CN108794644A

CN108794644A - A kind of fusion protein and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α

Info

Publication number: CN108794644A
Application number: CN201810768632.0A
Authority: CN
Inventors: 单雪芹; 凡玉芳; 王亚男; 许高涛; 高耀辉; 周炜; 徐慕珍
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-13
Publication date: 2018-11-13
Also published as: CN107286251A

Abstract

The invention discloses a kind of fusion proteins and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α; the fusion protein is connected through flexible linker with Bov IFN α by cattle interleukins-2 2, Bov IFN γ and is formed, through being freeze-dried to obtain recombinant bovine long-acting interferon after fusion protein and freeze drying protectant mixture.The recombinant bovine long-acting interferon is remarkably improved the half-life period of Bov IFN, and the half-life period of more common Bov IFN improves 16 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of Niu Zishen.

Description

A kind of fusion being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α Albumen and preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to by cattle interleukins-2 2, Bov IFN γ and ox The fusion protein and preparation method thereof of interferon-' alpha ' composition.

Background technology

Ox is important one of the herding type in China, with intensive and large-scale cultivation continuous development, bovine viral The incidence of communicable disease improves year by year.Large-scale pasture is popular for a long time at home for the communicable disease of many oxen, because Disease infects fast, the high sound development that seriously restrict China's ox aquaculture of incidence, the death rate；More seriously some Poultry suffers from the life and health that brucellosis, tuberculosis of infectious disease such as ox etc. directly threaten the mankind altogether.

By vaccine inoculation and antibiotic mainly is used to the prevention and treatment approach of ox communicable disease at present.Big portion Antibiotics and traditional oral antiviral medicament is divided to be brought a negative impact to health due to medicament residue problem；And Traditional vaccine, the high specific due to it and side effect, can not resist virus variation and new virus continuously emerges to pig The significant damage that aquaculture is brought.Interferon determines its tool with the antiviral activity of its wide spectrum and extensive immunoregulation capability There are huge clinical application potentiality, can be used for preventing and treating bovine viral bacterial infection disease.

IFN is that the infection induced body of a viroid is generated with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, mainly by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.Now it is known that α types IFN in vivo can be selectively Act on the infection cells such as virus, by inhibit infected cell in virus protein biosynthesis, play wide spectrum and efficiently Antivirus action.But it is faint without acting on or acting on to normal host cell.IFN-α main physiological activity is with inhibition virus Duplication, the killing activity for anti parasitic, inhibiting various kinds of cell proliferation, stimulating immunocyte.

γ types IFN is the T cell and the generation of NK cells by activating, and has relatively strong antiviral and immunoloregulation function.Largely Studies have shown that interferon gamma also plays crucial adjustment effect other than having the function of broad-spectrum antiviral, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to virus infection it is anti- It answers, but the immunoregulatory activity of interferon gamma plays more in coordinating immune response and determining the long-term antiviral state of body Important role, therefore interferon gamma has particularly important clinical value.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocytes activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases Epidemic disease is treated.In addition, IL-2 can also influence the metabolism of drug, make the metabolism time lengthening of drug, action time increases, to improve Curative effect of medication.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Invention content

It is interfered by cattle interleukins-2 2, Bov IFN γ and ox in order to solve the above technical problems, the present invention provides one kind The fusion protein and preparation method thereof of plain α composition, and thus fusion protein with after freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of recombinant bovine long-acting interferon, the recombinant bovine long-acting interferon is remarkably improved the half-life period of Bov IFN, compared with The half-life period of common Bov IFN improves 16 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune of Niu Zishen and answer It answers.

The technical solution that the present invention takes is：

A kind of fusion protein being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α, the fusion protein Amino acid sequence table as shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in 2 equal codified of the genome 1 and the genome.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most ideal point of G/C content in gene Cloth ranging from 30~70% can influence translation and transcriptional efficiency in any region more than the range.It is sent out using software detection The now codon of cattle interleukins-2 2, ox IFN-γ, ox IFN-α original gene codon adaptation indexI in Escherichia coli (CAI) be respectively 0.19,0.24,0.25, GC percentages be 39.1%, 39.8%, 58.2%；And by cattle interleukins-2 2, obtained after ox IFN-γ, ox IFN-α gene optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 0.94, 1.0,0.97, GC percentages 48.2%, 44.8%, 54.6%.The utilization rate of low codon is significantly reduced by gene optimization, Influence of the rare codon to protein expression is avoided, the G/C content of gene is improved, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

