CN108864301A - A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2 - Google Patents
A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2 Download PDFInfo
- Publication number
- CN108864301A CN108864301A CN201810750999.XA CN201810750999A CN108864301A CN 108864301 A CN108864301 A CN 108864301A CN 201810750999 A CN201810750999 A CN 201810750999A CN 108864301 A CN108864301 A CN 108864301A
- Authority
- CN
- China
- Prior art keywords
- ifn
- fusion protein
- gene
- leu
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/55—IL-2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/57—IFN-gamma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Virology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The fusion protein and preparation method thereof that the invention discloses a kind of to be made of bovine albumin, Bov IFN γ and cattle interleukins-2 2; the fusion protein is connected through flexible linker with cattle interleukins-2 2 by bovine albumin, Bov IFN γ and is formed, and is freeze-dried to obtain recombinant bovine long-acting interferon after fusion protein and freeze drying protectant mixture.The recombinant bovine long-acting interferon is remarkably improved the half-life period of Bov IFN, and the half-life period of more common Bov IFN improves 19 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of Niu Zishen.
Description
Technical field
The invention belongs to technical field of biological genetic engineering, and in particular to thin by bovine albumin, Bov IFN γ and Niu Bai
The fusion protein and preparation method thereof that born of the same parents' interleukin 2 forms.
Background technique
Ox is important one of the herding type in China, with intensive and large-scale cultivation continuous development, bovine viral
The disease incidence of communicable disease improves year by year.Large-scale pasture is popular for a long time at home for the communicable disease of many oxen, because
Disease infects fastly, and disease incidence, the death rate are high seriously to restrict the sound development of China's ox aquaculture;More seriously some
Poultry suffers from the life and health that brucellosis, tuberculosis of infectious disease such as ox etc. directly threaten the mankind altogether.
Mainly pass through vaccine inoculation to the prevention and treatment approach of ox communicable disease at present and uses antibiotic.Big portion
Antibiotics and traditional oral antiviral medicament is divided to bring a negative impact due to medicament residue problem to health;And
Traditional vaccine, high specific and side effect due to it, can not resist virus variation and new virus continuously emerges to pig
Aquaculture bring significant damage.Interferon determines its tool with the antiviral activity of its wide spectrum and extensive immunoregulation capability
There are huge clinical application potentiality, can be used to prevent and treat bovine viral bacterial infection disease.
IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect
Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot
After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus
RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.It is existing it is known that γ type IFN be T cell by activating and
NK cell generates, and has relatively strong antiviral and immunoloregulation function.A large number of studies show that interferon gamma is in addition to broad-spectrum disease resistance
Outside malicious function, crucial adjustment effect is also played to immune system, so IFN-γ is also known as immunological regulation interferon.Although each
The interferon of seed type can reaction of the mediated cell to virus infection, but the immunoregulatory activity of interferon gamma coordinate exempt from
Epidemic disease, which is reacted and determined, plays even more important effect in the long-term antiviral state of body, therefore interferon gamma is with particularly important
Clinical value.
Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocyte activated
The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin
Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor
In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy
The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases
Epidemic disease treatment.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to improve
Curative effect of medication.IL-2, according to gene constructed, composition fusion protein, is generated and is mentioned to enhance the antibody of vaccine with other cell factors
High cellular immune level.
Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and
There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.Albumin fusion technology has the advantage that:Albumin and target egg
It is white to be linked in the cell through protein translation system by peptide bond, it is not required to additional extracorporeal treatment;The expression of albumin is higher,
The expression of destination protein can be improved after merging with it;Albumin is one stable " inert protein ", after merging with it
The stability of destination protein can be improved;Albumin fusion protein has longer drug half-life, by small molecular protein drug
It can be expected to improve half-life period in blood with Albumin fusion.Currently, in experimental animal after multiple protein and Albumin fusion
The extension of Half-life in vivo is confirmed.
The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4
A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment
Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short
There are two:The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from
Epidemic disease system is removed.
And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight
Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very
Height is unfavorable for clinically applying.
Summary of the invention
It is situated between in order to solve the above technical problems, the present invention provides one kind by bovine albumin, Bov IFN γ and bovine leukocyte
The fusion proteins and preparation method thereof of 2 composition of element, and thus after fusion protein and freeze drying protectant mixture, freeze-dried system
Standby to obtain a kind of recombinant bovine long-acting interferon, the recombinant bovine long-acting interferon is remarkably improved the half-life period of Bov IFN, compared with
The half-life period of common Bov IFN improves 19 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune of Niu Zishen and answer
It answers.
The technical scheme adopted by the invention is as follows:
A kind of fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2, the fusion protein
Amino acid sequence table is as shown in 400 < of SEQUENCE LISTING, 1 >.
The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene
Shown in 400 < of LISTING, 2 >, it is denoted as genome 1;Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.
Fusion protein described in the genome 1 and the equal codified of the genome 2.Genome 2 is the nucleosides to genome 1
Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system
In be optimal high efficient expression state, CAI value is lower to show that expression is lower in host.Most ideal point of G/C content in gene
Cloth range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region.It is sent out using software detection
Existing bovine albumin, ox IFN-γ, ox IL-2 original gene codon codon adaptation indexI (CAI) is respectively in Escherichia coli
It is 42.9%, 39.8%, 39.1% for 0.22,0.24,0.19, GC percentage;And by bovine albumin, ox IFN-γ, ox
It is 0.99,1.0,0.94, GC percentage that each gene codon adaptation indexI (CAI) in Escherichia coli is obtained after IL-2 gene optimization
Than 49.9%, 44.8%, 48.2%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon
Influence of the son to protein expression, improves the G/C content of gene, improves transcription and translation efficiency.
The present invention also provides the expression vectors containing genome 1 or genome 2.
Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.
The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.
Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2.
Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place
Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell
Or BL21 (DE3) competent cell with pGro7 plasmid.
The present invention also provides a kind of recombinant bovine long-acting interferon, the recombinant bovine long-acting interferon is by the fusion egg
It is freeze-dried to form after the white mixture with freeze drying protectant.
The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS
For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.
The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps:It will contain
The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium
The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.
The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2;
The genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2, and preparation method is:
(1) design primer obtains by reverse transcription or is manually respectively synthesized the synthesis ox for connecting flexible linker sequence
Albumin, Bov IFN γ, cattle interleukins-2 2 target gene;By flexible linker by bovine albumin, Bov IFN
γ, cattle interleukins-2 2 target gene connect, the nucleotides sequence list such as SEQUENCE of the target gene after connection
Shown in 400 < of LISTING, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >;
(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector;
(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb- can be obtained
IFNγ-IL2。
The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid
By state cell.
The method of the purifying is:The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve
Chromatographic purifying.
BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise
Biology, article No. V205.
