CN108794638A

CN108794638A - A kind of recombinant bovine long-acting interferon α and the fusion protein and preparation method thereof for preparing this long-acting interferon

Info

Publication number: CN108794638A
Application number: CN201810701409.4A
Authority: CN
Inventors: 夏兵兵; 徐慕珍; 徐文俊; 单雪芹; 郭志燕; 何志远; 蒋敏之
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2018-06-29
Publication date: 2018-11-13
Also published as: CN107266587A

Abstract

The invention discloses a kind of recombinant bovine long-acting interferon α and the fusion proteins and preparation method thereof for preparing this long-acting interferon; the fusion protein is connect through flexible linker with Bov IFN α by Bov IFN γ and is formed, through being freeze-dried to obtain recombinant bovine long-acting interferon α after fusion protein and freeze drying protectant mixture.The recombinant bovine long-acting interferon α is remarkably improved the half-life period of Bov IFN, and the half-life period of more common Bov IFN improves 11 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of Niu Zishen.

Description

A kind of recombinant bovine long-acting interferon α and prepare this long-acting interferon fusion protein and Preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to a kind of recombinant bovine long-acting interferon α and prepare this Fusion protein of long-acting interferon and preparation method thereof.

Background technology

Ox is important one of the herding type in China, with intensive and large-scale cultivation continuous development, bovine viral The incidence of communicable disease improves year by year.Large-scale pasture is popular for a long time at home for the communicable disease of many oxen, because Disease infects fast, the high sound development that seriously restrict China's ox aquaculture of incidence, the death rate；More seriously some Poultry suffers from the life and health that brucellosis, tuberculosis of infectious disease such as ox etc. directly threaten the mankind altogether.

By vaccine inoculation and antibiotic mainly is used to the prevention and treatment approach of ox communicable disease at present.Big portion Antibiotics and traditional oral antiviral medicament is divided to be brought a negative impact to health due to medicament residue problem；And Traditional vaccine, the high specific due to it and side effect, can not resist virus variation and new virus continuously emerges to pig The significant damage that aquaculture is brought.Interferon determines its tool with the antiviral activity of its wide spectrum and extensive immunoregulation capability There are huge clinical application potentiality, can be used for preventing and treating bovine viral bacterial infection disease.

IFN is that the infection induced body of a viroid is generated with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, mainly by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.According to the generation cell of IFN, biochemical character and The difference to be played a role in terms of immunity of organism, is divided into α, β, γ three classes.Now it is known that α types IFN can selectively make in vivo For infection cells such as viruses, by inhibiting the biosynthesis of the virus protein in infected cell, playing wide spectrum and efficiently resisting Virus function.IFN-α main physiological activity is with suppressing virus replication, anti parasitic, inhibits various kinds of cell proliferation, stimulation The killing activity of immunocyte.

γ types IFN is the T cell and the generation of NK cells by activating, and has relatively strong antiviral and immunoloregulation function.Largely Studies have shown that interferon gamma also plays crucial adjustment effect other than having the function of broad-spectrum antiviral, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to virus infection it is anti- It answers, but the immunoregulatory activity of interferon gamma plays more in coordinating immune response and determining the long-term antiviral state of body Important role, therefore interferon gamma has particularly important clinical value.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the layer of molecular weight Partly solve the problems, such as that interferon molecule amount is small and leads to half-life short on face, while polyethylene glycol fused interferon cost is non- Chang Gao is unfavorable for clinically applying in domestic animal.

Invention content

In order to solve the above technical problems, the present invention provides a kind of recombinant bovine long-acting interferon α and preparing this long-acting interference The fusion protein and preparation method thereof of element, the recombinant bovine long-acting interferon is remarkably improved the half-life period of Bov IFN, more general The half-life period of logical Bov IFN improves 11 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of Niu Zishen.