The present invention also provides a kind of recombinant bovine long-acting interferon, the recombinant bovine long-acting interferon is by the fusion egg In vain with after freeze drying protectant mixture, it is freeze-dried to form.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, can be obtained fusion protein after purified.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, and preparation method is：

(1) design primer, is obtained or the cattle interleukins-2 of the flexible linker sequences of artificial synthesized band by reverse transcription 2, the target gene of Bov IFN γ, Bov IFN α；By flexible linker by cattle interleukins-2 2, Bov IFN γ, ox The target gene of interferon-' alpha ' connects, the nucleotides sequence list such as SEQUENCE LISTING of the target gene after connection Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIL2- IFNγ-IFNα。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of cattle interleukins-2 2 (IL-2) is：

Upstream IL-2-F1：CCGGAATTCATGTACAAGATACAACTCT carries EcoRI restriction enzyme sites；

Downstream IL-2-R1：

ACCACCACCAGAACCACCACCACCAGTCATTGTTGAGTAGAT, with flexible linker；

The primer sequence of Bov IFN γ (IFN-γ) is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAAATATACAAGCTATTT, with flexible linker；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCCGTTGATGCTCTCCG, with flexible linker；

The primer sequence of Bov IFN α (IFN-α) is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTTGCCACCTGCCTC, with flexible linker；

Downstream IFN-α-R1：CCCTCGAGGTCCTTTCTCCTGAAAC carries XhoI restriction enzyme sites；

B. RNA is extracted from cattle liver, by reverse transcription obtain ox IL-2, ox IFN-γ and ox IFN-α target gene, The gene order of three respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of ox IL-2, ox IFN-γ and ox IFN-α as template, and it is utilized respectively ox IL-2, ox The upstream and downstream primer of IFN-γ and ox IFN-α carries out PCR amplification, respectively obtains the ox IL-2 for connecting flexible linker, ox IFN-γ and ox IFN-α gene.

PCR reaction systems and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction condition of the RT-PCR reactions For：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into cycle；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C extend 1kb/min is recycled 35 times, last 72 DEG C of extensions 10min.

C. rIL2-IFN γ genes are obtained using flexible linker connection ox IL-2 and ox IFN-γ target gene

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's IL-2 gene template DNA1 μ L connect 1 μ L, IL-2 sense primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of γ downstream primers, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connection PCR reaction conditions are：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

D. rIL2-IFN γ-IFN are obtained using flexible linker connections rIL2-IFN γ genes and ox IFN-α target gene α genes

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, rIL2-IFN γ gene templates DNA1 μ L connect 1 μ L, IL-2 sense primer of IFN-α template DNA 0.5 the μ L, 0.5 μ of IFN-α downstream primer of flexible linker 2.5 μ L, dNTP Mix of L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction conditions is：95 DEG C pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Finally 72 DEG C of extension 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of cattle interleukins-2 2 (IL-2) is：

Upstream IL-2-F2：CGGGATCCATGTACAAAATCCAGCT carries BamHI restriction enzyme sites；

Downstream IL-2-R2：

ACCACCACCAGAACCACCACCACCGGTCATGGTAGAGTAGA, with flexible linker；

The primer sequence of Bov IFN γ (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACCTCTTAC, with flexible linker；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCGGTAGAAGCACGACG, with flexible linker；

Bov IFN α (IFN-α)：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTTGCCACCTGCCG, with flexible linker；

Downstream IFN-α-R2：

CCCTCGAGGTCTTTACGACGGAAA carries XhoI restriction enzyme sites.

B. the ox IL-2, ox IFN-γ and ox IFN-α target gene, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

PCR reaction systems and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into cycle；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C extend 1kb/min, follow Ring 35 times, last 72 DEG C of extensions 10min.

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's IL-2 gene template DNA1 μ L connect 1 μ L, IL-2 sense primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of γ downstream primers, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connection PCR reaction conditions are：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, rIL2-IFN γ gene templates DNA1 μ L connect 1 μ L, IL-2 sense primer of IFN-α template DNA 0.5 the μ L, 0.5 μ of IFN-α downstream primer of flexible linker 2.5 μ L, dNTP Mix of L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction conditions is：95 DEG C pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Finally 72 DEG C of extension 10min.