The acquisition methods of the genome 1 are:
A. design of primers
The primer sequence of bovine albumin (Alb) is:
Upstream Alb-F1:CCGGAATTCATGAAGTGGGTGACTT has EcoRI restriction enzyme site;
Downstream Alb-R1:
ACCACCACCAGAACCACCACCACCGGCTAAGGCTGTTTG, with flexible linker;
The primer sequence of Bov IFN γ (IFN-γ) is:
Upstream IFN-γ-F1:
GGTGGTTCTGGTGGTGGTGGTTCTATGAAATATACAAGCTATTT, with flexible linker;
Downstream IFN-γ-R1:
ACCACCACCAGAACCACCACCACCCGTTGATGCTCTCC, with flexible linker;
The primer sequence of cattle interleukins-2 2 (IL-2) is:
Upstream IL-2-F1:
GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAGATACAACTCT, with flexible linker;
Downstream IL-2-R1:CCCTCGAGAGTCATTGTTGAGTAGAT has XhoI restriction enzyme site;
B. RNA is extracted from cattle liver, by reverse transcription obtain ox Alb, ox IFN-γ and ox IL-2 target gene, three
The gene order of person respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and
Shown in 400 < of SEQUENCE LISTING, 6 >;
Respectively using the target gene of ox Alb, ox IFN-γ and ox IL-2 as template, and it is utilized respectively ox Alb, ox IFN-γ
PCR amplification is carried out with the upstream and downstream primer of ox IL-2.
PCR reaction system and condition are:In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each
0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L;The reaction of the RT-PCR reaction
Condition is:50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation;95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged
1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.
C. rAlb-IFN γ gene is obtained using flexible linker connection ox Alb and ox IFN-γ target gene
The PCR reaction system and reaction condition of connection be:In the overall reaction system of 25 μ L, connect flexible linker's
1 μ L of Alb gene template DNA connects 1 μ L, Alb upstream primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker
0.5 μ L, Taq archaeal dna polymerase of γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L;Connection
PCR reaction condition is:95 DEG C of initial denaturation 4min, into circulation:94 DEG C of denaturation 45s;58 DEG C of annealing 45s, 72 DEG C of extension 1kb/
Min, totally 35 recycle;Last 72 DEG C of extensions 10min.
D. rAlb-IFN γ-IL2 is obtained using flexible linker connection rAlb-IFN γ gene and ox IL-2 target gene
Gene
The PCR reaction system and reaction condition of connection be:In the overall reaction system of 25 μ L, rAlb-IFN γ gene template
1 μ L of DNA connects 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker,
2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L;Connecting PCR reaction condition is:95℃
Initial denaturation 4min, into circulation:94 DEG C of denaturation 45s;58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle;Last 72
DEG C extend 10min.
Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2
For:
A. design of primers
The primer sequence of bovine albumin (Alb) is:
Upstream Alb-F2:CGGGATCCATGAAATGGGTTACCTT has BamHI restriction enzyme site;
Downstream Alb-R2:
ACCACCACCAGAACCACCACCACCAGCCAGAGCGGTC, with flexible linker;
The primer sequence of Bov IFN γ (IFN-γ) is:
Upstream IFN-γ-F2:
GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACCTCTTAC, with flexible linker;
Downstream IFN-γ-R2:
ACCACCACCAGAACCACCACCACCGGTAGAAGCACGACG, with flexible linker;
Cattle interleukins-2 2 (IL-2):
Upstream IL-2-F2:
GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATCCAGCT, with flexible linker;
Downstream IL-2-R2:
CCCTCGAGGGTCATGGTAGAGTAGA has XhoI restriction enzyme site.
B. the ox Alb, ox IFN-γ and ox IL-2 target gene, the gene order of three is respectively such as SEQUENCE
Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >;
Respectively using the target gene of ox Alb, ox IFN-γ and ox IL-2 as template, and it is utilized respectively ox Alb, ox IFN-γ
PCR amplification is carried out with the upstream and downstream primer of ox IL-2.
PCR reaction system and condition are:In the overall reaction system of 25 μ L, 1 μ L of genomic DNA, upstream and downstream primer is each
0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L;The RT-PCR reaction
Reaction condition is:95 DEG C of initial denaturation 4min, into circulation;95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed
Ring 35 times, last 72 DEG C of extensions 10min.
C. rAlb-IFN γ gene is obtained using flexible linker connection ox Alb and ox IFN γ target gene
The PCR reaction system and reaction condition of connection be:In the overall reaction system of 25 μ L, connect flexible linker's
1 μ L of Alb gene template DNA connects 1 μ L, Alb upstream primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker
0.5 μ L, Taq archaeal dna polymerase of γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L;Connection
PCR reaction condition is:95 DEG C of initial denaturation 4min, into circulation:94 DEG C of denaturation 45s;60 DEG C of annealing 45s, 72 DEG C of extension 1kb/
Min, totally 35 recycle;Last 72 DEG C of extensions 10min.
D. rAlb-IFN γ-IL2 base is obtained using flexible linker connection rAlb-IFN γ gene and ox IL2 target gene
Cause
The PCR reaction system and reaction condition of connection be:In the overall reaction system of 25 μ L, rAlb-IFN γ gene template
1 μ L of DNA connects 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker,
2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L;Connecting PCR reaction condition is:95℃
Initial denaturation 4min, into circulation:94 DEG C of denaturation 45s;60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle;Last 72
DEG C extend 10min.
The present invention also provides the application of the recombinant bovine long-acting interferon, long half time had up to 76 hours or more
Broad-spectrum disease resistance toxic action and the immune response that Niu Zishen can be improved.
Compared with prior art, the present invention has the advantages that:
1. ox Alb, ox IFN-γ and ox IL-2 gene are realized amalgamation and expression by flexibility linker, interferon is improved
Half-life period improves 19 times or more compared with plain interferon;Compared with common polyethylene glycol fused interferon, significantly reduce
Cost.
2. improving ox ox Alb, ox IFN-γ and ox by optimizing to ox Alb, ox IFN-γ and ox IL-2 gene
The expression quantity of IL-2 fusion protein.
3. using recombination bacillus coli pET-32a/rAlb-IFN γ-IL2 as expression bacterial strain, by introducing molecular chaperones
PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers
The process of property, substantially reduces the time of expressing fusion protein;
4. the fusion protein disclosed by the invention being made of ox Alb, ox IFN-γ and ox IL-2 not only has IFN-γ
Broad-spectrum disease resistance toxic action, while significantly improving the immune response of Niu Zishen.
