US20200362337A1 - Oligonucleotide compositions and methods thereof - Google Patents

Oligonucleotide compositions and methods thereof Download PDF

Info

Publication number
US20200362337A1
US20200362337A1 US16/636,900 US201816636900A US2020362337A1 US 20200362337 A1 US20200362337 A1 US 20200362337A1 US 201816636900 A US201816636900 A US 201816636900A US 2020362337 A1 US2020362337 A1 US 2020362337A1
Authority
US
United States
Prior art keywords
oligonucleotide
wing
c9orf72
linkage
core
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/636,900
Other languages
English (en)
Inventor
Jean-Cosme Dodart
Yuanjing Liu
Chandra Vargeese
Zhong Zhong
Naoki Iwamoto
Jason Jingxin Zhang
Pachamuthu Kandasamy
Sethumadhavan Divakaramenon
Genliang Lu
Subramanian Marappan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wave Life Sciences Pte Ltd
Original Assignee
Wave Life Sciences Pte Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wave Life Sciences Pte Ltd filed Critical Wave Life Sciences Pte Ltd
Priority to US16/636,900 priority Critical patent/US20200362337A1/en
Assigned to WAVE LIFE SCIENCES LTD. reassignment WAVE LIFE SCIENCES LTD. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: IWAMOTO, NAOKI, LIU, Yuanjing, DODART, Jean-Cosme, ZHONG, ZHONG, DIVAKARAMENON, Sethumadhavan, KANDASAMY, PACHAMUTHU, LU, GENLIANG, MARAPPAN, SUBRAMANIAN, ZHANG, Jason Jingxin, VARGEESE, CHANDRA
Publication of US20200362337A1 publication Critical patent/US20200362337A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1072—Differential gene expression library synthesis, e.g. subtracted libraries, differential screening
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/345—Spatial arrangement of the modifications having at least two different backbone modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/34—Allele or polymorphism specific uses