The present invention also provides the application of the recombinant bovine long-acting interferon, long half time had up to 65 hours or more Broad-spectrum disease resistance toxic action and the immune response that Niu Zishen can be improved.

Compared with prior art, the present invention has the advantages that：

1. ox IL-2, ox IFN-γ and ox IFN-α gene are realized amalgamation and expression by flexible linker, interference is improved Plain half-life period improves 16 times or more compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly drop Low cost.

2. by being optimized to ox IL-2, ox IFN-γ and ox IFN-α gene, improve ox IL-2, ox IFN-γ and The expression quantity of ox IFN-α fusion protein.

3. using recombination bacillus coli pET-32a/rIL2-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of ox IL-2, ox IFN-γ and ox IFN-α not only has IFN-α Broad-spectrum disease resistance toxic action, while significantly improving the immune response of Niu Zishen.

Description of the drawings

Fig. 1 is 2 gene of cattle interleukins-2, Bov IFN α genes and the Bov IFN γ genes RT-PCR in embodiment 1 The result of amplification；Swimming lane M：DNAMarker DL2000；Swimming lane 1：Ox interleukin-22 gene RT-PCR amplified productions；Swimming lane 2：Ox Interferon-' alpha ' gene RT-PCR amplified productions；Swimming lane 3：Bov IFN γ gene RT-PCR amplified productions；

Fig. 2 be embodiment 1 in ox IL-2, IFN-γ connected with the target gene of IFN-α after PCR amplification knot Fruit；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Ox interleukin-22 gene, Bov IFN γ genes and Bov IFN α genes Ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNAMarker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations results of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Zero load control；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Precipitation；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Supernatant after recombinant bacterium induction is broken；Swimming lane 2：It is precipitated after recombinant bacterium induction is broken；

Fig. 6 is that the recombinant bovine long-acting interferon α made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the recombinant bovine long-acting interferon α of gradient dilution (from right to left) handles hole；

Fig. 7 is the recombinant bovine long-acting interferon α intramuscular injection blood made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific implementation mode

Embodiment 1

A kind of fusion protein being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α, preparation method is such as Under：

1. cattle interleukins-2 2 (IL-2), Bov IFN γ (IFN-γ) and Bov IFN α (IFN-α) target gene It obtains and expands

Design of primers：

It is shown in Table 1 according to the objective gene sequence design synthetic primer reported in Genebank, in cattle interleukins-2 2 EcoRI restriction enzyme sites and Linker sequences are introduced in sense primer and downstream primer respectively, in the sense primer of Bov IFN γ With Linker sequences are introduced in downstream primer respectively, introduced respectively in the sense primer of Bov IFN α and downstream primer Linker sequences and XhoI restriction enzyme sites.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from cattle liver tissue, passes through reverse transcription acquisition ox IL-2, the purpose base of ox IFN-γ and ox IFN-α Cause, the gene order of three respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

RT-PCR reaction systems (25 μ L) are shown in Table 2

2 RT-PCR reaction systems of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into cycle：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 490bp, 560bp and 530bp or so in RT-PCR amplified productions, The results are shown in Figure 1, illustrates that the ox IL-2 for being separately connected flexible linker sequences, ox IFN-γ and ox have been prepared respectively The target gene of IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 rIL2-IFN γ PCR reaction systems of table

4 rIL2-IFN γ of table-IFN α PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1520bp or so in pcr amplification product, and the results are shown in Figure 2, Occur rIL2-IFN γ and IFN-α amplified production band in Fig. 2, this is because being connected with IFN-α gene in rIL2-IFN γ During, there is non-specific responding.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 2 > It is shown.

3. expression vector establishment

After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmids EcoRI and XhoI restriction enzymes carry out double digestion and recycling, and double digestion is done by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmids after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

It converts in connection product to e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plates of penicillin are incubated overnight；Single bacterium colony on picking LB tablets carries out target gene PCR identifications, positive colony Bacteria plasmid is identified through EcoRI and XhoI double digestions, is accredited as positive and is indicated that engineering bacteria is built successfully, PCR amplification and double digestion Product detects single band through agarose gel electrophoresis at the places 1520bp or so, and the results are shown in Figure 3, illustrates successfully to obtain PET-32a/rIL2-IFN γ-IFN α engineering bacteria.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, in LB culture mediums Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, the results are shown in Figure 4, it can be seen from the figure that recombinant bacterium lures Supernatant is deposited in the visible predominant expression band in the places 74.1KD or so after leading the bacterial cell disruption after 5h, illustrates in precipitation and supernatant Equal successful expression fusion protein.