Detailed description of the invention
Fig. 1 is that bovine albumin gene, ox interleukin-22 gene and the Bov IFN γ gene RT-PCR in embodiment 1 are expanded
Result;Swimming lane M:DNA Marker DL2000;Swimming lane 1:Ox interleukin-22 gene RT-PCR amplified production;Swimming lane 2:Ox interference
Plain γ gene RT-PCR amplified production;Swimming lane 3:Bovine albumin gene RT-PCR amplified production;
Fig. 2 be embodiment 1 in ox Alb, ox IFN-γ connected with the target gene of ox IL-2 after PCR amplification knot
Fruit;Swimming lane M:DNA Marker DL10000;Swimming lane 1:Bovine albumin gene, Bov IFN γ gene and ox interleukin-22 gene
Ligation amplification product;
Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1;Swimming lane M:DNA
Marker DL10000;Swimming lane 1:Recombinant plasmid double digestion result;Swimming lane 2:Plasmid PCR result;
Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1;Swimming lane M:Albumen Marker;Swimming lane
1:Supernatant after bacterial cell disruption after recombinant bacterium induction;Swimming lane 2:It is precipitated after bacterial cell disruption after recombinant bacterium induction;Swimming lane 3:It is unloaded
Control;
Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains;Swimming lane M:Albumen Marker;Swimming
Road 1:It is precipitated after recombinant bacterium induction is broken;Swimming lane 2:For the broken rear supernatant of recombinant bacterium induction;
Fig. 6 is that the recombinant bovine long-acting interferon as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5
The inhibiting effect of lesion;1 is VSV virus control wells;2 be HEp-2 cell control well;A3-12 is gradient dilution (from right to left)
Human interferon standard items handle hole;B3-12 is that the recombinant bovine long-acting interferon of gradient dilution (from right to left) handles hole;
Fig. 7 is the recombinant bovine long-acting interferon intramuscular injection blood medicine as made from the fusion protein in embodiment 1 in embodiment 8
Concentration-time change curve.
Specific embodiment
Embodiment 1
A kind of fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2, preparation method is such as
Under:
1. the acquisition of bovine albumin (Alb), Bov IFN γ (IFN-γ) and cattle interleukins-2 2 (IL-2) target gene
With amplification
Design of primers:
Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of bovine albumin
EcoRI restriction enzyme site and Linker sequence are introduced in primer and downstream primer respectively, Bov IFN γ upstream primer and under
Linker sequence is introduced respectively in trip primer, is introduced respectively in the upstream primer and downstream primer of cattle interleukins-2 2
Linker sequence and XhoI restriction enzyme site.
1 PCR amplification primer of table
RT-PCR obtains target gene:
RNA is extracted from cattle liver tissue, the target gene of ox Alb, ox IFN-γ and ox IL-2 are obtained by reverse transcription,
The gene order of three is respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and SEQUENCE
Shown in 400 < of LISTING, 6 >;
RT-PCR reaction system (25 μ L) is shown in Table 2
2 RT-PCR reaction system of table
Response parameter is:50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation:95 DEG C of denaturation 45s;58 DEG C are moved back
Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle;Last 72 DEG C of extensions 10min.
There is specific band in 1850bp, 560bp and 490bp or so through agarose gel electrophoresis in RT-PCR amplified production,
Its result is as shown in Figure 1, the target gene of ox Alb, ox IFN-γ and ox IL-2 has been prepared in explanation.
2. the connection of target gene
Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as
Shown in table 3, table 4:
3 rAlb-IFN γ PCR reaction system of table
4 rAlb-IFN γ-IL2 PCR reaction system of table
Response parameter is:95 DEG C of initial denaturation 4min, into circulation:94 DEG C of denaturation 45s;58 DEG C of annealing 45s, 72 DEG C of extensions
1kb/min, totally 35 recycle;Last 72 DEG C of extensions 10min.
There is specific band in 2840bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2,
Occur rAlb-IFN γ and IL-2 amplified product band in Fig. 2, this is because connected in rAlb-IFN γ with IL-2 gene
In the process, there is non-specific responding.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 2 > institute
Show.
3. expression vector establishment
After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmid
EcoRI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 5:
5 double digestion system of table
General buffer | 2μL |
Restriction enzyme (a pair) | 1μL+1μL |
Carrier or recycling segment | 2ul |
RNase Free water | 14μL |
The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4
DEG C overnight connection:
6 enzyme disjunctor system of table
Target fragment DNA | 10μL |
Expression vector | 3μL |
buffer | 2μL |
Ligase | 1μL |
RNase Free water | 4μL |
Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia
The LB culture medium flat plate of penicillin is incubated overnight;Single colonie on picking LB plate carries out target gene PCR identification, positive colony
Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, PCR amplification and double digestion through EcoRI and XhoI double digestion
Product detects single band at the place 2840bp or so through agarose gel electrophoresis, and result is as shown in Figure 3.
4. the expression of recombinant protein
Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as
pET-32a/rAlb-IFNγ-IL2;Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin),
Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added;Thallus is collected, through SDS-PAGE electrophoresis detection, result is as schemed
Shown in 4, it can be seen from the figure that be deposited in the place 122.6KD or so visible for supernatant after bacterial cell disruption after recombinant bacterium induction 5h
Predominant expression band illustrates in precipitating and successful expression equal in supernatant fusion protein.
Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS;- 20 DEG C precipitate 3 times in room temperature multigelation;4 DEG C of ultrasound cracking
Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times;4 DEG C, 12000r/min is centrifuged 15min,
Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.
5. fusion protein purification
5.1 His affinity chromatographys
After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100
On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution
In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM
Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IL2 protein peak.
5.2 DEAE anion-exchange chromatographies
By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II
Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then
After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II
Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IL2 protein peak.
5.3 sieve chromatography
Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into
Na2HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III
It is de-, collect rAlb-IFN γ-IL2 protein peak.
5.4 sample identification
Measure rAlb-IFN γ-IL2 potency and specific activity, specific activity >=107U/mg, albumen are qualified;It is aseptic subpackaged, -80
DEG C save.The fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2, amino acid sequence can be obtained
Column are as shown in 400 < of SEQUENCE LISTING, 1 >.
Embodiment 2
A kind of fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2, other with embodiment 1,
Only e. coli bl21 therein (DE3) competent cell is replaced in order to have BL21 (DE3) competence of pGro7 plasmid
Cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,122.6KD or so place's predominant expression in supernatant
Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein
It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body;By introducing molecular chaperones in expression bacterial strain, assist
It is correctly folded with expression albumen, reaches solubility expression of protein.
BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise
Biology, article No. V205.
Embodiment 3
A kind of fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2, preparation method is such as
Under:
1. the acquisition of bovine albumin (Alb), Bov IFN γ (IFN-γ) and cattle interleukins-2 2 (IL-2) target gene
With amplification
Ox Alb, ox IFN-γ and ox IL-2 in embodiment 1 is optimized, artificial synthesized ox Alb, ox IFN-γ and
Ox IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 < of SEQUENCE LISTING 7 >, SEQUENCE
Shown in 400 < of LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.