Definitions

  • Oligonucleotides targeting the gene C9orf72 are useful in various applications, e.g., therapeutic, diagnostic, and/or research applications, including but not limited to treatment of various C9orf72-related disorders.
  • the present disclosure provides oligonucleotides, and compositions thereof, that can reduce levels of C9orf72 transcripts (or products thereof).
  • provided oligonucleotides and compositions can preferentially reduce levels of disease-associated transcripts of C9orf72 (or products thereof) over non-disease-associated transcripts of C9orf72 (see, e.g., FIG. 1 ).
  • Example C9orf72 transcripts include transcripts from either strand of the C9orf72 gene and from various starting points.
  • at least some C9orf72 transcripts are translated into proteins; in some embodiments, at least some C9orf72 transcripts are not translated into proteins.
  • certain C9orf72 transcripts contain predominantly intronic sequences.
  • C9orf72 Chosome 9, open reading frame 72
  • ALS amyotrophic lateral sclerosis
  • FTD frontotemporal dementia
  • C9orf72 gene variants comprising the repeat expansion and/or products thereof are also associated with other C9orf72-related disorders, such as corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, olivopontocerebellar degeneration (OPCD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Huntington's disease (HD) phenocopy, Alzheimer's disease (AD), bipolar disorder, schizophrenia, and other non-motor disorders.
  • CBD corticobasal degeneration syndrome
  • OPCD olivopontocerebellar degeneration
  • PLS primary lateral sclerosis
  • PMA progressive muscular atrophy
  • HD Huntington's disease
  • AD bipolar disorder
  • schizophrenia bipolar disorder
  • the present disclosure provides compositions and methods related to oligonucleotides which target a C9orf72 target (e.g., a C9orf72 oligonucleotide) and are capable of knocking down or decreasing expression, level and/or activity of the C9orf72 target gene and/or a gene product thereof (a transcript, particularly a repeat expansion containing transcript, a protein, etc.).
  • a C9orf72 target e.g., a C9orf72 oligonucleotide
  • a gene product thereof a transcript, particularly a repeat expansion containing transcript, a protein, etc.
  • an oligonucleotide targets a pathological or disease-associated C9orf72 mutation or variant comprising a repeat expansion.
  • a C9orf72 gene product is a RNA (e.g., a mRNA, mature RNA or pre-mRNA) transcribed from a C9orf72 gene, a protein translated from a C9orf72 RNA transcript (e.g., a dipeptide repeat protein translated from the hexanucleotide repeat), or a focus (plural: foci) (which reportedly comprises RNA comprising the repeat expansion bound by RNA-binding proteins).
  • RNA e.g., a mRNA, mature RNA or pre-mRNA
  • a protein translated from a C9orf72 RNA transcript e.g., a dipeptide repeat protein translated from the hexanucleotide repeat
  • a focus plural: foci
  • a C9orf72 oligonucleotide is capable of mediating preferential knockdown of a repeat expansion-containing C9orf72 RNA relative to a non-repeat expansion-containing C9orf72 RNA (a C9orf72 RNA which does not contain a repeat expansion).
  • a C9orf72 oligonucleotide decreases the expression, activity and/or level of a deleterious C9orf72 gene product (e.g., a RNA comprising a repeat expansion, a dipeptide repeat protein or a focus) without decreasing the expression, activity and/or level of a wild-type or non-deleterious C9orf72 gene product.
  • a C9orf72 oligonucleotide decreases the expression, activity and/or level of a deleterious C9orf72 gene product, but does not decrease the expression, activity and/or level of a wild-type or non-deleterious C9orf72 protein enough to eliminate or significantly suppress a beneficial and/or necessary biological activity or activities of C9orf72 protein.
  • Beneficial and/or necessary activities of C9orf72 protein are widely known and include but not limited to restricting inflammation, preventing autoimmunity and preventing premature mortality.
  • the present disclosure encompasses the recognition that controlling structural elements of C9orf72 oligonucleotides can have a significant impact on oligonucleotide properties and/or activities, including knockdown of a C9orf72 target gene.
  • knockdown of a target gene is mediated by RNase H or steric hindrance affecting translation.
  • controlled structural elements of C9orf72 oligonucleotides include but are not limited to: base sequence, chemical modifications (e.g., modifications of a sugar, base and/or internucleotidic linkage) or patterns thereof, alterations in stereochemistry (e.g., stereochemistry of a backbone chiral internucleotidic linkage) or patterns thereof, wing structure, core structure, wing-core structure, wing-core-wing structure, or core-wing structure, and/or conjugation with an additional chemical moiety (e.g., a carbohydrate moiety, a targeting moiety, etc.).
  • base sequence e.g., chemical modifications of a sugar, base and/or internucleotidic linkage
  • alterations in stereochemistry e.g., stereochemistry of a backbone chiral internucleotidic linkage
  • wing structure e.g., core structure, wing-core structure, wing-core-wing structure, or core-wing structure
  • the present disclosure provides technologies (e.g., compounds, methods, etc.) for improving C9orf72 oligonucleotide stability while maintaining or increasing oligonucleotide activity, including compositions of improved-stability oligonucleotides.
  • provided oligonucleotides target C9orf72 or products thereof.
  • a target gene is a C9orf72.
  • the present disclosure encompasses the recognition that various optional additional chemical moieties, such as carbohydrate moieties, targeting moieties, etc., when incorporated into c9orf72 oligonucleotides, can improve one or more properties.
  • an additional chemical moiety is selected from: glucose, GluNAc (N-acetyl amine glucosamine) and anisamide moieties. These and other moieties are described in more detail herein, e.g., in Examples 1 and 2.
  • an oligonucleotide can comprise two or more additional chemical moieties, wherein the additional chemical moieties are identical or non-identical, or are of the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.) or not of the same category.
  • certain additional chemical moieties facilitate delivery of oligonucleotides to desired cells, tissues and/or organs, including but not limited to particular cells, parts or portions of the central nervous system (e.g., cerebral cortex, hippocampus, spinal cord, etc.).
  • certain additional chemical moieties facilitate internalization of oligonucleotides.
  • certain additional chemical moieties increase oligonucleotide stability.
  • the present disclosure provides technologies for incorporating various additional chemical moieties into oligonucleotides.
  • the present disclosure provides, for example, reagents and methods, for introducing additional chemical moieties through internucleotidic linkages, sugars and/or nucleobases (e.g., by covalent linkage, optionally via a linker, to a site on a sugar, a nucleobase, or an internucleotidic linkage).
  • the present disclosure demonstrates that surprisingly high target specificity can be achieved with oligonucleotides, e.g., C9orf72 oligonucleotides, whose structures include one or more features as described herein [including, but not limited to, base sequences disclosed herein (wherein each U can be optionally and independently substituted by T and vice versa), and/or chemical modifications and/or stereochemistry and/or patterns thereof and/or combinations thereof, e.g., examples illustrated in FIG. 2 ].
  • oligonucleotides e.g., C9orf72 oligonucleotides, whose structures include one or more features as described herein [including, but not limited to, base sequences disclosed herein (wherein each U can be optionally and independently substituted by T and vice versa), and/or chemical modifications and/or stereochemistry and/or patterns thereof and/or combinations thereof, e.g., examples illustrated in FIG. 2 ].
  • the present disclosure demonstrates that certain provided structural elements, technologies and/or features are particularly useful for oligonucleotides that knock down C9orf72. Regardless, however, the teachings of the present disclosure are not limited to oligonucleotides that participate in or operate via any particular biochemical mechanism.
  • the present disclosure provides oligonucleotides capable of operating via a mechanism such as double-stranded RNA interference, single-stranded RNA interference or which acts as an antisense oligonucleotide which decreases the expression, activity and/or level of a C9orf72 gene or a gene product thereof via a RNase H-mediated mechanism or steric hindrance of translation.
  • the present disclosure pertains to any C9orf72 oligonucleotide which operates through any mechanism, and which comprises any sequence, structure or format (or portion thereof) described herein, wherein the oligonucleotide comprises at least one non-naturally-occurring modification of a base, sugar or internucleotidic linkage.
  • the present disclosure pertains to any C9orf72 oligonucleotide which comprises at least one stereocontrolled internucleotidic linkage (including but not limited to a phosphorothioate linkage in the Sp or Rp configuration).
  • the present disclosure pertains to any C9orf72 oligonucleotide which operates through any mechanism, and which comprises at least one stereocontrolled internucleotidic linkage (including but not limited to a phosphorothioate linkage in the Sp or Rp configuration).
  • the present disclosure provides a C9orf72 oligonucleotide which comprises any sequence, structure or format (or portion thereof) described herein, an optional additional chemical moiety (including but not limited to a carbohydrate moiety, and a targeting moiety), stereochemistry or patterns of stereochemistry, internucleotidic linkage or pattern of internucleotidic linkages; modification of sugar(s) or pattern of modifications of sugars; modification of base(s) or patterns of modifications of bases.
  • an optional additional chemical moiety including but not limited to a carbohydrate moiety, and a targeting moiety
  • a C9orf72 disorder-associated target allele contains a hexanucleotide repeat expansion in intron 1, including but not limited to G4C2 or (GGGGCC)ng, wherein ng is 30 or more.
  • ng is 50 or more.
  • ng is 100 or more.
  • ng is 150 or more.
  • ng is 200 or more.
  • ng is 300 or more.
  • ng is 500 or more.
  • the C9orf72 G4C2 repeat expansion in intron 1 reportedly accounts for 1 in 10 ALS cases among European-ancestry populations.
  • G4C2 repeats are reportedly of only about ⁇ 10% of the transcripts (e.g., transcripts V3 and V1 of the pathological allele illustrated in FIG. 1 ), with gain of function toxicities, at least partially mediated by the dipeptide repeat proteins and foci formation by, for example, repeat-expansion containing transcripts and/or spliced-out repeat-expansion containing introns and/or antisense transcription of the repeat-expansion containing region and various nucleic-acid binding proteins.
  • V1 is reportedly transcribed at very low levels (around 1% of the total C9orf72 transcript level) and does not contribute significantly to the levels of transcripts comprising hexanucleotide repeat expansions.
  • intron nucleic acid containing repeat expansions can be retained as pre-mRNA, partially spliced RNA, and/or spliced out introns, and RNA foci comprising these nucleic acids are associated with RNA binding protein sequestration.
  • C9orf72 RNA foci are described in, for example, Liu et al., 2017, Cell Chemical Biology 24, 1-8; Niblock et al. Acta Neuropathologica Communications (2016) 4:18.
  • DPR proteins Aberrant protein products comprising dipeptide repeat proteins (DPR proteins) are reportedly produced from the repeat expansion, with toxicity to neurons.
  • the present disclosure provides oligonucleotides and compositions and methods thereof which target an intron sequence close to the G4C2 repeats, and can reduce levels of repeat expansion-containing transcripts, proteins encoded thereby, and/or related foci.
  • the present disclosure provides C9orf72 oligonucleotides and compositions thereof which target an intron sequence close to the G4C2 repeats, to specifically knockdown the repeat expansion-containing transcripts via RNAse-H, with minimal impact on normal C9orf 72 transcripts.
  • the present disclosure demonstrates that provided technologies targeting an intron sequence (e.g., between the repeats and exon 1b) can effectively and/or preferentially reduce levels of repeat expansion-containing products.
  • the present disclosure notes that several possible mechanisms for the deleterious and disease-associated effects of the repeat expansion have been proposed in the literature. See for example: Edbauer et al. 2016 Curr. Opin. Neurobiol. 36: 99-106; Conlon et al. Elife. 2016 Sep. 13; 5. pii: e17820; Xi et al. 2015 Acta Neuropathol. 129: 715-727; Cohen-Hada et al. 2015 Stem Cell Rep. 7: 927-940; and Burguete et al. eLife 2015; 4:e08881.
  • the present disclosure provides technologies that can reduce or remove one or more or all deleterious and disease-associated C9orf72 products and/or disease-associated effects.
  • the present disclosure notes that a possible mechanism of a deleterious effect of repeat expansion-containing C9orf72 transcripts is the generation of foci.
  • the repeat expansion results in retention of intron 1-containing C9orf72 mRNA.
  • the majority of intron 1-retaining C9orf72 mRNA accumulates in the nucleus where it is targeted to a specific degradation pathway unable to process G4C2 RNA repeats.
  • the RNAs subsequently aggregate into foci, which also comprise RNA-binding proteins, sequestering them from their normal functions.
  • Reportedly antisense foci comprising antisense C9orf72 products are present at a significantly higher frequency in cerebellar Purkinje neurons and motor neurons, whereas sense foci are present at a significantly higher frequency in cerebellar granule neurons.
  • the present disclosure provides technologies for reducing levels of foci.
  • provided technologies reduce levels of or remove antisense foci and/or sense foci in one or more types of neurons.
  • DPR dipeptide repeat
  • ALS neurodegeneration also reported that inclusions containing sense or antisense derived dipeptide repeat proteins were present at significantly higher frequency in cerebellar granule neurons or motor neurons, respectively; and in motor neurons, which are the primary target of pathology in ALS, the presence of antisense foci but not sense foci correlated with mislocalisation of TDP-43, which is a hallmark of ALS neurodegeneration.
  • provided technologies reduce levels of one or more or all of C9orf72 DPR protein products.
  • gain- and/or loss-of-function mechanisms lead to neurodegeneration in a C9orf72-related disorder. See, for example: Mizielinska et al. 2014 Science 345: 1192-94; Chew et al. 2015 Science 348: 1151-1154; Jiang et al. 2016 Neuron 90: 535-550; and Liu et al. 2016 Neuron 90: 521-534; Gendron et al. Cold Spring Harb. Perspect. Med. 2017 Jan. 27. pii: a024224; Haeusler et al. Nat Rev Neurosci. 2016 June; 17(6):383-95; Koppers et al. Ann. Neurol. 2015; 78:426-438; Todd et al. J. Neurochem. 2016 138 (Suppl. 1) 145-162.
  • provided technologies reduce undesired gained functions, and/or restore or enhance desired functions.
  • oligonucleotides and compositions and methods thereof are useful for treatment of any of several C9orf72-related disorders, including but not limited to amyotrophic lateral sclerosis (ALS).
  • ALS is MIM: 612069.
  • Amyotrophic lateral sclerosis (ALS) is a reportedly a fatal neurodegenerative disease characterized clinically by progressive paralysis leading to death, often from respiratory failure, typically within two to three years of symptom onset (Rowland and Shneider, N. Engl. J. Med., 2001, 344, 1688-1700).
  • ALS reportedly is the third most common neurodegenerative disease in the Western world (Hirtz et al., Neurology, 2007, 68, 326-337), and there are currently no effective therapies. Approximately 10% of cases are familial in nature, whereas the bulk of patients diagnosed with the disease are classified as sporadic as they appear to occur randomly throughout the population (Chio et al., Neurology, 2008, 70, 533-537). Clinical, genetic, and epidemiological data reportedly support the hypothesis that ALS and frontotemporal dementia (FTD) represent an overlapping continuum of disease, characterized pathologically by the presence of TDP-43 positive inclusions throughout the central nervous system (Lillo and Hodges, J. Clin.
  • FDD frontotemporal dementia
  • ALS-FTD causing mutation is a large hexanucleotide (e.g., GGGGCC or G 4 C 2 ) repeat expansion in the first intron of the C9orf72 gene on chromosome 9 (Renton et al., Neuron, 2011, 72, 257-268; DeJesus-Hernandez et al., Neuron, 2011, 72, 245-256).
  • a founder haplotype, covering the C9orf72 gene is present in the majority of cases linked to this region (Renton et al., Neuron, 2011, 72, 257-268).
  • ALS is reportedly associated with degeneration of both upper and lower motor neurons in the motor cortex of the brain, the brain stem, and the spinal cord. Symptoms of ALS reportedly include: muscle weakness and/or muscle atrophy, trouble swallowing or breathing, cramping, stiffness. Respiratory failure is reportedly the main cause of death. In some embodiments, provided technologies reduces severity and/or removes one or more of symptoms related to ALS or other C9orf72 related conditions, disorders and/or diseases.
  • provided oligonucleotides and compositions and methods thereof are useful for treatment of any of several C9orf72-related disorders, including but not limited to frontotemporal dementia (FTD).
  • FTD is referred to as frontotemporal lobar degeneration or FTLD, MIM: 600274.
  • Frontotemporal dementia reportedly the second most common form of presenile dementia, is reportedly associated with focal atrophy of the frontal or temporal lobes. Boxer et al. 2005 Alzheimer Dis. Assoc. Disord. 19 (Suppl 1):S3-S6.
  • FTD shares extensive clinical, pathological, and molecular overlap with amyotrophic lateral sclerosis.
  • a C9orf72 target is a specific allele (e.g., one with a repeat expansion) and level, expression and/or activity of one or more products (e.g., RNA and/or protein products such as dipeptide repeat proteins or DPRs) are intended to be altered.
  • a C9orf72 target allele is one whose presence and/or expression is associated (e.g., correlated) with presence, incidence, and/or severity, of one or more diseases and/or conditions, including but not limited to ALS and FTD or other C9orf72-related disorders, or a symptom thereof.
  • a C9orf72 target allele is one for which alteration of expression, level and/or activity of one or more gene products correlates with improvement (e.g., delay of onset, reduction of severity, responsiveness to other therapy, etc.) in one or more aspects of a disease and/or condition, including but not limited to ALS and FTD or other C9orf72-related disorders.
  • a neurological disease is characterized by neuronal hyperexcitability.
  • a 50% reduction in C9orf72 activity, due to and/or in the presence of the (GGGGCC) expansion reportedly increases neurotransmission through the glutamate receptors NMDA, AMPA, and kainite.
  • glutamate receptors reportedly accumulate on neurons. The increased neurotransmission and accumulation of glutamate receptors reportedly leads to glutamate-induced excitotoxicity due to the neuronal hyperexcitability. Inhibiting glutamate receptors would reportedly treat the neuronal hyperexcitability. Clearance of dipeptide repeat proteins generated from the expansion reportedly is impaired, enhancing their neurotoxicity.
  • C9orf72 reportedly promotes early endosomal trafficking through activation of RAB5, which requires phosphatidylinositol 3-phosphase (PI3P).
  • PIKFYVE converts PI3P to phosphatidylinositol (3,5)-bisphosphate (PI(3,5)P2).
  • Inhibiting PIKFYVE reportedly would compensate for altered RAB5 levels by increasing PI3P levels to enable early endosomal maturation, which would ultimately lead to the clearance of dipeptide repeat proteins.
  • Neurons reportedly also use endosomal trafficking to regulate sodium and potassium ion channel localization.
  • Inhibiting PIKFYVE reportedly may also treat neuronal hyperexcitability.
  • provided technologies reduce neuronal hyperexcitability.
  • provided technologies may be administered as part of the same treatment regime as an inhibitor of PIKFYVE.
  • the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides which share:
  • the present disclosure provides a C9orf72 oligonucleotide composition
  • a C9orf72 oligonucleotide composition comprising a first plurality of oligonucleotides capable of directing C9orf72 knockdown, wherein oligonucleotides are of a particular oligonucleotide type characterized by:
  • a provided oligonucleotide (which can target C9orf72 or target a target other than C9orf72) comprises one or more blocks.
  • a block comprises one or more consecutive nucleosides, and/or nucleotides, and/or sugars, or bases, and/or internucleotidic linkages.
  • a provided oligonucleotide comprises three or more blocks, wherein the blocks on either end are not identical and the oligonucleotide is thus asymmetric.
  • a block is a wing or a core.
  • a c9orf72 oligonucleotide comprises at least one wing and at least one core, wherein a wing differs structurally from a core in that a wing comprises a structure [e.g., stereochemistry, additional chemical moiety, or chemical modification at a sugar, base or internucleotidic linkage (or pattern thereof)] different than the core, or vice versa.
  • a provided oligonucleotide comprises a wing-core-wing structure.
  • a provided oligonucleotide comprises a wing-core, core-wing, or wing-core-wing structure, wherein one wing differs in structure [e.g., stereochemistry, additional chemical moiety, or chemical modification at a sugar, base or internucleotidic linkage (or pattern thereof)] from the other wing and the core (for example, an asymmetrical oligonucleotide).
  • an oligonucleotide has or comprises a wing-core, core-wing, or wing-core-wing structure, and a block is a wing or core.
  • a core is also referenced to as a gap.
  • oligonucleotide compositions as described herein can be assessed using any appropriate assay.
  • FIG. 1 describes example C9orf72 transcripts.
  • V3, V2 and V1 transcripts produced from a healthy and a pathological C9orf72 allele are illustrated, wherein the pathological allele contains a hexanucleotide repeat expansion [horizontal bar, indicated by (GGGGCC) 30+ ].
  • the downward-pointing arrow indicates the position of some example C9orf72 oligonucleotides targeting intron 1.
  • FIG. 2 presents certain provided formats of oligonucleotides as examples.
  • FIGS. 3A and 3B present certain provided C9orf72 oligonucleotides as examples. Structural details of these oligonucleotides are further described in, for example, Table 1A.
  • FIG. 4 presents example data demonstrating that provided C9orf72 oligonucleotides can provide preferential knockdown of repeat expansion-containing C9orf72 transcripts relative to total C9orf72 transcripts (including non-repeat expansion-containing C9orf72 transcripts).
  • FIG. 4A shows knockdown of repeating expansion-containing transcripts by administration of WV-3662 and WV-3536 (which represent the base sequence of SEQ ID NO: 0553 of WO2015054676, and SEQ ID NO: 0057 of WO2016168592, respectively), and WV-6408, normalized to controls.
  • FIG. 4B shows knockdown of total C9orf72 transcripts by administration of WV-3662, WV-3536, and WV-6408.
  • WV-3662 and WV-3536 which represent the base sequence of SEQ ID NO: 0553 of WO2015054676, and SEQ ID NO: 0057 of WO2016168592, respectively
  • FIG. 4B shows knockdown of total
  • FIG. 4C shows knockdown of repeating expansion-containing transcripts provided by control oligonucleotides WV-2376 and WV-3542, and example oligonucleotides WV-3688, WV-6408, WV-7658, WV-7659, WV-8010, and WV-8011. Concentrations were 1 (left column) and 10 ⁇ M (right column).
  • FIG. 4D shows knockdown of total transcripts by administration of control oligonucleotides WV-2376 and WV-3542. Concentrations were 1 (left column) and 10 ⁇ M (right column).
  • FIG. 5 presents example data demonstrating in vivo potency of provided C9orf72 oligonucleotides in the C9-BAC mouse spinal cord.
  • WV-2376 is a negative control oligonucleotide.
  • Present data were those of WV-6408, WV-8009, WV-8010, WV-8011, and WV-8012.
  • FIG. 5A shows knockdown of total transcripts (including repeat expansion-containing and non-repeat expansion-containing transcripts).
  • FIG. 5B shows knockdown of V3 (repeat expansion-containing) transcripts.
  • FIG. 5C shows knockdown of Intron/AS transcripts (with probes targeting a region 3′ to the repeat transcript expansion, the detected area includes both sense and antisense transcripts of the intronic region).
  • PBS phosphate buffered saline (negative control).
  • FIG. 6 presents example data demonstrating the in vivo potency of some C9orf72 oligonucleotides in the C9-BAC mouse cortex.
  • WV-2376 is a negative control oligonucleotide which does not target C9orf72; presented data were those of: WV-6408, WV-8009, WV-8010, WV-8011, and WV-8012.
  • FIG. 6A shows knockdown of total transcripts (including repeat expansion-containing and non-repeat expansion-containing transcripts).
  • FIG. 6B shows knockdown of V3 (repeat expansion-containing) transcripts.
  • FIG. 6C shows knockdown of Intron/AS transcripts (with probes targeting a region 3′ to the repeat transcript expansion, the detected area includes both sense and antisense transcripts of the intronic region).
  • FIGS. 7A to 7D present example data on the activity of provided Malat1 oligonucleotides conjugated to various chemical moieties, for example, sulfonamide or anisamide.
  • FIG. 7A shows example data of Malat1 oligonucleotides in knocking down Malat1 in spinal cord;
  • FIG. 7B shows example distribution data of various Malat1 oligonucleotides (ASO or antisense oligonucleotides) in spinal cord;
  • FIG. 7C shows the knockdown of Malat1 in cortex;
  • FIG. 7D shows the distribution of the test oligonucleotides in cortex.
  • Presented data were those of: WV-3174, WV-7558, WV-7559, and WV-7560, administered ICV, 1 ⁇ 50 ⁇ g.
  • FIGS. 8A to H show the effect of certain provided C9orf72 oligonucleotides on C9orf72 transcripts in C9-BAC mice.
  • C9orf72 oligonucleotides tested were: WV-6408, WV-8009, WV-8010, WV-8011, and WV-8012.
  • Negative controls were PBS (phosphate-buffered saline) and WV-2376, which does not target C9orf72.
  • Transcripts were analyzed from the cerebral cortex ( FIGS. 8A to D) and spinal cord ( FIGS. 8E to H). Transcripts analyzed were: All transcripts ( FIGS. 8A and E); V3 ( FIGS. 8B and F); V3 (exon 1a) ( FIGS. 8C and G); and Intron1/AS ( FIGS. 8D and H).
  • the data in FIG. 9 and FIG. 10 are from the same in-vivo mouse study.
  • FIGS. 9A and 9B show example distribution data of C9orf72 oligonucleotides in spinal cord ( FIG. 9A ) and cerebral cortex ( FIG. 9B ) of C9-BAC mice.
  • C9orf72 oligonucleotides tested were: WV-6408, WV-8009, WV-8010, WV-8011, and WV-8012.
  • Negative controls were PBS (phosphate-buffered saline) and WV-2376, which does not target C9orf72.
  • FIG. 10 shows example data of C9orf72 oligonucleotides on the level of polyGP (a dipeptide repeat protein) in the hippocampus of C9-BAC mice.
  • C9orf72 oligonucleotides tested were: WV-6408, WV-8009, WV-8010, WV-8011, and WV-8012.
  • Negative controls were PBS (phosphate-buffered saline) and WV-2376, which does not target C9orf72.
  • FIG. 11A shows an example hybridization ELISA assay for measuring oligonucleotide levels, e.g., in tissues and fluids, including but not limited to animal biopsies.
  • FIG. 11B shows example chemistry for binding a primary amine-labeled capture probe to an amino-reactive solid support, such as a plate comprising maleic anhydride.
  • Aliphatic means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or combinations thereof.
  • aliphatic groups contain 1-50 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-20 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-10 aliphatic carbon atoms.
  • aliphatic groups contain 1-9 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-8 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-7 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms.
  • Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.
  • alkenyl refers to an alkyl group, as defined herein, having one or more double bonds.
  • Alkyl As used herein, the term “alkyl” is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In some embodiments, an alkyl has 1-100 carbon atoms. In certain embodiments, a straight chain or branched chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C 1 -C 2 for straight chain, C 2 -C 20 for branched chain), and alternatively, about 1-10.
  • cycloalkyl rings have from about 3-10 carbon atoms in their ring structure where such rings are monocyclic, bicyclic, or polycyclic, and alternatively about 5, 6 or 7 carbons in the ring structure.
  • an alkyl group may be a lower alkyl group, wherein a lower alkyl group comprises 1-4 carbon atoms (e.g., C 1 -C 4 for straight chain lower alkyls).
  • Alkynyl As used herein, the term “alkynyl” refers to an alkyl group, as defined herein, having one or more triple bonds.
  • animal refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish and/or worms. In some embodiments, an animal may be a transgenic animal, a genetically-engineered animal and/or a clone.
  • the terms “approximately” or “about” in reference to a number are generally taken to include numbers that fall within a range of 5%, 10%, 15%, or 20% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value). In some embodiments, use of the term “about” in reference to dosages means ⁇ 5 mg/kg/day.
  • Aryl refers to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic.
  • an aryl group is a monocyclic, bicyclic or polycyclic ring system having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic, and wherein each ring in the system contains 3 to 7 ring members.
  • an aryl group is a biaryl group.
  • aryl may be used interchangeably with the term “aryl ring.”
  • aryl refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl and the like, which may bear one or more substituents.
  • aryl is a group in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.
  • Comparable is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of results obtained or phenomena observed.
  • comparable sets of conditions or circumstances are characterized by a plurality of substantially identical features and one or a small number of varied features.
  • sets of conditions are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under the different sets of conditions or circumstances are caused by or indicative of the variation in those features that are varied.
  • Cycloaliphatic The term “cycloaliphatic,” “carbocycle,” “carbocyclyl,” “carbocyclic radical,” and “carbocyclic ring,” are used interchangeably, and as used herein, refer to saturated or partially unsaturated, but non-aromatic, cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems, as described herein, having, unless otherwise specified, from 3 to 30 ring members.
  • Cycloaliphatic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl.
  • a cycloaliphatic group has 3-6 carbons.
  • a cycloaliphatic group is saturated and is cycloalkyl.
  • cycloaliphatic may also include aliphatic rings that are fused to one or more aromatic or nonaromatic rings, such as decahydronaphthyl or tetrahydronaphthyl.
  • a cycloaliphatic group is bicyclic.
  • a cycloaliphatic group is tricyclic.
  • a cycloaliphatic group is polycyclic.
  • cycloaliphatic refers to C 3 -C 6 monocyclic hydrocarbon, or C 8 -C 10 bicyclic or polycyclic hydrocarbon, that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule, or a C 9 -C 16 polycyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.
  • Dosing regimen refers to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time.
  • a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses.
  • a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regime comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount.
  • a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount.
  • Heteroaliphatic is given its ordinary meaning in the art and refers to aliphatic groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). In some embodiments, one or more units selected from C, CH, CH 2 , and CH 3 are independently replaced by one or more heteroatoms (including oxidized and/or substituted form thereof). In some embodiments, a heteroaliphatic group is heteroalkyl. In some embodiments, a heteroaliphatic group is heteroalkenyl.
  • Heteroalkyl The term “heteroalkyl”, as used herein, is given its ordinary meaning in the art and refers to alkyl groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like).
  • heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.
  • Heteroaryl and “heteroar-”, as used herein, used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom.
  • a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), in some embodiments 5, 6, 9, or 10 ring atoms.
  • a heteroaryl group has 6, 10, or 14 ⁇ electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms.
  • Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl.
  • a heteroaryl is a heterobiaryl group, such as bipyridyl and the like.
  • heteroaryl and hetero- also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring.
  • Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one.
  • heteroaryl group may be monocyclic, bicyclic or polycyclic.
  • heteroaryl may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted.
  • heteroarylkyl refers to an alkyl group substituted by a heteroaryl group, wherein the alkyl and heteroaryl portions independently are optionally substituted.
  • Heteroatom means an atom that is not carbon or hydrogen.
  • a heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or a substitutable nitrogen of a heterocyclic ring (for example, N as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR (as in N-substituted pyrrolidinyl); etc.).
  • Heterocycle As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring”, as used herein, are used interchangeably and refer to a monocyclic, bicyclic or polycyclic ring moiety (e.g., 3-30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms.
  • a heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above.
  • nitrogen When used in reference to a ring atom of a heterocycle, the term “nitrogen” includes substituted nitrogen.
  • the nitrogen in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur and nitrogen, the nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or + NR (as in N-substituted pyrrolidinyl).
  • a heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted.
  • saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl.
  • heterocycle refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant and/or microbe).
  • in vivo refers to events that occur within an organism (e.g., animal, plant and/or microbe).
  • compounds, e.g., oligonucleotides, of the disclosure may contain optionally substituted and/or substituted moieties.
  • substituted whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent.
  • an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position.
  • an optionally substituted group is unsubstituted.
  • Suitable monovalent substituents on a substitutable atom are independently halogen; —(CH 2 ) 0-4 R ⁇ ; —(CH 2 ) 0-4 OR ⁇ ; —O(CH 2 ) 0-4 R, —O—(CH 2 ) 0-4 C(O)OR ⁇ ; —(CH 2 ) 0-4 CH(OR ⁇ ) 2 ; —(CH 2 ) 0-4 Ph, which may be substituted with R ⁇ ; —(CH 2 ) 0-4 O(CH 2 ) 0-1 Ph which may be substituted with R ⁇ ; —CH ⁇ CHPh, which may be substituted with R ⁇ ; —(CH 2 ) 0-4 O(CH 2 ) 0-1 -pyridyl which may be substituted with R ⁇ ; —NO 2 ; —CN; —N 3 ; —(CH 2 ) 0-4 N
  • Suitable monovalent substituents on R ⁇ are independently halogen, —(CH 2 ) 0-2 R ⁇ , -(haloR ⁇ ), —(CH 2 ) 0-2 OH, —(CH 2 ) 0-2 OR ⁇ , —(CH 2 ) 0-2 CH(OR ⁇ ) 2 ; —O(haloR ⁇ ), —CN, —N 3 , —(CH 2 ) 0-2 C(O)R ⁇ , —(CH 2 ) 0-2 C(O)OH, —(CH 2 ) 0-2 C(O)OR ⁇ , —(CH 2 ) 0-2 SR ⁇ , —(CH 2 ) 0-2 SH, —(CH 2 ) 0-2 NH 2 , —(CH 2 ) 0-2 NHR ⁇ , —(CH 2
  • Suitable divalent substituents are independently the following: ⁇ O, ⁇ S, ⁇ NNR* 2 , ⁇ NNHC(O)R*, ⁇ NNHC(O)OR*, ⁇ NNHS(O) 2 R*, ⁇ NR*, ⁇ NOR*, —O(C(R* 2 )) 2-3 O—, or —S(C(R* 2 )) 2-3 S—, wherein each independent occurrence of R* is selected from hydrogen, C 1-6 aliphatic which may be substituted as defined below, and an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: —O(CR* 2 ) 2-3 O—, wherein each independent occurrence of R* is selected from hydrogen, C 1-6 aliphatic which may be substituted as defined below, and an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • Suitable substituents on the aliphatic group of R* are independently halogen, —R ⁇ , -(haloR ⁇ ), —OH, —OR ⁇ , —O(haloR ⁇ ), —CN, —C(O)OH, —C(O)OR ⁇ , —NH 2 , —NHR ⁇ , —NR ⁇ 2 , or —NO 2 , wherein each R ⁇ is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C 1-4 aliphatic, —CH 2 Ph, —O(CH 2 ) 0-1 Ph, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • oral administration and “administered orally” as used herein have their art-understood meaning referring to administration by mouth of a compound or composition.
  • parenteral administration and “administered parenterally” as used herein have their art-understood meaning referring to modes of administration other than enteral and topical administration, usually by injection, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.
  • Partially unsaturated refers to a ring moiety that includes at least one double or triple bond.
  • the term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.
  • composition refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers.
  • an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population.
  • compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.
  • oral administration for example, drenches (aqueous or non-aqueous solutions or suspension
  • pharmaceutically acceptable refers to those compounds, materials, compositions and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • a pharmaceutically-acceptable material such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
  • materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ring
  • compositions that are appropriate for use in pharmaceutical contexts, i.e., salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
  • Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977).
  • pharmaceutically acceptable salt include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • nontoxic acid addition salts which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate
  • a provided compound comprises one or more acidic groups, e.g., an oligonucleotide, and a pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium (e.g., an ammonium salt of N(R) 3 , wherein each R is independently defined and described in the present disclosure) salt.
  • Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
  • a pharmaceutically acceptable salt is a sodium salt.
  • a pharmaceutically acceptable salt is a potassium salt.
  • a pharmaceutically acceptable salt is a calcium salt.
  • pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate.
  • a provided compound comprises more than one acid groups, for example, a provided oligonucleotide may comprise two or more acidic groups (e.g., in natural phosphate linkages and/or modified internucleotidic linkages).
  • a pharmaceutically acceptable salt, or generally a salt, of such a compound comprises two or more cations, which can be the same or different.
  • all ionizable hydrogen in the acidic groups are replaced with cations.
  • a pharmaceutically acceptable salt is a sodium salt of a provided oligonucleotide.
  • a pharmaceutically acceptable salt is a sodium salt of a provided oligonucleotide, wherein each acidic phosphate group exists as a salt form (all sodium salt).
  • Protecting group The term “protecting group,” as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3 rd edition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Also included are those protecting groups specially adapted for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry , edited by Serge L. Beaucage et al. June 2012, the entirety of Chapter 2 is incorporated herein by reference.
  • Suitable amino-protecting groups include methyl carbamate, ethyl carbamante, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluoroenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-d
  • Suitably protected carboxylic acids further include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids.
  • suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like.
  • suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl.
  • suitable alkenyl groups include allyl.
  • suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl.
  • suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.
  • Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxyte
  • the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1-methoxyethylidene ortho ester,
  • a hydroxyl protecting group is acetyl, t-butyl, tbutoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4′-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl,
  • each of the hydroxyl protecting groups is, independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and 4,4′-dimethoxytrityl.
  • the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4,4′-dimethoxytrityl group.
  • a phosphorous linkage protecting group is a group attached to the phosphorous linkage (e.g., an internucleotidic linkage) throughout oligonucleotide synthesis.
  • a protecting group is attached to a sulfur atom of an phosphorothioate group. In some embodiments, a protecting group is attached to an oxygen atom of an internucleotide phosphorothioate linkage. In some embodiments, a protecting group is attached to an oxygen atom of the internucleotide phosphate linkage.
  • a protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl, N-methyl)aminoethyl, or 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.
  • sample as used herein is a specific organism or material obtained therefrom.
  • a sample is a biological sample obtained or derived from a source of interest, as described herein.
  • a source of interest comprises an organism, such as an animal or human.
  • a biological sample comprises biological tissue or fluid.
  • a biological sample is or comprises bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washings or lavages such as a ductal lavages or broncheoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions and/or excretions; and/or cells therefrom, etc.
  • a biological sample is or comprises cells obtained from an individual.
  • a sample is a “primary sample” obtained directly from a source of interest by any appropriate means.
  • a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc.
  • body fluid e.g., blood, lymph, feces etc.
  • sample refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane.
  • a sample may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc.
  • a sample is an organism.
  • a sample is a plant.
  • a sample is an animal.
  • a sample is a human.
  • a sample is an organism other than a human.
  • subject refers to any organism to which a provided compound or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject may be suffering from and/or susceptible to a disease, disorder and/or condition.
  • the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest.
  • a base sequence which is substantially complementary to a second sequence is not identical to the second sequence, but is mostly or nearly identical to the second sequence.
  • the term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and/or chemical phenomena.
  • an individual who is “susceptible to” a disease, disorder and/or condition is one who has a higher risk of developing the disease, disorder and/or condition than does a member of the general public.
  • an individual who is susceptible to a disease, disorder and/or condition is predisposed to have that disease, disorder and/or condition.
  • an individual who is susceptible to a disease, disorder and/or condition may not have been diagnosed with the disease, disorder and/or condition.
  • an individual who is susceptible to a disease, disorder and/or condition may exhibit symptoms of the disease, disorder and/or condition.
  • an individual who is susceptible to a disease, disorder and/or condition may not exhibit symptoms of the disease, disorder and/or condition.
  • an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
  • Systemic The phrases “systemic administration,” “administered systemically,” “peripheral administration,” and “administered peripherally” as used herein have their art-understood meaning referring to administration of a compound or composition such that it enters the recipient's system.
  • therapeutic agent refers to any agent that, when administered to a subject, has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect.
  • a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition.
  • therapeutically effective amount means an amount of a substance (e.g., a therapeutic agent, composition, and/or formulation) that elicits a desired biological response when administered as part of a therapeutic regimen.
  • a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the disease, disorder, and/or condition.
  • the effective amount of a substance may vary depending on such factors as the desired biological endpoint, the substance to be delivered, the target cell or tissue, etc.
  • the effective amount of compound in a formulation to treat a disease, disorder, and/or condition is the amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and/or reduces incidence of one or more symptoms or features of the disease, disorder, and/or condition.
  • a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.
  • Treat refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition.
  • Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition.
  • treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and/or condition, for example for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.
  • Unsaturated means that a moiety has one or more units of unsaturation.
  • Unit dose refers to an amount administered as a single dose and/or in a physically discrete unit of a pharmaceutical composition.
  • a unit dose contains a predetermined quantity of an active agent.
  • a unit dose contains an entire single dose of the agent.
  • more than one unit dose is administered to achieve a total single dose.
  • administration of multiple unit doses is required, or expected to be required, in order to achieve an intended effect.
  • a unit dose may be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined quantity of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained release formulation or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose may be present in a formulation that includes any of a variety of components in addition to the therapeutic agent(s). For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., may be included as described infra.
  • acceptable carriers e.g., pharmaceutically acceptable carriers
  • diluents e.g., diluents, stabilizers, buffers, preservatives, etc.
  • a total appropriate daily dosage of a particular therapeutic agent may comprise a portion, or a plurality, of unit doses, and may be decided, for example, by the attending physician within the scope of sound medical judgment.
  • the specific effective dose level for any particular subject or organism may depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of specific active compound employed; specific composition employed; age, body weight, general health, sex and diet of the subject; time of administration, and rate of excretion of the specific active compound employed; duration of the treatment; drugs and/or additional therapies used in combination or coincidental with specific compound(s) employed, and like factors well known in the medical arts.
  • Wild-type As used herein, the term “wild-type” has its art-understood meaning that refers to an entity having a structure and/or activity as found in nature in a “normal” (as contrasted with mutant, diseased, altered, etc) state or context. Those of ordinary skill in the art will appreciate that wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).
  • Nucleic acid includes any nucleotides and polymers thereof.
  • polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecules and, thus, include double- and single-stranded DNA, and double- and single-stranded RNA.
  • RNA or DNA made from modified nucleotides and/or modified polynucleotides, such as, though not limited to, methylated, protected and/or capped nucleotides or polynucleotides.
  • the terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and/or modified nucleobases; nucleic acids derived from sugars and/or modified sugars; and nucleic acids derived from phosphate bridges and/or modified internucleotide linkages.
  • RNA poly- or oligo-ribonucleotides
  • DNA poly- or oligo-deoxyribonucleotides
  • RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and/or modified nucleobases
  • nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified internucleotidic linkages examples include, and are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties.