Mass volume ratio 1 is added:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifuges 15min, Supernatant, inclusion body (inclusion body is through dissolving, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to 100 eggs of AKTAexplorer On white purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away with PBS buffer solution and are not tied The albumen of conjunction, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM miaows Azoles, PH8.0) elution, collect rIL2-IFN γ-IFN α protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purifications displacement to (the 50mM trihydroxy methyls of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After crossing column to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatographies of Superdex have been balanced, it is washed with Binding Buffer III It is de-, collect rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁷U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C preserve.It can be obtained the fusion protein being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α, amino acid sequence Row are as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α, other same embodiments 1, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmids experiences State cell.The SDS-PAGE electrophoresis results of its fusion protein are compareed with embodiment 1,74.1KD or so place's predominant expressions in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein Measure higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expressing bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 3

Ox IL-2, ox IFN-γ and ox IFN-α in embodiment 1 is optimized, artificial synthesized ox IL-2, ox IFN-γ With ox IFN-α target gene, after optimization, the nucleotide sequence of three respectively as 400 < of SEQUENCE LISTING, 7 >, Shown in 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common each biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the profit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IL-2 of ox, ox IFN- in the present embodiment γ and ox IFN-α gene codon optimize.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI values are lower to show that expression is lower in host.G/C content most ideal distribution ranging from 30 in gene~ 70%, in any region translation and transcriptional efficiency can be influenced more than the range.Ox IL-2, ox are found using software detection The codon of IFN-γ and ox IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.19, 0.24,0.25, GC percentages are 39.1%, 39.8%, 58.2%；And by ox IL-2, ox IFN-γ and ox IFN-α gene Obtained after optimization recombination codon adaptation indexI (CAI) in Escherichia coli be respectively 0.94,1.0,0.97, GC percentages 48.2%, 44.8%, 54.6%.The utilization rate that low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency, and then improves the table of recombinant protein Up to amount.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of ox IL-2, ox IFN-γ and ox IFN-α after optimization are diluted to 0.05mg/mL respectively.It utilizes PCR amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction systems of table

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

Ox IL-2, ox IFN-γ and ox IFN-α pcr amplification product through agarose gel electrophoresis respectively 490bp, There is specific band in 560bp and 530bp or so, illustrate that the ox for being separately connected flexible linker after optimization has been prepared The target gene of IL-2, ox IFN-γ and ox IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 rIL2-IFN γ PCR reaction systems of table

10 rIL2-IFN γ of table-IFN-α PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1520bp or so in pcr amplification product, illustrates successfully to be connected RIL2-IFN γ-IFN-α gene after connecing.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING 400 Shown in 3 > of <.

3. expression vector establishment

The glue recovery product of target gene PCR errorless after sequencing after selection connection is used with pET-32a plasmids BamHI, XhoI restriction enzyme carry out double digestion and recycling, and double digestion is done by 20 μ L systems in table 11：

11 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmids after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

It converts in connection product to e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB tablets of element；The bacterium colony grown on LB tablets is taken to identify target gene, positive colony bacteria plasmid warp through PCR BamHI, XhoI double digestion are identified, are accredited as positive and are indicated expression vector establishment success, PCR amplification and double digestion product are through fine jade There is single band at the places 1520bp or so in sepharose electrophoresis, illustrates containing rIL2-IFN γ-IFN α fusion gene engineering bacterium PET-32a/rIL2-IFN γ-IFN α is built successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, in LB culture mediums Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, supernatant is deposited in after the bacterial cell disruption after recombinant bacterium induction 5h The visible predominant expression band in the places 74.1KD or so illustrates to have obtained recombinant protein in supernatant precipitates.