1.1 codon optimization
Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those
By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes
The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production
(including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree
Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained
The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely
On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon
Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, in the present embodiment to ox Alb, ox IFN-γ and
Ox IL-2 gene codon optimizes.
Interpretation of result after 1.2 codon optimizations
It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0
Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~
70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Ox Alb, ox are found using software detection
The codon of IFN-γ and ox IL-2 original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.22,0.24,
0.19, GC percentage is 42.9%, 39.8%, 39.1%;And by after to ox Alb, ox IFN-γ and ox IL-2 gene optimization
Obtaining recombination codon adaptation indexI (CAI) in Escherichia coli is respectively 0.99,1.0,0.94, GC percentage
49.9%, 44.8%, 48.2%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon
Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency, and then improves the table of recombinant protein
Up to amount.
1.3 design of primers:
7 PCR amplification primer of table
The genomic DNA of ox Alb, ox IFN-γ and ox IL-2 after optimization are diluted to 0.05mg/mL respectively.It utilizes
PCR amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8:
8 PCR reaction system of table
RNase Free water | 10.5μL |
dNTP Mix | 10.0μL |
Taq archaeal dna polymerase | 2.5μL |
Upstream and downstream primer | Each 0.5 μ L |
Genomic DNA | 1.0μL |
Response parameter is:95 DEG C of initial denaturation 4min, into circulation:95 DEG C of denaturation 45s;60 DEG C of annealing 45s, 72 DEG C of extensions
1kb/min, totally 35 recycle;Last 72 DEG C of extensions 10min.
The pcr amplification product of ox Alb, ox IFN-γ and ox IL-2 are through agarose gel electrophoresis respectively in 1850bp, 560bp
There is specific band with 490bp or so, the purpose base of ox Alb, ox IFN-γ and ox IL-2 after illustrating to be prepared optimization
Cause.
2. the connection of target gene
Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as
Shown in table 9, table 10:
9 rAlb-IFN γ PCR reaction system of table
10 rAlb-IFN γ-IL2 PCR reaction system of table
Response parameter is:95 DEG C of initial denaturation 4min, into circulation:94 DEG C of denaturation 45s;60 DEG C of annealing 45s, 72 DEG C of extensions
1kb/min, totally 35 recycle;Last 72 DEG C of extensions 10min.
There is specific band in 2840bp or so through agarose gel electrophoresis in pcr amplification product, illustrate successfully to be connected
RAlb-IFN γ-IL2 gene after connecing, the nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 3 >
It is shown.
3. expression vector establishment
The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid
BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11:
11 double digestion system of table
General buffer | 2μL |
Restriction enzyme (a pair) | 1μL+1μL |
Carrier or recycling segment | 2ul |
RNase Free water | 14μL |
The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4
DEG C overnight connection:
Table 12
Target fragment DNA | 10μL |
Expression vector | 3μL |
buffer | 2μL |
Ligase | 1μL |
RNase Free water | 4μL |
Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia
It is incubated overnight in the LB plate of element;The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR
The identification of BamHI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade
There is single band at the place 2840bp or so in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN γ-IL2 fusion carries
Body constructs successfully.
4. the expression of recombinant protein
Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as
pET-32a/rAlb-IFNγ-IL2;Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin),
Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added;Thallus is collected, through SDS-PAGE electrophoresis detection, recombinant bacterium induction
Supernatant is deposited in the visible predominant expression band in the place 122.6KD or so after bacterial cell disruption after 5h, illustrates in supernatant precipitating
Recombinant protein is obtained.
Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS;- 20 DEG C precipitate 3 times in room temperature multigelation;4 DEG C of ultrasound cracking
Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times;4 DEG C, 12000r/min is centrifuged 15min,
Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.
5. fusion protein purification
5.1 His affinity chromatographys
After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100
On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution
In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM
Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IL2 protein peak.
5.2 DEAE anion-exchange chromatographies
By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II
Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then
After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II
Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IL2 protein peak.
5.3 sieve chromatography
Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into
(50mMNa2HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, with Binding Buffer
III elution, collects rAlb-IFN γ-IL2 protein peak.
5.4 sample identification
Measure rAlb-IFN γ-IL2 potency and specific activity, specific activity >=107U/mg, albumen are qualification;It is aseptic subpackaged ,-
80 DEG C of preservations.The fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2, amino acid can be obtained
Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.
Embodiment 4
A kind of fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2, other with embodiment 3,
Only e. coli bl21 therein (DE3) competent cell is replaced in order to have BL21 (DE3) competence of pGro7 plasmid
Cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 3,122.6KD or so place's predominant expression in supernatant
Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein
It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body;By introducing molecular chaperones in expression bacterial strain, assist
It is correctly folded with expression albumen, reaches solubility expression of protein.
BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise
Biology, article No. V205.
Embodiment 5
A kind of recombinant bovine long-acting interferon, it is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4
Later, freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer with 10mmol/L PBS,
Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.
Embodiment 6
Examples 1 to 4 obtains the mirror for the fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2
It is fixed
The quantitative detection of 6.1 protein contents
With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment
1~4 obtained fusion protein concentration is all larger than 1.1mg/ml.
6.2 SDS-PAGE electrophoresis detections
Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 122.6KD or so, as shown in Figure 4.
6.3 Western Blot results
Fusion protein in Examples 1 to 4 is detected, respectively with the anti-moggy gamma interferon (1 of abcam company mouse:5000 dilutions) be
Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant bovine long-acting interferon sample can be interfered with anti-ox
Specific reaction occurs for plain γ monoclonal antibody, and specific band occurs in the place 122.6KD or so, as shown in Figure 5.
Embodiment 7
The freeze-dried bioactivity of four parts of recombinant bovine long-acting interferons in embodiment 5
Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium5Cell/ml cell suspends
Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO2For 24 hours, the recombinant bovine that various dose is added is long for culture
Interferon is imitated, inhales abandon afterwards for 24 hours, then inoculation 100TCID50VSV virus respectively.
Test result
The result shows that the recombinant bovine long-acting interferon obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV
Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombinant bovine obtained is long
After imitating interferon treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur any
Lesion measures potency >=107U/ml, as shown in Figure 6.
Embodiment 8
The four parts of recombinant bovine long-acting interferons obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 are freeze-dried
The measurement of (being denoted as A, B, C, D respectively) in ox intracorporal half-life period
The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN γ-IL2
The ox (half male and half female) that six weight are roughly the same is taken, neck is subcutaneously injected 2mg/ml recombinant bovine long-acting interferon and freezes
Dry agent 2ml, respectively 1h, 3h, 6h, 12h, for 24 hours, 36h, 48h, 72h, 96h venous blood collection, 4 DEG C of blood sample solidifications, 3500rpm is low
Temperature centrifugation 10min separates serum, and every ox blood sample of each time point is to be measured in -20 DEG C of preservations.Blood is measured using cytopathic-effect inhibition assay
The concentration of rAlb-IFN γ-IL2 in final proof product is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculates knot
Fruit is shown in Table 13.
Dominant dynamic parameters in serum after 13 recombinant bovine long-acting interferon intramuscular injection of table
The result shows that recombinant bovine long-acting interferon has longer half-life period.Half-life period can reach 76h or so after measured, more general
Logical interferon improves about 19 times.
Embodiment 9
The freeze-dried measurement that ox cellullar immunologic response is influenced of four parts of recombinant bovine long-acting interferons in embodiment 5
It takes six roughly the same beef cattles of weight to be divided into two groups, is denoted as experimental group and control group;Experimental group neck is subcutaneously infused
The 2mg/ml freeze-dried 2ml of recombinant bovine long-acting interferon is penetrated, the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside ox
All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI
It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 106A/ml, 24 porocyte culture plates are every
Hole addition 1ml lymphocyte, 37 DEG C, 5%CO272h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant
Middle IL-4 content, is carried out by kit specification, and testing result is as shown in table 14:
It is horizontal that 14 ELISA of table detects each group ox cellullar immunologic response
The result shows that containing for ox Evaluation of Cytokines in Peripheral Blood IL-4 can be significantly improved after injection recombinant bovine long-acting interferon
Amount enhances cellullar immunologic response level, significantly improves immunity level.
It is above-mentioned referring to embodiment to a kind of fusion egg being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2
The detailed description that bletilla preparation method carries out, is illustrative without being restrictive, can enumerate according to limited range
Several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it
It is interior.
SEQUENCE LISTING
<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute
<120>A kind of fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2 and its preparation side
Method
<130>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 948
<212> PRT
<213>Fusion protein
<400> 1
Met Lys Trp Val Thr Phe Ile Ser Leu Leu Leu Leu Phe Ser Ser Ala
1 5 10 15
Tyr Ser Arg Gly Val Phe Arg Arg Asp Thr His Lys Ser Glu Ile Ala
20 25 30
His Arg Phe Lys Asp Leu Gly Glu Glu His Phe Lys Gly Leu Val Leu
35 40 45
Ile Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Asp Glu His Val
50 55 60
Lys Leu Val Asn Glu Leu Thr Glu Phe Ala Lys Thr Cys Val Ala Asp
65 70 75 80
Glu Ser His Ala Gly Cys Glu Lys Ser Leu His Thr Leu Phe Gly Asp
85 90 95
Glu Leu Cys Lys Val Ala Ser Leu Arg Glu Thr Tyr Gly Asp Met Ala
100 105 110
Asp Cys Cys Glu Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Ser
115 120 125
His Lys Asp Asp Ser Pro Asp Leu Pro Lys Leu Lys Pro Asp Pro Asn
130 135 140
Thr Leu Cys Asp Glu Phe Lys Ala Asp Glu Lys Lys Phe Trp Gly Lys
145 150 155 160
Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu
165 170 175
Leu Leu Tyr Tyr Ala Asn Lys Tyr Asn Gly Val Phe Gln Glu Cys Cys
180 185 190
Gln Ala Glu Asp Lys Gly Ala Cys Leu Leu Pro Lys Ile Glu Thr Met
195 200 205
Arg Glu Lys Val Leu Ala Ser Ser Ala Arg Gln Arg Leu Arg Cys Ala
210 215 220
Ser Ile Gln Lys Phe Gly Glu Arg Ala Leu Lys Ala Trp Ser Val Ala
225 230 235 240
Arg Leu Ser Gln Lys Phe Pro Lys Ala Glu Phe Val Glu Val Thr Lys
245 250 255
Leu Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly Asp
260 265 270
Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys
275 280 285
Asp Asn Gln Asp Thr Ile Ser Ser Lys Leu Lys Glu Cys Cys Asp Lys
290 295 300
Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Lys Asp Ala
305 310 315 320
Ile Pro Glu Asn Leu Pro Pro Leu Thr Ala Asp Phe Ala Glu Asp Lys
325 330 335
Asp Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Ala Phe Leu Gly Ser
340 345 350
Phe Leu Tyr Glu Tyr Ser Arg Arg His Pro Glu Tyr Ala Val Ser Val
355 360 365
Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Glu Cys Cys
370 375 380
Ala Lys Asp Asp Pro His Ala Cys Tyr Ser Thr Val Phe Asp Lys Leu
385 390 395 400
Lys His Leu Val Asp Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys Asp
405 410 415
Gln Phe Glu Lys Leu Gly Glu Tyr Gly Phe Gln Asn Ala Leu Ile Val
420 425 430
Arg Tyr Thr Arg Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu
435 440 445
Val Ser Arg Ser Leu Gly Lys Val Gly Thr Arg Cys Cys Thr Lys Pro
450 455 460
Glu Ser Glu Arg Met Pro Cys Thr Glu Asp Tyr Leu Ser Leu Ile Leu
465 470 475 480
Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Lys Val
485 490 495
Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser
500 505 510
Ala Leu Thr Pro Asp Glu Thr Tyr Val Pro Lys Ala Phe Asp Glu Lys
515 520 525
Leu Phe Thr Phe His Ala Asp Ile Cys Thr Leu Pro Asp Thr Glu Lys
530 535 540
Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys Pro
545 550 555 560
Lys Ala Thr Glu Glu Gln Leu Lys Thr Val Met Glu Asn Phe Val Ala
565 570 575
Phe Val Asp Lys Cys Cys Ala Ala Asp Asp Lys Glu Ala Cys Phe Ala
580 585 590
Val Glu Gly Pro Lys Leu Val Val Ser Thr Gln Thr Ala Leu Ala Gly
595 600 605
Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Lys Tyr Thr Ser Tyr Phe
610 615 620
Leu Ala Leu Leu Leu Cys Gly Leu Leu Gly Phe Ser Gly Ser Tyr Gly
625 630 635 640
Gln Gly Gln Phe Phe Arg Glu Ile Glu Asn Leu Lys Glu Tyr Phe Asn
645 650 655
Ala Ser Ser Pro Asp Val Ala Lys Gly Gly Pro Leu Phe Ser Glu Ile
660 665 670
Leu Lys Asn Trp Lys Asp Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln
675 680 685
Ile Val Ser Phe Tyr Phe Lys Leu Phe Glu Asn Leu Lys Asp Asn Gln
690 695 700
Val Ile Gln Arg Ser Met Asp Ile Ile Lys Gln Asp Met Phe Gln Lys
705 710 715 720
Phe Leu Asn Gly Ser Ser Glu Lys Leu Glu Asp Phe Lys Lys Leu Ile
725 730 735
Gln Ile Pro Val Asp Asp Leu Gln Ile Gln Arg Lys Ala Ile Asn Glu
740 745 750
Leu Ile Lys Val Met Asn Asp Leu Ser Pro Lys Ser Asn Leu Arg Lys
755 760 765
Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Thr Gly
770 775 780
Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Tyr Lys Ile Gln Leu Leu
785 790 795 800
Ser Cys Ile Ala Leu Thr Leu Ala Leu Val Ala Asn Gly Ala Pro Thr
805 810 815
Ser Ser Ser Thr Gly Asn Thr Met Lys Glu Val Lys Ser Leu Leu Leu
820 825 830
Asp Leu Gln Leu Leu Leu Glu Lys Val Lys Asn Pro Glu Asn Leu Lys
835 840 845
Leu Ser Arg Met His Thr Phe Asp Phe Tyr Val Pro Lys Val Asn Ala
850 855 860
Thr Glu Leu Lys His Leu Lys Cys Leu Leu Glu Glu Leu Lys Leu Leu
865 870 875 880
Glu Glu Val Leu Asn Leu Ala Pro Ser Lys Asn Leu Asn Pro Arg Glu
885 890 895
Ile Lys Asp Ser Met Asp Asn Ile Lys Arg Ile Val Leu Glu Leu Gln
900 905 910
Gly Ser Glu Thr Arg Phe Thr Cys Glu Tyr Asp Asp Ala Thr Val Asn
915 920 925
Ala Val Glu Phe Leu Asn Lys Trp Ile Thr Phe Cys Gln Ser Ile Tyr
930 935 940
Ser Thr Met Thr
945
<210> 2
<211> 2844
<212> DNA
<213>Genome 1
<400> 2
atgaagtggg tgacttttat ttctcttctc cttctcttca gctctgctta ttccaggggt 60
gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaaaga tttgggagaa 120
gaacatttta aaggcctggt actgattgcc ttttctcagt atctccagca gtgtccattt 180
gatgagcatg taaaattagt gaacgaacta actgagtttg caaaaacatg tgttgctgat 240
gagtcccatg ccggctgtga aaagtcactt cacactctct ttggagatga attgtgtaaa 300
gttgcatccc ttcgtgaaac ctatggtgac atggctgact gctgtgagaa acaagagcct 360
gaaagaaatg aatgcttcct gagccacaaa gatgatagcc cagacctccc taaattgaaa 420
ccagacccca atactttgtg tgatgagttt aaggcagatg aaaagaagtt ttggggaaaa 480
tacctatacg aaattgctag aagacatccc tacttttatg caccagaact cctttactat 540
gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600
ctgctaccaa agattgaaac tatgagagaa aaggtactag cttcatctgc cagacagaga 660
ctcaggtgtg ccagtattca aaaatttgga gaaagagctt taaaagcatg gtcagtagct 720
cgcctgagcc agaaatttcc caaggctgag tttgtagaag ttaccaagct agtgacagat 780
ctcacaaaag tccacaagga atgctgccat ggtgacctac ttgaatgcgc agatgacagg 840
gcagatcttg ccaagtacat atgtgataat caagatacaa tctccagtaa actgaaggaa 900
tgctgtgata agcctttgtt ggaaaaatcc cactgcattg ctgaggtaga aaaagatgcc 960
atacctgaaa acctgccccc attaactgct gactttgctg aagataagga tgtttgcaaa 1020
aactatcagg aagcaaaaga tgccttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080
catcctgaat atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140
gaggaatgct gtgccaaaga tgatccacat gcatgctatt ccacagtgtt tgacaaactt 1200
aagcatcttg tggatgagcc tcagaattta atcaaacaaa actgtgacca attcgaaaaa 1260
cttggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agtaccccaa 1320
gtgtcaactc caactctcgt ggaggtttca agaagcctag gaaaagtggg tactaggtgt 1380
tgtacaaagc cggaatcaga aagaatgccc tgtactgaag actatctgag cttgatcctg 1440
aaccggttgt gcgtgctgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500
acagagtcat tggtgaacag acggccatgt ttctctgctc tgacacctga tgaaacatat 1560
gtacccaaag cctttgatga gaaattgttc accttccatg cagatatatg cacacttccc 1620
gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680
aaggcaacag aggaacaact gaaaaccgtc atggagaatt ttgtggcttt tgtagacaag 1740
tgctgtgcag ctgatgacaa agaagcctgc tttgctgtgg agggtccaaa acttgttgtt 1800
tcaactcaaa cagccttagc cggtggtggt ggttctggtg gtggtggttc tatgaaatat 1860
acaagctatt tcttagcttt actgctctgt gggcttttgg gtttttctgg ttcttatggc 1920
cagggccaat tttttagaga aatagaaaac ttaaaggagt attttaatgc aagtagccca 1980
gatgtagcta agggtgggcc tctcttctca gaaattttga agaattggaa agatgaaagt 2040
gacaaaaaaa ttattcagag ccaaattgtc tccttctact tcaaactctt tgaaaacctc 2100
aaagataacc aggtcattca aaggagcatg gatatcatca agcaagacat gtttcagaag 2160
ttcttgaatg gcagctctga gaaactggag gacttcaaaa agctgattca aattccggtg 2220
gatgatctgc agatccagcg caaagccata aatgaactca tcaaagtgat gaatgacctg 2280
tcaccaaaat ctaacctcag aaagcggaag agaagtcaga atctctttcg aggccggaga 2340
gcatcaacgg gtggtggtgg ttctggtggt ggtggttcta tgtacaagat acaactcttg 2400
tcttgcattg cactaactct tgcactcgtt gcaaacggtg cacctacttc aagctctacg 2460
gggaacacaa tgaaagaagt gaagtcattg ctgctggatt tacagttgct tttggagaaa 2520
gttaaaaatc ctgagaacct caagctctcc aggatgcata catttgactt ttacgtgccc 2580
aaggttaacg ctacagaatt gaaacatctt aagtgtttac tagaagaact caaacttcta 2640
gaggaagtgc taaatttagc tccaagcaaa aacctgaacc ccagagagat caaggattca 2700
atggacaata tcaagagaat cgttttggaa ctacagggat ctgaaacaag attcacatgt 2760
gaatatgatg atgcaacagt aaacgctgta gaatttctga acaaatggat taccttttgt 2820
caaagcatct actcaacaat gact 2844
<210> 3
<211> 2844
<212> DNA
<213>Genome 2
<400> 3
atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60
gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120
gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180
gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240
gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300
gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360
gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420
ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480
tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540
gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600
ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660
ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720
cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780
ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840
gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900
tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960
atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020
aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080
cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140
gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200
aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260
ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320
gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380
tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440
aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500
accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560
gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620
gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680
aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740
tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800
tctacccaga ccgctctggc tggtggtggt ggttctggtg gtggtggttc tatgaaatac 1860
acctcttact tcctggctct gctgctgtgc ggtctgctgg gtttctctgg ttcttacggt 1920
cagggtcagt tcttccgtga aatcgaaaac ctgaaagaat acttcaacgc ttcttctccg 1980
gacgttgcta aaggtggtcc gctgttctct gaaatcctga aaaactggaa agacgaatct 2040
gacaaaaaaa tcatccagtc tcagatcgtt tctttctact tcaaactgtt cgaaaacctg 2100
aaagacaacc aggttatcca gcgttctatg gacatcatca aacaggacat gttccagaaa 2160
ttcctgaacg gttcttctga aaaactggaa gacttcaaaa aactgatcca gatcccggtt 2220
gacgacctgc agatccagcg taaagctatc aacgaactga tcaaagttat gaacgacctg 2280
tctccgaaat ctaacctgcg taaacgtaaa cgttctcaga acctgttccg tggtcgtcgt 2340
gcttctaccg gtggtggtgg ttctggtggt ggtggttcta tgtacaaaat ccagctgctg 2400
tcttgcatcg ctctgaccct ggctctggtt gctaacggtg ctccgacctc ttcttctacc 2460
ggtaacacca tgaaagaagt taaatctctg ctgctggacc tgcagctgct gctggaaaaa 2520
gttaaaaacc cggaaaacct gaaactgtct cgtatgcaca ccttcgactt ctacgttccg 2580
aaagttaacg ctaccgaact gaaacacctg aaatgcctgc tggaagaact gaaactgctg 2640
gaagaagttc tgaacctggc tccgtctaaa aacctgaacc cgcgtgaaat caaagactct 2700
atggacaaca tcaaacgtat cgttctggaa ctgcagggtt cggagaccag gttcacctgc 2760
gaatacgacg acgctaccgt taacgctgtt gaattcctga acaaatggat caccttctgc 2820
cagtctatct actctaccat gacc 2844
<210> 4
<211> 1821
<212> DNA