  • the prefix poly refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units and wherein the prefix oligo—refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.
  • Nucleotide refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more internucleotidic linkages.
  • the naturally occurring bases (guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)) are derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included.
  • the naturally occurring sugar is the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included.
  • Nucleotides are linked via internucleotidic linkages to form nucleic acids, or polynucleotides. Many internucleotidic linkages are known in the art (such as, though not limited to, phosphate, phosphorothioates, boranophosphates and the like).
  • Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothionates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates and other variants of the phosphate backbone of native nucleic acids, such as those described herein.
  • a natural nucleotide comprises a naturally occurring base, sugar and internucleotidic linkage.
  • the term “nucleotide” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleotides and nucleotide analogs.
  • Modified nucleotide includes any chemical moiety which differs structurally from a natural nucleotide but is capable of performing at least one function of a natural nucleotide.
  • a modified nucleotide comprises a modification at a sugar, base and/or internucleotidic linkage.
  • a modified nucleotide comprises a modified sugar, modified nucleobase and/or modified internucleotidic linkage.
  • a modified nucleotide is capable of at least one function of a nucleotide, e.g., forming a subunit in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.
  • Analog includes any chemical moiety which differs structurally from a reference chemical moiety or class of moieties, but which is capable of performing at least one function of such a reference chemical moiety or class of moieties.
  • a nucleotide analog differs structurally from a nucleotide but performs at least one function of a nucleotide
  • a nucleobase analog differs structurally from a nucleobase but performs at least one function of a nucleobase; etc.
  • nucleoside refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar.
  • Modified nucleoside refers to a moiety derived from or chemically similar to a natural nucleoside, but which comprises a chemical modification which differentiates it from a natural nucleoside.
  • modified nucleosides include those which comprise a modification at the base and/or the sugar.
  • modified nucleosides include those with a 2′ modification at a sugar.
  • modified nucleosides also include abasic nucleosides (which lack a nucleobase).
  • a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.
  • nucleoside analog refers to a chemical moiety which is chemically distinct from a natural nucleoside, but which is capable of performing at least one function of a nucleoside.
  • a nucleoside analog comprises an analog of a sugar and/or an analog of a nucleobase.
  • a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising a complementary sequence of bases.
  • sugar refers to a monosaccharide or polysaccharide in closed and/or open form.
  • sugars are monosaccharides.
  • sugars are polysaccharides.
  • Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties.
  • the term “sugar” also encompasses structural analogs used in lieu of conventional sugar molecules, such as glycol, polymer of which forms the backbone of the nucleic acid analog, glycol nucleic acid (“GNA”), etc.
  • GUA glycol nucleic acid
  • the term “sugar” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified sugars and nucleotide sugars.
  • Modified sugar refers to a moiety that can replace a sugar.
  • a modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of a sugar.
  • nucleobase refers to the parts of nucleic acids that are involved in the hydrogen-bonding that binds one nucleic acid strand to another complementary strand in a sequence specific manner.
  • the most common naturally-occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T).
  • the naturally-occurring nucleobases are modified adenine, guanine, uracil, cytosine, or thymine.
  • the naturally-occurring nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine.
  • a nucleobase is a “modified nucleobase,” e.g., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T).
  • the modified nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine.
  • the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of the nucleobase and retains the property of hydrogen-bonding that binds one nucleic acid strand to another in a sequence specific manner.
  • a modified nucleobase can pair with all of the five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes or activity of the oligonucleotide duplex.
  • the term “nucleobase” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleobases and nucleobase analogs.
  • Modified nucleobase refers to a chemical moiety which is chemically distinct from a nucleobase, but which is capable of performing at least one function of a nucleobase.
  • a modified nucleobase is a nucleobase which comprises a modification.
  • a modified nucleobase is capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.
  • Blocking group refers to a group that masks the reactivity of a functional group.
  • the functional group can be subsequently unmasked by removal of the blocking group.
  • a blocking group is a protecting group.
  • moiety refers to a specific segment or functional group of a molecule. Chemical moieties are often recognized chemical entities embedded in or appended to a molecule.
  • Solid support refers to any support which enables synthesis of nucleic acids.
  • the term refers to a glass or a polymer, that is insoluble in the media employed in the reaction steps performed to synthesize nucleic acids, and is derivatized to comprise reactive groups.
  • the solid support is Highly Cross-linked Polystyrene (HCP) or Controlled Pore Glass (CPG).
  • the solid support is Controlled Pore Glass (CPG).
  • the solid support is hybrid support of Controlled Pore Glass (CPG) and Highly Cross-linked Polystyrene (HCP).
  • Homology refers to sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence which can be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base, then the molecules are identical at that position; when the equivalent site occupied by the same or a similar nucleic acid residue (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position.
  • Expression as a percentage of homology/similarity or identity refers to a function of the number of identical or similar nucleic acids at positions shared by the compared sequences.
  • a sequence which is “unrelated” or “non-homologous” shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with a sequence described herein. In comparing two sequences, the absence of residues (amino acids or nucleic acids) or presence of extra residues also decreases the identity and homology/similarity.
  • the term “homology” describes a mathematically based comparison of sequence similarities which is used to identify genes with similar functions or motifs.
  • the nucleic acid sequences described herein can be used as a “query sequence” to perform a search against public databases, for example, to identify other family members, related sequences or homologs.
  • searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
  • Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402.
  • the default parameters of the respective programs e.g., XBLAST and BLAST
  • XBLAST and BLAST See www.ncbi.nlm.nih.gov.
  • identity means the percentage of identical nucleotide residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those known in the art, including but not limited to those cited in WO2017/192679.
  • Oligonucleotide refers to a polymer or oligomer of nucleotides, and may contain any combination of natural and non-natural nucleobases, sugars, and internucleotidic linkages.
  • Oligonucleotides can be single-stranded or double-stranded.
  • a single-stranded oligonucleotide can have double-stranded regions (formed by two portions of the single-stranded oligonucleotide) and a double-stranded oligonucleotide, which comprises two oligonucleotide chains, can have single-stranded regions for example, at regions where the two oligonucleotide chains are not complementary to each other.
  • Example oligonucleotides include, but are not limited to structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, UI adaptors, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immuno-stimulatory oligonucleotides, and decoy oligonucleotides.
  • RNAi agents or iRNA agents RNA interference reagents
  • shRNA antisense oligonucleotides
  • ribozymes microRNAs
  • microRNA mimics supermirs
  • aptamers antimirs
  • Internucleotidic linkage refers generally to a linkage linking nucleoside units of an oligonucleotide or a nucleic acid.
  • an internucleotidic linkage is a phosphodiester linkage, as found in naturally occurring DNA and RNA molecules (natural phosphate linkage).
  • an internucleotidic linkage includes a modified internucleotidic linkage.
  • an internucleotidic linkage is a “modified internucleotidic linkage” wherein each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety.
  • an organic or inorganic moiety is selected from but not limited to ⁇ S, ⁇ Se, ⁇ NR′, —SR′, —SeR′, —N(R′) 2 , B(R′) 3 , —S—, —Se—, and —N(R′)—, wherein each R′ is independently as defined and described in the present disclosure.
  • an internucleotidic linkage is a phosphotriester linkage, phosphorothioate diester linkage
  • an internucleotidic linkage is one of, e.g., PNA (peptide nucleic acid) or PMO (phosphorodiamidate Morpholino oligomer) linkage. It is understood by a person of ordinary skill in the art that an internucleotidic linkage may exist as an anion or cation at a given pH due to the existence of acid or base moieties in the linkage.
  • Non-limiting examples of modified internucleotidic linkages are modified internucleotidic linkages designated s, s1, s2, s3, s4, s5, s6, s7, s8, s9, s10, s11, s12, s13, s14, s15, s16, s17 and s18 as described in WO 2017/210647.
  • (Rp, Sp)-ATsCs1GA has 1) a phosphorothioate internucleotidic linkage
  • the Rp/Sp designations preceding an oligonucleotide sequence describe the configurations of chiral linkage phosphorus atoms in the internucleotidic linkages sequentially from 5′ to 3′ of the oligonucleotide sequence.
  • the phosphorus in the “s” linkage between T and C has Rp configuration and the phosphorus in “s1” linkage between C and G has Sp configuration.
  • “All-(Rp)” or “All-(Sp)” is used to indicate that all chiral linkage phosphorus atoms in oligonucleotide have the same Rp or Sp configuration, respectively.
  • Oligonucleotide type is used to define an oligonucleotide that has a particular base sequence, pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, etc.), pattern of backbone chiral centers (i.e. pattern of linkage phosphorus stereochemistry (Rp/Sp)), and pattern of backbone phosphorus modifications (e.g., pattern of “-XLR 1 ” groups in formula I).
  • oligonucleotides of a common designated “type” are structurally identical to one another.
  • each nucleotide unit of the oligonucleotide strand can be designed and/or selected in advance to have a particular stereochemistry at the linkage phosphorus and/or a particular modification at the linkage phosphorus, and/or a particular base, and/or a particular sugar.
  • an oligonucleotide strand is designed and/or selected in advance to have a particular combination of stereocenters at the linkage phosphorus.
  • an oligonucleotide strand is designed and/or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and/or selected to have a particular combination of bases. In some embodiments, an oligonucleotide strand is designed and/or selected to have a particular combination of one or more of the above structural characteristics.
  • the present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type (i.e., are structurally identical to one another). In many embodiments, however, provided compositions comprise a plurality of oligonucleotides of different types, typically in pre-determined relative amounts.
  • Chiral control refers to control of the stereochemical designation of a chiral linkage phosphorus in a chiral internucleotidic linkage within an oligonucleotide.
  • a control is achieved through a chiral element that is absent from the sugar and base moieties of an oligonucleotide, for example, in some embodiments, a control is achieved through use of one or more chiral auxiliaries during oligonucleotide preparation as exemplified in the present disclosure, which chiral auxiliaries often are part of chiral phosphoramidites used during oligonucleotide preparation.
  • a person having ordinary skill in the art appreciates that conventional oligonucleotide synthesis which does not use chiral auxiliaries cannot control stereochemistry at a chiral internucleotidic linkage if such conventional oligonucleotide synthesis is used to form the chiral internucleotidic linkage.
  • the stereochemical designation of each chiral linkage phosphorus in a chiral internucleotidic linkage within an oligonucleotide is controlled.
  • Chirally controlled oligonucleotide composition refers to a composition that comprises a plurality of oligonucleotides (or nucleic acids) which share 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone phosphorus modifications, wherein the plurality of oligonucleotides (or nucleic acids) share the same stereochemistry at one or more chiral internucleotidic linkages (chirally controlled internucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition, not a random Rp and Sp mixture as non-chirally controlled internucleotidic linkage).
  • Level of the plurality of oligonucleotides (or nucleic acids) in a chirally controlled oligonucleotide composition is pre-determined/controlled (e.g., through chirally controlled oligonucleotide preparation to stereoselectively form one or more chiral internucleotidic linkages).
  • about 1%-100% (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5% 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition are oligonucleotides of the plurality.
  • about 1%-100% (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition that share the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone phosphorus modifications are oligonucleotides of the plurality.
  • a predetermined level is be about 1%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a composition, or of all oligonucleotides in a composition that share a common base sequence (e.g., of a plurality of oligonucleotide or an oligonucleotide type), or
  • the plurality of oligonucleotides share the same stereochemistry at about 1-50 (e.g., about 1-10, 1-20, 5-10, 5-20, 10-15, 10-20, 10-25, 10-30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral internucleotidic linkages.
  • 1-50 e.g., about 1-10, 1-20, 5-10, 5-20, 10-15, 10-20, 10-25, 10-30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
  • the plurality of oligonucleotides share the same stereochemistry at about 1%-100% (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of chiral internucleotidic linkages.
  • 1%-100% e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-10
  • each chiral internucleotidic linkage is a chiral controlled internucleotidic linkage, and the composition is a completely chirally controlled oligonucleotide composition.
  • not all chiral internucleotidic linkages are chiral controlled internucleotidic linkages, and the composition is a partially chirally controlled oligonucleotide composition.
  • a chirally controlled oligonucleotide composition comprises non-random or controlled levels of individual oligonucleotide or nucleic acids types. For instance, in some embodiments a chirally controlled oligonucleotide composition comprises one oligonucleotide type.
  • a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises multiple oligonucleotide types. In some embodiments, a chirally controlled oligonucleotide composition is a composition of oligonucleotides of a oligonucleotide type, which composition comprises a non-random or controlled level of a plurality of oligonucleotides of the oligonucleotide type.
  • Chirally pure as used herein, the phrase “chirally pure” is used to describe an oligonucleotide or compositions thereof, in which all are nearly all (the rest are impurities) of the oligonucleotide molecules exist in a single diastereomeric form with respect to the linkage phosphorus atoms.
  • predetermined By predetermined (or pre-determined) is meant deliberately selected or non-random or controlled, for example as opposed to randomly occurring, random, or achieved without control.
  • predetermined By reading the present specification, will appreciate that the present disclosure provides technologies that permit selection of particular chemistry and/or stereochemistry features to be incorporated into oligonucleotide compositions, and further permits controlled preparation of oligonucleotide compositions having such chemistry and/or stereochemistry features.
  • Such provided compositions are “predetermined” as described herein. Compositions that may contain certain oligonucleotides because they happen to have been generated through a process that are not controlled to intentionally generate the particular chemistry and/or stereochemistry features are not “predetermined” compositions.
  • a predetermined composition is one that can be intentionally reproduced (e.g., through repetition of a controlled process).
  • a predetermined level of a plurality of oligonucleotides in a composition means that the absolute amount, and/or the relative amount (ratio, percentage, etc.) of the plurality of oligonucleotides in the composition is controlled.
  • a predetermined level of a plurality of oligonucleotides in a composition is achieved through chirally controlled oligonucleotide preparation.
  • Linkage phosphorus as defined herein, the phrase “linkage phosphorus” is used to indicate that the particular phosphorus atom being referred to is the phosphorus atom present in the internucleotidic linkage, which phosphorus atom corresponds to the phosphorus atom of a phosphodiester internucleotidic linkage as occurs in naturally occurring DNA and RNA.
  • a linkage phosphorus atom is in a modified internucleotidic linkage, wherein each oxygen atom of a phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety.
  • a linkage phosphorus atom is the P of Formula I.
  • a linkage phosphorus atom is chiral.
  • a linkage phosphorus atom is achiral.
  • P-modification refers to any modification at the linkage phosphorus other than a stereochemical modification.
  • a P-modification comprises addition, substitution, or removal of a pendant moiety covalently attached to a linkage phosphorus.
  • the “P-modification” is —X-L-R 1 wherein each of X, L and R′ is independently as defined and described in the present disclosure.
  • Blockmer refers to an oligonucleotide strand whose pattern of structural features characterizing each individual nucleotide unit is characterized by the presence of at least two consecutive nucleotide units sharing a common structural feature at the internucleotidic phosphorus linkage.
  • common structural feature is meant common stereochemistry at the linkage phosphorus or a common modification at the linkage phosphorus.
  • the at least two consecutive nucleotide units sharing a common structure feature at the internucleotidic phosphorus linkage are referred to as a “block”.
  • a provided oligonucleotide is a blockmer.
  • a blockmer is a “stereoblockmer,” e.g., at least two consecutive nucleotide units have the same stereochemistry at the linkage phosphorus. Such at least two consecutive nucleotide units form a “stereoblock.”
  • a blockmer is a “P-modification blockmer,” e.g., at least two consecutive nucleotide units have the same modification at the linkage phosphorus. Such at least two consecutive nucleotide units form a “P-modification block”.
  • (Rp, Sp)-ATsCsGA is a P-modification blockmer because at least two consecutive nucleotide units, the Ts and the Cs, have the same P-modification (i.e., both are a phosphorothioate diester).
  • TsCs forms a block, and it is a P-modification block.
  • a blockmer is a “linkage blockmer,” e.g., at least two consecutive nucleotide units have identical stereochemistry and identical modifications at the linkage phosphorus. At least two consecutive nucleotide units form a “linkage block”.
  • (Rp, Rp)-ATsCsGA is a linkage blockmer because at least two consecutive nucleotide units, the Ts and the Cs, have the same stereochemistry (both Rp) and P-modification (both phosphorothioate).
  • TsCs forms a block, and it is a linkage block.
  • a blockmer comprises one or more blocks independently selected from a stereoblock, a P-modification block and a linkage block.
  • a blockmer is a stereoblockmer with respect to one block, and/or a P-modification blockmer with respect to another block, and/or a linkage blockmer with respect to yet another block.
  • Altmer refers to an oligonucleotide strand whose pattern of structural features characterizing each individual nucleotide unit is characterized in that no two consecutive nucleotide units of the oligonucleotide strand share a particular structural feature at the internucleotidic phosphorus linkage.
  • an altmer is designed such that it comprises a repeating pattern.
  • an altmer is designed such that it does not comprise a repeating pattern.
  • a provided oligonucleotide is a altmer.
  • an altmer is a “stereoaltmer,” e.g., no two consecutive nucleotide units have the same stereochemistry at the linkage phosphorus.
  • an altmer is a “P-modification altmer” e.g., no two consecutive nucleotide units have the same modification at the linkage phosphorus.
  • P-modification altmer e.g., no two consecutive nucleotide units have the same modification at the linkage phosphorus.
  • All-(Sp)-CAs1GsT in which each linkage phosphorus has a different P-modification than the others.
  • an altmer is a “linkage altmer,” e.g., no two consecutive nucleotide units have identical stereochemistry or identical modifications at the linkage phosphorus.
  • Unimer refers to an oligonucleotide strand whose pattern of structural features characterizing each individual nucleotide unit is such that all nucleotide units within the strand share at least one common structural feature at the internucleotidic phosphorus linkage.
  • common structural feature is meant common stereochemistry at the linkage phosphorus or a common modification at the linkage phosphorus.
  • a provided oligonucleotide is a unimer.
  • a unimer is a “stereounimer,” e.g., all nucleotide units have the same stereochemistry at the linkage phosphorus.
  • a unimer is a “P-modification unimer”, e.g., all nucleotide units have the same modification at the linkage phosphorus.
  • a unimer is a “linkage unimer,” e.g., all nucleotide units have the same stereochemistry and the same modifications at the linkage phosphorus.
  • Gapmer refers to an oligonucleotide strand characterized in that at least one internucleotidic phosphorus linkage of the oligonucleotide strand is a phosphate diester linkage, for example such as those found in naturally occurring DNA or RNA. In some embodiments, more than one internucleotidic phosphorus linkage of the oligonucleotide strand is a phosphate diester linkage such as those found in naturally occurring DNA or RNA. In some embodiments, a provided oligonucleotide is a gapmer.
  • Skipmer refers to a type of gapmer in which every other internucleotidic phosphorus linkage of the oligonucleotide strand is a phosphate diester linkage, for example such as those found in naturally occurring DNA or RNA, and every other internucleotidic phosphorus linkage of the oligonucleotide strand is a modified internucleotidic linkage.
  • a provided oligonucleotide is a skipmer.
  • Oligonucleotides provide useful molecular tools in a wide variety of applications.
  • oligonucleotides e.g., oligonucleotides which target C9orf72
  • the use of naturally occurring nucleic acids e.g., unmodified DNA or RNA
  • various synthetic counterparts have been developed to circumvent these shortcomings.
  • oligonucleotides that contain chemical modifications, e.g., base modifications, sugar modifications, backbone modifications, etc., which, among other things, render these molecules less susceptible to degradation and improve other properties of oligonucleotides.
  • modifications to internucleotidic linkages can introduce chirality, and certain properties of oligonucleotides may be affected by configurations of phosphorus atoms that form the backbone of oligonucleotides.
  • antisense oligonucleotides such as binding affinity, sequence specific binding to complementary RNA, stability to nucleases, are affected by, inter alia, chirality of backbone phosphorus atoms.
  • Various modifications are efficacious for C9orf72 oligonucleotides.
  • the present disclosure provides an oligonucleotide comprising a region of consecutive nucleotidic units:
  • such oligonucleotides provide improved properties, e.g., improved stability, and/or activities.
  • y is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, y is 1. In some embodiments, y is 2. In some embodiments, y is 3. In some embodiments, y is 4. In some embodiments, y is 5. In some embodiments, y is 6. In some embodiments, y is 7. In some embodiments, y is 8. In some embodiments, y is 9. In some embodiments, y is 10.
  • each Nu M independently comprises a modified internucleotidic linkage.
  • a modified internucleotidic linkage is a chiral internucleotidic linkage.
  • a modified internucleotidic linkage is of formula I or a salt form thereof.
  • a modified internucleotidic linkage is chiral and is of formula I or a salt form thereof.
  • a modified internucleotidic linkage is a phosphorothioate diester linkage.
  • a modified internucleotidic linkage is chiral and is chirally controlled.
  • each modified internucleotidic linkage is chirally controlled.
  • internucleotidic linkage of Nu M is a chirally controlled phosphorothioate diester linkage.
  • Nu M of a provided oligonucleotides comprises different types of modified internucleotidic linkages.
  • Nu M of a provided oligonucleotides comprises chiral internucleotidic linkages having linkage phosphorus atoms of different configuration.
  • Nu M of a provided oligonucleotides comprises different types of modified internucleotidic linkages.
  • Nu M of a provided oligonucleotides comprises chiral internucleotidic linkages having linkage phosphorus atoms of different configuration.
  • at least one chiral internucleotidic linkage of Nu M is Sp at its linkage phosphorus.
  • at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 Nu M each independently comprise a chiral internucleotidic linkage of Sp at its linkage phosphorus.
  • each chiral internucleotidic linkage of Nu M is Sp at its linkage phosphorus.
  • at least one chiral internucleotidic linkage of Nu M is Rp at its linkage phosphorus.
  • At least one chiral internucleotidic linkage of Nu M is Rp at its linkage phosphorus, and at least one chiral internucleotidic linkage of Nu M is Sp at its linkage phosphorus.
  • Additional nucleotidic unit comprising modified internucleotidic linkages suitable for Nu M are known in the art and/or described in the present disclosure and can be utilized in accordance with the present disclosure.
  • each Nu O is independently a nucleotidic unit comprising a natural phosphate linkage.
  • at least one Nu O is a nucleotidic unit comprising a natural phosphate linkage, wherein the natural phosphate linkage is bonded to a 5′-nucleotidic unit and a carbon atom of the sugar unit of the nucleotidic unit, wherein the carbon atom is bonded to less than two hydrogen atoms.
  • each Nu O is independently a nucleotidic unit comprising a natural phosphate linkage, wherein the natural phosphate linkage is bonded to a 5′-nucleotidic unit and a carbon atom of the sugar unit of the nucleotidic unit, wherein the carbon atom is bonded to less than two hydrogen atoms.
  • at least one Nu O comprises a structure of —C(R 5s ) 2 —, which structure is directly boned to the natural phosphate linkage of Nu O and a ring moiety of the sugar unit of Nu O .
  • each Nu O independently comprises a structure of —C(R 5s ) 2 —, which structure is directly boned to the natural phosphate linkage of Nu O and a ring moiety of the sugar unit of Nu O .
  • each Nu O independently has the structure of formula N-I:
  • each of R 1s , R 2s , R 3s , and R 4s is independently R s and as described in the present disclosure. In some embodiments,
  • R 1s , R 2s , R 3s , and R 4s is independently as described in the present disclosure. In some embodiments,
  • R 1s , R 2s , R 3s , and R 4s is independently as described in the present disclosure.
  • L s is —C(R 5s ) 2 —. In some embodiments, one R 5s is —H and L s is —CHR 5s —. In some embodiments, each R 5s is independently R. In some embodiments, —C(R 5s ) 2 — is —C(R) 2 —. In some embodiments, one R 5s is —H and —C(R 5s ) 2 — is —CHR—. In some embodiments, R is not hydrogen. In some embodiments, R is optionally substituted C 1-6 aliphatic. In some embodiments, R is optionally substituted C 1-6 alkyl. In some embodiments, R is substituted.
  • R is unsubstituted. In some embodiments, R is methyl. Additional example R groups are widely described in the present disclosure.
  • the C of —C(R 5s ) 2 — is chiral and is R. In some embodiments, the C of —C(R 5s ) 2 — is chiral and is S. In some embodiments, —C(R 5s ) 2 — is —(R)—CHMe-. In some embodiments, —C(R 5s ) 2 — is —(S)—CHMe-.
  • a region of consecutive nucleotidic units comprises a pattern of backbone chiral centers (linkage phosphorus) of (Np)t[(Op)n(Sp)m]y, wherein each variable is independently as described in the present disclosure.
  • a region of consecutive nucleotidic units comprises a pattern of backbone chiral centers (linkage phosphorus) of (Sp)t[(Op)n(Sp)m]y, wherein each variable is independently as described in the present disclosure.
  • the present disclosure provides oligonucleotides that comprise one or two wings and a core, and comprise or are of a wing-core-wing, a core-wing, or a wing-core structure. In some embodiments, provided oligonucleotides comprise or are of a wing-core-wing structure. In some embodiments, provided oligonucleotides comprise or are of a core-wing structure. In some embodiments, provided oligonucleotides comprise or are of a wing-core structure. In some embodiments, a core of is a region of consecutive nucleotidic unit as described in the present disclosure. In some embodiments, each wing independently comprises one or more nucleobases as described in the present disclosure.
  • a wing-core-wing motif is described as “X-Y-Z”, where “X” represents the length of the 5′ wing, “Y” represents the length of the core, and “Z” represents the length of the 3′ wing.
  • the core is positioned immediately adjacent to each of the 5′ wing and the 3′ wing.
  • X and Z are the same or different lengths and/or have the same or different modifications or patterns of modifications.
  • Y is between 8 and 15 nucleotides.
  • X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides.
  • an oligonucleotide described herein has or comprises a wing-core-wing structure of, for example 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4, or 4-7-4.
  • an oligonucleotide described herein has or comprises a wing-core or core-wing structure of, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.
  • a wing or a core is a block
  • a wing-core, core-wing, or wing-core-wing structure is a blockmer comprising two or three blocks.
  • an oligonucleotide has a wing-core-wing-structure, wherein the length (in bases) of the first wing is represented by X, the length of the core is represented by Y and the length of the second wing is represented by Z, wherein X—Y—Z is any of: 1-5-1, 1-6-1, 1-7-1, 1-8-1, 1-9-1, 1-10-1, 1-11-1, 1-12-1, 1-13-1, 1-14-1, 1-15-1, 1-16-1, 1-17-1, 1-18-1, 1-19-1, 1-20-1, 1-5-2, 1-6-2, 1-7-2, 1-8-2, 1-9-2, 1-10-2, 1-11-2, 1-12-2, 1-13-2, 1-14-2, 1-15-2, 1-16-2, 1-17-2, 1-18-2, 1-19-2, 1-20-2, 1-5-3, 1-6-3, 1-7-3, 1-8-3, 1-9-3, 1-10-3, 1-11-3, 1-12-3, 1-13-3, 1-14-3, 1-15-3, 1-16-3, 1-17
  • the present disclosure provides an oligonucleotide comprising or of a wing-core-wing, core-wing or wing-core structure, wherein:
  • the present disclosure provides an oligonucleotide comprising or of a wing-core-wing, core-wing or wing-core structure, wherein:
  • (Np)t[(Op/Rp)n(Sp)m]y comprises at least one Op. In some embodiments, (Np)t[(Op/Rp)n(Sp)m]y comprises at least one Rp. In some embodiments, (Np)t[(Op/Rp)n(Sp)m]y is (Np)t[(Op)n(Sp)m]y. In some embodiments, (Np)t[(Op/Rp)n(Sp)m]y is (Np)t[(Rp)n(Sp)m]y.
  • a wing comprises one or more sugar modifications.
  • the two wings of a wing-core-wing structure comprise different sugar modifications.
  • sugar modifications provide improved stability compared to absence of sugar modifications.
  • certain sugar modifications e.g., 2′-MOE
  • a wing comprises 2′-MOE modifications.
  • each nucleoside unit of a wing comprising a pyrimidine base e.g., C, U, T, etc.
  • each sugar unit of a wing comprises a 2′-MOE modification.
  • each nucleoside unit of a wing comprising a purine base e.g., A, G, etc.
  • comprises no 2′-MOE modification e.g., 2′-OMe, no 2′-modification, etc.
  • each nucleoside unit of a wing comprising a purine base comprises a 2′-OMe modification.
  • each internucleotidic linkage at the 3′-position of a sugar unit comprising a 2′-MOE modification is a natural phosphate linkage.
  • each internucleotidic linkage at the 3′-position of a sugar unit comprising a 2′-MOE modification is a natural phosphate linkage, except that if the wing is a 5′-wing to the core, the first internucleotidic linkage of the wing is a modified internucleotidic linkage, e.g., a phosphorothioate diester linkage, and the internucleotidic linkage linking the 3′-end nucleoside unit of the wing and the 5′-end nucleoside unit of the core is a modified internucleotidic linkage, e.g., a phosphorothioate diester linkage; and if the wing is a 3′-wing to the core, the last internucleotidic linkage of the wing is a modified internucleotidic linkage, e.g., a phosphorothioate diester linkage, and the
  • a wing comprises no 2′-MOE modifications. In some embodiments, a wing comprises 2′-OMe modifications. In some embodiments, each nucleoside unit of a wing independently comprises a 2′-OMe modifications.
  • the present disclosure encompasses the recognition that oligonucleotides with 2′-OMe modifications are less stable than comparable oligonucleotides with 2′-MOE modifications under certain conditions.
  • modified non-natural internucleotidic linkages such as phosphorothioate diester linkages, in some instances particularly Sp phosphorothioate diester linkages, can be utilized to improve properties, e.g., stability, of oligonucleotides.
  • a wing comprises no 2′-MOE modifications, and each internucleotidic linkage between nucleoside units of the wing is a modified internucleotidic linkage.
  • a wing comprises no 2′-MOE modifications, each nucleoside unit of the wing comprise a 2′-OMe modification, and each internucleotidic linkage between nucleoside units of the wing is a modified internucleotidic linkage.
  • a modified internucleotidic linkage is a phosphorothioate diester lineage.
  • a modified internucleotidic linkage is a chirally controlled internucleotidic linkage.
  • a modified internucleotidic linkage is a chirally controlled internucleotidic linkage wherein the linkage phosphorus is of Sp configuration. In some embodiments, a modified internucleotidic linkage is a chirally controlled internucleotidic linkage wherein the linkage phosphorus is of Rp configuration. In some embodiments, a modified internucleotidic linkage is a Sp phosphorothioate diester linkage. In some embodiments, a modified internucleotidic linkage is a Rp phosphorothioate diester linkage. In some embodiments, such a wing is a 5′-wing. In some embodiments, such a wing is a 3′-wing.
  • the present disclosure encompasses the recognition that 2′-modifications and/or modified internucleotidic linkages can be utilized either individually or in combination to fine-tune properties, e.g., stability, and/or activities of oligonucleotides.
  • a wing comprises one or more natural phosphate linkages. In some embodiments, a wing comprises one or more consecutive natural phosphate linkages. In some embodiments, a wing comprises one or more natural phosphate linkages and one or more modified internucleotidic linkages. In some embodiments, a modified internucleotidic linkage is a phosphorothioate diester linkage. In some embodiments, a modified internucleotidic linkage is a Sp phosphorothioate diester linkage.
  • a wing comprises no natural phosphate linkages, and each internucleotidic linkage of the wing is independently a modified internucleotidic linkage.
  • a modified internucleotidic linkage is chiral and chirally controlled.
  • a modified internucleotidic linkage is a phosphorothioate diester linkage.
  • a modified internucleotidic linkage is a Sp phosphorothioate diester linkage.
  • the two wings are different in that they contain different levels and/or types of chemical modifications, backbone chiral center stereochemistry, and/or patterns thereof. In some embodiments, the two wings are different in that they contain different levels and/or types of sugar modifications, and/or internucleotidic linkages, and/or internucleotidic linkage stereochemistry, and/or patterns thereof.
  • one wing comprises 2′-OR modifications wherein R is optionally substituted C 1-6 alkyl (e.g., 2-MOE), while the other wing comprises no such modifications, or lower level (e.g., by number and/or percentage) of such modifications; additionally and alternatively, one wing comprises natural phosphate linkages while the other wing comprises no natural phosphate linkages or lower level (e.g., by number and/or percentage) of natural phosphate linkages; additionally and alternatively, one wing may comprise a certain type of modified internucleotidic linkages (e.g., phosphorothioate diester internucleotidic linkage) while the other wing comprises no natural phosphate linkages or lower level (e.g., by number and/or percentage) of the type of modified internucleotidic linkages; additionally and alternatively, one wing may comprise chiral modified internucleotidic linkages comprising linkage phosphorus atoms of a particular configuration
  • R is optionally substitute
  • one wing comprises one or more natural phosphate linkages and one or more 2′-OR modifications wherein R is not —H or -Me, and the other wing comprises no natural phosphate linkages and no 2′-OR modifications wherein R is not —H or -Me.
  • one wing comprises one or more natural phosphate linkages and one or more 2′-MOE modifications, and each internucleotidic linkage in the other wing is a phosphorothioate linkage and each sugar unit of the other wing comprises a 2′-OMe modification.
  • one wing comprises one or more natural phosphate linkages and one or more 2′-MOE modifications
  • each internucleotidic linkage in the other wing is a Sp phosphorothioate linkage and each sugar unit of the other wing comprises a 2′-OMe modification.
  • an oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a 2′-OMe and the other wing comprises a bicyclic sugar. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a 2′-OMe and the other wing comprises a bicyclic sugar, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and the majority of the sugars in the other wing are a bicyclic sugar.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and the majority of the sugars in the other wing are a bicyclic sugar, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and, in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises a 2′-OMe.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and, in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises a 2′-OMe, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are a bicyclic sugar and, in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises a 2′-OMe.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are a bicyclic sugar and, in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises a 2′-OMe, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and, in the other wing, at least two sugars are a bicyclic sugar and at least two sugars comprise a 2′-OMe.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and, in the other wing, at least two sugars are a bicyclic sugar and at least two sugars comprise a 2′-OMe, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are a bicyclic sugar and, in the other wing, at least two sugars are a bicyclic sugar and at least two sugars comprise a 2′-OMe.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are a bicyclic sugar and, in the other wing, at least two sugars are a bicyclic sugar and at least two sugars comprise a 2′-OMe, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises a 2′-OMe and each sugar in the other wing comprises a bicyclic sugar. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises a 2′-OMe and each sugar in the other wing comprises a bicyclic sugar, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises a bicyclic sugar, each sugar in the other wing comprises a 2′-OMe, and each sugar in the core comprises a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a bicyclic sugar and the other wing comprises a 2′-MOE. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a bicyclic sugar and the other wing comprises a 2′-MOE, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a bicyclic sugar and the majority of the sugars in the other wing comprise a 2′-MOE. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a bicyclic sugar and the majority of the sugars in the other wing comprise a 2′-MOE, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a bicyclic sugar and, in the other wing, at least one sugar comprises a 2′-MOE and at least one sugar are a bicyclic sugar.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a bicyclic sugar and, in the other wing, at least one sugar comprises a 2′-MOE and at least one sugar are a bicyclic sugar, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-MOE and, in the other wing, at least one sugar comprises a 2′-MOE and at least one sugar are a bicyclic sugar.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-MOE and, in the other wing, at least one sugar comprises a 2′-MOE and at least one sugar are a bicyclic sugar, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a bicyclic sugar and, in the other wing, at least two sugars comprise a 2′-MOE and at least two sugars is a bicyclic sugar.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a bicyclic sugar and, in the other wing, at least two sugars comprise a 2′-MOE and at least two sugars is a bicyclic sugar, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-MOE and, in the other wing, at least two sugars comprise a 2′-MOE and at least two sugars is a bicyclic sugar.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-MOE and, in the other wing, at least two sugars comprise a 2′-MOE and at least two sugars is a bicyclic sugar, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing are a bicyclic sugar and each sugar in the other wing comprises a 2′-MOE. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing are a bicyclic sugar and each sugar in the other wing comprises a 2′-MOE, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises a 2′-MOE, each sugar in the other wing are a bicyclic sugar, and each sugar in the core comprises a 2′-deoxy.
  • a bicyclic sugar is a LNA, a cEt or BNA.
  • an oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a 2′-OMe and the other wing comprises 2′-F. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a 2′-OMe and the other wing comprises 2′-F, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and the majority of the sugars in the other wing are 2′-F. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and the majority of the sugars in the other wing are 2′-F, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and, in the other wing, at least one sugar is 2′-F and at least one sugar comprises a 2′-OMe.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and, in the other wing, at least one sugar is 2′-F and at least one sugar comprises a 2′-OMe, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are 2′-F and, in the other wing, at least one sugar is 2′-F and at least one sugar comprises a 2′-OMe.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are 2′-F and, in the other wing, at least one sugar is 2′-F and at least one sugar comprises a 2′-OMe, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and, in the other wing, at least two sugars are 2′-F and at least two sugars comprise a 2′-OMe.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-OMe and, in the other wing, at least two sugars are 2′-F and at least two sugars comprise a 2′-OMe, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are 2′-F and, in the other wing, at least two sugars are 2′-F and at least two sugars comprise a 2′-OMe.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are 2′-F and, in the other wing, at least two sugars are 2′-F and at least two sugars comprise a 2′-OMe, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises a 2′-OMe and each sugar in the other wing comprises 2′-F. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises a 2′-OMe and each sugar in the other wing comprises 2′-F, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises 2′-F, each sugar in the other wing comprises a 2′-OMe, and each sugar in the core comprises a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises 2′-F and the other wing comprises a 2′-MOE. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises 2′-F and the other wing comprises a 2′-MOE, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2′-F and the majority of the sugars in the other wing comprise a 2′-MOE. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2′-F and the majority of the sugars in the other wing comprise a 2′-MOE, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2′-F and, in the other wing, at least one sugar comprises a 2′-MOE and at least one sugar are 2′-F.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2′-F and, in the other wing, at least one sugar comprises a 2′-MOE and at least one sugar are 2′-F, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-MOE and, in the other wing, at least one sugar comprises a 2′-MOE and at least one sugar are 2′-F.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-MOE and, in the other wing, at least one sugar comprises a 2′-MOE and at least one sugar are 2′-F, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2′-F and, in the other wing, at least two sugars comprise a 2′-MOE and at least two sugars is 2′-F.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2′-F and, in the other wing, at least two sugars comprise a 2′-MOE and at least two sugars is 2′-F, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-MOE and, in the other wing, at least two sugars comprise a 2′-MOE and at least two sugars is 2′-F.
  • an oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise a 2′-MOE and, in the other wing, at least two sugars comprise a 2′-MOE and at least two sugars is 2′-F, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing is 2′-F and each sugar in the other wing comprises a 2′-MOE. In some embodiments, an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing is 2′-F and each sugar in the other wing comprises a 2′-MOE, and the majority of the sugars in the core comprise a 2′-deoxy.
  • an oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises a 2′-MOE, each sugar in the other wing are 2′-F, and each sugar in the core comprises a 2′-deoxy.
  • a C9orf72 oligonucleotides has a wing-core-wing structure and has an asymmetrical format. In some embodiments of a C9orf72 oligonucleotide having an asymmetrical format, one wing differs from another. In some embodiments of a C9orf72 oligonucleotide having an asymmetrical format, one wing differs from another in the sugar modifications or pattern thereof, or the backbone internucleotidic linkages or pattern thereof, or the backbone chiral centers or pattern thereof. In some embodiments of an oligonucleotide having an asymmetrical format, the core comprises 1 or more 2′-deoxy sugars.
  • the core comprises 5 or more consecutive 2′-deoxy sugars. In some embodiments of an oligonucleotide having an asymmetrical format, the core comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more consecutive 2′-deoxy sugars.
  • a first wing and a second wing independently has a pattern of stereochemistry of internucleotidic linkages which is or comprises PO, SR, Sp, Rp, Sp-PO, Rp-PO, PO-Sp, PO-Rp, PO-PO-PO, Sp-PO-PO, Rp-PO-PO, Rp-PO-PO, Rp-PO-PO-PO-Rp, Rp-PO-PO-Rp-Rp, Rp-PO-Rp-PO-Rp, Rp-Rp-PO-PO-Rp, Sp-PO-PO-PO-Sp, Sp-Sp-Sp-Sp, Sp-Sp-Sp-Sp, Sp-Sp-Sp-Sp-Sp, Sp-Xn-Xn-Xn-Sp, SR-PO-PO-SR, SR-SR-SR-SR, SR-SR-SR-SR-SR, SR-SR-SR-SR-SR, SR-SR-SR-SR-SR, SR-
  • the first wing is the 5′ wing (the wing closer to the 5′-end of the oligonucleotide) and the second wing is the 3′-wing (the wing closer to the 3′-end of the oligonucleotide).
  • the first wing is the 3′ wing (the wing closer to the 3′-end of the oligonucleotide) and the second wing is the 5′-wing (the wing closer to the 5′-end of the oligonucleotide).