The technical solution that the present invention takes is：

A kind of fusion protein being made of Bov IFN γ and Bov IFN α, the amino acid sequence table of the fusion protein As shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in 2 equal codified of the genome 1 and the genome.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most ideal point of G/C content in gene Cloth ranging from 30~70% can influence translation and transcriptional efficiency in any region more than the range.It is sent out using software detection The codon of existing ox IFN-γ and IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.24, 0.25, GC percentage is 39.8%, 58.2%；And by existing to obtaining recombination after ox IFN-γ and IFN-α gene optimization Codon adaptation indexI (CAI) is 1.0,0.97, GC percentages 44.8%, 54.6% in Escherichia coli.It is aobvious by gene optimization Writing reduces the utilization rate of low codon, avoids influence of the rare codon to protein expression, improves the G/C content of gene, Improve transcription and translation efficiency.

The present invention also provides the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIFN γ-IFN α.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

The present invention also provides a kind of recombinant bovine long-acting interferon α, and the recombinant bovine long-acting interferon α is by the fusion It is freeze-dried to form after albumen and freeze drying protectant mixture.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, can be obtained fusion protein after purified.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIFN γ-IFN α, and preparation method is：

(1) design primer, is obtained or the Bov IFN of the flexible linker sequences of artificial synthesized connection by reverse transcription The target gene of γ and Bov IFN α；Bov IFN γ has been connected with the target gene of Bov IFN α by flexible linker Come, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 2 > or such as SEQUENCE LISTING Shown in 400 <, 3 >；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIFN γ-IFNα。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of Bov IFN γ (IFN-γ) is：

Upstream IFN-γ-F1：CCGGAATTCATGAAATATACAAGCTATTT carries EcoRI restriction enzyme sites；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCCGTTGATGCTCTCCG, with flexible linker；

The primer sequence of Bov IFN α (IFN-α) is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTTGCCACCTGCCTC, with flexible linker；

Downstream IFN-α-R1：CCCTCGAGGTCCTTTCTCCTGAAAC carries XhoI restriction enzyme sites；

B. RNA is extracted from cattle liver, and the target gene of IFN-γ and IFN-α, the gene of the two are obtained by reverse transcription Sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

Respectively using the target gene of IFN-γ and IFN-α as template, and the upstream and downstream for being utilized respectively IFN-γ and IFN-α is drawn Object carries out PCR amplification, respectively obtains the IFN-γ and IFN-α target gene for connecting flexible linker.

PCR reaction systems and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into cycle；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. IFN-γ gene and IFN-α gene are connected using flexible linker

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IFN-γ template DNA connect the 1 μ L of IFN-α template DNA I of flexible linker, IFN-γ sense primer 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of α downstream primers, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 cycles；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of Bov IFN γ (IFN-γ) is：

Upstream IFN-γ-F2：CGGGATCCATGAAATACACCTCTTAC carries BamHI restriction enzyme sites；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCGGTAGAAGCACGACG；With flexible linker；

The primer sequence of Bov IFN α (IFN-α) is：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTTGCCACCTGCCG, with flexible linker；

Downstream IFN-α-R2：CCCTCGAGGTCTTTACGACGGAAA carries XhoI restriction enzyme sites；

B. the target gene of the IFN-γ and IFN-α, the gene order of the two is respectively such as SEQUENCE LISTING Shown in 400 <, 6 > and SEQUENCE LISTING, 400 <, 7 >；

Respectively using the target gene of IFN-γ and IFN-α as template, and the upstream and downstream for being utilized respectively IFN-γ and IFN-α is drawn Object carries out PCR amplification, respectively obtains IFN-γ and IFN-α target gene after the optimization for connecting flexible linker.

PCR reaction systems and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into cycle；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C extend 1kb/min, follow Ring 35 times, last 72 DEG C of extensions 10min.

C. IFN-γ gene and IFN-α gene are connected using flexible linker

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IFN-γ template DNA connect the 1 μ L of IFN-α template DNA of flexible linker, 0.5 μ L of IFN-γ sense primer, IFN-α 0.5 μ L, Taq archaeal dna polymerase of downstream primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；It is anti-to connect PCR The condition is answered to be：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 A cycle；Last 72 DEG C of extensions 10min.

