CN108840936A

CN108840936A - A kind of Recombinant Swine long-acting interferon α and the fusion protein for preparing this long-acting interferon and preparation method thereof

Info

Publication number: CN108840936A
Application number: CN201810700893.9A
Authority: CN
Inventors: 鲍可兵; 蒋敏之; 夏兵兵; 徐慕珍; 徐文俊; 郭志燕; 杨建伟
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: ANHUI DIVINITY BIOLOGICAL PRODUCTS Co.,Ltd.; WUHU YINGTEFEIER BIOLOGICAL PRODUCTS INDUSTRY RESEARCH INSTITUTE Co.,Ltd.
Priority date: 2017-08-09
Filing date: 2018-06-29
Publication date: 2018-11-20
Also published as: CN107286257A

Abstract

The invention discloses a kind of Recombinant Swine long-acting interferon α and the fusion proteins for preparing this long-acting interferon and preparation method thereof; the fusion protein is connected through flexible linker by Porcine interferon-gamma and porcine interferon alpha and is formed, and is freeze-dried to obtain Recombinant Swine long-acting interferon α after fusion protein and freeze drying protectant mixture.The Recombinant Swine long-acting interferon α is remarkably improved the half-life period of pig interferon, and the half-life period of more common pig interferon improves 16 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

Description

A kind of Recombinant Swine long-acting interferon α and prepare this long-acting interferon fusion protein and Preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to a kind of Recombinant Swine long-acting interferon α and prepare this Fusion protein of long-acting interferon and preparation method thereof.

Background technique

Scale Compact Develop is rapidly growing in China in recent years, and China's live pig breeding stock and pork production are sure to occupy First place in the world, traditional swine disease control method is far from the control for adapting to infectious disease in extensive intensive pig production production.I Newly there are nearly 20 kinds of livestock and poultry infectious diseases in the past 20 years in state, in addition original animal epidemic, causes aquaculture industry of China huge Economic loss.According to incompletely statistics, China is every year because various viral diseases cause mortality of livestock to be up to 15%-20%, Economic loss reaches billions of members.

Mainly pass through vaccine inoculation to the prevention and treatment approach of porcine viral diseases at present and uses antibiotic, but by It is not perfect in breeding environment, virus variation and Abwehrkraft des Koepers variation etc. reasons, make traditional prevention and treatment approach by Huge challenge, most of antibiotics and traditional oral antiviral medicament, due to medicament residue problem, to health It brings a negative impact；And traditional vaccine, high specific and side effect due to it can not resist virus variation and novel disease Poison continuously emerges and gives pig aquaculture bring significant damage.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.According to the generation cell of IFN, biochemical character and The difference to be played a role in terms of immunity of organism, is divided into α, β, γ three classes.Now it is known that α type IFN can selectively make in vivo For infection cells such as viruses, by inhibiting the biosynthesis of the virus protein in infected cell, playing wide spectrum and efficiently resisting Virus function.IFN-α main physiological activity is with suppressing virus replication, anti parasitic, inhibits various kinds of cell proliferation, stimulation The killing activity of immunocyte.

γ type IFN is that the T cell and NK cell by activating generate, and has relatively strong antiviral and immunoloregulation function.Largely Studies have shown that interferon gamma also plays crucial adjustment effect other than having the function of broad-spectrum antiviral, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to the anti-of virus infection It answers, but the immunoregulatory activity of interferon gamma is coordinating immune response and determining in the long-term antiviral state of body to play more Important role, therefore interferon gamma has particularly important clinical value.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the layer of molecular weight Partially solve the problems, such as that interferon molecule amount is small and leads to half-life short on face, while polyethylene glycol fused interferon cost is non- Chang Gao is unfavorable for clinically applying in domestic animal.

Summary of the invention

In order to solve the above technical problems, the present invention provides a kind of Recombinant Swine long-acting interferon α and preparing this long-acting interference The fusion protein and preparation method thereof of element, the Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, more general The half-life period of logical pig interferon improves 16 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of Porcine interferon-gamma and porcine interferon alpha, the amino acid sequence table of the fusion protein As shown in 400 < of SEQUENCE LISTING, 1 >, it is denoted as fusion protein 1；Or as shown in 400 < of SEQUENCE LISTING, 2 >, It is denoted as fusion protein 2.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 3 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 4 >, it is denoted as genome 2.