  • the first and second wing are the same or different lengths.
  • an oligonucleotide having an asymmetrical structure (e.g., wherein one wing differs chemically from another wing) has an improved biological activity compared to an oligonucleotide having the same base sequence but a different structure (e.g., a symmetric structure wherein both wings have the same pattern of chemical modifications; or a different asymmetrical structure).
  • improved biological activity includes improved decrease of the expression, activity, and/or level or a gene or gene product.
  • improved biological activity is improved delivery to a cellular nucleus.
  • improved biological activity is improved delivery to a cellular nucleus and one wing in an oligonucleotide having an asymmetrical structure comprises a 2′-F or two or more 2′-F. In some embodiments, improved biological activity is improved delivery to a cellular nucleus and one wing in an oligonucleotide having an asymmetrical structure comprises a 2′-MOE or two or more 2′-MOE. In some embodiments, improved biological activity is improved delivery to a cellular nucleus and one wing in an oligonucleotide having an asymmetrical structure comprises a 2′-OMe or two or more 2′-OMe. In some embodiments, improved biological activity is improved delivery to a cellular nucleus and one wing in an oligonucleotide having an asymmetrical structure comprises a bicyclic sugar or two or more bicyclic sugars.
  • a core comprises no 2′-substitution, and each sugar unit is a natural sugar unit found in natural unmodified DNA.
  • a core comprises one or more 2′-halogen modification.
  • a core comprises one or more 2′-F modification.
  • no less than 70%, 80%, 90% or 100% of internucleotidic linkages in a core is a modified internucleotidic linkage.
  • no less than 70%, 80%, or 90% of internucleotidic linkages in a core is independently a modified internucleotidic linkage of Sp configuration, and the core also contains 1, 2, 3, 4, or 5 internucleotidic linkages selected from modified internucleotidic linkages of Rp configuration and natural phosphate linkages. In some embodiments, the core also contains 1 or 2 internucleotidic linkages selected from modified internucleotidic linkages of Rp configuration and natural phosphate linkages.
  • the core also contains 1 and no more than 1 internucleotidic linkage selected from a modified internucleotidic linkage of Rp configuration and a natural phosphate linkage, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration.
  • the core also contains 2 and no more than 2 internucleotidic linkage each independently selected from a modified internucleotidic linkage of Rp configuration and a natural phosphate linkage, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration.
  • the core also contains 1 and no more than 1 natural phosphate linkage, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration. In some embodiments, the core also contains 2 and no more than 2 natural phosphate linkages, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration. In some embodiments, the core also contains 1 and no more than 1 modified internucleotidic linkage of Rp configuration, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration.
  • the core also contains 2 and no more than 2 modified internucleotidic linkages of Rp configuration, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration.
  • the two natural phosphate linkages, or the two modified internucleotidic linkages of Rp configuration are separated by two or more modified internucleotidic linkages of Sp configuration.
  • a modified internucleotidic linkage is of formula I.
  • a modified internucleotidic linkage is a phosphorothioate diester linkage.
  • Core and wings can be of various lengths.
  • a core comprises no less than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases.
  • a wing comprises no less than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleobases.
  • a wing comprises no more than 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleobases.
  • both wings are of the same length, for example, of 5 nucleobases. In some embodiments, the two wings are of different lengths.
  • a core is no less than 40%, 45%, 50%, 60%, 70%, 80%, or 90% of total oligonucleotide length as measured by percentage of nucleoside units within the core. In some embodiments, a core is no less than 50% of total oligonucleotide length.
  • the present disclosure provides oligonucleotides comprising additional chemistry moieties, optionally connected to the oligonucleotide moiety through a linker. In some embodiments, the present disclosure provides oligonucleotides comprising (R D )b-L M1 -L M2 -L M3 -, wherein:
  • each of L M1 L M2 , and L M3 is independently a covalent bond, or a bivalent or multivalent, optionally substituted, linear or branched group selected from a C 1-10 aliphatic group and a C 1-10 heteroaliphatic group having 1-5 heteroatoms, wherein one or more methylene units are optionally and independently replaced with C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—,
  • L M1 comprises one or more —N(R′)— and one or more —C(O)—.
  • a linker or L M1 is or comprises
  • n L is 1-8.
  • a linker or -L M1 -L M2 -L M3 - is
  • a linker or -L M1 -L M2 -L M3 - is
  • the moiety and the linker, or (R D )b-L M1 -L M2 -L M3 - is or comprises
  • the moiety and the linker, or (R D )b-L M1 -L M2 -L M3 - is or comprises
  • the moiety and the linker, or (R D )b-L M1 -L M2 -L M3 - is or comprises
  • the moiety and the linker, or (R D )b-L M1 -L M2 -L M3 - is or comprises
  • the moiety and the linker, or (R D )b-L M1 -L M2 -L M3 - is or comprises
  • the moiety and the linker, or (e)b-L M1 -L M2 -L M3 - is or comprises
  • the linker, or L M1 is or comprises
  • the moiety and linker, or (R D )b-L M1 -L M2 -L M3 - is or comprises:
  • the moiety and linker, or (R D )b-L M1 -L M2 -L M3 - is or comprises:
  • n L is 1-8. In some embodiments, n L is 1, 2, 3, 4, 5, 6, 7, or 8. In some embodiments, n L is 1. In some embodiments, n L is 2. In some embodiments, n L is 3. In some embodiments, n L is 4. In some embodiments, n L is 5. In some embodiments, n L is 6. In some embodiments, n L is 7. In some embodiments, n L 8.
  • L M2 is a covalent bond, or a bivalent, optionally substituted, linear or branched group selected from a C 1-10 aliphatic group and a C 1-10 heteroaliphatic group having 1-5 heteroatoms, wherein one or more methylene units are optionally and independently replaced with C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O)S—, —C(O)O
  • L M2 is a covalent bond, or a bivalent, optionally substituted, linear or branched group selected from a C 1-10 aliphatic group and a C 1-10 heteroaliphatic group having 1-5 heteroatoms, wherein one or more methylene units are optionally and independently replaced with C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O)S—, —C(O)O
  • L M2 is a covalent bond, or a bivalent, optionally substituted, linear or branched C 1-10 aliphatic wherein one or more methylene units are optionally and independently replaced with C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —N(R′)—, or —C(O)—.
  • L M2 is —NH—(CH 2 ) 6 —, wherein —NH— is bonded to L M1 .
  • L M3 is —P(O)(OR′)—, —P(O)(SR′)—, —P(O)(R′)—, —P(O)(NR′)—, —P(S)(OR′)—, —P(S)(SR′)—, —P(S)(R′)—, —P(S)(NR′)—, —P(R′)—, —P(OR′)—, —P(SR′)—, —P(NR′)—, —P(OR′)[B(R′) 3 ]—, —OP(O)(OR′)—, —OP(O)(SR′)—, —OP(O)(R′)—, —OP(O)(NR′)—, —OP(S)(OR′)—, —OP(S)(SR′)—, —OP(S)(SR′)—, —OP(S)(SR′)—, —OP(
  • L M3 is —OP(O)(OR′)—, or —OP(O)(SR′)—, wherein —O— is bonded to L M2 .
  • the P atom is connected to a sugar unit, a nucleobase unit, or an internucleotidic linkage.
  • the P atom is connected to a —OH group through formation of a P—O bond.
  • the P atom is connected to the 5′-OH group through formation of a P—O bond.
  • L M1 is a covalent bond. In some embodiments, L M2 is a covalent bond. In some embodiments, L M3 is a covalent bond. In some embodiments, L M1 is L M2 as described in the present disclosure. In some embodiments, L M1 is L M3 as described in the present disclosure. In some embodiments, L M2 is L M1 as described in the present disclosure. In some embodiments, L M2 is L M3 as described in the present disclosure. In some embodiments, L M3 is L M1 as described in the present disclosure. In some embodiments, L M3 is L M2 as described in the present disclosure. In some embodiments, L M1 is L M1 as described in the present disclosure.
  • L M1 is L 2 as described in the present disclosure. In some embodiments, L M is L M3 as described in the present disclosure. In some embodiments, L M1 is -L M2 , wherein each of L M1 and L M2 is independently as described in the present disclosure. In some embodiments, L M1 is L M1 -L M3 , wherein each of L M1 and L M3 is independently as described in the present disclosure. In some embodiments, L M is L M2 -L M3 , wherein each of L M2 and L M3 is independently as described in the present disclosure. In some embodiments, L M is L M1 -L M2 -L M3 , wherein each of L M1 , L M2 and L M3 is independently as described in the present disclosure.
  • each R D is independently a chemical moiety as described in the present disclosure.
  • R D is targeting moiety.
  • R D is or comprises a carbohydrate moiety.
  • R is or comprises a lipid moiety.
  • R D is or comprises a ligand moiety for, e.g., cell receptors such as a sigma receptor, an asialoglycoprotein receptor, etc.
  • a ligand moiety is or comprises an anisamide moiety, which may be a ligand moiety for a sigma receptor.
  • a ligand moiety is or comprises a GalNAc moiety, which may be a ligand moiety for an asialoglycoprotein receptor.
  • R D is selected from optionally substituted phenyl,
  • R s is F. In some embodiments, R s is OMe. In some embodiments, R s is OH. In some embodiments, R s is NHAc. In some embodiments, R s is NHCOCF 3 . In some embodiments, R′ is H. In some embodiments, R is H. In some embodiments, R 2s is NHAc, and R 5s is OH. In some embodiments, R 2s is p-anisoyl, and R 5s is OH. In some embodiments, R 2s is NHAc and R 5s is p-anisoyl. In some embodiments, R 2s is OH, and R 5s is p-anisoyl. In some embodiments, R D is selected from
  • R D includes additional chemical moiety embodiments, e.g., those described in Example, Example 2, etc.
  • n′ is 1. In some embodiments, n′ is 0.
  • n′′ is 1. In some embodiments, n′′ is 2.
  • the present disclosure provides a provided compound, e.g., an oligonucleotide of a provided composition, having the structure of formula O-I:
  • each L P independently has the structure of formula I:
  • each L P independently has the structure of formula I, and R E is —C(R 5s ) 3 , -L-P DB , —C(R 5s ) 2 OH, -L-R 5s , or -L-P 5s -L-R 5 , or a salt form thereof, wherein each variable is independently as described in the present disclosure.
  • each L P independently has the structure of formula I, and R E is —C(R 5s ) 3 , -L-P DB , —C(R 5s ) 2 OH, -L-R 5s , or -L-P 5s -L-R 5 , or a salt form thereof, wherein each variable is independently as described in the present disclosure.
  • R E is —C(R 5s ) 3 , —C(R 5s ) 2 OH, or -L-R 5s ;
  • R E is —C(R 5s ) 3 , —C(R 5s ) 2 OH, or -L-R 5s
  • R E is —C(R 5s ) 3 , —C(R 5s ) 2 OH, or -L-R 5s ;
  • R E is a 5′-end group as described herein.
  • R E is —C(R 5s ) 3 , -L-P DB , —C(R 5s ) 2 OH, -L-R 5s , or -L-P 5s -L-R s , or a salt form thereof, wherein each variable is independently as described in the present disclosure.
  • R E is —CH 2 OH.
  • R E is —CH 2 OP(O)(OR) 2 or a salt form thereof, wherein each R is independently as described in the present disclosure.
  • R E is —CH 2 OP(O)(OH) 2 or a salt form thereof.
  • R E is —CH 2 OP(O)(OR)(SR) or a salt form thereof, wherein each R is independently as described in the present disclosure. In some embodiments, R E is —CH 2 OP(O)(SH)(OH) or a salt form thereof. In some embodiments, R E is (E)-CH ⁇ CHP(O)(OR) 2 or a salt form thereof, wherein each R is independently as described in the present disclosure. In some embodiments, R E is (E)-CH ⁇ CHP(O)(OH) 2 .
  • R E is —CH 2 OH. In some embodiments, R E is —CH 2 OP(O)(R) 2 or a salt form thereof, wherein each R is independently as described in the present disclosure. In some embodiments, R E is —CH 2 P(O)(OR) 2 or a salt form thereof, wherein each R is independently as described in the present disclosure. In some embodiments, R E is —CH 2 OP(O)(OH) 2 or a salt form thereof. In some embodiments, R E is —CH 2 OP(O)(OR)(SR) or a salt form thereof, wherein each R is independently as described in the present disclosure.
  • R E is —CH 2 OP(O)(SH)(OH) or a salt form thereof. In some embodiments, R E is (E)-CH ⁇ CHP(O)(OR) 2 or a salt form thereof, wherein each R is independently as described in the present disclosure. In some embodiments, R E is (E)-CH ⁇ CHP(O)(OH) 2 .
  • R E is —CH(R 5s )—OH, wherein R 5s is as described in the present disclosure.
  • R E is —CH(R 5s )—OP(O)(R) 2 or a salt form thereof, wherein each R 5s and R is independently as described in the present disclosure.
  • R E is —CH(R 5s )—OP(O)(OR) 2 or a salt form thereof, wherein each R 5s and R is independently as described in the present disclosure.
  • R E is —CH(R 5s )—OP(O)(OH) 2 or a salt form thereof.
  • R E is —CH(R 5s )—OP(O)(OR)(SR) or a salt form thereof. In some embodiments, R E is —CH(R)—OP(O)(OH)(SH) or a salt form thereof. In some embodiments, R E is —(R)—CH(R 5s )—OH, wherein R 5s is as described in the present disclosure. In some embodiments, R E is —(R)—CH(R 5s )—OP(O)(R) 2 or a salt form thereof, wherein each R 5s and R is independently as described in the present disclosure.
  • R E is —(R)—CH(R 5s )—OP(O)(OR) 2 or a salt form thereof, wherein each R 5s and R is independently as described in the present disclosure.
  • R E is —(R)—CH(R 5s )—OP(O)(OH) 2 or a salt form thereof.
  • R E is —(R)—CH(R 5s )—OP(O)(OR)(SR) or a salt form thereof.
  • R E is —(R)—CH(R 5s )—OP(O)(OH)(SH) or a salt form thereof.
  • R E is —(S)—CH(R 5s )—OH, wherein R 5s is as described in the present disclosure. In some embodiments, R E is —(S)—CH(R 5s )—OP(O)(R) 2 or a salt form thereof, wherein each R 5s and R is independently as described in the present disclosure. In some embodiments, R E is —(S)—CH(R 5s )—OP(O)(OR) 2 or a salt form thereof, wherein each R 5s and R is independently as described in the present disclosure. In some embodiments, R E is —(S)—CH(R 5s )—OP(O)(OH) 2 or a salt form thereof.
  • R E is —(S)—CH(R 5s )—OP(O)(OR)(SR) or a salt form thereof. In some embodiments, R E is —(S)—CH(R 5s )—OP(O)(OH)(SH) or a salt form thereof. In some embodiments, R 5s is optionally substituted C 1 , C 2 , C 3 , or C 4 aliphatic. In some embodiments, R 5s is C 1 , C 2 , C 3 , or C 4 aliphatic or haloaliphatic. In some embodiments, R 5s is optionally substituted —CH 3 . In some embodiments, R 5s is —CH 3 .
  • BA is an optionally substituted group selected from C 3-30 cycloaliphatic, C 6-30 aryl, C 5-30 heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, C 3-30 heterocyclyl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, a natural nucleobase moiety, and a modified nucleobase moiety.
  • BA is an optionally substituted group selected from C 5-30 heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, C 3-30 heterocyclyl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, a natural nucleobase moiety, and a modified nucleobase moiety.
  • BA is an optionally substituted group selected from C 5-30 heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, a natural nucleobase moiety, and a modified nucleobase moiety.
  • BA is optionally substituted C 5-30 heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
  • BA is optionally substituted natural nucleobases and tautomers thereof. In some embodiments, BA is protected natural nucleobases and tautomers thereof. Various nucleobase protecting groups for oligonucleotide synthesis are known and can be utilized in accordance with the present disclosure. In some embodiments, BA is an optionally substituted nucleobase selected from adenine, cytosine, guanosine, thymine, and uracil, and tautomers thereof. In some embodiments, BA is an optionally protected nucleobase selected from adenine, cytosine, guanosine, thymine, and uracil, and tautomers thereof.
  • BA is optionally substituted C 3-30 cycloaliphatic. In some embodiments, BA is optionally substituted C 6-30 aryl. In some embodiments, BA is optionally substituted C 3-30 heterocyclyl. In some embodiments, BA is optionally substituted C 5-30 heteroaryl. In some embodiments, BA is an optionally substituted natural base moiety. In some embodiments, BA is an optionally substituted modified base moiety. BA is an optionally substituted group selected from C 3-30 cycloaliphatic, C 6-30 aryl, C 3-30 heterocyclyl, and C 5-30 heteroaryl. In some embodiments, BA is an optionally substituted group selected from C 3-30 cycloaliphatic, C 6-30 aryl, C 3-30 heterocyclyl, C 5-30 heteroaryl, and a natural nucleobase moiety.
  • BA is connected through an aromatic ring. In some embodiments, BA is connected through a heteroatom. In some embodiments, BA is connected through a ring heteroatom of an aromatic ring. In some embodiments, BA is connected through a ring nitrogen atom of an aromatic ring.
  • BA is a natural nucleobase moiety. In some embodiments, BA is an optionally substituted natural nucleobase moiety. In some embodiments, BA is a substituted natural nucleobase moiety. In some embodiments, BA is natural nucleobase A, T, C, U, or G. In some embodiments, BA is an optionally substituted group selected from natural nucleobases A, T, C, U, and G.
  • BA is an optionally substituted group, which group is formed by removing a —H from
  • BA is an optionally substituted group, which group is formed by removing a —H from
  • BA is an optionally substituted group which group is selected from
  • BA is an optionally substituted group which group is selected from
  • BA is an optionally substituted group, which group is formed by removing a —H from
  • BA is an optionally substituted group, which group is formed by removing a —H from
  • BA is an optionally substituted group which group is selected from
  • BA is an optionally substituted group which group is selected from
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is optionally substituted
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA of the 5′-end nucleoside unit of a provided oligonucleotide is an optionally substituted group, which group is formed by removing a —H from
  • BA of the 5′-end nucleoside unit is an optionally substituted group which group is selected from
  • BA of the 5′-end nucleoside unit is an optionally substituted group, which group is formed by removing a —H from
  • BA of the 5′-end nucleoside unit is an optionally substituted group which group is selected from
  • BA of the 5′-end nucleoside unit is optionally substituted
  • BA of the 5′-end nucleoside unit is optionally substituted
  • BA of the 5′-end nucleoside unit is optionally substituted
  • BA of the 5′-end nucleoside unit is optionally substituted
  • BA of the 5′-end nucleoside unit is optionally substituted
  • BA of the 5′-end nucleoside unit is
  • BA of the 5′-end nucleoside unit is
  • BA of the 5′-end nucleoside unit is
  • BA of the 5′-end nucleoside unit is
  • BA of the 5′-end nucleoside unit is
  • BA is H
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • BA is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • a protection group is —Ac. In some embodiments, a protection group is -Bz. In some embodiments, a protection group is -iBu for nucleobase.
  • BA is an optionally substituted purine base residue. In some embodiments, BA is a protected purine base residue. In some embodiments, BA is an optionally substituted adenine residue. In some embodiments, BA is a protected adenine residue. In some embodiments, BA is an optionally substituted guanine residue. In some embodiments, BA is a protected guanine residue. In some embodiments, BA is an optionally substituted cytosine residue. In some embodiments, BA is a protected cytosine residue. In some embodiments, BA is an optionally substituted thymine residue. In some embodiments, BA is a protected thymine residue. In some embodiments, BA is an optionally substituted uracil residue. In some embodiments, BA is a protected uracil residue. In some embodiments, BA is an optionally substituted 5-methylcytosine residue. In some embodiments, BA is a protected 5-methylcytosine residue.
  • BA is a protected base residue as used in oligonucleotide preparation.
  • BA is a base residue illustrated in US 2011/0294124, US 2015/0211006, US 2015/0197540, and WO 2015/107425, each of which is incorporated herein by reference.
  • BA is a modified nucleobase illustrated in WO 2017/192679.
  • each R s is independently —H, halogen, —CN, —N 3 , —NO, —NO 2 , -L s -R′, -L s -Si(R) 3 , -L s -OR′, -L s -SR′, -L s -N(R′) 2 , —O-L s -R′, —O-L s -Si(R) 3 , —O-L s -OR′, —O-L s -SR′, or —O-L s -N(R′) 2 as described in the present disclosure.
  • R s is —H. In some embodiments, R s is not —H.
  • R s is R′, wherein R is as described in the present disclosure. In some embodiments, R s is R, wherein R is as described in the present disclosure. In some embodiments, R s is optionally substituted C 1-30 heteroaliphatic. In some embodiments, R s comprises one or more silicon atoms. In some embodiments, R s is —CH 2 Si(Ph) 2 CH 3 .
  • R s is -L s -R′. In some embodiments, R s is -L s -R′ wherein -L s — is a bivalent, optionally substituted C 1-30 heteroaliphatic group. In some embodiments, R s is —CH 2 Si(Ph) 2 CH 3 .
  • R s is —F. In some embodiments, R s is —Cl. In some embodiments, R s is —Br. In some embodiments, R s is —I. In some embodiments, R s is —CN. In some embodiments, R s is —N 3 . In some embodiments, R s is —NO. In some embodiments, R s is —NO 2 . In some embodiments, R s is -L s —Si(R) 3 . In some embodiments, R s is —Si(R) 3 . In some embodiments, R is -L s -R′. In some embodiments, R s is —R′.
  • R s is -L s -OR′. In some embodiments, R s is —OR′. In some embodiments, R s is -L s -SR′. In some embodiments, R s is —SR′. In some embodiments, R s is -L-N(R′) 2 . In some embodiments, R s is —N(R′) 2 . In some embodiments, R s is —O-L s -R′. In some embodiments, R s is —O-L s —Si(R) 3 . In some embodiments, R s is —O-L-OR′. In some embodiments, R s is —O-L s -SR′.
  • R is —O-L s -N(R′) 2 .
  • R s is a 2′-modification as described in the present disclosure.
  • R s is —OR, wherein R is as described in the present disclosure.
  • R s is —OR, wherein R is optionally substituted C 1-6 aliphatic.
  • R s is —OMe.
  • R s is —OCH 2 CH 2 OMe.
  • s is 0-20. In some embodiments, s is 1-20. In some embodiments, s is 1-5. In some embodiments, s is 1. In some embodiments, s is 2. In some embodiments, s is 3. In some embodiments, s is 4. In some embodiments, s is 5. In some embodiments, s is 6. In some embodiments, s is 7. In some embodiments, s is 8. In some embodiments, s is 9. In some embodiments, s is 10. In some embodiments, s is 11. In some embodiments, s is 12. In some embodiments, s is 13. In some embodiments, s is 14. In some embodiments, s is 15. In some embodiments, s is 16. In some embodiments, s is 17. In some embodiments, s is 18. In some embodiments, s is 19. In some embodiments, s is 20.
  • L s is L, wherein L is as described in the present disclosure. In some embodiments, L is a bivalent optionally substituted methylene group.
  • each L is independently a covalent bond, or a bivalent, optionally substituted, linear or branched group selected from a C 1-30 aliphatic group and a C 1-30 heteroaliphatic group having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus, boron and silicon, wherein one or more methylene units are optionally and independently replaced with C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)
  • L is a covalent bond, or a bivalent, optionally substituted, linear or branched group selected from a C 1-30 aliphatic group and a C 1-30 heteroaliphatic group having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R
  • L is a covalent bond, or a bivalent, optionally substituted, linear or branched C 1-30 aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O)S—, —C(O)O—, —P(O)(OR′)—, —C 1-6 al
  • L is a covalent bond, or a bivalent, optionally substituted, linear or branched C 1-30 heteroaliphatic group having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O)S—, —C(O)S
  • L is a covalent bond, or a bivalent, optionally substituted, linear or branched group selected from a C 1-30 aliphatic group and a C 1-30 heteroaliphatic group having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R
  • L is a covalent bond, or a bivalent, optionally substituted, linear or branched group selected from a C 1-10 aliphatic group and a C 1-10 heteroaliphatic group having 1-5 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C 1-6 alkylene, C 1-6 alkenylene, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O) 2
  • L is a covalent bond, or a bivalent, optionally substituted, linear or branched group selected from a C 1-10 aliphatic group and a C 1-10 heteroaliphatic group having 1-5 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O)S—, and —C(O)O—
  • L is a covalent bond. In some embodiments, L is optionally substituted bivalent C 1-30 aliphatic. In some embodiments, L is optionally substituted bivalent C 1-30 heteroaliphatic having 1-10 heteroatoms independently selected from boron, oxygen, nitrogen, sulfur, phosphorus and silicon.
  • aliphatic moieties e.g. those of L, R, etc., either monovalent or bivalent or multivalent, and can contain any number of carbon atoms (before any optional substitution) within its range, e.g., C 1 , C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 , C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , etc.
  • heteroaliphatic moieties e.g. those of L, R, etc., either monovalent or bivalent or multivalent, and can contain any number of carbon atoms (before any optional substitution) within its range, e.g., C 1 , C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 , C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , etc.
  • one or more methylene unit is optionally and independently substituted with —O—, —S—, —N(R′)—, —C(O)—, —S(O)—, —S(O) 2 —, —P(O)(OR′)—, —P(O)(SR′)—, —P(S)(OR′)—, or —P(S)(OR′)—.
  • a methylene unit is replaced with —O—.
  • a methylene unit is replaced with —S—.
  • a methylene unit is replaced with —N(R′)—.
  • a methylene unit is replaced with —C(O)—. In some embodiments, a methylene unit is replaced with —S(O)—. In some embodiments, a methylene unit is replaced with —S(O) 2 —. In some embodiments, a methylene unit is replaced with —P(O)(OR′)—. In some embodiments, a methylene unit is replaced with —P(O)(SR′)—. In some embodiments, a methylene unit is replaced with —P(O)(R′)—. In some embodiments, a methylene unit is replaced with —P(O)(NR′)—.
  • a methylene unit is replaced with —P(S)(OR′)—. In some embodiments, a methylene unit is replaced with —P(S)(SR′)—. In some embodiments, a methylene unit is replaced with —P(S)(R′)—. In some embodiments, a methylene unit is replaced with —P(S)(NR′)—. In some embodiments, a methylene unit is replaced with —P(R′)—. In some embodiments, a methylene unit is replaced with —P(OR′)—. In some embodiments, a methylene unit is replaced with —P(SR′)—.
  • a methylene unit is replaced with —P(NR′)—. In some embodiments, a methylene unit is replaced with —P(OR′)[B(R′) 3 ]—. In some embodiments, one or more methylene unit is optionally and independently substituted with —O—, —S—, —N(R′)—, —C(O)—, —S(O)—, —S(O) 2 —, —P(O)(OR′)—, —P(O)(SR′)—, —P(S)(OR′)—, or —P(S)(OR′)—.
  • a methylene unit is replaced with —OP(O)(OR′)O—, —OP(O)(SR′)O—, —OP(O)(R′)O—, —OP(O)(NR′)O—, —OP(OR′)O—, —OP(SR′)O—, —OP(NR′)O—, —OP(R′)O—, or —OP(OR′)[B(R′) 3 ]O—, each of which may independently be an internucleotidic linkage.
  • L e.g., when connected to R, is —CH 2 —. In some embodiments, L is —C(R) 2 —, wherein at least one R is not hydrogen. In some embodiments, L is —CHR—. In some embodiments, R is hydrogen. In some embodiments, L is —CHR—, wherein R is not hydrogen. In some embodiments, C of —CHR— is chiral. In some embodiments, L is —(R)—CHR—, wherein C of —CHR— is chiral. In some embodiments, L is —(S)—CHR—, wherein C of —CHR— is chiral.
  • R is optionally substituted C 1-6 aliphatic. In some embodiments, R is optionally substituted C 1-6 alkyl. In some embodiments, R is optionally substituted C 1-5 aliphatic. In some embodiments, R is optionally substituted C 1-5 alkyl. In some embodiments, R is optionally substituted C 1-4 aliphatic. In some embodiments, R is optionally substituted C 1-4 alkyl. In some embodiments, R is optionally substituted C 1-3 aliphatic. In some embodiments, R is optionally substituted C 1-3 alkyl. In some embodiments, R is optionally substituted C 2 aliphatic. In some embodiments, R is optionally substituted methyl.
  • R is C 1-6 aliphatic. In some embodiments, R is C 1-6 alkyl. In some embodiments, R is C 15 aliphatic. In some embodiments, R is C 1-5 alkyl. In some embodiments, R is C 1-4 aliphatic. In some embodiments, R is C 1-4 alkyl. In some embodiments, R is C 1-3 aliphatic. In some embodiments, R is C 1-3 alkyl. In some embodiments, R is C 2 aliphatic. In some embodiments, R is methyl. In some embodiments, R is C 1-6 haloaliphatic. In some embodiments, R is C 1-6 haloalkyl. In some embodiments, R is C 15 haloaliphatic.
  • R is C 1-5 haloalkyl. In some embodiments, R is C 1-4 haloaliphatic. In some embodiments, R is C 1-4 haloalkyl. In some embodiments, R is C 1-3 haloaliphatic. In some embodiments, R is C 1-3 haloalkyl. In some embodiments, R is C 2 haloaliphatic. In some embodiments, R is methyl substituted with one or more halogen. In some embodiments, R is —CF 3 . In some embodiments, L is optionally substituted —CH ⁇ CH—. In some embodiments, L is optionally substituted (E)-CH ⁇ CH—. In some embodiments, L is optionally substituted (Z)—CH ⁇ CH—. In some embodiments, L is —C ⁇ C—.
  • L comprises at least one phosphorus atom.
  • at least one methylene unit of L is replaced with —P(O)(OR′)—, —P(O)(SR′)—, —P(O)(R′)—, —P(O)(NR′)—, —P(S)(OR′)—, —P(S)(SR′)—, —P(S)(R′)—, —P(S)(NR′)—, —P(R′)—, —P(OR′)—, —P(SR′)—, —P(NR′)—, —P(OR′)[B(R′) 3 ]—, —OP(O)(OR′)O—, —OP(O)(SR′)O—, —OP(O)(SR′)O—, —OP(O)(R′)O—, —OP(O)(NR′)O—, —OP(OR′)O—, —OP(
  • Cy L is an optionally substituted tetravalent group selected from a C 3-20 cycloaliphatic ring, a C 6-20 aryl ring, a 5-20 membered heteroaryl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, and a 3-20 membered heterocyclyl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus, boron and silicon.
  • Cy L is monocyclic. In some embodiments, Cy L is bicyclic. In some embodiments, Cy L is polycyclic.
  • Cy L is saturated. In some embodiments, Cy L is partially unsaturated. In some embodiments, Cy L is aromatic. In some embodiments, Cy L is or comprises a saturated ring moiety. In some embodiments, Cy L is or comprises a partially unsaturated ring moiety. In some embodiments, Cy L is or comprises an aromatic ring moiety.
  • Cy L is an optionally substituted C 3-20 cycloaliphatic ring as described in the present disclosure (for example, those described for R but tetravalent).
  • a ring is an optionally substituted saturated C 3-20 cycloaliphatic ring.
  • a ring is an optionally substituted partially unsaturated C 3-20 cycloaliphatic ring.
  • a cycloaliphatic ring can be of various sizes as described in the present disclosure.
  • a ring is 3, 4, 5, 6, 7, 8, 9, or 10-membered.
  • a ring is 3-membered.
  • a ring is 4-membered.
  • a ring is 5-membered. In some embodiments, a ring is 6-membered. In some embodiments, a ring is 7-membered. In some embodiments, a ring is 8-membered. In some embodiments, a ring is 9-membered. In some embodiments, a ring is 10-membered. In some embodiments, a ring is an optionally substituted cyclopropyl moiety. In some embodiments, a ring is an optionally substituted cyclobutyl moiety. In some embodiments, a ring is an optionally substituted cyclopentyl moiety. In some embodiments, a ring is an optionally substituted cyclohexyl moiety.
  • a ring is an optionally substituted cycloheptyl moiety. In some embodiments, a ring is an optionally substituted cyclooctanyl moiety. In some embodiments, a cycloaliphatic ring is a cycloalkyl ring. In some embodiments, a cycloaliphatic ring is monocyclic. In some embodiments, a cycloaliphatic ring is bicyclic. In some embodiments, a cycloaliphatic ring is polycyclic. In some embodiments, a ring is a cycloaliphatic moiety as described in the present disclosure for R with more valences.
  • Cy L is an optionally substituted 6-20 membered aryl ring.
  • a ring is an optionally substituted tetravalent phenyl moiety.
  • a ring is a tetravalent phenyl moiety.
  • a ring is an optionally substituted naphthalene moiety.
  • a ring can be of different size as described in the present disclosure.
  • an aryl ring is 6-membered.
  • an aryl ring is 10-membered.
  • an aryl ring is 14-membered.
  • an aryl ring is monocyclic.
  • an aryl ring is bicyclic.
  • an aryl ring is polycyclic.
  • a ring is an aryl moiety as described in the present disclosure for R with more valences.
  • Cy L is an optionally substituted 5-20 membered heteroaryl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, Cy L is an optionally substituted 5-20 membered heteroaryl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, as described in the present disclosure, heteroaryl rings can be of various sizes and contain various numbers and/or types of heteroatoms. In some embodiments, a heteroaryl ring contains no more than one heteroatom. In some embodiments, a heteroaryl ring contains more than one heteroatom. In some embodiments, a heteroaryl ring contains no more than one type of heteroatom.
  • a heteroaryl ring contains more than one type of heteroatoms.
  • a heteroaryl ring is 5-membered.
  • a heteroaryl ring is 6-membered.
  • a heteroaryl ring is 8-membered.
  • a heteroaryl ring is 9-membered.
  • a heteroaryl ring is 10-membered.
  • a heteroaryl ring is monocyclic.
  • a heteroaryl ring is bicyclic.
  • a heteroaryl ring is polycyclic.
  • a heteroaryl ring is a nucleobase moiety, e.g., A, T, C, G, U, etc. In some embodiments, a ring is a heteroaryl moiety as described in the present disclosure for R with more valences.
  • Cy L is a 3-20 membered heterocyclyl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, Cy L is a 3-20 membered heterocyclyl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, a heterocyclyl ring is saturated. In some embodiments, a heterocyclyl ring is partially unsaturated. A heterocyclyl ring can be of various sizes as described in the present disclosure. In some embodiments, a ring is 3, 4, 5, 6, 7, 8, 9, or 10-membered. In some embodiments, a ring is 3-membered. In some embodiments, a ring is 4-membered.
  • a ring is 5-membered. In some embodiments, a ring is 6-membered. In some embodiments, a ring is 7-membered. In some embodiments, a ring is 8-membered. In some embodiments, a ring is 9-membered. In some embodiments, a ring is 10-membered.
  • Heterocyclyl rings can contain various numbers and/or types of heteroatoms. In some embodiments, a heterocyclyl ring contains no more than one heteroatom. In some embodiments, a heterocyclyl ring contains more than one heteroatom. In some embodiments, a heterocyclyl ring contains no more than one type of heteroatom.
  • a heterocyclyl ring contains more than one type of heteroatoms.
  • a heterocyclyl ring is monocyclic.
  • a heterocyclyl ring is bicyclic.
  • a heterocyclyl ring is polycyclic.
  • a ring is a heterocyclyl moiety as described in the present disclosure for R with more valences.
  • Cy L is a sugar moiety in a nucleic acid. In some embodiments, Cy L is an optionally substituted furanose moiety. In some embodiments, Cy L is a pyranose moiety. In some embodiments, Cy L is an optionally substituted furanose moiety found in DNA. In some embodiments, Cy L is an optionally substituted furanose moiety found in RNA. In some embodiments, Cy L is an optionally substituted 2′-deoxyribofuranose moiety. In some embodiments, Cy L is an optionally substituted ribofuranose moiety. In some embodiments, substitutions provide sugar modifications as described in the present disclosure.
  • an optionally substituted 2′-deoxyribofuranose moiety and/or an optionally substituted ribofuranose moiety comprise substitution at a 2′-position.
  • a 2′-position is a 2′-modification as described in the present disclosure.
  • a 2′-modification is —F.
  • a 2′-modification is —OR, wherein R is as described in the present disclosure.
  • R is not hydrogen.
  • Cy L is a modified sugar moiety, such as a sugar moiety in LNA.
  • Cy L is a modified sugar moiety, such as a sugar moiety in ENA.
  • Cy L is a terminal sugar moiety of an oligonucleotide, connecting an internucleotidic linkage and a nucleobase. In some embodiments, Cy L is a terminal sugar moiety of an oligonucleotide, for example, when that terminus is connected to a solid support optionally through a linker. In some embodiments, Cy L is a sugar moiety connecting two internucleotidic linkages and a nucleobase. Example sugars and sugar moieties are extensively described in the present disclosure.
  • Cy L is a nucleobase moiety.
  • a nucleobase is a natural nucleobase, such as A, T, C, G, U, etc.
  • a nucleobase is a modified nucleobase.
  • Cy L is optionally substituted nucleobase moiety selected from A, T, C, G, U, and 5mC.
  • Example nucleobases and nucleobase moieties are extensively described in the present disclosure.
  • two Cy L moieties are bonded to each other, wherein one Cy L is a sugar moiety and the other is a nucleobase moiety.
  • such a sugar moiety and nucleobase moiety forms a nucleoside moiety.
  • a nucleoside moiety is natural.
  • a nucleoside moiety is modified.
  • Cy L is an optionally substituted natural nucleoside moiety selected from adenosine, 5-methyluridine, cytidine, guanosine, uridine, 5-methylcytidine, 2′-deoxyadenosine, thymidine, 2′-deoxycytidine, 2′-deoxyguanosine, 2′-deoxyuridine, and 5-methyl-2′-deoxycytidine.
  • Example nucleosides and nucleosides moieties are extensive described in the present disclosure.
  • Cy L is an optionally substituted nucleoside moiety bonded to an internucleotidic linkage, for example, —OP(O)(OR′)O—, —OP(O)(SR′)O—, —OP(O)(R′)O—, —OP(O)(NR′)O—, —OP(OR′)O—, —OP(SR′)O—, —OP(NR′)O—, —OP(R′)O—, —OP(OR′)[B(R′) 3 ]O—, etc., which may form an optionally substituted nucleotidic unit.
  • Example nucleotides and nucleosides moieties are extensive described in the present disclosure.
  • each Ring A is independently an optionally substituted 3-20 membered monocyclic, bicyclic or polycyclic ring having 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • Ring A is an optionally substituted ring, which ring is as described in the present disclosure.
  • a ring is
  • a ring is
  • Ring A is or comprises a ring of a sugar moiety. In some embodiments, Ring A is or comprises a ring of a modified sugar moiety.
  • a sugar unit is of the structure
  • nucleoside unit is of the structure
  • nucleotide unit e.g., Nu M , Nu O , etc., is of the structure
  • L P is a natural phosphate linkage
  • L s is —C(R 5s ) 2 — as described in the present disclosure.
  • L s is —C(R 5s ) 2 —
  • R 1s , R 2s , R 3s , R 4s and R 5s is independently as described in the present disclosure.
  • R 1s , R 2s , R 3s , R 4s and R 5s is independently as described in the present disclosure.
  • R 2s is as described in the present disclosure. In some embodiments,
  • R 2s is not —OH.
  • R 2s and R 4s are R, and the two R groups are taken together with their intervening atoms to form an optionally substituted ring.
  • Ring A is optionally substituted
  • each of R 1s , R 2s , R 3s , R 4s , and R 5s is independently R s , wherein R s is as described in the present disclosure.
  • R 1s is R s wherein R s is as described in the present disclosure. In some embodiments, R 1s is at 1′-position (BA is at 1′-position). In some embodiments, R 1s is —H. In some embodiments, R 1s is —F. In some embodiments, R 1s is —Cl. In some embodiments, R 1s is —Br. In some embodiments, R 1s is —I. In some embodiments, R 1s is —CN. In some embodiments, R 1s is —N 3 . In some embodiments, R 1s is —NO. In some embodiments, R 1s is —NO 2 . In some embodiments, R 1s is -L-R′.
  • R 1s is —R′. In some embodiments, R 1s is -L-OR′. In some embodiments, R 1s is —OR′. In some embodiments, R 1s is -L-SR′. In some embodiments, R 1s is —SR′. In some embodiments, R 1s is L-L-N(R′) 2 . In some embodiments, R 1s is —N(R′) 2 . In some embodiments, R 1s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic. In some embodiments, R 1s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 1s is —OMe.
  • R 1s is -MOE. In some embodiments, R 1s is hydrogen. In some embodiments, R s at one 1′-position is hydrogen, and R s at the other 1′-position is not hydrogen as described herein. In some embodiments, R s at both 1′-positions are hydrogen. In some embodiments, R s at one 1′-position is hydrogen, and the other 1′-position is connected to an internucleotidic linkage. In some embodiments, R 1s is —F. In some embodiments, R 1s is —Cl. In some embodiments, R 1s is —Br. In some embodiments, R 1s is —I. In some embodiments, R 1s is —CN.
  • R 1s is —N 3 . In some embodiments, R 1s is —NO. In some embodiments, R 1s is —NO 2 . In some embodiments, R 1s is -L-R′. In some embodiments, R 1s is —R′. In some embodiments, R 1s is -L-OR′. In some embodiments, R 1 s is —OR′. In some embodiments, R 1s is -L-SR′. In some embodiments, R 1s is —SR′. In some embodiments, R 1s is -L-N(R′) 2 . In some embodiments, R 1s is —N(R′) 2 .
  • R 1s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic. In some embodiments, R 1s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 1s is —OH. In some embodiments, R 1 s is —OMe. In some embodiments, R 1s is -MOE. In some embodiments, R 1s is hydrogen. In some embodiments, one R 1s at a 1′-position is hydrogen, and the other R 1s at the other 1′-position is not hydrogen as described herein. In some embodiments, R 1s at both 1′-positions are hydrogen.
  • R 1s is —O-L s -OR′. In some embodiments, R 1s is —O-L s -OR′, wherein L s is optionally substituted C 1-6 alkylene, and R′ is optionally substituted C 1-6 aliphatic. In some embodiments, R 1s is —O-(optionally substituted C 1-6 alkylene)-OR′. In some embodiments, R 1s is —O-(optionally substituted C 1-6 alkylene)-OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 1s is —OCH 2 CH 2 OMe.
  • R 2s is R s wherein R s is as described in the present disclosure. In some embodiments, if there are two R 2s at the 2′-position, one R 2s is —H and the other is not. In some embodiments, R 2s is at 2′-position (BA is at 1′-position). In some embodiments, R 2s is —H. In some embodiments, R 2s is —F. In some embodiments, R 2s is —Cl. In some embodiments, R 2s is —Br. In some embodiments, R 2s is —I. In some embodiments, R 2s is —CN. In some embodiments, R 2s is —N 3 . In some embodiments, R 2s is —NO.
  • R 2s is —NO 2 . In some embodiments, R 2s is -L-R′. In some embodiments, R 2s is —R′. In some embodiments, R 2s is -L-OR′. In some embodiments, R 2s is —OR′. In some embodiments, R 2s is -L-SR′. In some embodiments, R 2s is —SR′. In some embodiments, R 2s is L-L-N(R′) 2 . In some embodiments, R 2s is —N(R′) 2 . In some embodiments, R 2s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic.
  • R 2s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 2s is —OMe. In some embodiments, R 2s is -MOE. In some embodiments, R 2s is hydrogen. In some embodiments, R s at one 2′-position is hydrogen, and R s at the other 2′-position is not hydrogen as described herein. In some embodiments, R s at both 2′-positions are hydrogen. In some embodiments, R s at one 2′-position is hydrogen, and the other 2′-position is connected to an internucleotidic linkage. In some embodiments, R 2s is —F. In some embodiments, R 2s is —Cl.
  • R 2s is —Br. In some embodiments, R 2s is —I. In some embodiments, R 2s is —CN. In some embodiments, R 2s is —N 3 . In some embodiments, R 2s is —NO. In some embodiments, R 2s is —NO 2 . In some embodiments, R 2s is -L-R′. In some embodiments, R 2s is —R′. In some embodiments, R 2s is -L-OR′. In some embodiments, R 2s is —OR′. In some embodiments, R 2s is -L-SR′. In some embodiments, R 2s is —SR′.
  • R 2s is -L-N(R′) 2 . In some embodiments, R 2s is —N(R′) 2 . In some embodiments, R 2s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic. In some embodiments, R 2s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 2s is —OH. In some embodiments, R 2s is —OMe. In some embodiments, R 2s is -MOE. In some embodiments, R 2s is hydrogen.
  • one R 2s at a 2′-position is hydrogen, and the other R 2s at the other 2′-position is not hydrogen as described herein.
  • R 2s at both 2′-positions are hydrogen.
  • R 2s is —O-L-OR′.
  • R 2s is —O-L-OR′, wherein L s is optionally substituted C 1-6 alkylene, and R′ is optionally substituted C 1-6 aliphatic.
  • R 2s is —O-(optionally substituted C 1-6 alkylene)-OR′.
  • R 2s is —O-(optionally substituted C 1-6 alkylene)-OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 2s is —OCH 2 CH 2 OMe.
  • R 3s is R s wherein R s is as described in the present disclosure. In some embodiments, R 3s is at 3′-position (BA is at 1′-position). In some embodiments, R 3s is —H. In some embodiments, R 3 is —F. In some embodiments, R 3s is —Cl. In some embodiments, R 3s is —Br. In some embodiments, R 3s is —I. In some embodiments, R 3s is —CN. In some embodiments, R 3s is —N 3 . In some embodiments, R 3s is —NO. In some embodiments, R 3s is —NO 2 . In some embodiments, R 3s is -L-R′.
  • R s is —R′. In some embodiments, R 3s is -L-OR′. In some embodiments, R 3s is —OR′. In some embodiments, R 3s is -L-SR′. In some embodiments, R 3s is —SR′. In some embodiments, R 3s is -L-N(R′) 2 . In some embodiments, R 3s is —N(R′) 2 . In some embodiments, R 3s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic. In some embodiments, R 3s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 3s is —OMe.
  • R 3s is -MOE. In some embodiments, R 3s is hydrogen. In some embodiments, R s at one 3′-position is hydrogen, and R s at the other 3′-position is not hydrogen as described herein. In some embodiments, R s at both 3′-positions are hydrogen. In some embodiments, R s at one 3′-position is hydrogen, and the other 3′-position is connected to an internucleotidic linkage. In some embodiments, R s is —F. In some embodiments, R 3s is —Cl. In some embodiments, R 3s is —Br. In some embodiments, R 3s is —I. In some embodiments, R 3s is —CN.
  • R 3s is —N 3 . In some embodiments, R 3s is —NO. In some embodiments, R 3s is —NO 2 . In some embodiments, R 3s is -L-R′. In some embodiments, R 3s is —R′. In some embodiments, R 3s is -L-OR′. In some embodiments, R 3s is —OR′. In some embodiments, R s is -L-SR′. In some embodiments, R 3s is —SR′. In some embodiments, R 3s is L-L-N(R′) 2 . In some embodiments, R 3s is —N(R′) 2 .
  • R 3s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic. In some embodiments, R 3s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 3s is —OH. In some embodiments, R 3s is —OMe. In some embodiments, R 3s is -MOE. In some embodiments, R 3s is hydrogen.
  • R 4s is R s wherein R s is as described in the present disclosure. In some embodiments, R 4s is at 4′-position (BA is at 1′-position). In some embodiments, R 4s is —H. In some embodiments, R 4s is —F. In some embodiments, R 4s is —Cl. In some embodiments, R 4s is —Br. In some embodiments, R 4s is —I. In some embodiments, R 4s is —CN. In some embodiments, R 4s is —N 3 . In some embodiments, R 4s is —NO. In some embodiments, R 4s is —NO 2 . In some embodiments, R 4s is -L-R′.
  • R 4s is —R′. In some embodiments, R 4s is -L-OR′. In some embodiments, R 4s is —OR′. In some embodiments, R 4s is -L-SR′. In some embodiments, R 4s is —SR′. In some embodiments, R 4s is -L-N(R′) 2 . In some embodiments, R 4s is —N(R′) 2 . In some embodiments, R 4s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic. In some embodiments, R 4s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 4s is —OMe.
  • R 4s is -MOE. In some embodiments, R 4s is hydrogen. In some embodiments, R s at one 4′-position is hydrogen, and R s at the other 4′-position is not hydrogen as described herein. In some embodiments, R s at both 4′-positions are hydrogen. In some embodiments, R s at one 4′-position is hydrogen, and the other 4′-position is connected to an internucleotidic linkage. In some embodiments, R 4 is —F. In some embodiments, R 4s is —Cl. In some embodiments, R 4s is —Br. In some embodiments, R 4s is —I. In some embodiments, R 4s is —CN.
  • R 4s is —N 3 . In some embodiments, R 4s is —NO. In some embodiments, R 4s is —NO 2 . In some embodiments, R 4s is -L-R′. In some embodiments, R 4s is —R′. In some embodiments, R 4s is -L-OR′. In some embodiments, R 4s is —OR′. In some embodiments, R 4s is -L-SR′. In some embodiments, R 4s is —SR′. In some embodiments, R 4s is L-L-N(R′) 2 . In some embodiments, R 4s is —N(R′) 2 .
  • R 4s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic. In some embodiments, R 4s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 4s is —OH. In some embodiments, R 4s is —OMe. In some embodiments, R 4s is -MOE. In some embodiments, R 4s is hydrogen.
  • R 5s is R s wherein R s is as described in the present disclosure. In some embodiments, R 5s is R′ wherein R′ is as described in the present disclosure. In some embodiments, R 5s is —H. In some embodiments, two or more R 5s are connected to the same carbon atom, and at least one is not —H. In some embodiments, R 5s is not —H. In some embodiments, R 5s is —F. In some embodiments, R 5s is —Cl. In some embodiments, R 5s is —Br. In some embodiments, R 5s is —I. In some embodiments, R 5s is —CN. In some embodiments, R 5s is —N 3 .