The present invention also provides the application of the recombinant bovine long-acting interferon α, long half time had up to 45 hours or more Broad-spectrum disease resistance toxic action and the immune response that Niu Zishen can be improved.

Compared with prior art, the present invention has the advantages that：

1. Bov IFN γ and Bov IFN-α genes are realized fusion by flexible linker, improves interferon and partly decline Phase improves 11 times or more compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce into This.

2. by being optimized to Bov IFN γ and Bov IFN-α genes, interferon gamma and Bov IFN-α are improved The expression quantity of fusion protein；

3. using recombination bacillus coli BL21/pET-32a-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids do not generate inclusion body in protein expression, form soluble protein, avoid the mistake of inclusion body denaturation and renaturation Journey substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of Bov IFN γ and Bov IFN-α not only has interferon-' alpha ' Broad-spectrum disease resistance toxic action, while significantly improving the immune response of Niu Zishen.

Description of the drawings

Fig. 1 is the result of the Bov IFN γ genes and the RT-PCR amplifications of Bov IFN α genes in embodiment 1；Swimming lane M： DNA Marker DL2000；Swimming lane 1：Bov IFN γ gene RT-PCR amplified productions；Swimming lane 2：Bov IFN α genes RT- Pcr amplification product；

Fig. 2 is the result of the PCR amplification after the ox IFN-γ in embodiment 1 is connected with the target gene of ox IFN-α；Swimming Road M：DNA Marker DL2000；Swimming lane 1：Bov IFN γ genes and Bov IFN α gene ligation amplification products；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations results of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Empty bacterium compares；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Precipitation；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the recombinant bovine long-acting interferon α made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the recombinant bovine long-acting interferon α of gradient dilution (from right to left) handles hole；

Fig. 7 is the recombinant bovine long-acting interferon α intramuscular injection blood made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific implementation mode

Embodiment 1

A kind of fusion protein being made of Bov IFN γ and Bov IFN α, preparation method are as follows：

1. the acquisition and amplification of Bov IFN γ (IFN-γ) and Bov IFN α (IFN-α) target gene

Design of primers：

It is shown in Table 1 according to the objective gene sequence design synthetic primer reported in Genebank, in the upper of Bov IFN γ Trip primer and downstream primer in introduce EcoRI restriction enzyme sites and Linker sequences respectively, Bov IFN α sense primer and under Linker sequences and XhoI restriction enzyme sites are introduced respectively in trip primer.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from cattle liver tissue, the target gene of IFN-γ and IFN-α, the base of the two are obtained by reverse transcription Because sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

RT-PCR reaction systems (25 μ L) are shown in Table 2

2 RT-PCR reaction systems of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into cycle：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45S, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 530bp and 530bp or so in RT-PCR amplified productions, and result is such as Shown in Fig. 1, illustrate the Bov IFN γ target gene for successfully having obtained being separately connected flexible linker and Bov IFN α purposes Gene.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3：

3 PCR reaction systems of table

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45S, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1030bp or so in pcr amplification product, and the results are shown in Figure 2, The nucleotide sequence of obtained target gene is as shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

The PCR glue recovery product for selecting the target gene after connection errorless after sequencing is used with pET-32a plasmids EcoRI and XhoI restriction enzymes carry out double digestion and recycling, and double digestion is done by 20 μ L systems in table 4：

4 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2uL
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmids after connection is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