5. fusion protein purification

5.1His affinity chromatography

5.2DEAE anion-exchange chromatography

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatographies of Superdex have been balanced, with Binding Buffer III elution, collects rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁷U/mg, albumen are qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.It can be obtained the fusion protein being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α, amino acid Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α, other same embodiments 3, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmids experiences State cell.The SDS-PAGE electrophoresis results of its fusion protein are compareed with embodiment 3,74.1KD or so place's predominant expressions in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein Measure higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expressing bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 5

A kind of recombinant bovine long-acting interferon α, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture Later, freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 is obtained by the mirror of cattle interleukins-2 2, Bov IFN γ and Bov IFN the α fusion protein formed It is fixed

The quantitative detection of 6.1 protein contents

With Lowry methods, the standard protein that institute is examined and determine with Chinese food pharmaceutical biological product is made standard test, measures embodiment 1~4 obtained fusion protein concentration is all higher than 1.1mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 74.1KD or so, as shown in Figure 4.

6.3Western Blot results

Fusion protein in Examples 1 to 4 is detected respectively, with the anti-ox alpha interferon of abcam companies mouse (1:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant bovine long-acting interferon sample can be with anti-Bov IFN α Specific reaction occurs for monoclonal antibody, and specific band occur in the places 74.1KD or so, as shown in Figure 5.

Embodiment 7

Bioactivity freeze-dried four parts of recombinant bovine long-acting interferon α in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombinant bovine that various dose is added is long for culture Interferon-' alpha ' is imitated, inhales abandon afterwards for 24 hours, then inoculation 100TCID50VSV viruses respectively.

Test result

The result shows that the recombinant bovine long-acting interferon α obtained causes the lesion of HEp-2 cells to have apparent inhibit VSV Effect.The lesions such as occurs cell rounding after untreated cell inoculation virus, falls off, is disintegrated.And the recombinant bovine obtained is long After imitating interferon-' alpha ' treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not go out incumbent What lesion, measures potency >=10⁷U/ml, as shown in Figure 6.

Embodiment 8

The four parts of recombinant bovine long-acting interferon α freeze-dryings obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 The measurement of half-life period of the agent (being denoted as A, B, C, D respectively) in ox body

Cytopathic-effect inhibition assay measures the blood concentration and time relationship of rIL2-IFN γ-IFN α

Take the ox (half male and half female) that six weight are roughly the same, neck that 2mg/ml recombinant bovine long-acting interferons α is subcutaneously injected Freeze-dried 2ml, respectively 1h, 3h, 6h, 12h, for 24 hours, 36h, 48h, 72h, 96h venous blood collection, the solidification of 4 DEG C of blood sample, 3500rpm Low-temperature centrifugation 10min detaches serum, and every ox blood sample of each time point is to be measured in -20 DEG C of preservations.It is measured using cytopathic-effect inhibition assay The concentration of rIL2-IFN γ-IFN α in blood serum sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Parameter meter Calculation the results are shown in Table 13.

Dominant dynamic parameters in serum after 13 recombinant bovine long-acting interferon α intramuscular injection of table

The result shows that recombinant bovine long-acting interferon α has longer half-life period.Half-life period can reach 65h or so after measured, compared with Plain interferon improves 16 times or more.

Embodiment 9

The freeze-dried measurement that ox cellullar immunologic response is influenced of four parts of recombinant bovine long-acting interferon α in embodiment 5

It takes six roughly the same oxen of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously injected The PBS of 2mL is subcutaneously injected in the 2mg/ml recombinant bovine long-acting interferon freeze-dried 2ml of α, control group neck, takes ox periphery after injecting 4 weeks Blood takes weekly a blood later, detaches lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 contents, are carried out by kit specification, and testing result is as shown in table 14：

Table 14 ELISA detection each group ox cellullar immunologic responses are horizontal

The result shows that after injection recombinant bovine long-acting interferon α, it can significantly improve ox Evaluation of Cytokines in Peripheral Blood IL-4's Content enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned with reference to embodiment to a kind of fusion egg being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α The detailed description that bletilla preparation method carries out is illustrative without being restrictive, and can be enumerated according to limited range Several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 507