  • R 5s is —NO. In some embodiments, R 5s is —NO 2 . In some embodiments, R 5s is -L-R′. In some embodiments, R 5s is —R′. In some embodiments, R 5s is -L-OR′. In some embodiments, R 5s is —OR′. In some embodiments, R 5s is -L-SR′. In some embodiments, R 5s is —SR′. In some embodiments, R 5s is L-L-N(R′) 2 . In some embodiments, R 5s is —N(R′) 2 . In some embodiments, R 5s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic.
  • R 5s is —OR′, wherein R′ is optionally substituted C 1-6 alkyl. In some embodiments, R 5s is —OH. In some embodiments, R 5s is —OMe. In some embodiments, R 5s is -MOE. In some embodiments, R 5s is hydrogen.
  • R 5s is optionally substituted C 1-6 aliphatic as described in the present disclosure, e.g., C 1-6 aliphatic embodiments described for R or other variables. In some embodiments, R 5s is optionally substituted C 1-6 alkyl. In some embodiments, R 5s is methyl. In some embodiments, R 5s is ethyl.
  • R 5s is a protected hydroxyl group suitable for oligonucleotide synthesis.
  • R 5s is —OR′, wherein R′ is optionally substituted C 1-6 aliphatic.
  • R 5s is DMTrO-.
  • Example protecting groups are widely known for use in accordance with the present disclosure. For additional examples, see Greene, T. W.; Wuts, P. G. M.
  • R 1s , R 2s , R 3s , R 4s , and R 5s are R and can be taken together with intervening atom(s) to form a ring as described in the present disclosure.
  • R 2s and R 4s are R taken together to form a ring, and a sugar moiety can be a bicyclic sugar moiety, e.g., a LNA sugar moiety.
  • L s is —C(R 5s ) 2 —, wherein each R 5s is independently as described in the present disclosure. In some embodiments, one of R 5s is H and the other is not H. In some embodiments, none of R 5s is H. In some embodiments, L is —CHR′—, wherein each R 5s is independently as described in the present disclosure. In some embodiments, —C(R 5s ) 2 — is 5′-C, optionally substituted, of a sugar moiety. In some embodiments, the C of —C(R 5s ) 2 — is connected to linkage phosphorus and a sugar wing moiety.
  • the C of —C(R 5s ) 2 — is of R configuration. In some embodiments, the C of —C(R 5s ) 2 — is of S configuration. As described in the present disclosure, in some embodiments, R 5s is optionally substituted C 1-6 aliphatic; in some embodiments, R 5s is methyl.
  • provided compounds comprise one or more bivalent or multivalent optionally substituted rings, e.g., Ring A, Cy L , those formed by two or more R groups (R and (combinations of) variables that can be R) taken together, etc.
  • a ring is a cycloaliphatic, aryl, heteroaryl, or heterocyclyl group as described for R but bivalent or multivalent.
  • ring moieties described for one variable, e.g., Ring A can also be applicable to other variables, e.g., Cy L , if requirements of the other variables, e.g., number of heteroatoms, valence, etc., are satisfied.
  • Example rings are extensively described in the present disclosure.
  • a ring e.g., in Ring A, R, etc. which is optionally substituted, is a 3-20 membered monocyclic, bicyclic or polycyclic ring having 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • a ring can be of any size within its range, e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-membered.
  • a ring is monocyclic. In some embodiments, a ring is saturated and monocyclic. In some embodiments, a ring is monocyclic and partially saturated. In some embodiments, a ring is monocyclic and aromatic.
  • a ring is bicyclic. In some embodiments, a ring is polycyclic. In some embodiments, a bicyclic or polycyclic ring comprises two or more monocyclic ring moieties, each of which can be saturated, partially saturated, or aromatic, and each which can contain no or 1-10 heteroatoms. In some embodiments, a bicyclic or polycyclic ring comprises a saturated monocyclic ring. In some embodiments, a bicyclic or polycyclic ring comprises a saturated monocyclic ring containing no heteroatoms. In some embodiments, a bicyclic or polycyclic ring comprises a saturated monocyclic ring comprising one or more heteroatoms.
  • a bicyclic or polycyclic ring comprises a partially saturated monocyclic ring. In some embodiments, a bicyclic or polycyclic ring comprises a partially saturated monocyclic ring containing no heteroatoms. In some embodiments, a bicyclic or polycyclic ring comprises a partially saturated monocyclic ring comprising one or more heteroatoms. In some embodiments, a bicyclic or polycyclic ring comprises an aromatic monocyclic ring. In some embodiments, a bicyclic or polycyclic ring comprises an aromatic monocyclic ring containing no heteroatoms. In some embodiments, a bicyclic or polycyclic ring comprises an aromatic monocyclic ring comprising one or more heteroatoms.
  • a bicyclic or polycyclic ring comprises a saturated ring and a partially saturated ring, each of which independently contains one or more heteroatoms.
  • a bicyclic ring comprises a saturated ring and a partially saturated ring, each of which independently comprises no, or one or more heteroatoms.
  • a bicyclic ring comprises an aromatic ring and a partially saturated ring, each of which independently comprises no, or one or more heteroatoms.
  • a polycyclic ring comprises a saturated ring and a partially saturated ring, each of which independently comprises no, or one or more heteroatoms.
  • a polycyclic ring comprises an aromatic ring and a partially saturated ring, each of which independently comprises no, or one or more heteroatoms. In some embodiments, a polycyclic ring comprises an aromatic ring and a saturated ring, each of which independently comprises no, or one or more heteroatoms. In some embodiments, a polycyclic ring comprises an aromatic ring, a saturated ring, and a partially saturated ring, each of which independently comprises no, or one or more heteroatoms. In some embodiments, a ring comprises at least one heteroatom. In some embodiments, a ring comprises at least one nitrogen atom. In some embodiments, a ring comprises at least one oxygen atom. In some embodiments, a ring comprises at least one sulfur atom.
  • a ring is typically optionally substituted.
  • a ring is unsubstituted.
  • a ring is substituted.
  • a ring is substituted on one or more of its carbon atoms.
  • a ring is substituted on one or more of its heteroatoms.
  • a ring is substituted on one or more of its carbon atoms, and one or more of its heteroatoms.
  • two or more substituents can be located on the same ring atom.
  • all available ring atoms are substituted.
  • not all available ring atoms are substituted.
  • in provided structures where rings are indicated to be connected to other structures (e.g., Ring A in
  • a ring is a bivalent or multivalent C 3-30 cycloaliphatic ring. In some embodiments, a ring is a bivalent or multivalent C 3-20 cycloaliphatic ring. In some embodiments, a ring is a bivalent or multivalent C 3-10 cycloaliphatic ring. In some embodiments, a ring is a bivalent or multivalent 3-30 membered saturated or partially unsaturated carbocyclic ring. In some embodiments, a ring is a bivalent or multivalent 3-7 membered saturated or partially unsaturated carbocyclic ring. In some embodiments, a ring is a bivalent or multivalent 3-membered saturated or partially unsaturated carbocyclic ring.
  • a ring is a bivalent or multivalent 4-membered saturated or partially unsaturated carbocyclic ring. In some embodiments, a ring is a bivalent or multivalent 5-membered saturated or partially unsaturated carbocyclic ring. In some embodiments, a ring is a bivalent or multivalent 6-membered saturated or partially unsaturated carbocyclic ring. In some embodiments, a ring is a bivalent or multivalent 7-membered saturated or partially unsaturated carbocyclic ring. In some embodiments, a ring is a bivalent or multivalent cyclohexyl ring. In some embodiments, a ring is a bivalent or multivalent cyclopentyl ring. In some embodiments, a ring is a bivalent or multivalent cyclobutyl ring. In some embodiments, a ring is a bivalent or multivalent cyclopropyl ring.
  • a ring is a bivalent or multivalent C 6-30 aryl ring. In some embodiments, a ring is a bivalent or multivalent phenyl ring.
  • a ring is a bivalent or multivalent 8-10 membered bicyclic saturated, partially unsaturated or aryl ring. In some embodiments, a ring is a bivalent or multivalent 8-10 membered bicyclic saturated ring. In some embodiments, a ring is a bivalent or multivalent 8-10 membered bicyclic partially unsaturated ring. In some embodiments, a ring is a bivalent or multivalent 8-10 membered bicyclic aryl ring. In some embodiments, a ring is a bivalent or multivalent naphthyl ring.
  • a ring is a bivalent or multivalent 5-30 membered heteroaryl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, a ring is a bivalent or multivalent 5-30 membered heteroaryl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, a ring is a bivalent or multivalent 5-30 membered heteroaryl ring having 1-5 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, a ring is a bivalent or multivalent 5-30 membered heteroaryl ring having 1-5 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
  • a ring is a bivalent or multivalent 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, a ring is a bivalent or multivalent 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, and oxygen.
  • a ring is a bivalent or multivalent 5-membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen or sulfur. In some embodiments, a ring is a bivalent or multivalent 6-membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 8-10 membered bicyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 5,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 5,6-fused heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 6,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 3-30 membered heterocyclic ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • a ring is a bivalent or multivalent 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 5-7 membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 5-6 membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 5-membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 6-membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 7-membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 3-membered heterocyclic ring having one heteroatom selected from nitrogen, oxygen or sulfur.
  • a ring is a bivalent or multivalent 4-membered heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, a ring is a bivalent or multivalent 5-membered heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, a ring is a bivalent or multivalent 6-membered heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, a ring is a bivalent or multivalent 7-membered heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, a ring is a bivalent or multivalent 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring is a bivalent or multivalent 5,6-fused heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, a ring is a bivalent or multivalent 6,6-fused heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • a ring formed by two or more groups taken together is a monocyclic saturated 5-7 membered ring having no additional heteroatoms in addition to intervening heteroatoms, if any.
  • a ring formed by two or more groups taken together is a monocyclic saturated 5-membered ring having no additional heteroatoms in addition to intervening heteroatoms, if any.
  • a ring formed by two or more groups taken together is a monocyclic saturated 6-membered ring having no additional heteroatoms in addition to intervening heteroatoms, if any.
  • a ring formed by two or more groups taken together is a monocyclic saturated 7-membered ring having no additional heteroatoms in addition to intervening heteroatoms, if any.
  • a ring formed by two or more groups taken together is a bicyclic, saturated, partially unsaturated, or aryl 5-30 membered ring having, in addition to the intervening heteroatoms, if any, 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • a ring formed by two or more groups taken together is a bicyclic, saturated, partially unsaturated, or aryl 5-30 membered ring having, in addition to the intervening heteroatoms, if any, 0-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
  • a ring formed by two or more groups taken together is a bicyclic and saturated 8-10 membered bicyclic ring having no additional heteroatoms in addition to intervening heteroatoms, if any. In some embodiments, a ring formed by two or more groups taken together is a bicyclic and saturated 8-membered bicyclic ring having no additional heteroatoms in addition to intervening heteroatoms, if any. In some embodiments, a ring formed by two or more groups taken together is a bicyclic and saturated 9-membered bicyclic ring having no additional heteroatoms in addition to intervening heteroatoms, if any.
  • a ring formed by two or more groups taken together is a bicyclic and saturated 10-membered bicyclic ring having no additional heteroatoms in addition to intervening heteroatoms, if any.
  • a ring formed by two or more groups taken together is bicyclic and comprises a 5-membered ring fused to a 5-membered ring.
  • a ring formed by two or more groups taken together is bicyclic and comprises a 5-membered ring fused to a 6-membered ring.
  • the 5-membered ring comprises one or more intervening nitrogen, phosphorus and oxygen atoms as ring atoms.
  • a ring formed by two or more groups taken together comprises a ring system having the backbone structure of
  • a ring formed by two or more groups taken together is a polycyclic, saturated, partially unsaturated, or aryl 3-30 membered ring having, in addition to the intervening heteroatoms, if any, 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • a ring formed by two or more groups taken together is a polycyclic, saturated, partially unsaturated, or aryl 3-30 membered ring having, in addition to the intervening heteroatoms, if any, 0-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 5-10 membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms. In some embodiments, a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 5-9 membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 5-8 membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms. In some embodiments, a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 5-7 membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 5-6 membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 5-membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 6-membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 7-membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms. In some embodiments, a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 8-membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 9-membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms. In some embodiments, a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 10-membered monocyclic ring whose ring atoms comprise one or more intervening nitrogen, phosphorus and/or oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 5-membered ring whose ring atoms consist of carbon atoms and the intervening nitrogen, phosphorus and oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 6-membered ring whose ring atoms consist of carbon atoms and the intervening nitrogen, phosphorus and oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 7-membered ring whose ring atoms consist of carbon atoms and the intervening nitrogen, phosphorus and oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 8-membered ring whose ring atoms consist of carbon atoms and the intervening nitrogen, phosphorus and oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 9-membered ring whose ring atoms consist of carbon atoms and the intervening nitrogen, phosphorus and oxygen atoms.
  • a ring formed by two or more groups taken together is monocyclic, bicyclic or polycyclic and comprises a 10-membered ring whose ring atoms consist of carbon atoms and the intervening nitrogen, phosphorus and oxygen atoms.
  • rings described herein are unsubstituted. In some embodiments, rings described herein are substituted. In some embodiments, substituents are selected from those described in example compounds provided in the present disclosure.
  • each L P is independently an internucleotidic linkage as described in the present disclosure, e.g., a natural phosphate linkage, a phosphorothioate diester linkage, a modified internucleotidic linkage, a chiral internucleotidic linkage, etc.,
  • each L P is independently a linkage having the structure of formula IIn some embodiments, L 3E is -L s - or -L s -L s -. In some embodiments, L 3E is -L s -. In some embodiments, L 3E is -L s -L s -. In some embodiments, L 3E is a covalent bond.
  • L 3E is a linker used in oligonucleotide synthesis. In some embodiments, L 3E is a linker used in solid phase oligonucleotide synthesis. Various types of linkers are known and can be utilized in accordance with the present disclosure. In some embodiments, a linker is a succinate linker (—O—C(O)—CH 2 —CH 2 —C(O)—). In some embodiments, a linker is an oxalyl linker (—O—C(O)—C(O)—). In some embodiments, L 3E is a succinyl-piperidine linker (SP) linker. In some embodiments, L 3E is a succinyl linker. In some embodiments, L 3E is a Q-linker.
  • SP succinyl-piperidine linker
  • R 3E is —R′, -L s -R′, —OR′, or a solid support. In some embodiments, R 3E is —R′. In some embodiments, R 3E is -L s -R′. In some embodiments, R 3E is —OR′. In some embodiments, R 3E is a solid support. In some embodiments, R 3E is —H. In some embodiments, -L-R 3E is —H. In some embodiments, R 3E is —OH. In some embodiments, -L-R 3E is —OH. In some embodiments, R 3E is optionally substituted C 1-6 aliphatic.
  • R 3E is optionally substituted C 1-6 alkyl. In some embodiments, R 3E is —OR′. In some embodiments, R 3E is —OH. In some embodiments, R 3E is —OR′, wherein R′ is not hydrogen. In some embodiments, R 3E is —OR′, wherein R′ is optionally substituted C 1-6 alkyl.
  • R 3E is a 3′-end cap (e.g., those used in RNAi technologies).
  • R 3E is a solid support. In some embodiments, R 3E is a solid support for oligonucleotide synthesis. Various types of solid support are known and can be utilized in accordance with the present disclosure. In some embodiments, a solid support is HCP. In some embodiments, a solid support is CPG.
  • R′ is —R, —C(O)R, —C(O)OR, or —S(O) 2 R, wherein R is as described in the present disclosure.
  • R′ is R, wherein R is as described in the present disclosure.
  • R′ is —C(O)R, wherein R is as described in the present disclosure.
  • R′ is —C(O)OR, wherein R is as described in the present disclosure.
  • R′ is —S(O) 2 R, wherein R is as described in the present disclosure.
  • R′ is hydrogen. In some embodiments, R′ is not hydrogen.
  • R′ is R, wherein R is optionally substituted C 1-20 aliphatic as described in the present disclosure. In some embodiments, R′ is R, wherein R is optionally substituted C 1-20 heteroaliphatic as described in the present disclosure. In some embodiments, R′ is R, wherein R is optionally substituted C 6-20 aryl as described in the present disclosure. In some embodiments, R′ is R, wherein R is optionally substituted C 6-20 arylaliphatic as described in the present disclosure. In some embodiments, R′ is R, wherein R is optionally substituted C 6-20 arylheteroaliphatic as described in the present disclosure.
  • R′ is R, wherein R is optionally substituted 5-20 membered heteroaryl as described in the present disclosure. In some embodiments, R′ is R, wherein R is optionally substituted 3-20 membered heterocyclyl as described in the present disclosure. In some embodiments, two or more R′ are R, and are optionally and independently taken together to form an optionally substituted ring as described in the present disclosure.
  • each R is independently —H, or an optionally substituted group selected from C 1-30 aliphatic, C 1-30 heteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, C 6-30 aryl, C 6-30 arylaliphatic, C 6-30 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, 5-30 membered heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, and 3-30 membered heterocyclyl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, or
  • each R is independently —H, or an optionally substituted group selected from C 1-30 aliphatic, C 1-30 heteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, C 6-30 aryl, C 6-30 arylaliphatic, C 6-30 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, 5-30 membered heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, and 3-30 membered heterocyclyl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, or
  • each R is independently —H, or an optionally substituted group selected from C 1-20 aliphatic, C 1-20 heteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, C 6-20 aryl, C 6-20 arylaliphatic, C 6-20 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, 5-20 membered heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, and 3-20 membered heterocyclyl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, or
  • each R is independently —H, or an optionally substituted group selected from C 1-30 aliphatic, C 1-30 heteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, C 6-30 aryl, C 6-30 arylaliphatic, C 6-30 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, 5-30 membered heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, and 3-30 membered heterocyclyl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • each R is independently —H, or an optionally substituted group selected from C 1-20 aliphatic, C 1-20 heteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, C 6-20 aryl, C 6-20 arylaliphatic, C 6-20 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, 5-20 membered heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, and 3-20 membered heterocyclyl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • R is hydrogen. In some embodiments, R is not hydrogen. In some embodiments, R is an optionally substituted group selected from C 1-30 aliphatic, C 1-30 heteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, C 6-30 aryl, a 5-30 membered heteroaryl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, and a 3-30 membered heterocyclic ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • R is hydrogen or an optionally substituted group selected from C 1-20 aliphatic, phenyl, a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted C 1-30 aliphatic. In some embodiments, R is optionally substituted C 1-20 aliphatic. In some embodiments, R is optionally substituted C 1-15 aliphatic. In some embodiments, R is optionally substituted C 1-10 aliphatic. In some embodiments, R is optionally substituted C 1-6 aliphatic. In some embodiments, R is optionally substituted C 1-6 alkyl. In some embodiments, R is optionally substituted hexyl, pentyl, butyl, propyl, ethyl or methyl. In some embodiments, R is optionally substituted hexyl. In some embodiments, R is optionally substituted pentyl.
  • R is optionally substituted butyl. In some embodiments, R is optionally substituted propyl. In some embodiments, R is optionally substituted ethyl. In some embodiments, R is optionally substituted methyl. In some embodiments, R is hexyl. In some embodiments, R is pentyl. In some embodiments, R is butyl. In some embodiments, R is propyl. In some embodiments, R is ethyl. In some embodiments, R is methyl. In some embodiments, R is isopropyl. In some embodiments, R is n-propyl. In some embodiments, R is tert-butyl. In some embodiments, R is sec-butyl. In some embodiments, R is n-butyl. In some embodiments, R is —(CH 2 ) 2 CN.
  • R is optionally substituted C 3-30 cycloaliphatic. In some embodiments, R is optionally substituted C 3-20 cycloaliphatic. In some embodiments, R is optionally substituted C 3-10 cycloaliphatic. In some embodiments, R is optionally substituted cyclohexyl. In some embodiments, R is cyclohexyl. In some embodiments, R is optionally substituted cyclopentyl. In some embodiments, R is cyclopentyl. In some embodiments, R is optionally substituted cyclobutyl. In some embodiments, R is cyclobutyl. In some embodiments, R is optionally substituted cyclopropyl. In some embodiments, R is cyclopropyl.
  • R is an optionally substituted 3-30 membered saturated or partially unsaturated carbocyclic ring. In some embodiments, R is an optionally substituted 3-7 membered saturated or partially unsaturated carbocyclic ring. In some embodiments, R is an optionally substituted 3-membered saturated or partially unsaturated carbocyclic ring. In some embodiments, R is an optionally substituted 4-membered saturated or partially unsaturated carbocyclic ring. In some embodiments, R is an optionally substituted 5-membered saturated or partially unsaturated carbocyclic ring. In some embodiments, R is an optionally substituted 6-membered saturated or partially unsaturated carbocyclic ring.
  • R is an optionally substituted 7-membered saturated or partially unsaturated carbocyclic ring. In some embodiments, R is optionally substituted cycloheptyl. In some embodiments, R is cycloheptyl. In some embodiments, R is optionally substituted cyclohexyl. In some embodiments, R is cyclohexyl. In some embodiments, R is optionally substituted cyclopentyl. In some embodiments, R is cyclopentyl. In some embodiments, R is optionally substituted cyclobutyl. In some embodiments, R is cyclobutyl. In some embodiments, R is optionally substituted cyclopropyl. In some embodiments, R is cyclopropyl.
  • R when R is or comprises a ring structure, e.g., cycloaliphatic, cycloheteroaliphatic, aryl, heteroaryl, etc., the ring structure can be monocyclic, bicyclic or polycyclic. In some embodiments, R is or comprises a monocyclic structure. In some embodiments, R is or comprises a bicyclic structure. In some embodiments, R is or comprises a polycyclic structure.
  • R is optionally substituted C 1-30 heteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, R is optionally substituted C 1-20 heteroaliphatic having 1-10 heteroatoms. In some embodiments, R is optionally substituted C 1-20 heteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus or silicon, optionally including one or more oxidized forms of nitrogen, sulfur, phosphorus or selenium. In some embodiments, R is optionally substituted C 1-30 heteroaliphatic comprising 1-10 groups independently selected from
  • R is optionally substituted C 6-30 aryl. In some embodiments, R is optionally substituted phenyl. In some embodiments, R is phenyl. In some embodiments, R is substituted phenyl.
  • R is an optionally substituted 8-10 membered bicyclic saturated, partially unsaturated or aryl ring. In some embodiments, R is an optionally substituted 8-10 membered bicyclic saturated ring. In some embodiments, R is an optionally substituted 8-10 membered bicyclic partially unsaturated ring. In some embodiments, R is an optionally substituted 8-10 membered bicyclic aryl ring. In some embodiments, R is optionally substituted naphthyl.
  • R is optionally substituted 5-30 membered heteroaryl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, R is optionally substituted 5-30 membered heteroaryl ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R is optionally substituted 5-30 membered heteroaryl ring having 1-5 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, R is optionally substituted 5-30 membered heteroaryl ring having 1-5 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
  • R is an optionally substituted 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is a substituted 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, and oxygen.
  • R is a substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, and oxygen.
  • R is an optionally substituted 5-membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen or sulfur. In some embodiments, R is an optionally substituted 6-membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5-membered monocyclic heteroaryl ring having one heteroatom selected from nitrogen, oxygen, and sulfur. In some embodiments, R is selected from optionally substituted pyrrolyl, furanyl, or thienyl.
  • R is an optionally substituted 5-membered heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, R is an optionally substituted 5-membered heteroaryl ring having one nitrogen atom, and an additional heteroatom selected from sulfur or oxygen.
  • Example R groups include but are not limited to optionally substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl or isoxazolyl.
  • R is an optionally substituted 5-membered heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • Example R groups include but are not limited to optionally substituted triazolyl, oxadiazolyl or thiadiazolyl.
  • R is an optionally substituted 5-membered heteroaryl ring having four heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • Example R groups include but are not limited to optionally substituted tetrazolyl, oxatriazolyl and thiatriazolyl.
  • R is an optionally substituted 6-membered heteroaryl ring having 1-4 nitrogen atoms. In some embodiments, R is an optionally substituted 6-membered heteroaryl ring having 1-3 nitrogen atoms. In other embodiments, R is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R is an optionally substituted 6-membered heteroaryl ring having four nitrogen atoms. In some embodiments, R is an optionally substituted 6-membered heteroaryl ring having three nitrogen atoms. In some embodiments, R is an optionally substituted 6-membered heteroaryl ring having two nitrogen atoms.
  • R is an optionally substituted 6-membered heteroaryl ring having one nitrogen atom.
  • Example R groups include but are not limited to optionally substituted pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, or tetrazinyl.
  • R is an optionally substituted 8-10 membered bicyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5,6-fused heteroaryl ring having 1 heteroatom independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted indolyl.
  • R is an optionally substituted azabicyclo[3.2.1]octanyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted azaindolyl.
  • R is an optionally substituted benzimidazolyl.
  • R is an optionally substituted benzothiazolyl.
  • R is an optionally substituted benzoxazolyl.
  • R is an optionally substituted indazolyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having 3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5,6-fused heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5,6-fused heteroaryl ring having four heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having five heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5,6-fused heteroaryl ring having one heteroatom independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is optionally substituted indolyl. In some embodiments, R is optionally substituted benzofuranyl. In some embodiments, R is optionally substituted benzo[b]thienyl. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is optionally substituted azaindolyl. In some embodiments, R is optionally substituted benzimidazolyl. In some embodiments, R is optionally substituted benzothiazolyl.
  • R is optionally substituted benzoxazolyl. In some embodiments, R is an optionally substituted indazolyl. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is optionally substituted oxazolopyridiyl, thiazolopyridinyl or imidazopyridinyl. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having four heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted purinyl, oxazolopyrimidinyl, thiazolopyrimidinyl, oxazolopyrazinyl, thiazolopyrazinyl, imidazopyrazinyl, oxazolopyridazinyl, thiazolopyridazinyl or imidazopyridazinyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having five heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted 1,4-dihydropyrrolo[3,2-b]pyrrolyl, 4H-furo[3,2-b]pyrrolyl, 4H-thieno[3,2-b]pyrrolyl, furo[3,2-b]furanyl, thieno[3,2-b]furanyl, thieno[3,2-b]thienyl, 1H-pyrrolo[1,2-a]imidazolyl, pyrrolo[2,1-b]oxazolyl or pyrrolo[2,1-b]thiazolyl.
  • R is optionally substituted dihydropyrroloimidazolyl, 1H-furoimidazolyl, 1H-thienoimidazolyl, furooxazolyl, furoisoxazolyl, 4H-pyrrolooxazolyl, 4H-pyrroloisoxazolyl, thienooxazolyl, thienoisoxazolyl, 4H-pyrrolothiazolyl, furothiazolyl, thienothiazolyl, 1H-imidazoimidazolyl, imidazooxazolylorimidazo[5,1-b]thiazolyl.
  • R is an optionally substituted 6,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In other embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1 heteroatom independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted quinolinyl. In some embodiments, R is an optionally substituted isoquinolinyl. In some embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is optionally substituted quinazoline or a quinoxaline.
  • R is 3-30 membered heterocyclic ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, R is 3-30 membered heterocyclic ring having 1-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R is 3-30 membered heterocyclic ring having 1-5 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, R is 3-30 membered heterocyclic ring having 1-5 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
  • R is an optionally substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is a substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an unsubstituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, R is an optionally substituted 5-7 membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5-6 membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, R is an optionally substituted 5-membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, R is an optionally substituted 6-membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, R is an optionally substituted 7-membered partially unsaturated monocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted 3-membered heterocyclic ring having one heteroatom selected from nitrogen, oxygen or sulfur.
  • R is optionally substituted 4-membered heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted 5-membered heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted 6-membered heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted 7-membered heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 3-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 4-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 6-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 7-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 4-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is nitrogen.
  • R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is oxygen. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is sulfur. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having 2 oxygen atoms. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having 2 nitrogen atoms. In some embodiments, R is an optionally substituted 4-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is nitrogen. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is oxygen.
  • R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is sulfur. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having 2 oxygen atoms. In some embodiments, R is an optionally substituted 4-membered partially unsaturated heterocyclic ring having 2 nitrogen atoms.
  • R is an optionally substituted 5-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5-membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom. In some embodiments, R is an optionally substituted 5-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is nitrogen.
  • R is an optionally substituted 5-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is oxygen. In some embodiments, R is an optionally substituted 5-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is sulfur. In some embodiments, R is an optionally substituted 5-membered partially unsaturated heterocyclic ring having 2 oxygen atoms. In some embodiments, R is an optionally substituted 5-membered partially unsaturated heterocyclic ring having 2 nitrogen atoms.
  • R is an optionally substituted 6-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom. In some embodiments, R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is nitrogen.
  • R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is oxygen. In some embodiments, R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having no more than 1 heteroatom, wherein the heteroatom is sulfur. In some embodiments, R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having 2 oxygen atoms. In some embodiments, R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having 2 nitrogen atoms.
  • R is a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, oxepaneyl, aziridineyl, azetidineyl, pyrrolidinyl, piperidinyl, azepanyl, thiiranyl, thietanyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, thiepanyl, dioxolanyl, oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl, dithiolanyl, dioxanyl, morpholinyl, oxathianyl, piperazinyl, thiomorph
  • R is an optionally substituted 5-6 membered partially unsaturated monocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, R is an optionally substituted tetrahydropyridinyl, dihydrothiazolyl, dihydrooxazolyl, or oxazolinyl group.
  • R is an optionally substituted 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted indolinyl.
  • R is optionally substituted isoindolinyl.
  • R is optionally substituted 1, 2, 3, 4-tetrahydroquinolinyl.
  • R is optionally substituted 1, 2, 3, 4-tetrahydroisoquinolinyl.
  • R is an optionally substituted azabicyclo[3.2.1]octanyl.
  • R is an optionally substituted 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5,6-fused heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted 1,4-dihydropyrrolo[3,2-b]pyrrolyl, 4H-furo[3,2-b]pyrrolyl, 4H-thieno[3,2-b]pyrrolyl, furo[3,2-b]furanyl, thieno[3,2-b]furanyl, thieno[3,2-b]thienyl, 1H-pyrrolo[1,2-a]imidazolyl, pyrrolo[2,1-b]oxazolyl or pyrrolo[2,1-b]thiazolyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted dihydropyrroloimidazolyl, 1H-furoimidazolyl, 1H-thienoimidazolyl, furooxazolyl, furoisoxazolyl, 4H-pyrrolooxazolyl, 4H-pyrroloisoxazolyl, thienooxazolyl, thienoisoxazolyl, 4H-pyrrolothiazolyl, furothiazolyl, thienothiazolyl, 1H-imidazoimidazolyl, imidazooxazolyl or imidazo[5,1-b]thiazolyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having four heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having five heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 5,6-fused heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In other embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having one heteroatom independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is optionally substituted indolyl. In some embodiments, R is optionally substituted benzofuranyl. In some embodiments, R is optionally substituted benzo[b]thienyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted azaindolyl.
  • R is optionally substituted benzimidazolyl.
  • R is optionally substituted benzothiazolyl.
  • R is optionally substituted benzoxazolyl.
  • R is an optionally substituted indazolyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted oxazolopyridiyl, thiazolopyridinyl or imidazopyridinyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having four heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted purinyl, oxazolopyrimidinyl, thiazolopyrimidinyl, oxazolopyrazinyl, thiazolopyrazinyl, imidazopyrazinyl, oxazolopyridazinyl, thiazolopyridazinyl or imidazopyridazinyl.
  • R is an optionally substituted 5,6-fused heteroaryl ring having five heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is an optionally substituted 6,6-fused heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In other embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having one heteroatom selected from nitrogen, oxygen, and sulfur. In some embodiments, R is optionally substituted quinolinyl. In some embodiments, R is optionally substituted isoquinolinyl. In some embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted quinazolinyl, phthalazinyl, quinoxalinyl or naphthyridinyl.
  • R is an optionally substituted 6,6-fused heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted pyridopyrimidinyl, pyridopyridazinyl, pyridopyrazinyl, or benzotriazinyl.
  • R is an optionally substituted 6,6-fused heteroaryl ring having four heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted pyridotriazinyl, pteridinyl, pyrazinopyrazinyl, pyrazinopyridazinyl, pyridazinopyridazinyl, pyrimidopyridazinyl or pyrimidopyrimidinyl.
  • R is an optionally substituted 6,6-fused heteroaryl ring having five heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • R is optionally substituted C 6-30 arylaliphatic. In some embodiments, R is optionally substituted C 6-20 arylaliphatic. In some embodiments, R is optionally substituted C 6-10 arylaliphatic. In some embodiments, an aryl moiety of the arylaliphatic has 6, 10, or 14 aryl carbon atoms. In some embodiments, an aryl moiety of the arylaliphatic has 6 aryl carbon atoms. In some embodiments, an aryl moiety of the arylaliphatic has 10 aryl carbon atoms. In some embodiments, an aryl moiety of the arylaliphatic has 14 aryl carbon atoms. In some embodiments, an aryl moiety is optionally substituted phenyl.
  • R is optionally substituted C 6-30 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, R is optionally substituted C 6-30 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R is optionally substituted C 6-20 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, R is optionally substituted C 6-20 arylheteroaliphatic having 1-10 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
  • R is optionally substituted C 6-10 arylheteroaliphatic having 1-5 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon. In some embodiments, R is optionally substituted C 6-10 arylheteroaliphatic having 1-5 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
  • two R groups are optionally and independently taken together to form a covalent bond.
  • —C ⁇ O is formed.
  • —C ⁇ C— is formed.
  • —C ⁇ C— is formed.
  • two or more R groups on the same atom are optionally and independently taken together with the atom to form an optionally substituted, 3-30 membered, monocyclic, bicyclic or polycyclic ring having, in addition to the atom, 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on the same atom are optionally and independently taken together with the atom to form an optionally substituted, 3-20 membered monocyclic, bicyclic or polycyclic ring having, in addition to the atom, 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on the same atom are optionally and independently taken together with the atom to form an optionally substituted, 3-10 membered monocyclic, bicyclic or polycyclic ring having, in addition to the atom, 0-5 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on the same atom are optionally and independently taken together with the atom to form an optionally substituted, 3-6 membered monocyclic, bicyclic or polycyclic ring having, in addition to the atom, 0-3 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on the same atom are optionally and independently taken together with the atom to form an optionally substituted, 3-5 membered monocyclic, bicyclic or polycyclic ring having, in addition to the atom, 0-3 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on two or more atoms are optionally and independently taken together with their intervening atoms to form an optionally substituted, 3-30 membered, monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on two or more atoms are optionally and independently taken together with their intervening atoms to form an optionally substituted, 3-20 membered monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on two or more atoms are optionally and independently taken together with their intervening atoms to form an optionally substituted, 3-10 membered monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on two or more atoms are optionally and independently taken together with their intervening atoms to form an optionally substituted, 3-10 membered monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-5 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on two or more atoms are optionally and independently taken together with their intervening atoms to form an optionally substituted, 3-6 membered monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-3 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • two or more R groups on two or more atoms are optionally and independently taken together with their intervening atoms to form an optionally substituted, 3-5 membered monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-3 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon.
  • heteroatoms in R groups, or in the structures formed by two or more R groups taken together, are selected from oxygen, nitrogen, and sulfur.
  • a formed ring is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-membered.
  • a formed ring is saturated.
  • a formed ring is partially saturated.
  • a formed ring is aromatic.
  • a formed ring comprises a saturated, partially saturated, or aromatic ring moiety.
  • a formed ring comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 aromatic ring atoms.
  • a formed contains no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 aromatic ring atoms.
  • aromatic ring atoms are selected from carbon, nitrogen, oxygen and sulfur.
  • a ring formed by two or more R groups (or two or more groups selected from R and variables that can be R) taken together is a C 3-30 cycloaliphatic, C 6-30 aryl, 5-30 membered heteroaryl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, or 3-30 membered heterocyclyl having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus and silicon, ring as described for R, but bivalent or multivalent.
  • P L is P( ⁇ W). In some embodiments, P L is P. In some embodiments, P L is P ⁇ B(R′) 3 . In some embodiments, P of P L is chiral. In some embodiments, P of P L s Rp. In some embodiments, P of P L is Sp. In some embodiments, a linkage of formula I is a phosphate linkage or a salt form thereof. In some embodiments, a linkage of formula I is a phosphorothioate linkage or a salt form thereof. In some embodiments, P L is P*( ⁇ W), wherein P* is a chiral linkage phosphorus. In some embodiments, P L is P*( ⁇ O), wherein P* is a chiral linkage phosphorus.
  • W is O. In some embodiments, W is S. In some embodiments, W is Se.
  • R 1 is H.
  • —X-L-R 1 is —X—R 1 .
  • —X-L-R 1 is —X—H.
  • Y and Z are O, and X is S.
  • Y and Z are O and X is O. Additional embodiments of each of the variables are independently described in the present disclosure.
  • a provided oligonucleotide has the structure of formula O-I.
  • an oligonucleotide of formula O-I comprise chemical modifications (e.g., sugar modification, base modifications, modified internucleotidic linkages, etc., and patterns thereof), stereochemistry (of 5′-C, chiral phosphorus, etc., and patterns thereof), base sequences, etc., as described in the present disclosure.
  • a provided oligonucleotide of formula O-I is one selected from in Table 1A, Table 17, etc.
  • the present disclosure provides multimers of oligonucleotides.
  • at least one of the monomer is a C9orf72 oligonucleotide.
  • a multimer is a multimer of the same oligonucleotides.
  • a multimer is a multimer of structurally different oligonucleotides.
  • each oligonucleotide of a multimer performs its functions independently through its own pathways, e.g., RNA interference (RNAi), RNase H dependent, etc.
  • provided oligonucleotides exist in an oligomeric or polymeric form, in which one or more oligonucleotide moieties are linked together by linkers, e.g., L, L M , etc., through nucleobases, sugars, and/or internucleotidic linkages of the oligonucleotide moieties.
  • linkers e.g., L, L M , etc.
  • a provided multimer compound has the structure of (A c ) a -L M -(A c ) b , wherein each variable is independently as described in the present disclosure.
  • a provided compound e.g., an oligonucleotide of a provided composition, has the structure of:
  • each A c is independently an oligonucleotide moiety (e.g., [H] a -A c or [H] b -A c is an oligonucleotide); a is 1-1000; b is 1-1000; L M is a multivalent linker; and each R D is independently a chemical moiety.
  • oligonucleotide moiety e.g., [H] a -A c or [H] b -A c is an oligonucleotide
  • a is 1-1000
  • b is 1-1000
  • L M is a multivalent linker
  • each R D is independently a chemical moiety.
  • a provided compound e.g., an oligonucleotide of a provided composition, have the structure of:
  • each A c is independently an oligonucleotide moiety (e.g., [H] a -A c or [H] b -A c is an oligonucleotide);
  • a is 1-1000;
  • b is 1-1000;
  • each R D is independently R LD , R CD or R TD ;
  • a c -[-L M -(R D ) a ] b , [(A c ) a -L M ] b -R D , or (A c ) a -L M -(R D ) b is a conjugate of a provided oligonucleotide with one or more chemical moieties, e.g., targeting moieties, carbohydrate moieties, lipid moieties, etc.
  • (R D ) b -L M - is (R D ) b -L M1 -L M2 as described in the present disclosure.
  • [H] a -A c or [H] b -A c is an oligonucleotide as described in the present disclosure. In some embodiments, [H] a -A c or [H] b -A c is of formula O-I.
  • R D is an additional chemical moiety as described in the present disclosure.
  • R D is a targeting moiety as described in the present disclosure.
  • R D is R TD , which is a targeting moiety as described in the present disclosure (e.g., targeting moiety described as embodiment for R D as targeting moiety).