It converts in connection product to e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB tablets is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through EcoRI and XhoI double digestions, is accredited as positive and indicates expression vector establishment success, obtain engineering bacteria pET-32a/ There is single band through agarose gel electrophoresis at the places 1030bp or so in rIFN γ-IFN α, PCR amplification and double digestion product, The results are shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIFN γ-IFN α shakes for 37 DEG C in the LB culture mediums of the 100 μ g/ml containing ampicillin Bacterium 1h recoveries engineering bacteria activity is surveyed OD values and is reached in LB culture mediums (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, 32 DEG C of induced expression (100 μ g/ml of final concentration) 5h is added；Bacterium is collected, is examined through SDS-PAGE electrophoresis It surveys, supernatant is deposited in the visible predominant expression band in the places 56KD or so after the bacterial cell disruption after recombinant bacterium induction 5h, and result is such as Shown in Fig. 4, it can be seen from the figure that be deposited in the places 56KD or so visible excellent for supernatant after bacterial cell disruption after recombinant bacterium induction 5h Gesture band of expression illustrates precipitating and the fusion protein of equal successful expression in supernatant.

Mass volume ratio 1 is added:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifuges 15min, Supernatant, inclusion body (inclusion body is through dissolving, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIFN γ-IFN α protein peak.

5.2 DEAE anion-exchange chromatographies

By the albumen collected after His affinitive layer purifications displacement to (the 50mM trihydroxy methyls of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After crossing column to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatographies of Superdex, with Binding Buffer III elution, collects rIFN γ-IFN α protein peak

5.4 sample identification：Measure rIFN γ-IFN α potency and specific activity, specific activity >=1.0 × 10⁷U/mg albumen is to close Lattice；It is aseptic subpackaged, -80 DEG C of preservations.It can be obtained the fusion protein being made of Bov IFN γ and Bov IFN α, amino acid Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of Bov IFN γ and Bov IFN α, other, only will be therein with embodiment 1 E. coli bl21 (DE3) competent cell is replaced for BL21 (DE3) competent cell with pGro7 plasmids.It is merged The SDS-PAGE electrophoresis results of albumen are compareed with embodiment 1, and 56KD or so place's predominant expression bands are thicker in supernatant, and explanation is drawn After entering molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount higher.Escherichia coli The albumen of expression is mostly present in inclusion body；By introducing molecular chaperones in expressing bacterial strain, coordinate expression albumen is correct It folds, reaches solubility expression of protein.

Embodiment 3

To in embodiment 1 IFN-γ and IFN-α optimize, artificial synthesized IFN-γ and IFN-α target gene, optimization Afterwards, the nucleotide sequence of the two is respectively such as 400 < of SEQUENCE LISTING 400 <, 6 > and SEQUENCE LISTING, 7 > institutes Show.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common each biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the profit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IFN-γ of ox and IFN- in the present embodiment α gene codons optimize.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI values are lower to show that expression is lower in host.G/C content most ideal distribution ranging from 30 in gene~ 70%, in any region translation and transcriptional efficiency can be influenced more than the range.Using software detection find ox IFN-γ and The codon of IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.24,0.25, GC percentages It is 39.8%, 58.2%；And by obtaining recombination password in Escherichia coli after ox IFN-γ and IFN-α gene optimization Sub- adaptation index (CAI) is 1.0,0.97, GC percentages 44.8%, 54.6%.Low password is significantly reduced by gene optimization The utilization rate of son, avoids influence of the rare codon to protein expression, improves the G/C content of gene, improve transcription and translation Efficiency, and then improve the expression quantity of recombinant protein.

1.3 design of primers：

6 PCR amplification primer of table

The genomic DNA of IFN-γ and IFN-α after optimization is diluted to 0.05mg/mL respectively.It is obtained using PCR amplification Target gene, 25 μ L reaction systems are as shown in table 7：

7 PCR reaction systems of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerases	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：95 DEG C of denaturation 45s；60 DEG C of annealing 45S, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 530bp and 530bp or so in pcr amplification product, and explanation is prepared into To the target gene for being separately connected IFN-γ and IFN-α after the optimization of flexible linker.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 8：

8 PCR reaction systems of table

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1030bp or so in pcr amplification product, illustrates successfully to obtain IFN-γ connected with IFN-α after target gene.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING Shown in 400 <, 3 >.