Fusion protein 1 described in 1 codified of genome；The 2 codified fusion protein 2 of genome.Genome 2 is pair The nucleotide sequence of genome 1 optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the base Because being optimal high efficient expression state in the expression system, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region. The codon of the porcine IFN γ and IFN-α original gene codon adaptation indexI in Escherichia coli is found using software detection (CAI) be respectively 0.24,0.22, GC percentage be 39.2%, 59.1%；And by porcine IFN γ and IFN-α gene optimization After obtain recombination in Escherichia coli codon adaptation indexI (CAI) be 1.0,1.0, GC percentage 45.4%, 55.6%. The utilization rate of low codon is significantly reduced by gene optimization, avoids influence of the rare codon to protein expression, is improved The G/C content of gene, improves transcription and translation efficiency.

The present invention also provides the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIFN γ-IFN α.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of Recombinant Swine long-acting interferon α, and the Recombinant Swine long-acting interferon α is by the fusion It is freeze-dried to form after albumen and freeze drying protectant mixture.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIFN γ-IFN α, and preparation method is：

(1) design primer, is obtained or the pig interferon of the flexible linker sequence of artificial synthesized connection by reverse transcription The target gene of γ and porcine interferon alpha；Porcine interferon-gamma has been connected with the target gene of porcine interferon alpha by flexible linker Come, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 3 > or such as SEQUENCE LISTING Shown in 400 <, 4 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIFN can be obtained γ-IFNα。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F1：ATAGAATTCATGAGTTATACAACTTATTTCTT has EcoRI restriction enzyme site；

Downstream IFN-γ-R1：

CCAGAACCACCTCCAGAACCTCCACCTTTTGATGCTCTCTGGCCTTG, with flexible linker；

The primer sequence of porcine interferon alpha (IFN-α) is：

Upstream IFN-α-F1：CTGGAGGTGGTTCTGGAGGTGGATCTTGCGACCTGCCTCAGAC, with flexible linker；

Downstream IFN-α-R1：CCAAGCTTCTCCTTCTTCCTGAGTCTGT has III restriction enzyme site of Hind；

B. RNA is extracted from pig liver, and the target gene of IFN-γ and IFN-α, the gene of the two are obtained by reverse transcription Sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 5 > and SEQUENCE LISTING, 6 >；

Respectively using the target gene of IFN-γ and IFN-α as template, and the upstream and downstream for being utilized respectively IFN-γ and IFN-α is drawn Object carries out PCR amplification, respectively obtains and connects the IFN-γ of flexible linker and the target gene of IFN-α.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. IFN-γ gene and IFN-α gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IFN-γ template DNA connects the 1 μ L of IFN-α template DNA I of flexible linker, IFN-γ upstream primer 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of α downstream primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F2：CATGCCATGGTATGTCTTACACCACCT has NcoI restriction enzyme site；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCTTTAGAAGCACGCTG is with flexible linker；

The primer sequence of porcine interferon alpha (IFN-α) is：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTGCTCTTACCTG, with flexible linker；

Downstream IFN-α-R2：CCCTCGAGTTCTTTACGACGCAG has XhoI restriction enzyme site；

B. the target gene of the IFN-γ and IFN-α, the gene order of the two is respectively such as SEQUENCE LISTING Shown in 400 <, 7 > and SEQUENCE LISTING, 400 <, 8 >；

Respectively using the target gene of IFN-γ and IFN-α as template, and the upstream and downstream for being utilized respectively IFN-γ and IFN-α is drawn Object carries out PCR amplification, the target gene of IFN-γ and IFN-α after respectively obtaining the optimization for connecting flexible linker.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. IFN-γ gene and IFN-α gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IFN-γ template DNA connects 1 μ L, IIFN- γ upstream primer of IFN-α template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of α downstream primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

The present invention also provides the application of the Recombinant Swine long-acting interferon α, long half time had up to 67 hours or more Broad-spectrum disease resistance toxic action and the immune response that pig itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. Porcine interferon-gamma and porcine interferon alpha gene are realized fusion by flexibility linker, improves interferon and partly decline Phase improves 16 times or more compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce into This.

2. improving interferon gamma and porcine interferon-α by optimizing to Porcine interferon-gamma and porcine interferon alpha gene The expression quantity of fusion protein；

3. using recombination bacillus coli BL21/pET-32a-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid does not generate inclusion body in protein expression, forms soluble protein, avoids the mistake of inclusion body denaturation and renaturation Journey substantially reduces the time of expressing fusion protein, and the albumen expressed is more stable；

4. the fusion protein disclosed by the invention being made of Porcine interferon-gamma and porcine interferon alpha not only has interferon-' alpha ' Broad-spectrum disease resistance toxic action, while significantly improving the immune response of pig itself.