  • R is R CD , wherein R CD is as described in the present disclosure.
  • R CD comprises one or more carbohydrate moieties.
  • R D is R LD .
  • R LD is a lipid moiety as described in the present disclosure.
  • a is 1-100. In some embodiments, a is 1-50. In some embodiments, a is 1-40. In some embodiments, a is 1-30. In some embodiments, a is 1-20. In some embodiments, a is 1-15. In some embodiments, a is 1-10. In some embodiments, a is 1-9. In some embodiments, a is 1-8. In some embodiments, a is 1-7. In some embodiments, a is 1-6. In some embodiments, a is 1-5. In some embodiments, 1-4. In some embodiments, a is 1-3. In some embodiments, a is 1-2. In some embodiments, a is 1. In some embodiments, a is 2. In some embodiments, a is 3.
  • a is 4. In some embodiments, a is 5. In some embodiments, a is 6. In some embodiments, a is 7. In some embodiments, a is 8. In some embodiments, a is 9. In some embodiments, a is 10. In some embodiments, a is more than 10.
  • b is 1-100. In some embodiments, b is 1-50. In some embodiments, b is 1-40. In some embodiments, b is 1-30. In some embodiments, b is 1-20. In some embodiments, b is 1-15. In some embodiments, b is 1-10. In some embodiments, b is 1-9. In some embodiments, b is 1-8. In some embodiments, b is 1-7. In some embodiments, b is 1-6. In some embodiments, b is 1-5. In some embodiments, b is 1-4. In some embodiments, b is 1-3. In some embodiments, b is 1-2. In some embodiments, b is 1. In some embodiments, b is 2. In some embodiments, b is 3.
  • b is 4. In some embodiments, b is 5. In some embodiments, b is 6. In some embodiments, b is 7. In some embodiments, b is 8. In some embodiments, b is 9. In some embodiments, b is 10. In some embodiments, b is 1. In some embodiments, b is 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more.
  • z is 1-1000. In some embodiments, z+1 is an oligonucleotide length as described in the present disclosure. In some embodiments, z is no less than 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19. In some embodiments, z is no less than 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14. In some embodiments, z is no more than 50, 60, 70, 80, 90, 100, 150, or 200.
  • z is 5-50, 10-50, 14-50, 14-45, 14-40, 14-35, 14-30, 14-25, 14-100, 14-150, 14-200, 14-250, 14-300, 15-50, 15-45, 15-40, 15-35, 15-30, 15-25, 15-100, 15-150, 15-200, 15-250, 15-300, 16-50, 16-45, 16-40, 16-35, 16-30, 16-25, 16-100, 16-150, 16-200, 16-250, 16-300, 17-50, 17-45, 17-40, 17-35, 17-30, 17-25, 17-100, 17-150, 17-200, 17-250, 17-300, 18-50, 18-45, 18-40, 18-35, 18-30, 18-25, 18-100, 18-150, 18-200, 18-250, 18-300, 19-50, 19-45, 19-40, 19-35, 19-30, 19-25, 19-100, 19-150, 19-200, 19-250, or 19-300.
  • z is 10. In some embodiments, z is 11. In some embodiments, z is 12. In some embodiments, z is 13. In some embodiments, z is 14. In some embodiments, z is 15. In some embodiments, z is 16. In some embodiments, z is 17. In some embodiments, z is 18. In some embodiments, z is 19. In some embodiments, z is 20. In some embodiments, z is 21. In some embodiments, z is 22. In some embodiments, z is 23. In some embodiments, z is 24. In some embodiments, z is 25. In some embodiments, z is 26. In some embodiments, z is 27. In some embodiments, z is 28. In some embodiments, z is 29. In some embodiments, z is 30. In some embodiments, z is 31. In some embodiments, z is 32. In some embodiments, z is 33. In some embodiments, z is 34.
  • L M1 is -L M1 -L M2 -L M3 - as described in the present disclosure.
  • L M is L M1 as described in the present disclosure.
  • L M is L M2 as described in the present disclosure.
  • L M is L M3 as described in the present disclosure.
  • At least one L M is directly bound to a sugar unit of a provided oligonucleotide.
  • a L M directly binds to a sugar unit incorporates a lipid moiety into an oligonucleotide.
  • a L M directly binds to a sugar unit incorporates a carbohydrate moiety into an oligonucleotide.
  • a L M directly binds to a sugar unit incorporates a R LD group into an oligonucleotide.
  • a L M directly binds to a sugar unit incorporates a R CD group into an oligonucleotide.
  • L M1 is directed bound through 5′-OH of an oligonucleotide chain. In some embodiments, L M1 is directed bound through 3′-OH of an oligonucleotide chain.
  • At least one L M is directly bound to an internucleotidic linkage unit of a provided oligonucleotide.
  • a L M directly binds to an internucleotidic linkage unit incorporates a lipid moiety into an oligonucleotide.
  • a L M directly binds to an internucleotidic linkage unit incorporates a carbohydrate moiety into an oligonucleotide.
  • a L M directly binds to an internucleotidic linkage unit incorporates a R D group into an oligonucleotide.
  • a L M directly binds to an internucleotidic linkage unit incorporates a R CD group into an oligonucleotide.
  • At least one L M is directly bound to a nucleobase unit of a provided oligonucleotide.
  • a L M directly binds to a nucleobase unit incorporates a lipid moiety into an oligonucleotide.
  • a L M directly binds to a nucleobase unit incorporates a carbohydrate moiety into an oligonucleotide.
  • a L M directly binds to a nucleobase unit incorporates a R L D group into an oligonucleotide.
  • a L M directly binds to a nucleobase unit incorporates a R CD group into an oligonucleotide.
  • L M is bivalent. In some embodiments, L M is multivalent. In some embodiments, L M is
  • L M is directly bond to a nucleobase, for example, as in:
  • L M is N
  • L M is N
  • L M is N
  • L M is N
  • R LD is optionally substituted C 10 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , or C 25 to C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , C 35 , C 40 , C 45 , C 50 , C 60 , C 70 , or C 80 aliphatic.
  • R LD is optionally substituted C 10-80 aliphatic.
  • R LD is optionally substituted C 2-80 aliphatic.
  • R LD is optionally substituted C 10-70 aliphatic. In some embodiments, R LD is optionally substituted C 20-70 aliphatic. In some embodiments, R LD is optionally substituted C 10-60 aliphatic. In some embodiments, R LD is optionally substituted C 20-60 aliphatic. In some embodiments, R LD is optionally substituted C 10-50 aliphatic. In some embodiments, R LD is optionally substituted C 20-50 aliphatic. In some embodiments, R LD is optionally substituted C 10-40 aliphatic. In some embodiments, R LD is optionally substituted C 20-40 aliphatic. In some embodiments, R LD is optionally substituted C 10-30 aliphatic.
  • R LD is optionally substituted C 20-30 aliphatic.
  • R LD is unsubstituted C 10 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , or C 25 to C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , C 35 , C 40 , C 45 , C 50 , C 60 , C 70 , or C 80 aliphatic.
  • R LD is unsubstituted C 10-80 aliphatic.
  • R LD is unsubstituted C 20-80 aliphatic. In some embodiments, R LD is unsubstituted C 10-70 aliphatic. In some embodiments, R LD is unsubstituted C 20-70 aliphatic. In some embodiments, R L D is unsubstituted C 10-60 aliphatic. In some embodiments, R LD is unsubstituted C 20-60 aliphatic. In some embodiments, R LD is unsubstituted C 10-50 aliphatic. In some embodiments, R LD is unsubstituted C 20-50 aliphatic. In some embodiments, R LD is unsubstituted C 10-40 aliphatic.
  • R L D is unsubstituted C 20-40 aliphatic. In some embodiments, R LD is unsubstituted C 10-30 aliphatic. In some embodiments, R LD is unsubstituted C 20-30 aliphatic.
  • R LD is not hydrogen. In some embodiments, R LD is a lipid moiety. In some embodiments, R LD is a targeting moiety. In some embodiments, R LD is a targeting moiety comprising a carbohydrate moiety. In some embodiments, R LD is a GalNAc moiety.
  • R TD is R LD , wherein R LD is independently as described in the present disclosure.
  • R T is R CD , wherein R CD is independently as described in the present disclosure.
  • R CD is an optionally substituted, linear or branched group selected from a C 1-30 aliphatic group and a C 1-30 heteroaliphatic group having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus, boron and silicon, wherein one or more methylene units are optionally and independently replaced with C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O)S—, —C(O
  • R CD is an optionally substituted, linear or branched group selected from a C 1-30 aliphatic group and a C 1-30 heteroaliphatic group having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus, boron and silicon, wherein one or more methylene units are optionally and independently replaced with C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O)S—, —C(O
  • R CD is an optionally substituted, linear or branched group selected from a C 1-30 aliphatic group and a C 1-30 heteroaliphatic group having 1-10 heteroatoms independently selected from oxygen, nitrogen, sulfur, phosphorus, boron and silicon, wherein one or more methylene units are optionally and independently replaced with C 1-6 alkylene, C 1-6 alkenylene, —C ⁇ C—, —C(R′) 2 —, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)O—, —S(O)—, —S(O) 2 —, —S(O) 2 N(R′)—, —C(O)S—, —C(O
  • the present disclosure provides salts of oligonucleotides, and pharmaceutical compositions thereof.
  • a salt is a pharmaceutically acceptable salt.
  • each hydrogen ion that may be donated to a base e.g., under conditions of an aqueous solution, a pharmaceutical composition, etc. is replaced by a non-H + cation.
  • a pharmaceutically acceptable salt of an oligonucleotide is an all-metal ion salt, wherein each hydrogen ion (for example, of —OH, —SH, etc.) of each internucleotidic linkage (e.g., a natural phosphate linkage, a phosphorothioate diester linkage, etc.) is replaced by a metal ion.
  • a provided salt is an all-sodium salt.
  • a provided pharmaceutically acceptable salt is an all-sodium salt.
  • a provided salt is an all-sodium salt, wherein each internucleotidic linkage which is a natural phosphate linkage (acid form —O—P(O)(OH)—O—), if any, exists as its sodium salt form (—O—P(O)(ONa)—O—), and each internucleotidic linkage which is a phosphorothioate diester linkage (acid form —O—P(O)(SH)—O—), if any, exists as its sodium salt form (—O—P(O)(SNa)—O—).
  • a provided compound e.g., a provided oligonucleotide
  • a purity is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • a purity is at least 60%.
  • a purity is at least 70%.
  • a purity is at least 80%.
  • a purity is at least 85%.
  • a purity is at least 90%.
  • a purity is at least 91%.
  • a purity is at least 92%.
  • a purity is at least 93%. In some embodiments, a purity is at least 94%. In some embodiments, a purity is at least 95%. In some embodiments, a purity is at least 96%. In some embodiments, a purity is at least 97%. In some embodiments, a purity is at least 98%. In some embodiments, a purity is at least 99%. In some embodiments, a purity is at least 99.5%.
  • a provided compound e.g., a provided oligonucleotide
  • a diastereomeric purity is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • a chiral element e.g., a chiral center (carbon, phosphorus, etc.) of a provided compound, e.g. a provided oligonucleotide, has a diastereomeric purity of 60%-100%.
  • a chiral element e.g., a chiral center (carbon, phosphorus, etc.) has a diastereomeric purity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • a diastereomeric purity is at least 60%.
  • a diastereomeric purity is at least 70%.
  • a diastereomeric purity is at least 80%.
  • a diastereomeric purity is at least 85%.
  • a diastereomeric purity is at least 90%.
  • a diastereomeric purity is at least 91%. In some embodiments, a diastereomeric purity is at least 92%. In some embodiments, a diastereomeric purity is at least 93%. In some embodiments, a diastereomeric purity is at least 94%. In some embodiments, a diastereomeric purity is at least 95%. In some embodiments, a diastereomeric purity is at least 96%. In some embodiments, a diastereomeric purity is at least 97%. In some embodiments, a diastereomeric purity is at least 98%. In some embodiments, a diastereomeric purity is at least 99%. In some embodiments, a diastereomeric purity is at least 99.5%.
  • At least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more chiral elements of a provided compound each independently have a diastereomeric purity as described herein.
  • at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more chiral carbon centers of a provided compound each independently have a diastereomeric purity as described herein.
  • at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more chiral phosphorus centers of a provided compound each independently have a diastereomeric purity as described herein.
  • At least 5%-100% of all chiral elements of a provided compound each independently have a diastereomeric purity as described herein. In some embodiments, at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of all chiral elements of a provided compound each independently have a diastereomeric purity as described herein. In some embodiments, at least 5%-100% of all chiral phosphorus centers of a provided compound each independently have a diastereomeric purity as described herein.
  • At least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of all chiral phosphorus centers of a provided compound each independently have a diastereomeric purity as described herein.
  • each chiral element independently has a diastereomeric purity as described herein. In some embodiments, each chiral center independently has a diastereomeric purity as described herein. In some embodiments, each chiral carbon center independently has a diastereomeric purity as described herein. In some embodiments, each chiral phosphorus center independently has a diastereomeric purity as described herein.
  • a provided compound e.g., oligonucleotide and/or compositions thereof, can modulate activities and/or functions of a C9orf72 target.
  • a C9orf72 target gene is a gene with respect to which expression and/or activity of one or more C9orf72 gene products (e.g., RNA and/or protein products) are intended to be altered.
  • a C9orf72 target gene is intended to be inhibited.
  • a C9orf72 oligonucleotide as described herein acts on a particular C9orf72 target gene, presence and/or activity of one or more gene products of that C9orf72 gene are altered when the oligonucleotide is present as compared with when it is absent.
  • a C9orf72 target is a specific allele (e.g., a pathological allele) with respect to which expression and/or activity of one or more products (e.g., RNA and/or protein products) are intended to be altered.
  • a C9orf72 target allele is one whose presence and/or expression is associated (e.g., correlated) with presence, incidence, and/or severity, of one or more diseases and/or conditions, e.g., a C9orf72-related disorder.
  • a C9orf72 target allele is one for which alteration of level and/or activity of one or more gene products correlates with improvement (e.g., delay of onset, reduction of severity, responsiveness to other therapy, etc) in one or more aspects of a disease and/or condition.
  • C9orf72 oligonucleotides and methods thereof as described herein may preferentially or specifically target the pathological allele relative to the non-pathological allele, e.g., one or more less-associated/unassociated allele(s).
  • a pathological allele of C9orf72 comprises a repeat expansion, e.g., a hexanucleotide repeat expansion (HRE), e.g., a hexanucleotide repeat expansion of greater than about 30 and up to 500 or 1000 or more.
  • HRE hexanucleotide repeat expansion
  • a C9orf72 target sequence is a sequence to which an oligonucleotide as described herein binds.
  • a C9orf72 target sequence is identical to, or is an exact complement of, a sequence of a provided oligonucleotide, or of consecutive residues therein (e.g., a provided oligonucleotide includes a target-binding sequence that is identical to, or an exact complement of, a C9orf72 target sequence).
  • a small number of differences/mismatches is tolerated between (a relevant portion of) an oligonucleotide and its target sequence.
  • a C9orf72 target sequence is present within a C9orf72 target gene.
  • a C9orf72 target sequence is present within a transcript (e.g., an mRNA and/or a pre-mRNA) produced from a C9orf72 target gene.
  • a C9orf72 target sequence includes one or more allelic sites (i.e., positions within a C9orf72 target gene at which allelic variation occurs).
  • a provided oligonucleotide binds to one allele preferentially or specifically relative to one or more other alleles.
  • C9orf72 (chromosome 9 open reading frame 72) is a gene or its gene product, also designated as C90RF72, C9, ALSFTD, FTDALS, FTDALS1, DENNL72; External IDs: MGI: 1920455 HomoloGene: 10137 GeneCards: C9orf72. C9orf72 is also informally designated C9.
  • C9orf72 Orthologs Species: Human Entrez: 203228; Ensembl: ENSG00000147894; UniProt: Q96LT7; RefSeq (mRNA): NM_145005 NM_001256054 NM_018325; RefSeq (protein): NP_001242983 NP_060795 NP_659442; Location (UCSC): Chr 9: 27.55-27.57 Mb; Species: Mouse Entrez: 73205; Ensembl: ENSMUSG00000028300; UniProt: Q6DFW0; RefSeq (mRNA): NM_001081343; RefSeq (protein): NP_00107481; Location (UCSC): Chr 4: 35.19-35.23 Mb.
  • Nucleotides which encode C9orf72 include, without limitation, GENBANK Accession No. NM_001256054.1; GENBANK Accession No. NT_008413.18; GENBANK Accession No. BQ068108.1; GENBANK Accession No. NM_018325.3; GENBANK Accession No. DN993522.1; GENBANKAccession No. NM_145005.5; GENBANK Accession No. DB079375.1; GENBANK Accession No. BU194591.1; Sequence Identifier 4141_014_A 5; Sequence Identifier 4008_73_A; and GENBANKAccession No. NT_008413.18.
  • C9orf72 reportedly is a 481 amino acid protein with a molecular mass of 54328 Da, which may undergo post-translational modifications of ubiquitination and phosphorylation.
  • the expression levels of C9orf72 reportedly may be highest in the central nervous system and the protein localizes in the cytoplasm of neurons as well as in presynaptic terminals.
  • C9orf72 reportedly plays a role in endosomal and lysosomal trafficking regulation and has been shown to interact with RAB proteins that are involved in autophagy and endocytic transport.
  • C9orf72 reportedly activates RAB5, a GTPase that mediates early endosomal trafficking.
  • a hexanucleotide repeat expansion (e.g., (GGGGCC)n) in C9orf72 reportedly may be present in subjects suffering from a neurological disease, such as a C9orf72-related disorder.
  • C9orf72 is not capitalized and is rendered as c9orf72.
  • a C9orf72 oligonucleotide can comprise any of various linkers, additional moieties (including but not limited to targeting moieties), and/or be chirally controlled and/or have any of various bases sequences and/or chemical structures or formats as described herein.
  • a carbohydrate moiety is a targeting moiety.
  • a targeting moiety is a carbohydrate moiety.
  • the present disclosure provides oligonucleotides and oligonucleotide compositions that are chirally controlled.
  • a provided composition contains non-random or controlled levels of one or more individual oligonucleotide types, wherein an oligonucleotide type is defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications.
  • a particular oligonucleotide type may be defined by 1A) base identity; 1B) pattern of base modification; 1C) pattern of sugar modification; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications.
  • oligonucleotides of the same oligonucleotide type are identical.
  • the present disclosure provides chirally controlled C9orf72 oligonucleotide compositions of oligonucleotides, wherein the composition comprises a non-random or controlled level of a plurality of oligonucleotides, wherein oligonucleotides of the plurality share a common base sequence, and comprise the same configuration of linkage phosphorus at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 chiral internucleotidic linkages (chirally controlled internucleotidic linkages).
  • oligonucleotides of a predetermined level and/or a provided plurality comprise 1-30 chirally controlled internucleotidic linkages.
  • provided C9orf72 oligonucleotides comprise 2-30 chirally controlled internucleotidic linkages.
  • provided oligonucleotides comprise 5-30 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 10-30 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 1 chirally controlled internucleotidic linkage. In some embodiments, provided oligonucleotides comprise 2 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 3 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 4 chirally controlled internucleotidic linkages.
  • provided oligonucleotides comprise 5 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 6 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 7 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 8 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 9 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 10 chirally controlled internucleotidic linkages.
  • provided oligonucleotides comprise 11 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 12 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 13 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides comprise 14 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides have 15 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides have 16 chirally controlled internucleotidic linkages.
  • provided oligonucleotides have 17 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides have 18 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides have 19 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides have 20 chirally controlled internucleotidic linkages. In some embodiments, about 1-100% of all internucleotidic linkages are chirally controlled internucleotidic linkages. In some embodiments, a percentage is about 5%-100%.
  • a percentage is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 965, 96%, 98%, or 99%. In some embodiments, a percentage is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 965, 96%, 98%, or 99%.
  • a provided oligonucleotide is a unimer. In some embodiments, a provided oligonucleotide is a P-modification unimer. In some embodiments, a provided oligonucleotide is a stereounimer. In some embodiments, a provided oligonucleotide is a stereounimer of configuration Rp. In some embodiments, a provided oligonucleotide is a stereounimer of configuration Sp.
  • a provided oligonucleotide is an altmer. In some embodiments, a provided oligonucleotide is a P-modification altmer. In some embodiments, a provided oligonucleotide is a stereoaltmer.
  • a provided oligonucleotide is a blockmer. In some embodiments, a provided oligonucleotide is a P-modification blockmer. In some embodiments, a provided oligonucleotide is a stereoblockmer.
  • a provided oligonucleotide is a gapmer.
  • a provided oligonucleotide is a skipmer.
  • a provided oligonucleotide is a hemimer.
  • a hemimer is an oligonucleotide wherein the 5′-end or the 3′-end region has a sequence that possesses a structure feature that the rest of the oligonucleotide does not have.
  • the 5′-end or the 3′-end region has or comprises 2 to 20 nucleotides.
  • a structural feature is a base modification.
  • a structural feature is a sugar modification.
  • a structural feature is a P-modification.
  • a structural feature is stereochemistry of the chiral internucleotidic linkage.
  • a structural feature is or comprises a base modification, a sugar modification, a P-modification, or stereochemistry of the chiral internucleotidic linkage, or combinations thereof.
  • a hemimer is an oligonucleotide in which each sugar moiety of the 5′-end region shares a common modification.
  • a hemimer is an oligonucleotide in which each sugar moiety of the 3′-end region shares a common modification.
  • a common sugar modification of the 5′ or 3′-end region is not shared by any other sugar moieties in the oligonucleotide.
  • an example hemimer is an oligonucleotide comprising a sequence of substituted or unsubstituted 2′-O-alkyl sugar modified nucleosides, bicyclic sugar modified nucleosides, ⁇ -D-ribonucleosides or ⁇ -D-deoxyribonucleosides (for example 2′-MOE modified nucleosides, and LNATM or ENATM bicyclic sugar modified nucleosides) at one terminus region and a sequence of nucleosides with a different sugar moiety (such as a substituted or unsubstituted 2′-O-alkyl sugar modified nucleosides, bicyclic sugar modified nucleosides or natural ones) at the other terminus region.
  • a provided oligonucleotide is a combination of one or more of unimer, altmer, blockmer, gapmer, hemimer and skipmer. In some embodiments, a provided oligonucleotide is a combination of one or more of unimer, altmer, blockmer, gapmer, and skipmer. For instance, in some embodiments, a provided oligonucleotide is both an altmer and a gapmer. In some embodiments, a provided nucleotide is both a gapmer and a skipmer.
  • provided oligonucleotides are 5′-hemimers that comprises modified sugar moieties in a 5′-end sequence. In some embodiments, provided oligonucleotides are 5′-hemimers that comprises modified 2′-sugar moieties in a 5′-end sequence.
  • a provided oligonucleotide comprises one or more optionally substituted nucleotides. In some embodiments, a provided oligonucleotide comprises one or more modified nucleotides. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted nucleosides. In some embodiments, a provided oligonucleotide comprises one or more modified nucleosides. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted LNAs.
  • a provided oligonucleotide comprises one or more optionally substituted nucleobases. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted natural nucleobases. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted modified nucleobases. In some embodiments, a provided oligonucleotide comprises one or more 5-methylcytidine; 5-hydroxymethylcytidine, 5-formylcytosine, or 5-carboxylcytosine. In some embodiments, a provided oligonucleotide comprises one or more 5-methylcytidine.
  • each nucleobase of a provided oligonucleotide e.g., one of formula O-I, A c -[-L M -(R D ) a ] b , [(A c ) a -L M ] b -R D , (A c ) a -L M -(A c ) b , or (A c ) a -L M -(R D ) b , is independently an optionally substituted or protected nucleobase of adenine, cytosine, guanosine, thymine, or uracil.
  • each BA is independently an optionally substituted or protected nucleobase of adenine, cytosine, guanosine, thymine, or uracil.
  • various protected nucleobases including those widely known in the art, for example, those used in oligonucleotide preparation (e.g., protected nucleobases of WO/2010/064146, WO/2011/005761, WO/2013/012758, WO/2014/010250, US2013/0178612, WO/2014/012081, WO/2015/107425, WO2017/015555, and WO2017/062862, protected nucleobases of each of which are incorporated herein by reference), and can be utilized in accordance with the present disclosure.
  • a provided oligonucleotide comprises one or more optionally substituted sugars. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted sugars found in naturally occurring DNA and RNA. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted ribose or deoxyribose.
  • a provided oligonucleotide comprises one or more optionally substituted ribose or deoxyribose, wherein one or more hydroxyl groups of the ribose or deoxyribose moiety is optionally and independently replaced by halogen, R′, —N(R′) 2 , —OR′, or —SR′, wherein each R′ is independently described in the present disclosure.
  • a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with halogen, R′, —N(R′) 2 , —OR′, or —SR′, wherein each R′ is independently described in the present disclosure.
  • a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with halogen.
  • a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with one or more —F. halogen.
  • a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —OR′, wherein each R′ is independently described in the present disclosure.
  • a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —OR′, wherein each R′ is independently an optionally substituted C 1 -C 6 aliphatic.
  • a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —OR′, wherein each R′ is independently an optionally substituted C 1 -C 6 alkyl.
  • a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —OMe. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —O— methoxyethyl.
  • a provided oligonucleotide is single-stranded oligonucleotide. In some embodiments, a provided single-stranded C9orf72 oligonucleotide further comprises one or more additional strands which are partially or completely complementary to the single-stranded C9orf72 oligonucleotide.
  • a provided oligonucleotide is a hybridized oligonucleotide strand. In certain embodiments, a provided oligonucleotide is a partially hybridized oligonucleotide strand. In certain embodiments, a provided oligonucleotide is a completely hybridized oligonucleotide strand. In certain embodiments, a provided oligonucleotide is a double-stranded oligonucleotide. In certain embodiments, a provided oligonucleotide is a triple-stranded oligonucleotide (e.g., a triplex).
  • a provided C9orf72 oligonucleotide is chimeric.
  • a provided oligonucleotide e.g., a C9orf72 oligonucleotide which has a base sequence which comprises, consists of, or comprises a portion of a base sequence of a C9orf72 oligonucleotide disclosed herein
  • a C9orf72 oligonucleotide can comprise a chemical structure described in WO2012/030683.
  • a provided oligonucleotide is a therapeutic agent.
  • a provided oligonucleotide comprises a nucleic acid analog, e.g., GNA, LNA, PNA, TNA, F-HNA (F-THP or 3′-fluoro tetrahydropyran), MNA (mannitol nucleic acid, e.g., Leumann 2002 Bioorg. Med. Chem. 10: 841-854), ANA (anitol nucleic acid), and Morpholino.
  • a provided oligonucleotide is about 2-500 nucleotide units in length. In some embodiments, a provided oligonucleotide is about 5-500 nucleotide units in length. In some embodiments, a provided oligonucleotide is about 10-50 nucleotide units in length. In some embodiments, a provided oligonucleotide is about 15-50 nucleotide units in length.
  • each nucleotide unit independently comprises a heteroaryl nucleobase unit (e.g., adenine, cytosine, guanosine, thymine, and uracil, each of which is optionally and independently substituted or protected), a sugar unit comprising a 5-10 membered heterocyclyl ring, and an internucleotidic linkage having the structure of formula I.
  • a heteroaryl nucleobase unit e.g., adenine, cytosine, guanosine, thymine, and uracil, each of which is optionally and independently substituted or protected
  • a sugar unit comprising a 5-10 membered heterocyclyl ring
  • an internucleotidic linkage having the structure of formula I.
  • a provided oligonucleotide is from about 15 to about 30 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 10 to about 25 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 15 to about 22 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide units in length.
  • an oligonucleotide is at least 15 nucleotide units in length. In some embodiments, an oligonucleotide is at least 16 nucleotide units in length. In some embodiments, an oligonucleotide is at least 17 nucleotide units in length. In some embodiments, an oligonucleotide is at least 18 nucleotide units in length. In some embodiments, an oligonucleotide is at least 19 nucleotide units in length. In some embodiments, an oligonucleotide is at least 20 nucleotide units in length. In some embodiments, an oligonucleotide is at least 21 nucleotide units in length.
  • an oligonucleotide is at least 22 nucleotide units in length. In some embodiments, an oligonucleotide is at least 23 nucleotide units in length. In some embodiments, an oligonucleotide is at least 24 nucleotide units in length. In some embodiments, an oligonucleotide is at least 25 nucleotide units in length. In some other embodiments, an oligonucleotide is at least 30 nucleotide units in length. In some other embodiments, an oligonucleotide is a duplex of complementary strands of at least 18 nucleotide units in length. In some other embodiments, an oligonucleotide is a duplex of complementary strands of at least 21 nucleotide units in length.
  • oligonucleotides of an oligonucleotide type characterized by 1) a common base sequence and length, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone chiral centers have the same chemical structure. For example, they have the same base sequence, the same pattern of nucleoside modifications, the same pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, etc), the same pattern of backbone chiral centers (i.e. pattern of linkage phosphorus stereochemistry (Rp/Sp)), and the same pattern of backbone phosphorus modifications (e.g., pattern of “-XLR 1 ” groups in Formula I).
  • backbone linkages i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, etc
  • Rp/Sp linkage phosphorus stereochemistry
  • backbone phosphorus modifications e
  • provided C9orf72 oligonucleotides can direct a decrease in the expression, level and/or activity of a C9orf72 target gene or its gene product. In some embodiments, provided C9orf72 oligonucleotides can direct a decrease in the expression, level and/or activity of a C9orf72 target gene or its gene product and has a base sequence which consists of, comprises, or comprises a portion (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous bases) of the base sequence of any C9orf72 oligonucleotide disclosed herein, and the oligonucleotide comprises at least one non-naturally-occurring modification of a base, sugar and/or internucleotidic linkage.
  • a provided composition comprises an oligonucleotide.
  • a provided oligonucleotide comprises one or more carbohydrate moieties.
  • a provided oligonucleotide comprises one or more targeting moieties.
  • additional chemical moieties which can be conjugated to an oligonucleotide are shown in Example 1.
  • provided oligonucleotides can direct a decrease in the expression, level and/or activity of a C9orf72 target gene or its gene product. In some embodiments, provided oligonucleotides can direct a decrease in the expression, level and/or activity of a C9orf72 target gene or its gene product via RNase H-mediated knockdown. In some embodiments, provided oligonucleotides can direct a decrease in the expression, level and/or activity of a C9orf72 target gene or its gene product by sterically blocking translation after binding to a C9orf72 target gene mRNA, and/or by altering or interfering with mRNA splicing. In some embodiments, a C9orf72 target gene comprises a hexanucleotide repeat expansion.
  • C9orf72 oligonucleotides include nucleic acids (including antisense compounds), including but not limited to antisense oligonucleotides (ASOs), oligonucleotides, double- and single-stranded siRNAs; and C9orf72 oligonucleotide can be co-administered or be used as part of a treatment regiment along with aptamers, antibodies, peptides, small molecules, and/or other agents capable of inhibiting the expression of C9orf72 antisense transcript or gene and/or its expression product or gene product, or a gene or gene product which increases the expression, activity and/or level of a C9orf72 transcript comprising a repeat expansion or its gene product, or a gene or gene product which is associated with a C9orf72-related disorder.
  • ASOs antisense oligonucleotides
  • oligonucleotides double- and single-stranded siRNAs
  • a provided oligonucleotide capable of directing a decrease in the expression, level and/or activity of a C9orf72 target gene or its gene product has a base sequence (or a portion thereof), pattern of chemical modification (or a portion thereof), structural element or a portion thereof, or a format or portion thereof described herein.
  • a provided oligonucleotide capable of directing a decrease in the expression, level and/or activity of a C9orf72 target gene or its gene product has the base sequence (or a portion thereof), pattern of chemical modification (or a portion thereof), format of any oligonucleotide disclosed herein, e.g., in Table 1A or in the Figures, or otherwise disclosed herein, or a structural element or format or portion thereof described herein.
  • a C9orf72 oligonucleotide can hybridize to a C9orf72 nucleic acid derived from either DNA strand. In some embodiments, a C9orf72 oligonucleotide can hybridize to a C9orf72 antisense or sense transcript. In some embodiments, a C9orf72 oligonucleotide can hybridize to a C9orf72 nucleic acid in any stage of RNA processing, including but not limited to a pre-mRNA or a mature mRNA.
  • a C9orf72 oligonucleotide can hybridize to any element of a C9orf72 nucleic acid or its complement, including but not limited to: a promoter region, an enhancer region, a transcriptional stop region, a translational start signal, a translation stop signal, a coding region, a non-coding region, an exon, an intron, the 5′ UTR, the 3′ UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, intron/exon or exon/intron junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon 1a, exon 1b, exon 1c, exon 1d, exon 1e, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron 3, intron
  • introns and exons alternate; intron 1 is between exon 1 (or 1a or 1b or 1c, etc.) and exon 2; intron 2 is between exon 2 and 3; etc.
  • the positions of exons and introns in variant transcripts of C9orf72 are diagrammed in the literature, e.g., WO 2014/062691.
  • a C9orf72 sequence is represented by:
  • a sequence of exon 1a is represented by nt 1137-1216; exon 1b, 1510-1572; exon 1c, 1137-1294; exon 1d, 1241-1279; and exon 1e, 1135-1169 of SEQ ID NO: 1.
  • intron 1 is represented by 1217-7838 (if the transcript includes exon 1a), 1573-7838 (1b), 1295-7838 (1c), 1280-7838 (1d), or 1170-7838 (1e) of SEQ ID NO: 1.
  • a sequence of exon 2 is represented by nt 7839-8326; exon 3, 9413-9472; exon 4, 12527-12622; exon 5, 13354-13418; exon 6, 14704-14776; exon 7, 16396-16512; exon 8, 18207-18442; exon 9, 24296-24353; exon 10, 26337-26446; and exon 11, 26581-28458 of SEQ ID NO: 1.
  • introns lie between the exons.
  • the portion upstream (5′) of exon 1a, 1b, 1c, 1d, or 1e includes the 5′-UTR.
  • the portion downstream (3′) of exon 11 is the 3′-UTR.
  • a C9orf72 oligonucleotide recognizes a site within a C9orf72 Intron 1 nearby the repeat expansion and is selected from: WV-6969, WV-3690, WV-6976, WV-7002, WV-6970, WV-3689, WV-6960, WV-7001, WV-6974, WV-6978, WV-6952, WV-6989, WV-3704, WV-7007, WV-7004, WV-6951, WV-6474, WV-3688, WV-7006, WV-6977, WV-6955, WV-6995, WV-6972, WV-7003, WV-6982, WV-6996, WV-7005, WV-6986, WV-6979, WV-6971, WV-6985, WV-6488, WV-6489, WV-6980, WV-6981, or any oligonucleot
  • a C9orf72 oligonucleotide recognizes a site within C9orf72 Exon 1a and is selected from: WV-3677, WV-6940, WV-3683, WV-6931, WV-3679, WV-6927, WV-6922, WV-6937, WV-6926, WV-3685, WV-6930, WV-6932, WV-6928, WV-6933, WV-6936, WV-7027, WV-3678, WV-8114, WV-8122, WV-8311, WV-8315, WV-8312, WV-8313, WV-8314, WV-8316, WV-8317, or WV-8318, or any oligonucleotide having the same base sequence of any of these oligonucleotides.
  • a C9orf72 oligonucleotide recognizes a site within C9orf72 Antisense (AS) transcript and is selected from: WV-3723, WV-3737, WV-3719, WV-3730, WV-3722, WV-3743, WV-3745, WV-3739, WV-3724, WV-3732, WV-3734, WV-3733, WV-3720, WV-3721, WV-3731, or any oligonucleotide having the same base sequence of any of these oligonucleotides.
  • AS Antisense
  • a C9orf72 oligonucleotide recognizes a site within C9orf72 Exon 2 transcript and is selected from: WV-3662 and WV-7118, or any oligonucleotide having the same base sequence of any of these oligonucleotides.
  • a C9orf72 oligonucleotide can hybridize to a portion of the C9orf72 sequence represented in GENBANK Accession No. NT_008413.18 or a complement thereof.
  • a C9orf72 oligonucleotide can hybridize to a portion of the C9orf72 pre-mRNA represented by the region which begins in the region from the start site of exon 1a to the start site of exon 1b. In some embodiments, a C9orf72 oligonucleotide can hybridize to a portion of the C9orf72 pre-mRNA represented by the region which begins in the region from the end site of exon 1a to the start site of exon 1b. In some embodiments, a c9orf72 oligonucleotide recognizes a site which straddles the junction between an intron and an exon.
  • a c9orf72 oligonucleotide straddles the junction between exon 1b and intron 1. In some embodiments, a c9orf72 oligonucleotide straddles the junction between exon 1b and intron 1, and has a base sequence which is, comprises or comprises 15 contiguous bases of the sequence CCTCACTCACCCACTCGCCA.
  • the present disclosure notes that the sequence CCTCACTCACCCACTCGCCA straddles the junction of exon 1b and intron 1 reported for c9orf72 mRNA Variant 2 or V2 (which lacks the hexanucleotide repeat), and that the site may be blocked by the splicing machinery from being bound by an oligonucleotide having a sequence which is, comprises or comprises 15 contiguous bases of the sequence CCTCACTCACCCACTCGCCA.
  • sequence CCTCACTCACCCACTCGCCA is in the middle of an intron reported in V1 and V3; that the sequence CCTCACTCACCCACTCGCCA straddles the junction of an exon (1b) and an intron (1) reported for V2, and access to this site may be sterically blocked by the splicing machinery.
  • a C9orf72 oligonucleotide comprises a base sequence complementary to a 5′ branching site at an intron-exon junction. In some embodiments, a C9orf72 oligonucleotide comprises a sequence complementary to a 5′ branching site at the junction of a C9orf72 exon 1 and a C9orf72 intron 1. In some embodiments, a 5′ branching site at the junction of C9orf72 exon 1 and intron 1 comprises the base sequence of GTGAGT. In some embodiments, a C9orf72 oligonucleotide comprises a base sequence complementary to GTGAGT.
  • an oligonucleotide is capable of preferentially decreasing the expression, level and/or activity of a disease-associated allele of a gene or a gene product thereof relative to that of a corresponding wild-type allele of the gene or the gene product thereof, wherein the oligonucleotide has a base sequence complementary to both the disease-associated allele and the wild-type allele, and wherein the binding site of the oligonucleotide in a mRNA or DNA of the disease-associated allele is less accessible to the oligonucleotide than the binding site of the oligonucleotide in a mRNA or DNA expressing the wild-type allele.
  • the accessibility of the oligonucleotide to a binding site in a mRNA or DNA of the disease-associated allele is decreased by binding of splicing machinery and/or other nucleic acids or proteins to the mRNA or DNA of the disease-associate allele.
  • the present disclosure pertains to: an oligonucleotide capable of preferentially decreasing (knocking down) the expression, level and/or activity of a mutant or disease-associated allele of a gene or a gene product thereof relative to that of a corresponding wild-type or non-disease-associated allele of the gene or the gene product thereof, wherein the oligonucleotide has a base sequence complementary to both the mutant or disease-associated allele and the wild-type or non-disease-associated allele, and wherein the binding site of (e.g., sequence complementary to) the oligonucleotide in a nucleic acid (e.g., chromosomal DNA, mRNA, pre-mRNA, etc.) of the mutant or disease-associated allele is less accessible to the oligonucleotide (e.g., due to increased binding of splicing machinery and/or other nucleic acids or proteins) than the binding site of the oligonucleotide
  • a C9orf72 oligonucleotide can hybridize to a portion of the C9orf72 pre-mRNA represented by GENBANK Accession No. NT_008413.18, nucleosides 27535000 to 27565000 or a complement thereof.
  • a C9orf72 oligonucleotide can hybridize to an intron. In some embodiments, a C9orf72 oligonucleotide can hybridize to an intron comprising a hexanucleotide repeat.
  • a C9orf72 oligonucleotide hybridizes to all variants of C9orf72 derived from the sense strand.
  • the antisense oligonucleotides described herein selectively hybridize to a variant of C9orf72 derived from the sense strand, including but not limited to that comprising a hexanucleotide repeat expansion.
  • a hexanucleotide repeat expansion comprises at least 24 repeats of any hexanucleotide.
  • a hexanucleotide repeat expansion comprises at least 30 repeats of any hexanucleotide.
  • a hexanucleotide repeat expansion comprises at least 50 repeats of any of a hexanucleotide. In some embodiments, a hexanucleotide repeat expansion comprises at least 100 repeats of any of a hexanucleotide. In some embodiments, a hexanucleotide repeat expansion comprises at least 200 repeats of any hexanucleotide. In some embodiments, a hexanucleotide repeat expansion comprises at least 500 repeats of any hexanucleotide.
  • a hexanucleotide is GGGGCC, GGGGGG, GGGGGC, GGGGCG, CCCCGG, CCCCCC, GCCCCC, and/or CGCCCC.
  • a hexanucleotide GGGGCC is designated GGGGCCexp or (GGGGCC), or is a repeat of the hexanucleotide GGGGCC.
  • a C9orf72 target of a C9orf72 oligonucleotide is a C9orf72 RNA which is not a mRNA.
  • provided oligonucleotides in provided compositions e.g., oligonucleotides of a first plurality, comprise base modifications, sugar modifications, and/or internucleotidic linkage modifications.
  • provided oligonucleotides comprise base modifications and sugar modifications.
  • provided oligonucleotides comprise base modifications and internucleotidic linkage modifications.
  • provided oligonucleotides comprise sugar modifications and internucleotidic modifications.
  • compositions comprise base modifications, sugar modifications, and internucleotidic linkage modifications.
  • Example chemical modifications, such as base modifications, sugar modifications, internucleotidic linkage modifications, etc. are widely known in the art including but not limited to those described in this disclosure.
  • a modified base is substituted A, T, C, G or U.
  • a sugar modification is 2′-modification.
  • a 2′-modification is 2-F modification.
  • a 2′-modification is 2′-OR 1 .
  • a 2′-modification is 2′-OR 1 , wherein R is optionally substituted alkyl.
  • a 2′-modification is 2′-OMe. In some embodiments, a 2′-modification is 2′-MOE.
  • a modified sugar moiety is a bridged bicyclic or polycyclic ring. In some embodiments, a modified sugar moiety is a bridged bicyclic or polycyclic ring having 5-20 ring atoms wherein one or more ring atoms are optionally and independently heteroatoms. Example ring structures are widely known in the art, such as those found in BNA, LNA, etc.
  • provided oligonucleotides comprise both one or more modified internucleotidic linkages and one or more natural phosphate linkages.
  • oligonucleotides comprising both modified internucleotidic linkage and natural phosphate linkage and compositions thereof provide improved properties, e.g., activities, etc.
  • a modified internucleotidic linkage is a chiral internucleotidic linkage.
  • a modified internucleotidic linkage is a phosphorothioate linkage.
  • a modified internucleotidic linkage is a substituted phosphorothioate linkage.
  • the present disclosure provides a stereorandom oligonucleotide having a base sequence which is, comprises or comprises a portion of the base sequence of any oligonucleotide described herein. In some embodiments, a portion of a base sequence is at least 15 contiguous bases thereof. In some embodiments, the present disclosure provides an oligonucleotide having a base sequence which is, comprises or comprises a portion of the base sequence of any oligonucleotide described herein, wherein the oligonucleotide comprises one or more stereorandom internucleotidic linkages.
  • the present disclosure provides an oligonucleotide having a base sequence which is, comprises or comprises a portion of the base sequence of any oligonucleotide described herein, wherein the oligonucleotide comprises one or more stereorandom phosphorothioate internucleotidic linkages.
  • oligonucleotide properties can be adjusted by optimizing stereochemistry (pattern of backbone chiral centers) and chemical modifications (modifications of base, sugar, and/or internucleotidic linkage) or patterns thereof.
  • a pattern of backbone chiral centers in a C9orf72 oligonucleotide provides increased stability. In some embodiments, a pattern of backbone chiral centers provides surprisingly increased activity. In some embodiments, a pattern of backbone chiral centers provides increased stability and activity. In some embodiments, a pattern of backbone chiral centers provides surprisingly increased binding to certain proteins. In some embodiments, a pattern of backbone chiral centers provides surprisingly enhanced delivery.
  • the present disclosure pertains to a c9orf72 oligonucleotide wherein the oligonucleotide comprises a backbone comprising at least one chiral center. In some embodiments, the present disclosure pertains to a c9orf72 oligonucleotide wherein the oligonucleotide comprises a backbone comprising at least one chiral center which is a phosphorothioate in the Rp or Sp configuration.
  • a C9orf72 oligonucleotide has a pattern of backbone chiral centers.
  • a pattern of backbone chiral centers of a provided oligonucleotide or a region thereof comprises or is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t[(Op)n(Sp)m]y, (Sp)t[(Op)n(Sp)m]y, (Np)t[(Rp)n(Sp)m]y, or (Sp)t[(Rp)n(Sp)m]y, wherein each variable is as described in the present disclosure.
  • y is 1.
  • a pattern of backbone chiral centers comprises or is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, (Sp)t(Rp)n(Sp)m, (Np)t[(Rp)n(Sp)m]2, (Sp)t[(Rp)n(Sp)m]2, (Np)t(Op)n(Sp)m, (Sp)t(Op)n(Sp)m, (Np)t[(Op)n(Sp)m]2, or (Sp)t[(Op)n(Sp)m]2.
  • y is 2.