3. expression vector establishment

The glue recovery product of target gene PCR errorless after sequencing after selection connection is used with pET-32a plasmids BamHI, XhoI restriction enzyme carry out double digestion and recycling, and double digestion is done by 20 μ L systems in table 9：

9 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmids after connection is attached by the system in table 10,4 DEG C overnight connection：

Table 10

It converts in connection product to e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB tablets is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through BamHI, XhoI double digestion, is accredited as positive and indicates expression vector establishment success, obtain engineering bacteria pET-32a/ There is single band through agarose gel electrophoresis at 1030bp in rIFN γ-IFN α, PCR amplification and double digestion product, and explanation contains The expression vector establishment success of target gene after thering is IFN-γ to be connected with IFN-α.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIFN γ-IFN α shakes for 37 DEG C in the LB culture mediums of the 100 μ g/ml containing ampicillin Bacterium 1h recoveries engineering bacteria activity is surveyed OD values and is reached in LB culture mediums (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, 32 DEG C of induced expression (100 μ g/ml of final concentration) 5h is added；Bacterium is collected, is examined through SDS-PAGE electrophoresis It surveys, supernatant is deposited in the visible predominant expression band in the places 56KD or so after the bacterial cell disruption after recombinant bacterium induction 5h, illustrates upper Recombinant protein has been obtained in cleer and peaceful precipitation.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude recombinant bovine interferon-' alpha ' with 0.22 μm of aperture, loading is by being connected to AKTA On 100 protein purification systems of explorer, the His affinity columns balanced with Binding Buffer I (PBS) use PBS Buffer solution washes away unbonded albumen, until A280nm stablizes, then with (the 50mM trihydroxy methyl amino first of Elution buffer I Alkane, 20~500mM imidazoles, PH8.0) elution, collect rIFN γ-IFN α protein peak.

5.2 DEAE anion-exchange chromatographies

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatographies of Superdex, with Binding Buffer III elution, collects rIFN γ-IFN α protein peak.

5.4 sample identification

Measure rIFN γ-IFN α potency and specific activity, specific activity >=1 × 10⁷U/mg albumen is qualification；It is aseptic subpackaged, -80 DEG C preserve.It can be obtained the fusion protein being made of Bov IFN γ and Bov IFN α, amino acid sequence such as SEQUENCE Shown in 400 < of LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of Bov IFN γ and Bov IFN α, other, only will be therein with embodiment 3 E. coli bl21 (DE3) competent cell is replaced for BL21 (DE3) competent cell with pGro7 plasmids.It is merged The SDS-PAGE electrophoresis results of albumen are compareed with embodiment 3, and 56KD or so place's predominant expression bands are thicker in supernatant, and explanation is drawn After entering molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount higher.Escherichia coli The albumen of expression is mostly present in inclusion body；By introducing molecular chaperones in expressing bacterial strain, coordinate expression albumen is correct It folds, reaches solubility expression of protein.

Embodiment 5

A kind of recombinant bovine long-acting interferon α, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture Later, freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 is obtained by the identification of Bov IFN γ and Bov IFN the α fusion protein formed

The quantitative detection of 6.1 protein contents

With Lowry methods, the standard protein that institute is examined and determine with Chinese food pharmaceutical biological product is made standard test, measures embodiment 1~4 obtained fusion protein concentration is all higher than 1.0mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 56KD or so, as shown in Figure 4.

6.3 Western Blot results

Fusion protein in Examples 1 to 4 is detected respectively, with the anti-ox alpha interferon of abcam companies mouse (1:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant bovine long-acting interferon α samples can be with anti-Bov IFN Specific reaction occurs for alpha monoclonal antibodies, and specific band occur in the places 56KD or so, as shown in Figure 5.

Embodiment 7

Bioactivity freeze-dried four parts of recombinant bovine long-acting interferon α in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombinant bovine that various dose is added is long for culture Interferon-' alpha ' is imitated, inhales abandon afterwards for 24 hours, then inoculation 100TCID50VSV viruses respectively.