Detailed description of the invention

Fig. 1 is the result of the Porcine interferon-gamma gene and porcine interferon alpha gene RT-PCR amplification in embodiment 1；Swimming lane M： DNA Marker DL2000；Swimming lane 1：Porcine interferon alpha gene RT-PCR amplified production；Swimming lane 2：Porcine interferon-gamma gene RT- Pcr amplification product；

Fig. 2 is the result of the PCR amplification after the pig IFN γ in embodiment 1 is connected with the target gene of pig IFN-α；Swimming Road M：DNA Marker DL2000；Swimming lane 1：Porcine interferon alpha gene and Porcine interferon-gamma gene ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Plasmid PCR result；Swimming lane 2：Recombinant plasmid double digestion result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Empty bacterium control；Swimming lane 2：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Supernatant；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the Recombinant Swine long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the Recombinant Swine long-acting interferon α of gradient dilution (from right to left) handles hole；

Fig. 7 is the Recombinant Swine long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve；

Specific embodiment

Embodiment 1

A kind of fusion protein being made of Porcine interferon-gamma and porcine interferon alpha, preparation method are as follows：

1. the acquisition and amplification of Porcine interferon-gamma (IFN-γ) and porcine interferon alpha (IFN-α) target gene

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upper of Porcine interferon-gamma Trip primer and downstream primer in introduce EcoRI restriction enzyme site and Linker sequence respectively, porcine interferon alpha upstream primer and under III restriction enzyme site of Linker sequence and Hind is introduced respectively in trip primer.

Table 1PCR amplimer

RT-PCR obtains target gene：

RNA is extracted from pig liver tissue, and the target gene of IFN-γ and IFN-α, the base of the two are obtained by reverse transcription Because sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 5 > and SEQUENCE LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

Table 2RT-PCR reaction system

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 530bp and 710bp or so through agarose gel electrophoresis in RT-PCR amplified production, and result is such as Shown in Fig. 1, illustrate to have obtained the Porcine interferon-gamma target gene for being separately connected flexible linker and porcine interferon alpha purpose base Cause.

2. the connection of target gene

Target gene is diluted to 10 μ g/mL, connects two sections of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3：

Table 3PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1200bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, The nucleotide sequence of obtained target gene is as shown in 400 < of SEQUENCE LISTING, 3 >.

3. expression vector establishment

The PCR glue recovery product for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid EcoRI and III restriction enzyme of Hind carry out double digestion and recycling, do double digestion by 20 μ L systems in table 4：

4 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2uL
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through EcoRI and III double digestion of Hind, being accredited as positive indicates expression vector establishment success, obtains engineering bacteria pET-32a/ rIFNγ-IFNα；There is single band at the place 1200bp or so through agarose gel electrophoresis in PCR amplification and double enzyme digestion product, As a result as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIFN γ-IFN α shakes for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin Bacterium 1h recovery engineering bacteria activity is surveyed OD value and is reached in LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, 32 DEG C of inducing expression (100 μ g/ml of final concentration) 5h is added；Bacterium is collected, is examined through SDS-PAGE electrophoresis It surveys, supernatant is deposited in the visible predominant expression band in the place 62.5KD or so, result after the bacterial cell disruption after recombinant bacterium induction 5h As shown in figure 4, it can be seen from the figure that recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in the place 62.5KD or so can See predominant expression band, illustrates in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rIFN γ-IFN α protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatography of Superdex, with Binding Buffer III elution, collects rIFN γ-IFN α protein peak.

5.4 sample identification：Measure rIFN γ-IFN α potency and specific activity, specific activity >=1.0 × 10⁶U/mg albumen is to close Lattice；It is aseptic subpackaged, -80 DEG C of preservations.The fusion protein being made of Porcine interferon-gamma and porcine interferon alpha, amino acid can be obtained Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of Porcine interferon-gamma and porcine interferon alpha, other, only will be therein with embodiment 1 The replacement of e. coli bl21 (DE3) competent cell is for BL21 (DE3) competent cell with pGro7 plasmid.It is merged The SDS-PAGE electrophoresis result of albumen is compareed with embodiment 1, and 62.5KD or so place's predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is just It really folds, reaches solubility expression of protein.