  • a pattern is (Np)t(Op/Rp)n(Sp)m(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)1-5(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)2-5(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)2(Op/Rp)n(Sp)m.
  • a pattern is (Np)t(Op/Rp)n(Sp)3(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)4(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)5(Op/Rp)n(Sp)m. In some embodiments, Np is Sp. In some embodiments, (Op/Rp) is Op. In some embodiments, (Op/Rp) is Rp. In some embodiments, Np is Sp and (Op/Rp) is Rp.
  • Np is Sp and (Op/Rp) is Op. In some embodiments, Np is Sp and at least one (Op/Rp) is Rp, and at least one (Op/Rp) is Op. In some embodiments, a pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein m>2.
  • a pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein n is 1, at least one t>1, and at least one m>2.
  • n is 1, at least one t>1, and at least one m>2.
  • at one n is 1, at least one t is no less than 1, and at least one m is no less than 2.
  • at one n is 1, at least one t is no less than 2, and at least one m is no less than 3.
  • each n is 1. In some embodiments, at least one t>1. In some embodiments, at least one t>2.
  • a pattern of backbone chiral centers comprises one or more achiral natural phosphate linkages.
  • the sum of m, t, and n is no less than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. In some embodiments, the sum is 5. In some embodiments, the sum is 6. In some embodiments, the sum is 7.
  • the sum is 8. In some embodiments, the sum is 9 In some embodiments, the sum is 10. In some embodiments, the sum is 11. In some embodiments, the sum is 12. In some embodiments, the sum is 13. In some embodiments, the sum is 14. In some embodiments, the sum is 15.
  • a nucleotidic unit comprising Op is Nu O as described in the present disclosure.
  • Nu O comprises a 5′-substitution/modification as described in the present disclosure, e.g., —C(R 5s ) 2 — as described in the present disclosure.
  • —C(R 5s ) 2 — is 5MRd as described in the present disclosure.
  • —C(R 5s ) 2 — is 5MSd as described in the present disclosure.
  • a pattern of backbone chiral centers comprises or is (Rp)n(Sp)m. In some embodiments, a pattern of backbone chiral centers comprises or is (Sp)t(Rp)n. In some embodiments, a pattern of backbone chiral centers comprises or is (Np)t(Rp)n(Sp)m. In some embodiments, a pattern of backbone chiral centers comprises or is (Sp)t(Sp)m, optionally with n achiral phosphate diester internucleotidic linkages and/or stereorandom (non-chirally controlled) chiral internucleotidic linkages between the section having (Sp)t and the section having (Sp)m.
  • a pattern of backbone chiral centers comprises or is (Sp)t(Rp)n(Sp)m.
  • each of t and m is independently equal to or greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
  • a common pattern of backbone chiral centers in a provided oligonucleotide comprises a pattern of i o -i s -i o -i s -i o , i o -i s -i s -i s -i o , i o -i s -i s -i o -i s -, i s -i o -i s -i o -, i s -i o -i s -i o -, i s -i o -i s -i o -i s -, i s -i o -i s -i o -i s -, i s -i o -i s -i o -i s -, i s -i o -i s -i o -i
  • a common pattern of backbone chiral centers comprises a pattern of OSOSO, OSSSO, OSSSOS, SOSO, SOSO, SOSOS, SOSOSO, SOSOSOSO, SOSSSO, SSOSSSOSS, SSSOSOSSS, SSSSOSOSSSS, SSSSS, SSSSSS, SSSSSSSSS, or RRR, wherein S represents a phosphorothioate of the Sp configuration, O represents a phosphodiester, and R represents a phosphorothioate of the Rp configuration.
  • the non-chiral center is a linkage phosphorus of a phosphodiester linkage.
  • the chiral center in a Sp configuration is a linkage phosphorus of a phosphorothioate linkage.
  • the chiral center in a Rp configuration is a linkage phosphorus of a phosphorothioate linkage.
  • 5% or more of the internucleotidic linkages of provided oligonucleotides are modified internucleotidic linkages. In some embodiments, 10% or more of the internucleotidic linkages of provided oligonucleotides are modified internucleotidic linkages. In some embodiments, 15% or more of the internucleotidic linkages of provided oligonucleotides are modified internucleotidic linkages. In some embodiments, 20% or more of the internucleotidic linkages of provided oligonucleotides are modified internucleotidic linkages.
  • 25% or more of the internucleotidic linkages of provided oligonucleotides are modified internucleotidic linkages. In some embodiments, 30% or more of the internucleotidic linkages of provided oligonucleotides are modified internucleotidic linkages. In some embodiments, 35% or more of the internucleotidic linkages of provided oligonucleotides are modified internucleotidic linkages. In some embodiments, 40% or more of the internucleotidic linkages of provided oligonucleotides are modified internucleotidic linkages.
  • expression or level of a C9orf72 target gene or its gene product is decreased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or 80% by administration of an oligonucleotide. In some embodiments, expression or level of a C9orf72 target gene or its gene product is decreased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or 80% total by RNase H-mediated knockdown directed by an oligonucleotide.
  • expression or level of a C9orf72 target gene or its gene product is decreased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or 80% by administration of an oligonucleotide in a cell(s) in vitro. In some embodiments, expression or level of a C9orf72 target gene or its gene product is decreased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or 80% by RNase H-mediated knockdown directed by an oligonucleotide in a cell(s) in vitro.
  • expression or level of a C9orf72 target gene or its gene product is decreased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or 80% by administration of an oligonucleotide at a concentration of 25 nm or less in a cell(s) in vitro. In some embodiments, expression or level of a C9orf72 target gene or its gene product is decreased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or 80% by administration of an oligonucleotide at a concentration of 10 nm or less in a cell(s) in vitro.
  • expression or level of a C9orf72 target gene or its gene product is decreased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or 80% by administration of an oligonucleotide at a concentration of 5 nm or less in a cell(s) in vitro. In some embodiments, expression or level of a C9orf72 target gene or its gene product is decreased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or 80% by RNase H-mediated knockdown directed by an oligonucleotide at a concentration of 5 nm or less in a cell(s) in vitro.
  • a cell(s) is a mammalian cell(s). In some embodiments, a cell(s) is a human cell(s). In some embodiments, a cell(s) is a hepatic cell(s). In some embodiments, a cell(s) is a Huh7 or Hep3B cell(s). In some embodiments, a C9orf72 oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 20% in a cell(s) in vitro at a concentration of 25 nM or less.
  • a C9orf72 oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 30% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, a C9orf72 oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 40% in a cell(s) in vitro at a concentration of 25 nM or less.
  • a C9orf72 oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 50% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, a C9orf72 oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 60% in a cell(s) in vitro at a concentration of 25 nM or less.
  • a C9orf72 oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 70% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, a C9orf72 oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 80% in a cell(s) in vitro at a concentration of 25 nM or less.
  • a C9orf72 oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 90% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, an oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 20% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, an oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 30% in a cell(s) in vitro at a concentration of 25 nM or less.
  • an oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 40% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, an oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 50% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, an oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 60% in a cell(s) in vitro at a concentration of 25 nM or less.
  • an oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 70% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, an oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 80% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, an oligonucleotide is capable of decreasing expression or level of a C9orf72 target gene or its gene product by at least about 90% in a cell(s) in vitro at a concentration of 25 nM or less. In some embodiments, IC50 is inhibitory concentration to decrease expression or level or a C9orf72 target gene or its gene product by 50% in a cell(s) in vitro.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)mRp or Rp(Sp)m. In some embodiments, the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises Rp(Sp)m. In some embodiments, the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)mRp. In some embodiments, m is 2.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises Rp(Sp) 2 . In some embodiments, the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp) 2 Rp(Sp) 2 . In some embodiments, the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Rp) 2 Rp(Sp) 2 .
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises RpSpRp(Sp) 2 . In some embodiments, the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises SpRpRp(Sp) 2 . In some embodiments, the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp) 2 Rp.
  • m is 1-50. In some embodiments, m is 1. In some embodiments, m is 2-50. In some embodiments, m is 2, 3, 4, 5, 6, 7 or 8. In some embodiments, m is 3, 4, 5, 6, 7 or 8. In some embodiments, m is 4, 5, 6, 7 or 8. In some embodiments, m is 5, 6, 7 or 8. In some embodiments, m is 6, 7 or 8. In some embodiments, m is 7 or 8. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6. In some embodiments, m is 7. In some embodiments, m is 8. In some embodiments, m is 9.
  • m is 10. In some embodiments, m is 11. In some embodiments, m is 12. In some embodiments, m is 13. In some embodiments, m is 14. In some embodiments, m is 15. In some embodiments, m is 16. In some embodiments, m is 17. In some embodiments, m is 18. In some embodiments, m is 19. In some embodiments, m is 20. In some embodiments, m is 21. In some embodiments, m is 22. In some embodiments, m is 23. In some embodiments, m is 24. In some embodiments, m is 25. In some embodiments, m is greater than 25.
  • a repeating pattern is (Sp)m(Rp)n, wherein n is 1-10, and m is independently described in the present disclosure.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)m(Rp)n.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)m(Rp)n.
  • a repeating pattern is (Rp)n(Sp)m, wherein n is 1-10, and m is independently described in the present disclosure.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Rp)n(Sp)m.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Rp)n(Sp)m.
  • (Rp)n(Sp)m is (Rp)(Sp) 2 .
  • (Sp)n(Rp)m is (Sp) 2 (Rp).
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)m(Rp)n(Sp)t.
  • a repeating pattern is (Sp)m(Rp)n(Sp)t, wherein n is 1-10, t is 1-50, and m is as described in the present disclosure.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)m(Rp)n(Sp)t.
  • a repeating pattern is (Sp)t(Rp)n(Sp)m, wherein n is 1-10, t is 1-50, and m is as described in the present disclosure.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)t(Rp)n(Sp)m.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)t(Rp)n(Sp)m.
  • a repeating pattern is (Np)t(Rp)n(Sp)m, wherein n is 1-10, t is 1-50, Np is independently Rp or Sp, and m is as described in the present disclosure.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Np)t(Rp)n(Sp)m.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Np)t(Rp)n(Sp)m.
  • a repeating pattern is (Np)m(Rp)n(Sp)t, wherein n is 1-10, t is 1-50, Np is independently Rp or Sp, and m is as described in the present disclosure.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Np)m(Rp)n(Sp)t.
  • the present disclosure provides a C9orf72 oligonucleotide of an oligonucleotide type whose pattern of backbone chiral centers comprises (Np)m(Rp)n(Sp)t.
  • Np is Rp. In some embodiments, Np is Sp. In some embodiments, all Np are the same. In some embodiments, all Np are Sp. In some embodiments, at least one Np is different from the other Np. In some embodiments, t is 2.
  • n is 1-10. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7 or 8. In some embodiments, n is 1. In some embodiments, n is 2, 3, 4, 5, 6, 7 or 8. In some embodiments, n is 3, 4, 5, 6, 7 or 8. In some embodiments, n is 4, 5, 6, 7 or 8. In some embodiments, n is 5, 6, 7 or 8. In some embodiments, n is 6, 7 or 8. In some embodiments, n is 7 or 8. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10.
  • t is 1-50. In some embodiments, t is 1. In some embodiments, t is 2-50. In some embodiments, t is 2, 3, 4, 5, 6, 7 or 8. In some embodiments, t is 3, 4, 5, 6, 7 or 8. In some embodiments, t is 4, 5, 6, 7 or 8. In some embodiments, t is 5, 6, 7 or 8. In some embodiments, t is 6, 7 or 8. In some embodiments, t is 7 or 8. In some embodiments, t is 2. In some embodiments, t is 3. In some embodiments, t is 4. In some embodiments, t is 5. In some embodiments, t is 6. In some embodiments, t is 7. In some embodiments, t is 8. In some embodiments, t is 9.
  • t is 10. In some embodiments, t is 11. In some embodiments, t is 12. In some embodiments, t is 13. In some embodiments, t is 14. In some embodiments, t is 15. In some embodiments, t is 16. In some embodiments, t is 17. In some embodiments, t is 18. In some embodiments, t is 19. In some embodiments, t is 20. In some embodiments, t is 21. In some embodiments, t is 22. In some embodiments, t is 23. In some embodiments, t is 24. In some embodiments, t is 25. In some embodiments, t is greater than 25.
  • At least one of m and t is greater than 2. In some embodiments, at least one of m and t is greater than 3. In some embodiments, at least one of m and t is greater than 4. In some embodiments, at least one of m and t is greater than 5. In some embodiments, at least one of m and t is greater than 6. In some embodiments, at least one of m and t is greater than 7. In some embodiments, at least one of m and t is greater than 8. In some embodiments, at least one of m and t is greater than 9. In some embodiments, at least one of m and t is greater than 10. In some embodiments, at least one of m and t is greater than 11.
  • At least one of m and t is greater than 12. In some embodiments, at least one of m and t is greater than 13. In some embodiments, at least one of m and t is greater than 14. In some embodiments, at least one of m and t is greater than 15. In some embodiments, at least one of m and t is greater than 16. In some embodiments, at least one of m and t is greater than 17. In some embodiments, at least one of m and t is greater than 18. In some embodiments, at least one of m and t is greater than 19. In some embodiments, at least one of m and t is greater than 20. In some embodiments, at least one of m and t is greater than 21.
  • At least one of m and t is greater than 22. In some embodiments, at least one of m and t is greater than 23. In some embodiments, at least one of m and t is greater than 24. In some embodiments, at least one of m and t is greater than 25.
  • each one of m and t is greater than 2. In some embodiments, each one of m and t is greater than 3. In some embodiments, each one of m and t is greater than 4. In some embodiments, each one of m and t is greater than 5. In some embodiments, each one of m and t is greater than 6. In some embodiments, each one of m and t is greater than 7. In some embodiments, each one of m and t is greater than 8. In some embodiments, each one of m and t is greater than 9. In some embodiments, each one of m and t is greater than 10. In some embodiments, each one of m and t is greater than 11. In some embodiments, each one of m and t is greater than 12.
  • each one of m and t is greater than 13. In some embodiments, each one of m and t is greater than 14. In some embodiments, each one of m and t is greater than 15. In some embodiments, each one of m and t is greater than 16. In some embodiments, each one of m and t is greater than 17. In some embodiments, each one of m and t is greater than 18. In some embodiments, each one of m and t is greater than 19. In some embodiments, each one of m and t is greater than 20.
  • the sum of m and t is greater than 3. In some embodiments, the sum of m and t is greater than 4. In some embodiments, the sum of m and t is greater than 5. In some embodiments, the sum of m and t is greater than 6. In some embodiments, the sum of m and t is greater than 7. In some embodiments, the sum of m and t is greater than 8. In some embodiments, the sum of m and t is greater than 9. In some embodiments, the sum of m and t is greater than 10. In some embodiments, the sum of m and t is greater than 11. In some embodiments, the sum of m and t is greater than 12. In some embodiments, the sum of m and t is greater than 13.
  • the sum of m and t is greater than 14. In some embodiments, the sum of m and t is greater than 15. In some embodiments, the sum of m and t is greater than 16. In some embodiments, the sum of m and t is greater than 17. In some embodiments, the sum of m and t is greater than 18. In some embodiments, the sum of m and t is greater than 19. In some embodiments, the sum of m and t is greater than 20. In some embodiments, the sum of m and t is greater than 21. In some embodiments, the sum of m and t is greater than 22. In some embodiments, the sum of m and t is greater than 23. In some embodiments, the sum of m and t is greater than 24. In some embodiments, the sum of m and t is greater than 25.
  • n is 1, and at least one of m and t is greater than 1. In some embodiments, n is 1 and each of m and t is independently greater than 1. In some embodiments, m>n and t>n. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp) 2 Rp(Sp) 2 . In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp) 2 Rp(Sp) 2 . In some embodiments, (Sp)t(Rp)n(Sp)m is SpRp(Sp) 2 .
  • (Np)t(Rp)n(Sp)m is (Np)tRp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is (Np) 2 Rp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is (Rp) 2 Rp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is (Sp) 2 Rp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is RpSpRp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is SpRpRp(Sp)m.
  • (Sp)t(Rp)n(Sp)m is SpRpSpSp. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp) 2 Rp(Sp) 2 . In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp) 3 Rp(Sp) 3 . In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp) 4 Rp(Sp) 4 . In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)tRp(Sp)s.
  • (Sp)t(Rp)n(Sp)m is SpRp(Sp)s. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp) 2 Rp(Sp) 5 . In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp) 3 Rp(Sp) 5 . In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp) 4 Rp(Sp). In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp) 5 Rp(Sp) 5 .
  • provided oligonucleotides are blockmers. In some embodiments, provided oligonucleotide are altmers. In some embodiments, provided oligonucleotides are altmers comprising alternating blocks.
  • a blockmer or an altmer can be defined by chemical modifications (including presence or absence), e.g., base modifications, sugar modification, internucleotidic linkage modifications, stereochemistry, etc., or patterns thereof. Example chemical modifications, stereochemistry and patterns thereof for a block and/or an alternating unit include but are not limited to those described in this disclosure, such as those described for an oligonucleotide, etc.
  • a blockmer comprises a pattern of . . . SS . . . RR . . . . .
  • an altmer comprises a pattern of SRSRSRSR.
  • a provided pattern of backbone chiral centers comprises repeating (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m units.
  • a repeating unit is (Sp)m(Rp)n.
  • a repeating unit is SpRp.
  • a repeating unit is SpSpRp.
  • a repeating unit is SpRpRp.
  • a repeating unit is SpRpRp.
  • a repeating unit is RpRpSp.
  • a repeating unit is (Rp)n(Sp)m.
  • a repeating unit is (Np)t(Rp)n(Sp)m.
  • a repeating unit is (Sp)t(Rp)n(Sp)m.
  • a provided pattern of backbone chiral centers is or comprises (Rp/Sp)x-(All Rp or All Sp)-(Rp/Sp)y. In some embodiments, a provided pattern of backbone chiral centers is or comprises (Rp/Sp)-(All Rp or All Sp)-(Rp/Sp). In some embodiments, a provided pattern of backbone chiral centers is or comprises (Rp)x-(All Sp)-(Rp)y. In some embodiments, a provided pattern of backbone chiral centers is or comprises (Rp)-(All Sp)-(Rp).
  • a provided pattern of backbone chiral centers is or comprises (Sp)x-(All Rp)-(Sp)y. In some embodiments, a provided pattern of backbone chiral centers is or comprises (Sp)-(All Rp)-(Sp). In some embodiments, a provided pattern of backbone chiral centers is or comprises (Rp/Sp)x-(repeating (Sp)m(Rp)n)-(Rp/Sp)y. In some embodiments, a provided pattern of backbone chiral centers is or comprises (Rp/Sp)-(repeating (Sp)m(Rp)n)-(Rp/Sp).
  • a provided pattern of backbone chiral centers is or comprises (Rp/Sp)x-(repeating SpSpRp)-(Rp/Sp)y. In some embodiments, a provided pattern of backbone chiral centers is or comprises (Rp/Sp)-(repeating SpSpRp)-(Rp/Sp).
  • a provided oligonucleotide comprises any pattern of stereochemistry or any sugar modification described herein.
  • a modified sugar moiety comprises a 2′-modification. In some embodiments, a modified sugar moiety comprises a 2′-modification. In some embodiments, a 2′-modification is 2′-OR 1 . In some embodiments, a 2′-modification is a 2′-OMe. In some embodiments, a 2′-modification is a 2′-MOE. In some embodiments, a 2′-modification is an LNA sugar modification. In some embodiments, a 2′-modification is 2′-F. In some embodiments, each sugar modification is independently a 2′-modification. In some embodiments, each sugar modification is independently 2′-OR 1 or 2′-F.
  • each sugar modification is independently 2′-OR 1 or 2′-F, wherein R 1 is optionally substituted C 1-6 alkyl. In some embodiments, each sugar modification is independently 2′-OR 1 or 2′-F, wherein at least one is 2′-F. In some embodiments, each sugar modification is independently 2′-OR′ or 2′-F, wherein R 1 is optionally substituted C 1-6 alkyl, and wherein at least one is 2′-OR 1 . In some embodiments, each sugar modification is independently 2′-OR 1 or 2′-F, wherein at least one is 2′-F, and at least one is 2′-OR 1 . In some embodiments, each sugar modification is independently 2′-OR 1 or 2′-F, wherein R 1 is optionally substituted C 1-6 alkyl, and wherein at least one is 2′-F, and at least one is 2′-OR 1 .
  • 5% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 10% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 15% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 20% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 25% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 30% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 35% or more of the sugar moieties of provided oligonucleotides are modified.
  • 40% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 45% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 50% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 55% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 60% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 65% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 70% or more of the sugar moieties of provided oligonucleotides are modified.
  • sugar moieties of provided oligonucleotides are modified. In some embodiments, 80% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 85% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 90% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, 95% or more of the sugar moieties of provided oligonucleotides are modified. In some embodiments, each sugar moiety of provided oligonucleotides is modified. In some embodiments, a modified sugar moiety comprises a 2′-modification.
  • a modified sugar moiety comprises a 2′-modification.
  • a 2′-modification is 2′-OR 1 .
  • a 2′-modification is a 2′-OMe.
  • a 2′-modification is a 2′-MOE.
  • a 2′-modification is an LNA sugar modification.
  • a 2′-modification is 2′-F.
  • each sugar modification is independently a 2′-modification.
  • each sugar modification is independently 2′-OR 1 or 2′-F.
  • each sugar modification is independently 2′-OR 1 or 2′-F, wherein R 1 is optionally substituted C 1-6 alkyl. In some embodiments, each sugar modification is independently 2′-OR 1 or 2′-F, wherein at least one is 2′-F. In some embodiments, each sugar modification is independently 2′-OR 1 or 2′-F, wherein R 1 is optionally substituted C 1-6 alkyl, and wherein at least one is 2′-OR 1 . In some embodiments, each sugar modification is independently 2′-OR 1 or 2′-F, wherein at least one is 2′-F, and at least one is 2′-OR 1 . In some embodiments, each sugar modification is independently 2′-OR 1 or 2′-F, wherein R 1 is optionally substituted C 1-6 alkyl, and wherein at least one is 2′-F, and at least one is 2′-OR 1 .
  • a nucleoside comprising a 2′-modification is followed by a modified internucleotidic linkage. In some embodiments, a nucleoside comprising a 2′-modification is preceded by a modified internucleotidic linkage. In some embodiments, a modified internucleotidic linkage is a chiral internucleotidic linkage. In some embodiments, a modified internucleotidic linkage is a phosphorothioate. In some embodiments, a chiral internucleotidic linkage is Sp.
  • a nucleoside comprising a 2′-modification is followed by an Sp chiral internucleotidic linkage.
  • a nucleoside comprising a 2′-F is followed by an Sp chiral internucleotidic linkage.
  • a nucleoside comprising a 2′-modification is preceded by an Sp chiral internucleotidic linkage.
  • a nucleoside comprising a 2′-F is preceded by an Sp chiral internucleotidic linkage.
  • a chiral internucleotidic linkage is Rp.
  • a nucleoside comprising a 2′-modification is followed by an Rp chiral internucleotidic linkage. In some embodiments, a nucleoside comprising a 2′-F is followed by an Rp chiral internucleotidic linkage. In some embodiments, a nucleoside comprising a 2′-modification is preceded by an Rp chiral internucleotidic linkage. In some embodiments, a nucleoside comprising a 2′-F is preceded by an Rp chiral internucleotidic linkage.
  • Provided oligonucleotides can comprise various number of natural phosphate linkages. In some embodiments, provided oligonucleotides comprise no natural phosphate linkages. In some embodiments, provided oligonucleotides comprise one natural phosphate linkage. In some embodiments, provided oligonucleotides comprise 1 to 30 or more natural phosphate linkages. In some embodiments, provided oligonucleotides comprise about 25 or more consecutive modified sugar moieties. In some embodiments, provided oligonucleotides comprise about 1 to 20 or more consecutive modified sugar moieties. In some embodiments, provided oligonucleotides comprise no more than about 5% to 90% unmodified sugar moieties.
  • each sugar moiety of the oligonucleotides of the first plurality is independently modified.
  • provided oligonucleotides are capable of directing a decrease in the expression, level and/or activity of a C9orf72 target gene or its gene product.
  • each oligonucleotide of the first plurality comprises one or more modified sugar moieties and modified internucleotidic linkages. In some embodiments, each oligonucleotide of the first plurality comprises two or more modified sugar moieties. In some embodiments, each oligonucleotide of the first plurality comprises three or more modified sugar moieties. In some embodiments, each oligonucleotide of the first plurality comprises four or more modified sugar moieties. In some embodiments, each oligonucleotide of the first plurality comprises five or more modified sugar moieties. In some embodiments, each oligonucleotide of the first plurality comprises ten or more modified sugar moieties.
  • each oligonucleotide of the first plurality comprises about 15 or more modified sugar moieties. In some embodiments, each oligonucleotide of the first plurality comprises about 20 or more modified sugar moieties. In some embodiments, each oligonucleotide of the first plurality comprises about 25 or more modified sugar moieties.
  • each oligonucleotide of the first plurality comprises two or more modified internucleotidic linkages. In some embodiments, each oligonucleotide of the first plurality comprises three or more modified internucleotidic linkages. In some embodiments, each oligonucleotide of the first plurality comprises four or more modified internucleotidic linkages. In some embodiments, each oligonucleotide of the first plurality comprises five or more modified internucleotidic linkages. In some embodiments, each oligonucleotide of the first plurality comprises ten or more modified internucleotidic linkages.
  • each oligonucleotide of the first plurality comprises about 15 or more modified internucleotidic linkages. In some embodiments, each oligonucleotide of the first plurality comprises about 20 or more modified internucleotidic linkages. In some embodiments, each oligonucleotide of the first plurality comprises about 25 or more modified internucleotidic linkages.
  • about 5% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 10% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 20% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 30% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages.
  • about 40% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 50% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 60% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 70% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages.
  • about 80% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 85% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 90% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages. In some embodiments, about 95% of the internucleotidic linkages in each oligonucleotide of the first plurality are modified internucleotidic linkages.
  • oligonucleotide compositions are surprisingly effective.
  • desired biological effects e.g., as measured by decreased levels of undesired mRNA, proteins, etc.
  • desired biological effects can be enhanced by more than 5, 10, 15, 20, 25, 30, 40, 50, or 100 fold.
  • a change is measured by increase of a desired mRNA level compared to a reference condition.
  • a change is measured by decrease of an undesired mRNA level compared to a reference condition.
  • a reference condition is absence of oligonucleotide treatment.
  • a reference condition is a stereorandom composition of oligonucleotides having the same base sequence and chemical modifications.
  • provided oligonucleotides contain increased levels of one or more isotopes.
  • provided oligonucleotides are labeled, e.g., by one or more isotopes of one or more elements, e.g., hydrogen, carbon, nitrogen, etc.
  • provided oligonucleotides in provided compositions e.g., oligonucleotides of a first plurality, comprise base modifications, sugar modifications, and/or internucleotidic linkage modifications, wherein the oligonucleotides contain an enriched level of deuterium.
  • provided oligonucleotides are labeled with deuterium (replacing — 1 H with — 2 H) at one or more positions.
  • one or more 1 H of an oligonucleotide or any moiety conjugated to the oligonucleotide is substituted with 2 H.
  • Such oligonucleotides can be used in any composition or method described herein.
  • the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides which:
  • each of the consecutive nucleoside units is independently preceded and/or followed by a modified internucleotidic linkage. In some embodiments, each of the consecutive nucleoside units is independently preceded and/or followed by a phosphorothioate linkage. In some embodiments, each of the consecutive nucleoside units is independently preceded and/or followed by a chirally controlled modified internucleotidic linkage. In some embodiments, each of the consecutive nucleoside units is independently preceded and/or followed by a chirally controlled phosphorothioate linkage. In some embodiments, a modified internucleotidic linkage has a structure of Formula I. In some embodiments, a modified internucleotidic linkage has a structure of Formula I-a.
  • a modified internucleotidic linkage has a structure of Formula I. In some embodiments, a modified internucleotidic linkage has a structure of Formula I-a.
  • a common base sequence and length may be referred to as a common base sequence.
  • oligonucleotides having a common base sequence may have the same pattern of nucleoside modifications, e.g., sugar modifications, base modifications, etc.
  • a pattern of nucleoside modifications may be represented by a combination of locations and modifications.
  • a pattern of backbone linkages comprises locations and types (e.g., phosphate, phosphorothioate, substituted phosphorothioate, etc.) of each internucleotidic linkages.
  • a pattern of backbone chiral centers of an oligonucleotide can be designated by a combination of linkage phosphorus stereochemistry (Rp/Sp) from 5′ to 3′.
  • Rp/Sp linkage phosphorus stereochemistry
  • locations of non-chiral linkages may be obtained, for example, from pattern of backbone linkages.
  • a stereorandom or racemic preparation of oligonucleotides is prepared by non-stereoselective and/or low-stereoselective coupling of nucleotide monomers, typically without using any chiral auxiliaries, chiral modification reagents, and/or chiral catalysts.
  • all or most coupling steps are not chirally controlled in that the coupling steps are not specifically conducted to provide enhanced stereoselectivity.
  • substantially racemic preparation of oligonucleotides is the preparation of phosphorothioate oligonucleotides through sulfurizing phosphite triesters from commonly used phosphoramidite oligonucleotide synthesis with either tetraethylthiuram disulfide or (TETD) or 3H-1, 2-bensodithiol-3-one 1, 1-dioxide (BDTD), a well-known process in the art.
  • substantially racemic preparation of oligonucleotides provides substantially racemic oligonucleotide compositions (or chirally uncontrolled oligonucleotide compositions).
  • At least one coupling of a nucleotide monomer has a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • at least two couplings of a nucleotide monomer have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • At least three couplings of a nucleotide monomer have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • at least four couplings of a nucleotide monomer have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • At least five couplings of a nucleotide monomer have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • each coupling of a nucleotide monomer independently has a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • At least one internucleotidic linkage in a stereorandom or racemic preparations, has a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least two internucleotidic linkages have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • At least three internucleotidic linkages have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • at least four internucleotidic linkages have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • At least five internucleotidic linkages have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • each internucleotidic linkage independently has a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
  • a diastereoselectivity is lower than about 60:40.
  • a diastereoselectivity is lower than about 70:30.
  • a diastereoselectivity is lower than about 80:20. In some embodiments, a diastereoselectivity is lower than about 90:10. In some embodiments, a diastereoselectivity is lower than about 91:9. In some embodiments, a diastereoselectivity is lower than about 92:8. In some embodiments, a diastereoselectivity is lower than about 93:7. In some embodiments, a diastereoselectivity is lower than about 94:6. In some embodiments, a diastereoselectivity is lower than about 95:5. In some embodiments, a diastereoselectivity is lower than about 96:4.
  • a diastereoselectivity is lower than about 97:3. In some embodiments, a diastereoselectivity is lower than about 98:2. In some embodiments, a diastereoselectivity is lower than about 99:1. In some embodiments, at least one coupling has a diastereoselectivity lower than about 90:10. In some embodiments, at least two couplings have a diastereoselectivity lower than about 90:10. In some embodiments, at least three couplings have a diastereoselectivity lower than about 90:10. In some embodiments, at least four couplings have a diastereoselectivity lower than about 90:10.
  • At least five couplings have a diastereoselectivity lower than about 90:10. In some embodiments, each coupling independently has a diastereoselectivity lower than about 90:10. In some embodiments, at least one internucleotidic linkage has a diastereoselectivity lower than about 90:10. In some embodiments, at least two internucleotidic linkages have a diastereoselectivity lower than about 90:10. In some embodiments, at least three internucleotidic linkages have a diastereoselectivity lower than about 90:10. In some embodiments, at least four internucleotidic linkages have a diastereoselectivity lower than about 90:10.
  • At least five internucleotidic linkages have a diastereoselectivity lower than about 90:10. In some embodiments, each internucleotidic linkage independently has a diastereoselectivity lower than about 90:10.
  • a chirally controlled internucleotidic linkage such as those of oligonucleotides of chirally controlled C9orf72 oligonucleotide compositions, has a diastereoselectivity of 90:10 or more.
  • each chirally controlled internucleotidic linkage such as those of oligonucleotides of chirally controlled C9orf72 oligonucleotide compositions, has a diastereoselectivity of 90:10 or more.
  • the selectivity is 91:9 or more.
  • the selectivity is 92:8 or more.
  • the selectivity is 97:3 or more.
  • the selectivity is 94:6 or more. In some embodiments, the selectivity is 95:5 or more. In some embodiments, the selectivity is 96:4 or more. In some embodiments, the selectivity is 97:3 or more. In some embodiments, the selectivity is 98:2 or more. In some embodiments, the selectivity is 99:1 or more.
  • diastereoselectivity of a coupling or a linkage can be assessed through the diastereoselectivity of a dimer formation under the same or comparable conditions, wherein the dimer has the same 5′- and 3′-nucleosides and internucleotidic linkage.
  • the present disclosure provides chirally controlled (and/or stereochemically pure) oligonucleotide compositions comprising a first plurality of oligonucleotides defined by having:
  • the present disclosure provides chirally controlled C9orf72 oligonucleotide composition of a first plurality of oligonucleotides in that the composition is enriched, relative to a substantially racemic preparation of the same oligonucleotides, for oligonucleotides of a single oligonucleotide type.
  • the present disclosure provides chirally controlled C9orf72 oligonucleotide composition of a first plurality of oligonucleotides in that the composition is enriched, relative to a substantially racemic preparation of the same oligonucleotides, for oligonucleotides of a single oligonucleotide type that share:
  • oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have identical structures.
  • oligonucleotides of an oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of sugar modifications. In some embodiments, oligonucleotides of an oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, oligonucleotides of an oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides of an oligonucleotide type are identical.
  • a C9orf72 oligonucleotide is a substantially pure preparation of an oligonucleotide type in that oligonucleotides in the composition that are not of the oligonucleotide type are impurities form the preparation process of said oligonucleotide type, in some case, after certain purification procedures.
  • oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of sugar modifications.
  • oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers are identical.
  • oligonucleotides in provided compositions have a common pattern of backbone phosphorus modifications.
  • a common base sequence is a base sequence of an oligonucleotide type.
  • a provided composition is an oligonucleotide composition that is chirally controlled in that the composition contains a non-random or controlled level of a first plurality of C9orf72 oligonucleotides of an individual oligonucleotide type, wherein an oligonucleotide type is defined by:
  • the base sequence of an oligonucleotide may refer to the identity and/or modification status of nucleoside residues (e.g., of sugar and/or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil) in the oligonucleotide and/or to the hybridization character (i.e., the ability to hybridize with particular complementary residues) of such residues.
  • nucleoside residues e.g., of sugar and/or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil
  • a particular oligonucleotide type may be defined by
  • purity of a C9orf72 oligonucleotide can be controlled by stereoselectivity of each coupling step in its preparation process.
  • a coupling step has a stereoselectivity (e.g., diastereoselectivity) of 60% (60% of the new internucleotidic linkage formed from the coupling step has the intended stereochemistry). After such a coupling step, the new internucleotidic linkage formed may be referred to have a 60% purity.
  • each coupling step has a stereoselectivity of at least 60%. In some embodiments, each coupling step has a stereoselectivity of at least 70%.
  • each coupling step has a stereoselectivity of at least 80%. In some embodiments, each coupling step has a stereoselectivity of at least 85%. In some embodiments, each coupling step has a stereoselectivity of at least 90%. In some embodiments, each coupling step has a stereoselectivity of at least 91%. In some embodiments, each coupling step has a stereoselectivity of at least 92%. In some embodiments, each coupling step has a stereoselectivity of at least 93%. In some embodiments, each coupling step has a stereoselectivity of at least 94%. In some embodiments, each coupling step has a stereoselectivity of at least 95%.
  • each coupling step has a stereoselectivity of at least 96%. In some embodiments, each coupling step has a stereoselectivity of at least 97%. In some embodiments, each coupling step has a stereoselectivity of at least 98%. In some embodiments, each coupling step has a stereoselectivity of at least 99%. In some embodiments, each coupling step has a stereoselectivity of at least 99.5%. In some embodiments, each coupling step has a stereoselectivity of virtually 100%. In some embodiments, a coupling step has a stereoselectivity of virtually 100% in that all detectable product from the coupling step by an analytical method (e.g., NMR, HPLC, etc) has the intended stereoselectivity.
  • an analytical method e.g., NMR, HPLC, etc
  • oligonucleotide structural elements e.g., patterns of chemical modifications, backbone linkages, backbone chiral centers, and/or backbone phosphorus modifications
  • can provide surprisingly improved properties such as bioactivities.
  • provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides that include one or more modified backbone linkages, bases, and/or sugars.
  • provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 15 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 16 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 17 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 18 bases.
  • provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 19 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 20 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 21 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 22 bases.
  • provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 23 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 24 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 25 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 bases.
  • provided compositions comprise oligonucleotides containing one or more residues which are modified at the sugar moiety. In some embodiments, provided compositions comprise oligonucleotides containing one or more residues which are modified at the 2′ position of the sugar moiety (referred to herein as a “2′-modification”). Examples of such modifications are described above and herein and include, but are not limited to, 2′-OMe, 2′-MOE, 2′-LNA, 2′-F, FRNA, FANA, 5′-vinyl, Morpholino, S-cEt, etc. In some embodiments, provided compositions comprise oligonucleotides containing one or more residues which are 2′-modified.
  • provided oligonucleotides contain one or more residues which are 2′-O-methoxyethyl (2′-MOE)-modified residues.
  • provided compositions comprise oligonucleotides which do not contain any 2′-modifications.
  • provided compositions are oligonucleotides which do not contain any 2′-MOE residues. That is, in some embodiments, provided oligonucleotides are not MOE-modified. Additional example sugar modifications are described in the present disclosure.
  • one or more is one. In some embodiments, one or more is two. In some embodiments, one or more is three. In some embodiments, one or more is four. In some embodiments, one or more is five. In some embodiments, one or more is six. In some embodiments, one or more is seven. In some embodiments, one or more is eight. In some embodiments, one or more is nine. In some embodiments, one or more is ten. In some embodiments, one or more is at least one. In some embodiments, one or more is at least two. In some embodiments, one or more is at least three. In some embodiments, one or more is at least four. In some embodiments, one or more is at least five. In some embodiments, one or more is at least six. In some embodiments, one or more is at least seven. In some embodiments, one or more is at least eight. In some embodiments, one or more is at least nine. In some embodiments, one or more is at least ten.
  • provided oligonucleotide compositions and methods have various uses as known by a person having ordinary skill in the art. Methods for assessing provided compositions, and properties and uses thereof, are also widely known and practiced by a person having ordinary skill in the art. Example properties, uses, and/or methods include but are not limited to those described in WO/2014/012081 and WO/2015/107425.
  • a chiral internucleotidic linkage has the structure of Formula I. In some embodiments, a chiral internucleotidic linkage is phosphorothioate. In some embodiments, each chiral internucleotidic linkage in a single oligonucleotide of a provided composition independently has the structure of Formula I. In some embodiments, each chiral internucleotidic linkage in a single oligonucleotide of a provided composition is a phosphorothioate.
  • oligonucleotides of the present disclosure comprise one or more modified sugar moieties.
  • C9orf72 oligonucleotides of the present disclosure comprise one or more modified base moieties.
  • various modifications can be introduced to a sugar and/or moiety.
  • a modification is a modification described in U.S. Pat. No. 9,006,198, WO2014/012081 and WO/2015/107425, the sugar and base modifications of each of which are incorporated herein by reference.
  • a sugar modification is a 2′-modification.
  • Commonly used 2′-modifications include but are not limited to 2′-OR 1 , wherein R 1 is not hydrogen.
  • a modification is 2′-OR, wherein R is optionally substituted aliphatic.
  • a modification is 2′-OMe.
  • a modification is 2′-O-MOE.
  • the present disclosure demonstrates that inclusion and/or location of particular chirally pure internucleotidic linkages can provide stability improvements comparable to or better than those achieved through use of modified backbone linkages, bases, and/or sugars.
  • a provided single oligonucleotide of a provided composition has no modifications on the sugars. In some embodiments, a provided single oligonucleotide of a provided composition has no modifications on 2′-positions of the sugars (i.e., the two groups at the 2′-position are either —H/—H or -H/—OH). In some embodiments, a provided single oligonucleotide of a provided composition does not have any 2′-MOE modifications.
  • a 2′-modification is —O-L- or -L-which connects the 2′-carbon of a sugar moiety to another carbon of a sugar moiety.
  • a 2′-modification is —O-L- or -L-which connects the 2′-carbon of a sugar moiety to the 4′-carbon of a sugar moiety.
  • a 2′-modification is S-cEt.
  • a modified sugar moiety is an LNA moiety.
  • a 2′-modification is —F. In some embodiments, a 2′-modification is FANA. In some embodiments, a 2′-modification is FRNA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Saccharide Compounds (AREA)
US16/636,900 2017-08-08 2018-08-07 Oligonucleotide compositions and methods thereof Abandoned US20200362337A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/636,900 US20200362337A1 (en) 2017-08-08 2018-08-07 Oligonucleotide compositions and methods thereof