Test result

The result shows that the recombinant bovine long-acting interferon α obtained causes the lesion of HEp-2 cells to have apparent inhibit VSV Effect.The lesions such as occurs cell rounding after untreated cell inoculation virus, falls off, is disintegrated.And the recombinant bovine obtained is long After imitating interferon-' alpha ' treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not go out incumbent What lesion, measures potency >=1.0 × 10⁷U/ml, as shown in Figure 6.

Embodiment 8

The measurement of half-life period of the recombinant bovine long-acting interferon α in ox body

The four parts of recombinant bovine long-acting interferon α freeze-dryings obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 The measurement of half-life period of the agent (being denoted as A, B, C, D respectively) in ox body

Cytopathic-effect inhibition assay measures the blood concentration and time relationship of rIFN γ-IFN α

Take the ox (half male and half female) that six weight are roughly the same, neck that 2mg/ml recombinant bovine long-acting interferons α is subcutaneously injected Freeze-dried 2ml, respectively 1h, 2h, 4h, 8h, 16h, for 24 hours, 48h, 72h venous blood collection, the solidification of 4 DEG C of blood sample, 3500rpm low temperature from Heart 10min detaches serum, and every ox blood sample of each time point is to be measured in -20 DEG C of preservations.Serum sample is measured using cytopathic-effect inhibition assay The concentration of rIFN γ-IFN α in product is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.The matched curve of A such as Fig. 7 It is shown；Parameter result of calculation is shown in Table 11.

Dominant dynamic parameters in serum after 11 recombinant bovine long-acting interferon α intramuscular injection of table

The result shows that recombinant bovine long-acting interferon α has longer half-life period.Half-life period can reach 45h or so after measured, compared with Plain interferon improves 11 times.

Embodiment 9

The freeze-dried measurement that ox cellullar immunologic response is influenced of four parts of recombinant bovine long-acting interferon α in embodiment 5

The young ox for taking six weight roughly the same is divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously noted The 2mg/ml recombinant bovine long-acting interferon freeze-dried 2ml of α are penetrated, the PBS of 2mL is subcutaneously injected in control group neck, takes after injecting 4 weeks outside ox All blood takes weekly a blood later, detaches lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-2, IL-4 content, is carried out by kit specification, and testing result is as shown in table 12：

Table 12 ELISA detection each group ox cellullar immunologic responses are horizontal

The result shows that after injection recombinant bovine long-acting interferon α, can significantly improve ox Evaluation of Cytokines in Peripheral Blood IL-2, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned to recombinant bovine long-acting interferon α and to prepare fusion protein and its preparation of this long-acting interferon with reference to embodiment The detailed description that method carries out is illustrative without being restrictive, and can enumerate several implementations according to limited range Example, therefore the change and modification in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of recombinant bovine long-acting interferon α and the fusion protein and preparation method thereof for preparing this long-acting interferon

<130> 1

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 342

<212> PRT

<213>Recombinant bovine long-acting interferon alpha fusion protein

<400> 1

Met Lys Tyr Thr Ser Tyr Phe Leu Ala Leu Leu Leu Cys Gly Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Gln Phe Phe Arg Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Ser Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Asp Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Lys Leu Ile Gln Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Thr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

165 170 175

Cys His Leu Pro His Thr His Ser Leu Ala Asn Arg Arg Val Leu Met

180 185 190

Leu Leu Gly Gln Leu Arg Arg Val Ser Pro Ser Ser Cys Leu Gln Asp

195 200 205

Arg Asn Asp Phe Ala Phe Pro Gln Glu Ala Leu Gly Gly Ser Gln Leu

210 215 220

Gln Lys Ala Gln Ala Ile Ser Val Leu His Glu Val Thr Gln His Thr

225 230 235 240

Phe Gln Leu Phe Ser Thr Glu Gly Ser Ala Thr Thr Trp Asp Glu Ser

245 250 255

Leu Leu Asp Lys Leu Arg Ala Ala Leu Asp Gln Gln Leu Thr Asp Leu

260 265 270

Gln Ala Cys Leu Arg Gln Glu Glu Glu Leu Gln Gly Ala Pro Leu Leu

275 280 285

Lys Glu Asp Ser Ser Leu Ala Val Arg Lys Tyr Phe His Arg Leu Thr

290 295 300

Leu Tyr Leu Gln Glu Lys Lys His Ser Pro Cys Ala Trp Glu Val Val

305 310 315 320

Arg Ala Gln Val Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Glu

325 330 335

Ser Phe Arg Arg Lys Asp

340

<210> 2

<211> 1026

<212> DNA

<213>Recombinant bovine long-acting interferon α genomes 1

<400> 2

atgaaatata caagctattt cttagcttta ctgctctgtg ggcttttggg tttttctggt 60

tcttatggcc agggccaatt ttttagagaa atagaaaact taaaggagta ttttaatgca 120

agtagcccag atgtagctaa gggtgggcct ctcttctcag aaattttgaa gaattggaaa 180

gatgaaagtg acaaaaaaat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaatgg cagctctgag aaactggagg acttcaaaaa gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccataa atgaactcat caaagtgatg 420

aatgacctgt caccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaacggg tggtggtggt tctggtggtg gtggttcttg ccacctgcct 540

cacacccaca gcctggccaa caggagggtc ctgatgctcc tgggacaact gaggagggtc 600

tccccttcct cctgcctgca ggacagaaat gacttcgcat tcccccagga ggcgctgggt 660

ggcagccagt tgcagaaggc tcaagccatc tctgtgctcc acgaggtgac ccagcacacc 720

ttccagcttt tcagcacaga gggctcggcc actacgtggg atgagagcct cctggacaag 780

ctccgcgctg cactggatca gcagctcact gacctgcaag cctgtctgag gcaggaggag 840

gagctgcaag gagctcccct gctcaaggag gactccagcc tggctgtgag gaaatacttc 900

cacagactca ctctctatct gcaagagaag aaacacagcc cttgtgcctg ggaggttgtc 960

agagcacaag tcatgagagc cttctcttcc tcaacaaact tgcaggagag tttcaggaga 1020

aaggac 1026

<210> 3

<211> 1026

<212> DNA

<213>Recombinant bovine long-acting interferon α genomes 2

<400> 3

atgaaataca cctcttactt cctggctctg ctgctgtgcg gtctgctggg tttctctggt 60

tcttacggtc agggtcagtt cttccgtgaa atcgaaaacc tgaaagaata cttcaacgct 120

tcttctccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gacgaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaaaa actgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctaccgg tggtggtggt tctggtggtg gtggttcttg ccacctgccg 540

cacacccact ctctggctaa ccgtcgtgtt ctgatgctgc tgggtcagtt acgtcgtgta 600

agcccgtctt cttgcctgca ggaccgtaac gacttcgctt tcccgcagga agctctgggt 660

ggttctcagc tgcagaaagc tcaggctatc tctgttctgc acgaagttac ccagcacacc 720

ttccagctgt tctctaccga aggttctgct accacctggg acgaatctct gctggacaaa 780

ctgcgtgctg ctctggacca gcagctgacc gacctgcagg cttgcctgcg tcaggaagaa 840

gaactgcagg gtgctccgct gctgaaagaa gactcttctc tggctgttcg taaatacttc 900

caccgtctga ccctgtacct gcaggaaaaa aaacactctc cgtgcgcttg ggaagttgtt 960

cgtgctcagg ttatgcgtgc tttctcttct tctaccaacc tgcaggaatc tttccgtcgt 1020

aaagac 1026

<210> 4

<211> 498

<212> DNA

<213>Bov IFN γ

<400> 4

atgaaatata caagctattt cttagcttta ctgctctgtg ggcttttggg tttttctggt 60

tcttatggcc agggccaatt ttttagagaa atagaaaact taaaggagta ttttaatgca 120

agtagcccag atgtagctaa gggtgggcct ctcttctcag aaattttgaa gaattggaaa 180

gatgaaagtg acaaaaaaat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaatgg cagctctgag aaactggagg acttcaaaaa gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccataa atgaactcat caaagtgatg 420