<212> PRT

<213>Ox IL-2-IFN- γ-IFN-α fusion protein

<400> 1

Met Tyr Lys Ile Gln Leu Leu Ser Cys Ile Ala Leu Thr Leu Ala Leu

1 5 10 15

Val Ala Asn Gly Ala Pro Thr Ser Ser Ser Thr Gly Asn Thr Met Lys

20 25 30

Glu Val Lys Ser Leu Leu Leu Asp Leu Gln Leu Leu Leu Glu Lys Val

35 40 45

Lys Asn Pro Glu Asn Leu Lys Leu Ser Arg Met His Thr Phe Asp Phe

50 55 60

Tyr Val Pro Lys Val Asn Ala Thr Glu Leu Lys His Leu Lys Cys Leu

65 70 75 80

Leu Glu Glu Leu Lys Leu Leu Glu Glu Val Leu Asn Leu Ala Pro Ser

85 90 95

Lys Asn Leu Asn Pro Arg Glu Ile Lys Asp Ser Met Asp Asn Ile Lys

100 105 110

Arg Ile Val Leu Glu Leu Gln Gly Ser Glu Thr Arg Phe Thr Cys Glu

115 120 125

Tyr Asp Asp Ala Thr Val Asn Ala Val Glu Phe Leu Asn Lys Trp Ile

130 135 140

Thr Phe Cys Gln Ser Ile Tyr Ser Thr Met Thr Gly Gly Gly Gly Ser

145 150 155 160

Gly Gly Gly Gly Ser Met Lys Tyr Thr Ser Tyr Phe Leu Ala Leu Leu

165 170 175

Leu Cys Gly Leu Leu Gly Phe Ser Gly Ser Tyr Gly Gln Gly Gln Phe

180 185 190

Phe Arg Glu Ile Glu Asn Leu Lys Glu Tyr Phe Asn Ala Ser Ser Pro

195 200 205

Asp Val Ala Lys Gly Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp

210 215 220

Lys Asp Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe

225 230 235 240

Tyr Phe Lys Leu Phe Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg

245 250 255

Ser Met Asp Ile Ile Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly

260 265 270

Ser Ser Glu Lys Leu Glu Asp Phe Lys Lys Leu Ile Gln Ile Pro Val

275 280 285

Asp Asp Leu Gln Ile Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val

290 295 300

Met Asn Asp Leu Ser Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser

305 310 315 320

Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Thr Gly Gly Gly Gly Ser

325 330 335

Gly Gly Gly Gly Ser Cys His Leu Pro His Thr His Ser Leu Ala Asn

340 345 350

Arg Arg Val Leu Met Leu Leu Gly Gln Leu Arg Arg Val Ser Pro Ser

355 360 365

Ser Cys Leu Gln Asp Arg Asn Asp Phe Ala Phe Pro Gln Glu Ala Leu

370 375 380

Gly Gly Ser Gln Leu Gln Lys Ala Gln Ala Ile Ser Val Leu His Glu

385 390 395 400

Val Thr Gln His Thr Phe Gln Leu Phe Ser Thr Glu Gly Ser Ala Thr

405 410 415

Thr Trp Asp Glu Ser Leu Leu Asp Lys Leu Arg Ala Ala Leu Asp Gln

420 425 430

Gln Leu Thr Asp Leu Gln Ala Cys Leu Arg Gln Glu Glu Glu Leu Gln

435 440 445

Gly Ala Pro Leu Leu Lys Glu Asp Ser Ser Leu Ala Val Arg Lys Tyr

450 455 460

Phe His Arg Leu Thr Leu Tyr Leu Gln Glu Lys Lys His Ser Pro Cys

465 470 475 480

Ala Trp Glu Val Val Arg Ala Gln Val Met Arg Ala Phe Ser Ser Ser

485 490 495

Thr Asn Leu Gln Glu Ser Phe Arg Arg Lys Asp

500 505

<210> 2

<211> 1521

<212> DNA

<213>Genome 1

<400> 2

atgtacaaga tacaactctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctggat 120

ttacagttgc ttttggagaa agttaaaaat cctgagaacc tcaagctctc caggatgcat 180

acatttgact tttacgtgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctaaatttag ctccaagcaa aaacctgaac 300

cccagagaga tcaaggattc aatggacaat atcaagagaa tcgttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcaacag taaacgctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgactggtgg tggtggttct 480

ggtggtggtg gttctatgaa atatacaagc tatttcttag ctttactgct ctgtgggctt 540

ttgggttttt ctggttctta tggccagggc caatttttta gagaaataga aaacttaaag 600

gagtatttta atgcaagtag cccagatgta gctaagggtg ggcctctctt ctcagaaatt 660

ttgaagaatt ggaaagatga aagtgacaaa aaaattattc agagccaaat tgtctccttc 720

tacttcaaac tctttgaaaa cctcaaagat aaccaggtca ttcaaaggag catggatatc 780

atcaagcaag acatgtttca gaagttcttg aatggcagct ctgagaaact ggaggacttc 840

aaaaagctga ttcaaattcc ggtggatgat ctgcagatcc agcgcaaagc cataaatgaa 900

ctcatcaaag tgatgaatga cctgtcacca aaatctaacc tcagaaagcg gaagagaagt 960

cagaatctct ttcgaggccg gagagcatca acgggtggtg gtggttctgg tggtggtggt 1020

tcttgccacc tgcctcacac ccacagcctg gccaacagga gggtcctgat gctcctggga 1080

caactgagga gggtctcccc ttcctcctgc ctgcaggaca gaaatgactt cgcattcccc 1140

caggaggcgc tgggtggcag ccagttgcag aaggctcaag ccatctctgt gctccacgag 1200

gtgacccagc acaccttcca gcttttcagc acagagggct cggccactac gtgggatgag 1260

agcctcctgg acaagctccg cgctgcactg gatcagcagc tcactgacct gcaagcctgt 1320

ctgaggcagg aggaggagct gcaaggagct cccctgctca aggaggactc cagcctggct 1380

gtgaggaaat acttccacag actcactctc tatctgcaag agaagaaaca cagcccttgt 1440

gcctgggagg ttgtcagagc acaagtcatg agagccttct cttcctcaac aaacttgcag 1500

gagagtttca ggagaaagga c 1521

<210> 3

<211> 1521

<212> DNA

<213>Genome 2

<400> 3

atgtacaaaa tccagctgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcgact tctacgttcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctgaacctgg ctccgtctaa aaacctgaac 300

ccgcgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaacgctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgaccggtgg tggtggttct 480

ggtggtggtg gttctatgaa atacacctct tacttcctgg ctctgctgct gtgcggtctg 540

ctgggtttct ctggttctta cggtcagggt cagttcttcc gtgaaatcga aaacctgaaa 600

gaatacttca acgcttcttc tccggacgtt gctaaaggtg gtccgctgtt ctctgaaatc 660

ctgaaaaact ggaaagacga atctgacaaa aaaatcatcc agtctcagat cgtttctttc 720

tacttcaaac tgttcgaaaa cctgaaagac aaccaggtta tccagcgttc tatggacatc 780

atcaaacagg acatgttcca gaaattcctg aacggttctt ctgaaaaact ggaagacttc 840

aaaaaactga tccagatccc ggttgacgac ctgcagatcc agcgtaaagc tatcaacgaa 900

ctgatcaaag ttatgaacga cctgtctccg aaatctaacc tgcgtaaacg taaacgttct 960

cagaacctgt tccgtggtcg tcgtgcttct accggtggtg gtggttctgg tggtggtggt 1020

tcttgccacc tgccgcacac ccactctctg gctaaccgtc gtgttctgat gctgctgggt 1080

cagttacgtc gtgtaagccc gtcttcttgc ctgcaggacc gtaacgactt cgctttcccg 1140

caggaagctc tgggtggttc tcagctgcag aaagctcagg ctatctctgt tctgcacgaa 1200

gttacccagc acaccttcca gctgttctct accgaaggtt ctgctaccac ctgggacgaa 1260

tctctgctgg acaaactgcg tgctgctctg gaccagcagc tgaccgacct gcaggcttgc 1320

ctgcgtcagg aagaagaact gcagggtgct ccgctgctga aagaagactc ttctctggct 1380

gttcgtaaat acttccaccg tctgaccctg tacctgcagg aaaaaaaaca ctctccgtgc 1440

gcttgggaag ttgttcgtgc tcaggttatg cgtgctttct cttcttctac caacctgcag 1500

gaatctttcc gtcgtaaaga c 1521

<210> 4

<211> 465

<212> DNA

<213>Ox IL-2

<400> 4

atgtacaaga tacaactctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctggat 120

ttacagttgc ttttggagaa agttaaaaat cctgagaacc tcaagctctc caggatgcat 180

acatttgact tttacgtgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctaaatttag ctccaagcaa aaacctgaac 300

cccagagaga tcaaggattc aatggacaat atcaagagaa tcgttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcaacag taaacgctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgact 465