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201762542778P 2017-08-08 2017-08-08
US16/636,900 US20200362337A1 (en) 2017-08-08 2018-08-07 Oligonucleotide compositions and methods thereof
PCT/US2018/045653 WO2019032607A1 (en) 2017-08-08 2018-08-07 OLIGONUCLEOTIDE COMPOSITIONS AND RELATED METHODS

Publications (1)

Publication Number Publication Date
US20200362337A1 true US20200362337A1 (en) 2020-11-19

Family

ID=65271538

Family Applications (3)

Application Number Title Priority Date Filing Date
US16/636,900 Abandoned US20200362337A1 (en) 2017-08-08 2018-08-07 Oligonucleotide compositions and methods thereof
US16/636,902 Active 2038-10-25 US11739325B2 (en) 2017-08-08 2018-08-07 Oligonucleotide compositions and methods thereof
US18/613,034 Pending US20250066775A1 (en) 2017-08-08 2024-03-21 Oligonucleotide compositions and methods thereof

Family Applications After (2)

Application Number Title Priority Date Filing Date
US16/636,902 Active 2038-10-25 US11739325B2 (en) 2017-08-08 2018-08-07 Oligonucleotide compositions and methods thereof
US18/613,034 Pending US20250066775A1 (en) 2017-08-08 2024-03-21 Oligonucleotide compositions and methods thereof

Country Status (11)

Country Link
US (3) US20200362337A1 (enrdf_load_stackoverflow)
EP (2) EP3664816A4 (enrdf_load_stackoverflow)
JP (3) JP2020534253A (enrdf_load_stackoverflow)
KR (1) KR20200035301A (enrdf_load_stackoverflow)
CN (2) CN111032057A (enrdf_load_stackoverflow)
AR (1) AR112779A1 (enrdf_load_stackoverflow)
AU (1) AU2018316159A1 (enrdf_load_stackoverflow)
CA (1) CA3072076A1 (enrdf_load_stackoverflow)
SG (1) SG11202000274RA (enrdf_load_stackoverflow)
TW (1) TW201920672A (enrdf_load_stackoverflow)
WO (2) WO2019032607A1 (enrdf_load_stackoverflow)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11149264B2 (en) 2018-02-12 2021-10-19 Ionis Pharmaceuticals, Inc. Modified compounds and uses thereof
US11208430B2 (en) 2014-08-22 2021-12-28 Noogen Llc Modified oligonucleotides and methods for their synthesis
US11407775B2 (en) 2016-03-13 2022-08-09 Wave Life Sciences Ltd. Compositions and methods for phosphoramidite and oligonucleotide synthesis
US11597927B2 (en) 2017-06-02 2023-03-07 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
US11596646B2 (en) 2017-10-12 2023-03-07 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11603532B2 (en) 2017-06-02 2023-03-14 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
US11608355B2 (en) 2017-09-18 2023-03-21 Wave Life Sciences Ltd. Technologies for oligonucleotide preparation
US20230098111A1 (en) * 2020-01-28 2023-03-30 University Of Southern California Compositions and methods to treat neurological diseases
US11634710B2 (en) 2015-07-22 2023-04-25 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11643657B2 (en) 2012-07-13 2023-05-09 Wave Life Sciences Ltd. Chiral control
US11718638B2 (en) 2017-06-21 2023-08-08 Wave Life Sciences Ltd. Compounds, compositions and methods for synthesis
US11739325B2 (en) 2017-08-08 2023-08-29 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11873316B2 (en) 2016-11-23 2024-01-16 Wave Life Sciences Ltd. Compositions and methods for phosphoramidite and oligonucleotide synthesis
US20240392290A1 (en) * 2018-06-14 2024-11-28 University Of Utah Research Foundation Staufen1 regulating agents and associated methods
US12180472B2 (en) 2014-01-16 2024-12-31 Wave Life Sciences Ltd. Chiral design
US12391942B2 (en) 2018-05-11 2025-08-19 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
US12403156B2 (en) 2016-06-03 2025-09-02 Wave Life Sciences Ltd. Oligonucleotides, compositions and methods thereof
US12409189B2 (en) 2023-05-31 2025-09-09 University Of Utah Research Foundation STAUFEN1 agents and associated methods

Families Citing this family (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
TW201722439A (zh) 2015-10-09 2017-07-01 波濤生命科學有限公司 寡核苷酸組合物及其方法
MA45270A (fr) 2016-05-04 2017-11-09 Wave Life Sciences Ltd Compositions d'oligonucléotides et procédés associés
AU2017281497B2 (en) 2016-06-22 2023-04-06 Proqr Therapeutics Ii B.V. Single-stranded RNA-editing oligonucleotides
PL3507366T3 (pl) 2016-09-01 2021-05-04 Proqr Therapeutics Ii B.V. Chemicznie modyfikowane jednoniciowe oligonukleotydy edytujące rna
GB201808146D0 (en) 2018-05-18 2018-07-11 Proqr Therapeutics Ii Bv Stereospecific Linkages in RNA Editing Oligonucleotides
WO2020117772A1 (en) 2018-12-06 2020-06-11 Biogen Ma Inc. Neurofilament protein for guiding therapeutic intervention in amyotrophic lateral sclerosis
CA3126845A1 (en) * 2019-02-01 2020-08-06 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
CA3162618A1 (en) * 2019-03-20 2020-09-24 Peter Jungsoo PARK Antisense oligonucleotide-based progranulin augmentation therapy in neurodegenerative diseases
US11629347B2 (en) 2019-05-06 2023-04-18 University Of Massachusetts Anti-C9ORF72 oligonucleotides and related methods
CN114502177A (zh) * 2019-05-09 2022-05-13 波涛生命科学有限公司 寡核苷酸组合物及其使用方法
US20220267776A1 (en) * 2019-07-05 2022-08-25 University Of Florida Research Foundation, Incorporated Methods for treating ran protein-associated neurological diseases
KR20220070324A (ko) * 2019-10-06 2022-05-30 웨이브 라이프 사이언시스 리미티드 올리고뉴클레오티드 조성물 및 이의 이용 방법
WO2021159008A2 (en) 2020-02-07 2021-08-12 Maze Therapeutics, Inc. Compositions and methods for treating neurodegenerative diseases
CN115516093A (zh) * 2020-04-09 2022-12-23 肌肉学研究协会 用于治疗肌萎缩侧索硬化症的反义序列
KR20230016201A (ko) 2020-05-22 2023-02-01 웨이브 라이프 사이언시스 리미티드 이중 가닥 올리고뉴클레오티드 조성물 및 이와 관련된 방법
AU2022255175A1 (en) 2021-04-06 2023-11-23 Trace Neuroscience, Inc. Compositions and methods for treating tdp-43 proteinopathy
TW202308663A (zh) * 2021-06-04 2023-03-01 美商艾拉倫製藥股份有限公司 人類染色體９開讀框７２（Ｃ９ＯＲＦ７２）ｉＲＮＡ劑組成物及其使用方法
EP4479535A1 (en) 2022-02-14 2024-12-25 ProQR Therapeutics II B.V. Guide oligonucleotides for nucleic acid editing in the treatment of hypercholesterolemia
EP4522742A2 (en) 2022-05-13 2025-03-19 Alnylam Pharmaceuticals, Inc. Single-stranded loop oligonucleotides
WO2024013361A1 (en) 2022-07-15 2024-01-18 Proqr Therapeutics Ii B.V. Oligonucleotides for adar-mediated rna editing and use thereof
EP4555085A1 (en) 2022-07-15 2025-05-21 ProQR Therapeutics II B.V. Chemically modified oligonucleotides for adar-mediated rna editing
CN120283053A (zh) 2022-10-05 2025-07-08 追踪神经科学公司 Unc13a反义寡核苷酸和其用途
GB202215614D0 (en) 2022-10-21 2022-12-07 Proqr Therapeutics Ii Bv Heteroduplex rna editing oligonucleotide complexes
AR131145A1 (es) 2022-11-24 2025-02-19 Proqr Therapeutics Ii Bv Oligonucleótidos antisentido para el tratamiento de hemocromatosis hfe hereditaria
GB202218090D0 (en) 2022-12-01 2023-01-18 Proqr Therapeutics Ii Bv Antisense oligonucleotides for the treatment of aldehyde dehydrogenase 2 deficiency
WO2024121373A1 (en) 2022-12-09 2024-06-13 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of cardiovascular disease
GB202300865D0 (en) 2023-01-20 2023-03-08 Proqr Therapeutics Ii Bv Delivery of oligonucleotides
WO2024175550A1 (en) 2023-02-20 2024-08-29 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of atherosclerotic cardiovascular disease
KR102599078B1 (ko) 2023-03-21 2023-11-06 고아라 큐티클 케어 세트 및 이를 이용한 큐티클 케어 방법
WO2024206175A1 (en) 2023-03-24 2024-10-03 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of neurological disorders
GB202304363D0 (en) 2023-03-24 2023-05-10 Proqr Therapeutics Ii Bv Chemically modified antisense oligonucleotides for use in RNA editing
WO2024200472A1 (en) 2023-03-27 2024-10-03 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of liver disease
WO2024238385A2 (en) 2023-05-12 2024-11-21 Alnylam Pharmaceuticals, Inc. Single-stranded loop oligonucleotides
WO2024256620A1 (en) 2023-06-16 2024-12-19 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of neurodegenerative disease
WO2025015335A1 (en) 2023-07-13 2025-01-16 Korro Bio, Inc. Rna-editing oligonucleotides and uses thereof
WO2025051946A1 (en) 2023-09-07 2025-03-13 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of metabolic disorders
WO2025096809A1 (en) 2023-10-31 2025-05-08 Korro Bio, Inc. Oligonucleotides comprising phosphoramidate internucleotide linkages
WO2025104239A1 (en) 2023-11-16 2025-05-22 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of classic galactosemia
WO2025128799A1 (en) 2023-12-12 2025-06-19 Korro Bio, Inc. Double-stranded rna-editing oligonucleotides and uses thereof
WO2025132708A1 (en) 2023-12-20 2025-06-26 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of huntington's disease

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017062862A2 (en) * 2015-10-09 2017-04-13 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
WO2017079291A1 (en) * 2015-11-02 2017-05-11 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating c90rf72

Family Cites Families (69)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6242589B1 (en) * 1998-07-14 2001-06-05 Isis Pharmaceuticals, Inc. Phosphorothioate oligonucleotides having modified internucleoside linkages
US6867295B2 (en) * 2001-09-07 2005-03-15 Dionex Corporation Ion exchange cryptands covalently bound to substrates
JP4348044B2 (ja) 2002-02-12 2009-10-21 株式会社キラルジェン 立体規則性の高いジヌクレオシドホスホロチオエートの製造法
AU2003254334A1 (en) 2002-07-10 2004-02-02 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Rna-interference by single-stranded rna molecules
WO2004014933A1 (en) 2002-08-07 2004-02-19 University Of Massachusetts Compositions for rna interference and methods of use thereof
JP2005089441A (ja) 2003-08-08 2005-04-07 Toudai Tlo Ltd 立体規則性の高いリン原子修飾ヌクレオチド類縁体の製造法
WO2005023828A1 (ja) 2003-09-02 2005-03-17 Takeshi Wada リボヌクレオチド又はリボヌクレオチド誘導体の製造方法
JP4616175B2 (ja) 2003-09-02 2011-01-19 株式会社キラルジェン ５’−ホスフィチル化モノマーおよびｈ−ホスホネートオリゴヌクレオチド誘導体の製造方法
WO2005070859A1 (ja) 2004-01-27 2005-08-04 Takeshi Wada フルオラス担体およびそれを用いたオリゴヌクレオチド誘導体の製造方法
WO2005085272A1 (ja) 2004-03-05 2005-09-15 Takeshi Wada ボラノホスフェートモノマーおよびそれを用いたオリゴヌクレオチド誘導体の製造方法
JP4865544B2 (ja) 2004-03-25 2012-02-01 株式会社キラルジェン 立体規則性の高いリボヌクレオチド類縁体及びデオキシリボヌクレオチド類縁体の製造法
CA2667055C (en) 2006-10-18 2017-05-09 Isis Pharmaceuticals, Inc. Antisense compounds
RU2015151857A (ru) 2008-12-02 2019-01-15 Уэйв Лайф Сайенсес Джапан, Инк. Способ синтеза модифицированных по атому фосфора нуклеиновых кислот
SG10201403841QA (en) * 2009-07-06 2014-09-26 Ontorii Inc Novel nucleic acid prodrugs and methods of use thereof
CN102574888A (zh) 2009-09-16 2012-07-11 株式会社启拉坚 用于rna及其衍生物的合成的新型保护基
EP3208347B1 (en) * 2010-02-08 2019-08-14 Ionis Pharmaceuticals, Inc. Selective reduction of allelic variants
JP5847700B2 (ja) 2010-03-05 2016-01-27 株式会社Ｗａｖｅ Ｌｉｆｅ Ｓｃｉｅｎｃｅｓ Ｊａｐａｎ リボヌクレオシドホスホロチオエートの製造方法
US20140011860A1 (en) * 2010-07-19 2014-01-09 Isis Pharmaceuticals, Inc. Compounds and methods for modulating target nuclear and sub-nuclear nucleic acid molecules in cells and animals
DK2620428T3 (da) 2010-09-24 2019-07-01 Wave Life Sciences Ltd Asymmetrisk hjælpegruppe
US8822671B2 (en) 2010-11-30 2014-09-02 The University Of Tokyo 2'-O-modified RNA
DK2734208T3 (en) 2011-07-19 2017-06-19 Wave Life Sciences Ltd PROCEDURES FOR SYNTHESIS OF FUNCTIONALIZED NUCLEIC ACIDS
CA2846307C (en) 2011-08-31 2020-03-10 Hospital District Of Helsinki And Uusimaa Method for diagnosing a neurodegenerative disease
EP2812433A4 (en) 2012-02-08 2016-01-20 Isis Pharmaceuticals Inc METHOD AND COMPOSITIONS FOR MODULATING THE FACTOR VII EXPRESSION
US9914922B2 (en) 2012-04-20 2018-03-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
SG10201912895PA (en) 2012-07-13 2020-02-27 Wave Life Sciences Ltd Chiral control
AU2013287630B2 (en) 2012-07-13 2017-05-25 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
DK2906696T4 (da) 2012-10-15 2023-02-27 Ionis Pharmaceuticals Inc Fremgangsmåder til modulering af c9orf72-ekspression
SG10201808903UA (en) * 2013-10-11 2018-11-29 Ionis Pharmaceuticals Inc Compositions for modulating c9orf72 expression
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
AU2015207773B2 (en) 2014-01-16 2021-06-17 Wave Life Sciences Ltd. Chiral design
WO2015168172A1 (en) * 2014-04-28 2015-11-05 Isis Pharmaceuticals, Inc. Linkage modified oligomeric compounds
WO2016024205A1 (en) * 2014-08-15 2016-02-18 Pfizer Inc. Oligomers targeting hexanucleotide repeat expansion in human c9orf72 gene
BR112017017178A2 (pt) * 2015-02-26 2018-04-03 Ionis Pharmaceuticals Inc moduladores específicos de alelo de rodopsina de p23h
HUE049233T2 (hu) 2015-04-16 2020-09-28 Ionis Pharmaceuticals Inc C9ORF72-expresszió módosítására szolgáló készítmények
MA43072A (fr) * 2015-07-22 2018-05-30 Wave Life Sciences Ltd Compositions d'oligonucléotides et procédés associés
MA43822A (fr) 2016-03-13 2018-11-28 Wave Life Sciences Ltd Compositions et procédés de synthèse de phosphoramidite et d'oligonucléotides
US20190142856A1 (en) 2016-04-13 2019-05-16 Ionis Pharmaceuticals, Inc. Methods for reducing c9orf72 expression
MA45290A (fr) 2016-05-04 2019-03-13 Wave Life Sciences Ltd Procédés et compositions d'agents biologiquement actifs
MA45270A (fr) 2016-05-04 2017-11-09 Wave Life Sciences Ltd Compositions d'oligonucléotides et procédés associés
WO2017210647A1 (en) 2016-06-03 2017-12-07 Wave Life Sciences Ltd. Oligonucleotides, compositions and methods thereof
US20190264267A1 (en) 2016-07-25 2019-08-29 Wave Life Sciences Ltd. Phasing
JP7296882B2 (ja) 2016-11-23 2023-06-23 ウェイブ ライフ サイエンシズ リミテッド ホスホラミダイト及びオリゴヌクレオチド合成のための組成物及び方法
WO2018223056A1 (en) 2017-06-02 2018-12-06 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
JP2020522265A (ja) 2017-06-02 2020-07-30 ウェイブ ライフ サイエンシズ リミテッドＷａｖｅ Ｌｉｆｅ Ｓｃｉｅｎｃｅｓ Ｌｔｄ． オリゴヌクレオチド組成物及びその使用方法
CN110997692B (zh) 2017-06-02 2025-01-07 波涛生命科学有限公司 寡核苷酸组合物及其使用方法
CN111051281A (zh) 2017-06-21 2020-04-21 波涛生命科学有限公司 用于合成的化合物、组合物和方法
CN110831951B (zh) 2017-06-28 2023-10-27 罗氏创新中心哥本哈根有限公司 多重偶联和氧化方法
KR20200035301A (ko) 2017-08-08 2020-04-02 웨이브 라이프 사이언시스 리미티드 올리고뉴클레오티드 조성물 및 이의 방법
CN111108096A (zh) 2017-09-18 2020-05-05 波涛生命科学有限公司 寡核苷酸制备技术
WO2019075357A1 (en) 2017-10-12 2019-04-18 Wave Life Sciences Ltd. OLIGONUCLEOTIDE COMPOSITIONS AND RELATED METHODS
WO2019200185A1 (en) 2018-04-12 2019-10-17 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
CN112218664A (zh) 2018-05-11 2021-01-12 波涛生命科学有限公司 寡核苷酸组合物及其使用方法
SG11202105626TA (en) 2018-12-06 2021-06-29 Wave Life Sciences Ltd Oligonucleotide compositions and methods thereof
CA3126845A1 (en) 2019-02-01 2020-08-06 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
KR20210149750A (ko) 2019-03-20 2021-12-09 웨이브 라이프 사이언시스 리미티드 올리고뉴클레오티드 제조에 유용한 기술
WO2020196662A1 (ja) 2019-03-25 2020-10-01 国立大学法人東京医科歯科大学 二本鎖核酸複合体及びその使用
CA3137741A1 (en) 2019-04-25 2020-10-29 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
AU2020261434A1 (en) 2019-04-25 2021-11-11 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
CN114502177A (zh) 2019-05-09 2022-05-13 波涛生命科学有限公司 寡核苷酸组合物及其使用方法
KR20220070324A (ko) 2019-10-06 2022-05-30 웨이브 라이프 사이언시스 리미티드 올리고뉴클레오티드 조성물 및 이의 이용 방법
US20230220384A1 (en) 2019-10-06 2023-07-13 Prashant Monian Oligonucleotide compositions and methods of use thereof
WO2021178237A2 (en) 2020-03-01 2021-09-10 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
JP2023526975A (ja) 2020-05-22 2023-06-26 ウェイブ ライフ サイエンシズ リミテッド オリゴヌクレオチド組成物及びその方法
EP4199957A4 (en) 2020-08-24 2024-10-02 Wave Life Sciences Ltd. NON-HUMAN CELLS AND ANIMALS ENGINEERED TO EXPRESS ADAR1 AND THEIR USES
WO2022046723A1 (en) 2020-08-24 2022-03-03 Wave Life Sciences Ltd. Immunoassays for detecting wild type huntingtin protein and methods of treatment employing such immunoassays
IL302558A (en) 2020-11-08 2023-07-01 Wave Life Sciences Ltd Oligonucleotide compositions and methods thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017062862A2 (en) * 2015-10-09 2017-04-13 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
WO2017079291A1 (en) * 2015-11-02 2017-05-11 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating c90rf72

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11643657B2 (en) 2012-07-13 2023-05-09 Wave Life Sciences Ltd. Chiral control
US12180472B2 (en) 2014-01-16 2024-12-31 Wave Life Sciences Ltd. Chiral design
US11208430B2 (en) 2014-08-22 2021-12-28 Noogen Llc Modified oligonucleotides and methods for their synthesis
US11634710B2 (en) 2015-07-22 2023-04-25 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11407775B2 (en) 2016-03-13 2022-08-09 Wave Life Sciences Ltd. Compositions and methods for phosphoramidite and oligonucleotide synthesis
US12403156B2 (en) 2016-06-03 2025-09-02 Wave Life Sciences Ltd. Oligonucleotides, compositions and methods thereof
US11873316B2 (en) 2016-11-23 2024-01-16 Wave Life Sciences Ltd. Compositions and methods for phosphoramidite and oligonucleotide synthesis
US11603532B2 (en) 2017-06-02 2023-03-14 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
US11597927B2 (en) 2017-06-02 2023-03-07 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
US11718638B2 (en) 2017-06-21 2023-08-08 Wave Life Sciences Ltd. Compounds, compositions and methods for synthesis
US11739325B2 (en) 2017-08-08 2023-08-29 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11608355B2 (en) 2017-09-18 2023-03-21 Wave Life Sciences Ltd. Technologies for oligonucleotide preparation
US11596646B2 (en) 2017-10-12 2023-03-07 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11332733B2 (en) 2018-02-12 2022-05-17 lonis Pharmaceuticals, Inc. Modified compounds and uses thereof
US11149264B2 (en) 2018-02-12 2021-10-19 Ionis Pharmaceuticals, Inc. Modified compounds and uses thereof
US12234447B2 (en) 2018-02-12 2025-02-25 Ionis Pharmaceuticals, Inc. Modified compounds and uses thereof
US12391942B2 (en) 2018-05-11 2025-08-19 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
US20240392290A1 (en) * 2018-06-14 2024-11-28 University Of Utah Research Foundation Staufen1 regulating agents and associated methods
US20230098111A1 (en) * 2020-01-28 2023-03-30 University Of Southern California Compositions and methods to treat neurological diseases
US12409189B2 (en) 2023-05-31 2025-09-09 University Of Utah Research Foundation STAUFEN1 agents and associated methods

Also Published As

Publication number Publication date
AR112779A1 (es) 2019-12-11
SG11202000274RA (en) 2020-02-27
EP3664816A4 (en) 2021-05-19
WO2019032612A1 (en) 2019-02-14
US11739325B2 (en) 2023-08-29
JP2020534254A (ja) 2020-11-26
EP3664815A4 (en) 2021-08-11
US20210032620A1 (en) 2021-02-04
TW201920672A (zh) 2019-06-01
JP7422068B2 (ja) 2024-01-25
JP2024009824A (ja) 2024-01-23
WO2019032607A1 (en) 2019-02-14
KR20200035301A (ko) 2020-04-02
CN111032057A (zh) 2020-04-17
EP3664816A1 (en) 2020-06-17
EP3664815A1 (en) 2020-06-17
JP2020534253A (ja) 2020-11-26
CA3072076A1 (en) 2019-02-14
CN110996968A (zh) 2020-04-10
AU2018316159A1 (en) 2020-02-06
US20250066775A1 (en) 2025-02-27

Similar Documents

Publication Publication Date Title
US20200362337A1 (en) Oligonucleotide compositions and methods thereof
US20240175016A1 (en) Oligonucleotide compositions and methods of use thereof
US20220145300A1 (en) Oligonucleotide compositions and methods of use thereof
US20240132894A1 (en) Oligonucleotide compositions and methods of use thereof
US20220195429A1 (en) Oligonucleotide compositions and methods thereof
US20220162598A1 (en) Oligonucleotide compositions and methods thereof
EP3891284A1 (en) Oligonucleotide compositions and methods thereof
US20240279658A1 (en) Double stranded oligonucleotide compositions and methods relating thereto
WO2025072886A9 (en) Oligonucleotide compositions and methods thereof
JP2025523905A (ja) オリゴヌクレオチド組成物及びその方法
JP2025518487A (ja) オリゴヌクレオチド組成物及びその方法
HK40027139A (en) Oligonucleotide compositions and methods thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: WAVE LIFE SCIENCES LTD., SINGAPORE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DODART, JEAN-COSME;LIU, YUANJING;VARGEESE, CHANDRA;AND OTHERS;SIGNING DATES FROM 20180924 TO 20181031;REEL/FRAME:053361/0523

STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION RETURNED BACK TO PREEXAM

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION COUNTED, NOT YET MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION