signaling, Signaling and Communication in Plants 20, Springer-Verlag Berlin Heidelberg 2014.
Yadav, S., et al., "Diversity and phylogeny of plant growth-promoting bacilli from moderately acidic soil", Journal of Basic Microbiology, Feb. 2011, pp. 98-106, vol. 51, No. 1.
Yegorenkova, I. V., et al., "Paenibacillus polymyxa Rhizobacteria and Their Synthesized Exoglycans in Interaction With Wheat Roots: Colonization and Root Hair Deformation", Current Microbiology, 2013, pp. 481-486, vol. 66, No. 5.
Zeigler, D. R., "Bacillus Thuringiensis Bacillus Cereus", Bacillus Genetic Stock Center Catalog of Strains, 1999, Seventh Edition, vol. 2, 58 pages.
Zhou, Z., et al., "Immunogenicity of recombinant Bacillus subtilis spores expressing Clonorchis sinensis tegumental protein", Parasitology Research, 2008, pp. 293-297, vol. 102, No. 2.
Zhou, Z., et al., "Oral administration of a Bacillus subtilis spore-based vaccine expressing Clonorchis sinensis tegumental Protein 22.3 kDa confers protection against Clonorchis sinensis", Vaccine, 2008, pp. 1817-1825, vol. 26, No. 15.
Zou, C., et al., "Bacillus megaterium Strain XTBG34 Promotes Plant Growth by Producing 2-pentylfuran", Journal of Microbiology, Aug. 2010, pp. 460-466, vol. 48, No. 4.

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11882829B2 (en) 2013-03-15 2024-01-30 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants, and immobilizing bacillus spores on plants
US10779542B2 (en) 2013-03-15 2020-09-22 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants, and immobilizing bacillus spores on plants
US11134681B2 (en) * 2013-03-15 2021-10-05 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants from pathogens, and immobilizing Bacillus spores on plant roots
US10349660B2 (en) 2013-03-15 2019-07-16 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants, and immobilizing bacillus spores on plants
US10555532B2 (en) 2013-03-15 2020-02-11 Spogen Biotech Inc. Plant growth-promoting bacteria and methods of use
US10555534B2 (en) 2013-03-15 2020-02-11 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants from pathogens, and immobilizing Bacillus spores on plant roots
US20220159965A1 (en) * 2014-09-17 2022-05-26 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and a fungicide
US20170295797A1 (en) * 2014-09-17 2017-10-19 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and a fungicide
US10836800B2 (en) 2014-09-17 2020-11-17 Spogen Biotech Inc. Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US20210179672A1 (en) * 2014-09-17 2021-06-17 Spogen Biotech Inc Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US11044916B2 (en) * 2014-09-17 2021-06-29 Bayer Cropscience Lp Compositions comprising recombinant Bacillus cells and an insecticide
US11044915B2 (en) * 2014-09-17 2021-06-29 Bayer Cropscience Lp Compositions comprising recombinant Bacillus cells and a fungicide
US20170290339A1 (en) * 2014-09-17 2017-10-12 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and an insecticide
US11905315B2 (en) * 2014-09-17 2024-02-20 Spogen Biotech Inc. Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
US11154064B2 (en) 2014-09-17 2021-10-26 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and another biological control agent
US20220151240A1 (en) * 2014-09-17 2022-05-19 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and an insecticide
US11124460B2 (en) 2016-03-16 2021-09-21 Spogen Biotech Inc. Methods for promoting plant health using free enzymes and microorganisms that overexpress enzymes
US11541105B2 (en) 2018-06-01 2023-01-03 The Research Foundation For The State University Of New York Compositions and methods for disrupting biofilm formation and maintenance
CN109138946A (zh) * 2018-07-16 2019-01-04 西南石油大学 一种10MPa监测水驱油过程三维渗流实验系统
US11793196B2 (en) 2019-03-19 2023-10-24 Bayer Cropscience Lp Fusion proteins, recombinant bacteria, and exosporium fragments for pest control and plant health
EP3969464A4 (en) * 2019-05-15 2023-02-08 Bayer CropScience LP TARGETING SEQUENCES FOR A PAENIBACILLUS BASED ENDOSPORES DISPLAY PLATFORM
US11406702B1 (en) 2020-05-14 2022-08-09 David Gordon Bermudes Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated Salmonella as a vaccine
US10973908B1 (en) 2020-05-14 2021-04-13 David Gordon Bermudes Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated salmonella as a vaccine
WO2022187961A1 (en) 2021-03-11 2022-09-15 Les Biotechnologies Ulysse Inc. Microorganism displaying antigenic protein of the sars-cov2 coronavirus

Also Published As

Publication number Publication date
US10407472B2 (en) 2019-09-10
IL278745A (es) 2020-12-31
US10836800B2 (en) 2020-11-17
US20180099999A1 (en) 2018-04-12
AR101953A1 (es) 2017-01-25
BR112017005326A2 (pt) 2017-12-12
NZ731011A (en) 2021-09-24
BR122023020910A2 (pt) 2024-01-30
BR122023020844A2 (pt) 2024-01-23
AU2021204089A1 (en) 2021-07-22
BR122023020928A2 (pt) 2024-01-30
CL2022003270A1 (es) 2023-05-26
BR122023020889A2 (pt) 2024-01-30
CL2022003269A1 (es) 2023-05-26
IL278745B2 (en) 2023-02-01
BR122023020822A2 (pt) 2024-01-23
AU2023201862A1 (en) 2023-06-08
MX2017003465A (es) 2017-06-19
BR122023020931A2 (pt) 2024-01-30
BR122023020829A2 (pt) 2024-01-23
PH12017500519A1 (en) 2017-08-07
BR122023020897A2 (pt) 2024-01-30
AU2015317521B2 (en) 2021-04-08
BR122023020925A2 (pt) 2024-01-30
CN107208042A (zh) 2017-09-26
BR122023020769A2 (pt) 2024-01-23
CA2961641A1 (en) 2016-03-24
NZ767896A (en) 2024-01-26
BR122023020799A2 (pt) 2024-01-23
BR122023020803A2 (pt) 2024-01-23
RU2017112965A (ru) 2018-10-17
US20200190149A1 (en) 2020-06-18
US20210179672A1 (en) 2021-06-17
AU2021204089B2 (en) 2023-07-27
WO2016044661A1 (en) 2016-03-24
US11905315B2 (en) 2024-02-20
BR122023020827A2 (pt) 2024-01-23
BR122023020869A2 (pt) 2024-01-30
BR122023020774A2 (pt) 2024-01-23
BR122023020809A2 (pt) 2024-01-23
IL251194A0 (en) 2017-05-29
BR122023020759A2 (pt) 2024-01-23
BR122023020863A2 (pt) 2024-01-30
CR20170139A (es) 2017-06-30
BR122023020835A2 (pt) 2024-01-23
WO2016044655A3 (en) 2016-05-12
WO2016044655A2 (en) 2016-03-24
EP3194425A1 (en) 2017-07-26
BR122023020858A2 (pt) 2024-01-30
BR122023020903A2 (pt) 2024-01-30
IL278745B (en) 2022-10-01
AU2015317521A1 (en) 2017-05-04
BR122023020779A2 (pt) 2024-01-23
BR122023020880A2 (pt) 2024-01-30
UY36304A (es) 2016-04-29
BR122023020788A2 (pt) 2024-01-23
UA126325C2 (uk) 2022-09-21
BR122023020794A2 (pt) 2024-01-23
BR122023020883A2 (pt) 2024-01-30
CL2020000039A1 (es) 2020-06-12
NZ767895A (en) 2024-01-26
MX2021002717A (es) 2021-05-12
IL295968A (en) 2022-10-01
US20160108096A1 (en) 2016-04-21
CL2017000647A1 (es) 2017-12-22
BR122023020780A2 (pt) 2024-01-23
RU2017112965A3 (es) 2019-05-06
BR122023020886A2 (pt) 2024-01-30
AR122050A2 (es) 2022-08-10
BR122023020904A2 (pt) 2024-01-30

Similar Documents

Publication Publication Date Title
US11905315B2 (en) Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
RU2771828C2 (ru) Слитые белки, рекомбинантные бактерии и способы применения рекомбинантных бактерий
NZ731011B2 (en) Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria

Legal Events

Date Code Title Description
AS Assignment

Owner name: SPOGEN BIOTECH INC., MISSOURI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:THOMPSON, BRIAN;SIEGEL, ASHLEY;REEL/FRAME:038341/0829

Effective date: 20141002

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4

AS Assignment

Owner name: GENISYS CREDIT UNION, MICHIGAN

Free format text: SECURITY INTEREST;ASSIGNORS:SPOGEN BIOTECH INC;ELEMENTAL ENZYMES AG AND TURF, LLC;THOMPSON, BRIAN M;AND OTHERS;REEL/FRAME:062458/0544

Effective date: 20230120

Owner name: GENISYS CREDIT UNION, MICHIGAN

Free format text: SECURITY INTEREST;ASSIGNORS:SPOGEN BIOTECH INC;ELEMENTAL ENZYMES AG AND TURF, LLC;THOMPSON, BRIAN M;AND OTHERS;REEL/FRAME:062458/0476

Effective date: 20230120