aatgacctgt caccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaacg 498

<210> 5

<211> 498

<212> DNA

<213>Bov IFN α

<400> 5

tgccacctgc ctcacaccca cagcctggcc aacaggaggg tcctgatgct cctgggacaa 60

ctgaggaggg tctccccttc ctcctgcctg caggacagaa atgacttcgc attcccccag 120

gaggcgctgg gtggcagcca gttgcagaag gctcaagcca tctctgtgct ccacgaggtg 180

acccagcaca ccttccagct tttcagcaca gagggctcgg ccactacgtg ggatgagagc 240

ctcctggaca agctccgcgc tgcactggat cagcagctca ctgacctgca agcctgtctg 300

aggcaggagg aggagctgca aggagctccc ctgctcaagg aggactccag cctggctgtg 360

aggaaatact tccacagact cactctctat ctgcaagaga agaaacacag cccttgtgcc 420

tgggaggttg tcagagcaca agtcatgaga gccttctctt cctcaacaaa cttgcaggag 480

agtttcagga gaaaggac 498

<210> 6

<211> 498

<212> DNA

<213>Bov IFN γ

<400> 6

atgaaataca cctcttactt cctggctctg ctgctgtgcg gtctgctggg tttctctggt 60

tcttacggtc agggtcagtt cttccgtgaa atcgaaaacc tgaaagaata cttcaacgct 120

tcttctccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gacgaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaaaa actgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctacc 498

<210> 7

<211> 498

<212> DNA

<213>Bov IFN α

<400> 7

tgccacctgc cgcacaccca ctctctggct aaccgtcgtg ttctgatgct gctgggtcag 60

ttacgtcgtg taagcccgtc ttcttgcctg caggaccgta acgacttcgc tttcccgcag 120

gaagctctgg gtggttctca gctgcagaaa gctcaggcta tctctgttct gcacgaagtt 180

acccagcaca ccttccagct gttctctacc gaaggttctg ctaccacctg ggacgaatct 240

ctgctggaca aactgcgtgc tgctctggac cagcagctga ccgacctgca ggcttgcctg 300

cgtcaggaag aagaactgca gggtgctccg ctgctgaaag aagactcttc tctggctgtt 360

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aaaaacactc tccgtgcgct 420

tgggaagttg ttcgtgctca ggttatgcgt gctttctctt cttctaccaa cctgcaggaa 480

tctttccgtc gtaaagac 498

Claims

1. a kind of fusion protein being made of Bov IFN γ and Bov IFN α, it is characterised in that：The amino of the fusion protein Acid sequence table is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene of coding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. the expression vector containing gene as claimed in claim 2.

4. the genetic engineering bacterium containing gene as claimed in claim 2.

5. a kind of recombinant bovine long-acting interferon α, which is characterized in that the recombinant bovine long-acting interferon α is by described in claim 1 It is freeze-dried to form after fusion protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, can be obtained fusion protein after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIFN γ- IFN α, preparation method are：

(1) design primer, obtained by reverse transcription or the Bov IFN γ of the flexible linker sequences of artificial synthesized connection and The target gene of Bov IFN α；The target gene of Bov IFN γ and Bov IFN α are connected by flexible linker, The nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 2 > or such as SEQUENCE LISTING 400 Shown in 3 > of <；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/r IFN γs- IFNα。

8. the preparation method described according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.

9. the preparation method described according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively purified through affinity chromatography, anion-exchange chromatography and sieve chromatography.

10. the application of recombinant bovine long-acting interferon α according to claim 5, which is characterized in that the recombinant bovine is long-acting dry The long half time of plain α is disturbed up to 45 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of Niu Zishen can be improved.