<213>Bovine albumin
<400> 4
atgaagtggg tgacttttat ttctcttctc cttctcttca gctctgctta ttccaggggt 60
gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaaaga tttgggagaa 120
gaacatttta aaggcctggt actgattgcc ttttctcagt atctccagca gtgtccattt 180
gatgagcatg taaaattagt gaacgaacta actgagtttg caaaaacatg tgttgctgat 240
gagtcccatg ccggctgtga aaagtcactt cacactctct ttggagatga attgtgtaaa 300
gttgcatccc ttcgtgaaac ctatggtgac atggctgact gctgtgagaa acaagagcct 360
gaaagaaatg aatgcttcct gagccacaaa gatgatagcc cagacctccc taaattgaaa 420
ccagacccca atactttgtg tgatgagttt aaggcagatg aaaagaagtt ttggggaaaa 480
tacctatacg aaattgctag aagacatccc tacttttatg caccagaact cctttactat 540
gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600
ctgctaccaa agattgaaac tatgagagaa aaggtactag cttcatctgc cagacagaga 660
ctcaggtgtg ccagtattca aaaatttgga gaaagagctt taaaagcatg gtcagtagct 720
cgcctgagcc agaaatttcc caaggctgag tttgtagaag ttaccaagct agtgacagat 780
ctcacaaaag tccacaagga atgctgccat ggtgacctac ttgaatgcgc agatgacagg 840
gcagatcttg ccaagtacat atgtgataat caagatacaa tctccagtaa actgaaggaa 900
tgctgtgata agcctttgtt ggaaaaatcc cactgcattg ctgaggtaga aaaagatgcc 960
atacctgaaa acctgccccc attaactgct gactttgctg aagataagga tgtttgcaaa 1020
aactatcagg aagcaaaaga tgccttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080
catcctgaat atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140
gaggaatgct gtgccaaaga tgatccacat gcatgctatt ccacagtgtt tgacaaactt 1200
aagcatcttg tggatgagcc tcagaattta atcaaacaaa actgtgacca attcgaaaaa 1260
cttggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agtaccccaa 1320
gtgtcaactc caactctcgt ggaggtttca agaagcctag gaaaagtggg tactaggtgt 1380
tgtacaaagc cggaatcaga aagaatgccc tgtactgaag actatctgag cttgatcctg 1440
aaccggttgt gcgtgctgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500
acagagtcat tggtgaacag acggccatgt ttctctgctc tgacacctga tgaaacatat 1560
gtacccaaag cctttgatga gaaattgttc accttccatg cagatatatg cacacttccc 1620
gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680
aaggcaacag aggaacaact gaaaaccgtc atggagaatt ttgtggcttt tgtagacaag 1740
tgctgtgcag ctgatgacaa agaagcctgc tttgctgtgg agggtccaaa acttgttgtt 1800
tcaactcaaa cagccttagc c 1821
<210> 5
<211> 498
<212> DNA
<213>Ox IFN-γ
<400> 5
atgaaatata caagctattt cttagcttta ctgctctgtg ggcttttggg tttttctggt 60
tcttatggcc agggccaatt ttttagagaa atagaaaact taaaggagta ttttaatgca 120
agtagcccag atgtagctaa gggtgggcct ctcttctcag aaattttgaa gaattggaaa 180
gatgaaagtg acaaaaaaat tattcagagc caaattgtct ccttctactt caaactcttt 240
gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300
tttcagaagt tcttgaatgg cagctctgag aaactggagg acttcaaaaa gctgattcaa 360
attccggtgg atgatctgca gatccagcgc aaagccataa atgaactcat caaagtgatg 420
aatgacctgt caccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480
ggccggagag catcaacg 498
<210> 6
<211> 465
<212> DNA
<213>Ox IL-2
<400> 6
atgtacaaga tacaactctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60
gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctggat 120
ttacagttgc ttttggagaa agttaaaaat cctgagaacc tcaagctctc caggatgcat 180
acatttgact tttacgtgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240
ctagaagaac tcaaacttct agaggaagtg ctaaatttag ctccaagcaa aaacctgaac 300
cccagagaga tcaaggattc aatggacaat atcaagagaa tcgttttgga actacaggga 360
tctgaaacaa gattcacatg tgaatatgat gatgcaacag taaacgctgt agaatttctg 420
aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgact 465
<210> 7
<211> 1821
<212> DNA
<213>Bovine albumin
<400> 7
atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60
gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120
gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180
gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240
gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300
gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360
gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420
ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480
tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540
gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600
ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660
ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720
cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780
ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840
gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900
tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960
atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020
aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080
cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140
gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200
aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260
ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320
gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380
tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440
aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500
accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560
gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620
gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680
aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740
tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800
tctacccaga ccgctctggc t 1821
<210> 8
<211> 498
<212> DNA
<213>Ox IFN-γ
<400> 8
atgaaataca cctcttactt cctggctctg ctgctgtgcg gtctgctggg tttctctggt 60
tcttacggtc agggtcagtt cttccgtgaa atcgaaaacc tgaaagaata cttcaacgct 120
tcttctccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180
gacgaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240
gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300
ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaaaa actgatccag 360
atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420
aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480
ggtcgtcgtg cttctacc 498
<210> 9
<211> 465
<212> DNA
<213>Ox IL-2
<400> 9
atgtacaaaa tccagctgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60
gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120
ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180
accttcgact tctacgttcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240
ctggaagaac tgaaactgct ggaagaagtt ctgaacctgg ctccgtctaa aaacctgaac 300
ccgcgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360
tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaacgctgt tgaattcctg 420
aacaaatgga tcaccttctg ccagtctatc tactctacca tgacc 465
Claims (10)
1. a kind of fusion protein being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2, it is characterised in that:It is described
The amino acid sequence table of fusion protein is as shown in 400 < of SEQUENCE LISTING, 1 >.