Embodiment 3

To in embodiment 1 IFN-γ and IFN-α optimize, artificial synthesized IFN-γ and IFN-α target gene, optimization Afterwards, the nucleotide sequence of the two is respectively such as 400 < of SEQUENCE LISTING 400 <, 7 > and SEQUENCE LISTING, 8 > institute Show.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IFN-γ of pig and IFN- in the present embodiment α gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Using software detection discovery porcine IFN γ and The codon of IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.24,0.22, GC percentage It is 39.2%, 59.1%；And by obtaining recombination password in Escherichia coli after porcine IFN γ and IFN-α gene optimization Sub- adaptation index (CAI) is 1.0,1.0, GC percentage 45.4%, 55.6%.Low codon is significantly reduced by gene optimization Utilization rate, avoid influence of the rare codon to protein expression, improve the G/C content of gene, improve transcription and translation effect Rate, and then improve the expression quantity of recombinant protein.

1.3 design of primers：

Table 6PCR amplimer

The genomic DNA of IFN-γ and IFN-α after optimization is diluted to 0.05mg/mL respectively.It is obtained using PCR amplification Target gene, 25 μ L reaction systems are as shown in table 7：

Table 7PCR reaction system

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 530bp and 710bp or so through agarose gel electrophoresis in pcr amplification product, and explanation is prepared into The target gene of porcine IFN γ and pig IFN-α after to the optimization for being separately connected flexible linker.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 8：

Table 8PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1200bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to obtain IFN-γ connected with IFN-α after target gene.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING Shown in 400 <, 3 >.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid NcoI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 9：

9 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 10,4 DEG C overnight connection：

Table 10

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through NcoI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, obtains engineering bacteria pET-32a/rIFN γ-IFNα；There is single band at the place 1200bp or so through agarose gel electrophoresis in PCR amplification and double enzyme digestion product, and explanation contains The expression vector establishment success of target gene after thering is IFN-γ to connect with IFN-α.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIFN γ-IFN α shakes for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin Bacterium 1h recovery engineering bacteria activity is surveyed OD value and is reached in LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, 32 DEG C of inducing expression (100 μ g/ml of final concentration) 5h is added；Bacterium is collected, is examined through SDS-PAGE electrophoresis It surveys, supernatant is deposited in the visible predominant expression band in the place 62.5KD or so after the bacterial cell disruption after recombinant bacterium induction 5h, illustrates Recombinant protein has been obtained in supernatant precipitating.

5. fusion protein purification

5.1His affinity chromatography

5.2DEAE anion-exchange chromatography

5.3 sieve chromatography

5.4 sample identification

Measure rIFN γ-IFN α potency and specific activity, specific activity >=1 × 10⁶U/mg albumen is qualification；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of Porcine interferon-gamma and porcine interferon alpha, amino acid sequence such as SEQUENCE can be obtained Shown in 400 < of LISTING, 2 >.

Embodiment 4

A kind of fusion protein being made of Porcine interferon-gamma and porcine interferon alpha, other, only will be therein with embodiment 3 The replacement of e. coli bl21 (DE3) competent cell is for BL21 (DE3) competent cell with pGro7 plasmid.It is merged The SDS-PAGE electrophoresis result of albumen is compareed with embodiment 3, and 62.5KD or so place's predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is just It really folds, reaches solubility expression of protein.

Embodiment 5

A kind of Recombinant Swine long-acting interferon α, it is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 Later, freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer with 10mmol/L PBS, Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 obtains the identification for the fusion protein being made of Porcine interferon-gamma and porcine interferon alpha

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.2mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 62.5KD or so, as shown in Figure 4.

6.3Western Blot result

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-porcine alpha-IFN (1 of abcam company mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant Swine long-acting interferon α sample can be with anti-pig interferon Specific reaction occurs for alpha monoclonal antibodies, and specific band occurs in the place 62.5KD or so, as shown in Figure 5.

Embodiment 7

Four parts of Recombinant Swine long-acting interferon α in embodiment 5 freeze-dried bioactivity

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the Recombinant Swine that various dose is added is long for culture Interferon-' alpha ' is imitated, inhales abandon afterwards for 24 hours, then inoculation 100TCID50VSV virus respectively.

Test result

The result shows that the Recombinant Swine long-acting interferon α obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the Recombinant Swine obtained is long After imitating interferon-' alpha ' treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, not incumbent out What lesion, measures potency >=1.0 × 10⁶U/ml, as shown in Figure 6.