<210> 5

<211> 498

<212> DNA

<213>Ox IFN-γ

<400> 5

atgaaatata caagctattt cttagcttta ctgctctgtg ggcttttggg tttttctggt 60

tcttatggcc agggccaatt ttttagagaa atagaaaact taaaggagta ttttaatgca 120

agtagcccag atgtagctaa gggtgggcct ctcttctcag aaattttgaa gaattggaaa 180

gatgaaagtg acaaaaaaat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaatgg cagctctgag aaactggagg acttcaaaaa gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccataa atgaactcat caaagtgatg 420

aatgacctgt caccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaacg 498

<210> 6

<211> 498

<212> DNA

<213>Ox IFN-α

<400> 6

tgccacctgc ctcacaccca cagcctggcc aacaggaggg tcctgatgct cctgggacaa 60

ctgaggaggg tctccccttc ctcctgcctg caggacagaa atgacttcgc attcccccag 120

gaggcgctgg gtggcagcca gttgcagaag gctcaagcca tctctgtgct ccacgaggtg 180

acccagcaca ccttccagct tttcagcaca gagggctcgg ccactacgtg ggatgagagc 240

ctcctggaca agctccgcgc tgcactggat cagcagctca ctgacctgca agcctgtctg 300

aggcaggagg aggagctgca aggagctccc ctgctcaagg aggactccag cctggctgtg 360

aggaaatact tccacagact cactctctat ctgcaagaga agaaacacag cccttgtgcc 420

tgggaggttg tcagagcaca agtcatgaga gccttctctt cctcaacaaa cttgcaggag 480

agtttcagga gaaaggac 498

<210> 7

<211> 465

<212> DNA

<213>Ox IL-2

<400> 7

atgtacaaaa tccagctgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcgact tctacgttcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctgaacctgg ctccgtctaa aaacctgaac 300

ccgcgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaacgctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgacc 465

<210> 8

<211> 498

<212> DNA

<213>Ox IFN-γ

<400> 8

atgaaataca cctcttactt cctggctctg ctgctgtgcg gtctgctggg tttctctggt 60

tcttacggtc agggtcagtt cttccgtgaa atcgaaaacc tgaaagaata cttcaacgct 120

tcttctccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gacgaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaaaa actgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctacc 498

<210> 9

<211> 498

<212> DNA

<213>Ox IFN-α

<400> 9

tgccacctgc cgcacaccca ctctctggct aaccgtcgtg ttctgatgct gctgggtcag 60

ttacgtcgtg taagcccgtc ttcttgcctg caggaccgta acgacttcgc tttcccgcag 120

gaagctctgg gtggttctca gctgcagaaa gctcaggcta tctctgttct gcacgaagtt 180

acccagcaca ccttccagct gttctctacc gaaggttctg ctaccacctg ggacgaatct 240

ctgctggaca aactgcgtgc tgctctggac cagcagctga ccgacctgca ggcttgcctg 300

cgtcaggaag aagaactgca gggtgctccg ctgctgaaag aagactcttc tctggctgtt 360

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aaaaacactc tccgtgcgct 420

tgggaagttg ttcgtgctca ggttatgcgt gctttctctt cttctaccaa cctgcaggaa 480

tctttccgtc gtaaagac 498

Claims

1. a kind of fusion protein being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α, it is characterised in that：It is described The amino acid sequence table of fusion protein is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene of coding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. the expression vector containing gene as claimed in claim 2.

4. the genetic engineering bacterium containing gene as claimed in claim 2.

5. a kind of recombinant bovine long-acting interferon, which is characterized in that the recombinant bovine long-acting interferon is melted by described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, can be obtained fusion protein after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, preparation method are：

(1) design primer, is obtained or the cattle interleukins-2 2 of the flexible linker sequences of artificial synthesized band, ox by reverse transcription The target gene of interferon gamma, Bov IFN α；Cattle interleukins-2 2, Bov IFN γ, ox are interfered by flexible linker The target gene of plain α connects, nucleotides sequence list such as 400 < of SEQUENCE LISTING, 2 > of the target gene after connection It is shown or as shown in 400 < of SEQUENCE LISTING, 3 >；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIL2-IFN γ-IFNα。

8. the preparation method described according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.

9. the preparation method described according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively purified through affinity chromatography, anion-exchange chromatography and sieve chromatography.

10. the application of recombinant bovine long-acting interferon according to claim 5, which is characterized in that the recombinant bovine is long-acting dry The long half time of element is disturbed up to 65 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of Niu Zishen can be improved.