2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene
Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >;Or as shown in 400 < of SEQUENCE LISTING, 3 >,
It is denoted as genome 2.
3. containing the expression vector of gene as claimed in claim 2.
4. containing the genetic engineering bacterium of gene as claimed in claim 2.
5. a kind of recombinant bovine long-acting interferon, which is characterized in that the recombinant bovine long-acting interferon is melted by described in claim 1
It is freeze-dried to form after hop protein and freeze drying protectant mixture.
6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step
Suddenly:Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained
Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.
7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN
γ-IL2, preparation method are:
(1) design primer obtains by reverse transcription or is manually respectively synthesized the bovine albumin for connecting flexible linker sequence, ox
The target gene of interferon gamma, cattle interleukins-2 2;By flexible linker by bovine albumin, Bov IFN γ, bovine leukocyte
The target gene of interleukin 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING 400
Shown in 2 > of < or as shown in 400 < of SEQUENCE LISTING, 3 >;
(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector;
(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained
γ-IL2。
8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21
(DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.
9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is:Fusion protein it is thick
Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.
10. the application of recombinant bovine long-acting interferon according to claim 5, which is characterized in that the recombinant bovine is long-acting dry
The long half time of element is disturbed up to 76 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of Niu Zishen can be improved.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2017106766978 | 2017-08-09 | ||
CN201710676697.8A CN107266588A (en) | 2017-08-09 | 2017-08-09 | A kind of fusion protein being made up of bovine albumin, Bov IFN γ and cattle interleukins-2 2 and preparation method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108864301A true CN108864301A (en) | 2018-11-23 |
Family
ID=60077243
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710676697.8A Pending CN107266588A (en) | 2017-08-09 | 2017-08-09 | A kind of fusion protein being made up of bovine albumin, Bov IFN γ and cattle interleukins-2 2 and preparation method thereof |
CN201810750999.XA Withdrawn CN108864301A (en) | 2017-08-09 | 2018-07-10 | A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2 |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710676697.8A Pending CN107266588A (en) | 2017-08-09 | 2017-08-09 | A kind of fusion protein being made up of bovine albumin, Bov IFN γ and cattle interleukins-2 2 and preparation method thereof |
Country Status (1)
Country | Link |
---|---|
CN (2) | CN107266588A (en) |
-
2017
- 2017-08-09 CN CN201710676697.8A patent/CN107266588A/en active Pending
-
2018
- 2018-07-10 CN CN201810750999.XA patent/CN108864301A/en not_active Withdrawn
Also Published As
Publication number | Publication date |
---|---|
CN107266588A (en) | 2017-10-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108840947A (en) | Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of ox long-acting interferon | |
CN108840952A (en) | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and chicken interferon α | |
CN108794638A (en) | A kind of recombinant bovine long-acting interferon α and the fusion protein and preparation method thereof for preparing this long-acting interferon | |
CN108822220A (en) | Sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep long-acting interferon | |
CN108840951A (en) | A kind of fusion protein and preparation method thereof being made of pig albumin, Porcine interferon-gamma and porcine interferon alpha | |
CN108864302A (en) | A kind of fusion protein and preparation method thereof being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 | |
CN108822221A (en) | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and recombinant chIL-2 | |
CN108794644A (en) | A kind of fusion protein and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α | |
CN108794645A (en) | A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and Bov IFN α | |
CN108840950A (en) | A kind of fusion protein and preparation method thereof being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha | |
CN108864295A (en) | A kind of recombinant bovine long-acting interferon and the fusion protein for preparing this long-acting interferon and preparation method thereof | |
CN108840953A (en) | A kind of fusion protein and preparation method thereof being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau | |
CN108840935A (en) | A kind of fusion protein being made of sheep albumin and sheep interferon gamma and preparation method thereof and a kind of recombination sheep long-acting interferon γ | |
CN108840941A (en) | A kind of fusion protein and preparation method thereof for recombinating sheep long-acting interferon γ and preparing this long-acting interferon γ | |
CN108864305A (en) | A kind of fusion protein and preparation method thereof being made of sheep albumin, sheep interferon gamma and sheep interferon-tau | |
CN108840934A (en) | A kind of recombination sheep long-acting interferon τ and the fusion protein for preparing this long-acting interferon and preparation method thereof | |
CN108864301A (en) | A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2 | |
CN108840944A (en) | A kind of fusion protein and preparation method thereof being made of sheep albumin, sheep interferon gamma and sheep interleukin 2 | |
CN108864294A (en) | A kind of fusion protein being made of bovine albumin and Bov IFN γ and preparation method thereof and a kind of recombinant bovine long-acting interferon γ | |
CN109053897A (en) | A kind of fusion protein and preparation method thereof being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α | |
CN108840942A (en) | A kind of Recombinant Swine long-acting interferon and the fusion protein for preparing this long-acting interferon and preparation method thereof | |
CN108794643A (en) | A kind of fusion protein and preparation method thereof being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2 | |
CN108864306A (en) | A kind of fusion protein and preparation method thereof being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha | |
CN108840936A (en) | A kind of Recombinant Swine long-acting interferon α and the fusion protein for preparing this long-acting interferon and preparation method thereof | |
CN108794640A (en) | A kind of Recombinant Swine long-acting interferon γ and the fusion protein and preparation method thereof for preparing this long-acting interferon γ |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WW01 | Invention patent application withdrawn after publication | ||
WW01 | Invention patent application withdrawn after publication |
Application publication date: 20181123 |