Embodiment 8

Measurement of the Recombinant Swine long-acting interferon α in pig intracorporal half-life period

Being lyophilized respectively by four parts of Recombinant Swine long-acting interferon α that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in chicken intracorporal half-life period

Cytopathic-effect inhibition assay measures rIFN γ-IFN α blood concentration and time relationship

The piglet (half male and half female) that six weight are roughly the same is taken, 2mg/ml Recombinant Swine long-acting interferon is subcutaneously injected in neck The freeze-dried 2ml of α, respectively 1h, 2h, 4h, 8h, 16h, for 24 hours, 36h, 48h, 60h, 88h jugular vein blood collection, 4 DEG C of blood sample solidification, 3500rpm low-temperature centrifugation 10min separates serum, and every pig blood sample of each time point is to be measured in -20 DEG C of preservations.Using cytopathic effect inhibition Method measures rIFN γ-IFN α concentration in blood serum sample, is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.A's is quasi- It is as shown in Figure 7 to close curve；Parameter calculated result is shown in Table 11.

Dominant dynamic parameters in serum after 11 Recombinant Swine long-acting interferon α intramuscular injection of table

The result shows that Recombinant Swine long-acting interferon α has longer half-life period.Half-life period can reach 67h or so after measured, compared with Plain interferon improves 16 times.

Embodiment 9

The freeze-dried measurement that pig cell immune response is influenced of four parts of Recombinant Swine long-acting interferon α in embodiment 5

It takes six roughly the same piglets of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously infused The 2mg/ml Recombinant Swine long-acting interferon freeze-dried 2ml of α is penetrated, the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside pig All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-2, IL-4 content, is carried out by kit specification, and testing result is as shown in table 12：

It is horizontal that table 12ELISA detects each group pig cell immune response

The result shows that injection Recombinant Swine long-acting interferon α after, can significantly improve cell factor IL-2 in pig peripheral blood, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned to Recombinant Swine long-acting interferon α and to prepare fusion protein and its preparation of this long-acting interferon referring to embodiment The detailed description that method carries out, is illustrative without being restrictive, can enumerate several implementations according to limited range Example, therefore the change and modification in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of Recombinant Swine long-acting interferon α and the fusion protein for preparing this long-acting interferon and preparation method thereof

<130> 1

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 404

<212> PRT

<213>Recombinant Swine long-acting interferon alpha fusion protein 1

<400> 1

Met Ser Tyr Thr Thr Tyr Phe Leu Ala Phe Gln Leu Cys Val Thr Leu

1 5 10 15

Cys Phe Ser Gly Ser Tyr Cys Gln Ala Pro Phe Phe Lys Glu Ile Thr

20 25 30

Ile Leu Lys Asp Tyr Phe Asn Ala Ser Thr Ser Gly Val Pro Asn Gly

35 40 45

Gly Pro Leu Phe Leu Glu Ile Leu Glu Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Phe Phe

65 70 75 80

Glu Ile Phe Lys Asp Asn Gln Ala Ile Gln Arg Ser Met Asp Val Ile

85 90 95

Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser Ser Gly Lys Leu

100 105 110

Asn Asp Phe Glu Lys Leu Val Lys Ile Pro Val Asp Asn Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Ser Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Thr Met Phe Gln

145 150 155 160

Gly Gln Arg Ala Ser Lys Arg Ser Thr Ser Arg Thr Thr Ser Arg Thr

165 170 175

Ser Thr Met Cys Ser Tyr Leu Arg His Arg Pro Glu Gly Arg Ser Ser

180 185 190

Asn Ile Leu Glu Ser Arg Val Thr Glu Ser Pro Thr Ser Ala Arg Thr

195 200 205

Ala Ala Ser Ala Arg Ser Pro Met Ala Pro Thr Ser Ala Phe Leu Thr

210 215 220

Ala Leu Val Leu Leu Ser Cys Asn Ala Ile Cys Ser Leu Gly Cys Asp

225 230 235 240

Leu Pro Gln Thr His Ser Leu Ala His Thr Arg Ala Leu Arg Leu Leu

245 250 255

Ala Gln Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Asp His Arg Arg

260 265 270

Asp Phe Gly Phe Pro Gln Glu Ala Leu Gly Gly Asn Gln Val Gln Lys

275 280 285

Ala Gln Ala Met Ala Leu Val His Glu Met Leu Gln Gln Thr Phe Gln

290 295 300

Leu Phe Ser Thr Glu Gly Ser Ala Ala Ala Trp Asp Glu Ser Leu Leu

305 310 315 320

His Gln Phe Cys Thr Gly Leu Asp Gln Gln Leu Arg Asp Leu Glu Ala

325 330 335

Cys Val Met Gln Glu Ala Gly Leu Glu Gly Thr Pro Leu Leu Glu Glu

340 345 350

Asp Ser Ile Leu Ala Val Arg Lys Tyr Phe His Arg Leu Thr Leu Tyr

355 360 365

Leu Gln Glu Lys Ser Tyr Ser Pro Cys Ala Trp Glu Ile Val Arg Ala

370 375 380

Glu Val Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Asp Arg Leu

385 390 395 400

Arg Arg Lys Glu

<210> 2

<211> 402

<212> PRT

<213>Recombinant Swine long-acting interferon alpha fusion protein 2

<400> 2

Met Ser Tyr Thr Thr Tyr Phe Leu Ala Phe Gln Leu Cys Val Thr Leu

1 5 10 15

Cys Phe Ser Gly Ser Tyr Cys Gln Ala Pro Phe Phe Lys Glu Ile Thr

20 25 30

Ile Leu Lys Asp Tyr Phe Asn Ala Ser Thr Ser Gly Val Pro Asn Gly

35 40 45

Gly Pro Leu Phe Leu Glu Ile Leu Glu Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Phe Phe

65 70 75 80

Glu Ile Phe Lys Asp Asn Gln Ala Ile Gln Arg Ser Met Asp Val Ile

85 90 95

Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser Ser Gly Lys Leu

100 105 110

Asn Asp Phe Glu Lys Leu Val Lys Ile Pro Val Asp Asn Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Ser Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Thr Met Phe Gln

145 150 155 160

Gly Gln Arg Ala Ser Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

165 170 175

Met Cys Ser Tyr Leu Arg His Arg Pro Glu Gly Arg Ser Ser Asn Ile

180 185 190

Leu Glu Ser Arg Val Thr Glu Ser Pro Thr Ser Ala Arg Thr Ala Ala

195 200 205

Ser Ala Arg Ser Pro Met Ala Pro Thr Ser Ala Phe Leu Thr Ala Leu

210 215 220

Val Leu Leu Ser Cys Asn Ala Ile Cys Ser Leu Gly Cys Asp Leu Pro

225 230 235 240

Gln Thr His Ser Leu Ala His Thr Arg Ala Leu Arg Leu Leu Ala Gln

245 250 255

Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Asp His Arg Arg Asp Phe

260 265 270

Gly Phe Pro Gln Glu Ala Leu Gly Gly Asn Gln Val Gln Lys Ala Gln

275 280 285

Ala Met Ala Leu Val His Glu Met Leu Gln Gln Thr Phe Gln Leu Phe

290 295 300

Ser Thr Glu Gly Ser Ala Ala Ala Trp Asp Glu Ser Leu Leu His Gln

305 310 315 320

Phe Cys Thr Gly Leu Asp Gln Gln Leu Arg Asp Leu Glu Ala Cys Val

325 330 335

Met Gln Glu Ala Gly Leu Glu Gly Thr Pro Leu Leu Glu Glu Asp Ser

340 345 350

Ile Leu Ala Val Arg Lys Tyr Phe His Arg Leu Thr Leu Tyr Leu Gln

355 360 365

Glu Lys Ser Tyr Ser Pro Cys Ala Trp Glu Ile Val Arg Ala Glu Val

370 375 380

Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Asp Arg Leu Arg Arg

385 390 395 400

Lys Glu

<210> 3

<211> 1212

<212> DNA

<213>Recombinant Swine long-acting interferon α genome 1

<400> 3

atgagttata caacttattt cttagctttt cagctttgcg tgactttgtg tttttctggc 60

tcttactgcc aggcgccctt ttttaaagaa ataacgatcc taaaggacta ttttaatgca 120

agtacctcag gtgtacctaa tggtggacct cttttcttag aaattttgga gaattggaaa 180

gaggagagtg acaaaaaaat aattcagagc caaattgtct ccttctactt caaattcttt 240

gaaatcttca aagataacca ggccattcaa aggagcatgg atgtgatcaa gcaagacatg 300

tttcagaggt tcctaaatgg tagctctggg aaactgaatg acttcgaaaa gctggttaaa 360

attccggtag ataatctgca gatccagcgc aaagccatca gtgaactcat caaagtgatg 420

aatgatctgt caccaagatc taacctaaga aagcggaaga gaagtcagac tatgttccaa 480

ggccagagag catcaaaaag atccacctcc agaaccacct ccagaacctc caccatgtgt 540

tcctatttaa gacacaggcc tgagggaagg tcttcaaaca tcctagagag cagggtcaca 600

gagtcaccca cctcagccag gacagcagca tctgcaaggt ccccaatggc cccaacctca 660

gccttcctca cggccctggt gctgctcagc tgcaatgcca tctgctctct gggctgcgac 720

ctgcctcaga cccacagcct ggctcacacc agggccctga ggctcctggc acaaatgagg 780

agaatctccc ccttctcctg cctggaccac agaagggact ttggattccc ccaagaggcc 840

ttggggggca accaggtcca gaaggctcaa gccatggctc tggtgcatga gatgctccag 900

cagaccttcc agctcttcag cacagagggc tcggctgctg cctgggatga gagcctcctg 960

caccagttct gcactggact ggatcagcag ctcagggacc tggaagcctg tgtcatgcag 1020

gaggccgggc tggaagggac ccccctgctg gaggaggact ccatcctggc tgtgaggaaa 1080

tacttccaca gactcaccct ctatctgcaa gagaagagct acagcccctg tgcctgggag 1140

atcgtcaggg cagaagtcat gagagccttc tcttcctcca caaacctgca agacagactc 1200

aggaggaagg ag 1212

<210> 4

<211> 1206

<212> DNA

<213>Recombinant Swine long-acting interferon α genome 2

<400> 4

atgtcttaca ccacctactt cctggctttc cagctgtgcg ttaccctgtg cttctctggt 60

tcttactgcc aggctccgtt cttcaaagaa atcaccatcc tgaaagacta cttcaacgct 120

tctacctctg gtgttccgaa cggtggtccg ctgttcctgg aaatcctgga aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaattcttc 240

gaaatcttca aagacaacca ggctatccag cgttctatgg acgttatcaa acaggacatg 300

ttccagcgtt tcctgaacgg ttcttctggt aaactgaacg acttcgaaaa actggttaaa 360

atcccggttg acaacctgca gatccagcgt aaagctatct ctgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagac catgttccag 480

ggtcagcgtg cttctaaagg tggtggtggt tctggtggtg gtggttctat gtgctcttac 540

ctgcgtcacc gtccggaagg tcgttcttct aacatcctgg aatctcgtgt taccgaatct 600

ccgacctctg ctcgtaccgc tgcttctgct cgttctccga tggctccgac ctctgctttc 660

ctgaccgctc tggttctgct gtcttgcaac gctatctgct ctctgggttg cgacctgccg 720

cagacccact ctctggctca cacccgtgct ctgcgtctgc tggctcagat gcgtcgtatc 780

tctccgttct cttgcctgga ccaccgtcgt gacttcggtt tcccgcagga agctctgggt 840

ggtaaccagg ttcagaaagc tcaggctatg gctctggttc acgaaatgct gcagcagacc 900

ttccagctgt tctctaccga aggttctgct gctgcttggg acgaatctct gctgcaccag 960

ttctgcaccg gtctggacca gcagctgcgt gacctggaag cttgcgttat gcaggaagct 1020

ggtctggaag gtaccccgct gctggaagaa gactctatcc tggctgttcg taaatacttc 1080

caccgtctga ccctgtacct gcaggaaaaa tcttactctc cgtgcgcttg ggaaatcgtt 1140

cgtgctgaag ttatgcgtgc tttctcttct tctaccaacc tgcaggaccg tctgcgtcgt 1200

aaagaa 1206

<210> 5

<211> 498

<212> DNA

<213>Porcine interferon-gamma

<400> 5

atgagttata caacttattt cttagctttt cagctttgcg tgactttgtg tttttctggc 60

tcttactgcc aggcgccctt ttttaaagaa ataacgatcc taaaggacta ttttaatgca 120

agtacctcag gtgtacctaa tggtggacct cttttcttag aaattttgga gaattggaaa 180

gaggagagtg acaaaaaaat aattcagagc caaattgtct ccttctactt caaattcttt 240

gaaatcttca aagataacca ggccattcaa aggagcatgg atgtgatcaa gcaagacatg 300

tttcagaggt tcctaaatgg tagctctggg aaactgaatg acttcgaaaa gctggttaaa 360

attccggtag ataatctgca gatccagcgc aaagccatca gtgaactcat caaagtgatg 420

aatgatctgt caccaagatc taacctaaga aagcggaaga gaagtcagac tatgttccaa 480

ggccagagag catcaaaa 498

<210> 6

<211> 678

<212> DNA

<213>Porcine interferon alpha

<400> 6

atgtgttcct atttaagaca caggcctgag ggaaggtctt caaacatcct agagagcagg 60

gtcacagagt cacccacctc agccaggaca gcagcatctg caaggtcccc aatggcccca 120

acctcagcct tcctcacggc cctggtgctg ctcagctgca atgccatctg ctctctgggc 180

tgcgacctgc ctcagaccca cagcctggct cacaccaggg ccctgaggct cctggcacaa 240

atgaggagaa tctccccctt ctcctgcctg gaccacagaa gggactttgg attcccccaa 300

gaggccttgg ggggcaacca ggtccagaag gctcaagcca tggctctggt gcatgagatg 360

ctccagcaga ccttccagct cttcagcaca gagggctcgg ctgctgcctg ggatgagagc 420

ctcctgcacc agttctgcac tggactggat cagcagctca gggacctgga agcctgtgtc 480

atgcaggagg ccgggctgga agggaccccc ctgctggagg aggactccat cctggctgtg 540

aggaaatact tccacagact caccctctat ctgcaagaga agagctacag cccctgtgcc 600

tgggagatcg tcagggcaga agtcatgaga gccttctctt cctccacaaa cctgcaagac 660

agactcagga ggaaggag 678

<210> 7

<211> 498

<212> DNA

<213>Porcine interferon-gamma

<400> 7

atgtcttaca ccacctactt cctggctttc cagctgtgcg ttaccctgtg cttctctggt 60

tcttactgcc aggctccgtt cttcaaagaa atcaccatcc tgaaagacta cttcaacgct 120

tctacctctg gtgttccgaa cggtggtccg ctgttcctgg aaatcctgga aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaattcttc 240

gaaatcttca aagacaacca ggctatccag cgttctatgg acgttatcaa acaggacatg 300

ttccagcgtt tcctgaacgg ttcttctggt aaactgaacg acttcgaaaa actggttaaa 360

atcccggttg acaacctgca gatccagcgt aaagctatct ctgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagac catgttccag 480

ggtcagcgtg cttctaaa 498

<210> 8

<211> 678

<212> DNA

<213>Porcine interferon alpha

<400> 8

atgtgctctt acctgcgtca ccgtccggaa ggtcgttctt ctaacatcct ggaatctcgt 60

gttaccgaat ctccgacctc tgctcgtacc gctgcttctg ctcgttctcc gatggctccg 120

acctctgctt tcctgaccgc tctggttctg ctgtcttgca acgctatctg ctctctgggt 180

tgcgacctgc cgcagaccca ctctctggct cacacccgtg ctctgcgtct gctggctcag 240

atgcgtcgta tctctccgtt ctcttgcctg gaccaccgtc gtgacttcgg tttcccgcag 300

gaagctctgg gtggtaacca ggttcagaaa gctcaggcta tggctctggt tcacgaaatg 360

ctgcagcaga ccttccagct gttctctacc gaaggttctg ctgctgcttg ggacgaatct 420

ctgctgcacc agttctgcac cggtctggac cagcagctgc gtgacctgga agcttgcgtt 480

atgcaggaag ctggtctgga aggtaccccg ctgctggaag aagactctat cctggctgtt 540

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aatcttactc tccgtgcgct 600

tgggaaatcg ttcgtgctga agttatgcgt gctttctctt cttctaccaa cctgcaggac 660

cgtctgcgtc gtaaagaa 678

Claims

1. a kind of fusion protein being made of Porcine interferon-gamma and porcine interferon alpha, it is characterised in that：The amino of the fusion protein Acid sequence table is denoted as fusion protein 1 as shown in 400 < of SEQUENCE LISTING, 1 >；Or such as SEQUENCE LISTING 400 Shown in 2 > of <, it is denoted as fusion protein 2.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 3 >；Or as shown in 400 < of SEQUENCE LISTING, 4 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of Recombinant Swine long-acting interferon α, which is characterized in that the Recombinant Swine long-acting interferon α is by described in claim 1 It is freeze-dried to form after fusion protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIFN γ- IFN α, preparation method are：

(1) design primer, obtained by reverse transcription or the Porcine interferon-gamma of the flexible linker sequence of artificial synthesized connection and The target gene of porcine interferon alpha；The target gene of Porcine interferon-gamma and porcine interferon alpha is connected by flexible linker, The nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 3 > or such as SEQUENCE LISTING 400 Shown in 4 > of <；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/r IFN γ-can be obtained IFNα。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of Recombinant Swine long-acting interferon α according to claim 5, which is characterized in that the Recombinant Swine is long-acting dry The long half time of plain α is disturbed up to 67 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of pig itself can be improved.